DOCSLIB.ORG

The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation Research Article The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation Zheng Wang,1 Ying Hao,1 and Anson W. Lowe1,2,3 1Department of Medicine, Stanford University, 2Stanford University Digestive Disease Center, and 3Stanford Cancer Center, Stanford, California Abstract AGR2 expression in Barrett’s esophagus, a premalignant lesion The AGR2 gene encodes a secretory protein that is highly characterized by intestinal metaplasia, is elevated >70-fold AGR2 expressed in adenocarcinomas of the esophagus, pancreas, compared with normal esophageal epithelia. Esophageal breast, and prostate. This study explores the effect of AGR2 expression alone is sufficient to distinguish Barrett’s esophagus expression with well-established in vitro and in vivo assays from normal esophageal epithelia (8). Barrett’s esophagus increases that screen for cellular transformation and tumor growth. the risk of developing esophageal adenocarcinoma by 30-fold (12). AGR2 AGR2 expression in SEG-1esophageal adenocarcinoma cells was chosen for further investigation for several reasons. Its was reduced with RNA interference. Cellular transformation universal expression in all premalignant and malignant esophageal was examined using NIH3T3 cells that express AGR2 after adenocarcinomas suggests that it serves an important role in stable transfection. The cell lines were studied in vitro with disease pathogenesis. Second, multiple highly conserved genes assays for density-dependent and anchorage-independent important in development, such as those belonging to the Wnt and growth, and in vivo as tumor xenografts in nude mice. SEG-1 Hedgehog pathways, have been found to significantly influence AGR2 cells with reduced AGR2 expression showed an 82% decrease tumor development (13–15). Because is established as an Xenopus in anchorage-independent colony growth and a 60% reduction essential gene in development and is expressed in human in tumor xenograft size. In vitro assays of AGR2-expressing tumors, we chose to further explore its potential role in esophageal NIH3T3 cells displayed enhanced foci formation and cancer using well-established assays in tumor biology. anchorage-independent growth. In vivo, AGR2-expressing NIH3T3 cells established tumors in nude mice. Thus, AGR2 Materials and Methods expression promotes tumor growth in esophageal adenocar- cinoma cells and is able to transform NIH3T3 cells. Immuno- Cell lines and antibodies. SEG-1 (16) cells (a generous gift from Dr. David G. Beer, University of Michigan, Ann Arbor, MI) were grown in 5% histochemistry of the normal mouse intestine detected AGR2 CO2 in DMEM supplemented with 4.5 g/L glucose, L-glutamine (Cellgro, expression in proliferating and differentiated intestinal cells Mediatech, Inc.), penicillin (100 units/mL), streptomycin (100 units/mL), of secretory lineage. AGR2 may be important for the growth and 10% (v/v) fetal bovine serum. NIH3T3 cells were grown in the same and development of the intestine as well as esophageal culture conditions. adenocarcinomas. [Cancer Res 2008;68(2):492–7] RNA interference. RNA interference was achieved using microRNA- adapted short hairpin RNA (shRNA) as previously described (17). Three Introduction constructs were employed that included the following AGR2 sequences Xenopus laevis (underlined) with intervening sequences representing short hairpins: KD1, AGR2 is a secreted protein initially described in , CTGATTAGGTTATGGTTTAATAGTGAAGCCACAGATGTATTAAACCA- from which it was identified in a screen for differentially expressed TAACCTAATCAG; KD2, CCCACACAGTCAAGCTTTAATAGTGAAGCCACA- genes in neural development. AGR2 serves an essential role in GATGTATTAAAGCTTGACTGTGTGGG; and KD3, CAACAAACCCTTGATG- Xenopus development by inducing the formation of the forebrain ATTATAGTGAAGCCACAGATGTATAATCATCAAGGGTTTGTTG. Each con- and the mucus-secreting cement gland (1). In humans, AGR2 was struct was subcloned into the MSCV-LTRmiR30-PIG retroviral vector, which first identified in studies focused on differentially expressed genes was used to transduce SEG-1 cells according to the manufacturer’s protocol in estrogen receptor–positive breast cancers (2). Subsequent (OpenBiosystems, Inc.). SEG-1 control cells were transduced with only the studies showed elevated AGR2 expression in adenocarcinomas of viral vector without the shRNA. Successful incorporation of the retroviral