2 000 Tonnes Were Exported with Refunds - DocsLib

sign in sign up

<<

Home , Oryza glaberrima, Red rice

,661 9R O

)22'$1'$*5,&8/785(25*$1,=$7,212) 7+(81,7('1$7,216 25*$1,6$7,21'(61$7,21681,(63285/·$/,0(17$7,21(7/·$*5,&8/785( 25*$1,=$&,Ð1'(/$61$&,21(681,'$63$5$/$$*5,&8/785$

1DA@AOECOBUJPOTFNQMPZFEBOEUIFQSFTFOUBUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPO QSPEVDUEPOPUJNQMZUIFFYQSFTTJPOPGBOZPQJOJPOXIBUTPFWFSPOUIFQBSU PGUIF'PPEBOE"HSJDVMUVSF0SHBOJ[BUJPOPGUIF6OJUFE/BUJPOTDPODFSOJOHUIF MFHBMPSEFWFMPQNFOUTUBUVTPGBOZDPVOUSZ UFSSJUPSZ DJUZPSBSFBPSPGJUTBVUIPSJUJFT PSDPODFSOJOHUIFEFMJNJUBUJPOPGJUTGSPOUJFSTPSCPVOEBSJFT

"MMSJHIUTSFTFSWFE3FQSPEVDUJPOBOEEJTTFNJOBUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPO QSPEVDUGPSFEVDBUJPOBMPSPUIFSOPODPNNFSDJBMQVSQPTFTBSFBVUIPSJ[FEXJUIPVU BOZQSJPSXSJUUFOQFSNJTTJPOGSPNUIFDPQZSJHIUIPMEFSTQSPWJEFEUIFTPVSDFJTGVMMZ BDLOPXMFEHFE3FQSPEVDUJPOPGNBUFSJBMJOUIJTJOGPSNBUJPOQSPEVDUGPSSFTBMFPSPUIFS DPNNFSDJBMQVSQPTFTJTQSPIJCJUFEXJUIPVUXSJUUFOQFSNJTTJPOPGUIFDPQZSJHIUIPMEFST "QQMJDBUJPOTGPSTVDIQFSNJTTJPOTIPVMECFBEESFTTFEUP $IJFG 1VCMJTIJOH.BOBHFNFOU4FSWJDF *OGPSNBUJPO%JWJTJPO '"0 7JBMFEFMMF5FSNFEJ$BSBDBMMB 3PNF *UBMZ PSCZFNBJMUP DPQZSJHIU!GBPPSH

¥'"0 Contents

Technical Editor: PART I PART III Nguu Van Nguyen, AGPC, FAO, Rome. OVERVIEW RICE INTEGRATED CROP Editing, layout, desktop publishing and MANAGEMENT graphics: M. Solh Ruth Duffy, Rome. Rice is Life in 2004 and beyond 1 V. Balasubramanian, R. Rajendran, V. Ravi, N. Chellaiah, E. Castro, B. Chandrasekaran, C. Calpe T. Jayaraj and S. Ramanathan International trade in rice: recent Integrated crop management for The International Rice Commission (IRC), developments and prospects 11 enhancing yield, factor productivity which works within the framework of FAO, and profitability in Asian rice farms 63 was established on 4 January 1949 with the N.V. Nguyen object of promoting national and Global climate changes and rice food S. Abdulrachman, I. Las and I. Yuliardi international action in respect of production, security 24 Development and dissemination of conservation, distribution and consumption integrated crop management for of rice. Matters relating to trade are outside productive and efficient rice the purview of the Commission. PART II production in Indonesia 73 Membership of the Commission is open to all RICE GENETIC IMPROVEMENT FAO Member Nations and Associate AND UTILIZATION R.T. Cruz, G.P. Llanto, A.P. Castro, K.E.T. Members who accept the constitution of the Barroga, F.H. Bordey. E.D. Redoña and IRC. The present membership of the Y. Wang, C. Li, J. Zhou, X. He, B. Lu, L.S. Sebastian Commission is 61 and represents all the rice- H. Leung, T.W. Mew and Y. Zhu PalayCheck: the Philippines’ rice growing regions of the world. Genetic diversity for rice disease integrated crop management system 83 The Commission keeps under review the sustainable management 31 scientific, technical and economic problems T.S. Pham, K.Q. Trinh and D.V. Tran relating to rice, encourages and coordinates J. Sheehy, A. Elmido, G. Centeno and Integrated crop management for intensive research, organizes (where necessary) P. Pablico irrigated rice in the Mekong Delta of cooperative projects and reports to the Searching for new plants for climate Viet Nam 91 member countries and the Director-General of change 40 FAO on appropriate action to be taken in furthering its objectives. M. Sié, S.Y. Dogbe and M. Coulibaly PART IV Selection of interspecific hybrids INTERNATIONAL RICE COMMISSION’S (O. sativa × O. glaberrima) or lowland CORNER NERICAs and intraspecifics adapted to rainfed lowland growing conditions 47 N.V. Nguyen Follow-up to the implementation of C. Brondani, R.P.V. Brondani, T.C.O. Borba, the International Year of Rice 2004 97 T. Brunes, P.H.N. Rangel and E.P. Guimarães Microsatellite analysis of Tio Taka, the first rice commercial cultivar released from the recurrent selection breeding method 52 1 PART I OVERVIEW

Rice is Life in 2004 and beyond1

M. Solh Director, Plant Production and Protection Division, FAO, Rome, Italy Chairperson, Steering Committee of the International Rice Commission

In response to the request made during the 31st Session directly and indirectly, for food security, livelihood of the Conference of the Food and Agriculture improvement, cultural heritage and sustainable Organization of the United Nations (FAO), the United development for global peace. Nations General Assembly (UNGA), during its 57th Session in December 2002, approved the resolution Rice and food security submitted by the Government of the Philippines and co- At present, approximately 850 million people suffer from sponsored by 44 countries, declaring 2004 the undernourishment. Constant hunger stifles development International Year of Rice (IYR). The dedication of an through malnutrition and disease. The cycle of hunger International Year to a single crop is unprecedented in and poverty causes increasing susceptibility to illness and the history of UNGA. In declaring the International Year reduces a person’s capacity for work and concentration. of Rice 2004, UNGA noted that rice is the staple food of The end result is even greater poverty and hunger. Food more than half the world population and reaffirmed the security is essential in order to maintain a peaceful need to focus world attention on the role that rice can environment and in order to improve livelihoods. No one play in providing food security and eradicating poverty can feel content with an empty stomach. in the attainment of the internationally agreed Indeed, rice plays a vital role in the promotion of peace development goals, including those contained in the and harmony throughout the world. Rice is grown in United Nations Millennium Declaration. 113 countries and most of the rice produced is consumed The UN General Assembly invited FAO to facilitate directly as food. In 2001, more than 3 billion people the implementation of IYR, in collaboration with consumed as food 517.9 million tonnes of rice out of a governments, UN agencies, the international centres of total production of 580 million tonnes (i.e. 89.2 percent the Consultative Group on International Agricultural of total production). In the same year, wheat was the staple Research (CGIAR), other international institutions, non- food for under 1 billion people, while maize was the staple governmental organizations (NGOs), the private sector food for only 185 million people (Table 1). In South and and other stakeholders in rice development. I wish to share Southeast Asia, where more than 600 million people live with you the major aspects of Rice is Life, the issues and opportunities of sustainable rice production, the implementation of IYR during 2004, and FAO’s view on TABLE 1 World production and use of rice, wheat and maize in 2001 the development of sustainable rice production beyond 2004. Maize Wheat Rice (paddy) Total production (million tonnes) 629 591 580 RICE IS LIFE Food (million tonnes) 112 419 518 Rice is Life was selected as the slogan for the Year by the Population with per caput Informal International Working Group for IYR. The consumption of over 100 kg of 185 991 3 143 product per year (million people) theme of IYR – Rice is Life – comes from the understanding that rice-based systems are essential to everyone, Source: FAOSTAT.

1 Keynote Address presented at “Rice and Brussel Sprouts: A Celebration of the International Year of Rice in Brussels”, Brussels, 8 Dec. 2004. 2 PART I OVERVIEW

on less than US$1 a day, the poor in urban centres and Festival” is celebrated in a number of Asian countries landless people in rural areas – i.e. those who are very (e.g. China, Japan, Thailand and Viet Nam) to honour vulnerable regarding food security – normally devote the beginning of the rice season. Rice is a symbol of life, approximately half of their income to buying rice. During fertility and abundance and was considered divine by the last decade, rice has also become the most rapidly many emperors and kings in ancient times. Rice terraces growing food source in sub-Saharan Africa and as a result beautify landscapes; the terraces in Banawe, the the region has had to increase rice importation to satisfy Philippines have been declared a world cultural heritage demand. Rice importation has caused a heavy drain of site by UNESCO (UN Educational, Scientific and scarce foreign exchange in the region; The Africa Rice Cultural Organization). Center (WARDA) estimates that rice importation in 2001 Over the centuries, rice has shaped the culture and cost the region about US$1 billion (WARDA, 2002). dietary habits of its consumers. Almost every culture has its own way of eating rice and these different recipes are Rice, poverty alleviation and livelihood improvement part of the world’s cultural heritage. The different rice When all developing countries are considered together, varieties provide a wide range of flavours, even when rice provides 27 percent of dietary energy supply and simply boiled or steamed. Rice is traditionally coupled 20 percent of dietary protein intake. Rice cultivation is with fish, meat or legumes (e.g. beans, lentils and chick- the principal activity and source of income for millions peas), depending on the region in which it is consumed. of households in Asia, Africa and Latin America. Rice The combination of rice and fish in Asian countries has systems are hubs of biodiversity. Various kinds of generated the term “rice-fish societies”, while rice and livestock are supported by rice-based systems: ducks feed legumes characterize culinary tradition in various parts on small fish, other aquatic organisms and weeds within of the world, from Mexico to the Near East. Northern the paddy fields, while buffaloes, cattle, sheep and goats Italy is the home of the world-renowned “risotto”. graze on rice straw in rice-producing areas. Rice bran (a by-product of rice milling) and low-quality and surplus Rice and sustainable development rice grains provide feed supplementation for livestock. Thousands of years ago, people from East and South Asia For thousands of years, rural people in Asia have relied settled in river deltas and domesticated wild rice. The heavily on the existing biodiversity within rice-based productivity of wetland rice crops enabled population systems to secure their daily food supply and income. growth and led to the development of society and In addition, support services to rice-based systems, civilization. Rice-based systems in the deltas of major such as the production, servicing and maintenance of river systems – Yangtze, Yellow, Ganges, Mekong and tools, implements and equipment for land preparation, Nile – have supported the sustainable development and harvest and post-harvest operations, have created add- growth of society and civilization for thousands of years. itional sources of employment and income for millions Indeed, the population densities in these river deltas are of people around the world and provided the mechanism among the world’s highest. for industrial development in many countries. The drying, Rice has since travelled the world and is today cleaning, milling and trading of rice account for millions cultivated in 113 countries. Rice-based production of other jobs. In Asia, the transformation of rice grains systems span from 53° north latitude in the Heilongjiang into other food products (e.g. noodles, snacks, cakes, rice- Province of the People’s Republic of China, to 35° south bran oil, health drinks and beauty products) and the latitude in New South Wales, Australia; from the tropical trading of these products employ a large share of the total rain forest climate of the Democratic Republic of Congo labour force. Rice-based products also provide alternative to the continental temperate climate in Krasnodar, the food for enhancing people’s livelihoods. Russian Federation; from the arid desert climate in Egypt’s Nile Delta to the sea-level regions of Guinea- Rice and cultural heritage Bissau and to 2 600 m above sea level in the Himalayan Rice is a central part of many cultures and civilizations. mountain chains of Nepal. The relationship between rice and people has inspired Rice is the only cereal crop that can be grown under a songs, paintings, stories and other modes of communi- wide range of soil moisture regimes, from deep-flooded cation. For example, the well-known “Land Opening to dryland, and in different soil conditions. The majority 3 PART I OVERVIEW

of rice farmers are resource-poor men and women in uction has been less than rice consumption since 2000 developing countries, but a considerable number are also (Figure 1). The deficit has been addressed by drawing resource-rich and living in developed countries, such as on rice from buffer stock. As the world population grows, Japan, the Republic of Korea, Italy, the United States of innovative technologies and a renewed focus will become America, Argentina, Brazil and Uruguay. The size of a increasingly critical to ensure the sustainable development household rice farm ranges from a few thousand square of rice-based production systems. metres (e.g. in Cambodia, Rwanda or Viet Nam) to several hundred hectares (e.g. in Argentina or the United States Decline in growth rate of rice yield of America). At present, about 75 percent of global rice production The diversity of the regions, people and resources comes from irrigated rice ecosystems. As the population within rice-based systems, the biodiversity present in rice continues to grow, land and water resources for irrigated fields and the close relationship between rice and livestock rice production continue to diminish. It is therefore likely production in many regions, provide the best prism that any future increase in global rice production will through which the intricate and interdependent rela- depend greatly on an increase in rice yield or productivity. tionships between agriculture, culture, nutrition, environ- The growth rate of rice yield was very high during the mental resource management, biodiversity, economic 1970s and 1980s, but it has been declining rapidly since policies, science, gender and labour issues can be viewed. 1990 (Figure 2). The stagnation of the yield potential of high-yielding rice varieties is a major factor in this decline. ISSUES OF AND OPPORTUNITIES FOR SUSTAINABLE Also, the full yield potential of high-yielding rice varieties RICE PRODUCTION The fundamental objective of IYR 2004 is to promote FIGURE 1 World rice production and consumption, 1995–2004 the development of efficient and sustainable rice-based production systems and improve access to this vital food. 430 A full understanding and awareness of the issues and 410 technical opportunities of rice-based systems is essential in order to achieve this noble goal. 390 370 Issues 350 Diminishing gain from the Green Revolution During the 1950s, in response to the then imminent food 330 '95 '96 '97 '98 '99 '00 '01 '02 '03 '04* shortage in Asia, the International Rice Commission Production Consumption (IRC) implemented a project which focused on japonica × indica hybridization. This project marked the beginning * Forecast. of the campaign that led to the successful development Source: Calpe, 2004. of the first high-yielding variety – IR8 – at the Inter- FIGURE 2 national Rice Research Institute (IRRI) in 1966. The high- Average growth rate of rice yield, 1980–2000 yielding varieties and improved crop management practices developed by researcher systems, together with the 4 development of irrigation infrastructure and marketing 3.5 systems, led to the Green Revolution, and global rice 3 production increased steadily during the period from 1970 2.5 2 to 1999. The increase in rice production provided adequ- 1.5 ate rice for food security while at the same time creating 1 employment opportunities, increasing the incomes of rice 0.5 farmers and enhancing access to food for poor populations Growth rate (% per year) 0 living in urban centres across the world. 1981-85 1986-90 1991-95 1996-2000 However, the gains made during the Green Revolution have not been matched in recent years. World rice prod- Source: FAOSTAT. 4 PART I OVERVIEW

is rarely met because of the toll taken by pests and disease. Opportunities In fact, it is estimated that disease and insects cause annual Closing the yield gap yield losses of up to 25 percent (Khush, 2004). Fortunately, there are still a number of opportunities for global rice production to meet the increasing demand of Population concern for sustainable development and a growing population on a sustainable basis. For example, human nutrition the yield potential of high-yielding and hybrid rice Economically, the declining rice prices in the international varieties released for irrigated rice production in tropical markets since 1995 (Figure 3) have caused a sharp reduc- climate areas is still much higher than the yield obtained tion in the returns from rice production. This has been a by farmers (Figure 4). Closing the large yield gap in irrig- major cause of poverty and hardship for many small ated rice production could substantially increase rice prod- farmers in developing countries. The “low return/poverty” uction without further investment in land and water dev- cycle in turn affects the capacity of farmers to invest in elopment. In Australia, for example, rice production incr- production inputs, eventually leading to lower yield. eased steadily following the adoption of the RiceCheck In numerous countries, the intensification of rice system (Clampett, Nguyen and Tran, 2003). The initial production combined with inefficient pesticide appli- results of recent field tests carried out by the IRC and its cation has caused significant damage to agricultural member countries demonstrate that rice integrated crop biodiversity and environmental pollution. This has led in management (RICM) is effective – RiceCheck is a case turn to increasing public concern for environmental in point – for closing the yield gap. Farmers achieving conservation. As a result, a number of international five target values of the modified RiceCheck with five agreements have been made, including the Convention crop management areas obtained yield increases of on Biological Diversity and the Framework Convention 23 percent and benefits of 165 percent (Woodhead, 2003). on Climate Change. In Viet Nam, the application of Viet RiceCheck in direct- Many rice-consuming populations are afflicted with seeding rice resulted in seed saving of 50 percent and a protein-energy malnutrition, vitamin-A deficiency, and reduction in N rate of 20 percent (Tran, 2004), while in nutritional anaemia as a result of iron deficiency. There Brazil and Venezuela, farmers practising RICM increased is, therefore, increasing concern among member countries yield by 30 percent (Pulver, 2004). about the capacity of rice-based systems to produce sufficient quantity for food security, human nutrition and Development and use of hybrid rice and NERICA (New livelihood improvement. Rice for Africa) The first commercial cultivation of hybrid rice took place in China in 1976. Three-line hybrid varieties yield at least 15 percent more than high-yielding varieties (Yuan, 1999; Tran and Nguyen, 1998). Super hybrid varieties yielding FIGURE 3 FAO export price index for rice at least 20 percent more than three-line hybrid varieties were released recently (Yuan, 2004). The wide adoption 1998-2000 = 100 of hybrid rice led to the steady increase of rice production 140 from 128 million tonnes in 1975 to 189 million tonnes in 2000 (FAOSTAT), with about 6 million ha saved for 120 diversification in order to increase farmers’ income (Table 2). The experience gained by the IRC since 1990 100 also indicates that the yield and production of rice in Asian countries outside China can be substantially increased 80 with the adoption of hybrid rice.

60 Similarly, the recently developed NERICA (New Rice for Africa) rice varieties are promising to raise rice yield 40 and production in sub-Saharan Africa, where upland rice 1990 1992 1994 1996 1998 2000 2002 2004 is dominant. NERICA varieties are the product of the Source: FAOSTAT. crossing between Oryza sativa and O. glaberrima carried 5 PART I OVERVIEW

FIGURE 4 Yield gap in irrigated rice production: tropical climate (left); temperate climate (right)

TROPICAL CLIMATE SUB-TROPICAL CLIMATE

Hybrid

15 Hybrid High- yielding 12 High- yielding 14 Best farmer 10 Best farmer 9-10

7-8 Average Average farmer farmer 6-7 4-5

tonnes/ha tonnes/ha

TABLE 2 Advances in rice biotechnology Rice harvested area, yield and production in China, 1965–2000 The successful mapping of the rice genome sequence offers still further opportunities to identify and charac- Harvested area Yield Production terize the genes and biochemical pathways that are (ha) (kg/ha) (tonnes) responsible for increasing rice yield, strengthening 1965 30 574 546 2 967 90 705 628 1970 33 107 861 3 416 113 101 872 resistance to biotic and abiotic stress and improving rice 1975 36 483 983 3 528 128 726 268 quality for consumer preference. Research is currently 1980 34 482 478 4 144 142 876 522 1985 32 633 684 5 250 171 318 871 underway to improve the yield potential of rice by incor- 1990 33 518 971 5 717 191 614 680 porating the genes from maize to alter the photosynthesis 1995 31 107 479 6 021 187 297 968 2000 30 301 490 6 264 189 814 060 of rice from a C3 to a C4 pathway. Wild species of rice are a rich source of genes for Source: FAOSTAT. resistance breeding and yield enhancement. For example, using biotechnology, genes that resist blast and bacterial out at WARDA (Jones and Wopereis, 2001). The first blight have been transferred from O. minuta to improve released varieties are early maturing and are suitable for the rice germplasm. When genes can be tagged by tight upland ecosystems in West Africa. The short duration of linkage with molecular markers, time and money can be NERICA varieties, in addition to their good yield potential saved in transferring these genes from one varietal and other traits, could help upland rice production in the background to another. Molecular marker assisted breed- region to escape drought stress (the result of the short ing (MAS) has also been employed to move genes from and variable rainy season). The short growth duration pyramided lines into new plant type (NPT) (Sanchez et would also facilitate the introduction and adoption of rice- al., 2000). Protocols for rice transformation have been based systems, such as rice-grain-legume and rice-cover developed which allow the transfer of foreign genes from crops, to stabilize the fragile soil fertility of the region’s diverse biological systems into rice. Bt genes have been upland ecosystems (Nguyen, 2003). introduced to rice for resistance to yellow stem borer. 6 PART I OVERVIEW

Similarly, the ots A and ots B genes for trehalose biosynth- press releases, posters and the IYR official Web site esis were introduced to rice to enhance tolerance to abiotic (available at www.rice2004.org). On 31 October 2003, stresses such as drought and salinity. This new technology the Director-General of FAO officially launched the Year has already led to the development of a genetically and conveyed the importance of sustainable rice-based modified rice – commonly called “Golden Rice”: the high development to the members and delegates of the content of beta-carotene (the precursor of Vitamin A) Economic and Social Council (ECOSOC) of the United enhances its nutritional value (Khush, 2004). Nations in New York.

IMPLEMENTATION OF IYR DURING 2004 Major global events for IYR The strategy of the implementation of IYR is to engage A series of meetings, conferences, symposia and the global community by establishing mutually beneficial workshops on rice and rice-based production systems activities, including: information generation and exch- have been organized by national, regional and ange, transfer of improved production technology and international institutions and organizations around the capacity-building through education and extension, and globe. Among them, the FAO Conference on Rice in adoption of policy and regulatory frameworks that are Global Markets and Sustainable Production Systems, conducive to the development of productive and environ- which took place in Rome, Italy from 12 to 13 February mentally friendly rice-based systems. By increasing global 2004, was a major event. The conference was attended awareness and promoting the importance of rice dev- by over 600 senior officers, including ministers and elopment, immediate and long-term integrated action is deputy ministers from over 100 countries, as well as heads expected to enhance global food security and poverty and senior officers from UN agencies, CGIAR centres, alleviation. NGOs and the private sector. In November 2004, the Government of Japan organized the World Rice Research FAO Secretariat and the Informal International Working Conference to provide an opportunity for promoting Group cooperation among stakeholders. Thanks to the exchange In January 2003, FAO established an international that is facilitated through such opportunities, steps can Organizing Committee for IYR by expanding the memberships of the Steering Committee of the Inter- national Rice Commission to cover 15 technical services from six departments within FAO Headquarters. In March 2003, FAO convened a meeting attended by: repre- BOX 1 sentatives from 17 major rice-producing and consuming Membership of the Informal International countries; UN agencies, such as IFAD (International Fund Working Group for the implementation of the for Agricultural Development), UNDP (United Nations International Year of Rice 2004 Development Programme), UNEP (United Nations Environment Programme), UNICEF (United Nations Nations: Australia, Brazil, China, Egypt, France Children’s Fund) and UNESCO; CGIAR centres, (CIRAD), India, Indonesia, Italy, Japan, Republic of including CIAT (International Centre for Tropical Korea, Madagascar, Nigeria, Peru, Philippines, Agriculture), IRRI (International Rice Research Institute) Thailand, United States of America, Viet Nam, European Union and WARDA; and representatives from NGOs and the private sector to discuss the implementation of IYR. The UN Organizations: FAO, UNDP, UNEP, UNESCO, meeting established an Informal International Working UNICEF, IFAD Group (IIWG) for IYR (Box 1). CGIAR centres: IRRI, WARDA, CIAT, IFPRI, IPGRI Under the guidance of the IIWG, the Secretariat for IYR was established at FAO to facilitate the GFAR (Global Forum on Agricultural Research) implementation of IYR 2004 at national, regional and NGO: IFAP global level, and to prepare key documents and facilities for IYR implementation, such as the Concept Paper, the Private sector: IAFN IYR Logo, the International Rice Calendar, fact sheets, 7 PART I OVERVIEW

be taken to achieve global food security and to improve SUSTAINABLE RICE PRODUCTION BEYOND 2004 the livelihood of each and every member of the world The implementation of the International Year of Rice will population. only be meaningful and successful when more rice is A month-long exhibit on Rice is Life was organized at available, accessible and affordable to the poor population FAO Headquarters with contributions from Italy, the in both urban centres and rural areas around the globe, Philippines, Switzerland, Thailand and IRRI. FAO and while the incomes of rice farmers increase in a sustainable its partners in the Informal International Working Group, manner. Therefore, FAO and its partners envision that in particular IRRI, organized two global contests – the the implementation of the International Year of Rice will IYR Scientific Research Paper Contest and the IYR be much more than a 1-year effort ending in December Photography Contest – to enhance the global community’s 2004. participation in and commitment to the implementation The lessons learnt during the Green Revolution in the of IYR. The winners of both contests were honoured at a 1970s and 1980s and recently in a number of countries special event held in conjunction with World Food Day (in particular China and Viet Nam) demonstrate that on 15 October 2004. An exhibition was also held during global rice production can meet the demand of the World Food Day with a display of prize-winning increasing population provided that it receives commit- photographs and a selection of other entries to further ment and support from all stakeholders: from government heighten awareness. policy-makers to researchers and scientists, extension officers, farmers and civil societies. However, the changes Major national and regional events for IYR in the environment of rice production and its agro- Supporting national rice activities, however, was ecosystems necessitate the reorientation and refocusing representative of FAO’s central strategy for the of the efforts made by all stakeholders for the effective implementation of IYR. National organizing committees promotion of the development of efficient and sustainable were operational, implementing IYR initiatives in rice-based production systems and the improvement of 40 countries: 10 in sub-Saharan Africa, 16 in Asia and access to this vital food. the Pacific, 8 in Latin America, 3 in the Near East and 3 in Europe and North America. New orientations and focuses for sustainable rice The IYR Secretariat actively supported national production organizing committees, providing numerous documents The battle against hunger and poverty does not end when – e.g. technical books and manuals on rice, fact sheets, bellies are full, but when they are nourished. It is necessary posters and the Concept Paper – as well as the 4-minute to look to science and new technologies to confront the video on the International Year of Rice 2004. The FAO need for added value of this staple crop. In addition to IYR Secretariat also assisted in the preparation and treating rice as a staple, it is important to focus on its presentation of the implementation of IYR at the five FAO value as a speciality food, a food that is treasured in Regional Conferences of the Ministers in 2004 and the developed and developing economies alike. It is also ASEAN (Association of Southeast-Asian Nations) important to increase the focus on the rice plant within Summit in March 2004, during which the heads of ten its ecosystem. The rice system is a hub of biodiversity ASEAN countries, and of the People’s Republic of China, that can be harnessed to improve rural diets and liveli- Japan and the Republic of Korea, signed the IYR Poster. hoods in an ecologically sustainable way. It is time to In September, the Pan-African Celebration of IYR took consider the rice system with vision. The aspects outlined place in Accra, Ghana, attended by ministers from five below need to be considered by all stakeholders, esp- countries in sub-Saharan Africa; it was on this occasion ecially policy-makers. that Dr Jones Monty, the 2004 Laureate of the World Food Prize, was honoured. Members of the Secretariat also Integration of rice production into national economic offered their services at conferences, symposia and development workshops organized by national, regional and inter- In many developing countries in Asia, rice still plays a national institutions to celebrate IYR. You are invited to vital role in the livelihood of the low-income population. visit the IYR official Web site at www.rice2004.org for During the Green Revolution, many countries established further information. policies to encourage self-sufficiency in rice by investing 8 PART I OVERVIEW

in the development of irrigation infrastructures and especially with regard to global warming in observation providing subsidies to production inputs (seeds, of the Kyoto Protocol. fertilizers, pesticides etc.) in order to increase domestic Given the increasing scarcity of fresh water and the rice production. In Asia, some countries also established phenomenon of global warming, rice varieties requiring guaranteed prices in order to stabilize domestic production less water, with good tolerance to drought and salinity, and the market, while in other countries subvention and and able to maintain high productivity under a high night- support for the purchase of rice were provided to the poor temperature regime, are essential for sustainable rice for food security. The cost of these programmes, however, production. The development of rice varieties with better has become high and may become unbearable especially grain quality, on the other hand, would promote rice under pressure from WTO (World Trade Organization). consumption in the developed countries, thus widening Moreover, in some countries, while national rice prod- the market for rice farmers. uction exceeds demand (e.g. in China, India and Viet Nam), rice shortages remain prevalent in some localities Partnership expansion and regions within the same country due to poor The fundamental challenge associated with rice prod- distribution systems and policies restricting rice marketing uction is this: the crop is so necessary that what often and trading. Policies that promote the integration of rice happens is that it is simply taken for granted. Rice does production into the national economy through enhanced not receive the high level of attention that so many other distribution and marketing systems will play an important crops receive, yet its importance is indisputable. Trad- role in securing food security for all, even in remote areas itionally, rice research and development has been or areas where agro-ecological conditions are not dominated by the public sector, but recently non- favourable to rice production. governmental organizations and the private sector have begun to actively invest in these areas. Policies that Development and dissemination of rice technologies support the expanding and widening partnerships among Policy support for the development and use of hybrid the public sector, NGOs and the private sector will be rice technology outside China could bring about an important for rice production in the future. This calls for immediate increase in rice yield and production. In sub- the increased harmonization of national, regional and Saharan Africa, investment in the development of inland international efforts aimed at the improvement of the valley swamps for rice-based production systems using productivity and efficiency of rice-based systems at all low-cost technologies, coupled with the dissemination levels. of NERICA rice in upland systems, creates potential for attaining rice self-sufficiency in the region. Most of the FAO rice programme beyond 2004 24 million ha of wetlands in tropical sub-Saharan Africa Rice has always been a major concern at FAO. The FAO are suitable for rice production (Andriesse, 1986). International Rice Commission (IRC) was established in However, today fewer than 1 million ha have been 1949 to promote cooperative action in matters related to developed to support rice-based production systems rice production, conservation, distribution and consump- (Nguyen, 2003). tion. The implementation of IYR in 2004 generated The experiences gained in recent years indicate that considerable support. The Italian Government provided policies supporting the enhancement of farmers’ know- initial funding support within the framework of the project ledge in rice production – for example, the dissemination GCP/INT/933/ITA, “Promoting, Coordinating and of rice integrated crop management systems such as Rice Implementing Observance of the International Year of Check and improved rice varieties – have helped to Rice – 2004”. The Government of Japan contributed an increase rice production in a sustainable manner, while Associate Professional Officer to assist in the coordination reducing production costs and improving the returns from of regional rice activities, conferences and seminars and rice production. Efficient input application would enhance approved funding support for the dissemination of farmers’ knowledge and help promote biodiversity in rice- NERICA and improved rice technologies in Ghana and based systems for human nutrition improvement and Sierra Leone. As requested by member countries, the IYR income generation, while at the same time reducing the Secretariat developed two regional Technical Cooperation negative effects of rice production on the environment, Projects to help transfer specific technological 9 PART I OVERVIEW

innovations and promote capacity-building for improved needed in order to translate the achievement gained rice production in member countries. through the implementation of IYR into concrete Beyond 2004, the FAO Secretariat of the IRC will programmes and projects on sustainable rice development strengthen its capacity and assist member countries in in rural communities for food security and poverty the formulation and implementation of programmes and alleviation. The International Rice Commission will be projects to help transfer specific technological ready to assist in the harmonization of efforts towards innovations. The FAO Secretariat of the IRC will also the development of efficient and sustainable rice-based continue to assist in capacity-building for the sustainable production systems and the improvement of access to this development of and increase in rice production for food vital food. security and poverty alleviation in member countries. In the immediate future (2005–06), the IRC will undertake REFERENCES the following major activities: Andriesse, W. 1986. Wetlands in Sub-Saharan Africa. • Publication of a book, Rice is Life, to further raise Proceedings International Conference on Soil and the awareness of all stakeholders of the role of rice Climate Resources and Constraints in Relation to Food in food security, livelihood improvement and Crop Production in West Africa, IITA, Ibadan, Nigeria, sustainable production, and using the winning 4–8 Nov. 1985. photographs in the IYR Global Contest to enhance Calpe, C. 2004. Rice market outlook. Paper presented at the message. the FAO Rice Conference, Rome, 12–13 Feb. 2004. • Preparation and submission of the report on the Clampett, W.S., Nguyen, V.N. & Tran, D.V. 2003. The implementation of IYR in 2004 to the UN General development and use of Integrated Crop Management Assembly with recommendations on action to be for rice production. In Proceedings 20th Session of the taken. International Rice Commission, Bangkok, 23–26 July • Organization of a Consultation Workshop on Rice 2002, p. 135–144. Rome, FAO. Integrated Crop Management Systems in February FAOSTAT. FAO statistical database (available at 2005 in collaboration with the Ministry of www.fao.org). Agriculture and Rural Development of Viet Nam Jones, M. & Wopereis, M.P. 2001. History of NERICA in order to review the progress made and to and PVS. Paper presented at the International Workshop formulate guidelines for the effective development on NERICA-based Food Security in Sub-Saharan Africa, and dissemination of rice integrated crop Mbe, Côte d’Ivoire, 9–12 April 2001. management systems for rice production. Khush, G.S. 2004. Harnessing science and technology for • Organization of the 21st Session of the Commission sustainable rice-based production systems. Keynote in 2006 in collaboration with the Ministry of address presented at the FAO Rice Conference, Rome, Agriculture of Peru to provide member countries 12–13 Feb. 2004. with an opportunity to review the implementation Nguyen, V.N. 2003. Recent development in rice production of IYR and examine the issues and opportunities of in Sub-Saharan Africa and the dissemination of NERICA. sustainable rice production for reorientation of their Paper presented at the FAO-Japanese Nihon University national rice development programmes. Symposium on Food Security in Africa, Nihon University, • Provision of technical guidance and support for the Fujisawa, Japan, 6 Oct. 2003. implementation of 17 projects on rice and rice-based Pulver, E.L. 2004. Summary of CFC project in Brazil and systems in member countries. Venezuela. Sanchez, A.C., Brar, D.S., Huang, N., Li, Z. & Khush, CONCLUSION G.S. 2000. STS marker-assisted selection for three The International Year of Rice 2004 is a powerful bacterial blight resistance genes in rice. Crop Sci., 40: opportunity for the world community to implement global 792–797. initiatives, including the Millennium Goals and the Tran, D.V. 2004. Back-to-office report of mission to Viet recommendations of the World Food Summit. Continued Nam. support from policy-makers at national, regional and Tran, D.V. & Nguyen, V.N. 1998. Global hybrid rice: global level as well as from the donor community is still Progress, issues, and challenges. IRC Newsl., 47: 16–28. 10 PART I OVERVIEW

WARDA. 2002. Participatory varietal selection: beyond the flame. Côte d’Ivoire, WARDA. 75 pp. Woodhead, T. 2003. Report of mission to Indonesia. Yuan, L.P. 1999. Hybrid rice development and use: Innovative approach and challenges. In Proceedings 19th Session of the International Rice Commission, Cairo, 7– 9 Sept. 1998, p. 77–85. Rome, FAO. Yuan, L.P. 2004. Hybrid rice technology for food security in the world. Keynote address presented at the FAO Rice Conference, Rome, 12–13 Feb. 2004. 11 PART I OVERVIEW

International trade in rice: recent developments and prospects

C. Calpe Senior Commodity Specialist Basic Foodstuffs Service, FAO, Rome, Italy

The international rice market was dominated by two major a number of countries, although in the 1990s several tendencies in the 1990s: first, a sharp rise in volume and countries liberalized imports and allowed the private second, a continued slide of international prices, both in sector to engage in rice trade. Rice has also been assigned real terms and relative to the other major cereals. In spite very high bound tariffs (although applied tariffs are often of the changes which have taken place, the international well below those ceilings) and special safeguard prov- rice market continues to be regarded as “highly distorted”, isions under the 1994 WTO (World Trade Organization) “segmented”, “thin” and “volatile”. This paper reviews agreement. the factors underlying each of these attributes and In several high-income countries, the rice sector has discusses whether they continue to give a good represen- been isolated from external competition through high tation of the current world rice market. border protection: outright import prohibitions, state trading monopolies, minimum import quotas, high tariffs INTERNATIONAL RICE TRADE – DISTORTED? or variable duties. Rice in such countries is also subject Given that rice is a lifeline for many poor farmers and to export subsidies, credit guarantees and food aid. Since also a major food staple for large segments of the 1995, domestic support to rice producers has been population, governments in many developing countries increasingly channelled through direct payments actively intervene to stabilize domestic prices and promote classified as production-neutral (“green box”) or as self-sufficiency. High degrees of external protection have minimally distorting (“blue box”), while direct price also been established in a number of higher-income support has been cut back. These instruments have been countries, to preserve producers’ incomes and the environ- used extensively and, as a result, according to OECD mental benefits arising from rice cultivation. (Organisation for Economic Co-operation and Develop- In many developing countries, rice self-sufficiency ment) estimates of producer support, rice appears as one objectives continue to be pursued as a means to achieving of the most protected agricultural commodities. food security. As a result, trade in rice largely remains a There have been, however, several instances of trade residual option, and it is not infrequent to see nations liberalization over the 1990s which have tended to make shifting from being a net importer to a net exporter, rice markets more open to foreign competition. depending on the outcome of their paddy season. To protect producers and consumers from large price On the import side:1 fluctuations, a number of governments intervene to • After liberalizing rice imports in May 1988, Brazil stabilize their market, either through changes in border started reducing tariffs in 1990. measures or through government procurement prog- • Nigeria lifted its rice import ban in 1994 and rammes at minimum prices and management of govern- imposed ad valorem tariffs. Since then, these have ment-owned rice stocks. Concerns over scarcity of supplies have often led to the imposition of rice export limitations, including export bans, ceilings, taxes and 1 In 2001–03, the top rice importers were Indonesia, Nigeria, Iraq, the minimum prices. On the other hand, rice imports are still Philippines, Bangladesh, Saudi Arabia, Iran (Islamic Republic of), Brazil, Democratic People’s Republic of Korea, Côte d’Ivoire, Senegal and under the sole responsibility of state trading agencies in South Africa. 12 PART I OVERVIEW

varied from 50 to 100 percent. The country has the level of procurement prices – a mechanism that recently imposed minimum import prices for tariff appears to have boosted rice imports. The EU, which calculation purposes, depending on the product already gets about 40 percent of its total purchases origin. under preferential rate quotas, launched the • Senegal eliminated the requirement for prior Everything but Arms Initiative (EBA) in 2001, authorization to import rice in 1992 and liberalized granting relatively low duty-free access to rice from domestic prices in 1995. least developed countries until 2008 and unlimited • In 2000, members of the West Africa Economic and access thereafter. In 2004, a new EU rice policy Monetary Union (UEMOA)2 started applying a regime was put in place, cutting procurement prices common external tariff of 10 percent on milled rice by half. On a provisional basis, the EU lowered imports. import tariffs on husked and milled rice as of • Bangladesh liberalized the rice trade in 1994. Since 1 September 2004 – a move likely to erode the value then, rice has been mainly imported by the private of preferential access to the EU market, EBA sector, resulting in much higher rice deliveries to included. the country. • Upon accessing WTO in 2001, China committed to • In 1995, Sri Lanka abolished the import licensing allowing large imports of rice at a low tariff system and replaced it with a tariff rate (initially (1 percent). The preferential access quota was 35 percent). originally set at 3.99 million tonnes (rising to • Japan and the Republic of Korea opened their 5.3 million tonnes by 2004), with half reserved to markets to rice under a minimum access quota in government agencies and half to the private sector. 1995. Taiwan Province of China also resorted to However, actual imports fell well short of the quota, the special WTO provision upon joining WTO in despite a contraction in production since 2000. Only 2002. In 1999, Japan opted for tariffication of trade in 2004 was there an import surge, in reaction to barriers and imposed very high specific tariffs of rising domestic prices. The Government reacted by US$2 900 per tonne. (Imports of rice to the three re-introducing incentives to raise production, with destinations have risen since the implementation of a substantial increase in output anticipated in 2004. these reforms, but as rice stocks have accumulated, • Although the Philippines allows farmers to import Japan and the Republic of Korea have also stepped limited amounts of rice, rice trade remains under up their exports of rice under food aid programmes.) tight government control and imports are mostly • In 1999, Indonesia put an end to Bulog’s import carried out by the government state agency. monopoly and let the private sector import high- quality rice subject to tariffs. In 2000, the quality On the export side:3 import limitation was lifted and a specific tariff of • In 1994, India lifted the ban on exports of ordinary Rp430 (about US$53) per tonne applied. (The (non-Basmati) rice. In 2001, it started conceding country was a major rice importer in the late 1990s, subsidies on non-Basmati rice exports and the as a consequence of several production shocks – in country was propelled to the position of second particular, El Niño in 1997, which led to imports of largest exporter in 2002 and 2003. a massive 6 million tonnes in 1998 and 4 million • Exports of rice from Viet Nam are mainly under the tonnes in 1999. However, in 2004, the country responsibility of state trading companies, although banned imports following a bumper harvest.) private traders have been allowed to participate since • In 1995, under the Blair House Agreement, the 1998. Exports are controlled though the release of European Union (EU) introduced the “margin of licences. In periods of tight supply, the Government preference” for import duty calculation, linking the tends to impose quantitative limitations and duty applied on husked and milled rice imports to minimum sale prices on exports. On the other hand,

2 Benin, Burkina Faso, Côte d’Ivoire, Guinea-Bissau, Mali, Niger, Senegal 3 Leading rice exporters are Thailand, India, Viet Nam, the United States and Togo. of America, China, Pakistan, Uruguay, Myanmar, Egypt, Japan and Australia. 13 PART I OVERVIEW

in the late 1990s and early 2000s, against the • The EU committed to reducing export subsidies on backdrop of low world prices, official support to rice under the WTO Agreement. In 2000, about finding markets was granted, especially through 132 000 tonnes were exported with refunds. government-to-government deals, often with credits • Large food aid shipments have been made by the exceeding 2 years. United States of America and Japan in recent years. • Pakistan fully privatized exports in 1996. In 2000, Food aid deliveries represent about 5 percent of it also eliminated the minimum export prices for global trade flows. IRRI (International Rice Research Institute) rice. • Pakistan, Uruguay and Australia maintain fairly • Myanmar liberalized rice exports in 2003, but as market-oriented and open trade policies. However, this resulted in a domestic price spree, it banned drought problems constrained the size of their rice exports in 2004. The country’s exports were exports in 2002 and 2003. erratic during the 1990s. • China’s rice exports remained under the TRENDS AND CHARACTERISTICS OF THE WORLD responsibility of the Government. Following a series RICE MARKET of bumper crops in the mid-1990s, the country Rising volumes of trade adopted less expansionary production rice policies The volume of the international rice trade is traditionally and fostered large sales abroad (mainly of low- small, both relative to production and when compared quality rice to Africa) so as to free government with the other major cereals. Trade rose from some storage space. This stance changed radically in 2004, 7 million tonnes in 1961 to more than 28 million tonnes when domestic prices began to soar, and the in 2003 (i.e. a rate of about 3 percent per year and not Government moved back to supportive production markedly different from the growth in the wheat and policies. maize trade). During this period, the expansion in the

FIGURE 1 Trends in global cereal trade

million tonnes 160

140

Wheat: y = 48.147e0.0269t 120

100

Maize: y = 24.223e0.0351t 80

60

40

Rice: y = 6.0645e0.0321t 20

0 1961 1963 1965 1967 1969 1971 1973 1975 1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001 2003 14 PART I OVERVIEW

rice trade was far from steady, growing at a rate of just Nam, the United States of America, Pakistan and China. 2 percent between 1961 and 1989, compared to 6 percent As a result, there has been little change to the make-up from 1990 onwards. of the ten major exporters since the 1980s, although their However, the international rice market remains small relative position does continue to change. In particular, relative to that of the other major cereals, with an average during the period from 2000 to 2003, India became the of 27 million tonnes in 2000–03, i.e. about one-quarter second major source of supplies after Thailand, while it of the volume traded in wheat and a little over one-third ranked fourth among exporters in the 1990s and a mere of the trade in maize. sixth in the 1980s. The export surge witnessed in India during the 1990s and early 2000s was prompted by Geographical concentration of the rice trade changes in policy; particularly worthy of note are the The expansion of the global rice trade from 1980 onwards relaxation of the ban on ordinary (non-Basmati) rice has been driven mainly by growing shipments from the exports in 1994 and the concession of export subsidies traditional exporting countries, in particular Thailand, Viet between 2001 and 2003. Viet Nam has also made consid-

TABLE 1 Top ten rice exporting countries

1980–89 1990–99 2000–03 Major exporters ‘000 Share Major exporters ‘000 Share Major exporters ‘000 Share tonnes (%) tonnes (%) tonnes (%) World 11 734 100 World 19 062 100 World 26 837 100 Thailand 4 237 36 Thailand 5 398 28 Thailand 7 907 29 United States of 2 434 21 Viet Nam 2 697 14 India 3 935 15 America Pakistan 1 025 9 United States of 2 641 14 Viet Nam 3 650 14 America China 710 6 India 2 122 11 United States of 3 243 12 America Myanmar 482 4 Pakistan 1 615 8 China 1 957 7 India 405 3 China 1 525 8 Pakistan 1 931 7 Australia 388 3 Australia 541 3 Uruguay 707 3 EC 12 369 3 Uruguay 478 3 Egypt 627 2 Viet Nam 364 3 Argentina 318 2 Myanmar 553 2 Uruguay 214 2 EC 12 263 1 Japan 469 2

