
Research Article The Adenocarcinoma-Associated Antigen, AGR2, Promotes Tumor Growth, Cell Migration, and Cellular Transformation Zheng Wang,1 Ying Hao,1 and Anson W. Lowe1,2,3 1Department of Medicine, Stanford University, 2Stanford University Digestive Disease Center, and 3Stanford Cancer Center, Stanford, California Abstract AGR2 expression in Barrett’s esophagus, a premalignant lesion The AGR2 gene encodes a secretory protein that is highly characterized by intestinal metaplasia, is elevated >70-fold AGR2 expressed in adenocarcinomas of the esophagus, pancreas, compared with normal esophageal epithelia. Esophageal breast, and prostate. This study explores the effect of AGR2 expression alone is sufficient to distinguish Barrett’s esophagus expression with well-established in vitro and in vivo assays from normal esophageal epithelia (8). Barrett’s esophagus increases that screen for cellular transformation and tumor growth. the risk of developing esophageal adenocarcinoma by 30-fold (12). AGR2 AGR2 expression in SEG-1esophageal adenocarcinoma cells was chosen for further investigation for several reasons. Its was reduced with RNA interference. Cellular transformation universal expression in all premalignant and malignant esophageal was examined using NIH3T3 cells that express AGR2 after adenocarcinomas suggests that it serves an important role in stable transfection. The cell lines were studied in vitro with disease pathogenesis. Second, multiple highly conserved genes assays for density-dependent and anchorage-independent important in development, such as those belonging to the Wnt and growth, and in vivo as tumor xenografts in nude mice. SEG-1 Hedgehog pathways, have been found to significantly influence AGR2 cells with reduced AGR2 expression showed an 82% decrease tumor development (13–15). Because is established as an Xenopus in anchorage-independent colony growth and a 60% reduction essential gene in development and is expressed in human in tumor xenograft size. In vitro assays of AGR2-expressing tumors, we chose to further explore its potential role in esophageal NIH3T3 cells displayed enhanced foci formation and cancer using well-established assays in tumor biology. anchorage-independent growth. In vivo, AGR2-expressing NIH3T3 cells established tumors in nude mice. Thus, AGR2 Materials and Methods expression promotes tumor growth in esophageal adenocar- cinoma cells and is able to transform NIH3T3 cells. Immuno- Cell lines and antibodies. SEG-1 (16) cells (a generous gift from Dr. David G. Beer, University of Michigan, Ann Arbor, MI) were grown in 5% histochemistry of the normal mouse intestine detected AGR2 CO2 in DMEM supplemented with 4.5 g/L glucose, L-glutamine (Cellgro, expression in proliferating and differentiated intestinal cells Mediatech, Inc.), penicillin (100 units/mL), streptomycin (100 units/mL), of secretory lineage. AGR2 may be important for the growth and 10% (v/v) fetal bovine serum. NIH3T3 cells were grown in the same and development of the intestine as well as esophageal culture conditions. adenocarcinomas. [Cancer Res 2008;68(2):492–7] RNA interference. RNA interference was achieved using microRNA- adapted short hairpin RNA (shRNA) as previously described (17). Three Introduction constructs were employed that included the following AGR2 sequences Xenopus laevis (underlined) with intervening sequences representing short hairpins: KD1, AGR2 is a secreted protein initially described in , CTGATTAGGTTATGGTTTAATAGTGAAGCCACAGATGTATTAAACCA- from which it was identified in a screen for differentially expressed TAACCTAATCAG; KD2, CCCACACAGTCAAGCTTTAATAGTGAAGCCACA- genes in neural development. AGR2 serves an essential role in GATGTATTAAAGCTTGACTGTGTGGG; and KD3, CAACAAACCCTTGATG- Xenopus development by inducing the formation of the forebrain ATTATAGTGAAGCCACAGATGTATAATCATCAAGGGTTTGTTG. Each con- and the mucus-secreting cement gland (1). In humans, AGR2 was struct was subcloned into the MSCV-LTRmiR30-PIG retroviral vector, which first identified in studies focused on differentially expressed genes was used to transduce SEG-1 cells according to the manufacturer’s protocol in estrogen receptor–positive breast cancers (2). Subsequent (OpenBiosystems, Inc.). SEG-1 control cells were transduced with only the studies showed elevated AGR2 expression in adenocarcinomas of viral vector without the shRNA. Successful incorporation of the retroviral vector was confirmed with the expression of green fluorescent protein that the esophagus, pancreas, and prostate (2–8). The clinical effect of cis AGR2 was contained within the vector in . Transduced cells were selected with expression in tumors is unclear as the implications for 2 Ag/mL of puromycin (MP Biomedicals, Inc.) for a period of 2 weeks. The prognosis are mixed