DOCSLIB.ORG

Disruption of GSTZ1 Gene by Large Genetic Alteration in Oryza Glaberrima

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Disruption of GSTZ1 Gene by Large Genetic Alteration in Oryza Glaberrima Breeding Science 54 : 67-73 (2004) Disruption of GSTZ1 Gene by Large Genetic Alteration in Oryza glaberrima Tokuji Tsuchiya and Ikuo Nakamura* Graduate School of Science and Technology, Chiba University, 648 Matsudo, Matsudo, Chiba 271-8510, Japan After the completion of the genome sequencing project Introduction of common rice (Oryza sativa L.), comparative genomic studies between rice and related species became impor- Glutathione S-transferases (GSTs; EC 2.5.1.18) are tant to reveal the function of each gene. The rice ge- ubiquitous and abundant detoxifying enzymes in all the organ- nome contains two copies of the gene encoding zeta class isms, such as bacteria, fungi, animals and plants. Recently, glutathione S-transferase (GSTZ) that is reported to be plant GSTs have been classified into four different classes, the enzyme in the catabolic pathway of tyrosine and phi, tau, theta and zeta, based on amino acid sequence simi- phenylalanine. Two GSTZ genes of O. sativa, OsGSTZ1 larity and gene structure (Dixon et al. 1998, Edward et al. and OsGSTZ2, display a tandem arrangement. Up- 2000). The phi and tau GST genes are plant-specific and com- stream OsGSTZ1 gene is constitutively expressed, pose large multi-gene families, whereas the theta and zeta whereas the downstream OsGSTZ2 gene is inducible by GST genes have a few copies. The zeta class GST (GSTZ) stresses. We analyzed the expression of the GSTZ gene genes are present as one or two copies in every plant genome in the African cultivated species O. glaberrima and wild studied, such as A. thaliana, maize, soybean, carnation and species O. longistaminata by using RT-PCR. The results rice (Meyer et al. 1991, Raghothama et al. 1991, McGonigle showed that both GSTZ1 and GSTZ2 genes were ex- et al. 2000, Dixon et al. 2002). Since the plant GSTZ genes pressed in O. longistaminata, whereas only the cDNA are highly homologous to those of mammals and fungi fragment of downstream GSTZ2 was detected in (Board et al. 1997, Blackburn et al. 1998, Subramaniam O. glaberrima. Thus, the genomic sequence of the GSTZ1 et al. 1999), GSTZ genes have been considered to encode locus of O. glaberrima was determined by PCR genomic common essential proteins in all eukaryotes (Hayes and walking. Sequence comparison between O. sativa and Mclellan 1999). Actually, human and fungal GSTZ proteins O. glaberrima revealed that the genomic sequence up- occur as maleylacetoacetate isomerase (MAAI) in phenyl- stream from the eighth intron of the OgGSTZ1 gene was alanine and tyrosine metabolic pathways (Fernandez-Canon highly homologous, in inverted orientation, to a BAC and Penalva 1998). Thom et al. (2001) showed that the clone, over 1-Mb apart from the OsGSTZ1 gene in GSTZ protein in Arabidopsis exhibited a similar activity to O. sativa. This result suggested that the OgGSTZ1 gene that of MAAI. The function of MAAI is important because was disrupted by a large rearrangement or inversion. MAAI might be involved in the nitrogen metabolism in The genetic alteration was also observed in several lines plants. of O. glaberrima and its ancestral wild species O. barthii. We have characterized the structure and expression of The loss of the OgGSTZ1 gene in O. glaberrima is im- the GSTZ genes in rice (Oryza sativa L.). Rice contains two portant, as the expression of the gene is 12-fold higher copies of the GSTZ gene, OsGSTZ1 and OsGSTZ2, in a tan- than that of OsGSTZ2 in O. sativa and since O. sativa dem arrangement orientation on the short arm of chromo- and O. glaberrima differ in several such as seed yield some 12. The upstream OsGSTZ1 and downstream OsGSTZ2 and annual/perennial habitat that might be related to genes display a complex structure with ten and nine exons, the translocation of nitrogen metabolites from leaves to respectively, in spite of encoding a relatively short coding seeds. sequence (ca. 700bp). The amino acid sequences deduced from the OsGSTZ1 and OsGSTZ2 genes