DOCSLIB.ORG

Supplementary Table 2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 2 Index CPG_ISLANDDISTANCE_TO_TSSTargetID Chr MAPINFO SYMBOL 29 TRUE 185 cg00027083 18p11.32 5533801 EPB41L3 220 TRUE 141 cg00202711 X 1.14E+08 HTR2C 285 TRUE 446 cg00263760 10 1.19E+08 VAX1 403 TRUE cg00399483 18 48122376 DCC 476 TRUE 43 cg00465284 2 80385409 LRRTM1 504 TRUE 691 cg00489401 5q35.3 1.8E+08 FLT4/VEGFR3 530 TRUE 275 cg00512279 10 1.19E+08 SLC18A2 571 TRUE 779 cg00548268 7 98083766 NPTX2 692 TRUE cg00662556 18 73092352 GALR1 797 TRUE 103 cg00768439 X 92815367 NAP1L3 815 TRUE 79 cg00792849 15 32833902 CX36 874 TRUE 193 cg00848728 1 58488606 DAB1 1013 TRUE 196 cg00973677 7 1.36E+08 CHRM2 1036 TRUE 50 cg01009664 3q13.3-q21 1.31E+08 TRH 1161 TRUE 325 cg01144286 20 9443596 C20orf103 1241 TRUE 59 cg01231779 14q22.1 51605637 NID2 1378 TRUE 698 cg01366419 7 70235027 WBSCR17 1404 TRUE cg01401376 6q23 1.34E+08 EYA4 1435 TRUE 204 cg01424107 13 27441113 CDX2 1493 TRUE 188 cg01471384 4 1.08E+08 DKK2 1542 TRUE 191 cg01519742 4 6252992 JAKMIP1 1570 TRUE cg01546563 8 11604598 GATA4 1598 TRUE 578 cg01580681 4 1.75E+08 HAND2 1863 TRUE 684 cg01837719 6 96569906 FUT9 1865 TRUE cg01839464 18 48122475 DCC 2040 TRUE 295 cg02008154 7 35260062 TBX20 2082 TRUE 203 cg02055963 13 27441520 CDX2 2243 TRUE 565 cg02217159 6 63054656 KHDRBS2 2261 TRUE 363 cg02233559 13q12.3 28191325 SLC46A3 2442 TRUE 47 cg02422694 17 44010789 HOXB4 2456 TRUE 89 cg02440177 19q13.41 58188507 ZNF702 2625 TRUE 98 cg02622316 6 28475389 ZNF96 2627 TRUE cg02624705 18 48122676 DCC 2776 TRUE 657 cg02774439 4 1.75E+08 HAND2 2848 TRUE 41 cg02847500 X 1.39E+08 SOX3 2924 TRUE 49 cg02919422 8q11.23 55533097 SOX17 3047 TRUE 158 cg03028472 12p12.3 15265729 RERG 3255 TRUE 118 cg03238797 16q23 76026394 ADAMTS18 3308 TRUE 359 cg03289872 19 61680914 ZNF667 3379 TRUE 32 cg03365437 15q21.3 56145166 ALDH1A2 3446 TRUE 85 cg03425110 10 71003043 NEUROG3 3488 TRUE 352 cg03469054 12 1.29E+08 KIAA1944 3502 TRUE 621 cg03483626 1 1.11E+08 KCNA3 3614 TRUE 301 cg03586879 16 6008832 A2BP1 3656 TRUE 833 cg03634234 7 1.52E+08 MLL3 3725 TRUE 345 cg03712038 19 58298833 ZNF160 3773 TRUE 60 cg03751813 19 42393233 ZNF585B 3779 TRUE 270 cg03755123 10 1.35E+08 UTF1 3800 TRUE 51 cg03775422 7 54577686 MGC33530 3912 TRUE 74 cg03874199 2q31.1 1.77E+08 HOXD12 3926 TRUE 342 cg03884783 19 42649837 ZNF569 3949 TRUE 108 cg03909500 5p15.1-p14 33972354 RLN3R1 4023 TRUE 164 cg03975694 19 42734312 ZNF540 4101 TRUE 153 cg04048259 20 57308741 EDN3 4119 TRUE 75 cg04062391 19 9470204 ZNF560 4125 TRUE 17 cg04072323 2q36 2.29E+08 SKIP 4129 TRUE 359 cg04080057 19 59186995 CACNG6 4265 TRUE 60 cg04237663 8 1.11E+08 KCNV1 4282 TRUE 484 cg04263186 4 1.05E+08 TACR3 4292 TRUE 201 cg04272086 18 48121357 DCC 4413 TRUE 244 cg04386405 19 57833206 ZNF83 4424 TRUE 308 cg04396791 11 70185828 SHANK2 4489 TRUE cg04456238 11 32406680 WT1 4529 TRUE 8 cg04490714 16q12.2 54248065 SLC6A2 4540 TRUE 154 cg04499325 