vector was confirmed with the expression of green fluorescent protein that the esophagus, pancreas, and prostate (2–8). The clinical effect of cis AGR2 was contained within the vector in . Transduced cells were selected with expression in tumors is unclear as the implications for 2 Ag/mL of puromycin (MP Biomedicals, Inc.) for a period of 2 weeks. The prognosis are mixed in breast and prostate cancer (7, 9, 10). resultant cells for each construct were assessed for AGR2 expression with AGR2 Evidence that may influence tumor biology stems from protein immunoblotting and quantified with conjugated second antibodies studies in which overexpression in a rat nonmetastatic breast that emit in the IR spectrum (Odyssey Infrared Imaging Systems; LiCor tumor cell line were associated with increased metastasis when Biosciences). propagated as xenografts in nude mice (11). NIH3T3 cell transfection. NIH3T3 cells were cotransfected with the plasmids pCMV-SPORT6.0 containing the full-length AGR2 sequence (Openbiosystems, Inc.) and pcDNA3.1-GFP that carries a neo selective marker. The transfection was performed using Fugene 6.0 (Roche Diagnostics) followed by drug selection with G418 at 0.8 mg/mL. Requests for reprints: Anson W. Lowe, Division of Gastroenterology and Xenograft tumor model. Ten-week-old male BALB/c nude mice were Hepatology, Stanford University, Alway Building, Room M211, 300 Pasteur Drive, obtained from Taconic Farms, Inc.; 1  106 cells were injected s.c. The Stanford, CA 94305-5187. Phone: 650-725-6764; Fax: 650-723-5488; E-mail: resultant tumors were measured with calipers (Westward, Grainger [email protected]. I2008 American Association for Cancer Research. International, Inc.) and the volume was calculated using the formula doi:10.1158/0008-5472.CAN-07-2930 (length  width2 / 2) as previously described (18). Animals were sacrificed Cancer Res 2008;68: (2). January 15, 2008 492 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. AGR2 Promotes Tumor Growth when the maximal allowable tumor size was achieved or after observation In vitro and in vivo assays often used to characterize malignantly for 21 days. transformed cells were employed to assess the effects of reducing Microscopy. Immunohistochemistry was performed using Dako Cyto- AGR2 expression in SEG-1 cells. Anchorage-independent growth in mation Envision Plus following the manufacturer’s instructions. Tissue soft agar is an in vitro characteristic displayed by many trans- sections were obtained from formaldehyde-fixed paraffin-embedded mouse formed cells, including wild-type SEG-1 cells (21, 23). SEG-1:KD1 intestine. Rabbit anti-AGR2 antibodies (Imgenex Corp.) were incubated AGR2 overnight at room temperature at a dilution of 1:100 in PBS. Rabbit anti- cells with reduced expression formed 82% fewer colonies in B in vivo chromogranin A antibodies (ImmunoStar, Inc.) were incubated overnight at soft agar than SEG-1 control cells (Fig. 1 ). The assay room temperature at a dilution of 1:200 in PBS and 0.3% (v/v) Triton X-100. consisted of the same cells implanted s.c. in BALB/c nude mice and Rat anti-mouse anti-Ki67 (Dako Cytomation, Inc.) was incubated for 1 h at grown as tumor xenografts. Twenty-one days after implantation, room temperature at a dilution of 1:25 in PBS. Rat anti-mouse musashi-1 tumors formed by AGR2-deficient cells were on average 60% monoclonal antibodies were a kind gift of Dr. H. Okano (Keio University, smaller than tumors established from SEG-1 control cells (Fig. 1C). Tokyo, Japan) and were incubated at a dilution of 1:500 for 16h at 4 jC (19). Thus, reduction in AGR2 expression compromised SEG-1 growth in Fluorescent images were visualized with a Nikon Eclipse E600 microscope two assays of malignant transformation. ¶ equipped with fluorescence filters for Texas red, FITC, and 4 ,6-diamidino-2- AGR2 possesses a signal peptide and is secreted from cells phenylindole. A monochrome image was acquired with a Spot RT Slider (1, 24). We explored whether secreted AGR2 could affect cells in an digital camera (Diagnostic Instruments, Inc.) for each color channel and in vitro merged with Adobe Photoshop 7.0 (Adobe Systems, Inc.). migration assay in which cells are induced to move across a Migration assay. The cell migration assay used to assess metastatic filter support in response to components added to the bathing potential was performed using Matrigel-coated transwells according to the culture media. Conditioned media derived from SEG-1 cells that manufacturer’s protocols (BD BioCoat growth factor reduced Matrigel express high levels of AGR2 enhanced SEG-1:KD1 cell migration at invasion chamber, BD Biosciences; ref. 20); 1  105 cells were plated in each 2.7-fold higher rates than conditioned media from AGR2-deficient well. The inside chamber within the transwell was incubated with 500 ALof SEG-1:KD1 cells (Fig. 1D). The results support a model in which unconditioned cell culture media containing DMEM supplemented with SEG-1 cells are able to respond to secreted AGR2, which results in 4.5 g/L of glucose, L-glutamine