TABLE 2 Top ten rice importing countries

1980–89 1990–99 2000–03 Major importers ‘000 Share Major importers ‘000 Share Major importers ‘000 Share tonnes (%) tonnes (%) tonnes (%) World 11 842 100 World 18 816 100 World 26 707 100 Asia 5 760 49 Asia 9 724 52 Asia 12 692 48 Africa 3 035 26 Africa 4 243 23 Africa 8 194 31 Iran (Islamic 674 6 Indonesia 1 769 9 Indonesia 2 255 8 Republic of EC 12 664 6 Iran (Islamic 895 5 Nigeria 1 710 6 Republic of) Saudi Arabia 520 4 Brazil 858 5 Iraq 1 100 4 Indonesia 510 4 Saudi Arabia 840 4 Philippines 1 010 4 Iraq 506 4 Bangladesh 693 4 Bangladesh 841 3 Nigeria 419 4 EC 12 625 3 Saudi Arabia 806 3 Senegal 357 3 Philippines 602 3 Côte d'Ivoire 769 3 Côte d'Ivoire 352 3 Japan 553 3 Brazil 747 3 China, Hong Kong 348 3 Nigeria 534 3 Democratic 743 3 People’s Republic of Korea Malaysia 320 3 Iraq 517 3 EC 12 738 3 15 PART I OVERVIEW

TABLE 3 Structure of rice trade

1992–1994 2001–2003 Quantity Share Quantity Share (‘000 tonnes) (%) (‘000 tonnes) (%) Total trade 15 263 26 818 Variety: Indica 11 663 76 20 068 75 Japonica 2 132 14 3 186 12 Aromatic2 1 353 9 3 322 12 Glutinous 115 1 242 1 Quality: High quality 11 781 77 20 226 75 Low quality 3 482 23 6 592 25 Degree of processing (forms): Paddy 263 2 1 122 4 Husked 508 3 1 077 4 Milled 12 559 82 20 639 77 Parboiled 1 934 13 3 980 15

erable inroads, and during the 1990s it positioned itself Changes in the structure of the international rice as the second most important source of external rice market supplies. Rice is not a uniform commodity and consumer prefer- Thus, overall, the supply side of the international rice ences for specific types and qualities are often entrenched, market remained highly concentrated, with the four which limits the scope for substitution. Market fragmen- leading exporting countries (Thailand, India, Viet Nam tation has thwarted the establishment of internationally and the United States of America) shipping 66 percent recognized grades or standards and delayed the establish- of aggregate trade flows in the early 2000s, while the top ment of futures markets. At present, there are more than ten exporters supplied more than 90 percent of the total. 50 different published international price quotations for Viewed from the demand side, much of the expansion rice. of the global rice trade was on account of Asian and The international rice market can be broken down into African countries. Deliveries to countries in the Near East several submarkets, depending on a minimum of three and Central America and the Caribbean also increased criteria: greatly. The growth witnessed in the 1990s was facilitated 1. There are four distinct rice varieties: indica (long- by reductions in border protection, as several countries grain), japonica (medium-grain, sticky and humid liberalized their trade policies. However, it also reflected when cooked), aromatic (long-grain, scented)4 and a number of production setbacks, as was the case for glutinous. Indonesia, which imported exceptionally high volumes 2. Varieties can be further distinguished according to in 1997 and 1998, in the wake of an El Niño weather the quality of grain, measured, for example, by the anomaly. percentage of brokens and impurities or by the Despite the relatively stable demand for rice in colour and chalkiness of the grain. To distinguish countries in Africa and the Near East (in particular higher from lower qualities, FAO uses an arbitrary Nigeria, Côte d’Ivoire, South Africa, Iraq and Saudi benchmark: rice containing less than 20 percent of Arabia), the rice market continues to be highly fragmented broken rice is classified as “higher quality” and rice and – in contrast with the export situation – the geog- containing 20 percent or more brokens is “lower raphical concentration of rice imports remains weak; quality”. indeed, the ten major importers are responsible for only 40 percent of global trade. 4 Aromatic rice includes fragrant indica rice varieties produced by Thailand as well as Basmati rice exported by India and Pakistan. 16 PART I OVERVIEW

3. The degree of processing constitutes another of lower-quality and parboiled rice has expanded faster criterion for segmentation of the rice market, with – a reflection of strong import demand by countries in rice traded in the form of paddy, husked, milled or western African (e.g. Senegal, Côte d’Ivoire and Nigeria) parboiled rice. and Southeast Asia (Indonesia and the Philippines). The growing importance of aromatic rice varieties in FAO has recently re-examined the structure of the world global trade reflects brisk imports to the European Union rice trade, relying mostly on the trade-by-destination (mainly Basmati rice which enters the Community under statistics of the major exporting countries. preferential access conditions), the United States of The major changes in the structure of the market America, Canada and Australia. However, it has also been between 1992–94 and 2001–03 are as follows: associated with large deliveries of Hom Mali (a fragrant • Indica rice maintained its leading position among rice variety from Thailand) with a high percentage of the various traded varieties, accounting for brokens to countries in Africa, in particular Côte d’Ivoire, 75 percent of the market, slightly down from the Ghana and Senegal. early 1990s. Aromatic rice gained an increasing On the other hand, high levels of protection have share of the market, with 12 percent of the total in limited the growth of imports to japonica markets such 2000–03 (up from 9 percent in the early 1990s). This as Japan, the Republic of Korea, the European Union advancement was at the expense of japonica rice, and Turkey. which accounted for only 12 percent of the global Import tariff structures that favour the entry of the market in 2001–03 (i.e. down from 14 percent a product in its lower-processed forms have also boosted decade earlier). trade in paddy rice, in particular to Latin America and • Lower-quality rice made greater inroads in trade the Caribbean. In this respect, it is noteworthy that, also than higher-quality rice, and now accounts for on the export side, paddy rice is often subject to 25 percent of total trade. Nonetheless, rice flows restrictions (or even bans), although recently there has continue to consist mainly of high-quality rice (less been removal of such restrictions (in India, for example). than 20 percent brokens), accounting for 75 percent Tariff escalation on rice imports and restrictions on paddy of the total. rice exports pursue the same objective of protecting • The bulk of rice flowing internationally continues domestic rice milling industries. to be in the form of milled rice, with 77 percent (albeit 5 percent less than one decade ago) indicating The international market “deepens” a growing tendency for trading rice in the form of An international commodity market is considered thin paddy and husked rice. Parboiled rice has also when it represents only a small proportion of global gained market share, accounting for 15 percent of production. Thin markets are often subject to large swings the international rice market in recent years in traded volume, since relatively small changes in (2 percent more than in 1992–94). production in an important producing country may result in large increases in exports or imports, should that Most of the highlighted changes can be associated with country resort to the international market to dispose of a the increasing importance of Africa and a number of Asian sudden increase in domestic supplies or to cover a countries as destinations of rice flows. In particular, trade shortfall. Trade in thin markets is often considered a

TABLE 4 Shares of global production traded in world markets

Rice (milled equivalent) Wheat Maize Average Global Global % Global Global % Global Global % production trade production trade production trade 1980–89 305 306 11 734 4 497 379 97 044 20 438 592 64 522 15 1990–99 370 853 19 062 5 573 607 102 567 18 547 011 64 207 12 2000–03 393 464 26 837 7 576 073 104 777 18 611 893 78 843 13 17 PART I OVERVIEW

residual option, often secondary to the alternative of Measuring the variability of the rice trade within each building-up or drawing from domestic reserves. decade reveals greater stability. In the 1980s, the volumes Since the early 1990s, trade in rice has risen not only flowing on the international rice market fluctuated within in terms of volume but also in relation to production, a relatively small range (11–14 million tonnes), resulting resulting in a “deepening” of the international rice market, in a measure of variability in the order of 8 percent (not which went from representing a mere 4 percent of global very different from the variability prevailing in the wheat production in the 1980s to 7 percent in 2000–03. The and maize markets, and indicative of fairly stable tendency for the rice trade to deepen over time contrasts international rice flows). Trade fluctuated within a much with the patterns in the international markets of wheat broader band of 12 million to 28 million tonnes in the and maize, which have “thinned” since the early 1980s. 1990s, which gave rise to a much higher CV of 26 percent. Nonetheless, the international rice market continues to The marked fluctuations in the rice trade during the be thinner than that of the other two cereals, representing 1990s were the result of sudden surges or drops in import only 7 percent of global production in recent years, com- demand and export supplies, arising from the “residual” pared with 18 percent for wheat and 13 percent for maize. nature of the international rice market for some major A growing reliance on trade among countries in Africa trade players. For example, imports to Indonesia, the and the Near East contributed to this deepening of the leading rice importer in the 1990s, varied from a minimum market. In those regions, rice imports now satisfy more of 23 000 tonnes in 1993 to 6 million tonnes in 1998. than 40 percent of domestic requirements. The contribu- With many of the major rice importers continuing to hover tion is even higher for Central America and Caribbean around self-sufficiency positions, they constitute potential countries, with half of their rice consumption now sources of disruption on the international market. Regions consisting of imports. For developed countries as a group, like Africa and the European Union, on the other hand, imports now satisfy about one-quarter of domestic utiliza- have established themselves as stable markets for rice. tion of rice. The international rice market has also ceased to be considered “residual” by the major exporters, which are Variability of rice trade flows directing an increasing share of their production to the Global trade in rice fluctuated widely in the last two world market. The greater reliance on trade is evident in decades, from 10.6 million to 28.3 million tonnes. This Thailand, Viet Nam and the United States of America. resulted in a coefficient of variation (CV) of 33 percent On the other hand, China and India, the two major prod- between 1980 and 1999; this is high, especially if ucing countries, have maintained self-sufficiency ratios compared with the CV of 12 percent for global rice very close to unity and have preferred to balance their production and with the CVs for the wheat and maize domestic markets by building up or drawing supplies from trade (respectively, 6 and 8 percent over the same period). stocks, with trade considered a “secondary” option. However, there are several instances when the two countries have relied on trade to balance their domestic FIGURE 2 Year-to-year changes in rice international trade volumes markets. In particular, bad crops prompted China to sharply increase rice imports in 1988, 1994 and 1995, 60% while in India, bumper crops and changes in policy 50% resulted in much enlarged exports from the country in 40% 1994, 1995 and again in 2001 and 2002. 30% 20% PATTERNS OF INTERNATIONAL RICE PRICES 10% International rice price trends 0% World rice prices, represented by Thai 5% broken rice -10% (fob [free on board] Bangkok), have not followed a -20% definite pattern (in nominal terms)5 over recent decades. -30% 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001 2003 5 An exponential trend fit resulted in a very poor R2 of 16 percent. 18 PART I OVERVIEW

FIGURE 3 Production/consumption ratio: exporters

Ratio 3.5

3.0

2.5

2.0

1.5

1.0

0.5 1961 1963 1965 1967 1969 1971 1973 1975 1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001

Thailand India Viet Nam United States of America Pakistan China

However, on a real basis (deflated by the Index of Unit by 0.9 percent per year relative to maize and by 1.3 Value of Manufactured Goods), there has been a distinct6 percent per year relative to wheat over the 40-year period. tendency for them to decline by 3 percent per year since 1960. Thus, not only has there been a major expansion in International price volatility the volume of trade, the world rice market has also been International rice prices are notoriously prone to large dominated by a long-term tendency for world prices to swings and volatility, much greater than those observed decline in real terms, a pattern which is consistent with in wheat and maize prices. Measures of annual price the improvements in productivity and reduction in per variability for the period 1961–2003 were on average unit costs associated with the Green Revolution in the higher for rice than for wheat or maize. However, price 1960s and 1970s. Falling prices of basic inputs, in variation since the 1990s has fallen relative to that of particular fertilizers (Dawe, 2004), also explain the other cereals. continued tendency for prices to dip in the 1980s. The growing stability of world rice prices has resulted International rice prices have also lost ground to wheat in levels of price variability similar to those of wheat and and maize,7 since rice prices are estimated to have fallen maize. In terms of annual frequency, the 1990s coefficient of variation (CV) of prices was actually lower for rice than for wheat or maize, in sharp contrast to the pattern prevailing in the 1960s and the 1980s. 6 An exponential trend fit resulted in an R2 of 74 percent. Rice prices at the monthly frequency level have also 7 Rice prices are represented by Thai 5% broken rice (fob Bangkok); wheat prices by N.1 hard red winter (fob Mexico Gulf); maize prices by exhibited a distinct tendency to stabilize, with the Yellow N.2 (fob Gulf ports). The index of international prices of manufactured goods (1990 = 100) was used as a deflator. coefficient of variation estimated at 15 percent in the 19 PART I OVERVIEW

FIGURE 4 Production/consumption ratio: importers

Ratio 1.5

1.0

0.5 1961 1963 1965 1967 1969 1971 1973 1975 1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001

Africa Indonesia Bangladesh Philippines European Union (15)

FIGURE 5 FIGURE 6 International rice prices Relative price ratios

US$ per tonne Ratio 1400 5.0 1200 4.5 Rice/maize = 3.23e-0.0086t 4.0 1000 3.5 y = 814.52e-0.031x 800 3.0 R2 = 0.7354 2.5 600 2.0 400 1.5 Rice/wheat = 2.7707e-0.0126t 200 1.0 0.5 0 0.0 1960 1964 1968 1972 1976 1980 1984 1988 1992 1996 2000 2004 1961 1964 1967 1970 1973 1976 1979 1982 1985 1988 1991 1994 1997 2000 2003

Rice price nominal Rice price real 20 PART I OVERVIEW

FIGURE 7 International prices of major cereals

US$ per tonne 600

500

400

300

200

100

0 1961 1963 1965 1967 1969 1971 1973 1975 1977 1979 1981 1983 1985 1987 1989 1991 1993 1995 1997 1999 2001 2003

Rice Wheat Maize

1990s, well lower than 32 percent (1980s) and 45 percent international prices, which on the contrary became less (1970s). volatile. The growing stability of international rice prices in There are various possible explanations for this the 1990s is in contrast to the sharp increase in the apparent paradox: variability of trade volume over that same decade. Indeed, • First, the deepening of trade is likely to have had a while the expansion of the rice trade was associated with stabilizing effect on prices, since individual much larger year-to-year variations in the volume of countries’ incursions, on either the import or the transactions, no corresponding effect was seen on export side, are expected to have a lower impact on prices the larger the share of world trade in relation to global production. TABLE 5 • Second, the greater “dependability” of exporters as Variability of international prices – annual frequency a source of supplies is also thought to have CV Rice Wheat Maize contributed to increasing world price stability. For 1960s 0.20 0.05 0.07 example, shipments from Thailand (the principal 1970s 0.44 0.37 0.29 rice exporter) accounted for more than 40 percent 1980s 0.32 0.15 0.18 of the country’s production in the early 2000s, which 1990s 0.11 0.19 0.18 2000s 0.11 0.14 0.13 is well above the 35 percent it exported a decade earlier. The share of exports in production also surpassed 40 percent in recent years in the United TABLE 6 Variability of rice international prices – monthly frequency States of America, Pakistan and Uruguay. Exports have also been rising in Viet Nam, the second largest 1960–69 1970–79 1980–89 1990–99 exporter, reaching 16 percent of production in 2000– CV 21% 45% 32% 15% 03. Variability of supplies from several of the major 21 PART I OVERVIEW

exporters, especially Thailand, Viet Nam and the Since the early 1960s, trade in rice has expanded at a United States of America, also declined in the 1990s rate of about 3 percent per annum – not much different compared with the preceding decade, making them from the rate of growth in the wheat or maize trade. more reliable and dependable sources of trade. In However, growth has been far from steady. The liberaliz- contrast, the volatility of exports from China and ation thrust of the 1990s coincided with a period of India increased. dynamic expansion in the volume of rice trade, which • Third, the existence of sizeable rice inventories and followed a decade of relatively lacklustre growth during the willingness of governments to keep and manage the 1980s. The volume of rice exchanged rose from less such reserves in the 1990s reduced the impact on than 7 million tonnes in 1961 to 24 million tonnes in 2000 world prices of large swings in import demand and and continued to expand further in the early 2000s, export supplies. The surge in exports by Thailand surpassing 28 million tonnes in 2001 and 2002. Never- in 2004, for example, was possible because of the theless, the international rice market is still small relative large purchases made by the Government within the to the other major cereals, with an average of 27 million framework of domestic price stabilization and tonnes in 2000–03 – i.e. about one-quarter of the volume procurement programmes in 2001 and 2002. The traded in wheat and a little over one-third of that in maize. availability of large public stocks indeed allowed Rising import demand by countries in Asia and Africa the country to meet demand and fill the gap left by was the main force underpinning the rice trade in the other major exporters that had restricted exports in 1990s and early 2000s. Increases in imports were often a 2004. reflection of more open trade policies but were also • Finally, the improved flow of information on rice prompted by several production setbacks, for example, supply and demand prospects, together with the problems caused by the El Niño weather anomaly in improved access to international price quotations, 1997. Despite the consolidation of countries in Africa has increased transparency in the international rice and the Near East as important and stable destinations of market. Access to information about the rice global the rice trade, the demand side of the rice international market and prices, together with the adoption of market remains highly dispersed geographically, with the policy disciplines under WTO and regional top ten importers accounting for only 40 percent of the agreements, is likely to have contributed to the total. stabilization of prices. Most of the trade expansion witnessed in the past two decades was met by traditional exporters. Thailand, in CONCLUSIONS AND PROSPECTS particular, has maintained its leadership since 1980 as In recent decades, the international rice market has the top rice exporter. Major inroads have been made by undergone major changes: a shift in its general policy Viet Nam, which became the second most important setting; marked expansion in the volume of trade; and a source of trade supplies in the 1990s (a position it was to lingering tendency for world prices to decline in real terms lose, however, in the early 2000s, when India started and relative to the other two most traded cereals, wheat granting export subsidies). Despite changes in the relative and maize. Nonetheless, the world rice market continues positions of the major exporters, the supply side of the to be regarded as distorted, thin, segmented and volatile. rice international market is still highly concentrated, with This paper discusses whether these attributes continue to the top four exporting countries (Thailand, India, Viet be a valid reflection of the market. Nam and the United States of America) supplying On the policy front, interventions have diminished in 66 percent of trade and the top ten more than 90 percent the wake of the market liberalization launched by several of the total. countries since the late 1980s. The WTO agreement in Rice is not a homogenous commodity and there are 1994 disciplined government policies and helped improve currently more than 50 different published international market access. Nonetheless, rice continues to be one of price quotations for rice. In fact, there are distinct sub- the most protected commodities in both developing and markets featured according to a number of criteria, the developed countries, subject to high tariff and non-tariff most important of which are: variety, quality (defined barriers, export restrictions or aids, state trading and mainly by the percentage of brokens) and the degree of domestic market interventions. processing. 22 PART I OVERVIEW

The expansion of trade witnessed in the 1990s was up or drawing supplies from stocks, with trade considered accompanied by small but significant changes in the only a “residual” option. Global trade in rice fluctuated structure of the world rice market and in the relative widely over the last two decades, from a minimum of importance of each segment. The bulk of global trade 10.6 million to 28.3 million tonnes, and variability continues to be in the form of milled, indica, high-quality measured by the coefficient of variation was high at rice (defined as containing less than 20 percent of 37 percent, compared with a 12 percent variability of brokens). However, aromatic rice varieties, lower-quality global rice production. It was also much higher than the rice and paddy have made large inroads and increased variability of the wheat and maize trade (CV of 6 and their market share, mainly at the expense of trade in 8 percent, respectively). japonica, higher-quality and milled rice. Variability of the rice trade measured decade-by-decade Most of these changes can be associated with shifts in pointed to greater stability. In the 1980s, volumes the geographical pattern of trade. The increasing exchanged on the international rice market fluctuated importance of Africa and a number of Asian countries as within a relatively small range of 11 to 14 million tonnes, destinations of rice flows, in particular, has led to a large resulting in a measure of variability in the order of increase in the trade of lower-quality rice. The growing 8 percent (not very different from that prevailing on the importance of aromatic rice varieties in global trade wheat and maize markets). Trade fluctuated within a much reflects the dynamic imports to the European Union broader band of 12 to 28 million tonnes in the 1990s, (mainly of Basmati rice, imported under preferential which gave rise to a much higher CV of 26 percent. Thus, access conditions), the United States of America, Canada the strong tendency for international trade to grow in the and Australia. However, it can also been associated with 1990s was associated with much greater volatility in large deliveries of Hom Mali rice (a fragrant variety from volume. Thailand) to countries in Africa, particularly Côte The international rice market is also characterized by d’Ivoire, Ghana and Senegal, albeit with a high percentage a long-term tendency for world rice prices (represented of brokens. On the other hand, high degrees of protection by Thai 5% broken rice, fob Bangkok) to fall in real terms have limited import growth in markets such as Japan, the (deflated by the Index of Unit Value of Manufactured Republic of Korea, the European Union and Turkey and Goods) between 1961 and 2003. The decline in constant have constrained the opportunities for the expansion of US$ was 3 percent per annum and in 2003, rice was worth trade in japonica rice. Tariff escalation, whereby the more less than 40 percent (in real terms) of its 1961 value. Rice processed forms of a commodity are assigned higher tariff prices also declined relative to wheat and maize. If 1 tonne rates, has favoured a strong expansion of trade in paddy, of rice could be exchanged for 2.5 tonnes of wheat in principally to Latin America and the Caribbean. 1961, it could only be bartered for 1.3 tonnes in 2003. A An international commodity market is considered similar loss of value was seen in world maize prices. “thin” when it represents a relatively small proportion of Although variability in the volume of rice trade rose global production. The international rice market in the 1990s compared with the 1980s, this did not cause represented only 3 to 5 percent of global production in the variability of world prices to follow suit. On the the 1980s, but the marked growth in world trade since contrary, rice prices are becoming more stable over time, the mid-1990s has “deepened” the market and it has come to the point of achieving levels of volatility similar to to represent 7 percent of global production in recent years. those exhibited by wheat and maize prices. Actually, on Nonetheless, the international rice market remains “thin”, an annual frequency basis, prices in the 1990s were more compared with wheat or maize, the trade of which now stable for rice than for wheat or maize, in sharp contrast accounts for some 18 and 13 percent, respectively, of to the pattern prevailing in the 1960s and the 1980s. global production. Stabilization of world rice quotations was also evidenced Thin commodity markets are often subject to large on a monthly frequency basis. swings in volume, since relatively small changes in supply Thus, the rising variability of trade flows is not or utilization in an important producing country may give associated with more volatile world prices, which have – rise to large increases or contractions in its exports or on the contrary – stabilized. Several explanations can be imports. In general, however, such countries have offered to explain this paradox. First, the “deepening” of preferred to balance their domestic markets by building the international market has meant greater dependability 23 PART I OVERVIEW

of supplies. The existence of large buffer stocks, the there is still much uncertainty about whether the improved flows of information on markets and prices, as tendencies observed in the 1990s will linger into the rest well as the introduction of disciplines on national and of the 2000s and in the decades to come. Against this international policies are also believed to have fostered backdrop, the outcome of the ongoing multilateral trade price stability in the market, in spite of the wider negotiations will be of particular importance in shaping fluctuations in the volume of trade. the future of the international market. In summary, it can be said that international trade in rice has become less distorted, less “thin”, more unstable REFERENCES volume-wise, but more dependable. There are potentially Dawe, D. 2004. Changing structure, conduct and important implications for policy-makers who may be performance of the world rice market. Paper presented encouraged to lower domestic protection to the rice sector at FAO Rice Conference, Rome, Italy, 12–13 Feb. 2004. and increase their countries’ reliance on trade. However, 24 PART I OVERVIEW

Global climate changes and rice food security

N.V. Nguyen Executive Secretary, International Rice Commission, FAO, Rome, Italy

Reducing hunger and poverty are the key United Nations Koyama (2005) reported that high temperatures would Millenium Development Goals. This was the main reason cause a marked decrease in world rice production. for the UN declaration of the International Year of Rice Furthermore, studies have demonstrated that the prod- 2004. In 2002, rice was the source of more than uction and distribution of (thus the supply of and access 500 calories per person per day for over 3 billion people to) rice food in different parts of the world might be (FAOSTAT). Furthermore, rice cultivation is the principal affected greatly by the global climate changes. Under- activity and source of income for more than 100 million standing the potential impact of climate change on rice- households in developing countries in Asia, Africa and based production systems is important for the dev- Latin America. The concerted and coordinated efforts to elopment of appropriate strategies to adapt to and mitigate improve rice production through science, research and the likely outcomes on long-term food security of development in the 1970s and 1980s enabled global rice interaction between rice production and climate change. production to meet the demand of a growing population, created employment opportunities, increased the income BASIC FACTS ON RICE FOOD SECURITY AND of rice farmers, and enhanced access to rice of the poor GLOBAL CLIMATE CHANGE populations living in urban centres across the world. The Rice production systems make a vital contribution to the gains made during the Green Revolution, however, have reduction of hunger and poverty. The basic facts presented begun to show diminishing returns in recent years. Since herein on rice production, rice consumption and global 2000, world rice production has been less than rice climate changes provide a general appreciation of the consumption and the deficit has been addressed by dimensions of rice food security and global climate drawing on rice from buffer stocks. What is more, changes. 852 million people continue to suffer from hunger and malnutrition (FAO, 2004). Rice production The world population continues to grow steadily, while The cultivation of rice extends from drylands to wetlands land and water resources are declining. Furuya and and from the banks of the Amur River at 53° north latitude to central Argentina at 40° south latitude. Rice is also grown in cool climates at altitudes of over 2 600 m above sea level in the mountains of Nepal, as well as in the hot deserts of Egypt. However, most of the annual rice TABLE 1 World rice harvested area, 2004 a production comes from tropical climate areas. In 2004, more than 75 percent of the global rice harvested area Harvested area (ha) (about 114 million out of 153 million ha) came from the Inside tropical region (from Tropic of Cancer to 114 794 445 tropical region whose boundaries are formed by the Tropic Tropic of Capricorn) of Cancer in the Northern Hemisphere and the Tropic of Outside tropical region 38 224 740 World total 153 019 185 Capricorn in the Southern Hemisphere (Table 1). The tropical region includes: all Southeast Asian countries, a It is estimated that about 1 119 450 ha in Brazil, 5 830 000 ha Bangladesh, Sri Lanka, almost all the rice-growing states in Mainland China, 135 000 ha in Taiwan Province of China, 39 725 000 ha in India and 25 250 ha in Mexico were inside the of India, almost all rice-growing countries in sub-Saharan tropical region. African countries, and the majority of rice-growing areas Source: FAOSTAT (adapted). in Latin America and the Caribbean. 25 PART I OVERVIEW

TABLE 2 Food calories derived from rice of different people groups of the world population, 2002

Dependency on rice for Position in relation to Countries Total population calories tropical region (thousands) Very highly dependent Mostly to fully inside Bangladesh, Cambodia, Guinea-Bissau, Guyana, India, 1 762 354 (> 800 kcal/person/day) Indonesia, Lao People's Democratic Republic, Madagascar, Myanmar, Nepal, Philippines, Sri Lanka, Thailand, Timor-Leste, Viet Nam Partially inside China Mainland 1 272 403 Outside Republic of Korea 47 430 Subtotal 3 082 187 Highly dependent Mostly to fully inside Brunei, Comoros, Costa Rica, Côte d’Ivoire, Cuba, Guinea, 86 394 (500–799 kcal/person/day) Guyana, Liberia, Malaysia, Maldives, Mauritius, Senegal, Sierra Leone, Solomon Islands, Suriname, Vanuatu Partially inside China Macao SAR 460 Outside Democratic People's Republic of Korea, Japan 150 019 Subtotal 236 873 Moderately dependent Mostly to fully inside Cape Verde, Colombia, Dominican Republic, Ecuador, Fiji, 128 230 (300–499 kcal/person/day) French Polynesia, Gabon, Gambia, Haiti, Kiralbati, Mali, Mauritania, Nicaragua, Panama, Peru, Sao Tome and Principe Partially inside Brazil, China Hong Kong SAR, Taiwan Province of China 205 701 Outside Egypt, Iran (Islamic Republic of), Kuwait, Saudi Arabia, 167 477 United Arab Emirates Subtotal 501 408 Less dependent All categories Remaining countries 2 404 510 (< 300 kcal/person/day) Total 6 224 978

Source: FAOSTAT (adapted).

Rice consumption majority of people who depended on rice for food lived In terms of food energy derived from rice in 2002 (when in low-income and developing countries. the most recent data are available), Table 2 shows that: 3.08 billion people out of the whole world population Global climate changes (6.22 billion) belonged to group A, i.e. very high Attention to global climate changes resulting from human dependence on rice for food calories (> 800 kcal/person/ activities and their potential impact took a momentous day); followed by 236.8 million people in group B, highly step on 16 February 2005 when the Kyoto Protocol dependent (500–799 kcal/person/day); 501.4 million entered into force. Enormous quantities of greenhouse people in group C, moderately dependent (300–499 kcal/ gases are released into the atmosphere through mining person/day); and the remaining 2.4 billion people in and combustion of fossil fuels, deforestation, maintenance group D, less dependent (< 300 kcal/person/day). Rice of livestock herds and even rice production. The emission is considered a staple food for the 3.31 billion people in of methane and nitrous oxide gases from lowland rice groups A and B in 2002 (Table 2). cultivation and the deforestation entailed in upland rice Of groups A and B, about 1.84 billion people lived production under slash-and-burn shifting cultivation are inside and 1.27 billion people partially inside the tropical considered contributors to global climate changes. region, while only 197 million people lived outside. Of The accumulation of greenhouse gases in the the 501 million people who were moderately dependent atmosphere has warmed the planet and caused changes on rice for food calories, 128 million lived inside and in the global climate. In 2001 the UN-sponsored 205 million partially inside the tropical region, with only Intergovernmental Panel on Climate Change (IPCC) 167 million outside. In summary, in 2002, rice clearly reported that worldwide temperatures have increased by had a vital role in the food security of people living in the more than 0.6°C in the past century and it also estimated tropical region. Data in Table 2 also indicate that the that by 2100, average temperatures will increase by 26 PART I OVERVIEW

between 1.4° and 5.8°C. IPCC also reported that sea levels TABLE 3 Critical temperatures for the development of rice plant at have risen by between 10 and 20 cm and snow and ice different growth stages covers have fallen almost worldwide, while the precipitation patterns characterizing land areas of the Northern Growth stages Critical temperature (°C) Hemisphere have progressively changed. In the same Low High Optimum report, IPCC estimated that sea levels would rise by an Germination 16–19 45 18–40 Seedling emergence 12 35 25–30 average 0.09 to 0.88 m between 1990 and 2100. Rooting 16 35 25–28 Leaf elongation 7–12 45 31 Tillering 9–16 33 25–31 POTENTIAL IMPACTS OF GLOBAL CLIMATE Initiation of panicle 15 - - CHANGES ON RICE PRODUCTION AND primordia Panicle differentiation 15–20 30 - DISTRIBUTION Anthesis 22 35–36 30–33 The food security of more than half the world population Ripening 12–18 > 30 20–29 depends on the ability of the world to supply and distribute Source: Yoshida, 1978. rice. Rice supply depends on global rice production, while its distribution depends on the distance from production TABLE 4 Symptoms of heat stress in rice sites to consumers’ residences as well as on transportation systems and facilities. Studies suggest that the temperature Growth stage Symptoms increases, rising seas and changes in rainfall patterns and Vegetative White leaf tip, chlorotic bands and blotches, white bands and specks, distribution expected as a result of global climate change reduced tillering, reduced height could lead to substantial modifications in land and water Reproductive anthesis Reduce spikelet number, sterility resources for rice production as well as in the productivity Ripening Reduced grain-filling of rice crops grown in different parts of the world. Source: Yoshida, 1981 (adapted).

Effect on land and water resources for rice production In 1992, it was reported that Zimbabwe’s core agricultural the development of the rice plant at different growth zone would be reduced by 67 percent with a 2°C phases are shown in Table 3. temperature increase (Downing, 2002). A later report also Extreme temperatures – whether low or high – cause suggested that the greatest temperature increase could injury to the rice plant. In tropical regions, high temp- be expected in agricultural land in low latitude tropical eratures are a constraint to rice production. Table 4 out- regions (Rosenzweig and Iglesias, 1994). Darwin et al. lines the various possible injuries to rice crops caused by (2005) estimated that the amount of land classified as extremely high temperatures. The most damaging effect “land class 6” – i.e. the primary land class for rice, tropical is on grain sterility; just 1 or 2 hours of high temperature maize, sugarcane and rubber in tropical areas – would at anthesis (about 9 days before heading and at heading) decline by between 18.4 and 51 percent during the next result in a large percentage of grain sterility. century due to global warming. On the other hand, it is Studies on rice productivity under global warming also possible that the land and water resources for rice suggest that the productivity of rice and other tropical production in areas outside the tropical region increase crops will decrease as global temperature increases. with global climate changes (Darwin et al., 2005). Mohandrass et al. (1995), using the Hadley-coupled Likewise, enormous areas of coastal Florida, much of model, predicted a yield decrease of 14.5 percent for Louisiana, the Nile Delta and Bangladesh will become summer rice crops across nine experiment stations in India uninhabitable once sea levels have risen by as much as in 2005. Peng et al. (2004) reported that the yield of dry- 88 cm (Klutger and Lemonick, 2001). season rice crops in the Philippines decreased by as much as 15 percent for each 1°C increase in the growing season Effect on the productivity of rice crops mean temperature. Similarly, Mohamed et al. (2002a and Temperature increase b) estimated that by 2005, climate change in Niger could Temperature regimes greatly influence not only the lower yields of millet by 13 percent, groundnut by growth duration, but also the growth pattern and the between 11 and 25 percent and cowpea by 30 percent. productivity of rice crops. The critical temperatures for Chipanshi, Chandra and Tototo (2003) reported that in 27 PART I OVERVIEW

Bostwana, climate change could bring about yield Changes in the pattern of precipitation decreases of 10 to 36 percent in maize and 10 to 30 per- At present, about 40 percent of the total rice area is cent in sorghum. classified as rainfed (lowland or upland), while about Temperature increases in subtropical and temperate 3.5 million ha of rice-land are still being classified as climate areas may have a positive or negative effect on deep-water or flood-prone (Maclean et al., 2002). rice crops, depending on the location. For example, temp- Variability in the amount and distribution of rainfall is erature increase would improve the crop establishment the most important factor limiting yield of rainfed rice. of rice in Mediterranean areas, where cool weather usually Variability in the onset of the rainy season leads to causes poor crop establishment (Ferrero and Nguyen, variation in the start of the planting season in rainfed rice. 2004). On the other hand, a similar temperature increase Moreover, in freely drained upland, moisture stress would reduce the beneficial effects on grain production severely damages or even kills rice plant in an area that of the low night temperature in northern Japan (16°–21°C) receives as much as 200 mm of precipitation in 1 day (Matsushima and Tsunoda, 1958). and then receives no rainfall for the next 20 days. Complete crop failure usually occurs when severe drought Rising seas stress takes place during the reproductive stages. Large areas in the low-lying deltas of the Ganges, the Flood is the most important constraint to rice Mekong, the Nile, the Yangtze, the Yellow and other production in low-lying areas. Most rice varieties for major river systems that are home to major rice-growing rainfed lowland, irrigated and deep-water ecosystems can regions have been affected by tidal waves. For example, stand complete submergence for at least 6 days before it was reported that there were about 650 000 ha of saline 50 percent of them die. However, the mortality rate soils (eutric fluvisols) along the coastal belt in the Mekong becomes 100 percent when submergence lasts 14 days. River Delta and 350 000 ha in the Red River Delta of Floods also cause indirect damage to rice production Viet Nam (FAO, 1988). Most eutric fluvisols have through the destruction of property and farmers’ moderate to high inherent fertility, but a saline phase in production means, as well as of infrastructures supporting these soils limits their potential for wetland rice rice production (e.g. dams, dikes and roads). The changes production (Dent, 1980). in the pattern of rainfall distribution may lead to a more Enterprising farmers worldwide have improved tidal- frequent occurrence of intense flood and drought in affected lands for rice production. They have also used different parts of the world (Depledge, 2002). flooded rice systems to reclaim land to produce other crops for their food and incomes. Yields of rice planted Effects on rice distribution and access to rice in tidal-affected lands, however, are normally lower than Studies on the impact of global climate changes on land in lowlands that are not influenced by tidal waves. This and water resources for rice production and on the is due to the salinity in the soil (tidal waves contaminate productivity of rice crops point towards a possible water and soil with the salt in the seawater). In flooded decrease in rice production in the tropical region, + + 2+ 2+ 2+ 2+ soils, salt displaces K , NH4 , Fe , Mn , Ca and Mg contrasted with a possible increase in areas outside the from exchange sites. Most rice varieties are severely tropical region. As the majority of people who are highly injured in submerged soil culture at an electrical dependent on rice for food live in the tropical region conductivity (ECe) of 8–10 mmho/cm at 25°C (Table 2), such a shift in rice production areas would (Ponnamperuma and Bandyopadhya, 1980). The create difficulty in the distribution of and access to rice. symptoms of salt injury in rice are stunted growth, rolling Furthermore, the expected increase in the intensity and of leaves, white tips, drying of older leaves and grain frequency of floods and storms caused by the changes in sterility. The rising seas expected under global climate rainfall and its distribution pattern (Depledge, 2002) changes would definitely increase the size of land areas would have negative effects on the transport and that are influenced by tidal waves in the low-lying deltas distribution of rice to consumers. In summary, the analysis of the major river systems. In the Mekong Delta of Viet suggests that there will be serious implications for world Nam, for example, the effect of the ocean tides could food security if no effort is made to adapt rice production sometimes be observed as far as 200 km from the sea to climate changes. The effort to reduce the emission of (Nguyen, 1987). greenhouse gases and deforestation from rice production 28 PART I OVERVIEW

would also be beneficial to sustainable rice production would be very helpful under the environment of global in the long run. warming. Efforts to increase the trehalose biosynthesis in rice by introducing ots A and ots B genes from TECHNICAL OPTIONS FOR ADAPTATION AND Escherichia coli have resulted in transgenic rice with a MITIGATION higher level of tolerance to drought and salinity (Garg et Adaptation involves adjustments to decrease the al., 2002). Similarly, FR13A (one of the submergence- vulnerability of rice production to climate changes, while tolerant donors) has been used to develop improved rice mitigation focuses on reducing the emission of green- cultivars with submergence tolerance (MacKill et al., house gases from rice production and minimizing de- 1993). forestation resulting from upland rice cultivation under slash-and-burn shifting cultivation. There are a range of Optimization of high CO2 concentration for higher yield technological options that are presently available or which The high CO2 concentration present in the atmosphere can potentially be developed in the near future for under global warming could be harnessed to increase the enhancing the rice production systems’ ability to adapt productivity of the rice crop. The grain yield of IR8, for to and mitigate the effects of global climate changes. example, was significantly increased with carbon dioxide enrichment before and after heading (Table 5). C4 plants, Technical options for adaptation such as maize and sorghum, are more productive than Selection of appropriate planting date C3 rice and wheat, because C4 plants are 30 to 35 percent Given that germination and emergence of rice seedlings more efficient in photosynthesis, especially when the level are more likely to be limited by low than by high of CO2 concentration in the atmosphere is high. Ku et al. temperatures, any temperature increase under global (1999) and Matsuoka et al. (2001) introduced cloned climate changes would not significantly affect the genes from maize to regulate the production of enzymes selection of the appropriate date for establishing the rice responsible for C4 synthesis to alter the photosynthesis crop in tropical regions. As temperature varies from month of rice from C3 to C4 pathway. to month, it is possible to select the right date for crop establishment in such a way that the reproductive and Technical options for mitigation grain filling phases of rice fall into those months with a Reducing the emission of greenhouse gas relatively low temperature. This would minimize the The emission of methane from flooded rice soils has been negative effect of temperature increase on rice yield as identified as a contributor to global warming. Water reported by Peng et al. (2004). Efforts to collect and regime, organic matter management, temperature and soil disseminate the information on month-to-month variation properties, as well as rice plants, are the major factors in temperature regimes in major rice-producing tropical determining the production and flux of methane (CH4) areas, therefore, are essential for helping rice production in rice fields. Results of studies during the 1990s, to adapt to climate changes.