7 37926842 EPDR1 4558 TRUE 44 cg04515001 6 24466215 DCDC2 4581 TRUE 636 cg04534765 18q23 73091357 GALR1 4654 TRUE 84 cg04598121 8q23-q24 57521059 PENK 4665 TRUE 7 cg04609859 17 44010735 HOXB4 4771 TRUE 11 cg04721883 X 1.03E+08 ESX1 4841 TRUE 334 cg04784672 14q21.1 41147424 LRFN5 4922 TRUE 229 cg04875162 X 90576482 PABPC5 4970 TRUE 8 cg04922810 7p14.3 30688413 CRHR2 5118 TRUE 12 cg05073035 3 1.49E+08 ZIC1 5241 TRUE 118 cg05221167 19p13.2 9470397 ZNF560 5378 TRUE 7 cg05368341 1 1.14E+08 SYT6 5393 TRUE 318 cg05380982 21q22.1 38210248 KCNJ6 5403 TRUE 346 cg05389335 4 1.05E+08 TACR3 5410 TRUE 820 cg05396987 4 1.23E+08 FLJ30834 5449 TRUE 246 cg05436658 16 23755069 PRKCB1 5537 TRUE 48 cg05520656 19 23733431 ZNF681 5538 TRUE 0 cg05521696 12 7916762 SLC2A14 5723 TRUE 60 cg05722918 12 1E+08 SLC5A8 5768 TRUE 139 cg05772663 X 1.14E+08 HTR2C 5802 TRUE 76 cg05807991 4q26 1.18E+08 TRAM1L1 5850 TRUE 89 cg05860890 8 1.11E+08 KCNV1 5886 TRUE cg05896682 18 73093018 GALR1 5997 TRUE 15 cg06015218 6 1.46E+08 GRM1 6057 TRUE 64 cg06092815 2 2.29E+08 SKIP 6110 TRUE 513 cg06151165 20 25010254 VSX1 6119 TRUE 946 cg06165395 1 37273377 GRIK3 6211 TRUE 104 cg06243556 19 63301285 ZNF447 6240 TRUE 58 cg06274159 4 1.89E+08 ZFP42 6355 TRUE 86 cg06384463 1 90955296 BARHL2 6714 TRUE 535 cg06722633 1p34.3 37271896 GRIK3 6748 TRUE 498 cg06760035 17 44010244 HOXB4 6819 TRUE 231 cg06821993 8q23.3 1.15E+08 CSMD3 6902 TRUE 203 cg06908778 10 22674608 SPAG6 7003 TRUE 254 cg07017374 13q12 27572451 FLT3 7015 TRUE 390 cg07028533 7 1.45E+08 CNTNAP2 7045 TRUE 163 cg07054095 19q13.43 62730668 ZNF549 7102 TRUE 401 cg07104706 13 83354128 SLITRK1 7422 TRUE 38 cg07447922 1 38003414 EPHA10 7506 TRUE 311 cg07533148 1 2.46E+08 TRIM58 7531 TRUE 264 cg07559730 19 58188860 ZNF702 7676 TRUE 6 cg07703401 16p13.3 170341 HBQ1 7718 TRUE 270 cg07748540 11q22.3 1.04E+08 PDGFD 7744 TRUE 35 cg07778029 7 27171639 HOXA9 7782 TRUE 173 cg07823492 17q21.3 43963098 HOXB1 7865 TRUE 507 cg07903918 9 1.01E+08 GABBR2 7884 TRUE 6 cg07922606 6 26333368 HIST1H3E 8019 TRUE 188 cg08047907 1q24 1.68E+08 C1orf114 8051 TRUE 182 cg08089301 17 44010560 HOXB4 8073 TRUE 184 cg08107272 2 79593450 CTNNA2 8380 TRUE 1077 cg08432727 2 5749173 SOX11 8402 TRUE 119 cg08453021 7p14.1 37455100 ELMO1 8526 TRUE 320 cg08583049 15 58084107 FOXB1 8559 TRUE 130 cg08614481 6 78229969 HTR1B 8615 TRUE 100 cg08668790 19q13.4 62912474 ZNF154 8797 TRUE 148 cg08832227 12 4890954 KCNA1 8810 TRUE 420 cg08847636 19 12337027 ZNF442 8812 TRUE 325 cg08849574 19 62817765 ZNF134 8834 TRUE 343 cg08876932 11 71633195 PHOX2A 8933 TRUE 462 cg08995424 12 52357158 ATP5G2 8939 TRUE 133 cg08997253 9 1.04E+08 GRIN3A 9009 TRUE 174 cg09068492 11 14950234 CALCA 9078 TRUE 163 cg09137696 16 55229916 MT1A 9169 TRUE 134 cg09229912 12q24.12 1.1E+08 CUTL2 9200 TRUE 408 cg09260089 10q26 1.34E+08 NKX6-2 9204 TRUE 59 cg09261015 X 1.03E+08 ESX1 9481 TRUE 191 cg09542111 21 30233962 GRIK1 9497 TRUE 902 cg09551147 10 1.06E+08 