were highly homol- Key Words: Oryza glaberrima, glutathione S-transferase, ogous (77.9 %). Real-Time RT-PCR revealed that OsGSTZ1 maleylacetoacetate isomerase, tyrosine was expressed at a level ca. 12-fold higher than that of metabolism, comparative genomics, PCR OsGSTZ2 in the leaves of rice plants. OsGSTZ1 was express- genomic walking. ed in a relatively constitutive manner under various stress conditions. In contrast, the expression of the OsGSTZ2 gene was strongly enhanced (30-fold) by treatment with jasmonate (Tsuchiya et al., data not shown). There are two cultivated species of rice, Oryza sativa and O. glaberrima Steud. The former species is common rice widely grown in tropical and temperate world wide and Communicated by K. Kadowaki differentiated into various subspecies, such as indica and Received October 14, 2003. Accepted November 6, 2003. japonica, while the latter is a monomorphic species endemic *Corresponding author (e-mail: [email protected]) to West Africa (Morishima et al. 1984). Oryza sativa and 68 Tsuchiya and Nakamura O. glaberrima originated independently from wild relatives, from both ends using universal primers. the O. rufopogon-nivara complex in Southeast Asia and O. barthii in West Africa, respectively. As F1s between Sequencing of OgGSTZ locus O. sativa and O. glaberrima are sterile, the genome symbol was Two different methods of PCR genomic walking were designated as AA for O. sativa and AgAg for O. glaberrima. employed to obtain sequence information around the However, the chromosomal pairing in their hybrid was nor- OgGSTZ locus in O. glaberrima. About 1-kb fragment up- mal (Morinaga and Kuriyama 1957). The chromosomal or- stream of OgGSTZ2 was amplified by TAIL-PCR (Liu et al. ganization and location of six different loci (wx, A, Se-1, Rc, 1995) using random RP primer and P5, P6 and P7 as gene 5S and 45S rDNA) are comparable between the two species specific primers (Table 1 and Fig. 2). The sequence further (Sano 1988, Ohmido and Fukui 1995). Oka (1988) pointed upstream (ca. 2-kb) was isolated by Anchor-PCR (Troutt et out that O. glaberrima exhibited stress tolerance to drought, al. 1992). Briefly, gDNA of the O. glaberrima line CG14 diseases and weeds, while O. sativa showed a high seed was digested by BglII and ligated with an anchor (AD-F, yield of seeds and was susceptible to various kinds of biotic AD-R, Table 1). PCR reactions were performed twice using and abiotic stresses. two OgGSTZ2 specific primers (P11 and P12) and adapter After the completion of the rice genome sequence primers (AP1 and AP2). The gDNA and cDNA sequences of project, the comparison of genomic sequences between rice the OgGSTZ2 gene were also amplified using P8, P9 and P10 and related species may enable to study the function of the primers. The amplified fragments were directly sequenced genes. We examined the expression of the OgGSTZ genes in or cloned into pCR2.1 plasmid (Invitrogen). Homology O. glaberrima because O. sativa and O. glaberrima display search was carried out through NCBI Blast server (Altschul differences in seed production and annual-perennial habitat. et al. 1997). That may possibly be related to the translocation of nitrogen metabolites. In this paper, it was observed that the OgGSTZ1 PCR amplification of the altered region gene of O. glaberrima was disrupted by a large genetic re- A pair of primers (P13 and P14) was designed to ampli- arrangement or inversion over 1-Mb of the chromosomal fy the fragment containing the genetic alteration found in fragment. Comparative genetics of O. glaberrima may also O. glaberrima. PCR reactions were executed using DNA give the opportunity to reveal the physiological function of templates extracted from five lines of O. glaberrima and three the GSTZ1 gene. lines of O. barthii. The amplified products were subjected to agarose gel electrophoresis. Materials and Methods Southern blot analysis Plant materials A DIG-labeled probe for OgGSTZ2 cDNA was pre- Oryza sativa ‘Sasanishiki’, O. glaberrima (lines CG14, pared using P9 and P10 primers and a PCR DIG probe syn- C0028, C0039, C0416, C7290 and C7293), O. barthii (lines thesis kit (Roche). Aliquots of 5 µg gDNA were digested by W0652, W0720 and W0747) and O. longistaminata (line eight appropriate restriction endonucleases that did not W1413) were obtained from Iwate Agricultural Research Center and the National Institute of Genetics, Japan. These Table 1. List of primers used in this study rice plants were grown in a greenhouse and leaves at the adult stage were harvested. Genomic DNAs (hereafter re- Name Sequence (5′→3′) ferred to as gDNA(s)) and total RNAs were isolated from the P1 AGCATTTCAAGCTGCTGTC leaves by the CTAB (Rogers and Bendich 1988) and phenol/ P2 TATGGCACTGGAGACTACTCA SDS (Shirzadegan et al. 1991) methods, respectively. Total P3 CGTCAAAGCCAATCCTGTA CTCCATCTACTAATGCTGGTATG RNA (2 µg) was reverse-transcribed using a ReverTra Ace P4 AGCTAAAGCAGTAAGAGTGTTGACT Kit (Toyobo) to synthesize cDNA, according to the manu- P5 P6 AGCTCAGTGAAGCCAAAGAATCAA facturer’s instructions. P7 CTCCAATTGCTCAAGAAATGCTTAC P8 AACTAAACGTGGCATTTATTCACTTACATA PCR amplification of gDNA and cDNA for GSTZ genes P9 AGGTACTGGAGTACTGGATGGATAAT PCR was performed to amplify gDNA and cDNA of the P10 ACCTTTTCAGGACAGCATCTACTC GSTZ gene in O. glaberrima (CG14) and O. longistaminata P11 CATCTGGTTGGTTTTGAGAATGTA (W1413). Two pairs of specific primers, P1-P2 and P3-P4 P12 AGTATTCAATAGGATTCTCTTGTCACTTAGA (Fig. 2 and Table 1), were designed based on the cDNA se- P13 GAAGGTGCATCTGGCTGATTCTTT quences of OsGSTZ1 (Genbank AF309381) and OsGSTZ2 P14 GCGTCGTCAAAGCCAATCCTGTA (Genbank AF402792), respectively. The amplified products RP GTNCGA(G/C)(A/T)CANA(A/T)GTT were fractionated through a 1 % agarose gel and visualized AD-F CGCAGGCTGGCAGTCTCTTTAGGGTTACACGATTGCTT by staining with ethidium bromide under a UV trans- AD-R TCAAGCAATCGTGT illuminator. Furthermore, the amplified fragments were AP1 CGCAGGCTGGCAGTCTCTTTAG ATGCGGCCGCTCTCTTTAGGGTTACACGATTGCTT cloned into a pCR2.1 plasmid (Invitrogen) and sequenced AP2 Disruption of GSTZ1 gene by genetic alteration in Oryza glaberrima 69 digest the inside part of the OgGSTZ2 gene.
Load more

Recommended publications
  • Loss of Function at RAE2, a Previously Unidentified EPFL, Is Required for Awnlessness in Cultivated Asian Rice
    Loss of function at RAE2, a previously unidentified EPFL, is required for awnlessness in cultivated Asian rice Kanako Bessho-Ueharaa,1, Diane R. Wangb,1, Tomoyuki Furutaa, Anzu Minamia, Keisuke Nagaia, Rico Gamuyaoa, Kenji Asanoa, Rosalyn B. Angeles-Shima, Yoshihiro Shimizua, Madoka Ayanoa, Norio Komedaa, Kazuyuki Doic, Kotaro Miurad, Yosuke Todae, Toshinori Kinoshitae, Satohiro Okudae, Tetsuya Higashiyamae, Mika Nomotof, Yasuomi Tadaf, Hidefumi Shinoharaf, Yoshikatsu Matsubayashif, Anthony Greenbergb, Jianzhong Wug, Hideshi Yasuih, Atsushi Yoshimurah, Hitoshi Moric,2, Susan R. McCouchb,2, and Motoyuki Ashikaria,2 aBioscience and Biotechnology Center, Nagoya University, Furo-cho, Chikusa, Nagoya, Aichi 464-8601, Japan; bSection of Plant Breeding and Genetics, School of Integrated Plant Sciences, Cornell University, Ithaca, NY 14853-1901; cGraduate School of Agriculture, Nagoya University, Furo-cho, Chikusa, Nagoya, Aichi 464-8601, Japan; dFaculty of Biotechnology, Fukui Prefectural University, 4-1-1 Eiheiji-Town, Fukui 910-1195, Japan; eInstitute of Transformative Bio-Molecules, Nagoya University, Furo-cho, Chikusa, Nagoya, Aichi 464-8602, Japan; fDivision of Biological Science, Graduate School of Science, Nagoya University, Furo-cho, Chikusa, Nagoya, Aichi 464-8602, Japan; gNational Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8634, Japan; and hFaculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan Edited by Maarten Koornneef, Max Planck Institute for Plant Breeding Research, Cologne, Germany, and approved June 22, 2016 (received for review March 24, 2016) Domestication of crops based on artificial selection has contributed important for habitat expansion and survival of wild rice. Under numerous beneficial traits for agriculture. Wild characteristics such domestication, the awnless phenotype has been selected to facilitate as red pericarp and seed shattering were lost in both Asian (Oryza planting, harvesting, and storage of seeds (17).
