The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation

Research Article

Zheng Wang,1 Ying Hao,1 and Anson W. Lowe1,2,3

1Department of Medicine, Stanford University, 2Stanford University Digestive Disease Center, and 3Stanford Cancer Center, Stanford, California

Abstract AGR2 expression in Barrett’s esophagus, a premalignant lesion The AGR2 gene encodes a secretory protein that is highly characterized by intestinal metaplasia, is elevated >70-fold AGR2 expressed in adenocarcinomas of the esophagus, pancreas, compared with normal esophageal epithelia. Esophageal breast, and prostate. This study explores the effect of AGR2 expression alone is sufficient to distinguish Barrett’s esophagus expression with well-established in vitro and in vivo assays from normal esophageal epithelia (8). Barrett’s esophagus increases that screen for cellular transformation and tumor growth. the risk of developing esophageal adenocarcinoma by 30-fold (12). AGR2 AGR2 expression in SEG-1esophageal adenocarcinoma cells was chosen for further investigation for several reasons. Its was reduced with RNA interference. Cellular transformation universal expression in all premalignant and malignant esophageal was examined using NIH3T3 cells that express AGR2 after adenocarcinomas suggests that it serves an important role in stable transfection. The cell lines were studied in vitro with disease pathogenesis. Second, multiple highly conserved genes assays for density-dependent and anchorage-independent important in development, such as those belonging to the Wnt and growth, and in vivo as tumor xenografts in nude mice. SEG-1 Hedgehog pathways, have been found to significantly influence AGR2 cells with reduced AGR2 expression showed an 82% decrease tumor development (13–15). Because is established as an Xenopus in anchorage-independent colony growth and a 60% reduction essential gene in development and is expressed in human in tumor xenograft size. In vitro assays of AGR2-expressing tumors, we chose to further explore its potential role in esophageal NIH3T3 cells displayed enhanced foci formation and cancer using well-established assays in tumor biology. anchorage-independent growth. In vivo, AGR2-expressing NIH3T3 cells established tumors in nude mice. Thus, AGR2 Materials and Methods expression promotes tumor growth in esophageal adenocarcinoma cells and is able to transform NIH3T3 cells. Immuno- Cell lines and antibodies. SEG-1 (16) cells (a generous gift from Dr. David G. Beer, University of Michigan, Ann Arbor, MI) were grown in 5% histochemistry of the normal mouse intestine detected AGR2 CO2 in DMEM supplemented with 4.5 g/L glucose, L-glutamine (Cellgro, expression in proliferating and differentiated intestinal cells Mediatech, Inc.), penicillin (100 units/mL), streptomycin (100 units/mL), of secretory lineage. AGR2 may be important for the growth and 10% (v/v) fetal bovine serum. NIH3T3 cells were grown in the same and development of the intestine as well as esophageal culture conditions. adenocarcinomas. [Cancer Res 2008;68(2):492–7] RNA interference. RNA interference was achieved using microRNA- adapted short hairpin RNA (shRNA) as previously described (17). Three Introduction constructs were employed that included the following AGR2 sequences Xenopus laevis (underlined) with intervening sequences representing short hairpins: KD1, AGR2 is a secreted protein initially described in , CTGATTAGGTTATGGTTTAATAGTGAAGCCACAGATGTATTAAACCA- from which it was identified in a screen for differentially expressed TAACCTAATCAG; KD2, CCCACACAGTCAAGCTTTAATAGTGAAGCCACA- genes in neural development. AGR2 serves an essential role in GATGTATTAAAGCTTGACTGTGTGGG; and KD3, CAACAAACCCTTGATG- Xenopus development by inducing the formation of the forebrain ATTATAGTGAAGCCACAGATGTATAATCATCAAGGGTTTGTTG. Each con- and the mucus-secreting cement gland (1). In humans, AGR2 was struct was subcloned into the MSCV-LTRmiR30-PIG retroviral vector, which first identified in studies focused on differentially expressed genes was used to transduce SEG-1 cells according to the manufacturer’s protocol in estrogen receptor–positive breast cancers (2). Subsequent (OpenBiosystems, Inc.). SEG-1 control cells were transduced with only the studies showed elevated AGR2 expression in adenocarcinomas of viral vector without the shRNA. Successful incorporation of the retroviral vector was confirmed with the expression of green fluorescent protein that the esophagus, pancreas, and prostate (2–8). The clinical effect of cis AGR2 was contained within the vector in . Transduced cells were selected with expression in tumors is unclear as the implications for 2 Ag/mL of puromycin (MP Biomedicals, Inc.) for a period of 2 weeks. The prognosis are mixed in breast and prostate cancer (7, 9, 10). resultant cells for each construct were assessed for AGR2 expression with AGR2 Evidence that may influence tumor biology stems from protein immunoblotting and quantified with conjugated second antibodies studies in which overexpression in a rat nonmetastatic breast that emit in the IR spectrum (Odyssey Infrared Imaging Systems; LiCor tumor cell line were associated with increased metastasis when Biosciences). propagated as xenografts in nude mice (11). NIH3T3 cell transfection. NIH3T3 cells were cotransfected with the plasmids pCMV-SPORT6.0 containing the full-length AGR2 sequence (Openbiosystems, Inc.) and pcDNA3.1-GFP that carries a neo selective marker. The transfection was performed using Fugene 6.0 (Roche Diagnostics) followed by drug selection with G418 at 0.8 mg/mL. Requests for reprints: Anson W. Lowe, Division of Gastroenterology and Xenograft tumor model. Ten-week-old male BALB/c nude mice were Hepatology, Stanford University, Alway Building, Room M211, 300 Pasteur Drive, obtained from Taconic Farms, Inc.; 1 Â 106 cells were injected s.c. The Stanford, CA 94305-5187. Phone: 650-725-6764; Fax: 650-723-5488; E-mail: resultant tumors were measured with calipers (Westward, Grainger [email protected]. I2008 American Association for Cancer Research. International, Inc.) and the volume was calculated using the formula doi:10.1158/0008-5472.CAN-07-2930 (length Â width2 / 2) as previously described (18). Animals were sacrificed