SORCS3 9510 TRUE 2 cg09562455 X 30237411 NR0B1 9587 TRUE 0 cg09643544 19 9334696 ZNF177 9862 TRUE 20 cg09936561 4 9392721 DRD5 9878 TRUE 106 cg09952204 5 80292420 RASGRF2 10012 TRUE 103 cg10088985 4q13.3 75083177 CXCL5 10058 TRUE 536 cg10141715 12 1E+08 SLC5A8 10139 TRUE 455 cg10217445 21 33319654 OLIG2 10225 TRUE 36 cg10300684 14 28306074 FOXG1B 10229 TRUE 219 cg10303487 8 1.06E+08 DPYS 10261 TRUE 68 cg10332700 19q13.42 58327889 ZNF415 10290 TRUE 51 cg10364513 1 1.64E+08 RXRG 10399 TRUE 54 cg10486998 18q23 73090775 GALR1 10435 TRUE 68 cg10520887 4 96689117 UNC5C 10705 TRUE cg10806140 7 37923079 SFRP4 10794 TRUE 188 cg10894453 X 78509515 ITM2A 10813 TRUE 90 cg10911660 19 42355545 ZNF585A 10860 TRUE 132 cg10957151 2 1.77E+08 HOXD9 11096 TRUE 10 cg11174654 X 1.2E+08 GLUD2 11141 FALSE 587 cg11213150 9 1.29E+08 ANGPTL2 11218 TRUE 372 cg11285003 5 45732349 HCN1 11324 TRUE 48 cg11389172 10q11.2 50488305 SLC18A3 11438 TRUE cg11500797 7 96490059 DLX5 11589 TRUE 248 cg11657808 1q43 2.35E+08 RYR2 11691 TRUE 182 cg11747771 9 6635468 GLDC 11755 TRUE 717 cg11812218 3 1.74E+08 GHSR 11767 TRUE 524 cg11822659 20 52526188 DOK5 11891 TRUE 433 cg11934695 20p13 4178092 ADRA1D 11973 TRUE 99 cg12024906 19 42517519 HKR1 11997 TRUE 178 cg12052765 10 50486969 CHAT 12040 TRUE 394 cg12087643 10 1.18E+08 GFRA1 12169 TRUE 87 cg12238343 5p15.1-p14 33972159 RLN3R1 12189 TRUE 20 cg12259537 19 63206506 ZNF606 12226 TRUE 466 cg12300353 4 44145115 KCTD8 12293 TRUE 242 cg12374721 17q21 44154639 PRAC 12441 TRUE 359 cg12515638 7 37922543 SFRP4 12462 TRUE 6 cg12537796 X 1.06E+08 12553 TRUE 626 cg12614105 7 24290960 NPY 12574 TRUE 156 cg12629325 5 1.4E+08 PCDHAC1 12614 TRUE 609 cg12680609 8 1.44E+08 ZFP41 12655 TRUE 548 cg12717594 9 36027454 RECK 12688 TRUE 371 cg12741420 6 337131 IRF4 12693 TRUE 35 cg12745769 19 21371833 LOC115648 12737 TRUE 233 cg12792011 19 63353727 ZNF329 12791 TRUE 438 cg12842316 X 1.43E+08 SLITRK4 12797 TRUE cg12847373 13 77391350 EDNRB 12831 TRUE 19 cg12880658 5 1.15E+08 CDO1 13038 TRUE 696 cg13121699 2 1.85E+08 C2orf10 13144 TRUE 925 cg13234863 12 1.29E+08 KIAA1944 13175 TRUE 509 cg13262687 4 1.48E+08 POU4F2 13225 TRUE 396 cg13297960 21 21292108 NCAM2 13255 TRUE 72 cg13323752 12 7916834 SLC2A14 13479 TRUE 235 cg13547644 1q42.13 2.28E+08 ACTA1 13527 TRUE 47 cg13589108 1 1.75E+08 FAM5B 13560 TRUE 32 cg13619915 3q26.1 1.66E+08 SLITRK3 13658 TRUE 9 cg13714039 19 19704912 ZNF14 13772 TRUE 48 cg13823136 1 77105726 ST6GALNAC5 13796 TRUE 507 cg13843613 1 1.75E+08 FAM5B 13823 TRUE 112 cg13870866 7p14.3 35259655 TBX20 13829 TRUE 83 cg13877915 19q13.4 63643484 ZNF132 13867 TRUE 117 cg13912117 8q24 1.32E+08 ADCY8 13884 TRUE 179 cg13921352 3 69064580 FAM19A4 13916 TRUE 33 cg13958426 1 1.68E+08 C1orf114 13972 TRUE 48 cg14011639 5 1.41E+08 PCDHGB7 14086 TRUE 1 cg14116122 12 84198015 CART1 14237 FALSE 92 cg14262937 6 1.54E+08 OPRM1 14266 TRUE 364 cg14289985 19 61710660 ZNF471 14375 TRUE 963 cg14384532 15 