Load more

Recommended publications
  • AGR2, an Endoplasmic Reticulum Protein, Is Secreted Into the Gastrointestinal Mucus
    AGR2, an Endoplasmic Reticulum Protein, Is Secreted into the Gastrointestinal Mucus Joakim H. Bergstro¨ m1, Katarina A. Berg1, Ana M. Rodrı´guez-Pin˜ eiro1,Ba¨rbel Stecher2, Malin E. V. Johansson1, Gunnar C. Hansson1* 1 Department of Medical Biochemistry, University of Gothenburg, Gothenburg, Sweden, 2 Max von Pettenkofer Institute for Hygiene and Medical Microbiology, LMU Munich, Munich, Germany Abstract The MUC2 mucin is the major constituent of the two mucus layers in colon. Mice lacking the disulfide isomerase-like protein Agr2 have been shown to be more susceptible to colon inflammation. The Agr22/2 mice have less filled goblet cells and were now shown to have a poorly developed inner colon mucus layer. We could not show AGR2 covalently bound to recombinant MUC2 N- and C-termini as have previously been suggested. We found relatively high concentrations of Agr2 in secreted mucus throughout the murine gastrointestinal tract, suggesting that Agr2 may play extracellular roles. In tissue culture (CHO-K1) cells, AGR2 is normally not secreted. Replacement of the single Cys in AGR2 with Ser (C81S) allowed secretion, suggesting that modification of this Cys might provide a mechanism for circumventing the KTEL endoplasmic reticulum retention signal. In conclusion, these results suggest that AGR2 has both intracellular and extracellular effects in the intestine. Citation: Bergstro¨m JH, Berg KA, Rodrı´guez-Pin˜eiro AM, Stecher B, Johansson MEV, et al. (2014) AGR2, an Endoplasmic Reticulum Protein, Is Secreted into the Gastrointestinal Mucus. PLoS ONE 9(8): e104186. doi:10.1371/journal.pone.0104186 Editor: Jean-Luc Desseyn, Inserm, France Received March 16, 2014; Accepted July 11, 2014; Published August 11, 2014 This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose.
    [Show full text]
  • Uterine Double-Conditional Inactivation of Smad2 and Smad3 in Mice Causes Endometrial Dysregulation, Infertility, and Uterine Cancer
    Uterine double-conditional inactivation of Smad2 and Smad3 in mice causes endometrial dysregulation, infertility, and uterine cancer Maya Krisemana,b, Diana Monsivaisa,c, Julio Agnoa, Ramya P. Masanda, Chad J. Creightond,e, and Martin M. Matzuka,c,f,g,h,1 aDepartment of Pathology and Immunology, Baylor College of Medicine, Houston, TX 77030; bReproductive Endocrinology and Infertility, Baylor College of Medicine/Texas Children’s Hospital Women’s Pavilion, Houston, TX 77030; cCenter for Drug Discovery, Baylor College of Medicine, Houston, TX 77030; dDepartment of Medicine, Baylor College of Medicine, Houston, TX 77030; eDan L. Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX 77030; fDepartment of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; gDepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030; and hDepartment of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, TX 77030 Contributed by Martin M. Matzuk, December 6, 2018 (sent for review April 30, 2018; reviewed by Milan K. Bagchi and Thomas E. Spencer) SMAD2 and SMAD3 are downstream proteins in the transforming in endometrial function. Notably, members of the transforming growth factor-β (TGF β) signaling pathway that translocate signals growth factor β (TGF β) family are involved in many cellular from the cell membrane to the nucleus, bind DNA, and control the processes and serve as principal regulators of numerous biological expression of target genes. While SMAD2/3 have important roles functions, including female reproduction. Previous studies have in the ovary, we do not fully understand the roles of SMAD2/3 in shown the TGF β family to have key roles in ovarian folliculo- the uterus and their implications in the reproductive system.