Selection and development of appropriate rice varieties TABLE 5 Rice varieties have different abilities to tolerate high Effect of carbon dioxide enrichment on grain yield of IR8 temperature, salinity, drought and floods. For example, Treatment Yield BKN6624-46-2 is more tolerant to high-temperature- (tonnes/ha) induced sterility than N22 (Yoshida, 1981). Rice varieties Dry season with a high level of salinity tolerance have been utilized Control 9.0 a CO enrichment before heading 11.6 b to expedite the recovery of rice production in areas 2 CO2 enrichment after heading 10.9 b recently damaged by the tsunami. The selection of Wet season appropriate rice varieties is, therefore, another technical Control 5.7 a option for adaptation to global climate changes. CO2 enrichment before heading 7.7 b CO2 enrichment after heading 6.9 b Also, the development of rice varieties that have not Note: Two means followed by the same letter are not only high-yielding potential, but also a good degree of significantly different at the 5 percent level. tolerance to high temperature, salinity, drought and flood, Source: Yoshida, 1981. 29 PART I OVERVIEW

however, showed that methane emission from rice fields CONCLUSIONS is actually much lower than originally thought, accounting Rice is the staple food crop of the world population. The for only about 10 percent of total global methane world population continues to grow steadily, while land emissions (Maclean et al., 2002). Varietal differences and water resources are on the decline. Studies suggest could be used to lessen methane emission in rice prod- that temperature increase, rising seas and changes in uction. Also, intermittent irrigation or alternating dry-wet patterns of rainfall and its distribution under global irrigation could reduce emissions from rice-fields, while climate changes might lead to substantial modifications the transfer and adoption of a Rice Integrated Crop in land and water resources for rice production as well as Management (RICM) approach (e.g. the Australian the productivity of rice crops grown in different parts of RiceCheck) would increase the efficiency of nitrogen the world. The emission of methane and nitrous oxide fertilizer in rice production, thus reducing nitrous oxide gases from lowland rice production and the deforestation emissions (Nguyen, 2002). In addition, the initial results in upland rice production under slash-and-burn shifting obtained from rice-wheat systems in China and India cultivation are contributors to global climate changes. demonstrate that the fossil fuels used in land preparation The sustainable increase of rice production for food operations in rice-based systems could be substantially security will require efforts to enhance the capacity of minimized with conservation agriculture practices such rice production systems to adapt to global climate change as minimum and reduced tillage (T. Friedrich, personal as well as to mitigate the effects of rice production on communication, 2005). global warming. Technical options for adaptation and Similarly, the planting of high-yielding rice (e.g. hybrid mitigation are available and could be further improved. rice and super rice) would permit sustainable rice Policy support to rice research and development to production, while reducing the area actually planted to develop and transfer appropriate and efficient tech- rice and consequently the emission of methane. As a result nologies, however, will be vital for the realization of such of the widespread adoption of hybrid rice (about measures for sustainable rice production. 50 percent of total rice area), Chinese rice production increased sustainably from 128 million tonnes in 1975 REFERENCES to 191 million tonnes in 1990, while over the same period Andriesse, W. 1986. Wetlands in sub-Saharan Africa. In the rice harvested area was reduced from 36 to Proceedings International Conference on Soil and 33 million ha (Nguyen, 2004). Climate Resources and Constraints in Relation to Food Crop Production in West Africa, IITA, Ibadan, Nigeria, Minimizing deforestation resulting from upland rice 4–8 Nov. 1985. cultivation Chipanshi, A.C., Chandra, R. & Totolo, O. 2003 Upland rice cultivation, especially in sub-Saharan Africa, Vulnerability assessment of maize and sorghum crops to is done under slash-and-burn shifting cultivation. Under climate change in Bostwana. Clim. Change, 61: 339–360. this system the vegetation in a forest land area is cleared Darwin, R., Tsigas, M., Lewandrowski, J. & Raneses, and burnt and the area is then cultivated to upland rice A. 2005. World agriculture and climate change: for 1 to 2 years before the farmers move to new areas. economic adaptation. USDA Agricultural Economic Farmers return to a previously cleared area only several Report No. 703. 86 pp. years later to repeat the same process of cutting and Dent, F.J. 1980. Major production systems and soil related burning of the cover vegetation. Upland rice production constraints in Southeast Asia. In Priority for alleviating in sub-Saharan Africa is a major cause of deforestation soil-related constraints to food production in the tropics, and desertification. However, tropical sub-Saharan Africa p. 79–106. IRRI and Cornell University has a total of 24 million ha of wetlands which are suitable Depledge, J. 2002. Climate change in focus: the IPCC Third for rice production (Andriesse, 1986). The development Assessment Report. Royal Institute of International of wetland rice in sub-Saharan Africa would markedly Affairs, Briefing Paper New Series, No. 29. Feb. 2002. reduce the deforestation which currently results from Downing, T. 1992. Climate change and vulnerable places: upland rice cultivation. global food security and country studies in Zimbabwe, Kenya, Senegal and Chile. Research Report No. 1. Oxford, Environmental Change Unit, University of Oxford. 30 PART I OVERVIEW

FAO. 1988. Report of the mission on Agricultural Sector and case study for groundnut and cowpea in Niger. Clim. Review. Change, 54: 327–348. FAO. 2004. The state of food insecurity in the world. Rome, Mohamed, A.B., Duivenbooden, N.V. & Abdoussallam, FAO. 4 pp. S. 2002b. Impact of climate changes on agricultural FAOSTAT. FAO statistical database (available at production in the Sahel – Part II: Methodological www.fao.org). approach and case study for millet in Niger. Clim. Ferrero, A. & Nguyen, V.N. 2004. The sustainable Change, 54: 349–368. development of rice-based production systems in Europe. Mohandrass, S., Kareem, A.A., Ranganathan, T.B. & IRC Newsl., 54: 115–124. Jeyaraman, S. 1995. Rice production in India under the Furuya, J. & Koyama, O. 2005. Impacts of climatic change current and future climate. In R.B. Mathews, M.J. Kroff, on world agricultural product markets: Estimation of D. Bachelet & H.H. van Laar, eds. Modeling the impact macro yield functions. JARQ, 39(2): 121–134. of climate change on rice production in Asia, p. 165– Garg, A.K., Ju-Kon Kim, Owens, T.G., Ranwala, A.P., 181. United Kingdom, CAB International. Yang Do Choi, Kochian, L.V. & Wu, R.J. 2002. Nguyen, N.T. 1987. Thuy trieu va su xam nuoc man vao Trehalose accumulation in rice plants confers high dong bang song Cuu Long. Tap San Thuy Loi, 254: 14– tolerance levels to different abiotic stresses. Proc. Natl 18. Bo Thuy Loi, Hanoi, Viet Nam. Acad. Sci. USA, 10.1073/pnas 252637799. Nguyen, V.N. 2004. FAO programme on hybrid rice Kluger, J. & Lemonick, M.D. 2001. Global warming. Time development and use for food security and livelihood Magazine, 23 April 2001: 51–59. improvement. Paper presented at the Concluding Ku, M.B.S., Agarie, S., Nomura, M., Fukayama, H., Workshop of the IRRI-ADB funded project “Sustaining Tsuchida, H., Ono, K., Horose, S., Toki, S., Miyao, Food Security in Asia through the Development of Hybrid M. & Matsuoka, M. 1999. High-level expression of Rice Technology”, IRRI, Los Baños, Philippines, 7–9 maize phosphoenolpyruvate carboxylase in transgenic Dec. 2004. rice plants. Nature Biotech., 17: 76–80. Nguyen, V.N. 2002. Productive and environmentally Maclean, J.L., Dawe, D.C., Hardy, B. & Hettel, G.P. (eds). friendly rice integrated crop management systems. IRC 2002. Rice almanac (Third Edition). Philippines, IRRI, Newsl., 51: 25–32. WARDA, CIAT and FAO. Peng, S., Huang, J., Sheehy, J.E., Laza, R.C., Visperas, MacKill, D.J., Amante, M.M., Vergara, B.S. & R.M., Zhong, X., Centeno, G.S., Khush, G.S. & Sarkarung, S. 1993. Improved semi-dwarf rice lines with Cassman, K.G. 2004. Rice yield decline with higher tolerance to submergence. Crop Sci., 33: 749–753. night temperature from global warming. In E.D. Redona, Matsuoka, M., Fukayama, H., Ku, M.B.S. & Miyao, M. A.P. Castro & G.P. Llanto, eds. Rice Integrated Crop 2001. High level expression of C4 photosynthetic genes Management: Towards a RiceCheck syatem in the in transgenic rice. In G.S. Khush, D.S. Brar & B. Hardy, Philippines, p. 46–56. Nueva Ecija, Philippines, PhilRice. eds. Rice genetics IV, p. 439–447. Los Baños, Philippines, Ponnamperuma, F.N. & Bandyopadhya, A.K. 1980. Soil IRRI. salinity as a constraint on food production in the tropics, Matsushima, S. & Tsunoda, K. 1958. Analysis of p. 203–216. developmental factors determining yield and application Rosenzweig, C. & Iglesis, A. 1994. Implications of climate of yield prediction and culture improvement of lowland change for international agriculture: Crop modeling rice XLV. Effects of temperature and its daily range in study. Washington DC, US Environmental Protection different growth stages upon the growth, grain yield, and Agency, Climate Change Division. constitutional factors in rice plants. Proc. Crop Sci. Soc. Yoshida, S. 1978. Tropical climate and its influence on rice. Jpn, 26: 243–244. IRRI Research Paper Series 20. Los Baños, Philippines, Mohamed, A.B., Duivenbooden, N.V. & Abdoussallam, IRRI. S. 2002a. Impact of climate changes on agricultural Yoshida, S. 1981. Fundamentals of rice crop science. Los production in the Sahel – Part I: Methodological approach Baños, Philippines, IRRI. 269 pp. 31 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Genetic diversity for rice disease sustainable management

Y. Wang, C. Li, J. Zhou, X. He, B. Lu, H. Leung, T.W. Mew and Y. Zhu a Yunnan Agricultural University, The Research Center for Agricultural Biodiversity, Kunming, China aCorresponding author: [email protected]

Rice disease is one of the major barriers to high and structures. Research was supported by the Asian sustainable rice productivity. Deploying resistant varieties Development Bank, the National Natural Science Found- is the most effective and economical way to control ation of China and the “863” Programme of Science and disease and it plays a key role in world rice productivity Technology, Ministry of China, and there was significant (Mew, 1991; Bonman, Khush and Nelson, 1992). During success in mixed planting of traditional glutinous rice the 1970s and 1980s, when epidemics of rice tungro were with modern hybrid rice as a means for blast control (Zhu, frequent in the Philippines and Indonesia, farmers 2000 and 2002). This paper reviews the status of rice expressed more confidence in using resistant varieties disease management and goes on to highlight the experi- than in other control measures. There are limitations, ments conducted in Yunnan Agricultural University. however, in using resistant varieties alone to manage rice disease. Most varieties are only resistant to a few major UTILIZING THE DIVERSITY OF RICE DISEASE diseases that are the subject of intensive breeding efforts. RESISTANCE GENES Rice production environments, particularly in the tropics, Since the release in the mid-1960s of the “miracle” rice provide the habitat for many rice pathogens causing variety, IR8, there have been continuous gains in rice varying degrees of damage. Even the “minor” diseases productivity up to the present day. This remarkable could collectively pose a significant threat to production increase in rice yield served to achieve food security in (Mew, 1992a). Epidemic loss is dramatic but less frequent, Asia (Evenson and Gollin, 2003). At least three factors whereas endemic loss is less obvious but pervasive in have made this successful technological change possible: each cropping season. Recent surveys indicated that an • continuous efforts in the development of high- estimated annual yield loss of between 1 and 10 percent yielding semi-dwarf rice varieties by public research was due to a combination of different diseases (Savary et institutions and making the seed freely available to al., 2000a). Thus, resistance against a few targeted farmers; diseases only offers a partial solution to rice disease • the dramatic yield increase provided by improved problems. To those diseases caused by non-specialized varieties (hence rapidly adopted by farmers); and pathogens, such as sheath blight and false smut (caused • a parallel improvement in farming infrastructure to by Ustilaginoidea virens), no useful source of resistance support the cultivation of these modern varieties. has been identified to improve the resistance of rice varieties. To achieve sustainability of rice production in Although rice resistance breeding has achieved much Asia, what is needed is a rice production system built with regard to managing epidemics of many important upon effective resistant varieties with broad resilience to diseases, there are other diseases in tropical rice a range of diseases and insect pests. Broad-spectrum production ecosystems which collectively cause chronic resistance at the genotypic level and sustainability at the yield losses and destabilize annual production. cropping systems level are therefore complementary Furthermore, as cultural practices and cropping intensity approaches in the management of rice diseases. change over time, some previously “minor” diseases In 1996, Yunnan Agricultural University and the become serious problems (Evenson, 1998). To assess the International Rice Research Institute (IRRI) moved current rice disease problems, Savary et al. (2000a and towards the deployment of different resistance varieties b) combined field survey data and controlled experiments based on an understanding of the pathogen population to determine the production constraints and yield loss 32 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

under different production scenarios. The group applied NILs carrying resistance genes from diverse donors of non-parametric statistics to quantitatively define rice- traditional varieties (e.g. Utri Merah, TKM6) and wild cropping patterns of various production situations, pest rice (O. rufipogon) have been produced (Azzam and profiles and crop loss. The results showed that of the Chancellor, 2002). These NILs are excellent experimental numerous diseases occurring in rice-fields, sheath blight material for differentiating pathogen races, evaluating the and brown spot account for the highest yield loss (6 and effectiveness of individual resistance genes, and for mol- 5 percent, respectively) across all production situations ecular cloning of disease resistance genes. NILs and in South and Southeast Asia. Rice blast, with high molecular markers have provided the essential tools for potential for causing severe epidemics across Asia, is understanding pathogen diversity and population struc- estimated to cause a yield loss of 0.3 to 0.5 percent, while tures that form the basis of deploying disease-resistant losses due to bacterial blight are below 1 percent. The varieties. The NILs carrying individual resistance genes study provides important insights into the changing provide an efficient means to detect changes in pathogen production scenarios and shifting problems over time. avirulence genes corresponding to specific resistance They support the notion that the sustained efforts of genes. resistance breeding – started during the 1960s and 1970s This approach has been widely used in the charac- against blast and bacterial blight, and later against tungro terization of the bacterial blight (Shanti et al., 2001) and – have paid off. At the same time, diseases such as sheath blast pathogen populations (Mekwatanakarn et al., 2000) blight and brown spot become prominent due either to with the objective of determining the appropriate resis- lack of effective resistance in the germplasm or to lack tance genes to use and the impact of deployed genes on of breeding effort. pathogen evolution. Since the mid-1980s, a large quantity Because of the multitude of biotic stresses present in of field and laboratory data have been accumulated on rice fields, a single variety planted in a large area will the pathogen populations of the Magnaporthe grisea cause more serious problems. To meet such a challenge, (Mekwatanakarn et al., 2000), Xanthomonas oryzae pv. research on host plant resistance must not only cover the oryzae (Adhikari et al., 1995; Ardales et al., 1996) and significant diseases, but must take advantage of multiple tungro viruses (Arboleda and Azzam, 2000). For genetic resources for managing diseases. In the macro- M. grisea, pathogen population analysis has defined ecosystem, advanced techniques (e.g. molecular biology clonal populations (or lineages) of the pathogen as targets and biological information) combined with traditional of breeding. A lineage is a group of pathogen genotypes techniques for analysing the resistant resources, make it sharing a common DNA banding pattern that is inferred possible to: optimize the arrangement; increase the genetic to be related by descent from a common ancestor. This diversity of the rice field; and sustain the balance of the leads to the formulation of a breeding strategy where ecosystem. The multitude of resistance resources may major genes are combined to exclude infection by the consequently be used adequately and diseases can be known pathogen lineages in a location. This “lineage- managed permanently. exclusion” approach is being pursued at CIAT (Inter- national Centre for Tropical Agriculture) (Gibbons, Using the diverse rice gene pool in breeding Gonzales and Delgado, 2000) and by research groups in To date, over 40 blast resistance genes (Pi) (Imbe et al., Asia (Babujee and Gnanamanickam, 2000). 2000; Inukai et al., 1994), 20 bacterial blight resistance Single gene or oligogene breeding has its short- genes (Xa) (Chen, Wang and Ahang, 2002; Khush and comings. Many major genes and partial resistance genes Angeles, 1999) and rice tungro resistance genes (Azzam were, therefore, combined into one variety – a technique and Chancellor, 2002) have been identified. Although few which was to become the future trend in resistance resistance genes are actually used in commercial varieties, breeding. For rice blast, bacterial blight and tungro, a the diversity of resistance genes has been put to good use strategy of horizontal resistance was applied in resistance in developing differential varieties for pathogen charac- identification and breeding. All the above measures terization. For example, a large series of near-isogenic reduced the selecting pressure on pathogens by using the lines (NILs) for both bacterial blight resistance genes genetic diversity of resistance genes. The end result was (Ogawa et al., 1991) and blast resistance genes (Inukai the effective control of the diseases (Bonman, Khush and et al., 1994) have been produced. For tungro virus, several Nelson, 1992). 33 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

In practice, diverse donors with major genes and partial 2 to 3 years’ evaluation in “hot spot” areas in farmers’ resistance are utilized in breeding, with an average fields, these lines showed resistance to bacterial blight 100 000 pedigrees grown per year and screened for resis- under high disease pressure and outyielded the check. tance (Khush and Virmani, 1985). This system of Similarly, major genes for blast resistance (e.g. Pi1, Pi2, screening and breeding has been successful in tropical Pi9) have been accumulated in some elite lines by irrigated areas. Starting with the release of IR26 in 1973, research teams in Indonesia and India, although the nearly all released IRRI varieties have shown multiple performance of these gene pyramids remains to be tested resistance to blast, bacterial blight, grassy stunt and, later, (M. Bustamam and R. Sridhar, personal communication). tungro (Khush and Virk, 2002). Despite the gradual Past experience suggests that gene pyramids are most erosion of major gene resistance, some varieties have likely to be effective for controlling bacterial blight but shown durable resistance in the tropical irrigated environ- less so for blast due to the high level of pathogenic var- ment. For example, durable resistance to rice blast, iation exhibited by M. grisea. Alternative or comple- attributed to partial or quantitative resistance, was obser- mentary strategies are therefore needed for effective blast ved in IR36 in irrigated tropical areas (Bonman and control. Mackill, 1988). For bacterial blight, deployment of a single resistance gene Xa4 proved effective for a long Using the diverse rice gene pool in cultivation time (Khush, 1989). The gene has been incorporated in Rotation of resistant varieties was a temporal measure most IRRI varieties and in the Philippines, varieties with making use of genetic diversity. If one variety becomes Xa4 have been resistant to bacterial blight for 20 years, susceptible to disease, a new variety with different even though compatible races are present (Mew, VeraCruz resistance genes is released to farmers. In 1997, the and Medalla, 1992b). It has been suggested that varieties planting of Chujing12 began in Luxi County, Yunnan with the Xa4 gene also carry multiple minor genes for Province. Four years later, ZE1 became dominant and resistance; the apparent durability could be due to multiple the resistance of Chujing12 was lost. It was replaced by genes with lesser effects (Koch and Parlevliet, 1991). another new variety – Hexi41 – which showed resistance On the basis of an evolutionary risk assessment model, to ZE1 in an area of 803.6 ha and the control effects for it has been argued that rice blast and bacterial blight can rice blast were 83.2 percent in 1999 (Wang et al., 1998). be managed by gene pyramiding, because it is unlikely A modified single gene rotation scheme using two resis- that a sequence of multiple virulence mutations will occur tance genes at the same time was proposed to counter the in the same clonal lineage of the pathogen (McDonald rice blast epidemic in Korea in 1979–1980. In addition and Linde, 2002). Combining multiple resistance genes to managing blast, a varietal rotation system based on in breeding lines is difficult with conventional breeding planting different varieties in different seasons or localities methods, owing to epistasis (masking the effect of one was successfully implemented to control rice tungro in gene over the others). Because many blast and bacterial Indonesia (Manwan, Sama and Rizvi, 1985), where rice blight resistance genes have been tagged by molecular varieties with different resistance genes against the insect markers, gene pyramiding is widely practised in rice vector, green leafhopper, were grown in different seasons. breeding (Hittalmani et al., 2000). With marker-based Thus, the sequential release of varieties over time and selection, multiple genes can be identified in a single space is one form of diversifying varieties or resistance genotype. Thus, DNA marker technology has enabled the genes used in the field, but this strategy is valid only if use of multiple resistance genes in a single variety, hence the investment in developing a new variety is not out- increasing the overall diversity of resistance genes used weighed by the rapid loss of its usefulness. The system in the field. Using marker-aided selection, several would also need to be supported by good race prediction varieties with multiple Xa genes have been produced by and survey data. Furthermore, it proved very difficult to teams of researchers at the Philippine Rice Research replace varieties in large areas, especially in China where Institute (PhilRice), the Philippines, the Indonesian the fundamental production unit was the farmer’s family. Agricultural Biotechnology and Genetic Resources Optimizing variety arrangement is the spatial measure Research Institute (IABGRRI), Indonesia, and at Punjab in terms of using genetic diversity: planting multivarious Agricultural University, India (R. Tabien, M. Bustamam varieties in a region in order to increase genetic diversity, and K. Singh, personal communication). On the basis of reduce selecting pressure and suppress disease. The first 34 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

experiment of variety arrangement for rice blast control studied. The spore spatial distribution of Pyricularia was set up in 1998–2000 by Yunnan Agricultural oryzae and the microclimate conditions in the mixture University on small plots in BaoXiu, Shiping County. field environment were also considered. After several Seven varieties with different types of resistance were years of research, the technical parameter of interplanting chosen, and every farmer’s family planted one in their and technical instruction of expansion were established. own field. Seven varieties were thus arranged randomly The theory and technology of using genetic diversity for in an area of 42 ha. The results showed that mean disease sustainable management had been built and a new incidence of rice blast in this area was below 4.78 percent simple method of rice blast management tracked out. in the successive 3 years and good control effects were achieved (Wang et al., 1998). However, farmers were VARIETAL DIVERSIFICATION EXPERIMENTS IN reluctant to plant varieties having poor resistance without YUNNAN, CHINA economic compensation. Given the current agricultural Plot experiments for rice blast control using genetic production scenarios, it is not possible to establish an diversity economic compensation policy in China, and this strategy Two high-yielding hybrid rice varieties, Shanyou63 and cannot, therefore, be expanded on a large scale. Shanyou22, and two high-quality traditional rice varieties, Planting multilines and cultivar mixtures is another Huangkenuo and Zigu, were used by Yunnan Agricultural important method for using genetic diversity. A review University for plot experiments of rice blast control using of the literature indicates that reduction of blast can be genetic diversity (Zhu et al., 2003; Liu et al., 2003). The achieved in multilines and cultivar mixtures as compared fingerprinting analysis of resistance gene analogue (RGA) with pure stands (Koizumi, 2001). On the basis of a demonstrated that the two hybrid rice varieties shared a simulation model of pathogen evolution, Winterer et al. similar RGA fingerprinting pattern with a similarity (1994) argued that varietals mixture was the best coefficient of 86 percent. However, the RGA fingerprints deployment strategy for rice blast, compared with gene between the hybrid and traditional varieties were pyramids and gene rotation. The emergence of complex considerably different with a similarity coefficient of or “super” races has not been observed in fields using 65 and 45 percent, respectively. The inoculation exper- varietal mixtures or multilines (Chin and Husin, 1982). iment using 30 rice seedlings infected by rice blast in a Rice varietals mixtures are commonly used in traditional greenhouse showed excellent resistance of the hybrid rice culture in Asia and Africa, for example, in Mada- varieties (virulence frequency 13.8 percent) and poor gascar and Indonesia (Bonman, Estrada and Denton, resistance of the traditional varieties (virulence frequency 1986). In Japan, multilines have been used successfully 86.2 percent). On the basis of genetic background in commercial production (about 90 000 ha) by varying differences, resistance to rice blast and the agro-economic the composition of individual components according to characteristics of various rice varieties, 15 treatments the prevailing pathogen population (K. Ishizaki, personal were designed. The hybrid rice varieties, Shanyou63 and communication). Chin and Husin (1982) showed that a Shanyou22, were used as the main crop, while the high- mixture containing 66 percent resistance component lines quality traditional rice varieties, Huangkenuo and Zigu, was adequate to control blast; whereas Koizumi (2001) were used as the mixed crop. Based on the planting model found that 75 percent resistance in a multiline was of hybrid rice in rows, one additional row of traditional required to reduce severity to the level of control achieved rice was planted between the wide rows (30 cm) of hybrid by fungicide treatments. rice at four-row intervals. In summary, there have been considerable activities in The results showed a significant reduction of rice blast expanding the genetic basis for resistance in the field to in most of the mixed plantings of hybrid rice and find new methods of using genetic diversity to control traditional rice varieties. With Huangkenuo monoculture, rice diseases in a sustainable manner. In recent years, average blast incidence was 32.43 percent and seventy interplanting experiments have been conducted in Yunnan index 0.12; but in mixed plantings, blast incidence was Agricultural University. On the basis of the genetic reduced to 1.80 percent and seventy index to 0.0055 (i.e. analysis of massive varieties, optimized varietal mixed planting of Huangkenuo and hybrid rice varieties combinations were chosen, interplanting was conducted achieved average blast control efficiency of on a large scale, and the control effects of rice blast were 95.35 percent). Another high-quality traditional variety, 35 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Zigu, produced average rice blast incidence of • hybrid rice varieties used as the main crop and high- 9.23 percent and seventy index of 0.0395, reduced to quality traditional rice varieties as the mixed crop; 1.43 percent and 0.005, respectively, in mixed planting • high-product short-stem japonica rice varieties used (i.e. mixed planting of Zigu with hybrid rice varieties as the main crop and high-quality high-stem achieved an average blast control efficiency of traditional rice varieties as the mixed crop. 87.3 percent). The results also demonstrated that when two hybrid rice varieties or two traditional varieties were Adjustment of sowing time planted together, the resistance increase was not as For convenient harvesting, it was required that different significant as that in the mixed planting of traditional and varieties had the same reaping time. Thus, sowing was hybrid rice varieties. adjusted according to the growth period of the different Statistical data show that grain yield in mixed planting varieties. For example, tall, high-quality traditional (hybrid and traditional rice varieties) was significantly varieties were sown 10 days earlier than modern, high- higher than in monoculture. The grain yield of the mixed yielding hybrid varieties. If their growth periods were planting of Shanyou63 or Shanyou22 with Huangkenuo approximately uniform, they could be sown at the same or Zigu varied from 8 576 to 8 795 kg/ha, with an time. additional yield increase of between 522.5 and 705 kg, and rates of yield increase were from 6.5 to 8.7 percent Transplanting pattern compared with Shanyou63 or Shanyou22 in monoculture. The traditional transplanting mode in Yunnan Province However, when rice varieties in mixed planting had a for monoculture was 15 × 15 × 30 × 15 × 15 × 30 cm, i.e. similar genetic background, the intercropping did not help every two rows there was a group with a 30-cm space to achieve significant yield increase. Significant yield between groups, and the space both between and within increase was mostly due to disease control and obvious the rows was 15 cm. The optimized planting mode among improvement of the lodging of traditional varieties in different varieties was based on the traditional trans- intercropped populations. planting mode with one additional row of traditional rice planted between the wide rows (30 cm) of hybrid rice at Scaling-up the technique of using genetic diversity for four-row intervals. The hybrid varieties were transplanted rice blast control as a single seedling per hill spaced with 15 cm between Technical instruction of large scale-up hills, whereas the traditional rice varieties were trans- Varietal combination planted with 4 to 5 seedlings per hill spaced with 30 cm Varietal combination was based on a comprehensive between hills. analysis of the resistance background, agronomic character, economic value, local cultivation conditions Total area of expansion and planting habits of farmers. The selection norm for The total expansion area in 95 counties of Yunnan resistance background was that genetic similarity had to Province, including Honghe, Wenshan, Baoshan, be less than 75 percent using RGA (rapid generation Dehong, Simao and Zhaotong, was 418 847 ha from 1998 advance) analysis. Tall varieties were combined with short to 2003. The total expansion area in 102 counties of varieties based on the requirement that the difference in Sichuan Province, including Chengdu, Zigong, Deyang, height had to be over 30 cm and the difference in maturity Guangyuan, Naijiang, Leshan and Yibing, was period no more than 10 days. To boost the participation 377 267 ha from 2002 to 2003. In 2001–03, it was of farmers, mixed plantings had to provide a comple- expanded to 10 651 ha in Hunan, Jiangxi and Guizhou mentary economic effect and meet the demands for both provinces. In total, it was 981 433 ha all over the country high yield and high quality. From 1999 to 2003, until 2003. 94 traditional varieties and 20 modern varieties were selected for 173 combinations and expansion in Yunnan Effect of mixture planting on blast control Province. In 2002 and 2003, 23 traditional varieties and From the survey results during 1998–2003 in Yunnan 38 modern varieties were selected for 112 combinations Province, the mean disease incidence for traditional and expansion in Sichuan Province. At present, there are varieties in mixture decreased by 71.96 percent and the two patterns of combination: mean disease index decreased by 75.39 percent compared 36 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

to monoculture. For modern varieties, the mean disease consumption and as insurance against blast epidemics. incidence in mixture decreased by 32.42 percent and the Pilot field experiments are being conducted using a blast- mean disease index decreased by 48.24 percent compared resistant traditional variety, Sirendah, and a susceptible to monoculture. The results during 2002–03 in Sichuan modern variety, Cirata, in disease hot spots in Lampung, Province showed that the mean disease incidence for Indonesia, to evaluate various interplanting schemes. glutinous varieties in mixture decreased 58.1 percent and Preliminary observations suggest that leaf blast severity the mean disease index decreased 67.4 percent. For at maximum tillering stage is less in the interplanted plots modern varieties, the mean disease incidence in mixture than the pure stand. decreased 28.6 percent and there was a decrease in the Rice tungro is a destructive disease and widespread in mean disease index of 35.5 percent. The planting regions the Philippines. Genetic diversity mixed planting exper- covered a range of eco-environments and the varieties iments were conducted in Iloilo in the Philippines mixing involved also had differing levels of resistance; as a result, seeds in a 1: 1 ratio of two rice varieties with similar plant between regions and variety combinations, yet greater types, eating quality and maturity, but with differing resis- differences were seen in the effects of blast control. tance to the tungro virus. Results from two crop seasons However, the effects of mixture planting for blast control revealed a 50 percent reduction in tungro incidence in were all higher than in the corresponding monoculture. the mixture compared to the pure stand. Farmers were There is evidence that mixture planting has universal receptive to the seed mixture and harvested the crop as a adoption. mixture; they saved the seeds to be sowed in the following planting (Cabunagan, personal communication). Effect of mixture planting on yield The 1998–2003 survey results for Yunnan Province reveal MECHANISMS OF USING GENETIC DIVERSITY TO that the average yield of traditional varieties in mixture CONTROL RICE BLAST increased to 4 753 kg/ha (117.4 percent higher than for Genetic difference of resistance and effects of disease monoculture). The average yield of modern varieties in control mixture increased by 748.29 kg/ha (9.39 percent higher The genetic differences in rice varieties have mostly than for monoculture). The 2002–03 results for Sichuan affected blast control (Sun et al., 2002). Yunnan Province showed that the average yield of modern Agricultural University analysed the relationship between varieties in mixture increased by between 534 and 600 kg/ the genetic differences of five indica varieties ha (6.74–7.48 percent higher than for monoculture). The (Shanyou63, Shanyou22, Hexi41, Chujing12 and 8162), average yield of glutinous varieties in mixture increased two traditional varieties (Huangkenuo and Zinuo) and to between 3 270 and 3 303 kg/ha (61.1–64.2 percent the disease control effects in mixtures using the RGA higher than for monoculture). technique. The results indicated that those varieties with a higher degree of polymorphism have good effects of Research in other countries disease control when planted in mixtures. The similarity The success achieved in Yunnan generated considerable between traditional varieties (Huangkenuo and Zinuo) interest in varietal diversification, and scientists in and indica varieties (Shanyou63 and Shanyou22) were Indonesia, the Philippines, Viet Nam and Thailand have 44 and 63 percent. Mixed planting between indica and carried out research on genetic diversity. japonica varieties was more efficient in rice blast Rice blast is considered the most limiting constraint suppression with apparent falling of disease incidence in upland rice production in Indonesia (Suwarno and and severity, and control effects were between 88.2 and Soenarjo, 2001). Unlike the situation in Yunnan, where 92.3 percent. There were no obvious effects of disease most traditional varieties are susceptible, the traditional control when the varieties with low genetic difference upland varieties in Indonesia have high to moderate levels were mixed. The disease control effect of mixture with of blast resistance. In contrast, the modern varieties Shanyou63 and Shanyou22 was 32.1 and 24.3 percent, released to farmers succumb to blast within 2 to 3 years and that of Huangkenuo and Zinuo was only 10.2 and (Hasanuddin, personal communication). Farmers would 7.5 percent. The differences among the other three like to plant higher-yielding modern varieties to raise their varieties were very small and the control effects were income, but they retain the traditional varieties for between 15.8 and 20.7 percent. 37 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Genetic structure of Pyricularia oryzae in mixtures micro-environment relative humidity was distinctly With Rep-PCR and differential varieties, the isolates of decreased when high-stem glutinous varieties were mixed rice blast from monoculture and mixture were analysed with short-stem hybrid varieties. at Yunnan Agricultural University (He et al., 2003). The results indicated that 251 isolates were grouped into six Silica content of varieties in mixtures genetic lineages. Isolates from monoculture of Shanyou63 To understand the mechanism of varietal diversification had low genetic diversity with a single dominant lineage; mixtures for blast and lodging management, two high- Huangkenuo gave the same results, except for slightly stem traditional varieties (Huangkenuo and Milexianggu) higher diversity. There were no dominant lineages in and one short-stem variety (Hexi41) for mixture extension mixtures with much higher genetic diversity. were chosen to study their silica content in mixture and There were seven races belonging to six groups (ZB, monoculture at Yunnan Agricultural University. The ZC, ZD, ZE, ZF and ZG) in fields of mixtures, four races results showed that the average silica content of traditional belonging to four groups (ZC, ZD, ZE and ZG) in fields variety in mixture was higher than in monoculture. At of glutinous monocultures and ten races belonging to three booting stage, the average silica content of Huangkenuo groups (ZA, AB and ZC) in fields of hybrid monocultures. in mixture increased by 14.55 percent over monoculture. There were more groups in fields of mixtures than of At maturation stage, the average silica content of monocultures, which was evidence of pathogen stabil- Huangkenuo in mixture increased 11.83 percent izing selection. The frequency of the dominant race compared to monoculture. The average silica content of (ZB13) in fields of hybrid monocultures was 50.0 percent, Milexianggu in mixture increased 14.81 percent while the frequency of the dominant race (ZG1) in fields compared to monoculture at booting stage, and at of glutinous monocultures was 70.0 percent, resulting in maturation stage it increased 16.47 percent. The results directional selection on the virulent race. It can be conclu- showed that the difference of silica content between ded that rice variety diversity once again benefited mixture and monoculture was significant at the markedly stabilizing selection on the pathogen. different level of 5 percent. The siliceous cells of traditional varieties in mixture were bigger, and their numbers Relative humidity in mixtures were more than those in monoculture (Yang’s unpublished One short-stem hybrid variety (Shanyou63) and two high- results). The reasons require further research. stem glutinous varieties (Huangkenuo and Zinuo) were In mixture planting, the diversity of pathogens used to study the relative humidity in mixtures by Yunnan increased, humidity decreased and silica content Agricultural University. When high-stem glutinous increased, all of which could help to control rice blast. varieties were grown alternatively with the short-stem However, for a thorough understanding of the mechanism, hybrid varieties, the surface areas covered with moisture further research is required into the spore distribution in droplets on a rice hill decreased significantly. In 2000, space, inductive resistance and the biochemical and for mixtures of the high-stem glutinous varieties and ecological interaction between plant and pathogen. Shanyou63, the average surface areas had a descent range of between 49.76 and 48.90 percent (compared with CONCLUSIONS monoculture: 47.50 to 48.20 percent in 2001). In the 1930s, before the Green Revolution took place, In 2000, for mixture of glutinous varieties and agricultural scientists recognized the great possibility of Shanyou63, the days in relative saturated humidity disease epidemics in large areas where only one variety (100 percent) decreased by 22 and 13 compared with was planted. In the FAO report on global genetic resources monoculture; days of relative humidity between 90 and and food production, the importance of genetic diversity 94 percent increased by 11 and 6; and days of relative for sustainable agriculture was emphasized. The survey humidity under 90 percent increased by 8 and 6. There carried out by Savary et al. (2000a and b) indicated that were similar results in 2001. For mixture, the days of genetic diversity was the key foundation of disease relative saturated humidity decreased 19 and 17 compared management. Thus, according to the biodiversity and with monoculture; days of relative humidity between ecological balance theory, different varieties or crops were 90 and 94 percent increased 11 and 6; and days of relative mix-cultured, with the aim of increasing the species in humidity less than 90 percent increased 8 and 6. The field the field and maintaining the stability of the agricultural 38 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

ecosystem. As a result of the competition among different Chin, K.M. & Husin, A.N. 1982. Rice variety mixtures in species, the damage caused by plant diseases was relieved disease control. Proceedings International Conference effectively. There was a significant reduction in the dosage of Plant Protection in the Tropics, p. 241-246. of pesticides used and in environmental pollution; as a Evenson, R.E. 1998. The economic value of genetic result, the quantity and quality of farm products were improvement in rice. In N.G. Dowling, S.M. Greenfield improved and development could be sustainable. & K.S. Fischer, eds. Sustainability of rice in the global Pesticides have been used in agriculture for no more food system, p. 303–320. Manila, IRRI. than 100 years. In conventional farming, genetic diversity Evenson, R.E. & Gollin, D. 2003. Assessing the impact of of resistance genes was one of the major factors for pest the green revolution, 1960–2000. Sci., 300: 758–762. control (Zhu et al., 2002). The issues highlighted in this Gibbons, J.W., Gonzalez, D. & Delgado, D. 2000. Use of paper offer key guidance for plant disease control in the lineage exclusion in a multi-objective rice breeding future. program. In D. Therreau, M.H. Lebrun, N.J. Talbot & J.L. Notteghem, eds. Advances in rice blast research, p. REFERENCES 146–153. Dordrecht, Kluwer Academic Publishers. Adhikari, T.B., Vera Cruz, C.M., Zhang, Q., Nelson, R.J., He, X.H., Yang, J., Wang, Y.Y., Zhou, H.P., Chen, J.B., Skinner, D.Z., Mew, T.M. & Leach, J.E. 1995. Genetic Li, Z.S., Li, Y. & Zhu, Y.Y. 2003. Analysis of genetic diversity of Xanthomonoas oryzae pv. oryzae in Asia. structure of Magnaporthe grisea in the fields of different Appl. & Environ. Microbiol., 61: 966–971. rice varieties. Appl. Ecol., 14(5): 733–736. Arboleda, M. & Azzam, O. 2000. Inter and intra-site Hittalmani, S., Parco, A., Mew, T.V., Zeigler, R.S. & genetic diversity of natural field population of rice tungro Huang, N. 2000. Fine mapping and DNA marker-assisted bacilliform virus in the Philippines. Archives Virology, pyramiding of the three major genes for blast resistance 145: 275–289. in rice. Theor. Appl. Genet., 100: 1121–1128. Ardales, E.Y., Leung, H., Vera Cruz, C.M., Mew, T.W., Imbe, T., Tsunematsu, H., Kato, H. & Khush, G.S. Leach, J.E. & Nelson, R.J. 1996. Hierarchical analysis Genetic analysis of blast resistance in IR varieties. In D. of spatial variation of the rice bacterial blight pathogen Tharreau, M.H. Lebrun, N.J. Talbot, & J.L. Notteghem across diverse agroecosystems in the Philippines. (eds). 2000. Advances in rice blast research, p. 1–8. Phytopathology, 86: 241–252. Dordrecht, Kluwer Academic Publishers. Azzam, O. & Chancellor, T.C.B. 2002. The biology, Inukai, T., Nelson, R.J., Zeigler, R.S., Sarkarung, S., epidemiology, and management of rice tungro disease in Mackill, D.J., Bonman, J.M., Takamure & Asia. Plant Disease, 86: 88–100. Kinoshita, I.T. 1994. Allelism of blast resistance genes Babujee, L. & Gnanamanickam, S.S. 2000. Molecular in near-isogenic lines of rice. Phytopathol., 84(11): 1278– tools for characterization of rice blast pathogen 1283. (Magnaporthe grisea) population and molecular marker- Khush, G.S. 1989. Multiple disease and insect resistance assisted breeding for disease resistance. Current Sci., 78: for increased yield stability in rice. In Progress in 248–257. irrigated rice research, p. 79–92. Manila, Philippines, Bonman, J.M. & Mackill, D.J. 1988. Durable resistance IRRI. to rice blast disease. Oryza, 25: 103–110. Khush, G.S. & Angeles, R.E. 1999. A new gene for Bonman, J.M., Estrada, B.A. & Denton, R.I. 1986. Blast resistance to race 6 of bacterial blight in rice, Oryza sativa management with upland rice cultivar mixtures. In L. Rice Genet. Newsl., 16: 92–93. Progress in upland rice research, p. 375-382. Manila, Khush, G.S. & Virmani, S.S. 1985. Breeding for disease IRRI. resistance. In Progress in plant breeding, p. 239–279. Bonman, J.M., Khush, G.S. & Nelson, R.J. 1992. Manila, Philippines, IRRI. Breeding rice for resistance to pests. Ann. Rev. Khush, G.S. & Virk, P.S. 2002. Rice improvement: past, Phytopathol., 30: 507–528. present, and future. In M.S. Kang, ed. Crop improvement: Chen, H., Wang, S. & Ahang, Q. 2002. New gene for challenges in the twenty-first century, p. 17–42. New bacterial blight resistance in rice located on chromosome York, Food Products Press. 12 identified from Minghui 63, an elite restorer line. Koch, M. & Parlevliet, J.E. 1991. Genetic analysis of, and Phytopathol., 92: 750–754. selection for, factors affecting quantitative resistance to 39 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Xanthomonas campestris pv. oryzae in rice. Euphytica, Savary, S., Willocqet, L., Elazegui, F.A., Castilla, N.P., 53: 235–245. Teng, P.S., Du, P.V., Zhu, D., Tang, Q., Huang, S., Lin, Koizumi, S. 2001. Rice blast control with multilines in X., Singh, H.M. & Srivastava, R.K. 2000b. Rice pest Japan. In T.W. Mew, E. Borromeo & B. Hardy, eds. constraints in tropical Asia: Characterization of injury Exploiting biodiversity for sustainable pest management, profiles in relation to production situations. Plant p. 1443–1458. Manila, Philippines, IRRI. Disease, 84: 341–356. Liu, E., Zhu, Y., Xiao, F., Luo, M. & Ye, H. 2003. Using Shanti, M.L., George, M.L.C., Vera Cruz, C.M., genetic diversity of rice varieties for sustainable control Bernardo, M.A., Nelson, R.J., Leung, H., Reddy, J.N. of rice blast disease. Scientia Agric. Sinica, 36(2): 164– & Sridhar, R. 2001. Identification of resistance genes 168. effective against bacterial blight pathogen in eastern India. Manwan, I., Sama, S. & Rizvi, S.A. 1985. Use of varietal Plant Disease, 85: 506–512. rotation in the management of rice tungro disease in Sun, Y., Wang, Y.Y., He, Y.Q., Fan, J.H., Chen, J.B. & Indonesia. Indonesia Agric. Res. Dev. J., 7: 43–48. Zhu, Y.Y. 2002. Analysis of resistance gene analogue McDonald, B.A. & Linde, C. 2002. Pathogen population for rice cultivars in Yunnan Province. Scientia Agric. genetics, evolutionary potential, and durable resistance. Sinica, 1(5): 502–507. Ann. Rev. Phytopathol., 40: 349–379. Suwarno, L.E. & Soenarjo, E. 2001. Breeding of upland Mekwatanakarn, P., Kositratana, W., Levy, M. & rice for resistance to blast in Indonesia. In K.M. Kosim, Zeigler, R.S. 2000. Pathotype and avirulence gene I. Prasadja & M. Syam, eds. Current status and future diversity of Pyricularia grisea in Thailand as determined direction, p. 7–14. Bogor, Central Research Institute for by rice lines near-isogenic for major resistance genes. Food Crops. Plant Disease, 84: 60–70. Wang, Y.Y., Fan, J.X., Zhao, J.J. & Zhu, Y.Y. 1998. The Mew, T.W. 1991. Disease management in rice. In: D. layout and rotation of rice varieties and blast control. J. Pimentel & A.A. Hanson, eds. CRC handbook of pest China Agric. Univ., 3 (suppl.): 12–16. management, 2nd ed. Vol. III, p. 279–299. Boca Raton, Winterer, J., Klepetka, B., Banks, J. & Kareiva, P. 1994. FL, CRC Press. Strategies for minimizing the vulnerability of rice pest Mew, T.W. 1992a. Management of rice diseases – A future epidemics. In P.S. Teng, K.L. Heong & K. Moody, eds. perspective. In A. Aziz, S.A. Kadir & H.S. Barlow, eds. Rice pest science and management, p. 53–70. Manila, Pest management and the environment in 2000, p. 54- Philippines, IRRI. 66. Wallingford, CAB International. Zhu, Y.Y., Chen, H.R., Fan, J.H., Wang, Y.Y., Li, Y., Mew, T.W., Vera Cruz, C.M. & Medalla, E.S. 1992b. Chen, J.B., Fan, J.X., Yang, S.S., Hu, L.P., Leung, H., Changes in frequency of Xanthomonas oryzae pv. oryzae Mew, T.W, Teng, P.S., Wang, Z.H. & Mundt, C.C. in response to rice cultivars planted in the Philippines. 2000. Genetic diversity and disease control in rice. Plant Disease, 76: 1029–1032. Nature, 406: 718–722. Ogawa, T., Yamamoto, T., Khush, G.S. & Mew, T.W. Zhu, Y.Y., Chen, H.R., Fan, J.H., Wang, Y.Y., Li, Y., He, 1991. Breeding of near-isogenic lines of rice with single Y.Q., Sun, Y., He, X.H., Zhou, J.Y., Fan, J.X., Yang, genes for resistance to bacterial blight pathogen S.S. & Ma, G.L. 2002. The theory and technique of using (Xanthomonas campestris pv. oryzae). Jap. J. of genetics diversity for rice blast control. In The blue book Breeding, 41: 523–529. of sciences development in China, p. 516–519. Beijing, Savary, S., Willocquet, L., Elazegui, F.A., Castilla, N.P. China Sciences and Technology Press. (in Chinese) & Teng, P.S. 2000a. Rice pest constraints in tropical Zhu, Y.Y., Chen, H.R., Fan, J.H., Wang, Y.Y., Li, Y., Fan, Asia: Quantification of yield losses due to rice pests in J.X., Yang, S.S., Ma, G.L., Chen, J.B., Li, Z.S. & Lu, a range of production situations. Plant Disease, 84: B.R. 2003. The use of rice varietal diversity for rice blast 357–369. control. Scientia Agric. Sinica, 36(5): 521–527. 40 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Searching for new plants for climate change1

J. Sheehy, A. Elmido, G. Centeno and P. Pablico International Rice Research Institute, Manila, the Philippines

The combined changes in air quality and composition, photosynthesis, increased maintenance respiration or acid rain and climate are producing a new bioclimate for both. Increased temperatures can also lead to increases food production systems. Models predict an increase in in the rate of crop growth and shortened growing seasons, rice yield with increased atmospheric levels of carbon which cause reduced interception of solar radiation and dioxide (Horie et al., 1995a). However, the potentially yield (Horie et al., 1995a). Ziska and Manalo (1996) beneficial effects of increases in carbon dioxide may be suggest that increasing night temperature can reduce seed- offset by increases in O3 at ground level (Maggs and set and potential yield of tropical rice, although the Ashmore, 1998). Despite average atmospheric partial mechanism is unclear and night temperatures as low as pressure of carbon dioxide increasing by approximately 29°C could result in reduced grain yield. Peng, Khush 4.6 Pa between 1968 and 1998, yields for the same and Cassman (2004) suggest that increased night cultivar (IR8) grown on the IRRI (International Rice temperatures reduce yields in the field. Recent evidence Research Institute) farm in 1998 were about 2.6 tonnes/ suggests that night temperature has been the cause of ha lower than in 1968 at nitrogen inputs of approximately increases in global mean temperatures since the middle 150 kg/ha (Peng et al., 1999). of the 20th century (Kukla and Karl, 1993). The highest air temperatures recorded are 49°, 53°, For crop plants, temperatures in the range of 45° to 54°, 57° and 58°C for the land masses of South America, 65°C can cause severe damage and death (Levitt, 1972). Australia, Eurasia, North America and Africa, respec- Fruit-set was reduced by 6 percent per °C at temperatures tively (Trewartha and Horn, 1980; Ahrens, 1991). The above 33°C in peanut (Vara Prasad et al., 2001). In rice, Third Assessment Report (TAR) of the Intergovernmental anthesis is the most temperature-sensitive stage for Panel on Climate Change (IPCC, 2001) forecasts that by damage. Exposure for a matter of a few hours during 2100, mean planet-wide surface temperatures will rise flowering can reduce floral reproduction (Satake and by between 1.4° and 5.8°C. At high temperature, the Yoshida, 1978; Nishiyama and Satake, 1981; Baker, Allen denaturation of proteins, melting points of lipids, damage and Boote, 1992). Osada et al. (1973) observed sterility to thylakoid membranes or other processes (e.g. at temperatures exceeding 35°C in the field; rice becomes pollination) disrupt normal plant function. Damage completely infertile at temperatures above 40°C average becomes permanent when it is not reversible (physio- daily maximum temperature during the flowering period logically or developmentally), thus eliminating the chance (Horie et al., 1995a). At this temperature, female sterility for processes to occur correctly. Reproductive events in can occur (Satake and Yoshida, 1978). Mackill, Coffman once-flowering plants (especially annual crops) are the and Rutger (1982) suggest that high temperature tolerance conspicuous example. There is only one chance in a year at the grain-filling stage should be investigated in order for pollen tubes to grow fast enough in lime trees (Tilia) to discover high heat tolerance genotypic difference in to set seed (Piggot and Huntley, 1981) or one opportunity pollen shedding, pollen germination and pollen tube in the crop growth cycle for anthesis to occur in rice. extension under high temperature. It is interesting to note Short of the critical temperature for catastrophic damage, that despite the fact that only one pollen grain successfully losses of yield can occur because the daily net acquisition introduces sperm cells into the embryo sac and micropyle, of carbohydrate can be reduced owing to reduced a minimum number (20 approx.) have to be deposited on