Cancer Res 2008;68: (2). January 15, 2008 492 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. AGR2 Promotes Tumor Growth when the maximal allowable tumor size was achieved or after observation In vitro and in vivo assays often used to characterize malignantly for 21 days. transformed cells were employed to assess the effects of reducing Microscopy. Immunohistochemistry was performed using Dako Cyto- AGR2 expression in SEG-1 cells. Anchorage-independent growth in mation Envision Plus following the manufacturer’s instructions. Tissue soft agar is an in vitro characteristic displayed by many trans- sections were obtained from formaldehyde-fixed paraffin-embedded mouse formed cells, including wild-type SEG-1 cells (21, 23). SEG-1:KD1 intestine. Rabbit anti-AGR2 antibodies (Imgenex Corp.) were incubated AGR2 overnight at room temperature at a dilution of 1:100 in PBS. Rabbit anti- cells with reduced expression formed 82% fewer colonies in B in vivo chromogranin A antibodies (ImmunoStar, Inc.) were incubated overnight at soft agar than SEG-1 control cells (Fig. 1 ). The assay room temperature at a dilution of 1:200 in PBS and 0.3% (v/v) Triton X-100. consisted of the same cells implanted s.c. in BALB/c nude mice and Rat anti-mouse anti-Ki67 (Dako Cytomation, Inc.) was incubated for 1 h at grown as tumor xenografts. Twenty-one days after implantation, room temperature at a dilution of 1:25 in PBS. Rat anti-mouse musashi-1 tumors formed by AGR2-deficient cells were on average 60% monoclonal antibodies were a kind gift of Dr. H. Okano (Keio University, smaller than tumors established from SEG-1 control cells (Fig. 1C). Tokyo, Japan) and were incubated at a dilution of 1:500 for 16h at 4 jC (19). Thus, reduction in AGR2 expression compromised SEG-1 growth in Fluorescent images were visualized with a Nikon Eclipse E600 microscope two assays of malignant transformation. ¶ equipped with fluorescence filters for Texas red, FITC, and 4 ,6-diamidino-2- AGR2 possesses a signal peptide and is secreted from cells phenylindole. A monochrome image was acquired with a Spot RT Slider (1, 24). We explored whether secreted AGR2 could affect cells in an digital camera (Diagnostic Instruments, Inc.) for each color channel and in vitro merged with Adobe Photoshop 7.0 (Adobe Systems, Inc.). migration assay in which cells are induced to move across a Migration assay. The cell migration assay used to assess metastatic filter support in response to components added to the bathing potential was performed using Matrigel-coated transwells according to the culture media. Conditioned media derived from SEG-1 cells that manufacturer’s protocols (BD BioCoat growth factor reduced Matrigel express high levels of AGR2 enhanced SEG-1:KD1 cell migration at invasion chamber, BD Biosciences; ref. 20); 1 Â 105 cells were plated in each 2.7-fold higher rates than conditioned media from AGR2-deficient well. The inside chamber within the transwell was incubated with 500 ALof SEG-1:KD1 cells (Fig. 1D). The results support a model in which unconditioned cell culture media containing DMEM supplemented with SEG-1 cells are able to respond to secreted AGR2, which results in 4.5 g/L of glucose, L-glutamine (Cellgro, Mediatech, Inc.), and 1% (w/v) increased migration. bovine serum albumin (Sigma-Aldrich). The bottom chamber outside the Effects of AGR2 expression in NIH3T3 cells. In view of AGR2’s transwell was filled with 750 AL of DMEM supplemented with 4.5 g/L of effects on SEG-1 cells, additional studies were performed to glucose, L-glutamine medium, and 10% (v/v) FCS that was conditioned for 24 h with either SEG-1:KD1 cells or SEG-1 control cells. The cultures were examine its role in tumorigenesis. Transfected NIH3T3 cells are commonly used in in vitro and in vivo assays to assess whether incubated at 37jCin5%CO2 for 18 h, followed by fixation in 100% methanol for 15 min and staining in 0.2% (w/v) crystal violet, and 2% (v/v) specific genes could promote cellular transformation (21, 23). The ethanol for 15 min. The colony number was quantified by counting directly in vitro assays include measurements of foci formation, which with a microscope. reflect the loss of density-dependent growth, or anchorage- Cell proliferation. Cell proliferation was determined by plating 105 cells independent growth in soft agar as previously described. Trans- per 6cm dish in duplicate for each time point and at serum concentrations fected NIH3T3 cells that express AGR2 show significantly enhanced from 2% to 10%. Every 2 days following the initial plating, the cells were foci formation, as multiple foci are formed with AGR2 expression harvested and manually counted using a hemocytometer. compared with almost no foci formed by the controls (Fig. 2A). Miscellaneous methods. The assays for focus-formation and anchorage- Anchorage-independent growth, as assessed by colony growth in independent growth were performed as previously described (21). Culture plates containing foci or colonies in soft agar were stained with crystal soft agar, resulted in an up to 7-fold increase in colonies for B violet, scanned on a flatbed scanner, and quantified using ImageJ.4 NIH3T3:AGR2 cells compared with NIH3T3 control cells (Fig. 2 ). Real-time PCR used SYBR Green for quantification (Bio-Rad Laborato- Finally, NIH3T3 cells were also used in an in vivo assay in which ries, Inc.). PCR primer sequences used for AGR2 included 5¶-ATGAGTGCC- xenografts were evaluated for their ability to grow as tumors in CACACAGTCAA-3¶ and 5¶-GGACATACTGGCCATCAGGA-3¶; for h-actin, nude mice. AGR2-expressing NIH3T3:AGR2 cells grown as xeno- 5¶-CGGGAAATCGTGCGTGACATTAAG-3¶ and 5¶-TGATCTCCTTCTG- grafts were 15-fold larger in size 21 days after implantation CATCCTGTCGG-3¶; and for GFI1, 5¶-TCCACACTGTCCACACACCT-3¶ and compared with controls (Fig. 2C and D). Therefore, in vitro and ¶ ¶ 5 -CTGGCACTTGTGAGGCTTCT-3 . in vivo assays with NIH3T3 cells implicate AGR2 in cellular ATOH1 GFI1 Additional analysis of and gene expression from the data transformation. set in ref. 22 was explored using the Gene Expression Omnibus at the GEO Expression of AGR2 in the normal mouse intestine. We web site5 (accession no. GDS1321). explored AGR2 expression in the normal mouse small intestine because Barrett’s esophagus is characterized by intestinal meta- Results plasia, which significantly increases the risk of developing AGR2 RNA interference in SEG-1cells. We first explored AGR2 adenocarcinoma. In addition, knowledge available with respect to function in esophageal cancer by reducing its expression in the intestinal development and cell growth may be capitalized to esophageal adenocarcinoma cell line, SEG-1 (16). Stable AGR2- provide insights into AGR2’s function in normal gastrointestinal deficient SEG-1:KD1 (knockdown) cells were produced by trans- cells and tumors (25, 26). The small intestine is composed of four formation with retrovirus containing microRNA-adapted shRNAs cell types, absorptive enterocytes, goblet cells, Paneth cells, and that interfere with AGR2 expression through RNA interference. enteroendocrine cells; with the latter three classified together as Real-time PCR showed that AGR2 mRNA levels decreased by 85% secretory cells. We performed immunohistochemistry on normal in the SEG-1:KD1 cells. An associated decrease in protein mouse intestine and detected AGR2 protein in small intestinal expression was confirmed with immunoblotting (Fig. 1A). crypts and villi (Fig. 3A). The majority of cells in the intestinal villus, represented by absorptive enterocytes, did not label for AGR2. Granule-containing Paneth cells located in the base of A, G–J 4 http://rsb.info.nih.gov/ij intestinal crypts showed strong AGR2 labeling (Fig. 3 ). AGR2 5 http://www.ncbi.nlm.nih.gov/projects/geo/ staining was also observed in all cells that expressed chromogranin www.aacrjournals.org 493 Cancer Res 2008;68: (2). January 15, 2008

