Induction of Growth Factor RNA Expression in Human Malignant Melanoma: Markers of Transformation1

[CANCER RESEARCH 51, 4815-4820, September 15, 1991] Induction of Growth Factor RNA Expression in Human Malignant Melanoma: Markers of Transformation1

Anthony P. Albino,2 Brigid M. Davis, and David M. Nanus

Laboratory of Mammalian Cell Transformation [A. P. A., B. M. D., D. M, N.], Memorial Sloan Kettering Cancer Center, and Division of Solid Tumor Oncology ¡D.M. N.], Department of Medicine, Memorial Sloan Kettering Cancer Center and Cornell University Medical College, New York, New York 10021

ABSTRACT the present study a series of cell lines established from human metastatic melanomas and normal human foreskin melanocytes Alteration in the expression of growth factors is widely accepted as was analyzed for the production of RNA transcripts specific to being one of several critical defects in the generation of the malignant cell. In the present study, 19 human metastatic melanoma cell lines were a spectrum of growth factors. The results of this analysis compared to 14 normal human foreskin melanocyte cell lines for the indicated clear distinctions among the transcription patterns of production of RNA transcripts specific for 11 different growth factors. growth factors in normal melanocytes and metastatic mela Using the extremely sensitive technique of polymerase chain reaction to noma cells. amplify growth factor-specific complementary DNAs, we analyzed the following: transforming growth factor (TGF) types a, fi,, ti¡.and/i.,,acidic (a) fibroblast growth factor (FGF), basic (b) FGF, FGF-5, keratinocyte MATERIALS AND METHODS growth factor (KGF), HST, and platelet-derived growth factor (PDGF) Cell Lines and Tumor Specimens. Cell lines established from human types A and B. There were clear distinctions among the patterns of malignant melanomas (SK-MEL), human foreskin melanocytes, and growth factor RNA expression by normal melanocytes and malignant human foreskin fibroblasts were derived and cultured as previously melanoma cells. The prototypic melanocyte pattern of expression in described (12). Purity of melanocyte cultures was determined by the cluded TGF0!, TGF/Sj, and KGF. A subset of melanocyte cell lines also expression of melanocytic specific cell surface antigens, cytoplasmic expressed PDGFA transcripts. In contrast, melanoma cells characteris melanosomal proteins, and the presence of melanin (13). Melanoma tically expressed RNA transcripts of TGF0,, TGF&, TGF&, TGFa, and fibroblast cultures were maintained in Eagle's minimum essential bFGF, KGF, and PDGFA. Subsets of melanoma cell lines also expressed medium supplemented with 2 HIMglutamine, 1% nonessential amino aFGF, FGF-5, and PDGFB. The results presented indicated that TGF/32, acids, 100 units/ml streptomycin, 100 units/ml penicillin, and 7.5% TGF«,and bFGF may be particularly important in melanomagenesis and fetal bovine serum. Melanocytes were maintained in an identical me that these, as well as FGF-5, aFGF, and PDGFB, can be used as markers dium supplemented with TPA3 (10 ng/ml) and cholera toxin (10~8 M) of transformation in this tumor type. (Sigma Chemical Co., St. Louis, MO) (14). RNA was extracted from melanoma cells in culture from 8-40 passages and from melanocyte INTRODUCTION and foreskin fibroblast cell lines in culture from 2-10 passages. RNA extracted from a testicular germ cell tumor cell line, NTERA2 (15), Neoplastic transformation of human cells is consistently was used as a positive control for HST transcription. associated with quantitative or qualitative alterations in the Preparation of RNA. Total RNA was extracted from logarithmically expression of growth factors (1). These factors are thought to growing cells by the thiocyanate/guanidinium method as described confer a growth advantage upon the malignant cell by acting, previously (16). Extracted RNA was analyzed for integrity by agarose in part, as autocrine and paracrine mediators of cellular prolif gel electrophoresis. eration. Dissecting the types of biologically important growth Preparation of cDNA. cDNA was generated from total RNA essen tially as described in Ref. 17. Briefly, 1 pg of total RNA was incubated factors produced by malignant and normal progenitor cells of at 68°Cfor 5 min, chilled on ice, and reverse transcribed in a final a particular tumor type is the first step in elucidating whether volume of 20 ^1containing: 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 10 particular growth factors have any role in the diverse array of mM dithiothreitol, 3 mM MgCl2, 50 MM each of dATP, dCTP, phenotypic alterations observed in neoplastic cells. Malignant dGTP, and dTTP (Pharmacia, Piscataway, NJ), 500 ng random hex- melanoma provides a valuable model for study of stage-specific amer primers (Pharmacia), 12 units RNA Guard (Pharmacia), and 200 events that accompany the progression of the melanocyte units MoMuLV reverse transcriptase (BRL Co., Gaithersburg, MD). through the transformation process (2). To date, numerous The mixture was incubated at 37°Cfor 1 h, heated to 95°Cfor 10 min, studies have defined transformation-related alterations in (a) and stored at -20°C. antigen expression (3,4), (b) cell surface growth factor receptor PCR. Amplification was performed as described previously (9, 18). Briefly, cDNA was heated to 95°Cfor 10 min and cooled on ice for 5 expression (5), (c) production of growth factors (6, 7), (d) min, and then 1 n\ was added to a 25-^1 reaction mixture containing differentiation programs (8), (e) activation of oncogenes (9), and (/) normal chromosomal structure (10). Despite the fact 2.5 ul lOx PCR reaction buffer [0.5 M KC1, 0.1 M Tris (pH 8.0), 15 mM MgCl2, 0.1% gelatin (Fisher Scientific, Fair Lawn, NJ), 9.6 ^M that specific roles for each of these alterations in the develop each dATP, dCTP, dGTP, and dTTP (Pharmacia Inc.), 75 ng of each ment or maintenance of melanoma cells has yet to be elucidated, priming oligomer, and 1.0 unit Taq polymerase (Perkin-Elmer Cetus, they have been useful as markers of progression, differentiation, Norwalk, CT)] and H2O. Reaction mixtures were prepared for multiple and transformation of the melanocyte (11). In order to more samples and aliquoted. A negative control consisting of a 25 /