    [Show full text]
  • The Molecular Genetic Study About Awnedness of Rice
    The molecular genetic study about awnedness of rice (イネの芒に関する分子遺伝学的研究) Laboratory of Molecular Biosystem, Division of Molecular Cell Function, Department of Bioengineering Sciences, Graduate School of Bioagricultural Science, Nagoya University, Nagoya, Japan Kanako UEHARA March 2017 Contents Chapter 1: General introduction 2 References 7 Chapter 2: Evaluation of awn phenotype in chromosome segment substitution lines (CSSL). Introduction 12 Results 15 Discussion 23 Materials and methods 27 References 29 Tables and Figures 34 Chapter 3: Identification of Regulator of Awn Elongation 2 which is responsible for awn elongation. Introduction 60 Results 62 Discussion 78 Materials and methods 82 References 99 Tables and Figures 106 Acknowledgements 147 List of publications 148 1 Chapter 1 General introduction 2 Through the long domestication history, cultivated plants contribute to human health and prosperity. It is because human selected the species that have beneficial traits for agriculture from wild species over a long time period. In other words, human took an effort to improve wild species to be more manageable, to a higher yield and better taste. For example, the fruit of tomato (Solanum lycopersicum) has been selected larger and larger than its ancestor (Lin et al. 2014), and Brassica oleracea has been selected to represent the extraordinary diversity such as cabbage, kale, broccoli and so on (Maggioni et al. 2010). Among the agricultural products, cereals are the most important foods for human. Not only fruits or vegetables but also cereals have been domesticated. The wild progenitors of the major cereals, wheat (Triticum aestivum), maize (Zea mays) and rice (Oryza sativa), show weed like structure and physiological traits (Doebley et al.
    [Show full text]
  • Oryza Glaberrima Steud)
    plants Review Advances in Molecular Genetics and Genomics of African Rice (Oryza glaberrima Steud) Peterson W. Wambugu 1, Marie-Noelle Ndjiondjop 2 and Robert Henry 3,* 1 Kenya Agricultural and Livestock Research Organization, Genetic Resources Research Institute, P.O. Box 30148 – 00100, Nairobi, Kenya; [email protected] 2 M’bé Research Station, Africa Rice Center (AfricaRice), 01 B.P. 2551, Bouaké 01, Ivory Coast; [email protected] 3 Queensland Alliance for Agriculture and Food Innovation, University of Queensland, Brisbane, QLD 4072, Australia * Correspondence: [email protected]; +61-7-661733460551 Received: 23 August 2019; Accepted: 25 September 2019; Published: 26 September 2019 Abstract: African rice (Oryza glaberrima) has a pool of genes for resistance to diverse biotic and abiotic stresses, making it an important genetic resource for rice improvement. African rice has potential for breeding for climate resilience and adapting rice cultivation to climate change. Over the last decade, there have been tremendous technological and analytical advances in genomics that have dramatically altered the landscape of rice research. Here we review the remarkable advances in knowledge that have been witnessed in the last few years in the area of genetics and genomics of African rice. Advances in cheap DNA sequencing technologies have fuelled development of numerous genomic and transcriptomic resources. Genomics has been pivotal in elucidating the genetic architecture of important traits thereby providing a basis for unlocking important trait variation. Whole genome re-sequencing studies have provided great insights on the domestication process, though key studies continue giving conflicting conclusions and theories. However, the genomic resources of African rice appear to be under-utilized as there seems to be little evidence that these vast resources are being productively exploited for example in practical rice improvement programmes.