    [Show full text]
  • Study of Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in Biomedicine
    Journal of Developmental Biology Review Study of Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in Biomedicine Eleonora N. Grigoryan Kol’tsov Institute of Developmental Biology, Russian Academy of Sciences, 119334 Moscow, Russia; [email protected]; Tel.: +7-(499)-1350052 Abstract: The review considers the molecular, cellular, organismal, and ontogenetic properties of Urodela that exhibit the highest regenerative abilities among tetrapods. The genome specifics and the expression of genes associated with cell plasticity are analyzed. The simplification of tissue structure is shown using the examples of the sensory retina and brain in mature Urodela. Cells of these and some other tissues are ready to initiate proliferation and manifest the plasticity of their phenotype as well as the correct integration into the pre-existing or de novo forming tissue structure. Without excluding other factors that determine regeneration, the pedomorphosis and juvenile properties, identified on different levels of Urodele amphibians, are assumed to be the main explanation for their high regenerative abilities. These properties, being fundamental for tissue regeneration, have been lost by amniotes. Experiments aimed at mammalian cell rejuvenation currently use various approaches. They include, in particular, methods that use secretomes from regenerating tissues of caudate amphibians and fish for inducing regenerative responses of cells. Such an approach, along with those developed on the basis of knowledge about the molecular and genetic nature and age dependence of regeneration, may become one more step in the development of regenerative medicine Citation: Grigoryan, E.N. Study of Keywords: salamanders; juvenile state; tissue regeneration; extracts; microvesicles; cell rejuvenation Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in 1.
    [Show full text]
  • B Inhibition in a Mouse Model of Chronic Colitis1
    The Journal of Immunology Differential Expression of Inflammatory and Fibrogenic Genes and Their Regulation by NF-␬B Inhibition in a Mouse Model of Chronic Colitis1 Feng Wu and Shukti Chakravarti2 Fibrosis is a major complication of chronic inflammation, as seen in Crohn’s disease and ulcerative colitis, two forms of inflam- matory bowel diseases. To elucidate inflammatory signals that regulate fibrosis, we investigated gene expression changes under- lying chronic inflammation and fibrosis in trinitrobenzene sulfonic acid-induced murine colitis. Six weekly 2,4,6-trinitrobenzene sulfonic acid enemas were given to establish colitis and temporal gene expression patterns were obtained at 6-, 8-, 10-, and 12-wk time points. The 6-wk point, TNBS-w6, was the active, chronic inflammatory stage of the model marked by macrophage, neu- trophil, and CD3؉ and CD4؉ T cell infiltrates in the colon, consistent with the idea that this model is T cell immune response driven. Proinflammatory genes Cxcl1, Ccl2, Il1b, Lcn2, Pla2g2a, Saa3, S100a9, Nos2, Reg2, and Reg3g, and profibrogenic extra- cellular matrix genes Col1a1, Col1a2, Col3a1, and Lum (lumican), encoding a collagen-associated proteoglycan, were up-regulated at the active/chronic inflammatory stages. Rectal administration of the NF-␬B p65 antisense oligonucleotide reduced but did not abrogate inflammation and fibrosis completely. The antisense oligonucleotide treatment reduced total NF-␬B by 60% and down- regulated most proinflammatory genes. However, Ccl2, a proinflammatory chemokine known to promote fibrosis, was not down- regulated. Among extracellular matrix gene expressions Lum was suppressed while Col1a1 and Col3a1 were not. Thus, effective treatment of fibrosis in inflammatory bowel disease may require early and complete blockade of NF-␬B with particular attention to specific proinflammatory and profibrogenic genes that remain active at low levels of NF-␬B.