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. GROWTH FACTOR PRODUCTION IN MELANOMA CELLS for annealing, and 1.5 min at 73°Cfor primer extension. Optimal tection of individual members of the TGF/3 family after PCR annealing temperature was defined for each primer pair. Electropho- amplification with specific primers. resis of 10 ¿ilreaction mixture on a 1.4% agarose (IBI, New Haven, Growth Factor Production in Melanocytes and Melanoma CT) gel containing ethidium bromide was performed to evaluate am Cells. Table 2 summarizes the expression of RNA transcripts plification and size of fragments generated. of a panel of growth factors by 19 metastatic melanoma cell PCR Oligonucleotide Primers. Oligonucleotide primers were synthe sized using a DNA synthesizer 380A (Applied Biosystems, Foster City, lines and 14 melanocyte cell lines. All cell lines expressed RNA transcripts for 0-actin, indicating the integrity of the cDNAs CA). Gene sequences used to construct Oligonucleotide primers were from published sources. All primer pairs used were designed to bracket and their ability to serve as templates for amplification. Vir cDNA sequences that in genomic DNA cross an intron-exon boundary. tually all melanoma cell lines expressed RNA transcripts for Table 1 details the specific Oligonucleotide regions used. Primer se TGF/3, (18 of 19), TGF(32 (18 of 19), TGFft, (19 of 19), TGFa quences were as follows: 0-actin, 5'-GTGGGGCGCCCCAGGCACCA, (18 of 19), bFGF (19 of 19), KGF (18 of 19), and PDGFA (15 3'-CTCCTTAATGTCACGCACGATTTC (19); TGF/3,, 5'-AAGTG- of 19). In addition, a subset of cultured melanomas expressed GATCCACGAGCCCAA, 3'-GCTGCACTTGCAGGAGCGCAC aFGF (3 of 19), FGF-5 (5 of 19), and PDGFB (2 of 19). No (20); TGF02, 5'-AAATGGATACACGAACCCAA, 3'-GCTGCATTT- GCAAGACTTTAC (21); TGFft, 5'-AAGTGGGTCCATGAACC- melanoma culture (0 of 19) expressed HST-specific RNA TAA, 3'-GCTACATTTACAAGACTTCAC (22); TGF«,5'-CGCCC- transcripts. TGTTCGCTCTGGGTAT, 3 ' -AGGAGGTCCGCATGCTCACAG In contrast to melanoma cell lines, cultured melanocytes had (23); aFGF, 5'-CTTCACAGCCCTGACCGAGAA, 3'-TGGCCAT- a different pattern of expression for these growth factor RNA AGTGAGTCCGAGGA (24); bFGF, 5'-GTGTGTGCTAACCGTT- transcripts. The typical melanocyte pattern appeared to be ACCT, 3'-GCTCTTAGCAGACATTGGAAG (25); FGF-5, 5'-AGT- expression of only TGF/3, (14 of 14), TGF/33 (14 of 14), and GGCTTGGAGCAGAGCAG, 3'-TGGCTGCTCCGACTGCTTGA KGF (11 of 13). Cultured melanocytes had no detectable expres (26); KGF, 5'-ATCAGGACAGTGGCAGTTGGA, 3'-CATAGGAA- sion of TGFj32 (0 of 14), aFGF (0 of 13), bFGF (0 of 14), FGF- GAAAGTGGGCTGA (27); HST, 5'-ATCGGCTTCCACCTCCA- 5 (0 of 13), PDGFB (0 of 13), or HST (0 of 13). A subset of GGC, 3'-GTACTTGTAGGACTCGTAGGC (28); PDGFA, 5'-CC- melanocyte cell lines did, however, express PDGFA transcripts CCTGCCCATTCGGAGGAAGAGA, 3'-TTGGCCACCTTGACGC- TGCGGTG (23, 29); PDGFB, 5'-TGCTGAGTGACCACTCGATC, (5 of 14). In addition, because of the extreme sensitivity of the 3'-TCCAAGGGTCTCCTTCAGTG (30). PCR reactions performed, TGFa: transcripts were detectable in 3 of 13 cultured melanocyte cell lines. In dilution experiments, Restriction Endonuclease Digestion of PCR Products. Amplified frag ments were purified with Centricon-100 microconcentrators (Amicon, in which equal amounts of melanoma and melanocyte cDNAs Danvers, MA), lyophilized in a Speedvac concentrator (Savant Instru ments Inc., Hicksville, NY), and redissolved in water. Restriction Table 1 Growth factor-specific Oligonucleotide primers for PCR endonuclease digestion with the appropriate enzyme (5 units/^ig) was The nucleotide location within the sequence of the designated gene used for the amplification of cDNA and the expected size of each amplified fragment. performed at 37°Cfor 4 h. Digested fragments were fractionated on a Sequences are from published sources (see "Materials and Methods'"). 3% NuSieve/1% SeaKem agarose (FMC Bioproducts, Rockland, ME) Location of Oligonucleotide in nucleotide gel. sequence of cDNA size RESULTS RNAtranscript0-ActinTGF0,TGF02TGF/3,TGFaaFGFbFGFFGF-5KGFHSTPDGFAPDGFB5'-Oligonucleotide103-122928-9471(1X1(basepairs)541247247247241403238460277250228627 Analysis of PCR Products. Total RN A was extracted from 19 cultured human metastatic melanoma cell lines and 14 normal 11(1(11244-126358-7824-44229-248214-233298-318516-535622-64594-1133'-Oligonucleotide642-6191173-11531326-13061489-1469297-277425-405465-445672-653573-553764-744848-826719-700Fragment human melanocyte cell lines. RNA was also extracted from seven short-term cultures of normal human foreskin fibroblasts, which served as an independent control for these experiments. The RNAs were reverse transcribed into cDNA and then am plified using gene-specific primer pairs and polymerase chain reaction methodology. The location within each gene sequence of all oligonucleotides used for PCR and the expected size of each amplified DNA fragment are shown in Table 1. Three different methods were used to confirm the identity of the DNA Growth Factor Specific PCR Products product generated by sequence-specific primers: (a) PCR-am- plified DNA was analyzed by electrophoresis in agarose and compared to fragment size predicted by the location of the primers used (see Table 1 and Fig. 1); (¿>)PCR-amplified DNA was first digested with restriction endonucleases and then frac tionated by electrophoresis in agarose; the resultant fragments were compared to predicted sizes based on location of internal cleavage sites (method used for aFGF, FGF-5, HST, KGF, and 107X PDGFB) (data not shown); (c) PCR-amplified DNA was se- 603 quenced and the results compared to the known DNA sequence 310 of the growth factor gene (method used for /3-actin, TGF«, 194 HST, and PDGFA) (data not shown). Fig. 2 illustrates restric tion endonuclease analysis of the 247-base pair amplified PCR products generated from TGF0,, TGF&, and TGF/3, cDNA. Fig. 1. Predicted fragment sizes. PCR products of predicted size (see Table 1) Despite the high sequence homology of these genes, differences were generated using sequence-specific primer pairs for each growth factor shown. in restriction endonuclease sites allowed the unambiguous de Size markers (ordinate) are from OX174 DNA digested with //<«•!11endonuclease. 4816

