University of Groningen
Heat resistance of Bacillus spores Berendsen, Erwin Mathijs
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record
Publication date: 2016
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA): Berendsen, E. M. (2016). Heat resistance of Bacillus spores: Natural variation and genomic adaptation. Rijksuniversiteit Groningen.
Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
Download date: 24-09-2021 Heat resistance of Bacillus spores Natural variation and genomic adaptation
Erwin Mathijs Berendsen The research presented in this thesis was funded by TI Food and Nutrition (Wageningen, the Netherlands), a public-private partnership on pre- competitive research in food and nutrition. The research was conducted at NIZO Food Research BV (Ede, the Netherlands) and was embedded within the Molecular Genetics Group of the Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen (Groningen, the Netherlands).
Science (University of Groningen), TIFN, Danone, NIZO, and TNO. Printing of this thesis was financially supported by the Graduate School of
Cover Design: Sven Menschel & Erwin Berendsen Layout: Eirlys Pijpers & Erwin Berendsen Printed by: Ipskamp Drukkers B.V. ISBN (print): 978-90-367-8802-1 ISBN (electronic): 978-90-367-8801-4 Copyright © Erwin M. Berendsen, 2016. Heat resistance of Bacillus spores Natural variation and genomic adaptation
Proefschrift
ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen op gezag van de rector magnificus prof. dr. E. Sterken en volgens besluit van het College voor Promoties.
De openbare verdediging zal plaatsvinden op
vrijdag 3 juni 2016 om 16.15 uur
door
Erwin Mathijs Berendsen
geboren op 5 juli 1986 te Kampen Promotor Prof. dr. O.P. Kuipers
Copromotor Dr. M.H.J. Wells-Bennik
Beoordelingscommissie Prof. dr. J.W. Veening Prof. dr. S. Brul Prof. dr. M. Kleerebezem Contents
Chapter 1 7 General introduction
Chapter 2 29 Two distinct groups within the Bacillus subtilis different spore heat resistance properties group display significantly Chapter 3 47 A mobile genetic element profoundly increases heat resistance of bacterial spores
Chapter 4 81 High-level heat resistance of spores of Bacillus amyloliquefaciens and Bacillus licheniformis results from the presence of a spoVA operon in a Tn1546 transposon
Chapter 5 97 Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger clusters, but
efficiently upon non-nutrient Ca-DPA exposure Chapter 6 123 General discussion
Addenda 143 Nederlandse samenvatting
About the author
List of publications
Acknowledgements
Chapter 1
General introduction
Erwin M. Berendsen
Partly based on the review published as: Wells-Bennik MHJ, Eijlander RT, den Besten HMW, Berendsen EM, Warda AK, Krawczyk AO, Nierop Groot MN, Xiao Y, Zwietering MH, Kuipers OP, Abee T (2016). Bacterial spores in food: survival, emergence, and outgrowth. Annual Review of Food Science and Technology 7:457-482. Chapter 1
Endospores Bacterial spores are widely present in nature. The resistance properties of spores allow for survival against environmental insults. A very important property of spores is their ability to withstand high temperatures. The level of resistance of spores to heating can vary between different spore forming species, but can also vary between strains. The
well understood. Understanding which factors have a major impact on heat resistance mechanisms underlying strain specific variation in heat resistance of spores are not of spores can have important implications for their control in food and in applications to improve health. The focus of this thesis is on establishing variation in heat resistance
that underlie this variation. of spores that exists between strains, and on the identification of genomic determinants Spore formers from the Clostridiales and Bacillales to enter sporulation as an adaptive strategy to survive conditions encountered in their orders have the extraordinary ability natural habitat, for instance in soil, aquatic environments or in the gut of insects and
cell into a dormant endospore (3, 38, 50, 51, 108), a state in which it can reside for animals (23, 49, 69, 77). This complex regulatory process transforms the bacterial
Bacillus sphaericus from 25 to 40 million year old Dominican amber (22), and a Bacillus undefined periods of time. The isolation of spores have been reported for a strain of sp. 2-9-3 from a salt crystal of 250 million years old (118). Although these reports were
met with scepticism about potential external contamination, they illustrate the potential extent of longevity of spores. Dormant endospores are resistant to environmental stress low availability of nutrients (71, 77, 103). conditions including heat, salinity, acidity, radiation, oxygen and/or water depletion or The sporulation process is induced by high cell densities and nutrient limitation, and Bacillus subtilis strain 168, which is a gram positive model organism (38, 51). The availability of the genome sequence of B. subtilis 168 and has been extensively studies in the ability to genetically amend this strain greatly facilitated the progress to understand sporulation and spore resistance mechanisms (11, 55). The sporulation process is a
and involves differentiation, intercellular signaling and programmed cell death among unique developmental pathway that is fundamentally different from binary fission, others (39).
The composition of a spore Bacterial spores have various layered structures (Figure 1) that provide resistance against environmental insults and thus against several food processing conditions. The
way in which different structures contribute to spore resistance has been extensively reviewed elsewhere (56, 103) and will be only briefly discussed here. First and foremost, 8 General introduction
1 Coat Coat Outer membrane Outer membrane Cortex ICnonreter xmembrane Inner membrane Core Core
200 nm
Figure 1. Transmission electron microscopy (TEM) cross section of a spore of Bacillus subtilis 168 (E.M. Berendsen, unpublished results). The ultra- structure’s of the spore, the coat, cortex, inner membrane, and core are indicated with arrows. the spore core is strongly dehydrated, resulting in proteins present in the spore that are largely rotationally immobilized (107). A specific type of proteins present in spores is α/β-type small acid soluble proteins (SASPs) which protect the genetic material against DNA damage. In addition, the core contains the spore-specific chemical pyridine-2,6- cations (mostly Ca2+) (103). Surrounding the core is the inner membrane that provides carboxylic acid, also known as dipicolinic acid (DPA) which is chelated with divalent protection against chemicals (47, 102) and contains proteins required for germination. Outside the inner membrane lies the germ cell wall, which becomes the cell wall after germination, and the cortex, which consists of spore-specific peptidoglycan, characterized by the muramic-δ-lactam moiety and low peptide cross linking (90). The cortex is required for the development of full resistance toward wet heat (discussed in role in resistance is known [reviewed in (56)]. Finally, the outermost layers make up the more detail below). The cortex is surrounded by an outer membrane for which no clear spore coat, which contains various proteins that provide protection against lysozyme,
For certain species, (e.g. Bacillus cereus, Bacillus thuringiensis, Bacillus anthracis, and toxic chemicals, and grazing protozoa, amongst others [extensively reviewed in (71)]. Clostridium in direct contact with the environment and is potentially involved in pathogenicity spp.), the spore coat is further surrounded by an exosporium, which is [reviewed in (48, 85)].
9 Chapter 1
Sporulation and germination The spore properties, that are at the basis of resistance and dormancy, are largely
germination process. Proteins that are required for germination are already produced determined by the sporulation process. To exit the dormant state, spores undergo a during the sporulation process. The sporulation and germination process will be discussed below.