1 Gratitude is expressed to A. Ferrer and J. Dionora for their assistance in the preparation of this manuscript. 41 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

the stigma before pollen tubes elongate (Satake and practices were employed to achieve minimum possible Yoshida, 1978). Matsui, Omasa and Horie (2001) suggest stress from all biotic and abiotic factors so that yields that, rather than low numbers, poor germination is the could approach the maximum achievable yield in the cause of sterility at high temperature. Once a pollen tube weather conditions experienced (Sheehy et al., 1998). has entered the micropyle, all other pollen tubes cease To test the hypothesis that cultivars from different elongating and eventually degenerate. A complex thermal origins have different TDF, 96 cultivars were signalling process must take place in both cases. What selected from the IRRI germplasm collection. They were those signalling mechanisms are and whether they are selected from different latitudes and altitudes (surrogates disrupted by high temperature is unknown. for temperature at the origin of the germplasm); 91 were In this paper, some aspects of the climate and how it is Oryza sativa and five were O. glaberrima. All of the changing are described. The effects of year-to-year cultivars were grown in the field in 2000 and the cultivars weather variation on yield were calculated using data with the earliest TDF and latest TDF were grown again obtained at the IRRI farm in the Philippines. The main in 2001. The cultivars were sown in plots (1 × 2 m) and objective was to quantify the deleterious effects on rice each was replicated twice; they were transplanted at a of the higher temperatures that may be caused by climate spacing of 20 × 20 cm. A basal application of 60-60- change. The focus was on the identification of plants that 60 kg/ha NPK (N as urea, P as solophos and K as muriate might avoid damage to the reproductive processes leading of potash) and 10 kg/ha Zn (as zinc sulphate) was applied to sterility and subsequent loss of yield. One way of and they were later top-dressed with 60 kg/ha N at 30 and avoiding thermally induced sterility would be to complete 50 days after transplanting (DAT). The time of day at the reproductive processes in the cooler parts of the day. which the first flower on the main stem opened was Identifying genes that control the time of day when recorded during the period of flowering. flowering commences (TDF) would be crucial for that To test the hypothesis that wild rice types had a greater avoidance mechanism. The hypotheses were tested that range than cultivated types in TDF, 87 accessions were cultivars from different thermal origins have different selected from the IRRI germplasm collection. They were TDF and that wild rice accessions have a greater range selected to represent a wide range of countries with hot than cultivated types in TDF. climates. The wild types could not be grown in the field so they were grown in 2002 and 2003 in a screenhouse MATERIALS AND METHODS conforming to the appropriate protocols for such mater- Weather data ials. They were germinated in petri dishes for 14 days Weather data were collected from an agrometeorological and then four seedlings were transplanted at a spacing of station situated on the IRRI farm, Los Baños, the 20 × 20 cm into plastic buckets (diameter 45.5 cm, height Philippines, at 14°11’ north latitude, 121°15’ east 62.5 cm) containing lowland soil. A basal application of longitude and at an altitude of 21 m above sea level. Data 18.2 g per bucket of complete fertilizer (NPK) was recording began on 1 January 1979. The site measures applied. Subsequently, 2 g of nitrogen were added 10.5 × 9.5 m and is surrounded by irrigated rice monthly and the soil was kept saturated throughout the throughout the year. It conforms to the World Meteo- experiment. rological Organization standard specifications. Data for the acidity of rainwater, O3, SO2 and NOx were collected Model from a site adjacent to the IRRI wetland weather station. Ultimately, solar radiation is the energy source for growth The gas analysers and data logger were supplied by EMC and it has to be intercepted by the leaves of the canopy. Environment Engineering Limited, United Kingdom. There is a linear relationship between accumulated Data for continuous, diurnal changes in temperature for intercepted photosynthetically active solar radiation and 2003 were available and those data were used to calculate accumulated biomass when the crop is growing in the effects of TDF on the sterility of spikelets. adequate conditions of temperature, water and soil nutrient supply (Monteith, 1977). The slope of that linear Management relationship is known as radiation use efficiency (RUE). Irrigated rice crops were grown at IRRI, Los Baños, the In this work, the simple model of Sheehy et al. (2004) Philippines in the dry season (Jan.–May). Management based on RUE was used to predict yield. The value of 42 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

RUE used was 2.6 g DW/MJ (above-ground dry matter, the maximum dry season temperature. The deviation of intercepted photosynthetically active radiation [PAR]) and solar radiation in any year was calculated on the basis of it is the value obtained from very high-yielding rice the mean value of the 25 years. The deviation of temp- experiments (Mitchell, Sheehy and Woodward, 1998; erature from the linear regression (or from the mean value Sheehy et al., 2000; Horie, 2001). The effects of increases of 25 years – in the absence of a regression) was in temperature caused by climate change were simulated calculated. There was significant correlation between the by adding between 1° and 6°C to the daily values of deviations of solar radiation and the deviations of maxi- average temperature for the growing season of 1997 when mum temperature for both the wet and the dry seasons an RUE of 2.6 g DW/MJ was recorded. The model was (y = 0.23x, P < 0.05) showing that solar radiation caused used to calculate yield and to estimate separately: a) the much of the variation in maximum temperature. During effect of temperature on the length of the growing season; the wet season, a similar relationship existed for minimum and b) the additional effects of changes in maintenance temperature (y = 0.16x, P < 0.05). However, there was respiration caused by temperature. It was assumed that no significant relationship in the dry season, although the coefficient for maintenance respiration was 0.015 per the trend appeared to be negative. High solar radiation day (Thornley and Johnson, 1990) and the Q10 for on clear days may have been associated with increased temperature effects on the coefficient of respiration was back-radiation at night, so that sunny days may have been 1.22 with a reference temperature of 20°C (Sheehy, Cobby associated with cool nights. and Ryle, 1980; Frantz, Cometti and Bugbee, 2004). The model was driven by monthly averages of climatic data Weather variability and yield collected from the IRRI weather station. Climate change implies a gradual change in the weather which is expected to influence yield. Those gradual RESULTS AND DISCUSSION changes are masked by variations in annual weather Climate and aspects of change patterns – for example, El Niño and La Niña. In El Niño Measurements of the acidity of rainwater at IRRI were years, there are more clear days, less rainfall and increased taken over 5 years (1995–99). The annual trend in the solar radiation, whereas the opposite is experienced in mean pH of the rainfall followed a quadratic trend, La Niña years. To calculate the effects of weather variability on rice, the model of Sheehy et al. (2004) was y = 5.1288 - 0.0088x + 0.0000206x2 (1) where x is the day number (Jan. 1 = 1) and y is the pH. FIGURE 1 Increase in the average minimum temperature of the dry The minimum value (4.2) occurred at the end of July and season (solid circle) and wet season (open circle), at IRRI the maximum value (5.1) occurred in December. Los Baños, 1979–2003 a Measurements of gaseous SO at crop height showed 2 26 concentrations of less than 5 ppb – except after an 25 application of sulphur-containing fertilizer ([NH4]2SO4), when they rose to 25 ppb for a few days. On a sunny day, 24 the concentration of NOx reaches a maximum at 07.30 23 hours and the concentration of O3 reaches its maximum at 15.00 hours. The maximum concentration of both gases 22 was 55 ppb. The average value of O3 for April (i.e. the month of flowering) was 18 ppb and the maximum was (°C) Minimum temperature 21 55 ppb. 20 Between 1979 and 2003, minimum wet season 1975 1980 1985 1990 1995 2000 2005 temperatures were greater than dry season temperatures Year (both are increasing at approximately 0.04°C per year a [Figure 1]). Over the same period, there was a significant The lines through the data represent linear regressions between minimum temperature and year. For the wet season the function increase in the maximum wet season temperature (0.02°C is y = 0.0363x - 48.3 (r = 0.66, P < 0.001), and for the dry per year, P < 0.05). However, there was no increase in season the function is y = 0.0502x - 77.6 (r = 0.63, P < 0.001). 43 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

TABLE 1 Increasing temperatures can lead to shorter growing Predicted rice yields (tonnes/ha, 14%mc) for different seasons. For the 6°C increase, the predicted duration of weather conditions at Los Baños, Philippines the crop was reduced from 101 to 95 days and yields Year Weather Farmers' Maximum declined by 6 percent. The relationship between crop conditions yield attainable yield duration and the temperature increase is linear (y = -0.89x 1989 La Niña 7.5 8.9 < 1997 El Niño 9.6 11.4 + 100.25, P 0.001). Changes in crop duration are likely 1979–1999 Average 8.5 10.1 to be unimportant. It is commonly assumed that maintenance respiration Note: For the best yield currently achievable by farmers: RUE = 2.2 g DW/MJ. For the maximum attainable yield: RUE = 2.6 g increases with increasing temperature, although the DW/MJ. magnitude of this effect is unclear. To gain some insight into its possible impact over the 6°C rise in seasonal average temperature, its effect on RUE was calculated used. In particular, yields for irrigated rice in the dry (Mitchell, Sheehy and Woodward, 1998). RUE declined season were predicted for three weather data sets: from 2.6 to 2.0 g DW/MJ (y = -0.097x + 5.17, P < 0.001). • the average weather data at IRRI (1979–2003); When this effect was added to the shortening of crop • the weather data in 1997 (El Niño); and duration, the predicted yield fell from 11.4 to 8.2 tonnes/ • the weather data in 1989 (La Niña). ha (28 percent for a 6°C increase).

There are two possible future scenarios with respect to Fertility, temperature and time of day of flowering (TDF) the yield potential of rice. In the first, it is assumed that The most damaging effects of climate change on rice new high-yielding cultivars will be available to farmers yields can potentially come through the effect of enabling them to reach maximum attainable yield (RUE temperature on fertility. Events surrounding and including = 2.6 g DW/MJ) and in the second, it is assumed that the pollen tube extension in the hour following anthesis fail existing elite germplasm will be used by farmers adopting completely at temperatures between 35° and 40°C. Using the best management (RUE = 2.2 g DW/MJ). controlled environments, a decline in the fertility of For both scenarios (Table 1), farmers would obtain spikelets with increasing temperature was observed by 13 percent more yield in an El Niño year and 12 percent Satake and Yoshida (1978). A similar relationship between less in a La Niña year relative to the yield in an average the fertility of spikelets and maximum temperature was year. The biggest possible improvements in germplasm observed by Horie et al. (1995b) for plants growing in and management in the coming decades could increase temperature gradient tunnels. farmers’ yields by 18 percent. Yield improvements made Flowering, specifically fertilization, is not an instan- by plant breeders can easily be masked by fluctuations in taneous process. The elite indica-type rice cultivar, IR72, weather. Going from a La Niña to an El Niño year would has a large number of tillers and it flowers over approx- increase yield by 28 percent. imately 20 days. Breeding lines of the new plant type (Peng, Khush and Cassman, 1994) have a low number of Temperature, crop duration, respiration and yield tillers and they complete flowering in 1 week. Horie et al. (1995a) suggested that temperature increases The 96 cultivars selected from different latitudes and could result in serious decreases in yield across Asia. In altitudes flowered over several hours on any given day order to examine the effects on yield of an up to 6°C rise (Figure 2). There was no relationship between either in temperature caused by climate change, the model of latitude or altitude and TDF of the cultivated types. The Sheehy et al. (2004) and the weather data for 1997 were cultivar that flowered the earliest was Oryza glaberrima- used and it was assumed that harvest index remained Marori, which commenced flowering at 08.30 hours and constant. It was assumed that any potential benefits from finished at 13.30 hours. The cultivar with the latest TDF increasing CO2 were offset by degradation in air quality, was Oryza sativa-Ganja Ratria, which commenced such as increased concentration of tropospheric O3. For flowering at 10.00 hours and finished at 14.00 hours. these calculations, it was assumed that the greatest The wild rice accessions had a greater range of TDF improvements in germplasm and management would be than the cultivated types (Figure 2). Of the 87 wild rice made in the coming decades (RUE = 2.6 g DW/MJ). accessions, the one that had the earliest TDF was 44 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

FIGURE 2 in a 27 percent loss in fertility even with the accession Frequency distributions of the time of day when flowering commences (TDF) in wild rice accessions (filled bars) and with the earliest TDF observed in this work. For a 6°C rice cultivars (unfilled bars) a increase in seasonal average temperature, yields would decline by 28 percent owing to changes in respiration and 75% crop duration, and then by a further 85 percent owing to sterility, giving a total yield loss of 89 percent.

50% CONCLUSION The rates at which plants develop are a function of temperature, but some crucial processes such as reprod- Frequency 25% uction have a critical temperature bandwidth outside of which irreversible damage occurs. Given that the response of fertility to temperature is almost identical in species as different as Oryza and Tilia cordata, it is likely that the 0% 5.00 8.00 11.00 14.00 17.00 20.00 23.00 mechanisms that get damaged by high temperature are similar for many plant species. In cultivated rice, at Time of day of flowering, TDF (h) maximum temperatures of over 33°C, fertility falls at a Materials were obtained from the IRRI gene bank. about 14 percent per °C. It has been shown that early TDF can protect fertility from future adverse effects of climate change. Wild rice accessions have a wider range O. eichingeri, which commenced flowering at 05.40 of TDF than cultivated rice. No systematic relationship hours and finished at 06.00 hours. The accession that of TDF with the latitude or with the altitude of the origin flowered the latest was O. alta, which commenced of a cultivar was observed. The mechanisms controlling flowering at 22.30 hours and finished at midnight. Similar TDF are not well understood and Nishiyama and Satake observations for those accessions were reported by (1981) suggest that one extra hour of darkness could delay Matsuo and Hoshikawa (1993). Of the 87 wild rice the time of day when the treated plants flowered. accessions, 21 did not flower. Of the remaining 66, there Nonetheless, discovering the genes that control TDF may were 48 with a similar TDF in each of the two be of universal importance. experimental years. It has been suggested (Ziska and Manalo, 1996; Peng If the sterility of spikelets is defined as ψ and the et al., 2004) that increasing night temperature can reduce fertility as ϕ, then ψ = 1 - ϕ. The relationship between seed-set. It has been shown that seasonal average fractional sterility and maximum temperature (Tm) as minimum temperatures are increasing by 0.4°C every observed by Horie et al. (1995a) can be written as: 10 years. Increases in seasonal temperature could cause yields to decline by at least 5 percent for every 1°C ψ = 1 - 1/(1 + exp(0.853(Tm - 36.6))) (2) increase because of greater maintenance respiration and so that at 36.6°C, the fractional sterility and fertility are both 0.5. Spikelet sterility increased from 20 to 95 percent as temperature increased from 35° to 40°C, respectively. TABLE 2 The effect of increasing the maximum temperature during For the purposes of this paper, the maximum temperature flowering on the sterility of rice is assumed to occur 4 hours after the start of flowering. To test the benefits of changing TDF, equation (2) was Temperature Sterility (%) increase used to estimate the effects of a 2°, 4° and 6°C temperature a b c increase on sterility in a current elite cultivar, 2°C 16 11 1 4°C 52 39 6 O. glaberrima-Marori, and O. eichingeri (Table 2). It can 6°C 85 78 27 be seen that the adverse effects of a 2° or 4°C increase in Note: a) Current elite cultivar with a TDF of 10.00 hours; b) temperature could be largely avoided if the TDF was Cultivated rice with a TDF of 08.30 hours; c) Wild rice with a 05.40 hours. However, a 6°C increase would still result TDF of 05.40 hours. 45 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

reduced crop duration. However, there is little or no Horie, T. 2001. Increasing yield potential in irrigated rice: information concerning the respiratory behaviour of the breaking the yield barrier. In S. Peng & B. Hardy, eds. rice crop throughout its growth cycle; furthermore, the Proceedings of the International Rice Research relationship between respiration and temperature remains Conference on Rice Research for Food Security and obscure. The mechanisms through which night temp- Poverty Alleviation, p. 3–25. Los Baños, Philippines, erature could directly affect seed-set are also unknown. IRRI. Changes in weather can cause large variations in the IPCC. 2001. Climate change 2001: Synthesis Report. yield of irrigated rice and they can mask the more gradual, (edited by R.T. Watson and the Core Writing Team), but substantial effects of climate change. It has been Cambridge University Press. 397 pp. shown that acid rain, NOx and O3 are at levels that could Kukla, G. & Karl, T.R. 1993: Night-time warming and the affect yield (Maggs and Ashmore, 1998; Mansfield, 1999 greenhouse effect. Environ. Sci. and Technol., 27: 1468– and 2002) and their combined effects on yield warrant 1474. further study. Increasing CO2 concentration adversely Levitt, J. 1972. Responses of plants to environmental affects floral sterility (Ziska, Manalo and Ordonez, 1996; stresses. New York, Academic Press. Matsui et al., 1997). This paper has not explored the Mackill, D.J., Coffman, W.R. & Rutger, J.N. 1982. Pollen combined effects of increasing CO2 concentrations and shedding and combining ability for high temperature in gaseous pollutants (which have opposite effects on rice. Crop Sci., 22: 730–733. photosynthesis). Furthermore, it is recognized that air Maggs, R. & Ashmore, M.R. 1998. Growth and yield temperature can be a poor guide to tissue temperature responses of Pakistan rice (Oryza sativa L.) cultivars to

(Nishiyama, 1981; Sheehy et al., 1998). O3 and NO2. Environ. Pollut., 103: 159–170.

Finally, plants are most sensitive to water stress during Mansfield, T.A. 1999. SO2 pollution: a bygone problem or the reproductive period. A pre-dawn TDF might help a continuing hazard? In M.C. Press, ed. Physiological plants avoid the damaging effects on yield of both high plant ecology, p. 219–240. Oxford, United Kingdom, temperature and water stress. Blackwell Science. Mansfield, T.A. 2002. Nitrogen oxides: old and new REFERENCES challenges. In J.N.B. Bell & M. Treshow, eds. Air Ahrens, C.D. 1991. Meteorology today: an introduction to pollution and plant life, p. 119–133. John Wiley and Sons, weather, climate and the environment. St Paul, Ltd. Minnesota, West. Matsui, T., Namuco, O.S., Ziska, L.H. & Horie, T. 1997. Baker, J.T., Allen, L.H. Jr. & Boote, K.J. 1992. Effects of Effects of high temperature and CO2 concentration on

CO2 and temperature on growth and yield of rice. J. Exp. spikelet sterility in indica rice. Field Crops Res., 51: 213– Bot., 43: 959–964. 219. Frantz, J., Cometti, N. & Bugbee, B. 2004. Night Matsui, T., Omasa, K. & Horie, T. 2001. The difference temperature has a minimal effect on respiration and in sterility due to high temperatures during the flowering growth in rapidly growing plants. Ann. of Bot., 94: 155– period among japonica-rice varieties. Plant Prod. Sci., 166. 4: 90–93. Horie, T., Nakagawa, H., Centeno, H.G.S. & Kropff, M.J. Matsuo, T. & Hoshikawa, K. 1993. Science of the rice 1995a. The rice crop simulation model SIMRIW and its plant. Vol. 1, Morphology. Tokyo, Food and Agriculture testing. In R.B. Matthews, M.J. Kropff, D. Bachelet & Policy Research Center. 686 pp. H.H. van Laar, eds. Modeling the impact of climate Mitchell, P.L.M., Sheehy, J.E. & Woodward, F.I. 1998. change on rice production in Asia, p. 51–66. Wallingford, Potential yields and the efficiency of radiation use in rice. CAB International (in association with IRRI, Manila, IRRI Discussion Paper Series no. 32. Manila, Philippines, Philippines). IRRI. Horie, T., Nakagawa, H., Nakano, J., Hamotani, K. & Monteith, J.L. 1977. Climate and the efficiency of crop Kim, H.Y. 1995b. Temperature gradient chambers for production in Britain. Phil. Trans. R. Soc. London B, 281: research on global environment change. III. A system 277–294. designed for rice in Kyoto, Japan. Plant Cell Environ., Nishiyama, I. 1981. Temperature inside the flower of rice 18: 1064–1069. plants. Jpn. J. Crop Sci., 50: 54–58. 46 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Nishiyama, I. & Satake, T. 1981. High temperature damage Sheehy, J.E., Mitchell, P.L., Beerling, D.J., Tsukaguchi, in rice plants. Jpn. J. Trop. Agr., 25: 14–19. T. & Woodward, F.I. 1998. Temperature of rice Osada, A., Sasiprapa, V., Rahong, M., Dhammanuvong, spikelets: thermal damage and the concept of a thermal S. & Chakrabandho, H. 1973. Abnormal occurrence burden. Agronomie, 18: 449–460. of empty grains of indica rice plants in the dry, hot season Sheehy, J.E., Mitchell, P.L., Dionora, M.J.A., in Thailand. Proc. Crop Sci. Soc. Jpn., 42: 103–109. Tsukaguchi, T., Peng, S.B. & Khush, G.S. 2000. Peng, S., Khush, G.S. & Cassman, K.G. 1994. Evaluation Unlocking the yield barrier in rice through a nitrogen- of a new plant ideotype for increased yield potential. In led improvement in the radiation conversion factor. Plant K.G. Cassman, ed. Breaking the yield barrier: Production Sci., 3: 372–374. Proceedings of a Workshop on Rice Yield Potential in Sheehy, J.E., Peng, S., Dobermann, A., Mitchell, P.L., Favorable Environments, p. 5–20. Manila, Philippines, Ferrer, A., Jianchang Yang, Yingbin Zou, Xuhua IRRI. Zhong & Jianliang Huang. 2004. Fantastic yields in Peng, S., Cassman, K.G., Virmani, S.S., Sheehy, J.E. & the system of rice intensification: fact or fallacy? Field Khush, G.S. 1999. Yield potential trends of tropical rice Crops Res., 88: 1–8. since the release of IR8 and the challenge of increasing Thornley, J.H.M. & Johnson, I.R. 1990. Plant and crop rice yield potential. Crop Sci., 39: 1552–1559. modelling: a mathematical approach to plant and crop Peng, S., Jianliang Huang, Sheehy, J.E., Laza, R.C., physiology. Oxford, United Kingdom, Clarendon Press. Visperas, R.M., Xuhua Zhong, Centeno, H.G.S., Trewartha, G.T. & Horn, L.H. 1980. An introduction to Khush, G.S. & Cassman, K.G. 2004. Rice yields decline climate. London, McGraw–Hill. with higher night temperature from global warming. Proc. Vara Prasad, P.V., Crauford, P.Q., Kakani, V.G., Natl. Acad. Sci. USA, 101: 9971–9975. Wheeler, T.R. & Boote, K.J. 2001. Influence of high Piggot, C.D. & Huntley, J.P. 1981. Factors controlling the temperature during pre-and post-anthesis stage of floral distribution of Tilia cordata at the northern limits of its development on fruit set and pollen germination in geographical range 111 Nature and cause of seed sterility. peanut. Aust. J. Plant Physiol, 28: 233–240. New Phytol., 87: 817–839. Ziska, L. & Manalo, P. 1996. Increasing night temperature Satake, T. & Yoshida, S. 1978. High temperature induced can reduce seed set and potential yield of tropical rice. sterility in indica rice at flowering. Jap. J. of Crop Sci., Aust. J. Plant Physiol., 23: 791–794. 47: 6–17. Ziska, L., Manalo, P. & Ordonez, R. 1996. Intraspecific Sheehy, J.E., Cobby, J.M. & Ryle, G.J.A. 1980. The use variation in the response of rice (Oryza sativa L.) to

of a model to investigate the influence of some increased CO2: Growth and yield of response of 17 environmental factors on the growth of perennial cultivars. J. Exp. Bot., 47: 1353–1359. ryegrass. Ann. of Bot., 46: 343–365. 47 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Selection of interspecific hybrids (O. sativa × O. glaberrima) or lowland NERICAs and intraspecifics adapted to rainfed lowland growing conditions

M. Sié,a S.Y. Dogbe b and M. Coulibaly c a Breeder, The Africa Rice Center, Cotonou, Benin b Breeder, Agronomical Research Institute of Togo, Kpalime, Togo c Breeder, Institute of Rural Economy, Niono, Mali

Rice production potential in lowland ecologies is possible several interspecific and intraspecific crosses increasingly threatened by weed pressure and other biotic (Jones et al., 1996). The descents obtained were mostly constraints. To face the problems of weed competi- tested only in strict upland conditions. Interesting selected tiveness, the majority of farmers only have access to lines obtained are being disseminated in several countries manual weeding methods which require a lot of manual in the subregion. The spectacular success of these upland labour in a limited time period. Social changes in rural lines, which combine good productivity with better weed regions – in particular a pronounced population exodus competitiveness, opened the way to further evaluation in – have meant that manual weeding operations have lowland conditions of the genetic potential of inter- and become irregular: farmers’ efforts are penalized resulting intraspecific crosses available in WARDA. in major losses in rice production. Studies were carried out in Burkina Faso (2000–01) In the face of this negative situation, WARDA (The and in Togo (2002–03). The purpose was to exploit in a Africa Rice Center) scientists took up the challenge to judicious way the variability of genetic material in develop a farming system more adapted to lowland segregation in WARDA in order to select lines which ecologies, flexible in the use of manual labour, requiring have the capacity to plug the constraints of rainfed ecology a minimum of investment, and ensuring the food security cultivation (dryness, weeds, RYMV [rice yellow mottle of the rural population. Such a system is centred on the virus] disease, iron toxicity, gall midge) and which also development of plant material with horizontal resistance have high potential for yield and quality. to the biotic constraints of this environment where such varieties are not usually used (Dingkuhn and Randolph, MATERIAL AND METHODS 1996). Plant material Thus, WARDA developed the concept of “plant type The segregating populations comprise interspecific lines with low input”. This emanates from recent scientific (O. glaberrima × O. sativa indica) and intraspecific lines results: the success of interspecific hybridizations of (O. sativa indica × O. sativa japonica, O. sativa indica O. sativa × O. glaberrima (Jones et al., 1997) and × O. sativa indica × O. sativa japonica, O. sativa identification of the availability of manual labour as a japonica × O. sativa japonica) from the WARDA Sahel constraint to the increase of rice production in rural areas Station at Saint-Louis (Senegal) and from the WARDA (Richards, 1985). Studies were undertaken (beginning in headquarters site at M’bé, near Bouaké (Côte d’Ivoire), 1992) to better understand the expression of interesting for the crosses O. glaberrima × O. sativa japonica. The characters in the species O. glaberrima so as to exploit lines coming from Saint-Louis were screened at the potential in an interspecific programme of hybridization beginning for RYMV in semi-artificial conditions of for upland and lowland rice. This programme made infection. 48 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Methods DATA ANALYSIS Burkina Faso The data were analysed with Genstat and Statistica The study in Burkina Faso was carried out over 2 years software for the agromorphological and entomological (2000–01). In 2000, 571 lines were evaluated for several variables. Excel software was used for phytopathology characteristics, including plant vigour, vegetative cycle, variables and fluctuations in the water table. height, homogeneity, tillering, the form and density of the panicles, and the grain shape. The experiment was Results and discussion carried out in lowlands at the Banfora research station in Burkina Faso the southwest of the country. The trial layout comprised Agromorphological and entomological characters two rows of 2.5 m per line. Two checks (BG90-2 sensitive The lines coming from Saint Louis in Senegal were first to RYMV and the tolerant type FKR 33) were included screened for susceptibility to RYMV under semi-artificial at the beginning of the plot and after every 50 lines. conditions of infection. There are two distinct groups of A pre-drilling base application of 200 kg/ha of NPK lines: (14-23-14) was made, followed by a total of 150 kg/ha • Group I includes almost all the studied genotypes of urea in three applications of 50 kg/ha at the first and contains those lines having medium to high weeding, panicle initiation and booting stages. In year 2 tillering, long and dense panicles with medium (2001), 91 lines resulting from the synthesis of the first duration from sowing to maturity. selection were evaluated on two sites (in the lowland • Group II includes lines characterized by poor valley fringe and valley bottom) for their homogeneity tillering, relatively long and not very dense panicles, and stability under the same conditions of cultivation. with short duration from sowing to maturity. The following factors were observed: plant vigour at 15 days after sowing; tillering at 90 days after sowing; height Diseases: leaf blast and rice yellow mottle virus of the plant to maturity; homogeneity of the lines; the No severe symptoms of blast or RYMV were observed general behaviour with respect to the principal diseases on any of the lines. However, some exceptions were noted and principal insects; growing cycles; grain quality. within the O. glaberrima × O. sativa group in the valley bottom. The behaviour of the checks BG90-2 and FKR 33 Togo is similar to that of all the lines. Only IR50 of the Spreader The studies in Togo were carried out in 2002 and 2003. row expressed very severe symptoms of neck blast In 2002, 205 lines were evaluated for characteristics (score 7 in 2000 wet season). including plant vigour, vegetative cycle, height, homo- Biotic stresses were low throughout the life cycle of geneity, tillering, the form and density of the panicles, the rice seedlings in the two programmes. BG90-2, a and the format of the grains. The experiment at the variety highly sensitive to RYMV, did not express severe lowland Adeta research station was designed with five signs of RYMV, while FKR 33 confirmed its status as a rows, each with lines of 5 m. A check variety was used at variety tolerant to RYMV (Coulibaly, 1999). Some the beginning of the plot and at every 10 lines. These genotypes derived from O. glaberrima × O. sativa indica tests were carried out under low input conditions (100 kg/ crosses (WAS 127, WAS 131) and O. sativa japonica × ha of 15-15-15 pre-sowing + 50 kg/ha of urea). The O. sativa indica (WAS 115) appeared most sensitive to selection was carried out collaboratively by three national blast in the first year. breeders from the subregion (Burkina Faso, Mali and Ultimately, all the lines can be retained for the selection Togo). In year 2 (2003), 52 lines resulting from the process because severe signs of the two diseases could synthesis of the first selection were evaluated on four not be observed. In the 2001 wet season, the stresses were sites (favourable lowland and unfavourable lowland not sufficiently severe (judging by the behaviour of the ecologies) to determine homogeneity and stability under sensitive checks). Twenty-five lines showed sensitivity similar growing conditions. The following observations to the virus disease. were made: plant vigour at 15 days after sowing; tillering at 90 days after sowing; height of the plant to maturity; Insects homogeneity of the lines; the general response to principal They have low sensitivity to insect attacks, but exceptions diseases and insects; duration; and grain quality. remain within each group. Indeed, the presence of 49 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

silvershoots and deadhearts is 2 to 4 percent for the IR64//TOG 5681/4 * IR64 and 32 XUAN5C/IR4630-22- interspecific hybrids O. glaberrima × O. sativa japonica. 2. For the cycle from sowing to 50 percent flowering, The percentages recorded in the same group for the white 25 lines took 60 to 70 days, 25 lines 71 to 80 days and panicles variable were less than 3 percent. In the two lines took more than 81 days. interspecific hybrid group (O. sativa indica × O. sativa Twenty-nine lines with a selection score from 3 to 4 indica, O. sativa indica × O. sativa japonica, O. sativa can be selected on the basis of the synthesis of second- japonica × O. sativa japonica), 16 crossings from year observations of the four experiments. Among them 36 crosses displayed “onion tube” symptoms with an are 11 interspecific lines, three of which with a score of 4. average percentage of attack ranging from 5 to 15 percent. Their characteristics owe much to the fact that they result This same tendency was observed in the 2001 wet season. primarily from crossings between the species All the lines expressed sensitivity to gall midge, with O. glaberrima (TOG 5681) and O. sativa (IR64). The scores varying from 4 to 58 percent. presence of these interspecific hybrids was interesting. Ndjiondjop et al. (1996) also used the same parents in Togo molecular studies work which aimed to transfer the In the first year in Togo, selection of the best lines was character of RYMV resistance from O. glaberrima to carried out collaboratively by three breeders (Burkina, O. sativa. An interspecific line resulting from the cross, Mali and Togo). Of the 205 lines, 52 lines were selected. TOG 5674 × IR31785, was also selected. Disease was not generally noted on all the lines. In the For intraspecific lines, the most interesting generally classification of lines by the type of crossing, TOG 5681/ come from crosses of the varieties 32 XUAN 5C and 2 * IR64//IR64 came out on top with nine lines, followed Jaya with the IR lines. Two lines resulting from Jaya × by JAYA/BASMATI 370, JAYA/IR67410-84-2-3-2-1, Basmati were also selected.

FIGURE 1 Tillering and yield of selected lines in Togo

No. tillers/hill Yield (kg/5m2) 30 4.5 4 25 3.5 20 3 2.5 15 2 10 1.5 1 5 0.5 0 0

GR-6 GR-9 GR-2 GR-9 GR-24GR-10 -B-T

7-2-FKR-1-TGR-89 S197-B-5-2-TGR-11 WAS191-1-7-TGR-90 WAS 196-B-4-3-TGR-7 S173-B-B-13-7-TGR-21 WAS194-B-2-1-TGR-17 WAS169-B-B-4-2-TWAS173-B-B-4-2-TGR-4WAS170-B-B-6-3-TWA S49-B-B-9-1-4-3-TGR-94 WAS175-B-21-4-TGR-15WAS170-B-B-4-2-TGR-16WAS169-B-B-5-3-TGR-26WAS170-B-B-1-1-TGR-29 WAS170-B-B-14-6-T WA WAS191-9-WAB WA WAS163-B-5-3-FKR1-T WAS57-B-B-3-1-4-6-TGR-122WAS161-B-6-WAB-B-TGR-16WAS191-10-WAB-B-TGR-23 WAS50-B-B-24-4-2-4-TGR-116 WAS50-B-B-24-4-2-3-TGR-119 WAS57-B-B-17-13-3-10-TGR-97 2 WAS129-IDSA-B-WAS-1-3-TGR-128WAS122-IDSA-11-WAS-10-2-TGR-60WAS122-IDSA-15-WAS-6-1-TGR-103 No. tillers/hill Yield kg/5m WAS122-IDSA-1-WAS-2-WAB-1-T WAS122-IDSA-1-WAS-2-WAB-2-TGR-7 WAS122-IDSA-13-WAS-10-WAB-B-TGR-5WAS122-IDSA-10-WAS- 50 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

FIGURE 2 Yield potential variability of lines on four experimental sites in Togo

Coefficient of variation CV (%) 40

35

30

25

20

15

10

5

0 WAS191-1-7-TGR-90 WAS 196-B-4-3-TGR-7 WAS197-B-5-2-TGR-11 WAS194-B-2-1-TGR-17 WAS169-B-B-4-2-TGR-2 WAS173-B-B-4-2-TGR-4 WAS170-B-B-6-3-TGR-9 WAS175-B-21-4-TGR-15 WAS170-B-B-4-2-TGR-16 WAS169-B-B-5-3-TGR-26 WAS170-B-B-1-1-TGR-29 WAS173-B-B-13-7-TGR-21 WAS170-B-B-14-6-TGR-10 WAS191-9-WAB-B-TGR-24 WAS49-B-B-9-1-4-3-TGR-94 WAS191-10-WAB-B-TGR-23 WAS163-B-5-3-FKR1-TGR-9 WAS57-B-B-3-1-4-6-TGR-122 WAS161-B-6-WAB-B-TGR-16 WAS50-B-B-24-4-2-3-TGR-119 WAS50-B-B-24-4-2-4-TGR-116 WAS57-B-B-17-13-3-10-TGR-97 WAS129-IDSA-B-WAS-1-3-TGR-128 WAS122-IDSA-15-WAS-6-1-TGR-103 WAS122-IDSA-11-WAS-10-2-TGR-60 WAS122-IDSA-1-WAS-2-WAB-2-TGR-7 WAS122-IDSA-1-WAS-2-WAB-1-TGR-6 WAS122-IDSA-13-WAS-10-WAB-B-TGR-5 WAS122-IDSA-10-WAS-7-2-FKR-1-TGR-89

If tillering is considered, the data collected vary from of hybrids. The earliest lines were: WAS 122-IDSA 11- 8 to 24 tillers per hill. The interspecific lines produced WAS 10-2-TGR 60, WAS 57-B-B-17-13-3-10-TGR 97, the greatest number of tillers (12 to 24 tillers per hill). WAS 57-B-B-3-1-4-6-TGR 122 and WAS 170-B-B-1-1- These observations confirm those made by Jones et al. TGR 29. Five interspecific lines: WAS 122-IDSA 13- (1996), who noted that interspecific O. glaberrima × WAS 10-WAB-B-TGR 5, WAS 191-9-WAB-TGR 24, O. sativa had a very high tillering capacity, which WAS 122-IDSA 1-WAS 2-WAB-1-TGR 6, WAS 191-1- predisposed them to be more competitive with weeds. 7-TGR 90 and WAS 122-IDSA 1-WAS 2-WAB 2-TGR For evaluation of yield potential (on 5 m2), the yields 7, and two intraspecific lines: WAS 173-B-B-13-7-TGR obtained range from 2 to 4 kg per 5 m2. The interspecific 21 and WAS 173-B-B-4-3-TGR 4, had longer duration lines performed as well as the intraspecifics. No correl- cycles. ation was observed between productivity and tillering (Figure 1). However, according to the coefficients of CONCLUSIONS variation, 17 lines displayed stability across the four sites Burkina Faso (CV < 16%). The interspecific line, WAS 191-1-7-TGR 90, During 2000 and 2001, intra- and interspecific lines were and the intraspecifics, WAS 170-B-B-4-2-TGR 16 and WAS evaluated. At the end of this agromorphologic evaluation, 170-B-B-1-1-TGR 29, were particularly stable (Figure 2). carried out on the basis of their behaviour with respect to The sowing to maturity cycle ranges from 103 to insects and diseases, some lines were retained for their 123 days. There is no demarcation between the two types adaptability to lowland conditions. During the 2000 wet 51 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

TABLE 1 Lines displaying good behaviour with respect to rice blast, Burkina Faso

Intraspecific lines 1. WAT 1176-B-FKR-B-B ITA 123/ITA 414 2. WAT 1184-B-FKR-B-B FAROX 308-35-1-2/TOX 3226-5-2-2-2 3. WAT 1191-B-FKR-B-B TOX 3093-35-2-3-3/TOX 3226-5-2-2-2 4. WAS 114-B-FKR-B-B ITA 305/IR13240-2-2-3 5. WAS 129-B-FKR-B-B FOFIFA 62/BG 90-2//IR 13240-108-2-2-3 Interspecific lines 6. WAS 122-IDSA-1-B-FKR-B-B TOG 5681/3*IR 64 7. WAS 122-IDSA-1-2-FKR-B-B TOG 5681/3*IR 64 8. WAS 122-IDSA-1-WAS-6-1-FKR-B-B TOG 5681/3*IR 64 9. WAS 191-8-3-FKR-B-B IR 64 // TOG 5681/4*IR 64 10. WAS 191-9-3-FKR-B-B IR 64 // TOG 5681/4*IR 64 season, 15.9 percent of the lines were selected: 92 of présentée devant l’Université de Ouagadougou pour 571 intra- and interspecific lines. In the 2001 wet season, l’obtention du grade de Docteur 3eme cycle (sciences 91 lines were established, from which 15 lines were appliquées), option: biologie et écologie végétale. 106 pp. selected and replanted in the Banfora lowland during the Dingkuhn, M. & Randolph, T.F. 1996. The potential role 2002 dry season. Of these 15, those that displayed good of low-management rice technology during the behaviour with respect to rice blast are shown in Table 1. agricultural transition in West Africa. In Proceedings A joint mission of breeders from Mali, Burkina Faso Workshop: Africa-Asia Joint Research on Interspecific and Togo, together with the ROCARIZ (West and Central Hybridisation between the African and Asia Rice Species Africa Rice Research and Development Network) O. glaberrima and O. sativa, ADRAO, Bouaké, Côte coordinator, confirmed the good behaviour of these sel- d’Ivoire, 16–18 Dec. 1996, p. 3–9. ected lines. A joint selection retained the following lines: Jones, M.P., Audebert, A., Mande, S. & Aluko, K. 1996. WAS 122-IDSA-1-B-FKR-B-B, WAS 122-IDSA-1-2- Characterization and utilisation of Oryza glaberrima FKR-B-B, WAS 122-IDSA-1-WAS-6-1-FKR-B-B and Steud. in upland rice breeding. In Proceedings Workshop WAT 1176-B-FKR-B-B, to be evaluated in behaviour tests Africa-Asia Joint Research on Interspecific Hybridisation on the two toposequences and under irrigated rice- between the African and Asia Rice Species O. glaberrima growing conditions with total water control. and O. sativa, ADRAO, Bouaké, Côte d’Ivoire, 16–18 Dec. 1996, p. 43–59. Togo Jones, M.P., Dingkuhn, M., Aluko, G.K. & Semon, M. The selection of the progeny of inter- and intraspecific 1997. Interspecific O. sativa L. × O. glaberrima Steud. crossings over two consecutive years made it possible to progenies in upland rice improvement. Euphytica, 92: identify lines of great interest from the point of view of 237–246. their general agronomic characteristics. The results also Ndjiondjop, M.N., Lorieux, M., Sequier, J., Fargette, D., stress the importance of carrying out selection Reversat, G., Second, G. & Ghesquière, A. 1996. collaboratively. This strategy makes it possible to produce Application des marqueurs moléculaires et de la material rapidly for evaluation, particularly when there cartographie génétique à l’utilisation du potentiel de is a pressing demand for new varieties adapted to lowland l’espèce africain de riz cultivé (O. glaberrima Steud.) en rice cultivation. Evaluation of the 29 lines selected in amélioration des plantes. In Proceedings Workshop: Togo must continue in an integrated way with the aim of Africa-Asia Joint Research on Interspecific Hybridisation identifying those that best overcome the constraints of between the African and Asia Rice Species O. glaberrima lowland cultivation. and O. sativa, ADRAO, Bouaké, Côte d’Ivoire, 16–18 Dec. 1996, p. 124–139. REFERENCES Richards, P. 1985. Indigenous agricultural revolution: Coulibaly, M.B. 1999. Etude de la résistance du riz (Oryza Ecology and food production in West Africa. Hutchinson, sp.) au virus de la panachure jaune du riz (RYMV). Thèse London. 52 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Microsatellite analysis of Tio Taka, the first rice commercial cultivar released from the recurrent selection breeding method1

C. Brondani,a R.P.V. Brondani,a T.C.O. Borba,a T. Brunes,a P.H.N. Rangel a and E.P. Guimarães b a Embrapa Arroz e Feijao, Goiania, GO, Brazil b Food and Agriculture Organization of the United Nations, Rome, Italy

Rice (Oryza sativa) has one of the largest germplasm Thanks to knowledge of molecular markers, estimates collections in the world. The genus Oryza originated of genetic diversity stored in gene banks can be made 130 million years ago in Gondwanaland and different much more efficiently than with phenotypical analysis species have since been distributed in different continents. alone. Accessions with a DNA profile quite distinct from Rice is cultivated between 55° north latitude and 36° south that of modern germplasm are likely to contain the greatest latitude, and grows under diverse conditions found in number of novel alleles (Tanksley and McCouch, 1997). irrigated, rainfed lowland, rainfed upland and flood-prone Also, two breeding strategies can be efficiently used for ecosystems. Human selection and adaptation to diverse the exploitation of genetic resources: backcross and environments have created a large number of cultivars, recurrent selection methods. and it is estimated that about 120 000 varieties of rice The backcross method is generally used to breed a exist in the world (Khush, 1997). deficient trait in a cultivar (Fehr, 1987). When the Rice production doubled between 1966 and 1990, backcross involves a cultivar as the recurrent parent and following the release of high-yielding cultivars. However, an exotic germplasm as the donor parent, two or three the use of elite germplasm in breeding programmes backcrosses are necessary in the direction of the cultivated reduced the genetic variability available for selection. This parent, to produce a progeny without the undesirable traits reduction in genetic variability is thought to be the main incorporated by linkage drag (which reduces the propor- reason for the yield plateau reached in many regions; in tion of donor fragments by 12.5 to 6.25 percent). In this addition, it increases susceptibility to disease and insect case, the broadening of the genetic base is restricted to epidemics. localized genomic regions close to the introgressed gene With the increase in world population, it is projected of interest. that in 2025, there will be demand for an additional Recurrent selection permits the accumulation of genet- 290 million tonnes in relation to today’s rice production ic gain in the successive cycles (Rangel, Zimmermann of 560 million tonnes, as part of a scenario that includes and Fagundes, 2000). Hull (1945) described for the first the reduction of useful land area due to the degradation time recurrent selection: a method of reselecting, gener- of natural resources and increase in urbanization ation after generation, with the intercross of the selected (Tanksley and McCouch, 1997; Khush, 1997). It is, families, to obtain genetic gains. It permits the generation therefore, necessary to obtain rice cultivars with higher of progenies obtained from recombination and selection; yield potential and yield stability. It is also extremely thanks to the broad genetic basis population, improved important to broaden the rice genetic basis so as to permit lines with a broad genetic basis can be produced. The that new allelic combinations can be obtained and methodology has been used successfully to improve rice selected. in several countries in Latin America (Guimarães, 2005).