86601628 NTRK3 14411 TRUE 377 cg14419187 2 2.1E+08 C2orf21 14462 TRUE 349 cg14458834 17 44010393 HOXB4 14586 TRUE 424 cg14586939 4 1.56E+08 NPY2R 14615 TRUE 185 cg14611174 14 60045590 SIX6 14731 TRUE 199 cg14724613 7 86111365 GRM3 14834 TRUE 40 cg14832904 2 53940532 GPR75 14843 TRUE 228 cg14839257 6 1.67E+08 RPS6KA2 14853 TRUE 54 cg14847688 14 59001866 GPR135 14864 TRUE 120 cg14859460 5q35 1.78E+08 GRM6 14898 TRUE 92 cg14893163 13 57104037 PCDH17 14902 TRUE 465 cg14896516 7 30688886 CRHR2 14908 TRUE cg14900471 8 11599029 GATA4 14994 TRUE 316 cg14991487 2q31.1 1.77E+08 HOXD9 15148 TRUE 573 cg15156078 15 77170468 RASGRF1 15247 TRUE 382 cg15250797 2 1.2E+08 SCTR 15367 TRUE 151 cg15373633 X 85290130 DACH2 15489 TRUE 418 cg15489294 5 1.15E+08 FLJ90650 15542 TRUE 1498 cg15540820 3p24.1 27740287 EOMES 15778 TRUE 296 cg15747595 8 98359056 TSPYL5 15800 TRUE 392 cg15760840 7p15.2 27191747 HOXA11
Load more

Recommended publications
  • Unnatural Verticilide Enantiomer Inhibits Type 2 Ryanodine Receptor-Mediated Calcium Leak and Is Antiarrhythmic
    Unnatural verticilide enantiomer inhibits type 2 ryanodine receptor-mediated calcium leak and is antiarrhythmic Suzanne M. Batistea,1, Daniel J. Blackwellb,1, Kyungsoo Kimb,1, Dmytro O. Kryshtalb, Nieves Gomez-Hurtadob, Robyn T. Rebbeckc, Razvan L. Corneac, Jeffrey N. Johnstona,2, and Bjorn C. Knollmannb,2 aDepartment of Chemistry, Vanderbilt University, Nashville, TN 37235; bDepartment of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232; and cDepartment of Biochemistry, Molecular Biology, and Biophysics, University of Minnesota, Minneapolis, MN 55455 Edited by Dale L. Boger, The Scripps Research Institute, La Jolla, CA, and approved January 15, 2019 (received for review September 27, 2018) Ca2+ leak via ryanodine receptor type 2 (RyR2) can cause poten- heart diseases associated with both atrial and ventricular arrhyth- tially fatal arrhythmias in a variety of heart diseases and has also mia (9). Mutations in RyR2 and its binding partners, which increase + been implicated in neurodegenerative and seizure disorders, mak- SR Ca2 leak, cause primary atrial and ventricular arrhythmia ing RyR2 an attractive therapeutic target for drug development. syndromes such as catecholaminergic polymorphic ventricular Here we synthesized and investigated the fungal natural product tachycardia (CPVT), providing strong evidence for the mechanistic and known insect RyR antagonist (−)-verticilide and several conge- contribution of RyR2 to arrhythmia risk in humans (10). Further ners to determine their activity against mammalian RyR2. Although support comes from gene-targeted mouse models of CPVT, where + the cyclooligomeric depsipeptide natural product (−)-verticilide had catecholamine-induced spontaneous Ca2 release from the SR no effect, its nonnatural enantiomer [ent-(+)-verticilide] signifi- via RyR2 generates potentially fatal cardiac arrhythmias (11, 12).