The sporulation process
The formation of a bacterial endospore is the result of a complex regulatory process process involves a series of steps that ultimately lead to the formation of a dormant that has been extensively reviewed elsewhere (3, 38, 50, 51, 108). The sporulation spore. The point at which a vegetative cell of B. subtilis enters the sporulation process is determined by nutrient limitation and high cell densities. The key sporulation regulator is Spo0A, which requires to be phosphorylated and to form a dimer for initiation of sporulation (19, 59). In B. subtilis the phosphorylation of Spo0A is mediated via Spo0F and Spo0B and involves several histidine kinases KinA, KinB, KinC, KinD, and KinE, which all respond to different environmental stimuli (39). The phosphorylation of Spo0A is indirect, therefore this system is referred to as the phosphorelay system (19). Upon reaching a certain threshold level of phosporylated Spo0A (Spo0A~P) in the cell, an auto stimulatory positive feedback loop is established, initiating sporulation by the
Theexpression sporulation of multiple process genes is tightly (27). controlled by a gene regulatory network, which has
(38, 51). The spore is formed within the vegetative cell (mother cell) and after lysis of been extensively reviewed elsewhere, and therefore will only be discussed briefly here this cell is released into the environment. At the basis of the sporulation process are Bacillus RNA polymerase. A strict temporal regulation between the forespore and the mother the RNA polymerase sigma factors that change the promoter specificity of the F E G and K F G E K are cell compartments is mediated by the sporulation specific sigma factors σ , σ , σ σ (38, 51). The sigma factors σ and σ are forespore specific, whereas σ and σ stages as presented in Figure 2 (51). At stage 0, the cell is committed to sporulation and mother cell specific (38, 51). The sporulation process can be divided in seven different A H. During stage II, an asymmetric division of the DNA becomes more dense, followed by axial filament formation at stage I, during the vegetative cell takes place, and a septum divides the vegetative cell into a smaller which genes are regulated by σ and σ forespore compartment and a larger mother cell compartment. The gene regulation E F in the forespore. The forespore is subsequently engulfed by the membrane of the mother cell during stage during stage II is mediated by σ in the mother cell and by σ G K, in the forespore and mother cell,
III, while gene expression is regulated by σ and σ 10 General introduction
the dehydration of the spore core (stage IV). During stage V, the SASPs are synthesized respectively. Between the two membrane layers the spore cortex is built up, followed by in the forespore. Additionally, DPA is synthesized in the mother cell by SpoVFA and SpoVFB and subsequently incorporated into the spore core by proteins encoded on the spoVA operon (111). Finally, a number of protein coat layers are formed, and after maturation of the spore the mother cell lyses, whereupon the spore is released into the 1 which will be discussed in the following section. environment. The spores can exit the dormant state via the process of germination, The germination process into a vegetative cell. The germination of spores can be triggered by different means, Spores can exit dormancy via the process of germination followed by outgrowth namely by nutrients and by non-nutrients triggers. The germination process has been extensively reviewed (84, 101, 122) and will be briefly discussed here. The germination process consists of two different stages (Figure 2) (102). Prior to the first stage, the Germination process Sporulation process
σA σH
σE σF
Stage 0 Stage I DNA more dense Axial filament formation Stage II Assymetric division Outgrowth σK Resume metabolism σG SASP degradation
Stage III Stage II Engulfment Cortex hydrolysis Core hydration
Stage IV Stage I Core dehydration Cation release Cortex synthesis DPA release Partal core hydration
Activation Stage V SASPs production Stage VII Stage VI DPA incorporation Dormant spore Cell lysis Coat layers
Figure 2. Overview of the sporulation and germination process of B. subtilis 168. The sporulation process can be divided in seven stages, indicated in the figure. At the onset stage of sporulation, asymmetric cell division occurs, leading to formation of a mother cell and a forespore compartment. This is followed by a commitment stage. After engulfment of the forespore, a maturation state allows for completion of sporulation. Upon completion of sporulation, the mother cell lyses and the spore is released into the environment. If conditions are favorable, germination may occur, that can be followed by outgrowth into a vegetative cell. The germination process is divided in an activation step, stage I, stage II and outgrowth.
11 Chapter 1
are released from the spore core, which in turn is partly rehydrated, thereby losing a spore is activated to germinate. During the first stage, monovalent cations and Ca-DPA phase bright appearance using phase contrast microscopic imaging. During the second
hydrated further. During the outgrowth stage, the metabolic activity is resumed, SASPs stage of germination, the cortex is hydrolyzed by cortex lytic enzymes and the core is
Nutrientare degraded triggers, and the like spore sugars, exits nucleosides, from the coat salts layers. and amino acids can activate the germination receptors (GR) that are present in the inner membrane of the spore. For B. subtilis 168, the tricistronic operons gerA, gerK and gerB encode three distinct B. subtilis 168 contains two cryptic GR operons for which no role in germination has been established (6). germination receptor complexes. Additionally, the genome of were shown to be localized to the inner membrane (52, 83). Additionally, there is GerD, The proteins GerAA and GerAC of the GerA complex, and GerBA of the GerB complex which is required for germination and also localizes to the inner membrane (87, 88). The GRs, GerD, but not SpoVA proteins cluster together in the inner membrane and are called “germinosome” (101). Recently, an alternative pathway involved in spore
by peptidoglycan fragments of vegetative cells (104). germination was discovered, involving a serine/threonine kinase PrkC that is induced During germination, the release of Ca-DPA from the spore core is mediated by the SpoVA proteins (117). However, the signaling from the germination receptors to the SpoVA proteins is not known, and remains to be elucidated. The protein SpoVAC acts as a mechanosensitive channel and is required for the uptake and release of Ca-DPA (116). B. subtilis,
The protein SpoVAD specifically binds to Ca-DPA (62). During germination of strains lacking both sleB and cwlJ the spore cortex is hydrolyzed by two cortex lytic enzymes, namely CwlJ and SleB. Mutant are impaired in the second stage of germination. As a result, germinated spores do not can proceed through the first stage of germination but succeed to grow out (16, 26). The proper localization of SleB is mediated by YpeB, while CwlJ requires the presence of GerQ (ywdL) for correct localization (16, 92).
Non-nutrient germination triggers can be exogenous DPA, dodecylamine, or the application of a high temperature or high hydrostatic pressure (HHP) (84). Exogenous DPA directly activates the cortex lytic enzyme CwlJ, resulting in degradation of the cortex. The surfactant dodecylamine directly triggers the release of DPA from the spore can be used to trigger germination via the GRs at pressures around 150 MPa, and by core (117), thereby initiating degradation of the cortex by the cortex lytic enzymes. HHP opening of the SpoVA channels at moderate pressures of 500MPa or higher (15, 93).
12 General introduction
Genomics of spore formers
Genomic information of the sporulation process is largely based on the model organism B. subtilis 168 (11, 38, 55, 78). Recent advances have been in made in genomics of B. subtilis 168 to other 1 bacterial spore formers, extending the genomic knowledge from of genomes of spore formers, aiming at identifying a minimal set of genes required for spore formers (30). For example, Galperin et al. (2012) made a thorough comparison sporulation (41). This genomic analysis revealed that Bacilli and Clostridia share a core set of genes required for sporulation, but variation was seen between both classes with regard to gene presence and absence (41). A detailed comparison of 20 Bacillus spp. gene sets for the B. subtilis B. cereus group, and genomes showed that sporulation genes are divergent among the species, with specific genes missing in the group of thermomophilic spore formers (4). The sporulation genes group, specific genes missing in the involved in gene regulation like spo0A sigE, sigF, sigG, and sigK were found to belong to the core sporulation genes (4, 41). In addition, genes were conserved for which the encoded proteins have different roles during the sporulation process, such as the spore maturation proteins spmA and spmB, DPA synthesis genes spoVFA and spoVFB and the SASP sspI (4). A major divergence in sporulation genes was observed in sensory kinases, coat proteins, and SASPs (4). Similarly, a study by Earl et al. (2007) used a microarray based genomic hybridization approach (M-CGH) to assess seventeen strains of the B. subtilis group, and revealed that more than half of the variable genes in sporulation encoded proteins that are part of the spore coat (36). It should be noted that the genomic phenotypic differences of spores. variations observed in the above mentioned studies were not linked to strain-specific Spores in food Spore forming bacteria play an important role in food spoilage and foodborne disease, and food industries actively employ strategies to ensure adequate inactivation of spores and to control outgrowth. The resistance properties of spores lay at the heart of their ubiquitous presence in the environment, and as a consequence, it is inevitable that spores enter into the food chain. Given the robustness of spores, they are generally quite resistant to processing and preservation treatments used in food manufacturing (25, 106). Yet, spores can sense changes in their direct surroundings (e.g. the availability of nutrients), which can trigger the process of germination (101). This may occur in foods because these are rich in nutrients. Once germination is initiated, the spore can return to its vegetative cell form and once again start exponential cell division. If (possibly even followed by sporulation), this can lead to food spoilage. In the case of spore germination occurs in a final food product, followed by growth of vegetative cells foodborne pathogens, foodborne illness may occur upon intake of foods that contain
13 Chapter 1
spores of pathogenic species that may germinate and grow in the gut, or upon intake of foods in which spores have already germinated and grown to high numbers. In the
latter case, foodborne illness may be due to intake of toxin produced in the food (food to diarrhea (foodborne infection) (8, 37, 65, 106). poisoning) or intake of the pathogen that subsequently forms toxins in the gut, leading Although the impact of pathogenic spore formers is apparent, non-pathogenic species also pose major challenges to the food industry. A plethora of spore formers – sometimes
for growth – may be responsible for product defects or spoilage in a variety of food with very distinct characteristics with respect to spore resistance and/or requirements products, leading to substantial economic losses in the food chain and leading to substantial food waste (25, 91, 106).