in breast and prostate cancer (7, 9, 10). resultant cells for each construct were assessed for AGR2 expression with AGR2 Evidence that may influence tumor biology stems from protein immunoblotting and quantified with conjugated second antibodies studies in which overexpression in a rat nonmetastatic breast that emit in the IR spectrum (Odyssey Infrared Imaging Systems; LiCor tumor cell line were associated with increased metastasis when Biosciences). propagated as xenografts in nude mice (11). NIH3T3 cell transfection. NIH3T3 cells were cotransfected with the plasmids pCMV-SPORT6.0 containing the full-length AGR2 sequence (Openbiosystems, Inc.) and pcDNA3.1-GFP that carries a neo selective marker. The transfection was performed using Fugene 6.0 (Roche Diagnostics) followed by drug selection with G418 at 0.8 mg/mL. Requests for reprints: Anson W. Lowe, Division of Gastroenterology and Xenograft tumor model. Ten-week-old male BALB/c nude mice were Hepatology, Stanford University, Alway Building, Room M211, 300 Pasteur Drive, obtained from Taconic Farms, Inc.; 1  106 cells were injected s.c. The Stanford, CA 94305-5187. Phone: 650-725-6764; Fax: 650-723-5488; E-mail: resultant tumors were measured with calipers (Westward, Grainger [email protected]. I2008 American Association for Cancer Research. International, Inc.) and the volume was calculated using the formula doi:10.1158/0008-5472.CAN-07-2930 (length  width2 / 2) as previously described (18). Animals were sacrificed Cancer Res 2008;68: (2). January 15, 2008 492 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2008 American Association for Cancer Research. AGR2 Promotes Tumor Growth when the maximal allowable tumor size was achieved or after observation In vitro and in vivo assays often used to characterize malignantly for 21 days. transformed cells were employed to assess the effects of reducing Microscopy. Immunohistochemistry was performed using Dako Cyto- AGR2 expression in SEG-1 cells. Anchorage-independent growth in mation Envision Plus following the manufacturer’s instructions. Tissue soft agar is an in vitro characteristic displayed by many trans- sections were obtained from formaldehyde-fixed paraffin-embedded mouse formed cells, including wild-type SEG-1 cells (21, 23). SEG-1:KD1 intestine. Rabbit anti-AGR2 antibodies (Imgenex Corp.) were incubated AGR2 overnight at room temperature at a dilution of 1:100 in PBS. Rabbit anti- cells with reduced expression formed 82% fewer colonies in B in vivo chromogranin A antibodies (ImmunoStar, Inc.) were incubated overnight at soft agar than SEG-1 control cells (Fig. 1 ). The assay room temperature at a dilution of 1:200 in PBS and 0.3% (v/v) Triton X-100. consisted of the same cells implanted s.c. in BALB/c nude mice and Rat anti-mouse anti-Ki67 (Dako Cytomation, Inc.) was incubated for 1 h at grown as tumor xenografts. Twenty-one days after implantation, room temperature at a dilution of 1:25 in PBS. Rat anti-mouse musashi-1 tumors formed by AGR2-deficient cells were on average 60% monoclonal antibodies were a kind gift of Dr. H. Okano (Keio University, smaller than tumors established from SEG-1 control cells (Fig. 1C). Tokyo, Japan) and were incubated at a dilution of 1:500 for 16h at 4 jC (19). Thus, reduction in AGR2 expression compromised SEG-1 growth in Fluorescent images were visualized with a Nikon Eclipse E600 microscope two assays of malignant transformation. ¶ equipped with fluorescence filters for Texas red, FITC, and 4 ,6-diamidino-2- AGR2 possesses a signal peptide and is secreted from cells phenylindole. A monochrome image was acquired with a Spot RT Slider (1, 24). We explored whether secreted AGR2 could affect cells in an digital camera (Diagnostic Instruments, Inc.) for each color channel and in vitro merged with Adobe Photoshop 7.0 (Adobe Systems, Inc.). migration assay in which cells are induced to move across a Migration assay. The cell migration assay used to assess metastatic filter support in response to components added to the bathing potential was performed using Matrigel-coated transwells according to the culture media. Conditioned media derived from SEG-1 cells that manufacturer’s protocols (BD BioCoat growth factor reduced Matrigel express high levels of AGR2 enhanced SEG-1:KD1 cell migration at invasion chamber, BD Biosciences; ref. 20); 1  105 cells were plated in each 2.7-fold higher rates than conditioned media from AGR2-deficient well. The inside chamber within the transwell was incubated with 500 ALof SEG-1:KD1 cells (Fig. 1D). The results support a model in which unconditioned cell culture media containing DMEM supplemented with SEG-1 cells are able to respond to secreted AGR2, which results in 4.5 g/L of glucose, L-glutamine
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-