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. GROWTH FACTOR PRODUCTION IN MELANOMA CELLS || TGFßl || TGFB2 || TGFB3 || noma cultures, SK-MEL-93 DX-6 and SK-MEL-28, were grown in medium supplemented with TPA and cholera toxin for 2 weeks, at which time total RNA was extracted and used 1 2345678 9 for PCR amplification with primers specific for a selected set of growth factors: TGFa, TGF/3,, TGF&, TGF&, bFGF, KGF, 61)3 PDGFA, and PDGFB. The results showed no alterations in the expression pattern of any of these growth factors when these melanomas were cultured in medium containing TPA and 310 cholera toxin (data not shown). Thus, the action of TPA and 234 cholera toxin on melanocytes does not include the suppression 194 118 of any of the growth factors examined. Growth Factor Production in Foreskin Fibroblasts. The expression of RNA transcripts of these same growth factors was examined in 7 human foreskin fibroblast cell lines. The Fig. 2. Restriction endonuclease digestion. The 247-base pair PCR products pattern of expression was different from that observed in either were generated from sequence-specific primer pairs for TGF/J|, TGFft, and melanoma cell lines or melanocytes. With the exception of TGF0J. Size markers (ordinate) are from 0X174 DNA digested with Hae\\\ PDGFB (0 of 7) and HST (0 of 7), all cultures expressed each endonuclease. Uncut PCR products are shown in lanes l (TGFß,),4 (TGFft), and 7 (TGF/33). All three PCR products were digested with Rsal (lanes 2, 5, and of the growth factors analyzed: TGF/3, (7 of 7), TGFfo (7 of 7), «);Smal (lanes 3, 6, and 9). Rsal digests all three TGF0 PCR products but TGFft (7 of 7), TGFa (6 of 7), aFGF (7 of 7), bFGF (7 of 7), results in different size restriction fragments (lanes 2, 5, and X). Smal digests FGF-5 (7 of 7), KGF (6 of 7), and PDGFA (7 of 7). The failure only TCP/Si PCR product, resulting in 125- and 119-base pair doublet (lane 3). There are no Smal recognition sites in the TGFft and TGFfo PCR products as to detect HST transcripts in melanoma cells, melanocytes, or shown by the inability of this enzyme to reduce the size of the product (lanes 6 fibroblasts was due to the lack of transcription of this gene in and 9). these cells, and not to technical considerations, since HST- specific primers could detect HST transcripts in the germ cell were titrated before PCR amplification, the results suggested tumor cell line, NTERA2 (data not shown). that there was at least 10-fold more TGFa transcripts in mel anoma cell lines than in TGFa-positive melanocyte cultures DISCUSSION (data not shown). Since melanocyte cell lines were grown in the presence of In the present study, we compared the production by cultured TPA and cholera toxin, we examined melanoma cultures for human malignant melanomas and normal melanocytes of RNA induction or suppression of growth factor-specific RNAs by transcripts for 11 different growth factors: TGFa, TGF/3,, medium containing identical concentrations of TPA and chol TGF/32, TGF03, aFGF, bFGF, FGF-5, KGF, HST, PDGFA, era toxin as used for melanocyte growth. Representative mela and PDGFB. Clear distinctions in the patterns of growth factor