    [Show full text]
  • New Blocking Antibodies Against Novel AGR2-C4.4A Pathway Reduce Growth and Metastasis of Pancreatic Tumors and Increase Survival in Mice
    Author Manuscript Published OnlineFirst on February 2, 2015; DOI: 10.1158/1535-7163.MCT-14-0470 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. New Blocking Antibodies against Novel AGR2-C4.4A Pathway Reduce Growth and Metastasis of Pancreatic Tumors and Increase Survival in Mice Thiruvengadam Arumugam,1 Defeng Deng,1 Laura Bover2, Huamin Wang,3 Craig D. Logsdon1,4, and Vijaya Ramachandran,1* Depts. of Cancer Biology1, Genomic Medicine2, Pathology3 and GI Medical Oncology4, The University of Texas MD Anderson Cancer Center, Houston, TX, 77054, USA. Running title: C4.4A is the functional receptor of AGR2 Key words: Anterior Gradient 2, C4.4A, bioluminescence, pancreatic adenocarcinoma, AGR2/C4.4A blocking antibodies Disclosures: None Financial Support and Acknowledgements: This research was supported by funds from the Lockton Endowment (to C.D. Logsdon), by Cancer Center Support Core grant CA16672, Pancreatic Specialized Programs of Research Excellence (SPORE) grant P20 CA101936 (to The University of Texas MD Anderson Cancer Center), University Cancer Foundation (to V.Ramachandran) and GS Hogan Gastrointestinal Research funds (to C.D. Logsdon and V. Ramachandran). This research was also supported by funds from the Sheikh Ahmed Center for Pancreatic Cancer Research at The University of Texas M. D. Anderson Cancer Center (to V. Ramachandran). We also acknowledge the MDACC Monoclonal Antibody Core Facility for their help in developing the monoclonal antibodies and the core is funded by NCI#CA 16672. *Corresponding Author: Vijaya Ramachandran, Ph.D Assistant Professor, Department of Cancer Biology, The University of Texas MD Anderson Cancer Center, Unit 953, 1515 Holcombe Blvd, Houston, Texas 77030, USA Phone: 713-792-9134; Fax: 713- 563-8986 Email: [email protected] 1 Downloaded from mct.aacrjournals.org on September 28, 2021.
    [Show full text]
  • Aberrant Hypomethylation-Mediated AGR2 Overexpression Induces an Aggressive Phenotype in Ovarian Cancer Cells
    ONCOLOGY REPORTS 32: 815-820, 2014 Aberrant hypomethylation-mediated AGR2 overexpression induces an aggressive phenotype in ovarian cancer cells HYE YOUN SUNG1, EUN NAM CHOI1, DAHYUN LYU1, AE KYUNG PARK2, WOONG JU3 and JUNG-HYUCK AHN1 1Department of Biochemistry, School of Medicine, Ewha Womans University, Seoul 158-710; 2College of Pharmacy, Sunchon National University, Jeonnam 540-742; 3Department of Obstetrics and Gynecology, School of Medicine, Ewha Womans University, Seoul 158-710, Republic of Korea Received February 6, 2014; Accepted March 30, 2014 DOI: 10.3892/or.2014.3243 Abstract. The metastatic properties of cancer cells result from Introduction genetic and epigenetic alterations that lead to the abnormal expression of key genes regulating tumor phenotypes. Recent Ovarian cancer has the highest fatality rate among all discoveries suggest that aberrant DNA methylation provides gynecological cancers, since more than 70% of ovarian cancer cells with advanced metastatic properties; however, cancer patients are initially diagnosed when the cancer is in the precise regulatory mechanisms controlling metastasis- advanced stages (1,2). Although there have been significant associated genes and their roles in metastatic transformation improvements in surgical treatments and chemotherapy, the are largely unknown. We injected SK-OV-3 human ovarian overall survival rate remains poor (3). The poor survival rate cancer cells into the perineum of nude mice to generate a is attributed to frequent recurrence after several disease-free mouse model that mimics human ovarian cancer metastasis. months, which are obtained by optimal debulking surgery We analyzed the mRNA expression and DNA methylation and subsequent chemotherapy. Since all of the ovarian tissue profiles in metastasized tumor tissues in the mice.