    [Show full text]
  • GSTZ1 Deficiency Promotes Hepatocellular Carcinoma
    Li et al. Journal of Experimental & Clinical Cancer Research (2019) 38:438 https://doi.org/10.1186/s13046-019-1459-6 RESEARCH Open Access GSTZ1 deficiency promotes hepatocellular carcinoma proliferation via activation of the KEAP1/NRF2 pathway Jingjing Li1,2†, Qiujie Wang1†, Yi Yang1, Chong Lei1, Fan Yang1, Li Liang1, Chang Chen3, Jie Xia1, Kai Wang1* and Ni Tang1* Abstract Background: Glutathione S-transferase zeta 1 (GSTZ1) is the penultimate enzyme in phenylalanine/tyrosine catabolism. GSTZ1 is dysregulated in cancers; however, its role in tumorigenesis and progression of hepatocellular carcinoma (HCC) is largely unknown. We aimed to assess the role of GSTZ1 in HCC and to reveal the underlying mechanisms, which may contribute to finding a potential therapeutic strategy against HCC. Methods: We first analyzed GSTZ1 expression levels in paired human HCC and adjacent normal tissue specimens and the prognostic effect of GSTZ1 on HCC patients. Thereafter, we evaluated the role of GSTZ1 in aerobic glycolysis in HCC cells on the basis of the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR). Furthermore, we assessed the effect of GSTZ1 on HCC proliferation, glutathione (GSH) concentration, levels of reactive oxygen species (ROS), and nuclear factor erythroid 2-related factor 2 (NRF2) signaling via gain- and loss- of GSTZ1 function in vitro. Moreover, we investigated the effect of GSTZ1 on diethylnitrosamine (DEN) and carbon tetrachloride (CCl4)induced hepatocarcinogenesis in a mouse model of HCC. Results: GSTZ1 was downregulated in HCC, thus indicating a poor prognosis. GSTZ1 deficiency significantly promoted hepatoma cell proliferation and aerobic glycolysis in HCC cells. Moreover, loss of GSTZ1 function depleted GSH, increased ROS levels, and enhanced lipid peroxidation, thus activating the NRF2-mediated antioxidant pathway.
    [Show full text]
  • Age-Related Changes in Mirna Expression Influence GSTZ1 and Other Drug Metabolizing Enzymes S
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2020/04/30/dmd.120.090639.DC1 1521-009X/48/7/563–569$35.00 https://doi.org/10.1124/dmd.120.090639 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 48:563–569, July 2020 Copyright ª 2020 by The American Society for Pharmacology and Experimental Therapeutics Age-Related Changes in miRNA Expression Influence GSTZ1 and Other Drug Metabolizing Enzymes s Stephan C. Jahn, Lauren A. Gay, Claire J. Weaver, Rolf Renne, Taimour Y. Langaee,Department of Pharmacotherapy and Translational Research. Peter W. Stacpoole, and Margaret O. James Departments of Medicinal Chemistry (S.C.J., C.J.W., M.O.J.), Pharmacotherapy and Translational Research (T.Y.L.), Medicine (P.W.S.), Biochemistry and Molecular Biology (P.W.S.), and Molecular Genetics and Microbiology (L.A.G., R.R.), University of Florida, Gainesville, Florida Received January 1, 2020; accepted April 7, 2020 ABSTRACT Previous work has shown that hepatic levels of human glutathione miR-376c-3p could downregulate GSTZ1 protein expression. Our Downloaded from transferase zeta 1 (GSTZ1) protein, involved in tyrosine catabolism findings suggest that miR-376c-3p prevents production of GSTZ1 and responsible for metabolism of the investigational drug dichlor- through inhibition of translation. These experiments further our oacetate, increase in cytosol after birth before reaching a plateau understanding of GSTZ1 regulation. Furthermore, our array results around age 7. However, the mechanism regulating this change of provide a database resource for future studies on mechanisms expression is still unknown, and previous studies showed that regulating human hepatic developmental expression.