Table 2 Expression of growth factor-specific RNA transcripts Detection of transcripts after PCR amplification of the designated gene in individual melanoma and melanocyte cell lines; +, expression; —,noexpression. FGF-5SK-MEL-13Cell line Cell type 0-Actin TGF0, TGFft TGF& TGFa aFGF bFGF PDGFB-KGF PDGFA -SK-MEL-28 Melanoma + + + + + - + ++— -SK-MEL-30 Melanoma + + + + + - + —— + + +SK-MEL-63 Melanoma + + + +-- + +— + + -SK-MEL-81 Melanoma + + + + + - + —— + + -SK-MEL-93 Melanoma + + + + + - + —— + — -SK-MEL-93 DX2 Melanoma + + + + + - + —— + — -SK-MEL-93 DX3 Melanoma + + + + + - + +— — + -SK-MEL-93 DX4 Melanoma + + -+ + + + —— + — -SK-MEL-110DX6 Melanoma + + + + + + + —— + — +SK-MEL-127 Melanoma + + + + + - + —— + + -SK-MEL-136 Melanoma + + + + + + + —— + + -SK-MEL-140 Melanoma + + + + + - + —— + + -SK-MEL-146 Melanoma + + + + + - + —— + + -SK-MEL-147 Melanoma + + + + + - + —— + + +SK-MEL-186 Melanoma + + + + + - + —- + + +SK-MEL-203 Melanoma + + + + + - + —— + + +SK-MEL-204 Melanoma + + + + + - + —— + + -MEWO Melanoma + + + + + - + —— + + -FSM4 Melanoma + - + + + - + —- -1- + -+----FSM8W Melanocyte + + -— + + -+----FSM10 Melanocyte + + —_ + — -+----FSM11 Melanocyte + + _— __ -+----FSM120 Melanocyte + + —— — + -+----FSM138 Melanocyte + + —— + — -+----FSM151 Melanocyte + + —— + — ----FSM152 Melanocyte + + - + —— + — -+----FSM153 Melanocyte + + —— + + -+----FSM196 Melanocyte + + —— + — -+-"---FS215 Melanocyte + + —— + + +_»___FS220 Melanocyte + + - —— + + -+----FS225 Melanocyte + + —— + — +_"___FS238 Melanocyte -1- + - —ND + — ND" Melanocyte + + - + ND4 - ND - ND cycles.*Acknowledges detection of transcript after 50 amplification ND, not determined.HST