Figure 1. Effects of AGR2 suppression in SEG-1 cells. A, AGR2 expression in SEG-1 cells suppressed with shRNAmir. SEG-1 cells were transduced with shRNAmir retroviral constructs (KD1, KD2, KD3) followed by selection with puromycin. SEG-1 control cells were transduced with the retroviral vector alone (Vector). The chart displays the cell lines assayed by real-time PCR for AGR2 mRNA normalized to h-actin mRNA; and compared with SEG-1 control cells. Inset, AGR2 protein expression assayed with protein immunoblotting. All remaining experiments used the SEG-1:KD1 cells. B, anchorage-independent growth as measured by colony growth in soft agar at different initial plating densities. SEG-1:KD1 cells showed an 82% reduction in colonies with the plating of 1,000 cells. Columns, mean; bars, 1SD.C, SEG-1 control cells (x) and SEG-1:KD1 cells were grown as tumor xenografts in nude mice (n). Points, mean from five mice; bars, 1SD.D, migration assay. SEG-1:KD1 cells were grown in filter chambers bathed in conditioned culture media derived from either SEG-1 control cells (AGR2+) or SEG-1:KD1 cells (AGR2À). Columns, mean fold change from three experiments performed in duplicate and normalized to the experiments using AGR2-deficient conditioned media; bars, 1 SE. The number of cells which migrated for the AGR2+ media ranged from 133 to 264 cells.