1 This work has been supported by the FAO/Netherlands Partnership Programme on Agrobiodiversity. 53 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Tio Taka, a rice commercial cultivar released in 2002 breeding lines, 9 red rice accessions, 14 rice landraces in Brazil with the cooperation of EMBRAPA (Brazilian and 4 Oryza glumaepatula accessions (Tables 1 and 2) Agricultural Research Corporation) and EPAGRI were germinated in order to generate the plant material (Empresa de Pesquisa Agropecuária e Difusao de for DNA isolation. The DNA was extracted following Tecnologia de Santa Catarina), was the first cultivar in the protocol described by Doyle and Doyle (1987). The the world originating from a rice recurrent selection DNA concentration was estimated using electrophoresis programme. It was obtained from the recurrent selection in 0.8 percent agarose gel and by comparison with the population CNA-IRAT 4 (Rangel and Neves, 1997), lambda DNA standard, and adjusted to 3 ng/μl. which was in turn obtained in 1990 from the intercross of nine lines of the indica group: BG 90-2, CNA-7, CNA- Microsatellite analysis 3815, CNA-3848, CNA-3887, Colombia 1, Eloni, Genetic analysis was done using previously published Nanicão and UPR 103 80 1 2, with IR36, the androsterility microsatellite markers (Akagi et al., 1996; Chen et al., source. After 2 years of selection/recombination cycles, 1997; Temnykh et al., 2000; Brondani et al., 2001). families were selected from CNA-IRAT 4 to be evaluated Sixteen microsatellite markers were chosen on the basis in multiple environments. After 5 years of evaluation and of their informative content and representative of all selection, the SC 169 family was selected in Santa 12 rice chromosomes (Table 3). Catarina State, showing high yield, rice blast resistance The SSR reactions were performed in a final volume and tolerance of iron toxicity. For 3 years, the SC 169 of 13 μl containing the following constituents: 0.3 μM line was evaluated in yielding experiments in Santa of each primer, 1 U of Taq DNA polymerase, 0.2 mM of Catarina State, showing an average of 8 561 kg/ha (i.e. each dNTP, 1 mM TRIS-HCl (pH 8.3), 50 mM KCl, μ significantly more productive than both the other lines 1.5 mM MgCl2, 1.3 l of DMSO (50%) and 7.5 ng of and the controls). The SC 169 line was named SCS BRS template DNA. 113 (Tio Taka) and showed the following main The PCR (polymerase chain reaction) amplification characteristics: high yielding, low plant height (100 cm), reactions were performed in a PT-100 thermocycler (MJ lodging resistance, high tillering capacity, and high Research) with the following programme: one pre-cycle milling and cooking qualities. at 96°C for 2 minutes; followed by 30 cycles at 94°C for The increasing availability of highly polymorphic 1 minute, 56°C for 1 minute and 72°C for 1 minute; and genetic markers and the decreasing cost of typing provide a final stage at 72°C for 7 minutes. The amplification high power for resolving the true biological relationship was checked by horizontal electrophoresis in 3 percent between individuals (Presciuttini et al., 2002). Micro- agarose gel containing TBE 1x buffer (0.09M TRIS- satellite markers (also known as simple sequence repeats Borate and 2 mM EDTA, pH 8.3) and 0.2 μg/ml ethydium [SSR]) were used to infer the genetic variability resulting bromide. The allelic polymorphism between rice from the higher informativity in relation to other classes genotypes was detected in 6 percent denaturing of molecular markers (Rafalski et al., 1996). Rice has a polyacrylamide gels containing 7M urea and 1x TBE large collection of microsatellite markers, extensively produced by SSR-enriched libraries (Chen et al., 1997; TABLE 1 Brondani et al., 2001). List of genitors of CNA-IRAT 4 and their relative theoretical This paper aims: contribution in Tio Taka cultivar

• to estimate the genetic variability of the genitors of Lines/varieties Genitors the CNA-IRAT 4 population and the cultivar Tio BG 90-2 IR262/Remadja Taka derived from this population; and CNA 7 T 141/IR665-1-1-75-3 • to discuss this variability in relation to rice CNA 3815 Cica 4/BG 90-2//SML 1517 CNA 3848 IR36/Cica 7//5461 germplasm under cultivation in Brazil. CNA 3887 BG 90-2/Tetep//4440 Colombia 1 Napal/Takao Iku 18 MATERIAL AND METHODS Eloni IR454/SML Kapur//SML 66410 Nanicão Landrace Plant material UPR 103-80-1-2 IR24/Cauvery Seeds of Tio Taka, 10 accessions that originated the IR36 (msms) IR36 male sterile mutant population CNA-IRAT 4, 43 rice cultivars, 14 rice Source: Rangel and Neves, 1997. 54 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

buffer, and visualized by silver staining (Bassam, Caetano program (Rohlf, 1989). The private alleles and poly- Anolles and Gresshoff, 1991). morphism information content (PIC) were estimated using the GDA program (Lewis and Zaykin, 2000). STATISTICAL ANALYSIS The allele frequencies were determined using the TFPGA RESULTS AND DISCUSSION program (Miller, 1997). The dendrogram was constructed SSR analysis from the genetic distance matrix obtained by the J&C The 16 SSR markers used produced high values of genetic distance coefficient (Jukes and Cantor, 1969) and polymorphism information content (PIC), varying from grouping by UPGMA (unweighted pair group method 0.89 (OG17) to 0.45 (MRG4879), with an average of with arithmetic mean) clustering, using the NTSYS 0.70 (Table 4). These SSR markers identified 203 alleles,

TABLE 2 Ninety-five genotypes analysed in this study

Genotype Germplasm Genotype Germplasm 1 Tio Taka Cultivar 49 CNA 8502 Breeding line 2 BG 90-2 (*) Breeding line 50 CNAi 8859 Breeding line 3 CNA 3815 (*) Breeding line 51 CNAi 8860 Breeding line 4 UPR 103 80 1 2 (*) Breeding line 52 CNAi 8870 Breeding line 5 CNA 3848 (*) Breeding line 53 CNAi 9025 Breeding line 6 CNA 3887 (*) Breeding line 54 CNAi 9051 Breeding line 7 IR36 (*) Cultivar 55 CNAi 9150 Breeding line 8 Eloni (*) Cultivar 56 CNAi 9606 Breeding line 9 Colombia 1 (*) Cultivar 57 CNAi 9687 Breeding line 10 Nanicão (*) Landrace 58 CNAi 9705 Breeding line 11 CNA 7(*) Breeding line 59 CNAi 9747 Breeding line 12 AS 3510 Breeding line 60 CNAi 9748 Breeding line 13 Basmati 370 Cultivar 61 CNAi 9834 Breeding line 14 Blue Belle Cultivar 62 CNAi 9838 Breeding line 15 BR IRGA 409 Cultivar 63 Diamante Cultivar 16 BR IRGA 410 Cultivar 64 EEA 406 Landrace 17 BR IRGA 411 Cultivar 65 Embrapa 6 Chuí Cultivar 18 BR IRGA 412 Cultivar 66 Embrapa 7 Taim Cultivar 19 BR IRGA 413 Cultivar 67 Epagri 109 Cultivar 20 BR IRGA 417 Cultivar 68 Gen 1 Red rice 21 BR IRGA 418 Cultivar 69 Gen 11 Red rice 22 BR IRGA 419 Cultivar 70 Gen 13 Red rice 23 BR IRGA 420 Cultivar 71 Gen 141 Red rice 24 BRS Agrisul Cultivar 72 Gen 145 Red rice 25 BRS Atalanta Cultivar 73 Gen 19 Red rice 26 BRS Biguá Cultivar 74 Gen 2 Red rice 27 BRS Bojuru Cultivar 75 Gen 752 Red rice 28 BRS Bonança Cultivar 76 Gen 9 Red rice 29 BRS Firmeza Cultivar 77 IR22 Cultivar 30 BRS Formoso Cultivar 78 IR8 Cultivar 31 BRS Jaburu Cultivar 79 IR841 Cultivar 32 BRS Ligeirinho Cultivar 80 Javaé Cultivar 33 BRS Ouro Minas Cultivar 81 Jequitiba Cultivar 34 BRS Pelota Cultivar 82 Marajó Cultivar 35 BRS Soberana Upland cultivar 83 Maravilha Upland cultivar 36 BRS Talento Upland cultivar 84 Metica 1 Cultivar 37 Pacholinha (CA 780320) Landrace 85 O. glumaepatula P Wild species 38 Precoce (CA 780403) Landrace 86 O. glumaepatula RN Wild species 39 Matão (CA 800120) Landrace 87 O. glumaepatula RS Wild species 40 Saquarema (CA 840018) Landrace 88 O. glumaepatula VG Wild species 41 Lageado (CA 840075) Landrace 89 Oryzica 1 Cultivar 42 Palha Murcha (CA 840165) Landrace 90 Paga Dívida Landrace 43 Japonês (CA 940002) Landrace 91 Rio Grande Cultivar 44 Farroupilha (CA 940007) Landrace 92 São Francisco Cultivar 45 Cateto (CA 950011) Landrace 93 SCS 112 Cultivar 46 Cica 4 Cultivar 94 SCS BRS 111 Cultivar 47 Cica 8 Cultivar 95 Skrivimangoti Landrace 48 Cica 9 Cultivar

* Genitors who originated the population CNA-IRAT 4. 55 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

TABLE 3 Chromosomal assignment, primer reference and sequence information of 16 SSR loci for rice used

SSR marker Chromosome Source Primer sequence (5´ – 3´) OG17 2 Brondani et al., 2001 Forward CATGCATCAACAACGATC Reverse GTGCTCAAGTTAGCTGCTC RM207 2 Chen et al., 1997 Forward CCATTCGTGAGAAGATCTGA Reverse CACCTCATCCTCGTAACGCC OG44 3 Brondani et al., 2001 Forward ACACCAGCTCAGCTCATC Reverse TGTCCAGGTAGTACAAGCTC MRG4879 4 http://www.monsanto.com Forward CAGAGATCGATTGGTAGC Reverse CCTTGTACTCAGCTCCAT OG61 5 Brondani et al., 2001 Forward GCATGCTGATGACTGAAGG Reverse GAAACGAACGGATGGACA RM204 6 Chen et al., 1997 Forward GTGACTGACTTGGTCATAGGG Reverse GCTAGCCATGCTCTCGTACC RM11 7 Panaud et al., 1996 Forward TCTCCTCTTCCCCCGATC Reverse ATAGCGGGCGAGGCTTAG RM248 7 Chen et al., 1997 Forward TCCTTGTGAAATCTGGTCCC Reverse GTAGCCTAGCATGGTGCATG RM223 8 Chen et al., 1997 Forward GAGTGAGCTTGGGCTGAAAC Reverse GAAGGCAAGTCTTGGCACTG OG106 9 Brondani et al., 2001 Forward GGCCGTGTCACCATCTTCTCTA Reverse GGGGATCTGACATGGCATATGA RM304 10 Temnhyk et al., 2000 Forward TCAAACCGGCACATATAAGAC Reverse GATAGGGAGCTGAAGGAGATG OG7 11 Brondani et al., 2001 Forward CAGGTTCTTGTGAAATGTGT Reverse ACACTGACCACCATCTCC RM224 11 Chen et al., 1997 Forward ATCGATCGATCTTCACGAGG Reverse TGCTATAAAAGGCATTCGGG MRG4961 11 http://www.monsanto.com Forward CCACTTGTCTCCTGTATGCT Reverse GTGATGTGAACGCCTCTACT RM229 11 Chen et al., 1997 Forward CACTCACACGAACGACTGAC Reverse CGCAGGTTCTTGTGAAATGT RM247 12 Chen et al., 1997 Forward TAGTGCCGATCGATGTAACG Reverse CATATGGTTTTGACAAAGCG

TABLE 4 Results of 16 SSR marker analyses

SSR Allele Polymorphism information Allele size in Allele frequency Allele frequency in number content (PIC) Tio Taka in genitors all genotypes RM207 18 0.82 142 0.4 0.36 OG61 17 0.82 108 0.0 0.07 RM247 15 0.56 148 0.5 0.65 RM304 15 0.58 182 0.8 0.56 OG17 15 0.89 126 0.1 0.12 RM204 14 0.76 116 0.2 0.24 OG106 14 0.76 218 0.4 0.39 OG44 12 0.50 158 0.1 0.01 RM224 12 0.83 158 0.3 0.15 OG7 12 0.73 154 0.2 0.46 RM223 11 0.60 164 0.7 0.52 RM229 11 0.72 134 0.2 0.48 RM248 11 0.78 94 0.1 0.21 RM11 10 0.73 148 0.6 0.43 MRG4879 10 0.45 108 0.9 0.7 MRG4961 6 0.75 140 0.4 0.38 Average 12.7 0.70 - 0.31 0.36 56 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

TABLE 5 TABLE 6 Observed heterozygosity in rice germplasm based on 16 Number of private alleles in 95 analysed germplasm SSR markers Genotype Marker Allele Frequency Genotype Observed Number of AS3510 RM204 130 1 heterozygosity heterozygotes Basmati 370 RM248 74 1 CNA 3815 0.063 1 Blue Belle RM304 170 1 UPR 103 80 1 2 0.063 1 BR IRGA 413 RM229 132 1 Blue Belle 0.063 1 BRS Bojuru RM204 190 1 BRS Biguá 0.063 1 BRS Bojuru OG61 96 1 BRS Formoso 0.125 2 BRS Bojuru OG106 228 1 BRS Pelota 0.063 1 BRS Formoso RM207 114 0.5 BRS Atalanta 0.188 3 BRS Talento RM204 200 0.5 Cica 9 0.063 1 BRS Talento RM204 180 0.5 EEA 406 0.313 5 CA780403 RM223 174 1 BR IRGA 419 0.125 2 CA780403 RM247 150 1 Javaé 0.063 1 CA780403 MRG4879 146 1 Metica 1 0.250 4 CA800120 RM207 146 1 Rio Grande 0.188 3 CA840018 RM223 166 1 IR8 0.188 3 CA840018 OG106 212 0.5 Cica 4 0.063 1 CA940002 RM247 166 1 IR22 0.188 3 CA940002 MRG4879 116 0.5 CNAi 9025 0.188 3 CA940007 OG106 250 1 Maravilha 0.313 5 CA950011 RM207 118 1 BRS Bonança 0.063 1 CNA3815 RM207 158 1 BRS Talento 0.063 1 CNA7 RM304 186 1 Gen 9 0.125 2 CNA8502 RM304 194 1 Gen 11 0.313 5 Gen11 RM304 176 1 Gen 13 0.125 2 Gen11 OG106 226 1 Gen 145 0.188 3 Gen11 MRG4879 150 0.5 CNAi 9051 0.125 2 Gen13 OG61 140 1 Skrivimangoti 0.125 2 Gen141 RM247 190 1 O. glumaepatula RN 0.125 2 Gen141 RM304 156 1 O. glumaepatula RS 0.063 1 Gen145 RM224 154 0.5 O. glumaepatula VG 0.188 3 Gen752 RM248 100 1 CA 940002 0.063 1 IR8 RM207 150 1 CA 840018 0.25 4 Metica1 OG61 124 0.5 CA 840075 0.063 1 O. glumaepatula P RM223 154 1 CA 840165 0.063 1 O. glumaepatula P RM229 114 1 CA 780320 0.063 1 O. glumaepatula P RM247 140 1 O. glumaepatula P OG44 186 1 O. glumaepatula P RM224 132 1 O. glumaepatula P OG07 136 1 O. glumaepatula RN RM247 134 1 O. glumaepatula RN OG17 146 0.5 with an average of 12.7 alleles per locus, similar to the O. glumaepatula RN OG44 184 1 O. glumaepatula RN OG07 144 0.5 15.3 alleles per locus found in rice by Blair, Hedetale O. glumaepatula RS OG106 242 1 and McCouch (2002). Considering the cultivated rice O. glumaepatula RS RM247 130 1 O. glumaepatula RS OG44 180 1 genotypes alone, 137 alleles were identified, with an O. glumaepatula RS RM224 130 1 average of 8.6 alleles per locus. These reductions reflect O. glumaepatula RS MRG4879 128 1 O. glumaepatula RS OG07 124 0.5 the lesser variability of cultivated genotypes in relation O. glumaepatula RS RM207 100 1 to the complete pool of genotypes analysed. The average O. glumaepatula VG RM247 136 0.5 O. glumaepatula VG OG61 112 1 number of alleles found in rice was similar to that in two O. glumaepatula VG OG17 140 1 other cereal species: 7.4 alleles were found in wheat O. glumaepatula VG OG44 182 1 Paga Dívida OG61 132 1 (Prasad et al., 2000) and 8.6 alleles in barley (Struss and Paga Dívida RM248 96 1 Skrivimangoti RM304 158 1 Plieske, 1998). In general, SSR markers with a high UPR 103 80 1 2 RM11 140 1 number of detected alleles produced the highest values of PIC (Table 4). A total of 58 private (exclusive) alleles were observed, from Rio Solimões (RS) and four from Veredas de Goiás distributed in 31 of the 95 genotypes analysed. The (VG) (Table 6). From commercial cultivars, BRS Bojuru highest number of private alleles (21) was found in the showed three private alleles – the same number as the wild species Oryza glumaepatula: six alleles from the weed red rice Gen 11. Private alleles in wild species Pantanal (P) accession, four from Rio Negro (RN), seven populations are generally related to reproductive isolation. 57 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

In rice varieties, the private alleles result from genitors Analysis of CNA-IRAT 4 genitors whose ancestors were developed under very specific Based on the 16 SSR markers analysed, the detected environmental conditions, subjected to mutation, alleles in Tio Taka cultivar were used to determine its migration, selection and adaptation, and for this reason, frequencies in CNA-IRAT 4 genitors. The frequency generating more diverse germplasm with low frequency varied from 0.9 (MRG4879) to zero (OG61), with an alleles. With the use of highly polymorphic SSR markers, average of 0.31. Considering all 95 analysed genotypes, the detection of private alleles was facilitated. Private the frequency varied from 0.7 (MRG4879) to 0.01 alleles are important for defining the genetic identity of (OG61), with an average of 0.36 (Table 4). In general, each germplasm and can be used for its genetic evaluation, the most frequent alleles in genitors were also frequent the assessment of genetic relationships between them, in all accessions genotyped. and to follow the allele frequency during the recurrent selection programme. The existence of exclusive alleles TABLE 7 in recurrent selection populations would facilitate the Number of alleles in common and J&C distance coefficient between Tio Taka and the genitors of CNA-IRAT 4 population discovery of the real contribution of each parent in the released cultivars. No private alleles were detected in Genitor Shared alleles J&C genitor × Tio Taka CNA-IRAT 4 genitors with the 16 SSR analysed. BG 90-2 11 0.0510 However, increasing the number of SSR markers to UPR 103 80 1 2 9 0.0833 CNA 3815 8 0.0888 genotype the genitors, private alleles may be identified CNA 3848 6 0.1056 Nanicão 6 0.1056 and haplotypes for each genitor may be determined. This CNA 3887 5 0.1171 information can be used as an alternative to private alleles IR36 5 0.1171 Eloni 4 0.1287 to identify the genitor with the highest probability of CNA 7 3 0.1404 generating the best performed lines. Colombia 1 2 0.1524

FIGURE 1 Allelic polymorphism of OG61 SSR marker in 95 analysed genotypes. The allele 108 (indicated by an arrow) was present in Tio Taka (lanes 1 and 12) and absent in progenitors of Tio Taka. Between the lanes 1 and 12 (from left to right), are located the CNA-IRAT 4 genitors: BG 90-2, CNA 3815, UPR 103 80 1 2, CNA 3848, CNA 3887, IR36, Eloni, Colombia 1 and Nanicão. M = molecular mass marker: Ladder 10 bp (invitrogen)

M M 58 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

The breeding line, BG 90-2, was the CNA-IRAT 4 The Tio Taka allele 108, from SSR marker OG61, was genitor that showed the highest number (11) of alleles in not identified in the ten genitors that originated the common with Tio Taka and, consequently, the lowest J&C population CNA-IRAT 4 (Figure 1, Table 4). This allele distance coefficient to Tio Taka (Table 7, Figure 2). The is common in the rice gene pool, since it was identified genitor Colombia 1 showed two alleles in common with in the cultivars: BRS Formoso, BRS Ourominas, SCS Tio Taka and the higher J&C distance coefficient. The 112 and BRS Talento, and in the breeding lines: CNAi donor of the male sterility gene, the genitor IR36, shared 9834 and CNAi 9838. There are two possible reasons five alleles with Tio Taka, meaning that the recombination for the occurrence of this allele in Tio Taka: the seed and selection procedures prevented a higher contribution mixture originating a rice plant that could pollinate any of IR36 in the Tio Taka genetic background, as observed male sterile plants (msms); or the pollen migration from by Ferreira et al. (2000). The high similarity between BG a rice variety cultivated in adjacent areas of the CNA- 90-2 and Tio Taka may be due to the good general IRAT 4 field experiment, during recombination of the combining ability of BG 90-2 in relation to other CNA- recurrent selection population. The male sterile gene is IRAT 4 genitors. In addition, BG 90-2 has good plant responsible for important cost reductions during the architecture and high yield (traits that can be easily recombination step of the recurrent selection method. identified and selected) and would have contributed to However, due to the risk of pollen contamination, it is increasing the proportion of BG 90-2 alleles in the Tio recommended to maintain the population under recomb- Taka genome. ination as far as possible to other rice genotypes, since

TABLE 8 The J&C distance coefficient average of 69 rice cultivars, breeding lines and traditional varieties

Genotype J&C coefficient Genotype J&C coefficient Maravilha 0.1884 IR22 0.1055 BRS Bojuru 0.1776 Diamante 0.1051 BRS Bonança 0.1729 CNAi 9150 0.1049 Blue Belle 0.1721 BRS Formoso 0.1033 AS 3510 0.1677 CNAi 9687 0.1029 BR IRGA 411 0.1618 Cica 4 0.1023 BRS Talento 0.1591 CNA 3848 0.0985 BRS Soberana 0.1539 BRS Agrisul 0.0983 BRS Firmeza 0.1490 CNA 3887 0.0983 CNA 7 0.1490 Cica 8 0.0983 CNAi 9051 0.1476 Marajo 0.0983 Colombia 1 0.1438 CNAi 9747 0.0980 Nanicão 0.1405 CNAi 9606 0.0976 BRS Bigua 0.1215 Cica 9 0.0961 Sao Francisco 0.1192 Tio Taka 0.0953 CNAi 9025 0.1192 BR IRGA 413 0.0950 Eloni 0.1186 SCS BRS 111 0.0946 CNAi 9834 0.1180 CNAi 8859 0.0942 CNAi 9838 0.1180 BR IRGA 417 0.0934 BR IRGA 419 0.1169 CNAi 8860 0.0920 Rio Grande 0.1164 BRS Ligeirinho 0.0920 Metica 1 0.1161 BRS Pelota 0.0915 BRS Atalanta 0.1127 Jequitiba 0.0902 IR36 0.1115 CNAi 8870 0.0899 UPR 103 80 1 2 0.1106 Embrapa 6 Chuí 0.0887 Epagri 109 0.1098 BG 90-2 0.0882 Javae 0.1093 BR IRGA 412 0.0882 CNAi 9748 0.1092 BRS Ouro Minas 0.0875 CNAi 9705 0.1084 Embrapa 7 Taim 0.0871 CNA 8502 0.1083 BR IRGA 410 0.0860 CNA 3815 0.1070 BR IRGA 409 0.0860 IR8 0.1068 BR IRGA 420 0.0844 BRS Jaburu 0.1068 BR IRGA 418 0.0842 IR841 0.1067 SCS 112 0.0839 Oryzica 1 0.1057 59 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

the pollen has the potential to fecundate plants at least Maravilha) (Figure 2). Cluster A was formed with 10 m from the pollen source (Messeguer et al., 2001). 43 lowland rice genotypes, including Tio Taka and seven of the genitors of CNA-IRAT 4 (BG 90-2, CNA 3815, Genetic variability of rice germplasm CNA 3848, CNA 3887, UPR 103 80 1 2, IR36 and Eloni). The use of highly informative SSR markers permits the Cluster B included CNA 7 (a genitor of CNA-IRAT 4) identification and monitoring of specific alleles during and BRS Soberana (an upland rice cultivar). Cluster C cultivar development in recurrent selection populations. included BRS Firmeza and its two genitors, Blue Belle Despite the preferentially autogamous reproductive habit and BR IRGA 411. Cluster D included two upland rice of rice, it is possible to identify loci in a heterozygous cultivars, BRS Bonança and BRS Talento, which have state, even in commercial cultivars. When genetic identity two of its three genitors in common. The other two CNA- was based on phenotypic evaluation at whole plant level, IRAT 4 genitors, Nanicão and Colombia 1, were not this assumption was often an acceptable approximation included in clusters. to reality. For registered modern varieties, genetic heter- In order to determine the degree of genetic variability ogeneity may be diagnostic of unwanted seed mixtures, of each genotype in relation to all other cultivars, breeding outcrossing or, in rare cases, mutation (Olufowote et al., lines and traditional varieties, the average J&C distance 1997). The genotypes showing the highest number of coefficient was used to proceed the comparisons. heterozygous loci were: Maravilha (upland cultivar), EEA Maravilha, an upland rice cultivar, was the most 406 (landrace) and Gen 11 (red rice) with five loci in genetically distant from all other rice genotypes (0.1884), heterozygosity; and Metica 1 (lowland cultivar) and and the cultivar SCS 112 was the least distant (0.0839) Saquarema (landrace) with four loci in heterozygosity (Table 8). From CNA-IRAT 4 genitors, the most divergent (Table 5). Considering only the commercial cultivars was CNA 7 (0.15), and the least divergent was BG 90-2 expected to have a well-defined genetic identity with very (0.088). Tio Taka showed a J&C distance average of 0.095 low frequency residual heterozygosity, at least one – i.e. inferior to all genitors of the CNA-IRAT 4 heterozygous locus was observed in Blue Belle, BR IRGA population, except BG 90-2. 419, BRS Atalanta, BRS Biguá, BRS Bonança, BRS When the genitors of the CNA-IRAT 4 population Formoso, BRS Pelota, BRS Talento, Cica 4, Cica 9, IR22, were chosen at the beginning of the 1990s, the use of IR8, Javaé, Maravilha, Metica 1 and Rio Grande, corres- molecular markers in rice genetic evaluation was not a ponding to 33 percent of analysed cultivars (Table 5). In routine, and the selection performed was based uniquely relation to the breeding lines analysed, 21 percent showed on pedigree information of the genitors. As can be seen at least one SSR locus in heterozygosity. The identi- in the dendrogram (Figure 2), most of the CNA-IRAT 4 fication of an SSR locus in a heterozygous state in a genitors were included in Cluster A, indicating reduced certain genotype does not mean that such material is genetic variability available to the Brazilian lowland rice segregating to important agronomic traits. It is interesting, breeding programme, which strongly depends on the however, that lines to be released as new cultivars possess recombination obtained by recurrent selection to increase genetic homogeneity, and SSR markers can be used to the probability of obtaining superior genotypes. Molecular achieve this goal with the selection of homozygous plants. markers, mainly SSRs, are a powerful tool for identifying The estimates of the J&C distance coefficient between genetically divergent genotypes that can be used in crosses 44 Brazilian rice cultivars and ten CNA-IRAT 4 genitors to increase the genetic variability of lowland elite rice were used to construct a dendrogram (Figure 2). The J&C germplasm in Brazil. coefficient was chosen because it showed the highest value of cophenetic correlation (r = 0.92) in comparison The genitors’ choice for new recurrent selection to dendrograms obtained using Nei’s (Nei, 1972) and populations modified Rogers’s (Wright, 1978) distance coefficients. The use of molecular markers is extremely important in The average J&C genetic distance between all genotypes the evaluation of the genetic variability of rice germplasm. (0.11) was used to establish a cut-off value for cluster Furthermore, the fingerprinting obtained with molecular formation. Four clusters were formed including markers must be combined with additional information, 50 genotypes, and the remaining four genotypes were not such as the per se performance of a genotype and its grouped (Nanicão, BRS Bojuru, Colombia 1 and combining ability with other genotypes. This information 60 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

FIGURE 2 Dendrogram with 54 genotypes, including Tio Taka and cultivated germplasm, with distances obtained by J&C distance coefficient and UPGMA method (Dotted line corresponds to the cut-off value 0.11, obtained with the average J&C distance coefficient)

A

B

C D 61 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

can aid genitor selection, revealing genetic divergence Bassam, B.J., Caetano-Anolles, G. & Gresshoff, P.M. and good agronomic performance. Another advantage in 1991. Fast and sensitive silver staining of DNA in fingerprinting the genitors of a recurrent selection polyacrilamide gels. Analytical Biochemistry, 196: 80– population is the possibility to monitor the allele 83. frequencies of SSR markers between the different cycles Blair, M.W., Hedetale, V. & McCouch, S.R. 2002. of recombination. In order to avoid the genetic drift, which Fluorescent-labeled microsatellite panels useful for could reduce the genetic variability and, consequently, detecting allelic diversity in cultivated rice (Oryza sativa the genetic gain, SSR markers can be used to monitor L.). Theor. Appl. Genet., 105: 449–457. the allelic frequencies of all genitors of the population. If Brondani, C., Brondani, R.P.V., Rangel, P.H.N. & the frequency of a certain allele is reduced, or even lost, Ferreira, M.E. 2001. Development and mapping of the genitors that have this allele can be included in the Oryza glumaepatula-derived microsatellite markers in the recombination step of this population. interspecific cross O. glumaepatula × O. sativa. Hereditas, 134: 59–71. CONCLUSION Chen, X., Temnykh, S., Xu, Y., Cho, Y.G. & McCouch, The broadening of the genetic basis of rice cultivars can S.R. 1997. Development of a microsatellite framework be accomplished by a recurrent selection programme. The map providing genome-wide coverage in rice (Oryza choice of genitors in the development of recurrent sativa L). Theor. Appl. Genet., 95: 553–567. selection populations is decisive for the generation of Doyle, J.J. & Doyle, J.L. 1987. Isolation of plant DNA variable populations that will produce breeding lines with from fresh tissue. Focus, 12: 13–15. unique favourable allele combinations. SSR markers are Fehr, W.R. 1987. Principles of cultivar development. New a useful tool in the selection of genitors and for monitoring York, McMillan. 525 pp. allele variation during the successive recurrent cycles in Ferreira, M.E., Pentedo, M.I. de O., Brondani, C., Bélo, the recurrent selection programme. A., Ferreira, M.A. & Rangel, P.H.N. 2000. Since there is low genetic variability in elite lowland Caracterización y uso de marcadores RAPD y rice germplasm adapted to Brazilian cultivation, two microsatelites (SSR) en el monitoreo del programa de strategies are recommended to obtain better results: mejoramiento poblacional en arroz. In Avances en ele • First, integrate more diverse germplasm, such as rice mejoramiento poblacional en arroz, p. 37–62. Goiania, introductions from abroad, upland cultivars, Brasil, Embrapa Arroz e Feijão. landraces and lines derived from interspecific Guimarães, E.P. 2005. Population improvement: A way of crosses, into the elite rice background, by the exploiting the rice genetic resources of Latin America. implementation of a pre-breeding programme based Rome, FAO. 350 pp. on backcrosses, which will generate breeding lines Hull, F.H. 1945. Recurrent selection for specific combining with broader genetic variability to be used as ability in corn. J. Amer. Soc. Agron., 37(2): 134–145. genitors of the Brazilian rice breeding programme. Jukes, T.H. & Cantor, C.R. 1969. Evolution in protein • Second, use the recurrent selection method to molecules. In H.N. Munro, ed. Mammalian protein maximize the opportunity of recombination of this metabolism, p. 21–123. New York, Academic Press. genetically variable germplasm. Khush, G.S. 1997. Origin, dispersal, cultivation and • The release of Tio Taka, a highly productive rice variation of rice. Plant Mol. Biol., 35: 25–34. cultivar, developed from a population obtained with Lewis, P.O. & Zaykin, D. 2000. Genetic data analysis: less divergent genitors, is an indication that the Computer program for the analysis of allelic data. Version increase of genetic variability of elite genitors in 1.0 (d15) (available at http://alleyn.eeb.uconn.edu/gda/ new recurrent selection populations will produce 2000). even better lowland rice cultivars. Messeguer, J., Fogher, C., Guiderdoni, E., Marfà, V., Catalã, M.M., Baldi, G., Melè, E. & Field. 2001. REFERENCES Assessments of gene flow from transgenic to Akagi, H., Yokozeki, Y., Inagaki, A. & Fujimura, T. 1996. cultivated rice (Oryza sativa L.) using a herbicide Microsatellite DNA markers for rice chromosomes. resistance gene as tracer marker. Theor. Appl. Genet., Theor. Appl. Gen., 93: 1071–1077. 103: 1151–1159. 62 PART II RICE GENETIC IMPROVEMENT AND UTILIZATION

Miller, M. 1997. Tools for population genetic analyses Rangel, P.H.N. & Neves, P.C.F. 1997. Selección recurrente (TFPGA) 1.3: A Windows program for analyses of aplicada al arroz de riego en Brasil. In Selección allozyme and molecular population genetic data. recurrente en arroz, p. 79–97. Cali, Colombia, CIAT. Nei, M. 1972. Genetic distance between populations. Amer. Rangel, P.H.N., Zimmermann, F.J.P. & Fagundes, P.R.R. Naturalist, 106: 283–292. 2000. Mejoramiento poblacional del arroz de riego en Olufowote, J., Xu, Y., Chen, X., Park, W.D., Beachell, Brasil. In E.P. Guimarães, ed. Avances en el mejoramiento H.M., Dilday, R.H., Goto, M. & McCouch, S.R. 1997. poblacional en arroz, p. 65–85. Santo Antônio de Goiás, Comparative evaluation of within-cultivar variation of Embrapa Arroz e Feijão. rice (Oryza sativa L.) using microsatellite and RFLP Rohlf, F.J. 1989. NTSYS-Pc: Numerical Taxonomy and markers. Genome, 40: 370–378. Multivariate Analysis System. New York, Exeter Prasad, M., Varshney, R.K., Roy, J.K., Balyan, H.S. & Publisher. Gupta, P.K. 2000. The use of microsatellites for detecting Struss, D. & Plieske, J. 1998. The use of microsatellite DNA polymorphism, genotype identification and genetic markers for detection of genetic diversity in barley diversity in wheat. Theor. Appl. Genet., 100: 584–592. populations. Theor. Appl. Genet., 97: 308–315. Presciuttini, S., Toni, C., Tempestini, E., Verdiani, S., Tanksley, S.D. & McCouch, S.R. 1997. Seed banks and Casarino, L., Spinetti, I., De Stefano, F., Domenici, molecular maps: unlocking genetic potential from the R. & Bailey-Wilson, J.E. 2002. Inferring relationships wild. Sci., 277: 1063–1066. between pairs of individuals from locus heterozygosities. Temnykh, S., Park, W.D., Ayres, N., Cartinhour, S., BMC Genetics, 3: 23. Hauck, N. & McCouch, S.R. 2000. Mapping and Rafalski, J.A., Vogel, J.M., Morgante, M., Powell, W., genome organization of microsatellite sequences in rice Andre, C. & Tingey, S.V. 1996. Generating and using (Oryza sativa L.). Theor. Appl. Genet., 100: 697–712. DNA markers in plants. In B. Birren & E. Lai, eds. Wright, S. 1978. Evolution and the genetics of populations Analysis of non-mammalian genomes – a practical guide, (Vol. 4). Variability within and among natural p. 75–134. New York, Academic Press. populations. Chicago, U. Chicago Press. 63 PART III RICE INTEGRATED CROP MANAGEMENT

Integrated crop management for enhancing yield, factor productivity and profitability in Asian rice farms1

V. Balasubramanian,a R. Rajendran,a V. Ravi,b N. Chellaiah,c E. Castro,a B. Chandrasekaran,c T. Jayaraj b and S. Ramanathan d a International Rice Research Institute, Manila, the Philippines b Soil and Water Management Research Institute, Thanjavur, India c Tamil Nadu Rice Research Institute, Aduthurai, India d Tamil Nadu Agricultural University, Coimbatore, India

Asia’s population is projected to increase from 3.7 billion management. Herein it is defined as the integrated use of in 2000 to 4.6 billion in 2025. Rice is the staple food for compatible technologies that meet farmers’ needs and about 60 percent of this population. About 530 million improve their productivity and income. It is called by tonnes of rough rice were produced from 135 million ha different names in different countries: integrated crop and of harvested irrigated rice area (average yield = resource management in Indonesia (Zaini, Las and 3.9 tonnes/ha) in 2002. Further intensification of irrigated Makarim, 2004), transformed rice cultivation (TRC) in rice farms is necessary to feed the growing population Tamil Nadu, India (Rajendran et al., 2004) and integrated and maintain food security in the near future. Rice crop management (ICM) in the Philippines. In 2004, the farmers, however, face several problems: stagnating yield; Food and Agriculture Organization of the United Nations declining profit (due to rising input costs and low rice (FAO) adopted the ICM approach to identify and deploy prices); less land, water and labour for rice cultivation; technologies for increasing rice productivity in Asia and crop failures due to adverse weather conditions; high post- elsewhere. harvest losses; and growing environmental concerns. Rice scientists have developed a number of tech- What is the difference between ICM and the system of nologies for addressing the above problems. These rice intensification (SRI)? technologies must be deployed effectively to enhance When examining ICM, it is important to take into productivity and profits in rice farming. An approach consideration the system of rice intensification (SRI) dev- called integrated crop management (ICM) is used to eloped in Madagascar in the late 1980s (Randriamibarisoa assemble and apply several best management practices and Uphoff, 2002). Reports indicate that SRI can increase (BMPs) simultaneously to improve rice yield and rice yields two- or threefold compared to farmers’ current production efficiency. This paper presents a working rice yields (Uphoff, 2002). SRI prescribes a set of changes definition for ICM, discusses how to develop and adapt in crop, soil and water management practices (Table 1) ICM options for different locations, and provides the to achieve high yields. In on-farm evaluation of SRI in results of on-station research and on-farm evaluation on India, Indonesia and the Philippines during 2000–02, ICM and conventional rice cultivation. farmers faced some difficulties in adopting certain SRI practices: transplanting tiny young seedlings at the 2-leaf INTEGRATED CROP MANAGEMENT (ICM) stage, planting one seedling per hill at wider spacing What is ICM? (0.3 × 0.3 to 0.5 × 0.5 m), using mostly organic manures In literature, there is no universal definition for ICM. In for nutrient addition, and adopting intermittent irrigation. practical terms, ICM means good agronomy or crop By working with farmers, certain SRI practices were

1 Paper presented at the FAO Viet Nam Consultation Workshop on Rice Integrated Crop Management Systems – Rice Check Methodology for Food Security, Livelihood Improvement and Environmental Conservation, Ho Chi Minh, 28 Feb. – 2 Mar. 2005. 64 PART III RICE INTEGRATED CROP MANAGEMENT

modified, a modified mat nursery was developed to multiple sites and can thus be used in all locations: locally produce farmer-acceptable robust young seedlings in adapted high-yielding variety, use of good-quality seed 15 days, and new practices added to enhance yield or at a low seed rate, production of robust young seedlings protect the harvested grain. The main differences between through a modified mat nursery, two or three mechanical SRI and ICM are highlighted in Table 1. weedings + soil stirring at 10-day intervals from 15 days It is important to note that ICM options are developed after transplanting (DAT), need-based application of and adapted with farmers to meet the needs and const- nutrients through organic and chemical fertilizers, and raints in each location. These options also have to be IPM. Other location-specific ICM options include plant updated as and when new research findings and technol- spacing, intermittent irrigation and use of organic ogies become available. When ICM options are developed manures. Farmers can select suitable practices from these in close collaboration with farmers, the likelihood of options to address their problems and potentials. adoption of the introduced technologies is much higher. Important ICM practices are described below.

From single technology to ICM Selection of locally adapted rice varieties Farmers generally receive individual technologies from Rice varieties to be chosen for a location must have the different researchers or extension staff and integrate them following characteristics: stable and high yield; farmer- to maximize yield and profit. A thorough understanding and local-market-preferred grain quality; resistance to or of farmers’ production environment, challenges, problems tolerance of locally important diseases, insect pests and and potentials is a prerequisite to identifying suitable abiotic stresses; the right growth duration to match the solutions. Farmers and extension staff then jointly select season; and resistance to lodging under normal farmer three or four key constraints to increasing productivity management. Planting of locally adapted varieties will and suitable technologies are identified to address them. ensure good crop establishment, high yield and high Farmer volunteers are then invited to evaluate the selected market price for the grain. technologies in their fields and share their results and experience with fellow farmers in the locality. On the Use of good-quality seed basis of the results of volunteer farmers, it is possible to The use of good-quality seed assures good crop finalize a set of ICM options for wider dissemination to establishment at low seeding rates, minimizes weed farmers in that locality. contamination, lessens insect pest and disease problems, promotes good grain-filling, and leads to high grain yields. ICM options/technologies The use of good seeds alone can produce 15 percent There are two types of ICM options: core and location- higher yield than use of seeds recycled by farmers specific. Core options are those that perform similarly in (Malabanan, 1993).