4817

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. GROWTH FACTOR PRODUCTION IN MELANOMA CELLS expression in these cell types were evident. Virtually all foreskin a marker of melanocyte transformation. While a specific role melanocyte cultures expressed TGF/3i, TGFffj, and KGF RNA for TGFa in melanomagenesis remains obscure, TGFa is spec transcripts, and 35% expressed PDGFA RNA transcripts. A ulated to be an autocrine growth factor (32, 38), because it strikingly different pattern of expression was detectable in stimulates the growth of melanomas (40, 41) and melanocytes melanoma cells. All melanoma lines expressed RNA transcripts (40) in vitro. Moreover, the induction of TGFa by UVR may for TGF/3,, TGF/32, TGFft, TGFa, bFGF, and KGF, while be linked to the promotion of preneoplastic or neoplastic cells most also produced transcripts for PDGFA. A subset expressed (40), and the presence of a restriction fragment length poly aFGF-, FGF-5-, and PDGFB-specific RNAs. HST transcripts morphism in the TGFa gene of melanoma patients may be a were not detected in any melanocyte or melanoma cell line. risk factor (42). Foreskin fibroblast cultures expressed TGFßj,TGF02, TGFßj, Fibroblast Growth Factors. The FGF family is a diverse group TGFa, aFGF, bFGF, KGF, FGF-5, and PDGFA but not of polypeptide growth factors characterized by structural and PDGFB or HST. sequence homology, heparin-binding characteristics, and the Transforming Growth Factors. The TGF/3 polypeptide family, ability to promote angiogenesis and provide mitogenic stimuli which consists of at least 3 distinct members (TGF/3i, TGF/32 for a wide range of mesoderm- and ectoderm-derived cell types and TGFft) (20-22), can both inhibit and stimulate cell prolif (43). The FGF family includes bFGF, aFGF, FGF-5, HST/K- eration and can influence differentiation (31). TGF01 is ubiq FGF, FGF-6, Int-2, and KGF (43). bFGF, a cell-associated uitously expressed in human tissues, while expression of TGFj32 polypeptide, is found in a wide range of cell types and tissues and TGF/3, varies with cell type (20, 32). We showed that (44). It can mediate neoplastic growth and the development of cultured normal melanocytes and malignant melanomas ex metastasis by acting as an autocrine mediator of cell prolifera press TGFßiand TGFfti but that only melanoma cells synthe tion or as a transforming oncogene (44). The induction of bFGF size TGFj32 RNA transcripts. Since both normal and malignant transcription in all melanoma cell lines examined suggests that melanocytes express TGF/3, and TGF/33, it is possible that these it plays a fundamental role in the development of the malignant genes are involved more in the normal growth and differentia phenotype. This interpretation is strengthened by the observa tion of melanocytes than in melanoma development. In con tions that normal melanocytes require exogenous bFGF to trast, the transcription of TGF/32 in all melanoma cell lines proliferate in culture (45) and that the growth of melanoma studied indicates that this gene is regulated independently of cells in culture can be inhibited by suppressing endogenous TGF/Ji and TGF/3j and may serve a critical role during the bFGF synthesis with antisense oligonucleotides (46). Although development of the melanoma cell. TGF/32 does have immu- the spontaneous production of bFGF by transformed melano nosuppressive effects (33), and it is speculated that induction cytes may allow unrestrained proliferation, it is unlikely to be of immunosuppression in hosts by TGF/32-producing glioblas- an initiating event, since transfection of bFGF cDNA into tomas contributes to their growth by enabling these tumors to murine melanocytes abrogates proliferation dependence on ex escape immune surveillance (34). TGF/3], which shares a wide ogenous bFGF but does not induce tumorigenicity (47). range of biological effects with TGF/32 (35), has been shown to KGF is a potent mitogen for keratinocytes but not fibroblasts affect the regulation of expression of class II histocompatibility (27, 48); unlike bFGF, it is efficiently secreted. KGF may be antigens in melanomas, and it is speculated that this regulation necessary for renewal of cell populations that line the skin (27). has an adverse effect on host immune response (36). Thus, by We show here that KGF transcripts were found in dermal comparison with TGFßi,TGF/32 may similarly impact on the fibroblasts, epidermal melanocytes, and malignant melanoma growth and maintenance of melanoma cells. While it remains cells. Whether the expression of KGF by melanocytes has any to be determined whether three TGF0 mRNAs are actually role in epithelial cell proliferation in the epidermis remains translated into functional protein, the qualitative alteration in unknown. However, since both normal and malignant melano TGF02 transcription upon malignant transformation of the cytes express KGF, it may be more related to the normal growth melanocyte may allow its use as a new marker of transformation and differentiation of melanocytes and may not have any fun in this tumor type. Whether the induction of TGF/32 expression damental role in the development of melanoma. is associated with initial transforming events or with secondary Overexpression of normal FGF-5 and HST, which were events (e.g., those that affect growth, maintenance, or suppres originally isolated from human neoplasias as oncogenes capable sion of host immunity) is presently being analyzed. of transforming rodent cells (26, 49), can cause transformation TGF«is a 50-amino acid polypeptide that shares high struc of mammalian cells (28, 50). FGF-5 transcripts were not de tural homology in the receptor-binding domain with epidermal tected in any melanocyte culture, whereas approximately 25% growth factor and can bind and activate the epidermal growth of cultured melanomas did express FGF-5 transcripts. Whether factor receptor (37), thus stimulating proliferation by an auto- FGF-5 has a significant biological role in a subset of melanomas crine-mediated pathway. TGFa is expressed by a range of remains an open question, but the expression of FGF-5 only by malignant human tissues (32, 38) and by some normal adult malignant melanoma cells indicates that the transcription of tissues (39). Our results showed that the majority of melanocyte this gene may be a useful marker of transformation. Transcrip cell lines lacked expression of TGFa RNA. This confirms the tion of the HST gene, which may contribute to the development findings of a recent study that showed that TGF« protein is of breast cancer (51 ), appeared to be more tightly regulated in only detectable in foreskin melanocytes after treatment with cells of melanocytic lineage, since no melanocyte or melanoma UVR (40). However, because of the extreme sensitivity of the culture expressed HST RNA transcripts. Thus, HST is unlikely PCR method, low level transcription of TGFa was detected in to play a role in the biology of melanoma. a few melanocyte cultures, suggesting that induction by UVR Similar to bFGF, aFGF can act as an autocrine mediator of is quantitative as well. In contrast, virtually all cultures of cell proliferation and transform cells when overexpressed (52). metastatic melanomas produced large amounts of TGFa tran A subset (15%) of melanoma cultures synthesized aFGF tran scripts (at least 10-fold more transcripts than TGFa-positive scripts. While the biological impact of aFGF is as yet unknown, melanocytes). Thus, the expression of TGFa may be useful as one conjecture is that aFGF is more relevant to late stages in 4818