    [Show full text]
  • 9 Glutathione S-Transferases
    Enzyme Systems that Metabolise Drugs and Other Xenobiotics. Edited by Costas Ioannides Copyright # 2001 John Wiley & Sons Ltd ISBNs: 0-471-894-66-4 %Hardback); 0-470-84630-5 %Electronic) 9 Glutathione S-transferases Philip J. Sherratt and John D. Hayes University of Dundee, UK Introduction Glutathione S-transferase GST; EC 2.5.1.18) isoenzymes are ubiquitously distributed in nature, being found in organisms as diverse as microbes, insects, plants, ®sh, birds andmammals Hayes andPulford1995). The transferases possess various activities andparticipate in several differenttypes of reaction. Most of these enzymes can catalyse the conjugation of reduced glutathione GSH) with compounds that contain an electrophilic centre through the formation of a thioether bondbetween the sulphur atom of GSH and the substrate Chasseaud 1979; Mannervik 1985). In addition to conjugation reactions, a number of GST isoenzymes exhibit other GSH-dependent catalytic activities including the reduction of organic hydroperoxides Ketterer et al. 1990) andisomerisation of various unsaturatedcompoundsBenson et al. 1977; Jakoby andHabig 1980). These enzymes also have several non-catalytic functions that relate to the sequestering of carcinogens, intracellular transport of a wide spectrum of hydrophobic ligands, and modulation of signal transduction pathways Listowsky 1993; Adler et al. 1999; Cho et al. 2001). Glutathione S-transferases represent a complex grouping of proteins. Two entirely distinct superfamilies of enzyme have evolved that possess transferase activity Hayes andStrange 2000). The ®rst enzymes to be characterisedwere the cytosolic, or soluble, GSTs BoylandandChasseaud1969; Mannervik 1985). To dateat least 16 members of this superfamily have been identi®ed in humans Board et al. 1997, 2000; Hayes and Strange 2000).
    [Show full text]
  • Slavery on South Carolina Rice Plantations
    Slavery on South Carolina Rice Plantations The Migration of People and Knowledge in Early Colonial America Between 1505 and 1888 around 12 million Africans were enslaved and brought to the New World. The issues that arise from slavery are complex and vast. It is impossible to understand slavery from one lesson because it has existed throughout time and across different populations, in fact slavery still exists to this day. In this lesson you will learn about slavery on South Carolina rice plantations during Colonial America by reading this handout, reviewing charts and figures, and reading personal accounts. The “door of no return” at Elmina Castle. It leads from the dungeons of Elmina Castle in Ghana, West Africa to a harbor where slave ships docked. Elmina Castle was built on an island by the Dutch and African empires that controlled this area of West Africa in the 1700- 1800s. Both the Dutch and West African empires accumulated great power and wealth as thousands of enslaved Africans passed through the Door of No Return onto slave ships that took them to the New World. South Carolina Along the coastal lands of South Carolina are rice fields, they are now abandoned; the land has been reclaimed by wild grass and a few river alligators. The Gullah, African Americans who were originally from the West Coast of Africa, still populate the barrier islands along the coast today. During the 1700’s enslaved people worked tirelessly under deadly conditions to grow a crop that was as profitable as gold. Over 40,000 acres of land was cleared and 780 miles of canals were dug by the beginning of the 1800s.1 Disease, heat-stroke, and injuries killed many who worked the rice fields, but the rice was so valuable that the demand for enslaved people grew.
    [Show full text]
  • Rice Scientific Classification Kingdom: Plantae Division: Magnoliophyta
    Rice From Wikipedia, the free encyclopedia Rice Oryza sativa Scientific classification Kingdom: Plantae Division: Magnoliophyta Class: Liliopsida Order: Poales Family: Poaceae Genus: Oryza Species • Oryza glaberrima • Oryza sativa Rice refers to two species ( Oryza sativa and Oryza glaberrima ) of grass , native to tropical and subtropical southern & southeastern Asia and to Africa , which together provide more than one fifth of the calories consumed by humans [1]. (The term "wild rice" can refer to wild species of Oryza, but conventionally refers to species of the related genus Zizania , both wild and domesticated.) Rice is an annual plant , growing to 1–1.8 m tall, occasionally more, with long slender leaves 50–100 cm long and 2–2.5 cm broad. The small wind-pollinated flowers are produced in a branched arching to pendulous inflorescence 30–50 cm long. The seed is a grain (caryopsis) 5–12 mm long and 2–3 mm thick. Contents • 1 Cultivation • 2 Preparation as food o 2.1 Cooking • 3 History o 3.1 Etymology o 3.2 History of cultivation • 4 World production and trade • 5 Rice Pests • 6 Cultivars Cultivation The planting of rice is often a labour intensive process Rice is a dietary staple for a large part of the world's human population , making it the most consumed cereal grain . Rice is the world's third largest crop, behind maize ("corn") and wheat . Rice cultivation is well suited to countries and regions with low labour costs and high rainfall , as it is very labour-intensive to cultivate and requires plenty of water for irrigation , much like the licorice crops found in Eastern Europe.