A(CHGA), a marker for enteroendocrine cells (Fig. 3B–C). Although Effects of AGR2 expression on GFI1expression. GFI1 is AGR2 staining was strongest for enteroendocrine cells in the a basic helix-loop-helix transcription factor whose expression is intestinal villus, other positive-staining cells were also observed important in cell lineage determination among intestinal secre- À À and found to stain with Alcian blue, which identifies mucus- tory cells. GFI1 / mice exhibit increased numbers of enter- containing goblet cells (Fig. 3A). The ratio of AGR2-staining oendocrine cells, a decline in intestinal goblet cells, and the enteroendocrine cells to goblet cells was f1:8, which is consistent absence of Paneth cells. GFI1 expression influences cell fate with the previously described ratio for these cells in the mouse (27). but does not influence cell proliferation (30). Enhanced GFI1 ex- Thus, AGR2 is expressed in all three intestinal secretory cell pression, however, is associated with tumor development (31, 32). lineages. Because AGR2 and GFI1 expression is dependent on ATOH1 Because AGR2 expression is enhanced in tumors, we explored expression (see Discussion), real-time PCR of SEG1:KD1 cells was whether it is expressed in proliferating cells in normal intestinal performed to evaluate whether changes in AGR2 expres- crypts. Musashi-1 (MSI1) is a RNA-binding protein that is sion influences that of GFI1. Quantitative real-time PCR revealed expressed by intestinal stem cells or early progenitor cells (28). no significant changes in GFI1 mRNA levels between SEG-1:KD1 Coexpression of MSI1 and AGR2 was observed in the intestinal and control SEG-1 cells (Fig. 4A). crypt (Fig. 3D–F). MSI1 expression in the normal small intestine is rare, therefore, additional studies were performed with the proliferation-related Ki-67 antigen (MKI67;Fig.3G–J). Consistent Discussion with previous studies, nuclear Ki-67 staining is restricted to We explored the functional effect of AGR2 expression on tumor intestinal crypts and excludes Paneth cells (ref. 29; Fig. 3H). AGR2 growth because it is highly and universally expressed in staining was observed in a small fraction of Ki-67–positive cells premalignant Barrett’s epithelium and esophageal adenocarci- that often displayed intracellular inclusions characteristic of goblet nomas. In addition, enhanced AGR2 expression has also been cells (Fig. 3H–J). The low number of Ki-67–positive cells that also observed in numerous other common adenocarcinomas, including stain for AGR2 is consistent with the previously published low those derived from the pancreas, breast, and prostate. AGR2 is proportion of proliferating goblet (6%) and enteroendocrine (0.6%) highly conserved and its essential role in X. laevis development cells present in the mouse intestinal crypt (27). The data shows enhanced its candidacy for further exploration because of the AGR2 expression by proliferating and nonproliferating intestinal important role other developmental genes have served in tumor cells of secretory lineage. biology.