    [Show full text]
  • Aquaporin Channels in the Heart—Physiology and Pathophysiology
    International Journal of Molecular Sciences Review Aquaporin Channels in the Heart—Physiology and Pathophysiology Arie O. Verkerk 1,2,* , Elisabeth M. Lodder 2 and Ronald Wilders 1 1 Department of Medical Biology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Experimental Cardiology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-20-5664670 Received: 29 March 2019; Accepted: 23 April 2019; Published: 25 April 2019 Abstract: Mammalian aquaporins (AQPs) are transmembrane channels expressed in a large variety of cells and tissues throughout the body. They are known as water channels, but they also facilitate the transport of small solutes, gasses, and monovalent cations. To date, 13 different AQPs, encoded by the genes AQP0–AQP12, have been identified in mammals, which regulate various important biological functions in kidney, brain, lung, digestive system, eye, and skin. Consequently, dysfunction of AQPs is involved in a wide variety of disorders. AQPs are also present in the heart, even with a specific distribution pattern in cardiomyocytes, but whether their presence is essential for proper (electro)physiological cardiac function has not intensively been studied. This review summarizes recent findings and highlights the involvement of AQPs in normal and pathological cardiac function. We conclude that AQPs are at least implicated in proper cardiac water homeostasis and energy balance as well as heart failure and arsenic cardiotoxicity. However, this review also demonstrates that many effects of cardiac AQPs, especially on excitation-contraction coupling processes, are virtually unexplored.
    [Show full text]
  • Supplemental Material
    Supplemental Table B ARGs in alphabetical order Symbol Title 3 months 6 months 9 months 12 months 23 months ANOVA Direction Category 38597 septin 2 1557 ± 44 1555 ± 44 1579 ± 56 1655 ± 26 1691 ± 31 0.05219 up Intermediate 0610031j06rik kidney predominant protein NCU-G1 491 ± 6 504 ± 14 503 ± 11 527 ± 13 534 ± 12 0.04747 up Early Adult 1G5 vesicle-associated calmodulin-binding protein 662 ± 23 675 ± 17 629 ± 16 617 ± 20 583 ± 26 0.03129 down Intermediate A2m alpha-2-macroglobulin 262 ± 7 272 ± 8 244 ± 6 290 ± 7 353 ± 16 0.00000 up Midlife Aadat aminoadipate aminotransferase (synonym Kat2) 180 ± 5 201 ± 12 223 ± 7 244 ± 14 275 ± 7 0.00000 up Early Adult Abca2 ATP-binding cassette, sub-family A (ABC1), member 2 958 ± 28 1052 ± 58 1086 ± 36 1071 ± 44 1141 ± 41 0.05371 up Early Adult Abcb1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A 136 ± 8 147 ± 6 147 ± 13 155 ± 9 185 ± 13 0.01272 up Midlife Acadl acetyl-Coenzyme A dehydrogenase, long-chain 423 ± 7 456 ± 11 478 ± 14 486 ± 13 512 ± 11 0.00003 up Early Adult Acadvl acyl-Coenzyme A dehydrogenase, very long chain 426 ± 14 414 ± 10 404 ± 13 411 ± 15 461 ± 10 0.01017 up Late Accn1 amiloride-sensitive cation channel 1, neuronal (degenerin) 242 ± 10 250 ± 9 237 ± 11 247 ± 14 212 ± 8 0.04972 down Late Actb actin, beta 12965 ± 310 13382 ± 170 13145 ± 273 13739 ± 303 14187 ± 269 0.01195 up Midlife Acvrinp1 activin receptor interacting protein 1 304 ± 18 285 ± 21 274 ± 13 297 ± 21 341 ± 14 0.03610 up Late Adk adenosine kinase 1828 ± 43 1920 ± 38 1922 ± 22 2048 ± 30 1949 ± 44 0.00797 up Early
    [Show full text]
  • Supplemental Data Supplemental Table 1. Technical Specifications of the Primers Used for Individual Genotyping