    [Show full text]
  • Dmd.120.000143.Full.Pdf
    DMD Fast Forward. Published on September 1, 2020 as DOI: 10.1124/dmd.120.000143 This article has not been copyedited and formatted. The final version may differ from this version. Drug Metabolism and Disposition Exposure of Rats to Multiple Oral Doses of Dichloroacetate Results in Upregulation of Hepatic GSTs and NQO1 Edwin J. Squirewell, Ricky Mareus, Lloyd P. Horne, Peter W. Stacpoole, and Margaret O. James Downloaded from Department of Medicinal Chemistry (E.J.S., R.M., M.O.J.), Department of Medicine (L.P.H., P.W.S.), and Department of Biochemistry and Molecular Biology (P.W.S.), University of Florida, Gainesville FL dmd.aspetjournals.org at ASPET Journals on October 1, 2021 1 DMD Fast Forward. Published on September 1, 2020 as DOI: 10.1124/dmd.120.000143 This article has not been copyedited and formatted. The final version may differ from this version. Running title: Repeated DCA dosing in Rats Increases Hepatic GSTs and NQO1 Address correspondence to: Dr. Margaret O. James, Department of Medicinal Chemistry, University of Florida College of Pharmacy, 1345 Center Drive, Gainesville, FL 32610. Tel: 352-273-7707. Email: [email protected] Downloaded from Number of text pages: 16 Number of tables: 3 Number of figures: 3 dmd.aspetjournals.org Number of references: 77 Number of words in the Abstract: 250 Number of words in Introduction: 657 at ASPET Journals on October 1, 2021 Number of words in Discussion: 1512 Abbreviations: DCA, dichloroacetate; DCPIP, 2,6-dichlorophenolindophenol; DCNB, 1,2-dichloro-4- nitrobenzene; CDNB, 1-chloro-2,4-dinitrobenzene, NQO1, NAD(P)H dehydrogenase [quinone] 1; NBD-Cl, 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole; GCLC, glutamylcysteine ligase complex; GSS, glutathione synthetase; GSH, glutathione; GSTZ1, glutathione transferase zeta 1; MAAI, maleylacetoacetate isomerase; PDK, pyruvate dehydrogenase kinase; PDC, pyruvate dehydrogenase complex; ROS, reactive oxygen species; S.D., standard deviation.
    [Show full text]
  • African Origins of Rice Cultivation in the Black Atlantic
    África: Revista do Centro de Estudos Africanos. USP, S. Paulo, 27-28: 91-114, 2006/2007 African origins of rice cultivation in the Black Atlantic Judith A. Carney* Wade in de water, Wade in de water, children Wade in de water, God’s a goin’ to trouble de water. See dat band all dress’d in red, God’s a goin’ to trouble de water. It looks like de band dat Moses led. God’s a goin’ a trouble de water. Abstract: The African diaspora was one of plants as well as people. Rice (Oryza glaberrima) led the diffusion of African plants and agricultural systems that shaped environment, food preferences, economies and cultural identity during the era of plantation slavery. By the eighteenth century the cereal was widely established from South Carolina to Brazil in the Americas. Grown by slaves as well as maroons, on plantations for subsistence as well as for export, rice cultivation accompanied African settlement of the Americas. This article reviews the indigenous knowledge systems that informed the cultivation of rice along the African as well as American Atlantic. With identical methods and practices, slaves from West Africa adapted a favored dietary staple to new conditions in the Americas, thereby ensuring the cereal’s enduring significance in Diaspora cuisines. In illuminating the African origins of Ca- rolina rice beginnings, this paper aims to recover a significant narrative of the Atlantic slave trade. Keywords: African rice, slavery, Black Atlantic, African diaspora, knowledge systems. * Department of Geography, UCLA. USA. 91 African origins of rice cultivation in the Black Atlantic INTRODUCTION The African-American spiritual, “Wade in the Water,” recalls the passage to freedom that the parting of the Red Sea gave Moses and the enslaved Israelites.