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. GROWTH FACTOR PRODUCTION IN MELANOMA CELLS tumor progression. This speculation is based on the fact that REFERENCES there were qualitative differences in aFGF expression among 1. Goustin, A. S., Leof, E. B., Shipley, G. D., and Moses, H. L. Growth factors four cell lines established from separate metastatic deposits of and cancer. Cancer Res., 46: 1015-1029, 1986. an individual patient. Two of these lines (SK-MEL-93 DX-4 2. Clark, W. H., Jr., Elder, D. E., Guerry, D., 4th, Epstein, M. N., Greene, M. and SK-MEL-93 DX-6) expressed aFGF RNA, while two (SK- H., and van Horn, M. A study of tumor progression: the precursor lesions of superficial spreading and nodular melanoma. Hum. Pathol., 15: 1147 MEL-93 DX-2 and SK-MEL-93 DX-3) did not. The SK-MEL- 1165, 1984. 93 DX-2 and SK-MEL-93 DX-3 cell lines were established 3. Houghton, A. N., Davis, L. J., Dracopoli, N. C., and Albino, A. P. Antigens expressed by melanoma and melanocytes: studies of the immunology, biology from métastasesbiopsied 2 years before those used to establish and genetics of melanoma. In: M. I. Green and T. Hamaoka (eds.), Devel SK-MEL-93 DX-4 and SK-MEL-93 DX-6, which appeared opment and Recognition of the Transformed Cell. pp. 373-383. New York: late in the progression of this patient's disease (53). Plenum Publishers, 1987. 4. Elder, D. E., Rodeck, U., Thurin, J., et al. Antigenic profile of tumor Platelet-derived Growth Factors. PDGF, a potent mitogen progression stages in human melanocytic nevi and melanomas. Cancer Res., and chemoattractant for fibroblasts (54), is found as homodi- 49:5091-5096, 1989. 5. Real, F. X., Rettig, W. J., Chesa, P. G., Melamed, M. R., Old, L. J., and mers of the A or B chains and as a heterodimeric AB structure Mendelsohn, J. Expression of epidermal growth factor receptor in human (55). It has been shown that PDGF-related factors are produced cultured cells and tissues: relationship to cell lineage and stage of differentia tion. Cancer Res., 46: 4726-4731, 1986. by a subset of cultured melanomas but not by melanocytes (56), 6. Herlyn, M., Kath, R., Williams, N., Valyi Nagy, I., and Rodeck, U. Growth- suggesting that PDGF production may be involved in mela regulatory factors for normal, premalignant, and malignant human cells in noma development. However, because our results show that vitro. Adv. Cancer Res., 54: 213-234, 1990. approximately 50% of melanocyte cell lines as well as 80% of 7. Bordoni,melanoma R., growth Thomas, stimulatory G., and activityRichmond, uiRN'A A. Growth expression factor in modulationhuman malig of melanoma cultures express PDGFA transcripts, PDGFA nant melanoma cells correlates with cell growth. J. Cell Biochem., 39: 421- expression is not an unequivocal marker of transformation in 428, 1989. 8. Houghton, A. N., Real, F. X., Davis, L. J., Cordon Cardo, C., and Old, L. melanoma. On the contrary, PDGFA may be more related to J. Phenotypic heterogeneity of melanoma. Relation to the differentiation normal growth and differentiation than to transformation. The program of melanoma cells. J. Exp. Med., 165: 812-829, 1987. B chain of PDGF, which is structurally homologous to the c- 9. Albino, A. P., Nanus, D. M., Menile, I. R., et al. Analysis of ras oncogenes in malignant melanoma and precursor lesions: correlation of point mutations sis protooncogene, has demonstrable transforming activity with differentiation phenotype. Oncogene, 4: 1363-1374, 1989. when permuted to the v-sis oncogene (57). Analyses of c-sis 10. Balaban, G., Herlyn, M., Guerry, D. 4th, et al. Cytogenetics of human malignant melanoma and premalignant lesions. Cancer Genet. Cytogenet., expression at the RNA level have shown conflicting results. H: 429-439, 1984. One study, using Northern analysis, could not detect PDGFB 11. Albino, A. P., Houghton, A. N., Eisinger, M., et al. Class II histocompatibility antigen expression in human melanocytes transformed by Harvey murine transcripts in metastatic melanoma cells (56), but a more recent sarcoma virus (Ha-MSV) and Kirsten MSV retroviruses. J. Exp. Med., 164: study, relying on RNase protection assays, showed that 60% of 1710-1722, 1986. melanoma cell lines express PDGFB RNA transcripts (58). 