    [Show full text]
  • Recent Discoveries of Macromolecule- and Cell-Based Biomarkers and Therapeutic Implications in Breast Cancer
    International Journal of Molecular Sciences Review Recent Discoveries of Macromolecule- and Cell-Based Biomarkers and Therapeutic Implications in Breast Cancer Hsing-Ju Wu 1,2,3 and Pei-Yi Chu 4,5,6,7,* 1 Department of Biology, National Changhua University of Education, Changhua 500, Taiwan; [email protected] 2 Research Assistant Center, Show Chwan Memorial Hospital, Changhua 500, Taiwan 3 Department of Medical Research, Chang Bing Show Chwan Memorial Hospital, Lukang Town, Changhua County 505, Taiwan 4 School of Medicine, College of Medicine, Fu Jen Catholic University, New Taipei City 231, Taiwan 5 Department of Pathology, Show Chwan Memorial Hospital, No. 542, Sec. 1 Chung-Shan Rd., Changhua 500, Taiwan 6 Department of Health Food, Chung Chou University of Science and Technology, Changhua 510, Taiwan 7 National Institute of Cancer Research, National Health Research Institutes, Tainan 704, Taiwan * Correspondence: [email protected]; Tel.: +886-975-611-855; Fax: +886-4-7227-116 Abstract: Breast cancer is the most commonly diagnosed cancer type and the leading cause of cancer-related mortality in women worldwide. Breast cancer is fairly heterogeneous and reveals six molecular subtypes: luminal A, luminal B, HER2+, basal-like subtype (ER−, PR−, and HER2−), normal breast-like, and claudin-low. Breast cancer screening and early diagnosis play critical roles in improving therapeutic outcomes and prognosis. Mammography is currently the main commercially available detection method for breast cancer; however, it has numerous limitations. Therefore, reliable noninvasive diagnostic and prognostic biomarkers are required. Biomarkers used in cancer range from macromolecules, such as DNA, RNA, and proteins, to whole cells.
    [Show full text]
  • Hedgehog Signaling Regulates FOXA2 in Esophageal Embryogenesis and Barrett’S Metaplasia
    Hedgehog signaling regulates FOXA2 in esophageal embryogenesis and Barrett’s metaplasia David H. Wang, … , Stuart J. Spechler, Rhonda F. Souza J Clin Invest. 2014;124(9):3767-3780. https://doi.org/10.1172/JCI66603. Research Article Gastroenterology Metaplasia can result when injury reactivates latent developmental signaling pathways that determine cell phenotype. Barrett’s esophagus is a squamous-to-columnar epithelial metaplasia caused by reflux esophagitis. Hedgehog (Hh) signaling is active in columnar-lined, embryonic esophagus and inactive in squamous-lined, adult esophagus. We showed previously that Hh signaling is reactivated in Barrett’s metaplasia and overexpression of Sonic hedgehog (SHH) in mouse esophageal squamous epithelium leads to a columnar phenotype. Here, our objective was to identify Hh target genes involved in Barrett’s pathogenesis. By microarray analysis, we found that the transcription factor Foxa2 is more highly expressed in murine embryonic esophagus compared with postnatal esophagus. Conditional activation of Shh in mouse esophageal epithelium induced FOXA2, while FOXA2 expression was reduced in Shh knockout embryos, establishing Foxa2 as an esophageal Hh target gene. Evaluation of patient samples revealed FOXA2 expression in Barrett’s metaplasia, dysplasia, and adenocarcinoma but not in esophageal squamous epithelium or squamous cell carcinoma. In esophageal squamous cell lines, Hh signaling upregulated FOXA2, which induced expression of MUC2, an intestinal mucin found in Barrett’s esophagus, and the MUC2-processing protein AGR2. Together, these data indicate that Hh signaling induces expression of genes that determine an intestinal phenotype in esophageal squamous epithelial cells and may contribute to the development of Barrett’s metaplasia. Find the latest version: https://jci.me/66603/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Hedgehog signaling regulates FOXA2 in esophageal embryogenesis and Barrett’s metaplasia David H.