TABLE 1 Differences in practices between the system of rice intensification (SRI) and integrated crop management (ICM)

Practices SRI ICM Seedling age (days) 8–12 (2-leaf stage) 15–20 (4-leaf stage) Seedlings per hill 1 1–2 Plant spacing (m) 0.3 × 0.3 to 0.5 × 0.5 0.2 × 0.2 to 0.25 × 0.25 Planting geometry Square Square or paired row Mechanical weeding and soil stirring Yes (no herbicide) Yes (or use herbicide when labour limited) Intermittent irrigation during vegetative phase Yes Yes, wherever possible Nutrient application Organic manures Crop need-based: organic manures + fertilizers Pest control - IPM Good quality seed/seed treatment - Yes Modified mat nursery - Yes Post-harvest and grain quality management - Yes 65 PART III RICE INTEGRATED CROP MANAGEMENT

Modified mat nursery (MMN) heavy rains for the first 3 to 4 days. The beds are watered Early seedling vigour is critical for the successful culti- regularly by a sprinkler can to keep them moist until the vation of any crop. In tropical Asia, farmers prefer to seedlings become ready for transplanting in 14 to 15 days. transplant 15- to 20-cm-tall rice seedlings that require If regular watering is not possible, the area around the 25 to 30 days to prepare in a conventional wet-bed beds can be flooded to a water depth of 1 cm 5 days after nursery. In addition, high seed rates (50 to 80 kg of seed seeding (DAS). If necessary, a 0.5 percent urea solution in an approximately 500-m2 nursery area to plant 1 ha), can be sprinkled on the seedlings at 8 to 9 DAS to enhance dense sowing and poor nursery management result in seedling growth. If the nursery area is flooded, it must be weak and thin seedlings. To solve this problem, a modified drained 2 days before lifting the seedling mats to be mat nursery (MMN) was developed at the Soil and Water transported to the main field. In warm weather (approx. Management Research Institute (SWMRI), Thanjavur, 30°C), the seedlings grow to a height of 16 to 20 cm with India during 2002 (Rajendran et al., 2004). In warm four leaves and no tillers in 14 to 15 DAS. weather (approx. 30°C), the MMN produces robust young For transplanting by machine, robust seedlings can be seedlings with four leaves in 14 to 15 days after sowing prepared in trays with a 0.5-cm layer of soil mix. (DAS) that are similar in size to 25- to 30-day-old seedlings produced in a conventional wet-bed nursery. Transplanting a single seedling per hill at 0.2 × 0.2 to Seedling mats can be easily transported to the main field 0.25 × 0.25 m spacing for transplanting. Separation of seedlings is easy with The practice of transplanting a single seedling per hill minimal damage to roots. By using the mat nursery, enhances tillering and grain yield. It also facilitates farmers can save 80 to 90 percent on seed, 90 percent on roguing to maintain the purity of varieties during seed nursery fertilizers, 55 percent on water and 34 percent production. However, studies in Indonesia indicate that on labour costs as compared with the traditional wet-bed planting 15-day-old seedlings at 1 per hill and 21-day- nursery; the overall reduction in nursery costs could be old seedlings at 2 to 4 per hill produced similar yields as high as 50 percent (Rajendran et al., 2004). (Makarim et al., 2002). As such, planting 1 to 2 seedlings In MMN, the seedlings are established in a 4-cm layer per hill is recommended for grain production and 1 per of soil mix arranged on a firm surface. The requirements hill for seed production. If necessary, any missing hills for planting 1 ha are: a 100-m2 nursery area and 10 to must be replanted within 7 to 8 days after transplanting 12 kg of good-quality seed. The required soil mix (4 m3 (DAT). Square planting at 0.2 × 0.2 to 0.25 × 0.25 m for 100 m2 of mat nursery) is prepared by mixing 75 to spacing facilitates mechanical weeding + soil stirring in 80 percent soil, 15 to 20 percent well-decomposed both directions. Spacing wider than 0.25 × 0.25 m is not manure (optional) and 5 percent fresh or charred rice hull. recommended because of increasing problems with If well-decomposed manure is not available, 95 percent weeds, a higher level of asynchrony in flowering and soil + 5 percent rice hull can be used. To this soil mix, maturity, and a potential reduction in yield. 1.5 kg of powdered diammonium phosphate or 2.0 kg of powdered 15-15-15 compound fertilizer is added and Mechanical weeding + soil stirring mixed well. The nursery area is leveled and divided into The first mechanical weeding + soil stirring must be done 1.2-m-wide and 0.05-m-high beds of convenient length. at around 15 DAT when most weeds are at the 2- to 3- A 300-gauge-thick and 1-m-wide white or black plastic leaf stage (older and larger weeds are difficult to control sheet is spread over the beds. A wooden frame (0.5 m by mechanical weeding). A rotating hoe (conical or rotary long, 1.0 m wide and 0.04 m deep) divided into four equal weeder) is used for mechanical weeding + soil stirring in segments is placed over the plastic. The frame is filled both directions. Weeds remaining near the rice plants must with the soil mix almost to the top. Pre-germinated seeds be removed by hand. The stirring of soil during mech- are sown uniformly (approx. 100 g/m2 dry seed weight), anical weeding is important because it increases root and covered with the soil mix and firmed gently with the hand. shoot growth and consequently the final grain yield The seedbed is soaked by sprinkling water. The wooden (Thiyagarajan et al., 2002). The second weeding is done frame is carefully removed and the process continued until around 25 DAT and, if necessary, a third weeding around the required nursery area is sown. The beds can be covered 35 DAT. In many cases, a third weeding is not necessary with a straw mulch or banana leaves to protect them from as the crop canopy may have closed by that time. 66 PART III RICE INTEGRATED CROP MANAGEMENT

Crop need-based nutrient application Generally, crops under ICM are healthy and few insect Adequate nutrients must be applied to support high yields pests and diseases attack them, especially in the dry in ICM plots. The use of organic manures and composts season. Regular field monitoring and taking timely combined with chemical fertilizers has been shown to preventive action will minimize pest problems; farmers produce higher yields than either alone. The recently can then drastically reduce or avoid the use of pesticides. developed site-specific nutrient management approach (Dobermann, Witt and Dawe, 2004) promotes the use of Post-harvest management farm-produced organic manures and composts, Rice crops must be harvested at 95 percent maturity to supplemented by N, P and K fertilizers to meet the crop’s avoid grain shattering at harvest. For ICM crops, the flag demand for nutrients. The soil test or omission plot leaves remain green until maturity; therefore, farmers method is used to determine the rates of P and K, the leaf must look at the panicles and grains rather than the colour colour chart for real-time N management, and local of the flag leaves to determine the time of maturity for recommendations for S and Zn application, wherever harvesting their ICM crops. Threshing must be done necessary. immediately after harvest to minimize grain losses and cracking of grains while milling. The threshed grains must Intermittent irrigation be properly cleaned and dried to 14°C before bagging Recent experience shows that rice crops do not require for storage or sale. Overmilling is a serious problem in continuous flooding to achieve high yields (especially many Asian countries. In addition to the leaf colour chart, during the vegetative phase). Moreover, water is IRRI (International Rice Research Institute) developed a becoming a serious limiting factor for rice cultivation in rice milling chart – a visual guide to rice millers – to Asia (Tuong and Bouman, 2003). Therefore, the practice prevent overmilling of rice (J. Rickman, personal commu- of intermittent irrigation wherever possible during the nication, 2004). Simple sealed storage bags or drums have vegetative phase can provide the twin benefits of saving also been developed to minimize pest problems during water at field level and enhancing rice yield. This is storage. especially beneficial for farmers who pump groundwater for irrigation because they can save on energy and On-station evaluation of ICM versus conventional rice pumping costs. In addition, this will also help reduce the cultivation (CRC) rate of overexploitation of groundwater for irrigation in Details of ICM field trials many Asian countries. Researchers have recorded a saving ICM and CRC were evaluated at the SWMRI research in field water use of 50 to 56 percent for intermittent farms in Thanjavur, and at TNRRI (Tamil Nadu Rice irrigation in a field trial at the research farm of Tamil Research Institute) in Aduthurai, India during the 2002/ Nadu Agricultural University (TNAU) in Coimbatore, 03 wet season. The soil type is clay to clay loam at TNRRI India (Thiyagarajan et al., 2002). In other studies, the and sandy loam to loam at SWMRI. The soil properties adoption of intermittent irrigation resulted in water of the two sites are given in Table 2. The experiment had savings of between 25 and 30 percent (Chandrasekaran 13 treatments organized in a randomized complete block et al., 2004). These authors noted that rice yield was design with three replications. The 13 treatments were generally maintained or increased when intermittent the selected combinations of: irrigation was adopted during the vegetative phase. • the five crop management factors of ICM: – seedlings at 4-leaf stage; Integrated pest management (IPM) – one seedling per hill; Practical IPM guidelines include: – square planting (0.225 × 0.225 m); • Grow a healthy crop. – mechanical weeding plus soil stirring by a rota- • Enhance natural enemies of pests. ting hoe (cono weeder); • Monitor fields regularly and take preventive – intermittent irrigation; and measures to minimize pest incidence. • Engage the community to manage certain pests such • the recommended cultivation practices of CRC: as tungro, rice bug, black bug and rats. – 25-day-old seedlings; – multiple seedlings (3–4) per hill; 67 PART III RICE INTEGRATED CROP MANAGEMENT

– row planting (0.15 × 0.1 m); 48 percent over that of the full combination of CRC) at – hand weeding; TNRRI and 6.6 tonnes/ha (an increase of 35 percent over – continuous flooding. CRC) at SWMRI. The increased yield in the ICM treatment was due to 35 to 49 percent more panicles per The plot size was 5 × 6 m (30 m2). A 115-day, fine-grain unit area and 23 to 44 percent more filled grains per (1 000-seed weight 15 g) rice variety, ADT-R 45, was panicle. used in the study. An MMN was raised using a soil + manure mix enrich- Effect of individual ICM factors ed with powdered diammonium phosphate at 0.5 g/kg of Compared to the grain yield of full ICM, removal of one soil-manure mix. The seed rate was 8 to 10 kg per 100 m2 ICM component at a time reduced the yield by: of MMN to plant 1 ha. A 0.5 percent urea solution was • 18–20% for mechanical weeding + soil stirring; sprayed on the ninth day after sowing to enhance seedling • 15–17% for use of young seedlings; growth. Young robust seedlings produced in 15 to 16 days • 14% for planting single seedlings per hill; and were transplanted in ICM plots, whereas 25-day-old • 10% for intermittent irrigation (Table 3). traditional nursery seedlings were planted in CRC plots. The number of irrigations given to ICM and CRC plots This observation indicates that mechanical weeding + soil was recorded. All other management practices, including stirring is the most important, followed by use of young nutrient management, were followed uniformly at an seedlings, planting single seedlings per hill and inter- optimal level for all treatments. Yield parameters were mittent irrigation. recorded before sampling the final harvest in each plot. With the adoption of intermittent irrigation in ICM Grain yield from a 5-m2 net plot was determined and (compared with ICM under continuous flooding), the expressed at 14 percent moisture content. The costs of number of irrigations decreased by 33 percent and grain cultivation and gross return were worked out for each yield increased by 11 to 12 percent. Removal of two or treatment and the benefit/cost ratio (B/C) was obtained three ICM factors at a time reduced rice yield drastically by dividing the gross return by the cost of cultivation. (by 1.9 to 2.0 tonnes/ha) compared with the yield of full ICM. Results and discussion Effect of full ICM versus full CRC on grain yield and Effect of adding ICM factors to CRC yield components When only intermittent irrigation was adopted for CRC, The combined effect of all five ICM factors produced the number of irrigations was reduced by 37 percent. the highest grain yield: 7.1 tonnes/ha (an increase of There was a positive effect on yield in the clay soil at

TABLE 2 Median values of selected properties of the soils at the two experimental sites

Soil properties TNRRI research farm SWMRI research farm (Old Cauvery Delta) (New Cauvery Delta) Clay (%) 39.0 8.6 Silt (%) 26.0 2.9 Sand (%) 35.0 88.5 Soil organic C (g/kg) 10.1 7.0 Total soil N (g/kg) 0.93 0.55 Soil pH (1:1 water) 7.3 7.1

CEC (cmolc/kg) 31.4 9.0

Exch. K (cmolc/kg) 0.57 0.27

Exch. Na (cmolc/kg) 1.33 0.29

Exch. Ca (cmolc/kg) 21.39 6.80

Exch. Mg (cmolc/kg) 9.40 3.40 Extractable P (Olsen-P, mg/kg) 25.84 29.8 Extractable Zn (0.05N HCl, mg/kg) 1.64 -

Source: Nagarajan et al., 2004. 68 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 3 Grain yield and selected yield parameters and calculated benefit/cost (B/C) ratio for rice under integrated crop management (ICM) and conventional rice cultivation (CRC) at TNRRI and SWMRI farms, Tamil Nadu, India, 2002/03 wet season

Treatment a TNRRI SWMRI No. of Panicles/ Grains/ Grain yield B/C No. of Panicles/ Grains/ Grain yield B/C irrigations m2 panicle (tonnes/ha) ratio irrigations m panicle (tonnes/ha) ratio YOSCI 12 452 130 7.1 3.2 16 424 184 6.6 2.7 (full ICM) NOSCI 12 377 110 5.9 2.6 16 344 162 5.6 1.9 (ICM – young seedling) YMSCI 12 390 115 6.1 2.8 16 362 167 5.7 2.3 (ICM – single seedling) YOSHI 12 365 105 5.7 1.8 16 336 147 5.4 2.2 (ICM – soil stirring) YOSCF 18 412 118 6.4 2.9 21 396 178 5.9 2.4 (ICM – intermitt. irrigation) YORHI 12 332 97 5.2 1.6 16 290 139 4.6 1.9 (ICM – square planting and soil stirring) YMRHI 12 337 97 5.2 1.7 16 299 144 4.7 1.9 (ICM – 1 seedling, square planting and soil stirring) NMSCI 12 369 106 5.8 2.6 16 332 160 5.4 1.9 (CRC w/square planting + soil stirring + intermitt. irrigation) NOSHI 12 359 105 5.7 1.8 16 336 156 5.2 1.8 CRC w/1 seedling + square planting + intermitt. irrigation) NMSHI 12 357 103 5.6 1.8 16 328 152 5.0 1.8 (CRC w/square planting + intermitt. irrigation) NORHI 12 352 102 5.5 1.7 16 304 148 4.9 1.7 (CRC w/1 seedling + intermitt. irrigation) NMRHI 12 331 96 5.1 1.6 16 280 138 4.5 1.6 (CRC w/intermitt. irrigation) NMRHF 19 304 90 4.8 1.5 21 312 149 4.9 1.7 (full CRC) LSD (5%) - 25 6 0.2 n.a. - 21 7 0.1 n.a a Y = young seedlings (15-days old); N = normal age seedlings (25-days old); O = 1 seedling/hill; M = multiple seedlings (3–4)/hill; S = square planting (0.225 × 0.225 m); R = row planting (0.15 × 0.1 m); C = cono weeding + soil stirring; H = hand weeding; I = intermittent irrigation, F = flooding; n.a. = not statistically analysed.

TNRRI, with an increase of 0.3 tonnes/ha, while the effect Cost/benefit analysis on yield in the sandy loam soil at SWMRI was negative, The cost of raising seedlings in MMN decreased by with a decrease of 0.4 tonnes/ha. Changing multiple 50 percent (Rajendran et al., 2004), whereas the cost of factors in CRC in a move towards ICM could result in crop management in the main field declined by less than significant yield increase on both sites. These data clearly 10 percent. The simultaneous reduction in the cost of demonstrate that by changing all five factors of CRC, it cultivation and the increase in grain yield added to will be possible to maximize grain yield in transplanted farmers’ profit. In on-station trials, the calculated B/C rice. ratio was 3.2 for ICM (compared with 1.5 for CRC at 69 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 4 Details of practices and inputs for integrated crop management (ICM) and farmers’ practice (FP), Cauvery Delta Zone, Tamil Nadu, India, 2002 dry season

Input/practice ICM FP Remarks for ICM No. of farmers 4 4 - Total area (ha) 3.0 0.5 - Variety used ADT 43 and ADT 36 ADT 43 and ADT 36 - Seed rate (kg/ha) 10–12 50–80 80–90% less seed Seedling age (days) 15–16 (4 leaves) 25–30 (5–6 leaves) Younger seedlings No. of seedlings per hill 1 4–5 75–80% fewer seedlings needed Weeding + soil stirring Mechanical weeding + soil stirring, Hand weeding, 2 times, at Soil stirring only in ICM 3–4 times from 14 DAT 20–25 and 30–40 DAT Irrigation Intermittent up to heading stage Continuous flooding 25–30% saving in water Urea applied (kg/ha) 206–306 275–330 25–65 kg less urea No. of N splits 3–4 (LCC) 2–3 1–2 more N splits Single superphosphate applied 250 250 - (kg/ha) KCl applied (kg/ha) 85 85 - Gypsum applied (kg/ha) 375 375 - Zinc sulphate applied (kg/ha) 25 25 - Organic manure (tonnes/ha) 5 5 -

TNRRI) and 2.7 for ICM (compared with 1.7 for CRC at season. They trained the selected farmers and prepared SWMRI) (Table 3). These results clearly demonstrate that them for field evaluation of ICM vis-à-vis their own the combination of five ICM options (use of young methods of cultivation. seedlings at 4-leaf stage, planting of one seedling per hill, square planting at 0.225 × 0.225 m spacing, mechanical Process of field evaluation of ICM and CRC weeding + soil stirring, and intermittent irrigation) Research and extension staff provided the critical inputs increases the profit in rice farming by decreasing the cost (seeding frame, rotary weeder, seed etc.) to the farmer- of cultivation and increasing the rice yield. Further cooperators for evaluating ICM in their fields. They evaluation of the critical components of ICM is ongoing helped them to raise the seedlings in MMN and to at the two research stations. transplant single seedlings in a square pattern. Farmers also raised their own crops in adjacent fields using the On-farm evaluation of ICM same improved seed and their own practices (farmers’ Farmer-participatory evaluation of ICM is essential to practice [FP]). The research and extension staff monitored measure the agronomic and economic benefits of ICM the ICM and FP crops and periodically discussed with vis-à-vis the current farmers’ methods of rice cultivation. farmers the differences in the development of the crops The data from on-farm evaluation of ICM are critical in in both fields. At harvesting time, farmers around the test order to convince policy-makers of the importance and fields were assembled to witness the performance of ICM benefits of ICM and of the need for its promotion to and FP crops, including the difference in yields between farmers at large. the two crops. The ICM farmers shared their ICM experiences with fellow farmers. Selection and training of extension staff and farmer- cooperators Details of field activities and crop management Initially, selected extension staff from the three districts, Young (15–16-day-old) seedlings were transplanted at Thanjavur, Thiruvarur and Nagapattinam, were trained one per hill in a square at 0.25 × 0.25 m spacing. If in ICM methods, including the preparation of young necessary, farmers replanted the missing hills (gap filling) seedlings in an MMN. The researchers of TNRRI- up to 7 to 8 DAT. Fertilizers were applied at the rates Aduthurai and SWMRI-Thanjavur worked with the given in Table 4. Full P and half K were applied as basal trained extension staff of the three districts to select (preplant) to all fields, while gypsum and zinc sulphate 100 farmers to evaluate ICM during the 2003/04 wet were applied at the recommended rates wherever 70 PART III RICE INTEGRATED CROP MANAGEMENT

necessary. N was applied as urea, based on LCC (leaf wet season. The full data for 100 farmers are being colour chart) readings taken starting at 14 DAT and analysed for yield, cost of cultivation and profit. In ending at heading. The remaining 50 percent of the K Indonesia, farmers’ practices (FP) were compared with was applied when the crop reached panicle initiation (PI) ICM in 33 districts (14 provinces) during the 2002 dry stage. A rotating hoe (cono or rotary weeder) was used season: a mean rice yield of 6.3 tonnes/ha was obtained for weeding and soil stirring 3 to 4 times at 7- to 10-day with ICM (compared with 5.2 tonnes/ha with FP); intervals from 14 DAT. The remaining weeds growing furthermore, an additional profit of US$115/ha was near the rice hills were manually removed using a few realized by adopting ICM (Zaini, Las and Makarim, labourers (between 4 and 6 person-days/ha). Fields were 2004). Farmers in south Viet Nam produced similar irrigated to a level of 5 cm, water was allowed to benefits for direct wet-seeded rice by integrating three disappear, and then the next irrigation was given (inter- factors: good-quality seed at a low seed rate; optimization mittent irrigation) up to PI. Just after PI, a water level of of N application using the leaf colour chart; and IPM. 2 to 3 cm was maintained continuously until 15 days They realized an additional profit of between US$93 and before harvest. Farmers cultivated the conventional rice US$214 per hectare (Balasubramanian et al., 2002). In crops using the same improved seed and their own farmer the Philippines, a few farmers started evaluating ICM practices (FP) in an adjacent field. In general, the crop only during 2003 and 2004; preliminary results indicate grown under ICM was harvested 4 to 5 days earlier than that, compared to FP, ICM results in higher rice yield the conventional crop. Table 4 provides the differences and greater profit. in practices between ICM and FP for four farmers who evaluated ICM during the 2002 dry season. Farmers’ feedback on ICM Farmers who evaluated ICM in Tamil Nadu, India referred RESULTS AND DISCUSSION that the combined use of ICM practices increased rice Table 5 presents the results of four farmers who evaluated yield substantially and reduced costs considerably. It is ICM during the 2002 dry season. With the limited sample important to train farm labourers to plant a single seedling of farmers, the adoption of ICM led to an increase in per hill in a square pattern at wider spacing; after one or yield of 2.16 tonnes/ha and additional profit of Rs11 868 two seasons, efficiency increases because labourers learn (US$264). Initial results from the 100 farmers who how to apply effectively the new planting method. evaluated ICM during the 2003/04 wet season indicated Farmers estimated that the labour requirement for mech- that the increase in mean rice yield from the adoption of anical weeding + soil stirring was less than that for hand ICM ranged from 0.5 to 2.5 tonnes/ha. The cost/benefit weeding; in contrast, labourers felt that it was very analysis of 20 of the 100 farmers showed that an demanding, especially when the soil was hard and there additional profit of Rs10 667 (US$237) per hectare was was no standing water in the field. Weed control is effec- obtained by farmers adopting ICM during the 2003/04 tive if mechanical weeding is done early (at around

TABLE 5 Rice yield and profit under farmers’ practice (FP) and integrated crop management (ICM) in the Cauvery Delta Zone, Tamil Nadu, India, 2002 dry season

Location/village Farmer Grain yield Profit (tonnes/ha) (INR/ha) [US$] FP ICM FP ICM Arupathy Mr Kalyanam 5.49 7.56 8 872 [197] 21 916 [487] Kadiramangalam Mr Gopal 3.37 5.61 0 11 698 [260] Edamelaiyur-I Mr Meganathan 3.77 5.66 2 030 [45] 11 957 [266] Edamelaiyur-II Mr Soundararajan 4.92 7.35 8 047 [179] 20 842 [463] Mean 4.39 6.55 4 735 [105] 16 603 [369] Additional yield/profit due to ICM - 2.16 - 11 868 [264]

Note: Price of paddy at INR5 250 per tonne (US$1 = INR45). 71 PART III RICE INTEGRATED CROP MANAGEMENT

15 DAT) when weeds are at the 2- to 3-leaf stage. • transplanting 1–2 young seedlings per hill in a Maintaining a 2- to 3-cm water layer in the field will square pattern (0.2 × 0.2 to 0.25 × 0.25 m); facilitate weeding. A motorized rotary or conical weeder • 2 to 3 mechanical weedings + soil stirring at 10- needs to be developed to reduce the drudgery of mech- day intervals from 15 days after transplanting; anical weeding. Farmers stated that they could save on • intermittent irrigation during the vegetative phase; irrigation water by as much as 30 or 35 percent – espe- • crop need-based nutrient management; and cially important in areas where groundwater is pumped • integrated pest management. to irrigate rice fields. Most farmers practising ICM experienced reduced or no pest incidence, particularly In addition, timely harvest and threshing, proper cleaning during the dry season. They mentioned that they could and drying of grain to 14°C, sealed storage, and proper easily identify ICM fields from far away because the milling with the help of a rice milling chart will reduce foliage of ICM crops remained green until maturity. They losses in the quantity and quality of grains produced. observed more and larger panicles with more filled grains Farmer-cooperators evaluating ICM in the Cauvery Delta per panicle in ICM fields than in their conventional crops. zone of Tamil Nadu, India during 2002–04 reduced They also indicated that ICM crops matured 4 to 5 days seedling production costs by as much as 50 percent and earlier than their own crops and, therefore, bird damage main-field crop management costs by under 10 percent; was severe in some places. It is therefore better to plant they increased grain yield by more than 1.5 tonnes/ha ICM crops a week later to synchronize their maturity with and enhanced overall profits by more than Rs10 000 farmers’ crops. All the farmer-cooperators were highly (US$222) per hectare. Similar results were obtained by impressed with the performance of ICM crops in their farmers in Indonesia, the Philippines and Viet Nam. own fields and they planned to continue with the ICM Widespread dissemination of technologies and the ICM method for cultivating rice in subsequent seasons. approach to farmers will require training of extension staff, the production of training and mass communication CONCLUSIONS materials, training and follow-up support to farmers, and Most farmers face four serious problems in irrigated rice the provision of funding support to the extension depart- farming: ment and farmers. • yield stagnation; • declining profit (due to rising input costs and low REFERENCES rice prices); Balasubramanian, V., Makarim, A.K., Kartamadtja, S., • reduced availability of land, water and labour; and Zaini, Z., Nguyen, N.H., Tan, P.S., Heong, K.L. & • crop failure due to adverse weather. Buresh, R.J. 2002. Integrated resource management in Asian rice farming for enhanced profitability, efficiency In addition, rice yields vary substantially among farmers and environmental protection. Poster paper presented at in a given location. Scientists have developed suitable the 1st International Rice Congress, Beijing, China, 15– technologies to address these problems and to minimize 21 Sept. 2002. IRRI, Manila, Philippines. the yield gap. A new approach, known as integrated crop Chandrasekaran, B., Palanisami, K., Balasubramanian, management (ICM), is used to integrate compatible V., Rajendran, R., Nandhagopal, A. & Sivakumar, technologies with the following objectives: S.D. 2004. Participatory irrigation management for • enhance grain yield; equitable distribution of water and enhanced rice yield • reduce the cost of cultivation; in the Cauvery Delta Zone, Tamil Nadu, India. Accepted • promote efficient use of water and other resources; for publication in Intl. Rice Res. Notes. and Dobermann, A., Witt, C. & Dawe, D. (eds). 2004. • increase profits in rice farming. Increasing productivity of intensive rice systems through site-specific nutrient management. Enfield, NH, USA, Key components of ICM include: Science Publishers, Inc., and Los Baños, Philippines, • use of good-quality seed at a low seed rate; IRRI. 410 pp. • preparation and planting of young seedlings at the Makarim, A.K., Balasubramanian, V., Zaini, Z., 4-leaf stage; Syamsiah, I., Diratmadja, Handoko, Arafah, I.G.P.A., 72 PART III RICE INTEGRATED CROP MANAGEMENT

Wardana, I.P. & Gani, A. 2002. System of Rice Thiyagarajan, T.M., Velu, V., Ramasamy, S., Durgadevi, Intensification (SRI): evaluation of seedling age and D., Govindarajan, K., Priyadharshini, R., selected components in Indonesia. In B.A.M. Bouman, Sudhalakshmi, C., Senthilkumar, K., Nisha, P.T., H. Hengsdijk, B. Hardy, P.S. Bindraban, T.P. Tuong & Gayathry, G., Hengsdijk, H. & Pindraban, P.S. 2002. J.K. Ladha, eds. Water-wise rice production. Proceedings Effects of SRI practices on hybrid rice performance in of the International Workshop on Water-wise Rice Tamil Nadu, India. In B.A.M. Bouman, H. Hengsdijk, Production, Los Baños, Philippines, 8–11 April 2002. p. B. Hardy, P.S. Bindraban, T.P. Tuong & J.K. Ladha, eds. 129–139. Los Baños, Philippines, IRRI, and the Water-wise rice production, Proceedings of the Netherlands, Plant Research International (PRI). International Workshop on Water-wise Rice Production, Malabanan, F.M. 1993. Association of seed vigor with field 8–11 April 2002, Los Baños, Philippines, p. 119–127. performance of high-yielding and traditional rice (Oryza Los Baños, Philippines, IRRI, and the Netherlands, Plant sativa L.) cultivars. Ph.D. dissertation, University of the Research International (PRI). Philippines, Los Baños, Philippines. Tuong, T.P. & Bouman, B.A.M. 2003. Rice production in Rajendran, R., Ravi, V., Nadanasabapathy, T., water-scarce environments. In J.W. Kijne, R. Barker & Valliappan, K., Ramanathan, S., Jayaraj, T. & D. Molden, eds. Water productivity in agriculture: limits Balasubramanian, V. 2004. Modified rice mat nursery and opportunities for improvement, p. 53–67. CABI for producing robust young seedlings in 15 days for early Publishing, United Kingdom. transplanting and enhanced productivity under Uphoff, N. 2002. Changes and evolution in SRI methods. transformed rice cultivation. Accepted for publication in In Proceedings of International Conference on Indian J. Agron. Assessments of the SRI, Sanya, China, 1–4 April 2002, Randriamibarisoa, R., & Uphoff, N. 2002. Factorial trials p. 8–14. Ithaca, New York, Cornell University. evaluating the separate and combined effects of SRI Zaini, Z., Las, I. & Makarim, A.K. 2004. Development practices. In Proceedings of International Conference on of integrated crop and resource management options for Assessments of the SRI, Sanya, China, 1–4 April 2002, higher yield and profit in rice farming in Indonesia. p. 40–46. Ithaca, New York, USA, Cornell University. Submitted for publication in Intl. Rice Res. Notes. 73 PART III RICE INTEGRATED CROP MANAGEMENT

Development and dissemination of integrated crop management for productive and efficient rice production in Indonesia1

S. Abdulrachman, I. Las and I. Yuliardi Indonesian Institute for Rice Research, Indonesia

Although there is indication that the production and (Consultative Group on International Agricultural productivity decrease in intensive lowland rice is leveling Research) has a holistic and integrated approach to off, the lowland rice intensification system, particularly research and focuses on resources. On a macro scale, the the irrigated field, remains the priority for increasing strategy is the ecoregional initiative, while on a micro national rice production. The lowland rice production scale it is explained within integrated crop management. system is the most dominant rice production system in On this basis, the most feasible choice for rice Indonesia: over the last 30 years, it has accounted for production increase in Indonesia in the near future is between 92 and 95 percent of national rice production. productivity increase achieved by cultivation technology Therefore, the various efforts aimed at lowland rice development through integrated crop and resource production increase will have a direct impact on the management (ICM). ICM aims to obtain optimal plant national rice production increase. Nevertheless, the growth, high product quality and environment current rice situation is cause for alarm: harvest area and conservation, combining all selected, compatible and productivity growth (both reported as directly involved complementary components of a farming system in order in the level of rice production) are showing a tendency to to achieve optimal harvest yield and sustainable decrease. environment. ICM is not a package of technologies; it is The existing rice production system, particularly in a strategy or methodology – even philosophy – for plant irrigated lowland rice, is more focused on productivity production increase through the integrated management and production increase and rarely assumes that of plant, soil, water and nutrient resources, with the aim production input efficiency may decrease; moreover, soil of obtaining better plant growth as well as higher and degradation relates directly to the sustainability of the sustainable yields of production. production system. At the FAO Agriculture and Environment Conference, It is interesting that the success of the national rice held in the Netherlands in 1991, ICM was discussed and production increase (from 20 183 million tonnes in 1971 accepted as a new approach for the programme of to approx. 50 million tonnes in 2000) is more dominated sustainable food production. IRRI (International Rice by the increase in productivity than by the increase in Research Institute) attempted to integrate discipline- harvest area (Las, Siprihatno and Widiarta, 2004; Las, oriented research on wet rice-field into the Integrated Rice Widiarta and Ruskandar, 2004). Productivity increase Research Consortium (IRRC). However, at a meeting in accounts for 56.12 percent of production increase, Viet Nam in 1999, it was concluded that research con- expansion of harvest area accounts for around ducted in the field was still disipline-oriented in nature. 26.34 percent; the remainder is the interaction of both. Therefore, the research approach should be redesigned Commodity-based research is characterized by a partial in order to be adjusted to the integrated crop management approach for handling plant productivity. CGIAR (ICM) approach (Kartaatmadja and Fagi, 2000).

1 Paper presented at a Consultation Workshop on Rice Integrated Crop Management Systems – Rice Check Methodology for Food Security, Livelihood Improvement and Environmental Conservation, Ho Chi Minh, Viet Nam, 28 Feb. – 2 Mar. 2005. 74 PART III RICE INTEGRATED CROP MANAGEMENT

INTEGRATED CROP MANAGEMENT (ICM) developed in Madagascar and known as SRI (system of The concept and principles of ICM were developed and rice intensification), has given the inspiration for the tested by scientists from the Indonesian Institute for Rice implementation of ICM research in IIRR, Sukamandi Research (IIRR) and the Indonesian Center for Food Crop since 1999. On average, an ICM demonstration plot in Research and Development (ICFORD) between 1998 and the 1999 dry season produced a grain yield of 6.2 tonnes/ 2000. Information from various sources (the experience ha, i.e. 51 percent higher than the farmer’s yield using of the system of rice intensification [SRI] developed in the traditional method. Farmers used 21-day-old seedl- Madagascar, an international IPM network and IRRI’s ings, three seedlings per hole, no organic matter, Mega Project), existing rice technologies developed by continuous flooding, and fertilized with NPK. The grain researchers at IIRR-ICFORD and elsewhere, farmers’ yield in the 1999/2000 wet season, produced from six indigenous knowledge and biophysical aspects were demonstration plots (1 500 m2 each), ranged from 7.2 to accumulated and inserted into a concept of ICM. 9.3 tonnes/ha with a return-to-cost (R/C) ratio of between From the outset, ICM’s aim has been to increase 1.63 and 2.08. Meanwhile, the average grain yield with national rice production (including farmer income) and the farmer’s traditional method was 6.5 tonnes/ha with improve soil conditions in lowland rice. ICM tries to an R/C ratio of 1.61. Even some harvest samples from an introduce the notion that there is no single component of area of 10 × 10 m2 had a grain yield of 103 kg (equivalent technology capable of individually bringing about a of 10.3 tonnes/ha). This grain yield was the highest level significant increase in rice production and its efficiency ever achieved in Sukamandi. – or, if there is, the increase in productivity and efficiency In the second year (2000/01), i.e. the 2000/01 wet will be much higher if the synergy with other technologies season, ICM treatment could produce between 7.7 and is taken seriously into consideration. ICM, therefore, 9.1 tonnes/ha (R/C = 2.00 to 2.48), with an average yield accommodates principles developed in integrated pest of 8.4 tonnes/ha, i.e. a production increase of 29 percent management (IPM), integrated nutrient management compared to the farmer’s traditional method (6.5 tonnes/ (INM), integrated water management (IWM) and other ha and R/C = 1.97). The response towards ICM differed managements related to rice culture. In principle, this among varieties: Ciherang produced between 7.3 and concept is applicable to other commodities and other agro- 7.7 tonnes/ha, IR64 6.8 to 6.9 tonnes/ha, and Way Apo ecosystems, but the technology component of ICM places Buru 7.4 to 7.6 tonnes/ha. At the same time, farmers in emphasis on specific local considerations. surrounding areas using the traditional method only had ICM is not so much a package of technologies as a set yields of around 5.7, 4.7 and 4.9 tonnes/ha, respectively. of principles explaining the synergy among its compon- The three varieties used in ICM gave higher R/C values ents. Technologies include: compared to those of the traditional method. The main • selection of the best and highest-yielding new rice components of ICM (young, single seedlings, intermittent varieties, and of best-quality seed to produce irrigation and soil organic matter) were production superior seedlings; components used in irrigated lowland rice production. • planting young and healthy seedlings; Then, on the basis of the 2001 result, the model began to • seedling establishment; be developed outside Sukamandi. • crop-need-based nutrient application; • incorporation of organic manure and nitrogen RESEARCH AND ASSESSMENT NETWORK fertilizer into the soil; In the past, research and development in the working units • intermittent irrigation and drying of soil; of the Indonesian Agency for Agricultural Research and • frequent mechanical weeding; and Development (IAARD) operated individually, without • control of pests and diseases based on a regular field integration in programme implementation. Given the observation and an early warning system whenever difficulties in balancing the changes and the needs of possible. technology at farmer level (few technologies could be obtained and used by farmers in the field) and aware of INITIAL IMPLEMENTATION OF ICM the lack of efficiency and effectiveness of the dissemi- As mentioned above, Mega Project research resulted in nation techniques for the research results, IAARD and long-term fertilizing. A rice-intensification approach, its working units further sharpened the strategy and 75 PART III RICE INTEGRATED CROP MANAGEMENT

approach for agricultural research and development. In 2. efficiency and acceleration transfer of the research 2001, an integration of IAARD working units operated result and its development at regional level; as a research and assessment network. Within this net- 3. strengthening and revitalization of research work, the working units were members who actively resources (capacity-building); and participated in networking: from the planning, research- 4. feedback of research results from stakeholders and assessment and development processes through to farmer beneficiaries. level. The research-assessment network in IIRR and AIAT Research and development activities were assessed prior (Assessment Institute for Agricultural Technology) aims to the development of a technology or innovation and to increase the efficiency of research and development before its implementation to farmers. Research and assess- and dissemination through: ment programmes were implemented at farmer level 1. acceleration and up-calling of research; through the research-assessment network (the Center for

FIGURE 1 Research-assessment network of IAARD

IAARD

ICFORD ICASERD

IIRR

AIATs

Regional institution Farmer

Farm production system

Seed and seedling Cultivation technique/technology Distribution and marketing Dissemination Monitoring-evaluation Up-scaling 76 PART III RICE INTEGRATED CROP MANAGEMENT

Research and Development [CRD], Research Institute technology; it also aims to improve the components of [RI] and Assessment Institute for Agricultural Technology the technology which is location-specific. The standard [AIAT]). Within the AIAT working units, this networking of comparison are the farmers’ non-ICM fields located was further expanded by involving the institutions around the assessed location. Besides involving the concerned in the regional areas, with the result that the farmers, it is important to have good cooperation with research-assessment networking programme was imple- the institutions: agricultural services, irrigation offices and mented in an integrated way, both vertically and hori- regional developments. zontally (Figure 1). Various components of technology of irrigated lowland Coordination in the research and assessment prog- rice are available; researchers, extension officers and ramme involves team work between IAARD, CRD and farmers select and choose together the technology that is RI. Given the complexity of problems, it is essential that suitable for development in the location concerned, taking there is coordination among scientists from various into consideration the synergism among the components disciplines. The coordinator’s tasks include: of technology to be applied. In order to verify and improve • coordination of the implementation of the research the components of technology and accelerate ICM and assessment programme; development in the concerned region, in situ super- • development of the knowledge of the human imposed research of about 1 ha is conducted. resources involved in the programme; The implementation phases of the ICM approach • design of the development components (together model in an area are as follows: with the team from commodity institutes and 1. Area identification. ICM is developed and AIATs); evaluated in a region which offers potential for • monitoring and evaluation for smooth programme irrigated lowland rice development. Area implementation; and identification (sample province, district, subdistrict • reporting to CRD and IAARD. and village) is based on the potential of the irrigated lowland rice and the rice planting intensity. The ICM The coordinator is the RI concerned (e.g. IIRR), assisted components are determined once the PRA by scientists from IAARD, CRD and other parties (e.g. (participatory rural appraisal) activities in the sample IRRI). village have been conducted. In implementing the ICM research and assessment 2. ICM research and assessment. The ICM approach programme, the activities are distributed to the units under model is conducted in the irrigated lowland rice area IAARD, in accordance with the functions and roles of of approximately 4 ha, involving 10 to 15 farmer- each institution. Nevertheless, most ICM activities are cooperators for 3 years. On the basis of the conducted at IIRR which holds the national mandate for rice research and development. Each institution has its TABLE 1 own fund allotments, depending on the activities handled. Matrix of ICM research and assessment programme The job description in the operation of the ICM research activities a and assessment programme is given in the matrix of Activities ICFORD IIRR AIAT IRRI activities in Table 1. Initial design ** *** ** * Training ** *** ** ** RESEARCH AND ASSESSMENT APPROACH PRA * *** *** * Components of *** ** * The research and assessment programme on “ICM technology Development and Evaluation on Irrigated Lowland Rice” Implementation * ** *** * Superimpose * ** *** * evaluated the ICM approach model in eight provinces of research rice production centres in Indonesia beginning in 2001. Basic and strategic * *** * * research Research and assessment was carried out with the farmer Coordination ** *** *** * participatory approach within the community in an area Monitoring-evaluation *** *** *** * and synthesis of approximately 5 ha (4 ha of demonstration plot and Dissemination and ** * *** 1 ha used for superimposed research). The purpose of publication research and assessment is aside from disseminating a Number of stars shows the intensity of involvement. 77 PART III RICE INTEGRATED CROP MANAGEMENT

identification results of the resource potentials of 900 kg/ha NPK. Nowdays, farmers could accept a total (biophysical and socio-economic), the production of 450 kg/ha NPK fertilizer. After two seasons, the constraints, the problems faced by farmers and the collaborating farmers admitted that 10 kg of seed and problem priority to be solved, the components of 265 kg/ha of prill urea in the wet season were sufficient technology to be applied in the ICM model are to produce the same yield as before when more seed and determined. Without neglecting the participatory fertilizer were applied. approach principle, farmers are regarded as equal Reduction of seed rate was an innovation and was working partners with researchers and extension acceptable to most farmers involved in the collaborative officers. Therefore, they are directly involved in trial. In the Grobogan area, the farmers commonly used determining the components of technology to be up to 40 kg/ha of seeds. Reduction of seeds from 40 kg applied, as conducted during PRA. to only 10 to 15 kg would have a significant impact. It 3. Meetings and discussions between researchers, was interesting when an individual farmer in Cilacap, extension officers and farmers are periodically for example, found it difficult to manage irrigation water conducted in the research location with the aim of intermittently; the irrigation authorities in other districts, improving operations in the field. The ICM such as Grobogan, Kudus, Demak and Pati, administered approach model is not static in nature and the 3-day intermittent irrigation. Irrigation water management components of the existing technology must be has an important role not only in saving water but in perfected in line with the dynamics of the resources supporting the rice intensification programme. in the field. Rice Gross Margin Analysis, designed for the ICM 4. Superimposed research. In implementing ICM in Network with the assistance of Dr Thomas Fairhurst, the field, there is a possibility that not all available helps to explain the extent of the benefits resulting from components can be provided at the beginning of application of the ICM principles. Below is described an the assessment. Therefore, superimposed research example of reduction of cost production for 1 kg of rice. should be done to support ICM development and For example, in the second dry season (June–Sept.) of evaluation in every planting season. Different kinds 2001, the farmers in Sragen who were practising the ICM of superimposed research can be done in line with principles received a margin of Rp117/kg compared to the problem priority, the availability of resources, the farmers applying 500 kg/ha of urea. When a collabor- farmers’ needs etc. ative farmer could produce 10 tonnes/ha of dry harvest, he earned an additional Rp1 170 000 (US$130) compared ICM ASSESSMENT to other farmers. Applying more nitrogen fertilizer results An assessment of rice intensification practising ICM in a high level of infection by bacterial leaf blight disease; principles was first conducted in Grobogan District, the quantity of paddy is low due to the poor grain quality Central Java in the 2000/01 wet season (Nov.–Feb.). The caused by grain discoloration. following season, the same trial was repeated in a nearby On the basis of the above results, ICM was developed village. In the fiscal year of 2001 (which began in the and assessed in eight provinces: North Sumatra, West 2001/02 wet season), ICM assessment became part of Sumatra, West Java, Central Java, East Java, Bali, West the National ICM Network, a nationwide programme Nusa Tenggara and South Sulawesi, through the research initiated by IAARD and conducted by AIATs in seven and assessment programme network. There were two provinces. The districts of Grobogan and Sragen were villages in each province (except for West Sumatra, where chosen as sites for the ICM Network. there was only one village). In every province, there were Most farmers in Grobogan applied urea tablets (a single trials in two villages (5 ha in each village), implemented application at 3–5 days after transplanting). The rate of by the local farmer (cooperator). In each location, there fertilizer applied was around 250 to 280 kg/ha urea. In were four interrelated programmes to be implemented. contrast, farmers in Sragen and the surrounding districts Assessment began with a study of the potential and commonly applied prill urea at 500 kg/ha. The direction constraints of research implementation on the 4-ha of ICM assessment in the two districts is slightly different. development model (demonstration plot); superimposed The reduction in the quantity of urea application in Sragen research was carried out on the 1-ha area and impact became the main concern. Farmers used to apply a total analysis. The development model was dynamic in nature, 78 PART III RICE INTEGRATED CROP MANAGEMENT

improvement the following season was based on the best The Agricultural Service for Food Crops of Central results in the superimposed research, and communication Java Province, in cooperation with the Central Java was always through the farmer-cooperator (participatory). Assessment Institute for Agricultural Technology (AIAT), The intensification system was later implemented in other initiated an enrichment of the PMI programme through regions with a similar agroecosystem. Upon completion, the introduction of ICM principles. It was obvious that the programme could identify the most suitable lowland by employing the current approaches, the annual target rice intensification method for the existing resources in of national rice production was difficult to achieve. the region concerned. Furthermore, rice productivity tended to decrease. The Directorate General for Food Crops organized a INTEGRATED RICE DEVELOPMENT PROJECT (P3T) mass demonstration of PMI. In each district, 500 ha of In 2002, an integrated rice development project (known rice-field were selected on the basis of irrigation coverage. as P3T) was initiated and developed in 31 districts in These 500 ha of rice field were divided into five groups, 14 provinces. The project was directed towards the effort known locally as “gapoktan” (literally a “commune”, in to increase farmers’ income through additional on- and practice, three or four farmers per group). One gapoktan off-farm activities in the village. The introduction of a covered about 100 ha, with the total number of farmers crop livestock system was intended to increase farmers’ reaching 500. Although there were variations from district income and at the same time provide farmyard manure to to district, it appeared that 500 ha of rice field could be be used for rice. Rice farming was managed by applying cultivated by an average of 2 500 farmers. the ICM principles, with farmers growing common high- In order for the technology to be easily disseminated, yielding varieties or hybrid rice. Seed money was lent at in every 100 ha of gapoktan, voluntary farmers were a very low interest rate to the housewife or farmer who requested to establish a field laboratory. One field needed additional funds for off-farm activities. In this laboratory in each gapoktan covered approximately 5 ha project, village micro-financing was introduced by which served as a nucleus, while the remaining 95 ha establishing an innovative rural institution managed by a served as plasma. This field laboratory operated as a member of the rural community. AIAT provided training ground for farmers. In approximately 5 ha of administrative training. irrigated rice field, cooperation among farmers was One year later (2003), P3T was extended to cover facilitated by one farmer serving as the head of the 41 districts in 22 provinces. In each district, 100 ha were “irrigation block”. The 500 ha of PMI area were divided developed as a model of sustainable rice intensification. into 100 irrigation blocks coordinated by the head. The The backbone of this rice intensification model was ICM. heads of the farmer groups along with the head of the Other components were crop livestock and village micro- Agriculture Service for Food Crops at subdistrict level financing institutions. were responsible for managing the intensification of rice in the field laboratory. ENHANCEMENT PROGRAMME OF THE INTENSIFICATION QUALITY (PMI) PERFORMANCE OF ICM IMPLEMENTATION The acronym of this programme in Indonesian is PMI. It ICM assessment and evaluation in some provinces in covers rice, soybean and corn. The programme comprises Indonesia is now in its third year, and ICM application in several approaches: the farmer’s field has to date shown positive results. Gani • Establishment of a farmers’ cooperative institution. et al. (2002) reported that during the first season of • Competition for a leading farmer group. assessment (2001 dry season) in nine provinces • Institutionalization of groups of farmers. (15 villages) in Indonesia, ICM provided an average rice • Support to banks to provide credit for farmers. productivity increase of 20 percent (Table 2) and during • Facilitating the availability of production inputs. the 2001/02 wet season it was 38 percent higher than the • Increasing crop productivity. traditional method (Table 3). Where there was a poor response to ICM in some locations, there was less than Since 2002, the Directorate General for Food Crops has perfect application of the main components, particularly implemented these activities in major rice-producing with regard to irrigation. Some farmers continued to flood provinces. their wet rice field as they were afraid of water scarcity – 79 PART III RICE INTEGRATED CROP MANAGEMENT

for example, in Bojongjaya, West Java – and there was a (compared to the traditional irrigation method) could decrease in yield after applying ICM. In addition to the achieve savings in irrigation water of 24.7 percent in fact that irrigation is difficult to control, many farmers Sukamandi and of 22.0 percent in Kuningan. are unwilling to change their old irrigation system. Farmers applying ICM in the 2001/02 wet season saved The first season of ICM assessment revealed that, on 15 to 40 kg/ha of seed and 140 to 200 kg/ha of urea, with average, use of urea fertilizer could be reduced by 140 kg/ a consequent reduction in production costs. As a result, ha and seed by 30 kg/ha. ICM increases productivity, the R/C value using ICM was generally higher (2.06– reduces the use of urea fertilizer and seed, and also 3.28, with an average of 2.77) compared to the traditional reduces the use of irrigation water, since rice fields are method (1.71–3.42, average 2.36). Grain yield increases not always flooded (periodic irrigation). Wityanara, Gani were also seen in the ICM treatment during the 2002 dry and Pirngadi (2001) reported that intermittent watering season (Table 4).