12. Albino, A. P., Le Strange, R., Oliff, A. I., Furth, M. E., and Old, L. J. Transforming rus genes from human melanoma: a manifestation of tumour Using PCR methodology, we detected PDGFB transcripts in heterogeneity? Nature (Lond.), 308:69-72, 1984. only 10% of cultured metastatic melanomas (2 of 19). Since in 13. Thomson, T. M., Real, F. X., Murakami, S., Cordon Cardo, C., Old, L. J., and Houghton, A. N. Differentiation antigens of melanocytes and melanoma: our findings the frequency of expression is low, and since only analysis of melanosome and cell surface markers of human pigmented cells one cell line of four established from four independent métas with monoclonal antibodies. J. Invest. Dermatol., 90: 459-466, 1988. tases from the same patient expresses PDGFB, it would appear 14. Eisinger, M., and Marko, O. Selective proliferation of normal human melan ocytes in vitro in the presence of phorbol ester and cholera toxin. Proc. Nati. that the B chain of PDGF plays a minimal role in the etiology Acad. Sci. USA, 79:2018-2022, 1982. of melanoma. However, the transcription of PDGFB in a subset 15. Andrews, P. W. Retinoic acid induces neuronal differentiation of a cloned human embryonal carcinoma cell line in vitro. Dev. Biol., 103: 285-293, of melanomas could be useful as a marker of transformation. 1984. In conclusion, the transcriptional activation of protoonco- 16. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by genes encoding growth factors and their receptors are hypoth acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 762: 156-159, 1987. esized to have both direct and indirect roles in the regulation 17. Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning: A Labo of neoplastic growth (59). The results of the present study ratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. suggest that the development of the malignant melanoma cell 18. Saiki, R. K., Scharf, S., Faloona, F., et al. Enzymatic amplification of beta- is associated with the induction of TGF&, TGFa, and bFGF, globin genomic sequences and restriction site analysis for diagnosis of sickle while the induction of aFGF and FGF-5 may play a greater cell anemia. Science (Washington DC), 230: 1350-1354, 1985. 19. Ng, S. Y., Gunning, P., Eddy, R., et al. Evolution of the functional human role in tumor progression than in tumorigenesis. The analysis beta-actin gene and its multi-pseudogene family: conservation of noncoding of expression in precursor lesions and primary melanomas will regions and chromosomal dispersion of pseudogenes. Mol. Cell. Biol., 5: be of importance in determining the relevance of these growth 2720-2732, 1985. 20. Derynck, R., Jarrett, J. A., Chen, E. Y., et al. Human transforming growth factors within the developmental pathway leading to metastatic factor-beta complementary DNA sequence and expression in normal and melanoma. The minimal amounts of RNA needed for analysis transformed cells. Nature (Lond.), 316: 701-705, 1985. 21. Madisen, L., Webb, N. R., Rose, T. M., et al. Transforming growth factor- by PCR methodology should prove particularly useful in the beta 2: cDNA cloning and sequence analysis. DNA, 7: 1-8, 1988. study of these tissues, since it is usually difficult to obtain 22. Derynck, R., Lindquist, P. B., Lee, A., et al. A new type of transforming sufficient material for more conventional methodologies. Ulti growth factor-beta, TGF-beta 3. EMBO J., 7: 3737-3743, 1988. 23. Rappolee, D. A., Mark, D., Banda, M. J., and Werb, Z. Wound macrophages mately, the determination of consistent gene alterations in express TGF-alpha and other growth factors in vivo: analysis by mRNA melanomas may provide approaches for the better understand phenotyping. Science (Washington DC), 241: 708-712, 1988. ing of the biology of this neoplasia. 24. Jaye, M., Howk, R., Burgess, W., et al. Human endothelial cell growth factor: cloning, nucleotide sequence, and chromosome localization. Science (Wash ington DC), 233: 541-545, 1986. 25. Abraham, J. A., Whang, J. L., Turnólo, A., et al. Human basic fibroblast ACKNOWLEDGMENTS growth factor: nucleotide sequence and genomic organization. EMBO J., 5: 2523-2528, 1986. 26. Zhan, X., Bates, B., Hu, X. G., and Goldfarb, M. The human FGF-5 We thank Harold McQuilla for expert technical assistance, Dr. Ethan oncogene encodes a novel protein related to fibroblast growth factors. Mol. Dmitrovsky for providing the NTERA2 cell line, and Dr. Bernd Cell. Biol., 8: 3487-3495, 1988. Schmitz-Drager for useful discussions. 27. Finch, P. W., Rubin, J. S., Miki, T., Ron, D., and Aaronson, S. A. Human 4819