    [Show full text]
  • Human Homologue of Cement Gland Protein, a Novel Metastasis Inducer Associated with Breast Carcinomas
    Research Article Human Homologue of Cement Gland Protein, a Novel Metastasis Inducer Associated with Breast Carcinomas Dong Liu,1 Philip S. Rudland,1,2 D. Ross Sibson,3 Angela Platt-Higgins,2 and Roger Barraclough2 1Cancer Tissue Bank Research Centre and 2School of Biological Sciences, University of Liverpool, Liverpool, United Kingdom and 3Clatterbridge Cancer Research Trust, J.K. Douglas Laboratories, Clatterbridge Hospital, Wirral, United Kingdom Abstract PCR-selected suppression subtractive hybridization (11) has A suppression subtractive cDNA library representing mRNAs been used to identify cDNAs representing mRNAs differentially a a expressed at a higher level in the malignant human breast expressed (12–14) between an estrogen receptor (ER )–negative cancer cell line, MCF-7, relative to a benign breast tumor- benign human mammary epithelial cell line, Huma 123 (15), and a derived cell line, Huma 123, contained a cDNA, M36, which the ER -positive malignant human mammary epithelial cell line, was expressed in estrogen receptor A (ERA)–positive breast MCF-7 (16). The resulting subtracted libraries contained well- carcinoma cell lines but not in cell lines from normal/benign/ characterized, differentially expressed cDNAs that have been ERA-negative malignant breast lesions. M36 cDNA had an associated previously with tumor progression (12). In this article, identical coding sequence to anterior gradient 2 (AGR2), the we report one novel cloned cDNA, M36, which matches identically the coding sequence of human anterior gradient 2 (AGR2) cDNA, human homologue of the cement gland–specific gene (Xeno- pus laevis). Screening of breast tumor specimens using reverse the human homologue (previously hAG-2) of the Xenopus laevis transcription-PCR and immunocytochemistry with affinity- cement gland–specific gene, XAG-2 (17).
    [Show full text]
  • Thyroid Hormone Receptor Mutants Implicated in Human Hepatocellular Carcinoma Display an Altered Target Gene Repertoire
    Oncogene (2009) 28, 4162–4174 & 2009 Macmillan Publishers Limited All rights reserved 0950-9232/09 $32.00 www.nature.com/onc ORIGINAL ARTICLE Thyroid hormone receptor mutants implicated in human hepatocellular carcinoma display an altered target gene repertoire IH Chan and ML Privalsky Department of Microbiology, College of Biological Sciences, University of California at Davis, Davis, CA, USA Thyroid hormone receptors (TRs) are hormone-regulated lapping, biological roles (Lazar, 1993; Murata, 1998; transcription factors that control multiple aspects of Yen, 2001; Harvey and Williams, 2002). Both TRa1 and normal physiology and development. Mutations in TRs TRb1 bind to specific DNA sequences (response have been identified at high frequency in certain cancers, elements), and regulate the expression of adjacent target including human hepatocellular carcinomas (HCCs). The genes up or down (Katz and Koenig, 1993; Lazar, 1993, majority of HCC–TR mutants bear lesions within their 2003; Yen, 2001). On ‘positively regulated’ target genes, DNA recognition domains, and we have hypothesized that TRs recruit corepressors and repress gene transcription these lesions change the mutant receptors’ target gene in the absence of T3, but release corepressors, recruit repertoire in a way crucial to their function as oncoproteins. coactivators and activate gene transcription in the Using stable cell transformants and expression array presence of T3 (Cheng, 2000; Zhang and Lazar, 2000; analysis, we determined that mutant TRs isolated from Harvey and Williams, 2002; Tsai and Fondell, 2004). two different HCCs do, as hypothesized, display a target There is less understanding of ‘negatively regulated’ gene repertoire distinct from that of their normal TR target genes that are activated by TRs in the absence, progenitors.