    Supplemental data Supplemental table 1. Technical specifications of the primers used for individual genotyping SNP ID Size PCR primer forward PCR primer reverse Temp Pyrosequencing primer(s) PCR (°C) rs776108 127 5’- 5’- Biotin- 61 ATACCTCTCATTTTGCAG chr3:77,825,927- ACCAGGCTAGGCATGCTATA GTCACTTAACAGCAGTGTGTCA 77,826,729 rs3746192 92 5’- 5’- Biotin- 56 AGGCTTGTAACCTGGA chr19:17,946,368- ATTCTAGGTGGCATGAGGG CTGGGGAGCAACAGAAGA 17,946,488 rs988147 169 5' - 5' - Biotine- 53 GCAGGGGGTAGAAATG chr6:45282108- AGCCATTAAAGAATTTCAAA TTGGATTTTATTCTTGTAATAGG 45282608 rs227849 94 5' - 5' - Biotine- 56 GGTTTAAGGTCTTTGCAT chr6:44,806,436- AGGAAAATAAACATGTGGTT TCTACCAATATTTTCTTTCGTAG 44,806,936 TAAG T rs10733833 127 5' - 5' - Biotine- 58 CATGTTTAAAACCTTTCAG chr10:68,418,227- GCCAAAACCAACAGTTCAT GAAAAAAATTGCACCTGTCTC 68,418,727 rs322609 197 5’- 5’-Biotin- 60 GGTAGCTGTGGGTGGA chr16:62,432,604- TAGTTGATTTTGCCAACCTG AAATGGGTGACAGAAGTAATAA 62,433,104 GA rs1884779 127 5’-TGGCTATTGGAGTTCTCA 5’-Biotin- 55 AGTGAATTAAGGGCTTGT chr20:45,857,969- CCATCCATCCCAAATAGT 45,858,469 rs4703908 83 5’- GAAAATGCCCAAGGTGAC 5’-Biotin- 52 GTGACAGTGGGCAAA chr5:71,802,353- GAATGTGGGTGTGTTTTACTCT 71,802,853 rs6946871 290 5’- 5’-Biotin- 61 GGAGGAAAGGAAAAGTT chr7:4,037,310- ATCAGATAAAATCGGCTTCT TCGGGAAGGTTTTTGTACTTTTG 4,037,810 GTG rs11865033 123 5’- 5’-Biotin- 61 AAAGTCTCTTCCTATGAGC chr16:78,082,945- AATAAACCAAGCCCTGAAAA ACTAAAATCCCCCTTTCCTCCA 78,083,445 GTC rs247004 170 5’- 5’-Biotin- 62 GGAAGCCAGACTAGCAG chr5:131,372,007- GGGGAATTTGTCAGAGATAG GGGATCCTCTACCATCCAAATA 131,372,507 GG
    [Show full text]
  • Ion Channels 3 1
    r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia.
    [Show full text]
  • Disease Mutations in the Ryanodine Receptor N-Terminal Region Couple to a Mobile Intersubunit Interface
    ARTICLE Received 1 Oct 2012 | Accepted 15 Jan 2013 | Published 19 Feb 2013 DOI: 10.1038/ncomms2501 OPEN Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface Lynn Kimlicka1, Kelvin Lau1, Ching-Chieh Tung1 & Filip Van Petegem1 Ryanodine receptors are large channels that release Ca2 þ from the endoplasmic and sar- coplasmic reticulum. Hundreds of RyR mutations can cause cardiac and skeletal muscle disorders, yet detailed mechanisms explaining their effects have been lacking. Here we compare pseudo-atomic models and propose that channel opening coincides with widen- ing of a cytoplasmic vestibule formed by the N-terminal region, thus altering an interface targeted by 20 disease mutations. We solve crystal structures of several disease mutants that affect intrasubunit domain–domain interfaces. Mutations affecting intrasubunit ionic pairs alter relative domain orientations, and thus couple to surrounding interfaces. Buried disease mutations cause structural changes that also connect to the intersubunit contact area. These results suggest that the intersubunit contact region between N-terminal domains is a prime target for disease mutations, direct or indirect, and we present a model whereby ryanodine receptors and inositol-1,4,5-trisphosphate receptors are activated by altering domain arrangements in the N-terminal region. 1 Department of Biochemistry and Molecular Biology, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada V6T 1Z3. Correspondence and requests for materials should be addressed to F.V.P. (email: fi[email protected]). NATURE COMMUNICATIONS | 4:1506 | DOI: 10.1038/ncomms2501 | www.nature.com/naturecommunications 1 & 2013 Macmillan Publishers Limited. All rights reserved.