Cancer Res 2008;68: (2). January 15, 2008 494 www.aacrjournals.org

Previous work indicated that AGR2 enhances tumor metastasis expression pattern for ATOH1 (33, 34). ATOH1 (also known as based on the metastatic spread of xenografts derived from a MATH1 or HATH1) encodes for a basic helix-loop-helix transcrip- mammary tumor cell line transfected to express AGR2 (7). Another tion factor that is required for the development of intestinal À À study determined that AGR2 serves to attenuate the p53 response secretory cells (34). ATOH1 / mice possess intact intestinal villi to cell stress (3). In these studies, both p53 and AGR2 were populated by absorptive enterocytes, but lack enteroendocrine, À À expressed in a lung cancer cell line that normally does not express goblet, and Paneth cells. Analysis of ATOH1 / embryonic mouse either gene. In the present study, we chose to assess AGR2’s role in intestines revealed that AGR2 expression is absent compared with tumorigenesis using two model systems, SEG-1 cells and NIH3T3 controls (30). Immunohistochemistry, in the present study, cells. SEG-1 cells provided an opportunity to perform studies in a established that AGR2 expression was identical to that previously cell line that expresses high levels of AGR2 protein and shows reported for ATOH1 in the intestine, which is consistent with AGR2 strong similarities in its overall gene expression profile to serving as a downstream target of ATOH1 (33). Similar to AGR2, esophageal adenocarcinoma (8). Reduction of AGR2 expression ATOH1 is expressed in proliferating and differentiated intestinal with RNA interference permitted the assessment of its function in a secretory cells. AGR2 and ATOH1 gene expression, however, are not cell line that naturally expresses the protein. NIH3T3 cells provided similar in esophageal adenocarcinomas. Previous studies compar- a second approach and was used because of the long-standing ing the gene expression of normal esophagus, Barrett’s esophagus, utility the cells have shown in characterizing genes capable of and esophageal adenocarcinoma revealed no differences for inducing cellular transformation (21, 23). ATOH1, but enhanced expression for AGR2 in Barrett’s esophagus Both cell lines were employed in well-established in vitro and and adenocarcinoma (22). In many other tumors studied, including in vivo assays used to identify genes with transforming poten- those derived from the colon, small intestine, and pancreas, ATOH1 tial. We established that AGR2 compromises SEG-1 anchorage- expression is lower in tumors compared with normal tissue (35). independent growth in vitro and the growth of xenograft tumors Development of esophageal adenocarcinoma may therefore require in vivo. Use of the NIH3T3 cells carries the advantage that genes factors that promote AGR2 expression independent of ATOH1, capable of cellular transformation often result in a clear change in which may include components of a signal transduction process phenotype. As shown in this study, NIH3T3 cells expressing AGR2 active between ATOH1 and AGR2, or may be secondary to changes clearly displayed significant changes in density- and anchorage- in AGR2 itself. dependent growth in vitro, and as tumor xenografts in vivo. Thus, Cell culture media supplemented with normal and low serum the results obtained with the SEG-1 and NIH3T3 cells support a levels failed to reveal any changes in cell proliferation rate after significant role for AGR2 in tumor growth. AGR2 knockdown in SEG-1 cells or overexpression in NIH3T3 cells Well-established correlations between anatomic location with (data not shown). Thus, AGR2’s ability to affect tumor growth may levels of proliferation and differentiation in the normal intestine be achieved through means other than those that directly affect provided an opportunity to obtain insights into AGR2 function in cell proliferation. Similar to its role in X. laevis, AGR2 may serve a the adult mouse. Our immunohistochemistry of AGR2 expression similar function in the gastrointestinal tract in determining cell in the mouse intestine is identical to the previously described fate. GFI1 is a basic helix-loop-helix transcription factor whose