Selective pressure for high-level heat resistant spores High heat treatments are applied to produce commercially sterile foods with a long
high temperature (UHT) treated liquids (e.g. juices and milk). In canned, bottled, or shelf life, such as sterilized canned foods (e.g. meats, fish, and vegetables), and ultra vacuum packed products with a pH high enough to allow for growth of C. botulinum,
of this organism (7). Highly heat resistant spores can survive such heat treatments, heat treatments must exceed 3 minutes at 121°C (or the equivalent) to inactivate spores and depending on the product characteristics and storage temperatures during shelf life, different species may cause spoilage (65) (Figure 3). These may include Bacillus spp. and Paenibacillus spp. (20, 53, 96, 97), but also obligate thermophilic species that Geobacillus species (9, 20, 33). High-level heat resistant spores of the mesophilic spore formers of the B. subtilis require temperatures greater than 45°C for growth, such as group, which are focussed on in the work described in this thesis, are found in various food products, such as milk, bread, herbs and spices, soups, sauces and cocoa amongst others (63, 74, 81, 109, 110, 112). These mesophilic species generally have the ability
to grow at temperatures up to 55°C, and for certain strains their spores are not heat may introduce further heterogeneity in the potential of surviving spores to germination inactivated by a heat treatment of 30 minutes at 100°C (81). The application of heating and outgrowth in food matrices (10, 37, 114). Anaerobic spore formers producing highly heat resistant spores may also play a role in spoilage of commercially sterile foods; the most heat resistant spores described to date are produced by Moorella thermoacetica (21) that belongs to the class Clostridia (phylum Firmicutes), which is naturally associated with anaerobic warm waters. The spores can easily survive sterilization,
with a reported decimal reduction value (D-value) of 111 minutes at 121°C (21).
14 General introduction
Natural diversity
1
Selective pressure e.g. heating
Surviving spores Inactivated spores Inactivated cells
Figure 3. Overview of natural biodiversity of spore forming bacteria represented with different spores and cells. The application of a selective pressure (e.g. heating) selects for those spores that are able to survive the specific treatment. Studying these survivors might provide insight in adaptive mechanisms that allow for better survival of these spores compared to others.
Wet heat inactivation of spores The composition of spores provides resistance against conditions that are commonly agents (see also (71, 103)). As indicated above, an important process to inactivate used in the food industry to reduce bacterial loads, such as heat, acid, salt and oxidising microbes is the application of heat. still not clear. When spore populations of B. subtilis Exact mechanisms that lead to inactivation of spores after application of wet heat are of spores were recovered using buoyant density gradient centrifugation, namely were exposed to heat, two types spores that lost the internal DPA and suffered protein denaturation and a second fraction that consisted of spores did not lose internal DPA (28). Inactivated spores that still contained internal DPA were able to germinate, but they were impaired in outgrowth. This suggests that DPA release takes place after the heat inactivation and that proteins involved in outgrowth and resuming of metabolic activity are denatured of B. cereus and B. megaterium in which the outgrowth was also impaired (29). Later (28). The denaturation of proteins during wet heat treatment was confirmed in spores enzyme CwlJ, are damaged by wet heat treatment, leading to prolonged lag times of research indicated that proteins involved in germination, including the cortex lytic germination (119). Another suggested mode of action of wet heat is reduction of the ability to release CaDPA from the spore core due to protein damage.
15 Chapter 1
Wet heat application remains the most common treatment applied in the food industry
spore resistance against wet heat and mechanisms that play a role in this resistance are to decrease bacterial spore loads from food ingredients and products. Quantification of
further discussed in the next sections. Recovery of spores
The resistance of spores towards wet heat treatment can be quantified by assessment of the surviving fraction expressed in colony forming units (CFU) obtained by plate greatly depends on the ability of spores to germinate and grow out to a colony forming counting. This quantification of spore survival and viability after heat treatments unit. This includes the recovery of spores that survive inactivation treatments but that sustained damage, requiring proper cultivation conditions to avoid underestimation of viable spore numbers after such treatments (57, 120)
The inactivation data obtained can be fitted using different models to accurately is the D-value, which is the time required to achieve a decimal reduction of the micro- describe the inactivation curve (68). A common way to express the inactivation kinetics organisms. In addition, the z-value is used, which is the increase in temperature required
to determine resistance properties of spores, that do not depend on CFU formation, like to achieve one extra decimal reduction. Alternatively, other methods can be employed techniques can provide more insights in individual spore behavior and heterogeneity in flow cytometry (70), measuring DPA release (54) and Raman spectroscopy (45). These spore populations (37).
Known factors influencing spore heat resistance
Environmental factors influencing wet heat resistance of spores
of spores including the wet heat resistance (1, 58, 76). The temperature during the It is well known that environmental factors during sporulation can influence properties sporulation process has been reported to play a role in the wet heat resistance of the spores that were formed. Melly et al. (2002) reported that increased sporulation temperatures resulted in increased wet heat resistance of B. subtilis spores, which correlated with a lower core water content and a higher degree of muramic acid cross- B. subtilis
linking in the cortex (72). Spores of prepared at 45°C survived heating at 90°C without showing any inactivation, whereas spores of the same strain prepared at B. 22°C showed three log reduction in viable spore counts (72). Similarly, the sporulation weihenstephanensis, where a ten-fold increase spore wet heat resistance was observed temperature was important for the final heat resistance properties of spores of
when the sporulation temperature was increased from 5°C to 30°C (12). An increase 16 General introduction
B. licheniformis (12). Other reports describe increased in sporulation temperature from 20°C to 45°C also resulted in increased wet heat wet heat resistance of B. subtilis and B. megaterium resistance (six-fold) of spores of spores upon heat shock (45°C or in resistance is mediated; heat shock proteins appear not to be involved in increased 48°C for 30 minutes) during sporulation (73, 75, 100). It is not clear how this increase spore heat resistance despite their presence (73). 1
The presence of cations in the growth medium (in particular calcium, potassium, magnesium and manganese) can also contribute to an increased wet heat resistance of spores (24, 80). For spores of B. subtilis A163 prepared on sporulation medium with 2+ 2+ +, 2+ added salts (Ca , Mn , K Mg ), no inactivation of viable spore count was observed after heating at 114°C for 4 minutes, whereas for spores prepared without these salts . (2011) observed an in the sporulation medium, five log reduction in viable spore counts was observed (24). increased wet heat resistance of B. megaterium spores with higher concentrations of Interestingly, such effects may be species-specific, as Ghosh et al manganese in the sporulation medium (43), whereas Granger et al. (2011) did not see this effect for spores of B. subtilis (46). release from the sporulating cell (95). The presence of divalent cations, like Ca2+, is To achieve maximum wet heat resistance, spores require a maturation period after required for this maturation; addition of the chelator EDTA abolished the maturation subsequent increase in wet heat resistance is most likely mediated by chemical cross and thereby acquisition of maximal wet heat resistance (95). This maturation and linking of proteins in the outer coat layer and crust (2).
In general, conditions encountered during sporulation in the natural habitat of spore formers undoubtedly play a role in resistance properties of spores that occur in foods and ingredients (49, 63, 115). However, often these conditions are not known or are B. subtilis prepared on sporulation medium with agar were three fold more resistant than spores prepared in hard to mimic in a laboratory setting. For example, spores of the same liquid medium (94). When preparing spores in a laboratory, conditions used to prepare spores (e.g. medium type, incubation temperatures, liquid broth or agar with, and such conditions may require optimization when studying the mechanisms surface) can greatly influence spore wet heat resistance. This is a factor to be reckoned that determine the wet heat resistance properties of spores.
Intrinsic factors influencing wet heat resistance of spores
Besides the effect of environmental conditions during sporulation on the final heat properties of spores. Establishing the role of such genes relies mostly on the construction resistance properties, certain gene products are known to influence heat resistance
17 Chapter 1
of deletion mutants. For example, mutations in the small acid soluble proteins (SASPs) which the small acid soluble protein encoded by ssp4 was removed from C. perfringens are known to influence the final heat resistance properties of spores. In studies in D ) were reduced from 59.1
SM101, the decimal reduction times of spores at 100°C ( 100°C B. subtilis led to a reduction of the D of to 8.7 min, which is approximately a seven-fold reduction (60). In accordance with spores from 18 to 2.5 minutes, which is a seven-fold reduction (103). Deletion of certain these findings, deletion of the α/β SASPs from 90°C
stoA from B. subtilis genes can have a direct impact on the sporulation efficiency and on spore structures. For example, deletion of strongly impairs cortex synthesis, resulting mutations in dacB, spmA and spmB in reduced sporulation efficiency and increasing the heat sensitivity of spores. Similarly, spores with up to eight-fold lower heat resistance levels than those of the parent strain which are involved in cortex synthesis, resulted in (89). A complication of using mutants with deletions in genes that play a role in spore formation to subsequently study the wet heat resistance properties of spores, is that the composition of the spores might be severely affected. Additionally, the sporulation process itself might be blocked if genes required for the completion of sporulation are mutated, e.g. the mutations in the spoVA operon (111).