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. GROWTH FACTOR PRODUCTION IN MELANOMA CELLS

KGF is FGF-related with properties of a paracrine effector of epithelial cell 44. Rogelj. S., Weinberg, R. A., Fanning, P., and Klagsbrun, M. Basic fibroblast growth. Science (Washington DC), 245: 752-755, 1989. growth factor fused to a signal peptide transforms cells. Nature (Lond.), 331: 28. Delli Bovi, P., Curatola, A. M., Kern, F. G., Greco, A., Ittmann, M., and 173-175, 1988. Basilico, C. An oncogene isolated by transfection of Kaposi's sarcoma DNA 45. Halaban, R., Kwon, B. S., Ghosh, S., Delli Bovi, P., and Baird, A. bFGF as encodes a growth factor that is a member of the FGF family. Cell. SO: 729- an autocrine growth factor for human melanomas. Oncogene Res., 3: 177- 737, 1987. 186, 1988. 29. Betsholtz, C., Johnsson, A.. Heldin, C. H., et al. cDNA sequence and 46. Becker, D., Meier, C. B., and Herlyn, M. Proliferation of human malignant chromosomal localization of human platelet-derived growth factor A-chain melanomas is inhibited by antisense oligodeoxynucleotides targeted against and its expression in tumour cell lines. Nature (Lond.), 320:695-699, 1986. basic fibroblast growth factor. EMBO J.. *: 3685-3691, 1989. 30. Rao, C. D., Igarashi, H., Pech, M. W., Robbins, K. C., and Aaronson, S. A. 47. Dotto, G. P., Moellmann, G., Ghosh, S., Edwards, M., and Halaban, R. Oncogenic potential of the human platelet-derived growth factor transcrip- Transformation of murine melanocytes by basic fibroblast growth factor tional unit. Cold Spring Harbor Symp. Quant. Biol.. 51: 959-966, 1986. cDNA and oncogenes and selective suppression of the transformed phenotype 31. Moses, H. L., Yang, E. Y'., and Pietenpol, J. A. TGF-ii stimulation and in a reconstituted cutaneous environment. J. Cell Biol., 709: 3115-3128, inhibition of cell proliferation: new mechanistic insights. Cell. 63: 245-247, 1989. 1990. 48. Rubin, J. S., Osada, H., Finch, P. W., Taylor, W. G., Rudikoff, S., and 32. Derynck. R., Goeddel, D. V.. Ullrich, A., et al. Synthesis of messenger RNAs Aaronson, S. A. Purification and characterization of a newly identified for transforming growth factors alpha and beta and the epidermal growth growth factor specific for epithelial cells. Proc. Nati. Acad. Sci. USA, 86: factor receptor by human tumors. Cancer Res., 47: 707-712, 1987. 802-806, 1989. 33. Siepi, C., Bodmer, S., Frei, K., et al. The glioblatoma derived T cell suppressor 49. Bovi. P. D.. and Basilico. C. Isolation of a rearranged human transforming factor/transforming growth factor-B2 inhibits T cell growth without affecting gene following transfection of Kaposi sarcoma DNA. Proc. Nati. Acad. Sci. the interaction of interleukin 2 with its receptor. Eur. J. luminimi.. 18: 593- USA, 84: 5660-5664, 1987. 602, 1988. 50. Zhan, X., Culpepper, A., Reddy, M.. Loveless, J., and Goldfarb, M. Human 34. Bodmer, S., Strommer, K., Frei, K., et al. Immunosuppression and trans oncogenes detected by a defined medium culture assay. Oncogene, /: 369- forming growth factor-beta in glioblastoma. Preferential production of trans 376, 1987. forming growth factor-beta 2. J. Immunol., 143: 3222-3229, 1989. 51. Adnane, J., Gaudray, P., Simon, M.-P., Simony-Lafontaine, J., Jeanteur, P., and Theillet, C. Proto-oncogene amplification and human breast tumor 35. Jennings. J. C.. Mohan. S.. Linkhart. T. A., Widstrom, R., and Baylink. D. J. Comparison of the biological actions of TGF beta-1 and TGF beta-2: phenotype. Oncogene, 4: 1389-1395. 1989. differential activity in endothelial cells. J. Cell Physiol., 137:167-172, 1988. 52. Jaye. M., Lyall. R. M.. Mudd, R., Schlessinger, J., and Sarver. N. The 36. Czarniecki, C. W., Chiù,H. H.. Wong. G. H.. McCabe, S. M., and Palladino. expression of acidic fibroblast growth factor cDNA confers growth advantage M. A. Transforming growth factor-beta 1 modulates the expression of class and tumorigenesis to Swiss 3T3 cells. EMBO J., 7: 963-969, 1988. II histocompalibility antigens on human cells. J. Immunol., 140:4217-4223, 53. Albino, A. P., Lloyd, K. O., Houghton, A. N., Oettgen, H. F., and Old, L. J. Heterogeneity in surface antigen and glycoprotein expression of cell lines 1988. derived from different melanoma métastasesofthe same patient Implications 37. Burgess, A. W. Epidermal growth factor and transforming growth factor for the study of tumor antigens. J. Exp. Med., 154: 1764-1778, 1981. alpha. Br. Med. Bull., 45: 401-424, 1989. 54. Ross. R.. Raines, E. W.. and Bowen Pope, D. F. The biology of platelet- 38. Imanishi. K., Vamaguchi. K., Suzuki, M.. Honda. S., Yanaihara. N.. and derived growth factor. Cell, 46: 155-169. 1986. Abr. K. Production of transforming growth factor-alpha in human tumour 55. Shimokado. K., Raines. E. W.. Madtes, D. K., Barrett, T. B., Benditt, E. P., cell lines. Br. J. Cancer, 59: 761-765. 1989. and Ross, R. A significant part of macrophage-derived growth factor consists 39. Madtes, D. K., Raines, E. W., Sakariassen. K. S., Assonian, R. K., and of at least two forms of PDGF. Cell, 43: 277-286, 1985. Sporn, M. B. Induction of transforming growth factor alpha in activated 56. Westermark, B., Johnsson, A., Paulsson, Y.. et al. Human melanoma cell human alveolar macrophages. Cell, 53: 285-293. 1988. lines of primary and metastatic origin express the genes encoding the chains 40. Ellem, K. A., Cullinan. M., Baumann, K. C.. and Dunstan, A. UVR induction of platelet-derived growth factor (PDGF) and produce a PDGF-like growth of TGF alpha: a possible autocrine mechanism for the epidermal melanocytic factor. Proc. Nati. Acad. Sci. USA, 83: 7197-7200, 1986. response and for promotion of epidermal carcinogenesis. Carcinogenesis 57. Chiù, I. M., Reddy, E. P., Givol, D., Robbins, K. C., Tronick, S. R., and (Lond.), 9/797-801, 1988. Aaronson, S. A. Nucleotide sequence analysis identifies the human c-sis 41. Silici-lai \. S. E., Baker, F. L., Spitzer, G., et al. Biological effect of epidermal proto-oncogene as a structural gene for platelet-derived growth factor. Cell, growth factor on the in vitro growth of human tumors. Cancer Res., 47:403- 37: 123-129, 1984. 406. 1987. 58. Harsh, G. R., Keating, M. T.. Escobedo, J. A., and Williams, L. T. Platelet 42. Hayward, N.. Nancarrow, D.. Ellem. K.. Parsons. P.. and Kidson, C. A Taqi derived growth factor (PDGF) autocrine components in human tumor cell RFLP of the human TGF alpha gene is significantly associated with cuta lines. J. Neurooncol., 8: 1-12, 1990. neous malignant melanoma. Int. J. Cancer, 42: 558-561, 1988. 59. Slamon, D. J., deKernion, J. B., Verma, I. M.. and Cline, M. J. Expression 43. Goldfarb, M. The fibroblast growth factor family. Cell Growth Differ., I: of cellular oncogenes in human malignancies. Science (Washington DC), 439-445, 1990. 224:256-262, 1984.

4820

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research. Induction of Growth Factor RNA Expression in Human Malignant Melanoma: Markers of Transformation

Anthony P. Albino, Brigid M. Davis and David M. Nanus

Cancer Res 1991;51:4815-4820.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/51/18/4815

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/51/18/4815. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1991 American Association for Cancer Research.