Figure 2. Effects of AGR2 expression in NIH3T3 cells. A, focus-formation assay of AGR2-expressing NIH3T3 cells or control cells transfected with the expression vector alone. Top, images of the control cells (left) and a foci of NIH3T3 AGR2 cells (right). Bottom, chart depicting one of three representative experiments. B, anchorage-independent growth as measured by colony growth in soft agar after different initial plating densities of NIH3T3:AGR2 cells or control NIH3T3 cells. Columns, mean from one of two experiments performed in triplicate; bars, 1SD.C, representative example of NIH3T3 control cells (right) and NIH3T3:AGR2 cells (left) grown as xenografts in BALB/c nude mice. Implantation site of the cells (dotted lines). D, chart depicting the growth of NIH3T3 control cells (x) and NIH3T3:AGR2 expressing cells (n) grown as tumor xenografts. Points, mean of five mice; bars, 1SD.

www.aacrjournals.org 495 Cancer Res 2008;68: (2). January 15, 2008

determined that GFI1 expression is not influenced by AGR2, indicating that the growth-promoting properties of AGR2 are not mediated by changes in GFI1 expression. Consistent with these results, changes in GFI1 expression have not been associated with Barrett’s esophagus or esophageal adenocarcinoma (22). AGR2 coexpression with the Ki-67 antigen indicates a potential role in the growth and migration of normal intestinal cells of secretory lineage. Similar to its role in cement gland formation in X. laevis, AGR2 may participate in establishing cell fate and promoting growth in the gastrointestinal tract (Fig. 4B). The expression of AGR2 in potential progenitor cells in the intestinal crypt and in adenocarcinomas support hypotheses linking stem or progenitor cells and cancer (13, 36, 37). The results reported in this study support a role for AGR2 in cellular transformation and esophageal adenocarcinoma growth.

Figure 3. Immunohistochemistry of mouse small intestine. A, small intestinal section in which the goblet cells are labeled with Alcian blue (black arrows) and AGR2 is labeled with horseradish peroxidase stain (brown). Inset, Paneth cells at the bottom of a crypt that stain intensely for AGR2. Arrows, representative cells that stain for Alcian blue. B and C, immunofluorescence of adjacent serial intestinal sections stained for chromogranin A (CHGA) antibodies (B, green) or anti-AGR2 antibodies (C, green). Nuclei in both sections were stained with 4¶,6-diamidino-2-phenylindole (blue). Cells that label for both chromogranin A and AGR2 (white arrows). D to F, triple labeling of an intestinal crypt for MSI1 (E and F, green), AGR2 (D and E, red), and nuclei (D, E, and F, blue). Arrows, cells labeled for AGR2 and MSI1. G to J, a single intestinal crypt labeled for AGR2 (G–J, red), the proliferation marker Ki-67 (H and I, green), and nuclei (I and J, blue). G, phase contrast image of the crypt with overlying AGR2 immunofluorescence. White arrows, cells that label for the nuclear antigen Ki-67 and AGR2, which labels outside the nucleus. Arrowheads, representative Paneth cells at the bottom of the crypt. Figure 4. Relationship of AGR2 expression to other intestinal cell fate determinants. A, real-time PCR of AGR2 and GFI1 mRNA in SEG1:KD1 and expression is also dependent on ATOH1, and is important in cell SEG-1 control cells. AGR2 and GFI1 mRNA levels were normalized to h-actin À À lineage determination among intestinal secretory cells. GFI1 / and represented as the fold-change to SEG-1 control cells. Columns, mean value of samples measured in triplicate (mean Ct values in SEG-1 control mice exhibit increased numbers of enteroendocrine cells, a decline cells for AGR2 = 13.6 and GFI1 = 27). B, schematic of expression patterns in intestinal goblet cells, and the absence of Paneth cells. GFI1 for AGR2 in the context of basic helix-loop-helix transcription factors known to expression influences cell fate but does not influence cell influence intestinal cell fate (derived from refs. 30, 33, 34, 38, 39). Whether GFI1 each secretory lineage is derived from a dedicated progenitor cell remains to proliferation (30). Enhanced expression, however, is associ- be determined. ISC, intestinal stem cell. Gene names used are those approved ated with tumor development (31, 32). Quantitative real-time PCR by the HUGO Gene Nomenclature Committee.