Apart from the above mentioned genetic factors, it is known that small subsets of spores that do not respond to known germination triggers (also termed superdormant spores) display an elevated wet heat resistance, which is likely caused by lower core water content than spores that respond normally to germination triggers (44). This can
the industrial isolate B. subtilis A163 as well as B. sporothermodurans spores showed greatly influence the response of spores to environmental triggers. Likewise, spores of an increased wet heat resistance linked to increased dormancy when compared with the laboratory strain B. subtilis 168 (54). These observations demonstrate a strong correlation between spore heat resistance and dormancy. The consequence may be that spores with the highest level of heat resistance are the hardest to retrieve on cultivation media as a result of their impaired germination, possibly also leading to underestimation of their true numbers in foods.
Understanding variation in wet heat resistance of spores
Strain-specific variation in wet heat resistances of spores Spores encountered in food ingredients and foods may have a large natural diversity, including variation in heat resistance properties. The optimal growth temperature of species often correlates with thermal resistance of their spores, with thermophilic species generally producing spores with higher thermoresistance than mesophilic species, which in turn produce spores with higher heat resistance than psychrotrophic
18 General introduction
species (42, 77, 121). However, this is not always the case. While marked differences in spore heat resistance are found between different species, remarkable difference
B. cereus, strain variation was demonstrated to be a main variability factor for spore can also be observed between different strains of the same species. For example, for heat resistance (67). The same conclusion was drawn based on a meta analysis of 1 heat resistances of spores of B. cereus (113). Within the B. subtilis group, large strain
(54, 63, 81). For spores of B. sporothermodurans, the heat resistances of spores varied specific variation in heat resistance of spores has been reported in various studies between strains from a D of 14 minutes to 800 minutes (97). Similarly, differences in heat resistance of spores100°C were observed for strains of the anaerobic spore formers C. perfringens (60, 61, 82, 123) and C. botulinum (86). spores are mediated. Furthermore, as the mechanisms underlying these differences In general, it is not clear how the strain specific differences in heat resistances of in resistance of spores are not clear, it is not known whether these adaptations are similar or different between strains and species. The use of comparative genomics can contribute to an improved understanding of mechanisms that play a role in determining spore heat resistance properties of different strains and species.
Genomics approach to understand variation in wet heat resistance of spores Recently, the use of omics technology, including whole genome sequencing, in food safety gained more attention (5, 14, 18). Whole genome sequencing of Bacillus spp. strains can likely provide new insights in mechanisms of high-level heat resistance of spores (5, 66). Recently, more than 90 B. subtilis genomes have been sequenced and published (31, 35, 40, 98, 99, 105, 124, 125). These genome sequences provide a good differences in heat resistance of spores can provide insight in genomic adaptations basis for comparative genomic studies. Linking genomic variations to strain specific underlying high-level heat resistance of spores. A potential driver of genomic adaptation is horizontal gene transfer, and genetic material can be transferred between species and strains (79). The transfer of genetic material can take place via different mechanisms, such as phage transduction, conjugation and natural competence. Other processes and transposons, amongst others. underlying genomic variation, are mutations, genome reshuffling, insertion sequences level wet heat resistance of spores is a so-called gene-trait matching, as described by An approach that is promising for the identification of genes responsible for high- Bayanov et al. (13) (Figure 4). The requirements for gene-trait matching were described previously by Dutilh et al. (34). The correlation of presence or absence of genes with a phenotype does not necessarily mean that there is a causative effect. To establish the role
19 Chapter 1
of a certain gene that is correlated with a phenotype, deletion or complementation of
and absence of genes in relation to phenotypes. More subtle changes in the genome, the specific gene is required. The gene-trait matching approach focuses on the presence such as single nucleotide polymorphisms (SNP) or differences at transcriptional levels or translational levels will not easily be found using this approach. Alternatively, a transcriptome-trait matching could be employed, possibly revealing genes that are
B.correlated subtilis 168 to a is given a well-studied phenotype, model based organism on different and expression provides a profiles good basis (17, for 32). genomic comparisons with other B. subtilis strains that produce spores with different wet heat
between B. subtilis 168 and B. subtilis A163 that produces spores with higher heat resistance properties. For example, Brul et al. (2011) performed a genomic comparison
namely, xlyB, spsA, and wapA with stronger hybridization for B. subtilis A163 (18). It was resistance properties, and DNA-DNA hybridization experiments revealed three genes,
of B. subtilis A163 spores (18). Using whole genome sequencing of B. subtilis strains M1 not confirmed whether these genes play are role in the increased wet heat resistance
Single species - different strains
Phenotypic comparison Phenotype 1 Phenotype 2 A B C D E A B C E A B D E F A B C E F A B C D E F A C E F A C D E F A B C E F Genome comparison A B C D F A B C E F (Transcriptome comparison)
Gene-trait matching Gene D (Transcriptome-trait matching) Gene unique for phenotype 1
Figure 4. Gene-trait matching approach: theoretical example. Within a single species multiple strains are present. Upon testing a specific phenotype (e.g. heat resistance of spores) these strains may display different phenotypic behavior. Genome comparison reveals strain specific differences in genome content. Using a gene trait matching approach, in which phenotypic variation is matched with genotypic variation, genes correlating with a specific phenotype can be discovered. In this example gene D is always present in strains displaying phenotype 1, and always absent in strains with phenotype 2. Alternatively to genome comparison and gene- trait matching, transcriptome comparison and transcriptome can be used for identification of genes unique for a phenotype.
20 General introduction
and M112, which both produce spores with high heat resistance, and comparison with genes present in the B. subtilis 168 genome, Lima (64) reported genes uniquely present in strains M1 and M112, however no clear role for these genes in the increased resistance was hypothesized nor demonstrated (64). The above mentioned approaches could result in an understanding of high-level heat resistance of spores. The understanding 1 of spores will aid a better detection of highly heat resistant spore formers and allow for of molecular processes underlying differences in strain specific resistance properties improved control of these spores.
Thesis outline In this thesis, variation in heat resistance of spores within the B. subtilis group has been investigated. Following detailed phenotypic analyses of spores (which showed of the respective strains, breakthrough insights were obtained, uncovering genes that significant differences between strains) and combining these data with genome analyses determine high-level heat resistance of spores and their germination potential.
To assess the variation in heat resistances of spores, spore heat inactivation kinetics were determined for fourteen strains of the B. subtilis group in Chapter 2. With respect to heat resistance of spores, two groups could be distinguished for the 14 strains of B. subtilis group. It was not known how this variation in heat resistance between strains within a species was mediated. To unravel the underlying cause of this difference in heat resistance of spores between B. subtilis strains, a gene trait-matching approach was used. This revealed a Tn1546 transposon that was correlated with the increased heat resistance of spores, as described in Chapter 3. It was demonstrated that the Tn1546 transposon is directly responsible for increased heat resistance of spores: transfer of the transposon resulted in increased heat resistance of spores. Additionally, genome mining for the spoVA operon in other spore forming Bacillus sp. was performed. The occurrence of different spoVA operons in 103 spore forming Bacillus sp. was studied, revealing the same genomic element in strains of other species, including certain strains of B. amyloliquefaciens and B. licheniformis. Spores of various strains of these species, with and without the element, were evaluated for high-level heat resistance in Chapter 4 1546 transposon and spoVA operon in these species as well. Spores of highly heat resistant spore formers often have unpredictable , confirming the role of Tn germination behavior and heat resistance properties in foods. These properties were assessed for spores of four B. thermoamylovorans strains in Chapter 5. Overall, these strains showed very limited germination on standard rich media due to poor nutrient- induced germination, leading to strong underestimations of the viable spore numbers discussed in Chapter 6 together with perspectives for the food industry. and the spore heat resistances. The impact of the findings from Chapters 2, 3, 4, and 5 is