    [Show full text]
  • Oryza Glaberrima
    African rice (Oryza glaberrima) cultivation in the Togo Hills: ecological and socio-cultural cues in farmer seed selection and development and socio-cultural cues in farmer seed selection development African rice ( Oryza glaberrima ) cultivation in the Togo Hills: ecological Togo ) cultivation in the Béla Teeken Béla Béla Teeken African rice (Oryza glaberrima) cultivation in the Togo Hills: ecological and socio-cultural cues in farmer seed selection and development Béla Teeken Thesis committee Promotors Prof. Dr P. Richards Emeritus professor of Technology and Agrarian Development Wageningen University Prof. Dr P.C. Struik Professor of Crop Physiology Wageningen University Co-promotors Dr H. Maat Assistant Professor Knowledge, Technology and Innovation group Wageningen University Dr E. Nuijten Senior Researcher Plant Breeding & Sustainable Production Chains Louis Bolk Institute Other members Prof. Dr H.A.J. Bras, Wageningen University Prof. Dr S. Hagberg, Professor of Cultural Anthropology, Uppsala University, Sweden Dr T.J.L. van Hintum, Wageningen University Dr S. Zanen, Senior Trainer Consultant, MDF Training & Consultancy, Ede This research was conducted under the auspices of the Wageningen School of Social Sciences (WASS). African rice (Oryza glaberrima) cultivation in the Togo Hills: ecological and socio-cultural cues in farmer seed selection and development Be´la Teeken PHD Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr A.P.J. Mol, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 1 September 2015 at 4 p.m. in the Aula. Béla Teeken African rice (Oryza glaberrima) cultivation in the Togo Hills: ecological and socio-cultural cues in farmer seed selection and development 306 pages PhD thesis, Wageningen University, Wageningen, NL (2015) With references, with summaries in English and Dutch ISBN: 978-94-6257-435-9 Abstract Teeken B (2015).
    [Show full text]
  • 2 000 Tonnes Were Exported with Refunds
    ,661 9R O )22'$1'$*5,&8/785(25*$1,=$7,212) 7+(81,7('1$7,216 25*$1,6$7,21'(61$7,21681,(63285/·$/,0(17$7,21(7/·$*5,&8/785( 25*$1,=$&,Ð1'(/$61$&,21(681,'$63$5$/$$*5,&8/785$ </$$/,0(17$&,Ð1 5RPH5RPD 3KHQIAĠ KBPDA&JPANJ=PEKJ=H/E?A KIIEOOEKJ+ASOHAPPAN?KJP=EJO "JCHEODPATPKJHU1NEHEJCQ=HLNK@Q?PEKJSEHHNAOQIASEPD3KHQIA 1DA@AOECOBUJPOTFNQMPZFEBOEUIFQSFTFOUBUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPO QSPEVDUEPOPUJNQMZUIFFYQSFTTJPOPGBOZPQJOJPOXIBUTPFWFSPOUIFQBSU PGUIF'PPEBOE"HSJDVMUVSF0SHBOJ[BUJPOPGUIF6OJUFE/BUJPOTDPODFSOJOHUIF MFHBMPSEFWFMPQNFOUTUBUVTPGBOZDPVOUSZ UFSSJUPSZ DJUZPSBSFBPSPGJUTBVUIPSJUJFT PSDPODFSOJOHUIFEFMJNJUBUJPOPGJUTGSPOUJFSTPSCPVOEBSJFT "MMSJHIUTSFTFSWFE3FQSPEVDUJPOBOEEJTTFNJOBUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPO QSPEVDUGPSFEVDBUJPOBMPSPUIFSOPODPNNFSDJBMQVSQPTFTBSFBVUIPSJ[FEXJUIPVU BOZQSJPSXSJUUFOQFSNJTTJPOGSPNUIFDPQZSJHIUIPMEFSTQSPWJEFEUIFTPVSDFJTGVMMZ BDLOPXMFEHFE3FQSPEVDUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPOQSPEVDUGPSSFTBMFPSPUIFS DPNNFSDJBMQVSQPTFTJTQSPIJCJUFEXJUIPVUXSJUUFOQFSNJTTJPOPGUIFDPQZSJHIUIPMEFST "QQMJDBUJPOTGPSTVDIQFSNJTTJPOTIPVMECFBEESFTTFEUP $IJFG 1VCMJTIJOH.BOBHFNFOU4FSWJDF *OGPSNBUJPO%JWJTJPO '"0 7JBMFEFMMF5FSNFEJ$BSBDBMMB 3PNF *UBMZ PSCZFNBJMUP DPQZSJHIU!GBPPSH ¥'"0 Contents Technical Editor: PART I PART III Nguu Van Nguyen, AGPC, FAO, Rome. OVERVIEW RICE INTEGRATED CROP Editing, layout, desktop publishing and MANAGEMENT graphics: M. Solh Ruth Duffy, Rome. Rice is Life in 2004 and beyond 1 V. Balasubramanian, R. Rajendran, V. Ravi, N. Chellaiah, E. Castro, B. Chandrasekaran, C. Calpe T. Jayaraj and S. Ramanathan International trade
    [Show full text]