    [Show full text]
  • Physiological and Pathophysiological Regulation of the Ryanodine Receptor in Skeletal Muscle
    Physiological and pathophysiological regulation of the ryanodine receptor in skeletal muscle Alisa Umanskaya Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2015 © 2015 Alisa Umanskaya All rights reserved Abstract Physiological and pathophysiological regulation of ryanodine receptor in skeletal muscle Alisa Umanskaya Ryanodine receptor calcium release channels are essential for skeletal muscle contraction, as they mediate the release of calcium ions from intracellular stores into the cytosol. The data presented in this dissertation demonstrate the evolutionarily conserved mechanisms of skeletal muscle ryanodine receptor regulation in the physiological and pathophysiological states. Adrenergic stimulation causes increased skeletal muscle force, however, despite the well- established role of this physiological response, the molecular mechanism is not known. Here we present a mechanism whereby phosphorylation of a single amino acid on the ryanodine receptor is a key signal in the physiological stress-induced inotropic response in mouse skeletal muscle. Therefore acute post-translational modifications of ryanodine receptor channels are important for healthy muscle contraction. Conversely, chronic stress-induced post-translational modifications result in poorly functioning murine ryanodine receptor channels that contribute to skeletal muscle dysfunction in age- dependent skeletal muscle weakness and Muscular Dystrophies. Finally, we present data that demonstrates striking evolutionary conservation in ryanodine receptor regulation in the physiological and pathophysiological states between mice and C. elegans. This work has broad implications for understanding the underlying mechanisms of skeletal muscle contraction and important disorders that affect human health. Furthermore, this works presents ryanodine receptor channels as a viable therapeutic target for age-related skeletal muscle weakness, Muscular Dystrophies, and also implicates C.
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • RYR2 Gene Ryanodine Receptor 2
    RYR2 gene ryanodine receptor 2 Normal Function The RYR2 gene provides instructions for making a protein called ryanodine receptor 2. This protein is part of a family of ryanodine receptors, which form channels that transport positively charged calcium atoms (calcium ions) within cells. Channels made with the ryanodine receptor 2 protein are found in heart (cardiac) muscle cells called myocytes. These channels are embedded in the outer membrane of a cell structure called the sarcoplasmic reticulum, which acts as a storage center for calcium ions. The RYR2 channel controls the flow of calcium ions out of the sarcoplasmic reticulum. For the heart to beat normally, the cardiac muscle must tense (contract) and relax in a coordinated way. This cycle of muscle contraction and relaxation results from the precise control of calcium ions within myocytes. In response to certain signals, the RYR2 channel releases calcium ions from the sarcoplasmic reticulum into the surrounding cell fluid (the cytoplasm). The resulting increase in calcium ion concentration triggers the cardiac muscle to contract, which pumps blood out of the heart. Calcium ions are then transported back into the sarcoplasmic reticulum, and the cardiac muscle relaxes. In this way, the release and reuptake of calcium ions in myocytes produces a regular heart rhythm. Health Conditions Related to Genetic Changes Catecholaminergic polymorphic ventricular tachycardia More than 200 mutations in the RYR2 gene have been found to cause catecholaminergic polymorphic ventricular tachycardia (CPVT), a heart condition characterized by an abnormal heart rhythm (arrhythmia) during exercise or emotional stress, which can be fatal. Almost all of the RYR2 gene mutations involved in CPVT change single protein building blocks (amino acids) in the ryanodine receptor 2 protein.
    [Show full text]
  • MALAT1 Knockdown Protects from Bronchial/Tracheal Smooth Muscle Cell Injury Via Regulation of Microrna-133A/Ryanodine Receptor 2 Axis
    J Biosci (2021)46:28 Ó Indian Academy of Sciences DOI: 10.1007/s12038-021-00149-3 (0123456789().,-volV)(0123456789().,-volV) MALAT1 knockdown protects from bronchial/tracheal smooth muscle cell injury via regulation of microRNA-133a/ryanodine receptor 2 axis 1 2 MINGZHU YANG and LI WANG * 1Department of Pediatric Internal Medicine, Xian Yang Central Hospital, Xianyang 712000, People’s Republic of China 2Department of Laboratory Medicine, Affiliated Hospital of Shaanxi University of Chinese Medicine, Xianyang 712000, People’s Republic of China *Corresponding author (Email, [email protected]) MS received 9 December 2019; accepted 12 February 2021 Asthma has significant impacts on living quality particularly in children. Long noncoding RNA (lncRNA) MALAT1 plays a crucial role in neonatal respiratory diseases. Meanwhile, MALAT1 knockdown could induce viability and attenuate apoptosis of airway-related cells. However, the role of MALAT1 in neonatal asthma, asthma-related cell, and its possible mechanism is unclear. This study aims to investigate MALAT1 level in asthma and to identify the effects of MALAT1 on bronchial/tracheal smooth muscle cells (B/TSMCs). Newborn asthma modeling rat was constructed by introducing ovalbumin (OVA). MALAT1 levels in tissues or B/TSMCs were determined by RT-qPCR. Exogenous changes of MALAT1, RyR2 or miR-133a in B/TSMCs were fulfilled by cell transfection; cell apoptosis was measured by using Cell Death Detection ELISA kit and Hochest33342; IL-6, TNF-a and IL-1b level was detected by using corresponding ELISA kit; ryanodine receptor 2 (RyR2) mRNA and miR-133a level was determined by RT-qPCR; cleaved caspase-3 (c-caspase-3) and RyR2 expression was detected by Western blot; luciferase reporter assay was performed to confirm the target regulation of miR-133a on RyR2.