21 Chapter 1
References
1. Abbas, A. A., S. Planchon, M. Jobin, and P. Schmitt. 2014. to sporulate and the spore properties of Bacillus cereus. Food Microbiology 42:122-131. 2. Abhyankar, W., R. Pandey, A. Ter Beek, S. Brul, L. J. de Absence Koning, of and oxygen C. G. affects de Koster. the capacity 2015. Reinforcement of Bacillus subtilis spores by cross-linking of outer coat proteins during maturation. Food Microbiology 45, Part A:54-62. 3. Al-Hinai, M. A., S. W. Jones, and E. T. Papoutsakis. 2015. The Clostridium sporulation programs: Diversity and preservation of endospore differentiation. Microbiology and Molecular Biology Reviews 79:19-37. 4. Alcaraz, L., G. Moreno-Hagelsieb, L. Eguiarte, V. Souza, L. Herrera-Estrella, and G. Olmedo. 2010. Understanding the evolutionary relationships and major traits of Bacillus through comparative genomics. BMC Genomics 11:332. 5. Alkema, W., J. Boekhorst, M. Wels, and S. A. van Hijum. 2015. Microbial bioinformatics for food
6. Alzahrani, O. M., and A. Moir. 2014. Spore germination and germinant receptor genes in wild strainssafety and of Bacillus production. subtilis Briefings. Journal in of Bioinformatics. Applied Microbiology 117:741-9. 7. Anderson, N. M., J. W. Larkin, M. B. Cole, G. E. Skinner, R. C. Whiting, L. G. M. Gorris, A. Rodriguez, R. Buchanan, C. M. Stewart, J. H. Hanlin, L. Keener, and P. A. Hall. 2011. Food safety objective approach for controlling Clostridium botulinum commercially sterile foods. Journal of Food Protection 74:1956-1989. 8. Andersson, A., U. Rönner, and P. E. Granum. 1995. What problems growth does and the toxin food productionindustry have in with the spore-forming pathogens Bacillus cereus and Clostridium perfringens? International Journal of Food Microbiology 28:145-155. 9. Andre, S., F. Zuber, and F. Remize. 2013. Thermophilic spore-forming bacteria isolated from spoiled canned food and their heat resistance. Results of a French ten-year survey. International Journal of Food Microbiology 165:134-43. 10. Augustin, J.-C. 2011. Challenges in risk assessment and predictive microbiology of foodborne spore-forming bacteria. Food Microbiology 28:209-213. 11. Barbe, V., S. Cruveiller, F. Kunst, P. Lenoble, G. Meurice, A. Sekowska, D. Vallenet, T. Wang, I. Moszer, C. Medigue, and A. Danchin. the Bacillus subtilis 168 reference genome a decade later. Microbiology 155:1758-75. 12. Baril, E., L. Coroller, O. Couvert, I. Leguérinel, 2009. From F. Postollec, a consortium C. Boulais, sequence F. Carlin,to a unified and P.sequence: Mafart. 2012. Modeling heat resistance of Bacillus weihenstephanensis and Bacillus licheniformis spores as function of sporulation temperature and pH. Food Microbiology 30:29-36. 13. Bayjanov, J. R., D. Molenaar, V. Tzeneva, R. J. Siezen, and S. A. van Hijum. 2012. PhenoLink--a web-tool for linking phenotype to ~omics data for bacteria: application to gene-trait matching for Lactobacillus plantarum strains. BMC Genomics 13:170. 14. Bergholz, T. M., A. I. Moreno Switt, and M. Wiedmann. 2014. Omics approaches in food safety: 22:275-281. 15. Black, E. P., K. Koziol-Dube, D. Guan, J. Wei, B. Setlow, D. E. Cortezzo, D. G. Hoover, and P. Setlow.fulfilling the promise? Trends in Microbiology Bacillus subtilis spores via activation of nutrient receptors by high pressure. Applied and Environmental Microbiology 71:5879-5887. 16. Boland, 2005. F. M., Factors A. Atrih, influencing H. Chirakkal, germination S. J. Foster, of and A. Moir. hydrolysis during germination of Bacillus subtilis 168 requires SleB and YpeB. Microbiology 146:57-64. 2000. Complete spore-cortex 17. Bron, P. A., M. Wels, R. S. Bongers, H. van Bokhorst-van de Veen, A. Wiersma, L. Overmars, M. L. Marco, and M. Kleerebezem. 2012. Transcriptomes reveal genetic signatures underlying physiological variations imposed by different fermentation conditions in Lactobacillus plantarum. PLoS ONE 7:e38720. 18. Brul, S., J. van Beilen, M. Caspers, A. O’Brien, C. de Koster, S. Oomes, J. Smelt, R. Kort, and A. Ter Beek. 2011. Challenges and advances in systems biology analysis of Bacillus spore physiology; Bacillus subtilis food isolate and a laboratory strain. Food Microbiology 28:221-227. molecular differences between an extreme heat resistant spore forming
22 General introduction
19. Burbulys, D., K. A. Trach, and J. A. Hoch. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64:545-552. 20. Burgess, S. A., D. Lindsay, and S. H. Flint. 2010. Thermophilic bacilli and their importance in dairy processing. International Journal of Food Microbiology 144:215-225. 21. Byrer, D. E., F. A. Rainey, and J. Wiegel. 2000. Novel strains of Moorella thermoacetica form unusually heat-resistant spores. Archives of Microbiology 174:334-339. 22. Cano, R., and M. Borucki. year-old Dominican amber. Science 268:1060-1064. 1 23. Carlin, F. 2011. Origin of bacterial 1995. Revival spores and contaminating identification foods. of bacterial Food Microbiology spores in 25- 28: to177-82. 40-million- 24. Cazemier, A. E., S. F. M. Wagenaars, and P. F. Ter Steeg. 2001. Effect of sporulation and recovery medium on the heat resistance and amount of injury of spores from spoilage bacilli. Journal of Applied Microbiology 90:761-770. 25. Checinska, A., A. Paszczynski, and M. Burbank. 2015. Bacillus and other spore-forming genera: Variations in responses and mechanisms for survival. Annual Review of Food Science and Technology 6:351-369. 26. Chirakkal, H., M. O’Rourke, A. Atrih, S. J. Foster, and A. Moir. enzymes and related proteins in Bacillus subtilis endospore germination. Microbiology 148:2383- 2392. 2002. Analysis of spore cortex lytic 27. Chung, J. D., G. Stephanopoulos, K. Ireton, and A. D. Grossman. cells of Bacillus subtilis: evidence that a threshold mechanism controls the initiation of sporulation. Journal of Bacteriology 176:1977-1984. 1994. Gene expression in single 28. Coleman, W. H., D. Chen, Y.-q. Li, A. E. Cowan, and P. Setlow. 2007. How moist heat kills spores of Bacillus subtilis. Journal of Bacteriology 189:8458-8466. 29. Coleman, W. H., P. Zhang, Y. q. Li, and P. Setlow. 2010. Mechanism of killing of spores of Bacillus cereus and Bacillus megaterium by wet heat. Letters in Applied Microbiology 50:507-514. 30. de Hoon, M. J. L., P. Eichenberger, and D. Vitkup. 2010. Hierarchical Evolution of the Bacterial Sporulation Network. Current biology : CB 20:R735-R745. 31. Deng, Y., Y. Zhu, P. Wang, L. Zhu, J. Zheng, R. Li, L. Ruan, D. Peng, and M. Sun. 2011. Complete genome sequence of Bacillus subtilis BSn5, an endophytic bacterium of Amorphophallus konjac with antimicrobial activity for the plant pathogen Erwinia carotovora subsp. carotovora. Journal of Bacteriology 193:2070-1. 32. Dijkstra, A., W. Alkema, M. Starrenburg, J. Hugenholtz, S. van Hijum, and P. Bron. 2014. Lactococcus lactis MG1363 reveals transcriptome signatures for robustness. Microbial Cell Factories 13:148. 33. Durand,Fermentation-induced L., S. Planchon, variation M.-H. Guinebretiere, in heat and oxidative F. Carlin, stress and phenotypesF. Remize. 2015. of Genotypic and phenotypic characterization of foodborne Geobacillus stearothermophilus. Food Microbiology 45, Part A:103-110. 34. Dutilh, B. E., L. Backus, R. A. Edwards, M. Wels, J. R. Bayjanov, and S. A. F. T. van Hijum. 2013.
Genomics 12:366-380. 35. Earl,Explaining A. M., microbial M. Eppinger, phenotypes W. F. Fricke, on a genomic M. J. Rosovitz, scale: GWAS D. A. for Rasko, microbes. S. Daugherty, Briefings inR. FunctionalLosick, R. Kolter, and J. Ravel. 2012. Whole-genome sequences of Bacillus subtilis and close relatives. Journal of Bacteriology 194:2378-9. 36. Earl, A. M., R. Losick, and R. Kolter. 2007. Bacillus subtilis genome diversity. Journal of Bacteriology 189:1163-1170. 37. Eijlander, R. T., T. Abee, and O. P. Kuipers. 2011. Bacterial spores in food: how phenotypic variability complicates prediction of spore properties and bacterial behavior. Current Opinion in Biotechnology 22:180-186. 38. Eijlander, R. T., A. de Jong, A. O. Krawczyk, S. Holsappel, and O. P. Kuipers. 2014. SporeWeb: an interactive journey through the complete sporulation cycle of Bacillus subtilis. Nucleic Acids Research 42:D685-91. 39. Errington, J. 2003. Regulation of endospore formation in Bacillus subtilis. Nature Reviews Microbiology 1:117-126. 40. Fan, L., S. Bo, H. Chen, W. Ye, K. Kleinschmidt, H. I. Baumann, J. F. Imhoff, M. Kleine, and D. Cai. 2011. Genome sequence of Bacillus subtilis subsp. spizizenii gtP20b, isolated from the Indian ocean.
