Breeding Science 54 : 67-73 (2004) Disruption of GSTZ1 Gene by Large Genetic Alteration in Oryza glaberrima Tokuji Tsuchiya and Ikuo Nakamura* Graduate School of Science and Technology, Chiba University, 648 Matsudo, Matsudo, Chiba 271-8510, Japan After the completion of the genome sequencing project Introduction of common rice (Oryza sativa L.), comparative genomic studies between rice and related species became impor- Glutathione S-transferases (GSTs; EC 2.5.1.18) are tant to reveal the function of each gene. The rice ge- ubiquitous and abundant detoxifying enzymes in all the organ- nome contains two copies of the gene encoding zeta class isms, such as bacteria, fungi, animals and plants. Recently, glutathione S-transferase (GSTZ) that is reported to be plant GSTs have been classified into four different classes, the enzyme in the catabolic pathway of tyrosine and phi, tau, theta and zeta, based on amino acid sequence simi- phenylalanine. Two GSTZ genes of O. sativa, OsGSTZ1 larity and gene structure (Dixon et al. 1998, Edward et al. and OsGSTZ2, display a tandem arrangement. Up- 2000). The phi and tau GST genes are plant-specific and com- stream OsGSTZ1 gene is constitutively expressed, pose large multi-gene families, whereas the theta and zeta whereas the downstream OsGSTZ2 gene is inducible by GST genes have a few copies. The zeta class GST (GSTZ) stresses. We analyzed the expression of the GSTZ gene genes are present as one or two copies in every plant genome in the African cultivated species O. glaberrima and wild studied, such as A. thaliana, maize, soybean, carnation and species O. longistaminata by using RT-PCR. The results rice (Meyer et al. 1991, Raghothama et al. 1991, McGonigle showed that both GSTZ1 and GSTZ2 genes were ex- et al. 2000, Dixon et al. 2002). Since the plant GSTZ genes pressed in O. longistaminata, whereas only the cDNA are highly homologous to those of mammals and fungi fragment of downstream GSTZ2 was detected in (Board et al. 1997, Blackburn et al. 1998, Subramaniam O. glaberrima. Thus, the genomic sequence of the GSTZ1 et al. 1999), GSTZ genes have been considered to encode locus of O. glaberrima was determined by PCR genomic common essential proteins in all eukaryotes (Hayes and walking. Sequence comparison between O. sativa and Mclellan 1999). Actually, human and fungal GSTZ proteins O. glaberrima revealed that the genomic sequence up- occur as maleylacetoacetate isomerase (MAAI) in phenyl- stream from the eighth intron of the OgGSTZ1 gene was alanine and tyrosine metabolic pathways (Fernandez-Canon highly homologous, in inverted orientation, to a BAC and Penalva 1998). Thom et al. (2001) showed that the clone, over 1-Mb apart from the OsGSTZ1 gene in GSTZ protein in Arabidopsis exhibited a similar activity to O. sativa. This result suggested that the OgGSTZ1 gene that of MAAI. The function of MAAI is important because was disrupted by a large rearrangement or inversion. MAAI might be involved in the nitrogen metabolism in The genetic alteration was also observed in several lines plants. of O. glaberrima and its ancestral wild species O. barthii. We have characterized the structure and expression of The loss of the OgGSTZ1 gene in O. glaberrima is im- the GSTZ genes in rice (Oryza sativa L.). Rice contains two portant, as the expression of the gene is 12-fold higher copies of the GSTZ gene, OsGSTZ1 and OsGSTZ2, in a tan- than that of OsGSTZ2 in O. sativa and since O. sativa dem arrangement orientation on the short arm of chromo- and O. glaberrima differ in several such as seed yield some 12. The upstream OsGSTZ1 and downstream OsGSTZ2 and annual/perennial habitat that might be related to genes display a complex structure with ten and nine exons, the translocation of nitrogen metabolites from leaves to respectively, in spite of encoding a relatively short coding seeds. sequence (ca. 700bp). The amino acid sequences deduced from the OsGSTZ1 and OsGSTZ2 genes were highly homol- Key Words: Oryza glaberrima, glutathione S-transferase, ogous (77.9 %). Real-Time RT-PCR revealed that OsGSTZ1 maleylacetoacetate isomerase, tyrosine was expressed at a level ca. 12-fold higher than that of metabolism, comparative genomics, PCR OsGSTZ2 in the leaves of rice plants. OsGSTZ1 was express- genomic walking. ed in a relatively constitutive manner under various stress conditions. In contrast, the expression of the OsGSTZ2 gene was strongly enhanced (30-fold) by treatment with jasmonate (Tsuchiya et al., data not shown). There are two cultivated species of rice, Oryza sativa and O. glaberrima Steud. The former species is common rice widely grown in tropical and temperate world wide and Communicated by K. Kadowaki differentiated into various subspecies, such as indica and Received October 14, 2003. Accepted November 6, 2003. japonica, while the latter is a monomorphic species endemic *Corresponding author (e-mail: [email protected]) to West Africa (Morishima et al. 1984). Oryza sativa and 68 Tsuchiya and Nakamura O. glaberrima originated independently from wild relatives, from