TABLE 2 Grain yield, yield increase and R/C value through the application of ICM in various assessment locations, dry season 2001

Province Village ICMa Non-ICM a Yield increase (tonnes/ha) (tonnes/ha) (%) North Sumatra Aras 6.0 5.0 20.0 Tanjung Kubah 6.1 5.0 22.0 West Sumatra P. Pakandangan 4.7 3.8 24.0 West Java Sukasenang 5.0 4.6 8.7 Bojongjaya 5.9 6.1 -3.3 Central Java Sugihan 7.5 7.0 7.1 Kliwonan (DS1) 6.4 4.8 33.3 Kliwonan (DS2) 8.0 7.6 5.3 East Java Gunungrejo (DS1) 9.3 7.4 25.7 Gunungrejo (DS2) 7.6 [2.06] 6.8 [1.91] 11.8 Tembalang (DS1) 8.5 7.3 16.4 Tembalang (DS2) 8.4 [2.59] 5.7 [2.08] 47.4 West Nusa Tenggara Jangala 7.4 6.5 13.9 Balo 5.9 [2.92] 4.3 [2.22] 37.2 South Sulawesi Matoanging 6.5 5.8 12.1 Bali Petiga (DS2) 7.6 [2.59] 5.7 [2.08] 33.3 Tunjuk 6.9 5.7 21.1 South Sulawesi Pinrang 8.0 [3.00] 6.5 [3.08] 23.1 a Number in brackets is R/C value. Source: Gani et al., 2002.

TABLE 3 Grain yield, yield increase and R/C value through ICM application and the traditional farmer’s method, wet season 2001/02

Province Village ICMa Non-ICMa Yield increase (tonnes/ha) (tonnes/ha) (%)

West Sumatra P. Pakandangan 5.3 [2.98] 3.5 [1.71] 51.4 West Nusa Tenggara Tanjung 7.1 [3.28] 5.7 [3.42] 24.6 a Number in brackets is R/C value. Source: Gani et al., 2002. TABLE 4 Grain yield and yield increase through application of ICM in various assessment locations, dry season 2002

Province Village Grain yield (tonnes/ha) Yield increase (%) ICM Non-ICM North Sumatra Aras 5.5 3.8 44.7 West Java Sukasenang 5.7 4.8 18.8 Central Java Jetak 6.7 6.2 8.1 East Java Tembalang 6.7 5.9 13.6 Bali Tunjuk 7.1 6.4 10.9 West Nusa Tenggara Jenggala 9.1 7.9 15.2 80 PART III RICE INTEGRATED CROP MANAGEMENT

The ICM farming system conducted in 19 districts over West Sumatra, West Java, Central Java, East Java, Bali, one to three seasons showed that production and profits West Nusa Tenggara and South Sulawesi) revealed a very increased in all locations, except Subang. Per hectare positive response from farmers to ICM: they appreciated increases in production and profit varied from 0.06 to the benefits of the technology and wished to continue 3.68 tonnes and from Rp309 to Rp2 295. However, in the following season. some locations ICM production costs are still higher The average grain yield achieved by the farmer- (Table 5), with farmers spending a greater proportion of cooperators ranged from 4.65 tonnes/ha (West Sumatra) their budget on farmyard manure and potassium fertilizer to 7.68 tonnes/ha (Bali) with an average yield of – fertilizers otherwise rarely used. 6.32 tonnes/ha – while the average yield of non- Although the cost of purchasing these fertilizers was cooperators was 5.42 tonnes/ha. The increase in grain high, there are great benefits for soil fertility: first, it yield ranged from 7.1 percent (Central Java) to improves the physical properties of the soil, and second, 38.6 percent (Bali) with an average of 17.3 percent. Net it increases the resistance of plants to pests and diseases income increased by 49.9 percent compared to the and gives a better quality of grain. It takes time and farmer’s model. The figures show that development of support from agricultural experts to help farmers fully the ICM model in other regions is feasible. understand these benefits. High-yielding new varieties, seed treatment and rodent control are the ICM components preferred by the farmer- ICM IMPACT ANALYSIS cooperators, while other components – use of the leaf The results of the impact study on ICM development and colour chart to determine the giving of urea fertilizer, assessment carried out in eight provinces (North Sumatra, and use of organic matters and P and K fertilizing based

TABLE 5 Average changes in finances of rice-farming production for cooperator (ICM) and non-cooperator (non-ICM) farmers in several districts in Indonesia

District Season Production cost Grain yield Profit (‘000 Rp) (tonnes/ha) (‘000 Rp) Deli Serdang 2002/03 WS + 66.5 + 1.31 + 1 635.5 2003 DS + 191.5 + 1.95 + 2 294.8 Solok 2002/03 WS + 378.3 + 1.04 + 1 035.9 2003 DS + 390.3 + 0.90 + 970.5 Asahan 2002/03 WS + 283.2 + 2.04 + 2 164.8 Pinrang 2002/03 WS + 539.9 + 1.76 + 1 933.4 2003 DS + 399.8 + 1.73 + 1 797.2 Rokan Hulu 2003 DS + 867.8 + 1.70 + 1 166.5 OKU 2002/03 WS + 766.9 + 0.78 + 309.0 2003 DS + 55.0 + 1.27 + 1 065.0 Bone 2002/03 WS + 456.2 + 1.10 + 1 360.0 Bojonegoro 2002/03 WS + 287.0 + 1.05 + 868.0 2003 DS + 278.0 + 1.01 + 934.0 Sambas 2002/03 WS + 518.2 + 1.04 + 729.8 2003 DS + 239.2 + 0.40 + 640.8 Blitar 2002/03 WS + 360.0 + 1.14 + 1 008.0 2003 DS + 340.0 + 1.35 + 1 212.5 Karawang 2003 DS + 1.0 + 1.43 + 1 864.8 Subang 2003 DS - 85.2 0.00 - 117.3 Majalengka 2003 DS - 57.8 + 0.25 + 928.0 Kuningan 2003 DS - 83.6 + 0.98 + 1 328.4 Mandailing Natal 2003 DS - 17.8 + 3.68 + 5 307.0 Bima 2002/03 WS - 121.4 + 1.09 + 1 321.3 2003 DS - 263.7 + 0.28 + 534.6 Padang Pariaman 2002/03 WS - 57.0 + 0.58 + 724.0 2003 DS - 57.5 + 0.49 + 743.5 Lampung Tengah 2002/03 WS - 67.0 + 1.29 + 1 422.5 2003 DS - 33.1 + 1.02 + 1 261.6 2002 DS - 67.5 + 1.29 + 1 328.3 Lombok Barat 2002/03 WS - 88.6 + 0.06 + 599.6

Source: Makarim et al., 2003. 81 PART III RICE INTEGRATED CROP MANAGEMENT

on the result of soil analysis – are not as easily accepted • an approach for developing a rice farming system and farmers require support in these areas. The pair row on irrigated land; plant spacing (legowo) system of 4:1 or 2:1 is highly • a method of rice intensification on irrigated land, preferred by farmers in Sumatra, West Sumatra, West Java intended to increase farmer income by increasing and East Java AIATs, because it can produce higher grain productivity and the efficiency of production inputs, yield compared to the usual plant spacing (tegel) system. and by maintaining or increasing soil fertility for Single seedling and young age (15 days after sowing) is the sustainability of the production system. practised by farmers applying the ICM model, i.e. in Central Java and East Java. However, where golden snails Since the implementation of ICM research and assess- and mole crickets are constraints, the planting of young ment, this method has been widely developed; it has even seedlings is not recommended. been part of the national programme: Integrated Rice It is evident that ICM can increase productivity and Development Project and Enhancement Programme of income in lowland rice farming systems. At research level, the Intensification Quality. ICM can increase rice productivity by around 38 percent Essentially, ICM is not a package of technologies. It is with yields of between 7 and 8.9 tonnes/ha, while at a strategy or methodology – a philosophy – for crop assessment level in farmers’ fields in 18 locations in production increase designed to manage the crop, soil, 10 provinces, productivity increases at an average rate water and nutrients in an integrated way and achieve better of 27 percent (6.5–8.0 tonnes/ha). Through ICM plant growth, as well as higher and sustainable yield. The development in the Integrated Rice Development Project integrated crop and resource management model is in 28 districts, rice productivity increases at an average expected to be able to increase rice production, and its rate of 18 percent or at around 0.6 to 1.2 tonnes/ha with application in the broader production scale could lead to an income increase of between Rp900 000 and sustainable rice self-sufficiency in the country. Rp1.2 million per hectare. Implementation of ICM could increase rice prod- There is a gap between the productivity increase uctivity by: achieved in research and development and that seen at • 37 percent at research level (from 5.8 to 9.2 tonnes/ farmer level, indicating that the increased potential of ha, average 7.9 tonnes/ha); rice productivity to attain rice self-sufficiency is still quite • 27 percent at assessment level (from 5.3 to high. In 2004, the Directorate General for Food Crops 8.8 tonnes/ha, average 7.2 tonnes/ha); and Production programmed ICM replication and • 16 percent at farmer development level (from 4.2 to development activities in the Enhancement Programme 8.8 tonnes/ha, average 5.8 tonnes/ha). of the Intensification Quality area in 199 districts. If each district succeeds in its development, rice production will In addition, ICM has a positive impact on farmer income increase by almost 2 million tonnes of milled dry grain and input-use efficiency. with an added economic value of around Rp2.39 billion. REFERENCES CONCLUSION Gani, A., Kadir, T.S., Jatiharti, A., Wardhana, I.P. & The Indonesian research strategy policy for the future is Las, I. 2002. The system of rice intensification in to find and apply intensification technology packages Indonesia. Paper presented in SRI International which take into account the sustainability of a production Conference in Sanya, China, 1–4 April 2002. 9 pp. system – in particular in the intensive rice production Juliardi, I. & Gani, A. 2002. Report on impact analysis of system which aims to regain rice self-sufficiency in the ICM in some locations. Indonesian Institute for Rice country. With well-integrated crop and resource manage- Research, Sukamandi. Unpublished report (in Bahasa ment, the degradation of land resources that has often Indonesia). been reported can be minimalized and the sustainability Kartaatmadja, S. & Fagi, A.M. 2000. Pengelolaan tanaman of the production system maintained. terpadu: Konsep dan Penerapan. In A.K. Makarim, S. Integrated crop and resource management (ICM) is Kartaatmadja, J. Soejitno, Soetjipto Ph. & Suwarno, eds. an innovation of technology in irrigated lowland rice (far Tonggak kemajuan teknologi produksi tanaman pangan, from sustainable in recent years). ICM is: p. 75–89. Bogor, Food Crops Research Symposium IV. 82 PART III RICE INTEGRATED CROP MANAGEMENT

Las, I., Siprihatno, B. & Widiarta, N.I. 2004a. Keragaan Makarim, A.K., Pasaribu, D., Zaeni, Z. & Las, I. 2003. dan Inovasi Teknologi varietas Unggul Tanaman Padi Analisis dan Sintesis Hasil Pengelolaan Tanaman dan selama 30 Tahun terakhir. Seminar Nasional Sumberdaya Terpadu (PTT) dalam Program P3T. Agroteknologi Tanaman Pangan, dalam rangka Perakyaan IAARD, Dept. of Agriculture. 30 tahun Badan Litbang Pertanian. Bogor, 5 Aug. 2004. Wityanara, S.A.S., Gani, A. & Pirngadi, K. 2001. Las, I., Widiarta, N.I. & Ruskandar, A. 2004b. Penelitian Penelitian hara intensif padi sawah (Interaksi komponen dan Pengembangan serta Inovasi Teknologi Tanaman utama PTT) (Final Report). PAATP-IIRR. IAARD, Dept. Padi untuk Meningkatkan Produksi dan Peningkatan of Agriculture. Pendapatan Petani. Seminar on Agriculture Technology West Sumatra, AIAT West Sumatra, Sukarami, 18–19 Aug. 2004. 83 PART III RICE INTEGRATED CROP MANAGEMENT

PalayCheck: the Philippines’ rice integrated crop management system1

R.T. Cruz, G.P. Llanto, A.P. Castro, K.E.T. Barroga, F.H. Bordey, E.D. Redoña and L.S. Sebastian Philippine Rice Research Institute, Muñoz, Nueva Ecija, the Philippines

The staple food of 82.7 million Filipinos, rice, is grown The testing of RICM needs to be carried out through a on about 4 million ha (BAS, 2004). Rice farming and its participatory and experiential approach with neigh- related activities provide the main source of employment bourhood groups of farmers, extension workers and and income for 11.5 million farmers and family members researchers directly involved in a synergistic adaptation in rural areas. Rice production progressively increased and fine-tuning of RICM across demonstration sites in from 12.4 million tonnes in 2000 to 14.5 million tonnes the different provinces. in 2004. However, in spite of increasing production, rice Hence, the Philippine Rice Research Institute supply remains insufficient to cope with the national rice (PhilRice), which is responsible for leading and co- requirement. The average growth rate in rice production ordinating rice research and development in the (1.9 percent) cannot keep pace with the population growth Philippines, requested the technical assistance of the Food rate of 2.3 percent. This situation – compounded over and Agriculture Organization of the United Nations the decades by the widening yield gap – has resulted in (FAO) for the local integration and rapid development the country being a net rice importer. and use of RICM systems for food security and poverty In order to lessen the need for rice importation, cope alleviation in rural areas to enhance the technical with increasing consumer demand, achieve rice self- competencies and capacities of farmers and other sufficiency and ensure national food security, there is a stakeholders at both local and national level. vital need for more integration of crop management In February 2004, a project was initiated to develop technologies. The development and use of the rice and transfer an RICM system in the Philippines called integrated crop management (RICM) system offers great “Strengthening the Development and Use of Rice potential for addressing these long-term needs. RICM is Integrated Crop Management (Rice ICM) for Food a form of holistic crop management, using the best Security and Poverty Alleviation” (TCP/PHI/3002), with management practices with objective recommendations. funding and technical assistance from FAO. Relevance, repetition and reinforcement are the main The PalayCheck system in the Philippines, developed characteristics of RICM: by the aforementioned project, is patterned after the • Relevance: the latest technologies developed by Australian RiceCheck system to strengthen national research are applied to correct each of the identified capacity in the development and use of technology. It weaknesses. also aims to integrate and balance key technology and • Repetition: RICM learns from experience. RICM management recommendations with farmers’ groups provides target recommendations for farmers, learning to sustain improvement in productivity, profit- extension workers and researchers to evaluate the ability and environmental safety. Farmers working closely performance of each of the crop management with agricultural technicians observe, measure, record and practices. interpret. They observe the crop and measure and record • Reinforcement: technologies used for the correction the performance of each crop management technology. of weaknesses in crop management are continuously The records are compared with the targeted recomm- updated with the results from research. endations or criteria to interpret what went right and what

1 Paper presented during the Consultation Workshop on Rice Integrated Crop Management Systems – RiceCheck Methodology for Food Security, Livelihood Improvement and Environmental Conservation, Ho Chi Minh City, Viet Nam, 28 Feb. – 2 Mar. 2005. 84 PART III RICE INTEGRATED CROP MANAGEMENT

went wrong during the application of crop management 7. Ensure no significant yield loss from insect pests, practices in order to improve the following season. diseases, rats, snails and weeds. 8. Harvest the crop when one-fifth of the panicle length METHODOLOGY or 4 to 5 grains at the base of the primary panicle During the initial implementation of the PalayCheck are in the hard dough stage. system in the Philippines, a National Workshop on Rice 9. Achieve Premium Grade 1 for the palay (crop). Integrated Crop Management was held in May 2004 with the participation of FAO experts, PhilRice scientists and These key checks are presented in Tables 1–4. consultants, and International Rice Research Institute The PalayCheck system was initially carried out in the (IRRI) scientists. Key recommendations covering various 2004 wet season on 15 sites in 13 provinces of the areas of crop management suitable for the transplanted Philippines. A total of 280 farmers actively participated irrigated rice ecosystem were identified and simplified in its initial implementation. The number of provinces/ for testing, promotion and adoption in farmers’ fields. sites was increased in the 2005 dry season (Figure 1). Researchers, extension workers and model farmers One demonstration field was established in each site and actively participated in the workshop. The proceedings was managed according to the PalayCheck “Best were published and distributed to the collaborating Practice”. Participating farmers came from a neighbour- agencies in order to promote the principles and concepts hood of 15 to 25 farms. The PalayCheck demonstration of the technology. field and the participating fields grew the same variety A training course on RICM, “PalayCheck/RiceCheck or a variety with similar yield potential and agronomic System for Research and Extension Workers”, was characteristics. conducted and had the following objectives: The PalayCheck system as a participatory approach • Brief the project implementers/site coordinators on conducted Focus Group Discussions facilitated by the PalayCheck developed from the National Workshop site coordinator and agricultural technician. Interaction on Rice Integrated Crop Management. and sharing of farming experiences among farmers were • Further simplify the localized version of RiceCheck. encouraged to determine their weaknesses and identify • Map out the strategies for the implementation of the practices that needed to be improved. Site coordinators the PalayCheck system. facilitated and supported the meetings at each cropping • Discuss data collection and reporting forms, targets period (pre-crop planning, crop establishment, panicle and budgetary needs. initiation, crop maturity and post-harvest stages) to review the current practices, present the PalayCheck recomm- PalayCheck, consisting of “Recommendations for Trans- endations, discuss the difference between the PalayCheck planted Irrigated Lowland Rice”, was developed for the demonstration field and participating farmer fields, and 2004 wet season to improve yield, grain quality and profit monitor and record crop inputs and achievements. without harming the environment. It covered each crop Monitoring forms/databases and records of the highlights management area, a key message, the key check to be of the meeting were maintained by the site coordinators. achieved, and a description of the key practices, The site coordinators and the agricultural technicians understanding the principles and how to achieve the facilitated the recording of farm practices on the result. Eight key checks were used, namely: monitoring form. 1. Use pure seeds with at least 85 percent germination. In order to extend and promote the PalayCheck 2. Achieve no high and low soil spots at initial principles, concepts and practices as well as the experi- flooding. ences of farmers, field days at PalayCheck sites were 3. Achieve at least one healthy seedling/hill at 10 days conducted when the palay was at the flowering or grain- after transplanting. filling stage. Field days were attended by neighbouring 4. Maintain leaf colour chart (LCC) reading of 4 from farmers, local government officers (mayor and municipal early tillering to early flowering. agricultural officers) and PhilRice scientists and staff. T- 5. Achieve at least 24 tillers/hill at panicle initiation. shirts were distributed to farmer-cooperators and 6. Achieve 3 to 5 cm water depth from early tillering agricultural technicians during field days in recognition to grain filling stage. of their testing or adopting the PalayCheck technology 85 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 1 Number of key checks achieved and grain yields on Sta. Marcela Apayao farm site, the Philippines, 2004 wet season

Farmer PalayCheck recommendations No. checks Grain yield achieved (tonnes/ha) 1 2 3 4a 4b 5 6 7 8 Before After 1. Edison Taneca a √√√√ x x √√√ 7 4.20 5.47 2. Fernando Taneca √√√ x x x √ x √ 5 4.20 5.00 3. Francisco Ocampo √√√ x x x √ x √ 5 4.00 4.15 4. Juanito Pascua √√√ x x x √ x √ 5 4.00 4.02 5. Roger Gabuyo √√√ x x x x x √ 4 4.00 4.10 6. Generoso Arnedo √√√ x x x x x √ 4 4.00 4.30 7. Benito Villanueva √√√ x x x x x √ 4 4.00 4.10 8. Lito Acebedo √√√ x x x x x √ 4 4.00 4.00 9. Roland dela Cruz √√√ x x x √√√ 6 4.20 5.23 10. Cirilo Catenza √√√ x x x √ x √ 5 4.20 5.26 11. Jerry Leaño √√√ x x x √ x √ 5 4.00 4.60 12. Conceso Pascua Jr. √√√ x x x √ x √ 5 4.00 4.20 13. David Bagsangi √√√ x x x x x √ 4 4.00 4.30 14. Francisco Pascua √√√ x x x √ x √ 5 4.00 4.30 15. Patrocinio Acebedo √√√ x x x x x √ 4 4.00 4.10

TABLE 2 Number of key checks achieved and grain yields on Rizal, Nueva Ecija farm site, the Philippines, 2004 wet season

Farmer PalayCheck recommendations No. checks Grain yield achieved (tonnes/ha) 1 2 3 4a 4b 5 6 7 8 Before After 1. Rogelio Carreon a √√√√ x x √√√ 7 3.7 5.4 2. Charlie Nailon √√√ x x x √√√ 6 7.1 5.4 3. Armando Laugo √ x √√ x x √√√ 6 4.1 5.0 4. Demetrio dela Cruz Jr. √√√ x x x √√√ 6 4.1 4.2 5. Victoriano Regal √ x √ x x x √√√ 5 5.1 6.0 6. Anastacio Cruz x x √ x x √√√ 5 5.0 5.9 7. Demetrio Aguilar x √√ x x x √√√ 5 5.0 5.7 8. Jose Verdadero x √√ x x x √√√ 5 4.8 5.6 9. Crispin Regal √ x √ x x √√ x 5 5.3 5.1 10. Bonifacio Laugo √ x √ x x x √√√ 5 1.7 4.4 11. Eduardo Laugo x √√ x x x √√√ 5 4.8 4.3 12. Marianito Tabangay x √√ x x x √√√ 5 3.3 4.3 13. Celso Laugo x x √ x x x √√√ 4 4.7 5.9 14. Aniceto Geronimo x √√ x x x √√ x 4 4.1 5.1 15. Jojo Deus x x √ x x x √√√ 4 4.5 4.7 16. Ernesto delos Santos x x √ x x x √√√ 4 4.7 4.5 17. Romeo Rillo x x √ x x x √√ x 3 6.0 5.2 a Farmer partner expected to follow PalayCheck recommendations.

and as a way of promoting the technology to other of key practices. They were used in the 2004 wet season. farmers. A booklet, PalayTandaan (RiceCheck recomm- In addition to the promotion of the technology, articles endations for transplanted irrigated lowland rice), was on PalayCheck were published in national and local prepared. It covered eight key rice crop management newsletters, magazines and online news (the Internet). areas, nine key checks to be achieved and a description 86 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 3 Number of key checks achieved and grain yields on Mlang, North Cotabato farm site, the Philippines, 2004 wet season

Farmer PalayCheck recommendations No. checks Grain yield achieved (tonnes/ha) 1 2 3 4a4b 5 6 7 8 Before After 1. Santillan, E. a √√√√√ √√√√ 9 6.90 7.92 2. Acosta, P. √√√√ x √√√√ 8 5.10 5.49 3. Aliperio, D. √√√√√ √√√ x 8 5.58 6.70 4. Aliperio, J. √√√√√ √√√ x 8 3.00 6.49 5. Ambong, A. √√√ x √√√ x x 6 6.20 5.20 6. Ambong, R. √√√ x √√√ x x 6 5.40 5.93 7. Andutan, M. √√√√√ √√ x x 7 6.80 5.37 8. Armada, J. √√ x √√ √ √√√ 8 6.36 5.88 9. Capulos, R. √√√ x √√√ x x 6 6.63 6.86 10. Escarlan, M. √√ x √√ √ x √ x 6 5.00 5.35 11. Escarlan, N. √√√√ x √√√√ 8 4.00 7.02 12. Escarlan, S. √√√√√ √ x √√ 8 5.40 6.07 13. Jubelag, P. √√√√√ x x √ x 6 5.02 4.92 14. Lamson, E. √√ x √√ √ √√ x 7 4.28 5.94 15. Pelpinosas, P. √√√ x √√ x √ x 6 5.04 4.27 16. Peñaflorida, D. √√ x x √√√ x √ 6 5.90 6.82 17. Pilota, G. √√ x √√ √ √√ x 7 3.20 7.04 18. Saluc, J. √√ x √√ √ √√ x 7 6.70 7.41 19. Tamboon, H. √√ x √√ √ √√√ 8 6.20 7.57 20. Yata, N. √√√√√ √√√ x 8 5.53 6.40 21. Yata, S. √√ x √√ √ √ √ √ 8 6.00 6.13

TABLE 4 Number of key checks achieved and grain yields on Lambayong, Sultan Kudarat farm site, the Philippines, 2004 wet season

Farmer PalayCheck recommendations No. checks Grain yield achieved (tonnes/ha) 1 2 3 4a4b 5 6 7 8 Before After 1. Raguindin, P. a √√√√√ √√√√ 9 4.7 9.4 2. Alipio, M. x √ x x √√√√√ 6 5.5 7.4 3. Alipio, O. x √ x √ x √√√√ 6 5.2 6.4 4. Diga, D. x √ x √√ √ √√√ 7 5.8 7.6 5. Dimavivas, U. x √ x √ x √√√√ 6 5.2 5.7 6. Espiritu, F. √√ x √ x √ x √√ 6 5.6 6.8 7. Francisco, A. x √ x √ x √ x x x 3 4.5 4.7 8. Gabor, F. x √ x x √√√√√ 6 5.7 5.7 9. Garlit, S. x √ x √ x √√√√ 6 6.3 5.9 10. Gromeo, R. √√ x √ x √√√√ 7 4.8 5.4 11. Juan, G. x √ x √ x √√√√ 6 5.4 5.3 12. Lacibal, D. x √ x √ x √√√√ 6 5.4 5.9 13. Manzano, J. x √ x √ x √√√√ 6 4.5 5.7 14. Nastor, D. x √ x √ x √√√√ 6 6.0 7.3 15. Oti, S. x √ x √√ √ √√√ 7 6.3 6.9 16. Pacor, R. x √ x √√ √ √√√ 7 5.4 7.0 17. Raguindin, Ed. √√ x √ x √√ x √ 6 6.4 7.0 18. Raguindin, Ef. x √ x √ x √√√√ 6 3.0 7.4 19. Rapisora, R. x √ x √ x √√√√ 6 6.9 5.7 20. Santiago, B. x √ x √√ √ √√√ 7 5.8 6.1 21. Sevilla, F. √√√√ x √√√√ 8 6.6 6.9 22. Talbo, P. x √ x √ x √√√√ 6 6.9 6.4 23. Villanueva, D. x √ x √√ √ √√√ 7 6.6 8.4 24. Villanueva, O. x √ x √√ √ √√√ 7 6.6 8.4 a Farmer partner expected to follow PalayCheck recommendations. 87 PART III RICE INTEGRATED CROP MANAGEMENT

FIGURE 1 PalayCheck sites in the Philippines 88 PART III RICE INTEGRATED CROP MANAGEMENT

RESULTS dry season. Instead of just using pure seeds with at least In the 2004 wet season, grain yield and the number of 85 percent germination, key check 1 focuses on the use key checks achieved by the different farmers on four of certified seeds recommended by the National Seed PalayCheck sites were recorded (Tables 1–4). Consid- Quality Control Services. Key checks 4 to 6 focus on ering only the cultivars with similar yield potential, optimum tiller number produced following proper respondents were grouped on the basis of the number of management of N (LCC-based), P, K, Zn and S fertilizers. key checks they achieved. The average yield for each With optimum water management, key check 8 indicates group was then obtained and plotted against the number that growth and yield should not be affected by moisture of key checks. Figure 2 shows that the greater the number of key checks achieved, the higher the grain yield. Initial results were encouraging and implied that key checks FIGURE 2 were positively correlated to the achievement of grain Trends in grain yield in response to number of key checks achieved for 2004 wet season in Sta. Marcela, Apayao; Rizal, yield. Due to data limitation, however, the relative Nueva Ecija; Mlang, North Cotabato; and Lambayong, Sultan contribution of each key check to the increase in yield Kudarat could not be determined. The gross margin was plotted against the number of 8.00 key checks achieved for the same four PalayCheck sites 7.00 (Figure 3). Gross margin included the irrigation fee, cost of the usual farm inputs (seeds, fertilizers, pesticides etc.) 6.00 and cost of land preparation, crop establishment, harv- 5.00 esting, threshing and hauling. It excluded imputed costs, 4.00 food, repairs and interest. Figure 3 shows that farmers 3.00 achieving eight key checks had an average gross margin 2.00

of US$828 per hectare, while farmers who obtained only Grain yield (tonnes/ha) three checks had an average gross margin of US$421 per 1.00 hectare. The trend indicates that when farmers follow 0.00 more key checks, they tend to achieve a higher gross 345678 margin. However, the effects of each key check on No. of checks production cost per hectare were ambiguous. Further analysis will be done once data on grain yield and gross margin from other PalayCheck sites are available. FIGURE 3 Highlights of the meeting were documented. Crop Trends in gross margin in response to number of key management practices in the PalayCheck demonstration checks achieved for 2004 wet season in Sta. Marcela, Apayao; Rizal, Nueva Ecija; Mlang, North Cotabato; and field and the participating farmers’ fields were identified Lambayong, Sultan Kudarat and summarized. Problems encountered with the initial PalayCheck recommendations and changes or 1 000 modifications to the recommendations for the next 900 cropping season were documented. 800 Results of the first trial (2004 wet season) using the 700 PalayCheck system were presented and discussed during 600 the Evaluation Workshop on Rice Integrated Crop 500 Management held at PhilRice Central Experiment Station 400 in Nueva Ecija in December 2004. FAO consultants/ 300 experts participated in the workshop for technical (US$/ha) margin Gross 200 backstopping. Problems were addressed and recomm- 100 endations made. The nine key check recommendations 0 (Box 1) based on the seven crop management areas that 345678 No. of checks were finalized in the workshop are being used in the 2005 89 PART III RICE INTEGRATED CROP MANAGEMENT

stress. The key check on harvesting the crop at the right BOX 1 maturity stage (now key check 9) is retained while the post-harvest key check of achieving Premium Grade 1 Recommended key checks for 2005 dry season palay through proper threshing, drying and storage was excluded since many farmers sold their palay right after 1. Seed quality: Used certified seeds. harvest. 2. Land preparation: No high and low soil spots at Considering the positive results of the 2004 wet season initial flooding after final harrowing/leveling. trial and the need to further evaluate the data, the test of 3. Crop establishment: 22–25 hills/m2 and at least the PalayCheck system was continued in the following one healthy seedling/hill at 10 days after cropping season (2005 dry season). The number of transplanting. PalayCheck sites increased from 15 to 31 and the number 4. Nutrient management: 500–600 tillers/m2 or 20– of farmer-cooperators from 280 to 942. At present, the 24 tillers/hill (20 × 20 cm) at early panicle initiation (EPI). PalayCheck sites are located in the provinces of Agusan 5. Nutrient management: Nitrogen needs managed del Norte, Agusan del Sur, Sultan Kudarat, North according to number of tillers counted at panicle Cotabato, Bohol, Negros Occidental, Ilocos Sur, Apayao, initiation (PI). Assessed with LCC. Isabela, Quirino Province, Qezon, Sorsogon, Laguna and 6. Nutrient management: Other nutrients (P, K, Zn Nueva Ecija. and S) did not limit yield. Technical training pertinent to the improvement of 7. Pest management: Ensured no significant damage social and technical skills of the field implementers (site from pests. coordinators and agricultural technicians) was provided 8. Water management: Avoided moisture stress for a better and common understanding of the PalayCheck affecting growth and yield of crop. system, to demonstrate skills on facilitating and 9. Harvest management: Harvested the crop when conducting focus group discussion, and improve the data one-fifth of panicle length or 4 to 5 grains at the gathering and monitoring skills of the PalayCheck base of the primary panicle in the hard dough stage. implementers.

CONCLUSIONS AND PLANS A rice integrated crop management system, PalayCheck, has been implemented on 31 sites in 14 provinces in the tation, however, the relative contribution of each key Philippines with a total of 642 actively participating check to the increase in yield or gross margin could not farmer-cooperators for transplanted irrigated lowland rice. be determined. Further testing of PalayCheck in farmers’ A preliminary set of key checks and indicators were fields will provide more data that will allow better analysis evaluated and subjected to further development based on of these parameters. the experiences and current practices of farmers. Records The promising results of the initial implementation of of the meeting served as a guide for further amendments the PalayCheck system led to the expansion of the sites of the key management areas of the PalayCheck system. and an increase in the number of farmer-cooperators. To The PalayCheck system now has sufficiently trained facilitate further evaluation and analysis of management and experienced staff to perform well in data gathering practices, key check achievements, yield and quality, the and in monitoring and implementing the technology. project was extended for two further cropping seasons PhilRice and local government units were effective in (2005 wet season and 2005/06 dry season). assisting the regular farmer group discussions. Online The PalayCheck system will be integrated within the reports and newsletters as well as other publications were different research and development programmes of made to further promote the concept of the PalayCheck PhilRice to constantly improve the key check recomm- system. endations in accordance with the farming practices of A preliminary evaluation showed that the adoption of farmers. PhilRice research and development programmes PalayCheck technology was encouraging since the key will be focused to address specific issues and problems checks were positively correlated to the achievement of identified in the adaptation of the technology across the higher grain yield and gross margin. Due to data limi- different locations. 90 PART III RICE INTEGRATED CROP MANAGEMENT

If the pilot implementation of the PalayCheck system Training and extension programmes along with course in the succeeding two cropping seasons in 14 provinces curricula will be developed to expedite the diffusion and proves successful, the Philippine Rice Research Institute adaptation of the technology. The number of sites will be with the support of the Department of Agriculture (DA) increased and more farmer groups, local government units will upscale the implementation of the system towards a and non-governmental organizations will be involved national programme to make it a standard approach in through the participatory technology-transfer and rice production management. development approach (farmer field schools, community- The PalayCheck system is an integral factor to help based activities, technology demonstrations etc.) in order achieve the DA’s eight-point agenda in modernizing to enhance their capabilities and capacities. agriculture, empowering farmers and increasing farm productivity and profitability while ensuring environ- REFERENCES mental sustainability. The upscaling of the system will BAS (Bureau of Agricultural Statistics). On-line be patterned after the Philippine National IPM statistics database (available at www.bas.gov.ph/stat1 Programme, KASAKALIKASAN (Kasaganaan ng query.php). Sakahan at Kalikasan), which came into force in 1993. 91 PART III RICE INTEGRATED CROP MANAGEMENT

Integrated crop management for intensive irrigated rice in the Mekong Delta of Viet Nam

T.S. Pham,a K.Q. Trinh a and D.V. Tran b a Cuu Long Delta Rice Research Institute, Cantho, Viet Nam b Food and Agriculture Organization of the United Nations, Rome, Italy

Intensive rice growing with two to three crops per year is METHODOLOGY very common in the Mekong Delta. The practice currently It is hypothesized that two sets of knowledge exist: one, adopted by most farmers is direct seeding with a high local or experiential farmer knowledge; the other, seeding rate (200–250 kg/ha). High nitrogen fertilization researchers’ scientific knowledge. There is a certain and high seeding rate lead to more pest problems. Pest knowledge gap between farmers and researchers, and outbreaks occur yearly and the regular breakdown of closing this gap is critical by making research respond to resistant varieties has been observed. To protect crops, farmers’ real needs (relevance). Although the research million of dollars have been used to buy pesticides for agenda in research institutions is more and more influ- controlling pests; this will cause problems for both the enced by farmers’ real needs in recent times, participation environment and human health in the long run. Another of farmers in early research activities to develop new aspect is the income of rice farmers; there is clear evidence techniques is often limited. Scientists developed a set of that heavy application of pesticides for protecting crops technologies by conducting the trials in selected farmers’ results in farmers losing most of their income. High fields. Farmers often visited the trials in their fields and nitrogen fertilizer application leads to crop lodging and provided their opinions and suggestions for improvement. spoilage of grain quality at harvest. Here again, farmers This is the basis for ICM – a set of best-bet technologies lose due to the low prices paid for the poor-quality rice acceptable to farmers packaged as TRC for evaluation they produce. by farmers themselves in each location. In order to solve this problem and sustain rice prod- Farmers evaluate TRC (the ICM package) as a group uctivity in the Mekong Delta, it is essential that crop in a large area and modify or refine the package on the management be improved and farmer practices modified basis of their experience and changing needs. Thus, the appropriately. Integrated crop management (ICM) options set of ICM options developed for a site is highly location- and strategies are packaged as “tropical rice checks” specific and is based on local farmers’ needs and (TRC) adapted from the Australian RiceCheck concept. opportunities. The steps involved in the development and TRC must be designed to fully utilize the potential of evaluation of TRC are as follows: improved rice varieties and sustain high rice yields in 1. Participatory development of TRC for each site: intensive systems. This will also help close the yield gap core options and location-specific options. between what is obtained in the research station and what 2. Community evaluation of TRC by a group of farmers in similar ecologies harvest. TRC is dynamic in farmers (5–20) in a 5- to 10-ha area on each site the sense that it is continuously updated as and when new (village) (fully managed by farmers with assistance information and knowledge are generated by researchers and support from research and extension staff when and adopted by farmers. Being location-specific, farmers needed). have to develop and adapt TRC for each homogenous 3. Farmers day in each season to allow farmer- domain (region or ecology) based on needs and prod- cooperators to explain the results of TRC evaluation, uction constraints. Researchers and extension staff will their experience with TRC, and their opinions on work with farmers to develop the appropriate TRC for new techniques to fellow farmers from their village targeted areas. and nearby villages. Also farmers explain the adoption constraints, if any, of new techniques. 92 PART III RICE INTEGRATED CROP MANAGEMENT

4. Review and adjustment of TRC based on past their inputs (including labour) are monitored as well as seasons’ experience, and further evaluation of the all outputs. revised TRC in the second season. Two sets of observations are made (one set for ICM 5. Collection of researchable issues from farmers farmers, another for non-ICM farmers): evaluating or practising TRC and initiation of • All inputs including labour use research on issues emerging to develop appropriate • All outputs and their value solutions. • Incidence and severity of major insect pests (scale 6. Extension-managed large area demonstration of 1 to 9) TRC. Following four seasons of community evalu- • Incidence and severity of major diseases (scale 1 to ation and refining of TRC for each representative 9) location, expansion to a 100-ha area to be managed • Other problems, if any by farmers and monitored and assisted by extension • Grain yield staff, when necessary. • Total cultivation costs 7. Design of campaign and promotion strategies for • Total returns dissemination of farmer-accepted TRCs to farmers • Net profit at large in the targeted area (following two seasons of extension-managed large area demonstration). RESULTS AND DISCUSSION 8. Evaluation of the impact of project interventions Major information and constraints in the ICM sites at the appropriate time. Table 1 provides general information from the sites selected for conducting ICM. Major constraints for Community evaluation of a package of best-bet individual sites are listed below: technology options (ICM package or TRC) Figure 1 represents a pilot village in an area of 5 to 10 ha Omon, Cantho and with 5 to 20 ICM farmers. In addition, there are 10 to • Disease problems: Diseases occur very often. 20 non-ICM (control) farmers from outside the ICM area: Farmers are not able to identify certain disease

FIGURE 1 Pilot village

Pilot village

Non-ICM control farmers

ICM farmers 93 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 1 General information/observations from ICM sites

Crop management Omon, Cantho Go Cong Tay, Tiengiang practices Cropping system Winter/spring rice (dry season) – spring/summer Winter/spring rice (dry season) – summer/autumn rice rice (summer season) – summer/autumn rice (wet (wet season) – autumn/winter rice (mua season) season) Flood and water Flood during Sept.–Nov. with 0.5–1.0 m depth, No flooding, water peak less than 0.5 m during Sept.– condition for irrigation water availability throughout year Nov., water scarcity during Mar.–May Sowing and harvesting Dry season: Dry season:

time x sowing: Nov.–Dec. x sowing: Nov.–Dec.

x harvesting: Feb.–Mar. x harvesting: Feb.–Mar. Summer season: Wet season:

x sowing: Mar. x sowing: June x harvesting: May–June x harvesting: Aug.–Sept. Wet season: Mua season:

x sowing: June x sowing: Aug.–Sept.

x harvesting: Aug.–Sept. x harvesting: Nov.–Dec. Land preparation Buffalo puddling for dry season, straw burning with Buffalo puddling for dry season, tractor ploughing and no tillage for summer season and tractor ploughing soil drying for wet season, power tiller incorporating after summer season straw with soil for mua season Varieties Very short duration (< 100 days), medium to low Short duration (100–110 days), medium to high quality: quality: OM1490, OMCS2000, OM2031, IR50404 IR64, VD20, ST3, KDML-105 Crop establishment Broadcast wet seeding; some use row seeding by Broadcast wet seeding; almost all use row seeding by drum seeder + manual gap filling drum seeder + manual gap filling Weed control Herbicide "nominee", manual weeding 1–2 times; Herbicide pre-emergence "sofit", manual weeding 1–2 more weeds with drum seeding than with times; no weeds with drum seeding broadcasting at high seed rate (200–250 kg/ha) Fertilizer use Farmers apply 3–4 times: 7–15 days after sowing Farmers apply 3–4 times: 7–15 days after sowing (DAS), (DAS), 20–25 DAS and 40–45 DAS (if 3 splits); if 4 20–25 DAS and 40–45 DAS (if 3 splits); if 4 times, times, farmers apply at 10, 20, 30 and 40 DAS: farmers apply at 7, 15, 30 and 45 DAS:

x first: 50 kg DAP+ 50 kg urea/ha x first: 50 kg DAP+ 50 kg urea/ha x second: 50 kg urea + 100 kg 16-16-8/ha x second: 100 kg 20-20-15/ha

x third: 100 kg 16-16-8/ha x third: 100–150 kg 16-16-8/ha

x fourth (if 4 times): 30–50 kg urea/ha x fourth (if 4 times): 50 kg urea + 50 kg MOP/ha Pest management Insects: Common insects are brown plant hopper, leaf folder and golden snail. Insecticide "Applaud" is used against BPH, and nothing against leaf folder. Snail is controlled by draining the field and manual picking at pool depressions in the field. Disease: Sheath blight, leaf blast, red stripe (yellow leaf). Disease and symptoms not known well to farmers, thus they often resort to retailers for guidance. Water management Irrigation and drainage by tidal water from canal with supplementary pumping: 2–3 pump irrigations in dry season and wet season, but about 10 pump irrigations in summer season. Canal irrigation charges: 30 kg rice/ha/year. Pumping irrigation on contract: Þ15 000 per hour (US$1.00) for pump power of 6 HP. Harvest Manual harvesting; threshing by thresher Drying Sun-dry in dry season. Sun-dry or periodical drying by dryer in wet season Milling Middleman purchases paddy from farmers to sell to Cooperative purchases paddy from farmers;after milling small millers for milling; after milling, sold to traders rice, sells to traders Marketing Selling price of grain is Þ1 500–2 000 per kg Selling price of grain is Þ2 300–3 000 per kg depending depending on grain quality and season. Selling on grain quality and season. Selling price is low in dry price is low in dry season (Þ1 500–1 700) and season (Þ2 000–2 500) and higher in wet season higher in wet season (Þ1 800–2 000). The (Þ2 500–3 000). The difference in price between dry and difference in price between dry season and wet wet season is due to supply and demand. Supply is high season is due to supply and demand. Supply is in dry season, but very low in wet season and mua high in dry season, but very low in summer and wet season. season. Labour availability No problem Input availability No problem in input availability; problem is cash availability Yield gaps Average yield: 6 tonnes/ha in dry season, 3.5–4.0 Average yield: 6 tonnes/ha in dry season, 3.5–4.0 tonnes/ha in summer and wet season. tonnes/ha in wet season and mua season. Highest yield: 7.5 tonnes/ha in dry season, 5.5 Highest yield: 7.0 tonnes/ha in dry season, 5.0 tonnes/ha tonnes/ha in summer and wet season in wet season and mua season 94 PART III RICE INTEGRATED CROP MANAGEMENT

symptoms. Sometimes they apply the wrong fungi- use of certified seeds, sowing at a low seed rate with cides against diseases. drum seeder, fertilizer application using site specific • High fertilizer price: Almost all fertilizers are nutrient management (SSNM) with adjusted N rate by imported and prices depend on the world market. leaf colour chart (LCC), and pest control by integrated There are no government subsidies for fertilizer and pest management (IPM). Ten farmers located nearby in farmers’ local currency is weak. They have to obtain the same village in each site were also selected for non- fertilizers from retailers during the crop season and ICM recording. Non-ICM farmers were not obliged to pay at harvest at very high prices. adopt new techniques; they all followed rice production • High seeding rate: Most farmers used a high seeding on the basis of their own experiences. Normally they use rate since they do not want to spend for gap-filling uncertified seeds, sowing at a very high seed rate, apply- and want to be sure that golden snail attacks or ing high rates of N and P but low rates of K and spraying weeds cannot damage their crop. four to five times for pest control. Comprehensive data • Excess application of N fertilizer: Some farmers did are presented in Tables 2 and 3. not have proper knowledge about the nutrient Data in Tables 2 and 3 show clearly that farmers requirements of rice at certain stages. They under- applying new ICM techniques reduced seed rate by stand that green leaf colour will induce higher yield. around 50 percent, and decreased N and P fertilizer by They try applying more N fertilizer to keep the crop about 10 to 15 percent (increasing potassium), with a green (i.e. more fertilizer than the crop actually consequent two- to threefold reduction in pesticide needs). spraying. It was calculated that there was a 40 to • Poor seed quality: Most farmers used uncertified 60 percent saving for pesticides in the first crop and a seeds. There is poor availability of good-quality seed 10 to 20 percent saving in subsequent crops. In non-ICM and seed-supplying agencies charge high prices. plots, farmers always sow at a very high seed rate (average Farmers hold onto some grain from the previous 200 kg/ha or more), applying high doses of nitrogen rice-field, clean it and keep it as seeds for the fertilizers with the result that the crop grows densely. subsequent crop. Under these conditions, the crop is susceptible to insect and disease infestation; therefore, non-ICM farmers spray Go Cong Tay, Tiengiang more pesticides. • Pest problems: Problems are similar to those in the With adequate seeding rate and optimum fertilizer Omon site. application, there was healthy crop growth and fewer pest • High fertilizer price: Problems are similar to those problems in ICM plots; furthermore, farmers reduced in the Omon site. inputs of seeds, fertilizers and pesticides (accounting for • High seeding rate: Problems are similar to those in between US$35 and US$50 per hectare), but grain yield the Omon site. in ICM plots still increased by 2 to 4 percent. The average • Excess application of N fertilizer: Problems are profit made by ICM farmers was between US$44 and similar to those in the Omon site. US$64 per hectare in Cantho and between US$36 and • Poor seed quality: Problems are similar to those in US$98 per hectare in Tiengiang, i.e. higher compared to the Omon site. non-ICM farmers. • Scarce water for irrigation in the wet season: In years It was clear that the difference between ICM and non- when the monsoon is delayed, irrigation water is ICM farmers became less with each successive crop. With insufficient at the beginning of the wet season. the first crop, the difference in seed, fertilizer and pesticide • Poor marketing system: There is no system for rates between the two groups of farmers was quite high. marketing high-quality rice. Farmers cannot always Following the first crop, the group of non-ICM farmers sell their products at a good rate. who were following their own experience for rice production were invited for new technology training and Comparison between ICM and non-ICM farmers demonstrations at ICM farms. What they learnt they Five farmers in each site were selected to conduct on- immediately applied to their next crop and as a farm demonstrations for ICM. In these plots, farmers had consequence the difference between the two groups to follow a complete set of new techniques, for example: narrowed. 95 PART III RICE INTEGRATED CROP MANAGEMENT

TABLE 2 Comparison between ICM and non-ICM farmers at Omon, Cantho (average value from individual group of farmers)

Items ICM (A) Non-ICM (B) Difference (A-B) DS2002/03 WS2003 DS2003/04 DS2002/03 WS2003 DS2003/04 DS2002/03 WS2003 DS2003/04 Grain yield (tonnes/ha) 6.47 3.96 6.77 6.36 3.71 6.45 +0.11 +0.25 +0.32 Total return (US$/ha): 710.48 427.98 795.24 699.93 415.30 767.45 +10.55 +12.68 +27.79 Seeds x Seed rate (kg/ha) 120 144 120 285 206 188 -165 -62 -68

x Expenses (US$/ha) 19.44 21.44 20.78 36.89 32.68 28.07 -17.45 -11.24 -7.29 Fertilizers x Nitrogen (kg N/ha) 94 87 88 106 98 99 -12 -11 -11 x Phosphorous (kg P2O5/ha) 42 46 40 69 48 57 -27 -2 -17 x Potassium (kg K2O/ha) 45 36 43 28 41 31 +17 -5 +12 x Expenses (US$/ha) 59.00 57.94 70.09 70.35 64.28 76.42 -11.35 -6.34 -6.33 Pesticides x Expenses (US$/ha) 14.09 32.33 27.35 31.39 40.85 33.31 -17.30 -8.52 -5.96 Labour x Expenses (US$/ha) 161.17 160.12 183.50 168.93 165.17 185.98 -7.76 -5.05 -2.48 Total cost (US$/ha) 253.70 271.83 301.72 307.56 302.98 323.78 -53.86 -31.15 -22.06 Net profit (US$/ha) 456.78 156.15 493.52 392.37 112.32 443.67 +64.41 +43.83 +49.85

Note: DS = dry season; WS = wet season.