23 Chapter 1
Journal of Bacteriology 193:1276-1277. 41. Galperin, M. Y., S. L. Mekhedov, P. Puigbo, S. Smirnov, Y. I. Wolf, and D. J. Rigden. 2012. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation- 14:2870-90. 42. Gerhardt, P., and R. E. Marquis. 1989. Spore thermoresistance mechanisms, p. 17-63. In I. Smith, R.specific A. Slepecky, genes. Environmentaland P. Setlow (ed.), Microbiology Regulation of prokaryotic development. American society for microbiology, Washington, D.C. 43. Ghosh, S., A. Ramirez-Peralta, E. Gaidamakova, P. Zhang, Y. Q. Li, M. J. Daly, and P. Setlow. 2011. Effects of Mn levels on resistance of Bacillus megaterium spores to heat, radiation and hydrogen 111:663-670. 44. Ghosh, S., and P. Setlow. 2009. Isolation and characterization of superdormant spores of Bacillus species.peroxide. Journal Journal of of Bacteriology Applied Microbiology 191:1787-1797. 45. Ghosh, S., P. Zhang, Y.-q. Li, and P. Setlow. 2009. Superdormant spores of Bacillus species have elevated wet-heat resistance and temperature requirements for heat activation. Journal of Bacteriology 191:5584-5591. 46. Granger, A. C., E. K. Gaidamakova, V. Y. Matrosova, M. J. Daly, and P. Setlow. 2011. Effects of Mn and Fe levels on Bacillus subtilis spore resistance and dffects of Mn2+, other divalent cations, orthophosphate, and dipicolinic acid on protein resistance to ionizing radiation. Applied and Environmental Microbiology 77:32-40. 47. Griffiths, K. K., and P. Setlow. Bacillus subtilis sporulation and spore properties. Journal of Applied Microbiology 106:2064-78. 48. Henriques, A. O., and J. Moran, 2009. Charles Effects P. 2007. of modification Structure, assembly,of membrane and functionlipid composition of the spore on surface layers. Annual Review of Microbiology 61:555-588. 49. Heyndrickx, M. 2011. The importance of endospore-forming bacteria originating from soil for contamination of industrial food processing. Applied and Environmental Soil Science 2011:11. 50. Higgins, D., and J. Dworkin. 2012. Recent progress in Bacillus subtilis sporulation. FEMS Microbiology Reviews 36:131-148. 51. Hilbert, D. W., and P. J. Piggot. Bacillus subtilis spore formation. Microbiology and Molecular Biology Reviews 68:234-262. 52. Hudson, K. D., B. M. Corfe, E. H. 2004.Kemp, Compartmentalization I. M. Feavers, P. J. Coote, of geneand A.expression Moir. 2001. during Localization of GerAA and GerAC germination proteins in the Bacillus subtilis spore. Journal of Bacteriology 183:4317-4322. 53. Huemer, I. A., N. Klijn, H. W. J. Vogelsang, and L. P. M. Langeveld. 1998. Thermal death kinetics of spores of Bacillus sporothermodurans isolated from UHT milk. International Dairy Journal 8:851- 855. 54. Kort, R., A. C. O’Brien, I. H. M. van Stokkum, S. J. C. M. Oomes, W. Crielaard, K. J. Hellingwerf, and S. Brul. 2005. Assessment of heat resistance of bacterial spores from food product isolates
71:3556-3564. 55. Kunst,by fluorescence F., N. Ogasawara, monitoring I. ofMoszer, dipicolinic A. M. acid Albertini, release. AppliedG. Alloni, and V. EnvironmentalAzevedo, M. G. Microbiology Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, N. J. Cummings, R. A. Daniel, F. Denizot, K. M. Devine, A. Dusterhoft, S. D. Ehrlich, P. T. Emmerson, K. D. Entian, J. Errington, C. Fabret, E. Ferrari, D. Foulger, C. Fritz, M. Fujita, Y. Fujita, S. Fuma, A. Galizzi, N. Galleron, S. Y. Ghim, P. Glaser, A. Goffeau, E. J. Golightly, G. Grandi, G. Guiseppi, B. J. Guy, K. Haga, J. Haiech, C. R. Harwood, A. Henaut, H. Hilbert, S. Holsappel, S. Hosono, M. F. Hullo, M. Itaya, L. Jones, B. Joris, D. Karamata, Y. Kasahara, M. Klaerr-Blanchard, C. Klein, Y. Kobayashi, P. Koetter, G. Koningstein, S. Krogh, M. Kumano, K. Kurita, A. Lapidus, S. Lardinois, J. Lauber, V. Lazarevic, S. M. Lee, A. Levine, H. Liu, S. Masuda, C. Mauel, C. Medigue, N. Medina, R. P. Mellado, M. Mizuno, D. Moestl, S. Nakai, M. Noback, D. Noone, M. O’Reilly, K. Ogawa, A. Ogiwara, B. Oudega, S. H. Park, V. Parro, T. M. Pohl, D. Portetelle, S. Porwollik, A. M. Prescott, E. Presecan, P. Pujic, B. Purnelle, et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390:249-256. 56. Leggett, M. J., G. McDonnell, S. P. Denyer, P. Setlow, and J. Y. Maillard. 2012. Bacterial spore structures and their protective role in biocide resistance. Journal of Applied Microbiology 113:485-
24 General introduction
498. 57. Leguerinel, I., O. Couvert, and P. Mafart. 2000. Relationship between the apparent heat resistance of Bacillus cereus spores and the pH and NaCl concentration of the recovery medium. International Journal of Food Microbiology 55:223-227. 58. Lenz, C. A., and R. F. Vogel. 2015. Differential effects of sporulation temperature on the high pressure resistance of Clostridium botulinum type E spores and the interconnection with sporulation medium cation contents. Food Microbiology 46:434-442. 59. Lewis, R. J., D. J. Scott, J. A. Brannigan, J. C. Ladds, M. A. Cervin, G. B. Spiegelman, J. G. Hoggett, I. 1 Barák, and A. J. Wilkinson. 2002. Dimer formation and transcription activation in the sporulation response regulator Spo0A. Journal of Molecular Biology 316:235-245. 60. Li, J., and B. A. McClane. 2008. A novel small acid soluble protein variant is important for spore resistance of most Clostridium perfringens food poisoning isolates. PLoS Pathogens 4:e1000056. 61. Li, J., D. Paredes-Sabja, M. R. Sarker, and B. A. McClane. 2009. Further characterization of Clostridium perfringens 4:e6249. 62. Li, Y., A. Davis, G. Korza, small P. Zhang, acid solubleY. Q. Li, protein-4B. Setlow, (Ssp4) P. Setlow, properties and B. Hao.and expression. 2012. Role ofPLoS a SpoVA ONE protein in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 194:1875-84. 63. Lima, L. J. R., H. J. Kamphuis, M. J. R. Nout, and M. H. Zwietering. 2011. Microbiota of cocoa powder with particular reference to aerobic thermoresistant spore-formers. Food Microbiology 28:573-582. 64. Lima, L. S. R. 2012. Microbial ecology of the cocoa chain: Quality aspects and insight into heat- resistant bacterial spores Wageningen University Wageningen. 65. Logan, N. A. 2012. Bacillus and relatives in foodborne illness. Journal of Applied Microbiology 112:417-429. 66. Loman, N. J., C. Constantinidou, J. Z. Chan, M. Halachev, M. Sergeant, C. W. Penn, E. R. Robinson, and M. J. Pallen. 2012. High-throughput bacterial genome sequencing: an embarrassment of choice, a world of opportunity. Nature Reviews Microbiology 10:599-606. 67. Luu-Thi, H., D. B. Khadka, and C. W. Michiels. 2014. Thermal inactivation parameters of spores from different phylogenetic groups of Bacillus cereus. International Journal of Food Microbiology 189:183-188. 68. Mafart, P., I. Leguérinel, O. Couvert, and L. Coroller. for assessment and optimization of heating processes: A never-ending story. Food Microbiology 27:568-572. 2010. Quantification of spore resistance 69. Markland, S. M., D. F. Farkas, K. E. Kniel, and D. G. Hoover. 2013. Pathogenic psychrotolerant sporeformers: an emerging challenge for low-temperature storage of minimally processed foods. Foodborne Pathogens and Disease 10:413-419. 70. Mathys, A., B. Chapman, M. Bull, V. Heinz, and D. Knorr. 2007. Flow cytometric assessment of Bacillus spore response to high pressure and heat. Innovative Food Science & Emerging Technologies 8:519-527. 71. McKenney, P. T., A. Driks, and P. Eichenberger. 2013. The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nature Reviews Microbiology 11:33-44. 72. Melly, E., P. C. Genest, M. E. Gilmore, S. Little, D. L. Popham, A. Driks, and P. Setlow. 2002. Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. Journal of Applied Microbiology 92:1105-1115. 73. Melly, E., and P. Setlow. Bacillus subtilis spores. Journal of Bacteriology 183:779-784. 74. Miller, R. A., D. J. Kent, M. 2001. J. Watterson, Heat shock K. proteins J. Boor, doN. H.not Martin, influence and wet M. heat Wiedmann. resistance 2015. of Spore
Dairy Science 98:8492-8504. 75. populationsMovahedi, S., among and W. bulk Waites. tank raw2000. milk A two-dimensionaland dairy powders protein are significantly gel electrophoresis different. study Journal of the of heat stress response of Bacillus subtilis cells during sporulation. Journal of Bacteriology 182:4758- 4763. 76. Nguyen Thi Minh, H., A. Durand, P. Loison, J.-M. Perrier-Cornet, and P. Gervais. 2011. Effect of sporulation conditions on the resistance of Bacillus subtilis spores to heat and high pressure.