both ends using universal primers. the O. rufopogon-nivara complex in Southeast Asia and O. barthii in West Africa, respectively. As F1s between Sequencing of OgGSTZ locus O. sativa and O. glaberrima are sterile, the genome symbol was Two different methods of PCR genomic walking were designated as AA for O. sativa and AgAg for O. glaberrima. employed to obtain sequence information around the However, the chromosomal pairing in their hybrid was nor- OgGSTZ locus in O. glaberrima. About 1-kb fragment up- mal (Morinaga and Kuriyama 1957). The chromosomal or- stream of OgGSTZ2 was amplified by TAIL-PCR (Liu et al. ganization and location of six different loci (wx, A, Se-1, Rc, 1995) using random RP primer and P5, P6 and P7 as gene 5S and 45S rDNA) are comparable between the two species specific primers (Table 1 and Fig. 2). The sequence further (Sano 1988, Ohmido and Fukui 1995). Oka (1988) pointed upstream (ca. 2-kb) was isolated by Anchor-PCR (Troutt et out that O. glaberrima exhibited stress tolerance to drought, al. 1992). Briefly, gDNA of the O. glaberrima line CG14 diseases and weeds, while O. sativa showed a high seed was digested by BglII and ligated with an anchor (AD-F, yield of seeds and was susceptible to various kinds of biotic AD-R, Table 1). PCR reactions were performed twice using and abiotic stresses. two OgGSTZ2 specific primers (P11 and P12) and adapter After the completion of the rice genome sequence primers (AP1 and AP2). The gDNA and cDNA sequences of project, the comparison of genomic sequences between rice the OgGSTZ2 gene were also amplified using P8, P9 and P10 and related species may enable to study the function of the primers. The amplified fragments were directly sequenced genes. We examined the expression of the OgGSTZ genes in or cloned into pCR2.1 plasmid (Invitrogen). Homology O. glaberrima because O. sativa and O. glaberrima display search was carried out through NCBI Blast server (Altschul differences in seed production and annual-perennial habitat. et al. 1997). That may possibly be related to the translocation of nitrogen metabolites. In this paper, it was observed that the OgGSTZ1 PCR amplification of the altered region gene of O. glaberrima was disrupted by a large genetic re- A pair of primers (P13 and P14) was designed to ampli- arrangement or inversion over 1-Mb of the chromosomal fy the fragment containing the genetic alteration found in fragment. Comparative genetics of O. glaberrima may also O. glaberrima. PCR reactions were executed using DNA give the opportunity to reveal the physiological function of templates extracted from five lines of O. glaberrima and three the GSTZ1 gene. lines of O. barthii. The amplified products were subjected to agarose gel electrophoresis. Materials and Methods Southern blot analysis Plant materials A DIG-labeled probe for OgGSTZ2 cDNA was pre- Oryza sativa ‘Sasanishiki’, O. glaberrima (lines CG14, pared using P9 and P10 primers and a PCR DIG probe syn- C0028, C0039, C0416, C7290 and C7293), O. barthii (lines thesis kit (Roche). Aliquots of 5 µg gDNA were digested by W0652, W0720 and W0747) and O. longistaminata (line eight appropriate restriction endonucleases that did not W1413) were obtained from Iwate Agricultural Research Center and the National Institute of Genetics, Japan. These Table 1. List of primers used in this study rice plants were grown in a greenhouse and leaves at the adult stage were harvested. Genomic DNAs (hereafter re- Name Sequence (5′→3′) ferred to as gDNA(s)) and total RNAs were isolated from the P1 AGCATTTCAAGCTGCTGTC leaves by the CTAB (Rogers and Bendich 1988) and phenol/ P2 TATGGCACTGGAGACTACTCA SDS (Shirzadegan et al. 1991) methods, respectively. Total P3 CGTCAAAGCCAATCCTGTA CTCCATCTACTAATGCTGGTATG RNA (2 µg) was reverse-transcribed using a ReverTra Ace P4 AGCTAAAGCAGTAAGAGTGTTGACT Kit (Toyobo) to synthesize cDNA, according to the manu- P5 P6 AGCTCAGTGAAGCCAAAGAATCAA facturer’s instructions. P7 CTCCAATTGCTCAAGAAATGCTTAC P8 AACTAAACGTGGCATTTATTCACTTACATA PCR amplification of gDNA and cDNA for GSTZ genes P9 AGGTACTGGAGTACTGGATGGATAAT PCR was performed to amplify gDNA and cDNA of the P10 ACCTTTTCAGGACAGCATCTACTC GSTZ gene in O. glaberrima (CG14) and O. longistaminata P11 CATCTGGTTGGTTTTGAGAATGTA (W1413). Two pairs of specific primers, P1-P2 and P3-P4 P12 AGTATTCAATAGGATTCTCTTGTCACTTAGA (Fig. 2 and Table 1), were designed based on the cDNA se- P13 GAAGGTGCATCTGGCTGATTCTTT quences of OsGSTZ1 (Genbank AF309381) and OsGSTZ2 P14 GCGTCGTCAAAGCCAATCCTGTA (Genbank AF402792), respectively. The amplified products RP GTNCGA(G/C)(A/T)CANA(A/T)GTT were fractionated through a 1 % agarose gel and visualized AD-F CGCAGGCTGGCAGTCTCTTTAGGGTTACACGATTGCTT by staining with ethidium bromide under a UV trans- AD-R TCAAGCAATCGTGT illuminator. Furthermore, the amplified fragments were AP1 CGCAGGCTGGCAGTCTCTTTAG ATGCGGCCGCTCTCTTTAGGGTTACACGATTGCTT cloned into a pCR2.1 plasmid (Invitrogen) and sequenced AP2 Disruption of GSTZ1 gene by genetic alteration in Oryza glaberrima 69 digest the inside part of the OgGSTZ2 gene.