Cancer Res 2008;68: (2). January 15, 2008 496 www.aacrjournals.org

Because enhanced AGR2 expression is universally observed in Acknowledgments premalignant Barrett’s esophagus and in malignant esophageal Received 7/31/2007; revised 9/6/2007; accepted 10/8/2007. adenocarcinomas, AGR2 expression may be an early and essential Grant support: NIH Award DK063624 (A.W. Lowe) and DK56339 (Stanford prerequisite for cancer development. Enhanced AGR2 expression University Digestive Disease Center); and the Susan E. Riley Family Foundation (A.W. Lowe). in many other adenocarcinomas suggests a potentially similar The costs of publication of this article were defrayed in part by the payment of page regulatory function. As a secreted protein, AGR2 is potentially charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. accessible to therapeutic intervention and thus serves as a The authors acknowledge the technical assistance of Cindi Yim and Hong Dai, and promising candidate for future studies. the early input of Brianna Jang.

References 12. Maley CC, Rustgi AK. Barrett’s esophagus and its mouse small intestine. I. Columnar cell. Am J Anat 1974; progression to adenocarcinoma. J Natl Compr Canc 141:461–79. 1. Aberger F, Weidinger G, Grunz H, Richter K. Anterior Netw 2006;4:367–74. 28. Potten CS, Booth C, Tudor GL, et al. Identification of specification of embryonic ectoderm: the role of the 13. Radtke F, Clevers H. Self-renewal and cancer of the a putative intestinal stem cell and early lineage marker; Xenopus cement gland-specific gene XAG-2. Mech Dev gut: two sides of a coin. Science 2005;307:1904–9. musashi-1. Differentiation 2003;71:28–41. 1998;72:115–30. 14. Peifer M, Polakis P. Wnt signaling in oncogenesis and 29. Cheng H. Origin, differentiation and renewal of the 2. Thompson DA, Weigel RJ. hAG-2, the human embryogenesis—a look outside the nucleus. Science four main epithelial cell types in the mouse small homologue of the Xenopus laevis cement gland gene 2000;287:1606–9. intestine. IV. Paneth cells. Am J Anat 1974;141:521–35. XAG-2, is coexpressed with estrogen receptor in breast 15. Xie K, Abbruzzese JL. Developmental biology informs 30. Shroyer NF, Wallis D, Venken KJ, Bellen HJ, Zoghbi cancer cell lines. Biochem Biophys Res Commun 1998; cancer: the emerging role of the hedgehog signaling HY. Gfi1 functions downstream of Math1 to control 251:111–6. pathway in upper gastrointestinal cancers. Cancer Cell intestinal secretory cell subtype allocation and differ- 3. Pohler E, Craig AL, Cotton J, et al. The Barrett’s antigen 2003;4:245–7. entiation. Genes Dev 2005;19:2412–7. anterior gradient-2 silences the p53 transcriptional 16. Soldes OS, Kuick RD, Thompson IA II, et al. 31. Schmidt T, Karsunky H, Gau E, Zevnik B, Elsasser HP, response to DNA damage. Mol Cell Proteomics 2004;3: Differential expression of Hsp27 in normal oesophagus, Moroy T. Zinc finger protein GFI-1 has low oncogenic 534–47. Barrett’s metaplasia and oesophageal adenocarcinomas. potential but cooperates strongly with pim and myc 4. Lowe AW, Olsen M, Hao Y, et al. Gene expression Br J Cancer 1999;79:595–603. genes in T-cell lymphomagenesis. Oncogene 1998;17: patterns in pancreatic tumors, cells and tissues. PLoS 17. Silva JM, Li MZ, Chang K, et al. Second-generation 2661–7. ONE 2007;2:e323. shRNA libraries covering the mouse and human 32. Kazanjian A, Wallis D, Au N, et al. Growth factor 5. Iacobuzio-Donahue CA, Maitra A, Olsen M, et al. genomes. Nat Genet 2005;37:1281–8. independence-1 is expressed in primary human neuro- Exploration of global gene expression patterns in 18. Tomayko MM, Reynolds CP. Determination of endocrine lung carcinomas and mediates the differen- pancreatic adenocarcinoma using cDNA microarrays. subcutaneous tumor size in athymic (nude) mice. tiation of murine pulmonary neuroendocrine cells. Am J Pathol 2003;162:1151–62. Cancer Chemother Pharmacol 1989;24:148–54. Cancer Res 2004;64:6874–82. 