TABLE 3 Comparison between ICM and non-ICM farmers at Go Cong Tay, Tiengiang (average value from individual group of farmers)

Items ICM (A) Non-ICM (B) Difference (A-B) DS2002/03 WS2003 DS2003/04 DS2002/03 WS2003 DS2003/04 DS2002/03 WS2003 DS2003/04 Grain yield (tonnes/ha) 6.06 4.14 6.24 5.83 4.02 6.10 +0.23 +0.12 +0.14 Total return (US$/ha) 667.02 583.10 852.73 603.75 566.20 835.66 +73.27 +16.19 +17.07 Seeds: x Seed rate (kg/ha) 120 120 118 237 199 192 -117 -79 -74

x Expenses (US$/ha) 17.56 19.21 22.46 30.65 31.85 31.47 -13.09 -12.64 -9.01 Fertilizers: x Nitrogen (kg N/ha) 109 87 98 112 102 105 -3 -15 -7 x Phosphorous (kg P2O5/ha) 37 46 41 52 50 46 -15 -4 -5 x Potassium (kg K2O/ha) 48 36 43 47 53 41 +1 -17 +2 x Expenses (US$/ha) 65.36 59.86 75.95 68.68 71.25 84.64 -3.32 -11.39 -8.69 Pesticides: x Expenses (US$/ha) 14.10 24.57 24.30 35.09 37.52 27.60 -20.99 -12.63 -3.30 Labour: x Expenses (US$/ha) 147.23 144.75 193.34 147.51 148.88 191.22 -0.58 -4.13 +2.12 Total cost (US$/ha) 247.25 248.39 316.05 281.93 289.50 334.93 -34.68 -41.11 -18.88 Net profit (US$/ha) 419.77 334.71 536.68 321.82 276.70 500.73 +97.95 +58.01 +35.95

Note: DS = dry season; WS = wet season.

CONCLUSION 2. ICM promotes healthy growth of the crop with less After three consecutive crops conducted in Cantho and pest infestation and, consequently, improved yield Tiengiang provinces, it was found that ICM helped and quality. improve productivity, quality and profitability of the rice 3. ICM can be considered the best way for rice crop. It is clear that: production to receive simultaneously high yield and 1. ICM can help make savings on inputs, such as seeds, profitability. fertilizers and insecticides, all currently applied 4. Through ICM training and demonstration, farmers heavily by farmers in the Mekong Delta. can adopt the new techniques easily and effectively. 97 PART IV INTERNATIONAL RICE COMMISSION’S CORNER

Follow-up to the implementation of the International Year of Rice 2004

N.V. Nguyen Executive Secretary, International Rice Commission, FAO, Rome, Italy

The worldwide implementation of the International Year “It is the first time in the history of the UN General of Rice (IYR) 2004 was a remarkable success. The Assembly that an International Year was dedicated to a breadth and depth of IYR implementation reached from singly crop: Rice.” The book Rice is Life was published research laboratories and ministerial meetings to class- in October 2005. rooms, museums, tourism offices and, of course, farmers’ fields and the kitchens of more than a billion homes. ORGANIZATION OF THE 21ST SESSION OF THE IYR implementation in 2004 took place worldwide in INTERNATIONAL RICE COMMISSION more than 68 countries, with the participation of more The IRC session takes place every 4 years to review the than 250 national, regional and international organiz- innovations and the recent achievements in the scientific, ations. The IYR Secretariat prepared and distributed IYR technical and socio-economic fields related to sustainable materials to various organizations in 183 countries to rice production and methods used in rice farming, as well support a wide range of activities: from high-level as the application of strategies for rice development scientific symposia to cooking demonstrations and recipe programmes and established interactions between contests; from presidential proclamations and commemo- national, regional and international institutions. The 20th rative stamps to rock music festivals and poetry competi- session was held in Bangkok, Thailand in July 2002, tions; from rice walks promoting ecotourism to printed during which the delegate from Peru offered to host the calendars, posters and cookbooks. 21st session. A mission was undertaken by the Executive The year-long salute spotlighted serious sociological, Secretary of the IRC together with the Senior Officer and ecological and economic issues, focusing attention on the Coordinator of the Agriculture Department at the FAO the past, present and future of rice as a food, as a vital Regional Office for Latin America and the Caribbean component of the agricultural sector and as a major from 5 to 8 April 2004 to discuss with the national building block of global food security. IYR 2004 gave authorities in Peru the organization of the 21st session of millions of people all over the world a chance to celebrate the International Rice Commission in 2006. The national and show their respect for rice as a nucleus of their cultural authorities were in accordance that the session would heritage. IYR implementation officially came to an end provide a good opportunity for Peru to benefit from on 31 December 2004, but the IRC (International Rice international contributions and knowledge on rice Commission) continues to follow up IYR implementation production and development, and Peru agreed to host the in the areas outlined below. 21st session in 2006. The Government of Peru will nominate a liaison officer to work with the FAO-IRC REPORT ON IYR IMPLEMENTATION AND THE BOOK Secretariat in the organization of the session. It was RICE IS LIFE tentatively proposed that the 21st session would be held The implementation of IYR 2004 is to be reported to the from 3 to 5 May 2006 in Chiclayo city. Second Committee of the 60th Session of the UN General Assembly under agenda item 58 “eradication of poverty PROMOTION OF THE DEVELOPMENT AND USE OF and other development issues” on 7 November 2005. THE RICE INTEGRATED CROP MANAGEMENT (RICM) The International Rice Commission gave priority to APPROACH the preparation and publication of the book Rice is Life The Consultation Workshop on Rice Integrated Crop to honour the Year because: Management Methodology – RiceCheck for Food 98 PART IV INTERNATIONAL RICE COMMISSION’S CORNER

Security, Livelihood Improvement and Environmental supervisory staff and extension officers in Conservation was organized from 28 February to 2 March participating countries in RICM concepts, principles 2005 in Ho Chi Minh City, Viet Nam by the Ministry of and practices of RiceCheck and other approaches, Agriculture and Rural Development of Viet Nam and and in related extension methodology, particularly FAO, with funding support from the GCP/INT/933/ITA group facilitation and dynamics. project, “Promoting, Coordinating and Implementing • Participating countries should formulate and Observance of the International Year of Rice – 2004”. undertake a pilot project to develop and evaluate The consultation workshop was attended by delegates an RICM system suitable for their local conditions. from Australia, Cambodia, Fiji, Indonesia, Japan, the Philippines, Sri Lanka and Thailand and by officers and PROMOTION OF THE DEVELOPMENT AND USE OF scientists from different departments and institutes of the NERICA (NEW RICE FOR AFRICA) IN SUPPORT TO Ministry of Agriculture and Rural Development of Viet NEPAD (NEW PARTNERSHIP FOR AFRICA’S Nam (MARD), in particular the Cuu Long Rice Research DEVELOPMENT) Institute (CLRRI), the principal organizer of the work- The International Rice Commission is a member of the shop. Due to unforeseen circumstances, the delegates steering committee of the African Rice Initiative (ARI), from Bangladesh, China, India and the Lao People’s which was launched by West African heads of state in Democratic Republic were not able to participate in the 2002 to scale up the dissemination of NERICA rice. In workshop, although confirmation of their participation February 2005, the IRC Secretariat participated in the had been received. In addition to member countries, the JICA-WARDA (Japanese International Cooperation workshop was also attended by delegations from the Agency – The Africa Rice Center) Technical Seminar on International Rice Research Institute (IRRI), the Inter- Rice Cooperation in Eastern and Southern Africa, held national Cooperation Centre of Agricultural Research for from 17 to 18 February at the African Institute for Development (CIRAD), the Danish International Dev- Capacity Development (AICAD), Nairobi, Kenya. Rice elopment Agency (DANIDA) and FAO (Regional Office is becoming an increasingly popular food in eastern and for Asia and the Pacific and Headquarters). The main southern Africa, but production does not meet demand. recommendations of the consultation workshop were as The seminar was attended by about 70 officers and follows: scientists from Mozambique, Ethiopia, Kenya, Zambia, • All participating countries should continue to Uganda, Madagascar, Tanzania, Zimbabwe and Malawi; introduce, develop and evaluate RICM methodol- Japanese institutions such as JICA, JAICAF (Japan ogies as a means of improving yields and profit- Association for International Collaboration of Agriculture ability for food security, livelihood improvement and and Forestry) and JIRCAS (Japan International Research environmental conservation. Center for Agricultural Sciences); WARDA; the non- • A Regional RICM workshop should be held in governmental organization Sassakawa Global 2000 (an Southeast Asia in 2007, in order to share experiences international NGO); and FAO. The current status and in the development and application of RICM. research situation on NERICA as well as the initiatives • Administrative procedures need to be developed and to strengthen these activities in East and Central Africa applied to involve and integrate all stakeholders, were discussed during the seminar. particularly research and extension for the successful Recently, the IRC Secretariat also participated in the implementation of RICM. third steering committee meeting of the African Rice • Attempts should be made to modify RICM to suit Initiative (ARI) in Cotonou, Benin, from 25 to 27 April other crop enterprises to assist in the diversification 2005. In addition to FAO, participants at the meeting of rice-based farming systems. included senior officers from ARI/WARDA, the • The main outcomes of RICM should focus on Rockefeller Foundation, Sassakawa Global 2000 and nine improving grain yield, grain quality and cost- West African countries members of the ARI steering effective rice production with minimal adverse committee, namely Benin, Côte d’Ivoire, The Gambia, effects on the environment. Ghana, Guinea, Mali, Nigeria, Sierra Leone and Togo. • A short training course (3–5 days) should be The dissemination of NERICA across sub-Saharan Africa, developed to enhance the skills of frontline and which is central to ARI’s mission, is making rapid 99 PART IV INTERNATIONAL RICE COMMISSION’S CORNER

headway. Today, more than 100 000 ha are cultivated the project in December 2004 and attended the Regional under NERICA in sub-Saharan Africa, with Guinea alone Forum for Development and Dissemination of Hybrid accounting for 70 000 ha and Uganda for about Rice Technology organized by ADB and IRRI in Manila, 15 000 ha. NERICA lines are currently being grown or the Philippines in June 2005. evaluated in almost all the countries in sub-Saharan Africa. In 2004, seven out of nine pilot countries from FORMULATION AND IMPLEMENTATION OF West Africa received US$30 million from the African PROJECTS ON RICE-BASED SYSTEMS Development Bank (ADB) to carry out NERICA dissemi- One of the main objectives of the implementation of the nation. International Year of Rice 2004 was to promote and to provide technical support to ensure the sustainable PROMOTION OF THE DEVELOPMENT AND USE OF development of rice and rice-based systems at global, HYBRID RICE FOR REDUCING HUNGER AND regional, national and community level. At global level, POVERTY the project GCP/INT/933/ITA “Promoting, Coordinating The world population continues to grow steadily, while and Implementing Observance of the International Year land and water resources are declining. Increasing the of Rice – 2004” (with funding support from the Italian productivity of rice systems, therefore, is essential for Government) aided the implementation of IYR in about the food security of more than half the world population. 30 countries. During 2004, the FAO technical units and The Chinese experience in hybrid rice cultivation members of the Steering Committee of the International demonstrated beyond doubt the contribution of hybrid Rice Commission implemented and formulated rice to food security and other developmental goals. 26 projects to support rice production in sub-Saharan Thanks to the widespread adoption of hybrid rice (about Africa, Asia and the Pacific, Latin America and the 50 percent of total rice area), Chinese rice production Caribbean, and the Near East (Table 1). increased sustainably from 128 million tonnes in 1975 In addition to the projects listed overleaf in Table 1, to 191 million tonnes in 1990, while the rice harvested members of the FAO Steering Committee of the area was reduced from 36 million ha in 1975 to only International Rice Commission have provided technical 33 million ha in 1990. The International Rice support to rice-based systems in several projects Commission is a member of the Steering Committee of implemented worldwide by the following FAO the International Task Force on Hybrid Rice programmes: (INTAFOHR) established by member countries in Asia, • Special Programme for Food Security (http:// IRRI and FAO in 1996. Since 1998, under the framework www.fao.org/spfs/) of INTAFOHR, FAO has participated in the formulation • TeleFood (http://www.fao.org/food/english/ and implementation of the ADB-funded project index.html) “Sustaining Food Security in Asia through the Dev- • Emergency Relief and Rehabilitation (http:// elopment of Hybrid Rice Technology”. The IRC www.fao.org/reliefoperations/en/index.html) Secretariat participated in the concluding workshop of 100 PART IV INTERNATIONAL RICE COMMISSION’S CORNER

TABLE 1 IYR 2004 projects

Country/Region Project Status Project group I Guinea Multiplication and distribution of seed of NERICA rice (N.B. To be completed in 2005 implemented by National Programme with collaboration of FAO) Rwanda Support to programme on intensification of rice production for food Completed in 2005 security Thailand Training on ICM technologies for production of good quality rice seeds Completed in 2004 Regional Sustaining food security in Asia through the development of hybrid rice To be completed in 2005 technology (N.B. implemented by IRRI with collaboration of FAO) Global Promoting, coordinating and implementing observance of the To be completed in 2005 International Year of Rice 2004 Project group II Cameroon Support to the multiplication and distribution of good rice seed of To be completed after 2005 improved rice varieties Democratic Republic Technical assistance facility for FAO Representation To be completed after 2005 of the Congo Fiji Rice Revitalization – Fiji To be completed after 2005 Fiji Training on RICM To be completed after 2005 Democratic People’s Application of biotechnology to rice and maize breeding To be completed after 2005 Republic of Korea Nigeria Accelerated rice production in the Nigeri Rice Basin To be completed after 2005 Papua New Guinea Rice development in Papua New Guinea. To be completed after 2005 Philippines Strengthening the development and use of (RICM) for food security To be completed after 2005 and poverty alleviation Sierra Leone Provision of seed rice for expanding production in 2005 in support to To be completed after 2005 food security in Sierra Leone Regional Weed control in rice production To be completed after 2005 Regional Bridging the yield gaps in irrigated rice in Venezuela and Brazil To be completed after 2005 Regional Introduction of aquaculture and other integrated production To be completed after 2005 management practices to rice farmers Project group III Ghana Dissemination of NERICA and improved rice production systems to Recently approved reduce food deficit and improve farmers' income in Ghana Sierra Leone Dissemination of NERICA and improved rice production systems to Recently approved reduce food deficit and improve farmers' income in Sierra Leone Project group IV Democratic Republic Support to rice production for food security and poverty reduction Formulated and submitted for of the Congo funding support Egypt Rice straw management and conservation of environment Formulated and submitted for funding support Indonesia Accelerated adoption, assessment, capacity-building, and training for Formulated and submitted for farmer-group self-learning procedures (RiceCheck) that increase net funding support income from smallholders’ integrated rice crop management Sri Lanka Strengthening national capacity for hybrid rice development and use for Formulated and submitted for food security and poverty alleviation funding support Sudan Training on improved rice technologies for the enhancement of Formulated and submitted for irrigated rice production in the White Nile State in support of food funding support security and poverty alleviation Viet Nam Capacity-building for improvement of seed source quality and rice Formulated and submitted for production for food security in the highland and mountainous regions funding support in Viet Nam Regional Capacity-building for rice genetic improvement in Latin America and Formulated and submitted for the Caribbean funding support 5CNGUCPF/CTMGVKPI)TQWR+PHQTOCVKQP&KXKUKQP(#1 8KCNGFGNNG6GTOGFK%CTCECNNC4QOG+VCN[ 6GN Ō(CZ 'OCKNRWDNKECVKQPUUCNGU"HCQQTI 9*'4' 61 274%*#5' (#1 27$.+%#6+105 .1%#..; YYYHCQQTIECVCNQIIKRJQOGJVO 21+065 &' 8'06' &'5 27$.+%#6+105 &' .# (#1 270615 &' 8'06# &' 27$.+%#%+10'5 &' .# (#1

Ŗ#0)1.# Ŗ%*+0# 6GN Ŗ+0&+#

'ORTGUC0CEKQPCNFQ&KUEQGFG %JKPC0CVKQPCN2WDNKECVKQPU (CZ #NNKGF2WDNKUJGT.VF 2WDNKECÁÐGU'0&+277'' +ORQTV'ZRQTV%QTRQTCVKQP 5KVKQ9GDYYYOWPFKRTGPUCEQO /QWPV4QCF

4WC%KTKNQFC%QPEGKÁºQ5KNXC0Q )QPIVK'CUV4QCF$GKLKPI %QTTGQGNGEVTÎPKEQNKDTGTKC"OWPFKRTGPUCGU %JGPPCK %20Q%.WCPFC 6GN /WPFK2TGPUC$CTEGNQPC 6GN (CZ %QPUGLQFG%KGPVQ (CZ Ŗ#4)'06+0# 'OCKNUGTKCNU"EPRKGEEQOEP $CTEGNQPC 'OCKNCNNKGFOFU"UODURTKPVTRIGOUXUPNPGVKP .KDTGTÈC*GOKUHGTKQ5WT 6GN $QQMYGNN 2CUVGWT$WGPQU#KTGU Ŗ%1.1/$+# (CZ *GCF1HſEG %QTTGQGNÃEVTQPKEQCFQNHQR"JGOKUHGTKQUWT +0(1'0.#%'.6&# 0KTCPMCTK%QNQP[0GY&GNJK EQOCT %TC0Q#Ō Ŗ(+0.#0& 6GN 9QTNF2WDNKECVKQPU5# 5CPVCHÃFG$QIQV¶ #MCVGGOKPGP-KTLCMCWRRC (CZ #X%ÎTFQDC.QECN 6GN Ō 2.*GNUKPMK 5CNGU1HſEG#PUCTK4QCF $WGPQU#KTGU (CZ /[[O¼N¼5JQR-GUMWUMCVW &CT[C)CPL0GY&GNJK 6GN(CZ %QTTGQGNGEVTÎPKEQ *GNUKPMK 6GN %QTTGQGNGEVTÎPKEQ UGTXKENKGPVG"KPHQGPNCEGEQOEQ 6GN 'OCKNDMYGNN"PFGXUPNPGVKP XGPVCUYR"YRDQQMUEQOCT 5KVKQ9GDYYYKPHQGPNCEGEQOEQ (CZ '92#HſNKCVGF'CUV9GUV2TGUU286.VF 5KVKQ9GDYYYYRDQQMUEQOCT 'OCKNCMCVKNCWU"CMCVGGOKPGPEQO )+#PUCTK4QCF&CT[C)CP[ Ŗ%10)1 9GDUKVGYYYCMCVGGOKPGPEQO 0GY&GNJK Ŗ#7564#.+# 1HHKEGPCVKQPCNFGUNKDTCKTKGU UWWTCUKCMMCCVRCNXGNWVJVO 6GN &#KPHQTOCVKQP5GTXKEGU RQRWNCKTGU (CZ 9JKVGJQTUG4QCF $2$TC\\CXKNNG Ŗ(4#0%' 'OCKNCHſNKCV"PFCXUPNPGVKP /KVEJCO8KEVQTKC .CXQKUKGT6GE&QE /QPKVQT+PHQTOCVKQP5GTXKEGU 6GN Ŗ%156#4+%# TWGFG2TQXKIP[ /QIJCN/CTE4CVCP%QORNGZ0CTC[CPIWFC (CZ .KDTGTÈC.GJOCPP5# %CEJCP%GFGZ *[FGTCDCFŌ#PFJTC2TCFGUJ 'OCKNUGTXKEG"FCFKTGEVEQOCW #X%GPVTCN#RCTVCFQ %QWTTKGNNKXTGU"NCXQKUKGTHT 6GN 9GDUKVGYYYFCFKTGEVEQOCW 5CP,QUÃ 5KVG9GDYYYNCXQKUKGTHT (CZ %QTTGQGNÃEVTQPKEQNNGJOCPP"UQNTCEUCEQET .KDTCKTKGFWEQOOGTEGKPVGTPCVKQPCN 'OCKNJGNRFGUM"OQPKVQTKPHQEQO Ŗ#7564+# CXGPWGFŏ+ÃPC 9GDUKVGYYYOQPKVQTKPHQEQO 7PQ8GTNCI Ŗ%§6'&ŏ+81+4' 2CTKU%GFGZ /54GUGCTEJ%Q$QQM%GPVTG #O*QHICTVGP %'&# %QWTTKGNNKDTCTKG"EHEGHT $0GY4QJVCM4QCF PGCT.KDGTV[ &$QPP)GTOCP[ 5KVG9GDYYYRNCPGVGZRQTVHT %KPGOC 0GY&GNJK 6GN $2#DKFLCP 6GN (CZ 6ÃN 'OCKNKPHQ"WPQXGTNCIFG 6ÃNÃEQRKG Ŗ)'4/#0; (CZ 9GDUKVGYYYWPQXGTNCIFG #NGZCPFGT*QTP+PVGTPCVKQPCNG 'OCKNTGUGCTEJEQ"FKUJPGVFUNPGV Ŗ%7$# $WEJJCPFNWPI 1ZHQTF$QQMCPF5VCVKQPGT[%Q Ŗ$#0).#&'5* 'FKEKQPGU%WDCPCU (TKGFTKEJUVTCUUG&9KGUDCFGP 5EKPFKC*QWUG0GY&GNJK /+ /KETQ+PFWUVTKGU&GXGNQROGPV 'ORTGUCFG%QOGTEKQ'ZVGTKQT 6GN 6GN #UUKUVCPEGCPF5GTXKEGU FG2WDNKECEKQPGU (CZ (CZ *QWUG0Q4QCF0Q 0GY 1DKURQ#RCTVCFQ.C*CDCPC 'OCKNCNGZJQTP"CQNEQO 'OCKNQZHQTF"XUPNEQO &JCPOQPFK&JCMCŌ 64+1256TQRKECN5EKGPVKHKE$QQMU 2GTKQFKECN'ZRGTV$QQM#IGPE[ 6GN Ŗ%<'%*4'27$.+% 56QGEJG/KVVNGT )PF(NQQT.CZOK0CICT (CZ /[TKU6TCFG.VF 8GTUCPFDWEJJCPFNWPI)OD* 8KMCU/CTI&GNJK 'OCKNOKFCU"CKVNDFPGV 85VKPJNCEJ21$QZ *KPFGPDWTUVT 6GN 9GDUKVGYYYOKFCUƀEQO 2TCIWG &&CTOUVCFV (CZ 6GN 6GN 'OCKNRGDG"XUPNPGVKP Ŗ$'.)+37' (CZ (CZ /,&G.CPPQ[ 'OCKNO[TKU"O[TKUE\ 'OCKNHQTQTFGTUQTFGTU"PGVNKDTCT[FG Ŗ+0&10'5+# CXGPWGFW4QK 9GDUKVGYYYO[TKUE\ 'OCKNHQTKPHQKPHQ"PGVNKDTCT[FG 2($QQM $TWZGNNGU $GNIKSWG VTKQRU"VTKQRUFG ,N5GVKC$WFJK0Q$CPFWPI 6ÃN Ŗ&'0/#4- 9GDUKVGYYYPGVNKDTCT[FGYYYVTKQRUFG 6GN (CZ )CF+ORQTV$QQMUGNNGTU 7PQ8GTNCI (CZ %QWTTKGNLGCPFGNCPPQ["GWTQPGVDG EQ)CF&KTGEV(KQNUVTCGFG #WIWUV$GDGN#NNGG 'OCKNRHDQQM"DCPFWPIYCUCPVCTCPGVKF 5KVG9GDYYYLGCPFGNCPPQ[DG &-%QRGPJCIGP- &$QPP 6GN 6GN Ŗ+4#0 Ŗ$1.+8+# (CZ (CZ #VJGPG %WNVWTCN#TVKUVKE+PUVKVWVG .QU#OKIQUFGN.KDTQ /QVJCTK#XG#VCDCM%TQUU0Q 'OCKNKPHQ"ICFFKTGEVFM 'OCKNKPHQ"WPQXGTNCIFG 0CIUJG6CXQQU$WNF0Q6GJTCP #X*GTQÈPCU%CUKNNC 9GDUKVGYYYWPQXGTNCIFG 6GN(CZ %QEJCDCODC/GTECFQ.C2C\ Ŗ'%7#&14 %QTTGQGNÃEVTQPKEQIWVVGP"COKIQNDQPGV 'OCKNIJQTCUJK\CFGJ"[CJQQEQO .KDTK/WPFK.KDTGTÈC+PVGTPCEKQPCN Ŗ)*#0# 1HHKEGQHVJG+PVGTPCVKQPCN 4GCFYKFG$QQMUJQR.VF ,WCP.GÎP/GTC CPF4GIKQPCN1TICPK\CVKQPU +41 Ŗ$1659#0# #RCTVCFQ2QUVCN3WKVQ 21$QZ1UW#EETC $QVUCNQ$QQMU 2V[ .VF /KPKUVT[QH,KJCFG#ITKEWNVWTGQHVJG+UNCOKE %QTTGQGNGEVTÎPKEQ 6GN 4GRWDNKEQH+TCP 21$QZ)CDQTQPG NKDTKOW"NKDTKOWPFKEQOGE (CZ -GUJCXCT\$NF/1,#VJƀQQT 6GN 9GDUKVGYYYNKDTKOWPFKEQO 'OCKNTGCFYKFG"CHTKECQPNKPGEROIJ 6GJTCP (CZ 7PKXGTUKFCF#ITCTKCFGN'EWCFQT 'OCKNDQVUCNQ"DQVUPGVDY %GPVTQFG+PHQTOCEKÎP#ITCTKC Ŗ)4''%' Ŗ+6#.; #XFGLWNKQ#RCTVCFQ .KDTCKTKG-CWHHOCPP5# (#1$QQMUJQR Ŗ$4#<+. )WC[CSWKN TWG5VCFKQW#VJGPU 8KCNGFGNNG6GTOGFK%CTCECNNC (WPFCÁºQ)GVÕNKQ8CTICU .KDTGTÈC'URCÌQNC 6GN 4QOC 2TCKCFQ$QVCHQIQ%2 /WTIGÎP[7NNQC3WKVQ (CZ 6GN 4KQFG,CPGKTQ 'OCKNQTF"QVGPGVIT (CZ %QTTGKQGNÃEVTQPKEQNKXTCTKC"HIXDT Ŗ');26 'OCKNRWDNKECVKQPUUCNGU"HCQQTI /'4+%6JG/KFFNG'CUV4GCFGTUŏ Ŗ*#+6+ +N/CTG.KDTGTKC+PVGTPCVKQPCNG Ŗ%#0#&# +PHQTOCVKQP%GPVTG .KDTCKTKG%WNVWTG&KHHWUKQP 8KCFK4KRGVVC 4GPQWH2WDNKUJKPI $CIJCV#N[5VTGGV#RRV #XG,QJP$TQYP .CNWG 4QOC EJGOKP%CPQVGM4QCF7PKV 'N/CUT[6QYGT& 2QTVCW2TKPEG 6GN 1VVCYC1PVCTKQ-,, %CKTQ

P 8 HHKEG % CN D 7 1 . ſEGEQWM H QQMUEQO 4 Q R PD G\WGNC F.CTC UQ GT[ I4QQO &$ P QQMUEQ\Y ' R P P QTI G D TQU"CVVINQ % P EQO 8 EQO D QTI & P UKO P UVG QQMUJQ P CP[+PE C WKNFK P C $ 4 TKXG VKQP5GTXKEGU UVCVKQ P ' $ P U"W FKTGEVUCNGU 0 U & QIEJ 9QQF QTI U R GEWCTKC5 "W 1 JG5VCVKQPGT[ P TGUVKIG GT OR GT P N[ P P P R %CUKNNC VTCNFG R R 2 R D NG N[ 6 CTM D KEQVENK D CTVCFQ UQP$QQMU R P 2 D D P 2 R JQ Ã # CVKQ CZQ H 5 ; ; U VTGGV GTVCFQT / ( OR 0 UVC NKECVKQ R 0 0 D 5 P D NC\C4QQO WG /& 9 W QQMU" QUVOCUVGT"VJGUQEQWM QQMUJQ P 2 KXGN% P ( D R R D KVGF #UUGO %Q 0 IJCO#. QQM%C ( P WFGEQ# QU#KTGU QZ P KFC.K TGG GNVQ 6 70 UKVGYYYW UKVGYYY UKVGYYYW UKVGYYYVJG UKVGYYYUVGXG QWVJYGUV $ 7P VGXKFGQ% GTCN#UUGO NG P ( P JCO $ H D D D D D P 5 / P D KXGTUKFCF%G G#XG P OCKN OCKN OCKNSWGT[" OCKN OCKN H CTCEC[ GNVQ Q G CTCTG GY;QTM GY;QTM JG(CZQP%Q GEPK%KGPEKC.KDTQU F CTSWKUKOGVQ% KTOK WG CZ GNGZ CZ GN CZ GN GN QNN JG K CZ YQ JG GN GN CZ GN CZ CZ GN CZ GN 9G ' ' ( 9G 6 ' ( 0 %C 6 ( ' %CTCECU 6 ( %QTTGQGNGEVTÎ $ 6 * 6 9G 6 ( 9G .C $ 6 Ŗ747)7#; .KDTGTÈC#ITQ $ Ŗ8'0'<7'.# 6 %%% (WFGEQ.KDTGTÈC #XG .KDTGTÈC(#)4 7P Ŗ;7)15.#8+# 5GG5GTDKCCPF/QPVGPGITQ Ŗ<+/$#$9' 2TGUVKIG$QQMU 6 ( CPFVJTQWIJ $QQMUJQ ' 5VGXGP5K Ŗ70+6'&56#6'5 2WDNKECVKQPU $'40#0#UUQEKCVGU GZ70+27$ 7PKVGF0CVKQPU2WDNKECVKQPU 6 6 70$QQMUJQ 6 2GTKQFKECNU 'DUEQ5WDUETK 21 / 6 9GUVYQQF 6 ( / ( / 0 ( ' 6 ) 9G Q D "JMC P IMQM P NGFK G C CTCOCTK GP P $ GEJPKECN 2 SWKTKGU SWKTKGU 6 O P P NCEMYGNNEQO KVGF WG D C P O QTFGTU OCKNNKU P G QN ' G V#WIWUVK R UVGTICUUEJ EJ QZ KV ÑFGTV¼NLG GVVV [CEQOT 5 #XG P 5 5 R O P G P 5 $ P NCEMYGNNEQOUG WN GTI QTV GXK YQTNFEQOEJ CNEQ\C 7P D GVUM R P GT HHKEG D KVTC PD QTFGTU P R PD P [CIC\GVGUKEQOVT UG O 21 QTI 21+065 &' 8'06' &'5 27$.+%#6+105 &' .# (#1 1 0 + P CUK P G P U 270615 &' 8'06# &' 27$.+%#%+10'5 &' .# (#1 UVC Q"FW "OWG 4 $ P 4QCF + P TUC JCTLCJ QZ R 9*'4' 61 274%*#5' (#1 27$.+%#6+105 .1%#..; R P 7'.# NC\CŌ PH FGN & P C[ $ 5 5 G ÂXG $QQMU 2V[ .VF SWKTKGU"VJGUQEQWM P [C P 6 2 CK 5 FKGT"K P QQMU P P CVKQ " P P NQ O $ / G KP5WTKPC R GT W 0 VTGGV9[ 21 CJCNNGUK QQMU"INQ $ NOU.C P YYYW 9 $ ) CG & 5 X CP2CPKV CVKEU5VWFKGU.K .QOÃ QMJC 4CLFCO / D CIEKNCT ' R R 5 CVKQPHQT#ITKEWNVWTG RD R IWU D P O $ KPFW.CEWG\ GGUVTCCV G P P OGTCNF O WU P QZ QZ QZ P VJ K UKVGYYYFW UKVGYYYUYGVU UKVGYYYFQEWFKU UKVGYYYENKEMVUQEQO O CUVGT ' UKQ D FQ $ $ $ D D D D P ' 0 NQ P OCKNOXC OCKNCYCJNSWKUV"UGUYGVU OCKNCNTCYFJC"JQVOCKNEQO OCKN OCKNCMVWGNK OCKNUJKTNG[UUN"VUVV OCKNWXVK OCKNK OCKNFQEWFKU * 2 C QEWFKU QOK * * JG5VCVKQPGT[ COQXC CNCKUFGU KVG9G CZ CZ GN GN GN JG GN CZ CZ CZ GN CZ GN CZ GN CZ GN GN CZ CZ GN ;KN ) ( ' %JG 9G ' ( ' .Q 6 ' MCFGOK ' 6 Ŗ70+6'#$'/+4#6'5 #N4CYFJC$QQMUJQ 21 Ŗ70+6'&-+0)&1/ 6 6 Ŗ59'&'0 5YGVU$NCEMYGNN#$ 21 $QMFKUVTKDWVÑTGP EQ.Q 21 Ŗ6*#+.#0& 5WMUC / Ŗ61)1 .KDTCKTKGFW$QP2CUVGWT $ Ŗ64+0+&#�&61$#)1 5[UVG 6 Ŗ674-'; &70;##% 6 Ŗ5.18#-4'27$.+% +PUVKVWVGQH5EKGPVKHKECPF +PHQT 5 Ŗ5176*#(4+%# 2TGCUKFKW Ŗ57+55' 70$QQMUJQ 2 #FGEQ'FKVKQPU8CP&KGT /×PUVGTICUU$WEJJCPFNWPI & Ŗ574+0#/' 8CEQP & % 9G ( ( ( 6 ( 6 ( 6 ( 6 % 9G 6 ' ( ' % ( 6 ' 9G 5 ' K P R G \ R P N IQ R CTCÈUQ P C FKVGNEQO 2 P GVFQ P N \ P CGFW P R QOK P C P KC & JVO D D . CEQO T P FKTGEVEQ P VQ CIWC 7 EQ C P 4 E P P P P D GUCTTQNNQ C QC%QFGZ C 0KIGTKC .VF QNQ CEQO +P G CZ D QQMUTW R & P 5 R VTQCOGTKEC / QTVWICN"OCKNVGNG R "NCOQNK QQMUTW COGT"OW #\CO UVKICTTK ( D CFC VTG P QQMUEQOUI R P D R QTIFQ ' P GV[W D G H QNQ P +D C QQMUEQOUI P [ R FC"%QFGVGN D D QNGT H P P ECN CTCGN 5 NGIKUNCVKQ C GQITCF CGFW .KU QTGUVCN KX%G R I%G R GTGWNQM / TGUQTC5 R WCKF P $ KEQNKX ( P KEQ R KEQ KEQJKU K CFC P P 7P P P VTQ YYYCTU 3 K[ +D RR OR GVVG"NGIKUNCVKQ P R G VTGGV KEOKWU"[CJQQEQO P LKIC"GW H P QUVCN QUVCN# 5 D P 4QCF UVG Q"UGNGEV JQ QUEQY 2 KXGTUKFCFU 2 YYYEGFC C P %G ' GC 5 C.KOC D D CEJ D PH / P , P 9CTUCY QTG R INK VQEM%QO 7P P QUÃ#OCFQ EÎY GEWCTKQ[ CZ R P , 5 QZ.CJQTG EKÎ P QNK R UKVGJVV UKVGYYYI UKVGYYYUGNGEV UKVGYYYXGUOKT JCJTCJ ( INK C V V CNNGTQE P VWOKNCOQNK $ D D D D IC P 5 / 6 R TQ P KXGTUKV[Q D CTVCFQ CTVCFQ CTVCFQ R OCKNLWM OCKNMUKC\MK"CTU OCKNK OCKNQTFGTU"XGUOKT OCKN P C R R KVKQ9G R K KVKQ9G WIQUNQXGPUMC-PLKIC&& CZ GTC\KLG GN GN CZ GN CZ GN CZ GN CZ GN QK 6 #UW 21 # # #ITQ %CNNG 6 ( 5 Ŗ5'4$+##0&/106'0')41 , 6 21$ Ŗ5+0)#214' 5GNGEV$QQMU2VG.VF 4WCFQ%CTOQ Ŗ4'2$.+%#&1/+0+%#0# %'&#( Ŗ4755+#0('&'4#6+10 VUFCVGNUVQXQ8'5/+4 C-QN #X.C Ŗ21.#0& #TU2QNQPC , Ŗ21467)#. .KXTCTKC2QTVWICN&KCUG#PFTCFG .VFC %QTTGKQGNGEVTÎ ' # Ŗ0+)'4+# 7PKXGTUKV[$QQMUJQ 7P Ŗ2#-+56#0 /KT\C$QQM#IGPE[ Ŗ2#4#)7#; .KDTGTÈC+PVGTEQPVKPGPVCN 'FKVQTCG+ %C Ŗ2'47 .KDTGTÈCFGNC$KDNKQVGEC#ITÈEQNC 0CEKQPCN7PKXGTUKFCF0CEKQPCN #ITCTKC .C 6 Ŗ0+%#4#)7# .KDTGTÈC*+52#/'4 %QUVCFQ QT %QTTGQGNGEVTÎ 9G 6 ( CE 1D 6 %QTTGQGNGEVTÎ %QTTGQGNGEVTÎ ' ( ' 5 9G 6 ( ' 9G 5 JVV ' 9G 6 ( P CFG IVQ GVOZ G R O P P D VTGGV CV G 5 R GV D EQL P CLC O # P EQO 8 N $ ' R Q[ P "FCVC I QM[Q VC PP P WC[9GNNK X P DR GV 6 X NC FEQOO[ P N 3 NC -W N %#.KUUG VCU"N[GUCEQO FG% D P K FEQOO[ QZ 2 P P P Q["GWTQ QQMUJQ CTOCVC D QWUG.QKVC FG &( $ # D 2 RR * FQ JVC CV PP NW-GNC WT P QZ CP[.VF P P D QTVD GNIKSWG R 1 CKTQ 7 $ P .KUUG ( 21 %QN%WCWJVÃOQE $ KFCNIQ 0 KEQTGUCX KEQXG Q $ QEJQEJQOG CNC JQT FÎ & OR [ P * ÃZKEQ IQ OR P D , QZ 0 FGNC 6 QGM"GWTQ 21 P R 4C P .QKVC Q"UYGVU I / K P D $ 2 KO P P QUVCN R Q"NGICE[ Q UEC 2 GOYGI G YYYN[GUCEQO , SWKTKGU"OFE MW YYYLGC GTOCVC KIWGN ŏUUQWNG ÃZKEQ P 21 VTGGV D ' P PH PH * WEQ K D .KDTQU5 2 6 GKYCLKOC WKNFK / FC TWZGNNGU 5 / P K P KPIQ 4 KC * P P $ $ ¶ D QZ TQITGUQ QZ 5 G GEWTCEQ %:#OUVGTFCO %JC &G.CPPQ[ WGFW4QK R P UKVGYYYOFE UKVGYYYUYGVU 2 $ D 2 -WCNC.WO $ P 5 % D D CTVCFQ ) OCKNK OCKNTQQF OCKNK OCKNQAOK[CMCYC"OCTW\G OCKNK 2 2 , G\\C CKTQ GNGI GGTGYGI KGWYG GZV$QQM%GPVTG.VF KVKQ9G KVG9G R CZ CZ CZ CZ CZ CZ GN CZ GN CZ GN QM[Q GN CZ GN GN GN ÃN COC GN ÃN GN CZ -C UVƀQQT 9G ' ' ( %QTTGQGNGEVTÎ ( ( ' %QWTTKGNLGC ' ( %QTTGQGNGEVTÎ 5 9G ( ' ( 6 ( 6 ( 5 6 0 6 6 ( .QECN# %QNQ & # 6 6 EQ Ŗ0'9<'#.#0& .GIKUNCVKQP&KTGEV 5YGVU

Web Analytics