    [Show full text]
  • AGR2 Ameliorates Tumor Necrosis Factor-Α-Induced Epithelial Barrier Dysfunction Via Suppression of NF-Κb P65-Mediated MLCK/P-MLC Pathway Activation
    1206 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 39: 1206-1214, 2017 AGR2 ameliorates tumor necrosis factor-α-induced epithelial barrier dysfunction via suppression of NF-κB p65-mediated MLCK/p-MLC pathway activation XIAOLIN YE and MEI SUN Department of Paediatrics, China Medical University Affiliated with Shengjing Hospital, Shenyang, Liaoning 110004, P.R. China Received October 25, 2016; Accepted March 13, 2017 DOI: 10.3892/ijmm.2017.2928 Abstract. Intestinal epithelial barrier dysfunction plays and stabilized the cytoskeletal structure. Furthermore, a critical role in the pathogenesis of inflammatory AGR2 inhibited the changes in MLCK, MLC and p-MLC bowel disease (IBD). Anterior gradient protein 2 homo- expression in response to TNF-α stimulation. Collectively, logue (AGR2) assists in maintaining intestinal homeostasis our study suggests that AGR2 inhibits TNF-α-induced in dextran sulphate sodium-induced mouse ileocolitis; Caco-2 cell hyperpermeability by regulating TJ and that however, it is unclear whether it modulates intestinal barrier this protective mechanism may be promoted by inhibition function. Our study aimed to investigate the protective of NF-κB p65-mediated activation of the MLCK/p-MLC role of AGR2 in tumor necrosis factor (TNF)-α-induced signaling pathway. intestinal epithelial barrier injury. Caco-2 cell monolayers were pre-transfected with an AGR2 plasmid and then Introduction exposed to TNF-α. Epithelial permeability was assessed by detecting transepithelial electrical resistance and fluorescein Disruption of intestinal epithelial barrier function is a key isothiocyanate-dextran (40 kDa) flux. The protein expression characteristic of inflammatory bowel disease (IBD) (1-4). An levels of zonula occludens-1 (ZO-1), occludin, claudin-1, intact intestinal epithelial barrier is essential for defending myosin light chain kinase (MLCK)/p-MLC, and nuclear against the invasion of antigens and for maintaining the inte- factor (NF)-κB p65 were determined by western blotting.
    [Show full text]
  • Anterior Gradient-2 Monoclonal Antibody Inhibits Lung Cancer
    Cancer Letters 449 (2019) 125–134 Contents lists available at ScienceDirect Cancer Letters journal homepage: www.elsevier.com/locate/canlet Original Articles Anterior Gradient-2 monoclonal antibody inhibits lung cancer growth and metastasis by upregulating p53 pathway and without exerting any T toxicological effects: A preclinical study Hema Negia,1, Siva Bharath Merugua,1, Hitesh Bhagavanbhai Mangukiyaa, Zheqi Lib, Bingjie Zhoua, Qudsia Sehara, Suchitra Kamlec, Fakhar-un-Nisa Yunusa, Dhahiri Saidi Mashausia, ∗∗ ∗ Zhenghua Wua, , Dawei Lia,d, a School of Pharmacy, Shanghai Jiao Tong University, Shanghai, China b Department of Molecular Pharmacology and Chemical Biology, School of Medicine, University of Pittsburgh, PA, USA c Division of Molecular Microbiology and Immunology, Brown University, Providence, RI, USA d Engineering Research Center of Cell and Therapeutic Antibody of Ministry of Education, Shanghai Jiao Tong University, China ARTICLE INFO ABSTRACT Keywords: Increased drug resistance and acute side effects on normal organs are the major disadvantages of traditional mAb18A4 cancer chemotherapy and radiotherapy. This has increased the focus on targeted therapeutic strategies such as Anti-AGR2 monoclonal antibody monoclonal antibody-based cancer therapies. The major advantage of antibody-based therapies is the specific NSCLC inhibition of cancer-related targets, with reduced off-target side effects. Anterior gradient-2 (AGR2) is a pro- Angiogenesis metastatic and proangiogenic tumor marker that is overexpressed in multiple cancers. Therefore, anti-AGR2 MAPK antibodies may be potential therapeutic agents for treating different cancers. In the present study, we examined a p53 Toxicology novel anti-AGR2 monoclonal antibody mAb18A4 and found that this antibody inhibited lung cancer progression and metastasis without exerting any adverse side effects on the major organs and blood in mice.
    [Show full text]