6. Fletcher GC, Patel S, Tyson K, et al. hAG-2 and hAG-3, 19. Kaneko Y, Sakakibara S, Imai T, et al. Musashi1: an 33. Shroyer NF, Helmrath MA, Wang VY, Antalffy B, human homologues of genes involved in differentiation, evolutionally conserved marker for CNS progenitor cells Henning SJ, Zoghbi HY. Intestine-specific ablation of are associated with oestrogen receptor-positive breast including neural stem cells. Dev Neurosci 2000;22:139–53. mouse atonal homolog 1 (Math1) reveals a role in cellular tumours and interact with metastasis gene C4.4a and 20. Librach CL, Werb Z, Fitzgerald ML, et al. 92-kD type homeostasis. Gastroenterology 2007;132:2478–88. dystroglycan. Br J Cancer 2003;88:579–85. IV collagenase mediates invasion of human cytotropho- 34. Yang Q, Bermingham NA, Finegold MJ, Zoghbi HY. 7. Liu D, Rudland PS, Sibson DR, Platt-Higgins A, blasts. J Cell Biol 1991;113:437–49. Requirement of Math1 for secretory cell lineage Barraclough R. Human homologue of cement gland 21. Cox AD, Der CJ. Biological assays for cellular commitment in the mouse intestine. Science 2001;294: protein, a novel metastasis inducer associated with transformation. Methods Enzymol 1994;238:277–94. 2155–8. breast carcinomas. Cancer Res 2005;65:3796–805. 22. Kimchi ET, Posner MC, Park JO, et al. Progression of 35. Leow CC, Romero MS, Ross S, Polakis P, Gao WQ. 8. Hao Y, Triadafilopoulos G, Sahbaie P, Young HS, Barrett’s metaplasia to adenocarcinoma is associated Hath1, down-regulated in colon adenocarcinomas, Omary MB, Lowe AW. Gene expression profiling reveals with the suppression of the transcriptional programs of inhibits proliferation and tumorigenesis of colon cancer stromal genes expressed in common between Barrett’s epidermal differentiation. Cancer Res 2005;65:3146–54. cells. Cancer Res 2004;64:6050–7. esophagus and adenocarcinoma. Gastroenterology 2006; 23. Macpherson I, Montagnier L. Agar suspension 36. Clarke MF, Dick JE, Dirks PB, et al. Cancer stem 131:925–33. culture for the selective assay of cells transformed by cells—perspectives on current status and future direc- 9. Kristiansen G, Pilarsky C, Wissmann C, et al. polyoma virus. Virology 1964;23:291–4. tions: AACR Workshop on Cancer Stem Cells. Cancer Expression profiling of microdissected matched pros- 24. Zhang JS, Gong A, Cheville JC, Smith DI, Young CY. Res 2006;66:9339–44. tate cancer samples reveals CD166/MEMD and CD24 as AGR2, an androgen-inducible secretory protein overex- 37. Schier S, Wright NA, Stem cell relationships and the new prognostic markers for patient survival. J Pathol pressed in prostate cancer. Genes Chromosomes Cancer origin of gastrointestinal cancer. Oncology 2005;69 2005;205:359–76. 2005;43:249–59. Suppl 1:9–13. 10. Fritzsche FR, Dahl E, Pahl S, et al. Prognostic 25. Bjerknes M, Cheng H. Intestinal epithelial stem cells 38. Bjerknes M, Cheng H. Neurogenin 3 and the enter- relevance of AGR2 expression in breast cancer. Clin and progenitors. Methods Enzymol 2006;419:337–83. oendocrine cell lineage in the adult mouse small Cancer Res 2006;12:1728–34. 26. Crosnier C, Stamataki D, Lewis J. Organizing cell intestinal epithelium. Dev Biol 2006;300:722–35. 11. Innes HE, Liu D, Barraclough R, et al. Significance of renewal in the intestine: stem cells, signals and 39. Jenny M, Uhl C, Roche C, et al. Neurogenin3 is the metastasis-inducing protein AGR2 for outcome in combinatorial control. Nat Rev Genet 2006;7:349–59. differentially required for endocrine cell fate specifica- hormonally treated breast cancer patients. Br J Cancer 27. Cheng H, Leblond CP. Origin, differentiation and tion in the intestinal and gastric epithelium. EMBO J 2006;94:1057–65. renewal of the four main epithelial cell types in the 2002;21:6338–47.

www.aacrjournals.org 497 Cancer Res 2008;68: (2). January 15, 2008

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation

Zheng Wang, Ying Hao and Anson W. Lowe

Cancer Res 2008;68:492-497.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/2/492

Cited articles This article cites 39 articles, 14 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/2/492.full#ref-list-1

Citing articles This article has been cited by 15 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/68/2/492.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/2/492. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.