    [Show full text]
  • Original Article Unbalanced Upregulation of Ryanodine Receptor 2 Plays a Particular Role in Early Development of Daunorubicin Cardiomyopathy
    Am J Transl Res 2015;7(7):1280-1294 www.ajtr.org /ISSN:1943-8141/AJTR0010909 Original Article Unbalanced upregulation of ryanodine receptor 2 plays a particular role in early development of daunorubicin cardiomyopathy Dana Kucerova1,2, Gabriel Doka1, Peter Kruzliak3, Katarina Turcekova1, Jana Kmecova1, Zuzana Brnoliakova4, Jan Kyselovic1, Uwe Kirchhefer2, Frank U Müller2, Peter Krenek1, Peter Boknik2, Jan Klimas1 1Department of Pharmacology and Toxicology, Faculty of Pharmacy, Comenius University, Bratislava, Slovak Re- public; 2Institut für Pharmakologie und Toxikologie, Universitätsklinikum Münster, Münster, Germany; 3Internation- al Clinical Research Center, St. Anne’s University Hospital and Masaryk University, Brno, Czech Republic; 4Institute of Experimental Pharmacology, Slovak Academy of Sciences, Bratislava, Slovak Republic Received May 31, 2015; Accepted July 14, 2015; Epub July 15, 2015; Published July 30, 2015 Abstract: Calcium release channel on the sarcoplasmic reticulum of cardiomyocytes (ryanodine receptor type 2, RyR2) plays a critical role in the regulation of calcium and was identified as a crucial factor for development of chronic anthracycline cardiomyopathy. Its early stages are less well described although these determine the later development. Hence, we tested the effect of repeated, short-term anthracycline (daunorubicin) administration on cardiac performance, cardiomyocyte function and accompanied changes in calcium regulating proteins expression. Ten-twelve weeks old male Wistar rats were administered with 6 doses of daunorubicin (DAU, 3 mg/kg, i.p., every 48 h), controls (CON) received vehicle. Left ventricular function (left ventricular pressure, LVP; rate of pressure de- velopment, +dP/dt and decline, -dP/dt) was measured using left ventricular catheterization under tribromethanol anaesthesia (15 ml/kg b.w.).
    [Show full text]
  • Skeletal Muscle in Aged Mice Reveals Extensive Transformation of Muscle
    Lin et al. BMC Genetics (2018) 19:55 https://doi.org/10.1186/s12863-018-0660-5 RESEARCHARTICLE Open Access Skeletal muscle in aged mice reveals extensive transformation of muscle gene expression I-Hsuan Lin1†, Junn-Liang Chang3†, Kate Hua1, Wan-Chen Huang4, Ming-Ta Hsu2 and Yi-Fan Chen4* Abstract Background: Aging leads to decreased skeletal muscle function in mammals and is associated with a progressive loss of muscle mass, quality and strength. Age-related muscle loss (sarcopenia) is an important health problem associated with the aged population. Results: We investigated the alteration of genome-wide transcription in mouse skeletal muscle tissue (rectus femoris muscle) during aging using a high-throughput sequencing technique. Analysis revealed significant transcriptional changes between skeletal muscles of mice at 3 (young group) and 24 (old group) months of age. Specifically, genes associated with energy metabolism, cell proliferation, muscle myosin isoforms, as well as immune functions were found to be altered. We observed several interesting gene expression changes in the elderly, many of which have not been reported before. Conclusions: Those data expand our understanding of the various compensatory mechanisms that can occur with age, and further will assist in the development of methods to prevent and attenuate adverse outcomes of aging. Keywords: Aging, Skeletal muscle, Cardiac-related genes, RNA sequencing analysis, Muscle fibers, Defects on differentiation Background SIRT1 reduces the oxidative stress and inflammation Aging is a process whereby various changes were accu- associated with ameliorating diseases, such as vascular mulated over time, resulting in dysfunction in mole- endothelial disorders, neurodegenerative diseases, as cules, cells, tissues and organs.
    [Show full text]