25 Chapter 1
Applied Microbiology and Biotechnology 90:1409-1417. 77. Nicholson, W. L., N. Munakata, G. Horneck, H. J. Melosh, and P. Setlow. 2000. Resistance of Bacillus Molecular Biology Reviews 64:548-572. 78. Nicolas, endosporesP., U. Mäder, to E. Dervyn,extreme T.terrestrial Rochat, A. and Leduc, extraterrestrial N. Pigeonneau, environments. E. Bidnenko, Microbiology E. Marchadier, and M. Hoebeke, S. Aymerich, D. Becher, P. Bisicchia, E. Botella, O. Delumeau, G. Doherty, E. L. Denham, M. J. Fogg, V. Fromion, A. Goelzer, A. Hansen, E. Härtig, C. R. Harwood, G. Homuth, H. Jarmer, M. Jules, E. Klipp, L. Le Chat, F. Lecointe, P. Lewis, W. Liebermeister, A. March, R. A. T. Mars, P. Nannapaneni, D. Noone, S. Pohl, B. Rinn, F. Rügheimer, P. K. Sappa, F. Samson, M. Schaffer, B. Schwikowski, L. Steil, J. Stülke, T. Wiegert, K. M. Devine, A. J. Wilkinson, J. Maarten van Dijl, M. Hecker, U. Völker, P. Bessières, and P. Noirot. 2012. Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335:1103- 1106. 79. Ochman, H., J. G. Lawrence, and E. A. Groisman. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304. 80. Oomes, S. J. C. M., and S. Brul. 2004. The effect of metal ions commonly present in food on gene Bacillus subtilis cells in relation to spore wet heat resistance. Innovative Food Science & Emerging Technologies 5:307-316. 81. Oomes,expression S. J.of C. sporulating M., A. C. M. van Zuijlen, J. O. Hehenkamp, H. Witsenboer, J. M. B. M. van der Vossen, and S. Brul. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 82. Orsburn, B., S. B. Melville, and D. L. Popham. 2008. Factors contributing to heat resistance of Clostridium perfringens endospores. Applied and Environmental Microbiology 74:3328-3335. 83. Paidhungat, M., and P. Setlow. 2001. Localization of a germinant receptor protein (GerBA) to the inner membrane of Bacillus subtilis spores. Journal of Bacteriology 183:3982-3990. 84. Paredes-Sabja, D., P. Setlow, and M. R. Sarker. 2011. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends in Microbiology 19:85-94. 85. Paredes-Sabja, D., A. Shen, and J. A. Sorg. 2014. Clostridium difficile spore biology: sporulation, germination, and spore structural proteins. Trends in Microbiology 22:406-416. 86. Peck, M. W., S. C. Stringer, and A. T. Carter. 2011. Clostridium botulinum in the post-genomic era. Food Microbiology 28:183-191. 87. Pelczar, P. L., T. Igarashi, B. Setlow, and P. Setlow. 2007. Role of GerD in germination of Bacillus subtilis spores. Journal of Bacteriology 189:1090-1098. 88. Pelczar, P. L., and P. Setlow. 2008. Localization of the germination protein GerD to the inner membrane in Bacillus subtilis spores. Journal of Bacteriology 190:5635-5641. 89. Popham, D., B. Illades-Aguiar, and P. Setlow. 1995. The Bacillus subtilis dacB gene, encoding
synthesis and spore core dehydration. Journal of Bacteriology 177:4721-4729. 90. penicillin-bindingPopham, D. L. 2002. protein Specialized 5*, is partpeptidoglycan of a three-gene of the operonbacterial required endospore: for the proper inner spore wall cortexof the 59:426-433. 91. Postollec, F., A. G. Mathot, M. Bernard, M. L. Divanac’h, S. Pavan, and D. Sohier. 2012. Tracking spore-forminglockbox. Cellular bacteria and Molecular in food: Lifefrom Sciences natural biodiversity to selection by processes. International Journal of Food Microbiology 158:1-8. 92. Ragkousi, K., P. Eichenberger, C. van Ooij, and P. Setlow. essential for germination of Bacillus subtilis spores with Ca2+-dipicolinate. Journal of Bacteriology 185:2315-2329. 2003. Identification of a new gene 93. Reineke, K., A. Mathys, V. Heinz, and D. Knorr. 2013. Mechanisms of endospore inactivation under high pressure. Trends in Microbiology 21:296-304. 94. Rose, R., B. Setlow, A. Monroe, M. Mallozzi, A. Driks, and P. Setlow. 2007. Comparison of the properties of Bacillus subtilis spores made in liquid or on agar plates. Journal of Applied Microbiology 103:691-699. 95. Sanchez-Salas, J.-L., B. Setlow, P. Zhang, Y.-q. Li, and P. Setlow. 2011. Maturation of released spores is necessary for acquisition of full spore heat resistance during Bacillus subtilis sporulation. Applied and Environmental Microbiology 77:6746-6754. 96. Scheldeman, P., K. Goossens, M. Rodriguez-Diaz, A. Pil, J. Goris, L. Herman, P. De Vos, N. A.
26 General introduction
Logan, and M. Heyndrickx. 2004. Paenibacillus lactis sp. nov., isolated from raw and heat-treated milk. International Journal of Systematic and Evolutionary Microbiology 54:885-891. 97. Scheldeman, P., L. Herman, S. Foster, and M. Heyndrickx. 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 98. Schroeder, J. W., and L. A. Simmons. 2013. Complete genome sequence of Bacillus subtilis strain PY79. Genome Announcements 1. 99. Schyns, G., C. R. Serra, T. Lapointe, J. B. Pereira-Leal, S. Potot, P. Fickers, J. B. Perkins, M. Wyss, and A. O. Henriques. 2013. Genome of a gut strain of Bacillus subtilis. Genome Announcements 1. 1 100. Sedlak, M., V. Vinter, J. Adamec, J. Vohradsky, Z. Voburka, and J. Chaloupka. 1993. Heat shock applied early in sporulation affects heat resistance of Bacillus megaterium spores. Journal of Bacteriology 175:8049-8052. 101. Setlow, P. 2014. Germination of spores of Bacillus species: What we know and do not know. Journal of Bacteriology 196:1297-1305. 102. Setlow, P. 2003. Spore germination. Current Opinion in Microbiology 6:550-556. 103. Setlow, P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. Journal of Applied Microbiology 101:514-525. 104. Shah, I. M., M.-H. Laaberki, D. L. Popham, and J. Dworkin. 135:486-496. 105. Smith, J. L., J. M. Goldberg, and A. D. Grossman. 2014. Complete 2008. A eukaryotic-likegenome sequences Ser/Thr of Bacillus kinase subtilissignals bacteriasubsp. subtilis to exit laboratory dormancy strains in response JH642 to (AG174) peptidoglycan and AG1839. fragments. Genome Cell Announcements 2. 106. Stecchini, M. L., M. Del Torre, and P. Polese. 2013. Survival strategies of Bacillus spores in food. 51:905-9. 107. Sunde, E. P., P. Setlow, L. Hederstedt, and B. Halle. 2009. The physical state of water in bacterial spores.Indian Journal Proceedings of Experimental of the National Biology Academy of Sciences 106:19334-19339. 108. Talukdar, P. K., V. Olguín-Araneda, M. Alnoman, D. Paredes-Sabja, and M. R. Sarker. 2015. Updates on the sporulation process in Clostridium species. Research in Microbiology 166:225-235. 109. te Giffel, M. C., R. R. Beumer, S. Leijendekkers, and F. M. Rombouts. 1996. Incidence of Bacillus cereus and Bacillus subtilis in foods in the Netherlands. Food Microbiology 13:53-58. 110. te Giffel, M. C., A. Wagendorp, A. Herrewegh, and F. Driehuis. 2002. Bacterial spores in silage and raw milk. Antonie van Leeuwenhoek 81:625-630. 111. Tovar-Rojo, F., M. Chander, B. Setlow, and P. Setlow. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 184:584-587. 112. Valerio, F., P. De Bellis, M. Di Biase, S. L. Lonigro, B. Giussani, A. Visconti, P. Lavermicocca, and A. Sisto. Bacillus amyloliquefaciens as a species frequently associated with the ropy spoilage of bread. International Journal of Food Microbiology 2012. 156: Diversity278-85. of spore-forming bacteria and identification of 113. van Asselt, E. D., and M. H. Zwietering. 2006. A systematic approach to determine global thermal inactivation parameters for various food pathogens. International Journal of Food Microbiology 107:73-82. 114. van Melis, C. C. J., H. M. W. den Besten, M. N. Nierop Groot, and T. Abee. of the impact of single and multiple mild stresses on outgrowth heterogeneity of Bacillus cereus spores. International Journal of Food Microbiology 177:57-62. 2014. Quantification 115. van Zuijlen, A., P. M. Periago, A. Amézquita, A. Palop, S. Brul, and P. S. Fernández. 2010. Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilisation. Food Research International 43:1895- 1901. 116. Velasquez, J., G. Schuurman-Wolters, J. P. Birkner, T. Abee, and B. Poolman. 2014. Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel. Molecular Microbiology 92:813-23. 117. Vepachedu, V. R., and P. Setlow. 2007. Role of SpoVA proteins in release of dipicolinic acid during germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme. Journal of Bacteriology 189:1565-1572. 118. Vreeland, R. H., W. D. Rosenzweig, and D. W. Powers. 2000. Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal. Nature 407:897-900.
27 Chapter 1
119. Wang, G., P. Zhang, P. Setlow, and Y.-q. Li. 2011. Kinetics of germination of wet-heat-treated individual spores of Bacillus species, monitored by raman spectroscopy and differential interference contrast microscopy. Applied and Environmental Microbiology 77:3368-3379. 120. Warda, A. K., H. M. W. den Besten, N. Sha, T. Abee, and M. N. Nierop Groot. Bacillus cereus spores. International Journal of Food Microbiology 201:27-34. 2015. Influence 121. Warth,of food matrixA. D. 1978. on outgrowth Relationship heterogeneity between theof heat heat damaged resistance of spores and the optimum and Bacillus species. Journal of Bacteriology 134:699-705. 122. Xiao, Y., C. Francke, T. Abee, and M. H. J. Wells-Bennik. 2011. Clostridial spore germination versusmaximum bacilli growth: Genome temperatures mining and of current insights. Food Microbiology 28:266-274. 123. Xiao, Y., A. Wagendorp, T. Abee, and M. H. J. Wells-Bennik. 2015. Differential outgrowth potential of Clostridium perfringens food-borne isolates with various cpe-genotypes in vacuum- 194:40-45. 124. Yeo, I. C., N. K. Lee, and Y. T. Hahm. 2012. Genome sequencing of Bacillus subtilis SC-8, antagonistic topacked the Bacillus ground cereusbeef during group, storage isolated at from12°C. traditionalInternational Korean Journal fermented-soybean of Food Microbiology food. Journal of Bacteriology 194:536-7. 125. Zeigler, D. R. 2011. The genome sequence of Bacillus subtilis subsp. spizizenii W23: insights into speciation within the B. subtilis B. subtilis genetics. Microbiology 157:2033-41. complex and into the history of
28 Chapter 2
Two distinct groups within the Bacillus subtilis group display significantly different spore heat resistance properties
Erwin M. Berendsen Marcel H. Zwietering Oscar P. Kuipers Marjon H.J. Wells-Bennik
Published as: Berendsen EM, Zwietering MH, Kuipers OP, Wells-Bennik MHJ (2015). Two distinct groups within the Bacillus subtilis group display significantly different spore heat resistance properties. Food Microbiology 45, Part A:18-25. Chapter 2
Abstract The survival of bacterial spores after heat treatment and the subsequent germination and outgrowth in a food product can lead to spoilage of the food product and economical
requires access to detailed spore thermal inactivation kinetics of relevant model strains. losses. Prediction of time-temperature conditions that lead to sufficient inactivation In this study, the thermal inactivation kinetics of spores of fourteen strains belonging to the Bacillus subtilis group were determined in detail, using both batch heating in
capillary tubes and continuous flow heating in a micro heater. The inactivation data groups (p<0.001) within the B. subtilis were fitted using a log linear model. Based on the spore heat resistance data, two distinct had spores with an average D of 0.33 seconds, while the spores of the other group group could be identified. One group of strains 120˚C D of 45.7 seconds.
displayed significantly higher heat resistances, with an average 120˚C heating, the z When comparing spore inactivation data obtained using batch- and continuous flow -values were significantly different, hence extrapolation from one system from different strains in the B. subtilis group can vary greatly. Strains can be separated to the other was not justified. This study clearly shows that heat resistances of spores into two groups, to which different spore heat inactivation kinetics apply.
30 Two distinct groups of heat resistant spores
Introduction In the food industry, mesophilic, aerobic spore-forming bacteria are ubiquitously present (1, 9). Their dormant endospores are highly resistant to environmental insults, and are able to survive various preservation regimes commonly used in the food industry. Heat treatment is commonly applied in food processing to inactivate bacteria of spores, potentially leading to food spoilage upon germination and outgrowth, and, and their spores. Insufficient heat treatment of bacterial spores may allow for survival in the case of food borne pathogens, to food poisoning (4, 29). Depending on the spore affecting product quality. Hence, knowledge on required heat load to inactivate spores heat resistance, heating regimes may exceed the required heat load, often negatively in relation to product characteristics is important. 2
The heat resistance and germination properties of bacterial spores and their phenotypic variation are a major concern of the food industry (7, 10). Different Bacillus species including Bacillus cereus, Bacillus coagulans, Bacillus subtilis, and Bacillus sporothermodurans are able to form highly heat resistant spores that can survive the heating regimes that are commonly used in food preservation (28). Various spores belonging to the genera of Bacillus, Aneurinibacillus, and Paenibacillus are able to
Thesurvive heat heat resistance treatments of spores of temperatures can vary between higher than species 120°C and (30). even between strains of one species. Variation in spore heat resistance between different strains of Bacillus sp. indicated that strain variation in B. cereus has been reported, but not extensively studied. Van Asselt and Zwietering (2006) B. sporothermodurans, which produces spores that are highly significantly influences spore heat resistance heat resistant and can survive UHT treatments (8, 11, 33). For this bacterium, clear (31). Another example is differences were observed in decimal reduction times (D strains of various isolation sources (28). Variation in spore heat resistances of strains of -value) at 100°C for spores of B. subtilis isolated from different soups has also been reported (23). Kort et al. (2005) compared the spore heat resistances of a laboratory strain of B. subtilis 168 with that of B. subtilis A163 differences in spore heat resistances, namely a D which was isolated from peanut chicken soup, and found significant . In a study performed by Lima -value of 1.4 minutes at 105°C for et al. (2011), spores with high thermal resistance were isolated from cocoa powder. The strain 168 and 0.7 minutes at 120°C for strain A163 (13) spores with the highest thermal resistance mainly belonged to the B. subtilis group and displayed large variation in spore heat resistance after sporulation under laboratory conditions (15).
31 Chapter 2
The observed variations in spore heat resistance within a species can complicate predictive modeling and design of food processes. Therefore, better insight into spore heat resistance is required including the effect of strain variation on spore heat resistance.
In addition, most inactivation kinetics are determined in batch heating experiments, processes such as UHT treatment (5, 35, 36). Only a limited number of studies on spore thereby complicating the translation of the results to industrial flow inactivation
heat resistance have been performed in continuous flow heating systems. It has been heating for B. flexus and Geobacillus stearothermophilus (5). Wescott et al. (1995) also shown that the continuous flow heating system had a higher lethality compared to batch reported higher lethality of B. cereus batch heating (35). However, for spores from G. stearothermophilus, batch heating was spores during continuous flow heating than during (35). Clearly, there is a need to establish the effect of inactivation of spores in batch and shown to be more lethal compared to continuous flow heating at the tested conditions B. subtilis spores.
Thecontinuous aim of this flow study heating was for two-fold, namely, to assess variation in spore heat resistance between strains belonging to the B. subtilis group (18), and secondly to assess the spore
with batch heating data using capillary tubes. To this end, detailed spore inactivation inactivation kinetics in continuous flow heating using a micro heater and compare these kinetics were determined for fourteen strains of the B. subtilis group using batch heating
Materialsand continuous and flow methodsheating.
Bacterial strains and identification The strains investigated in this study were twelve industrial isolates, supplied by food manufacturers, and two type strains, namely B. subtilis 168 (Bacillus Genetic Stock Center (BGSC) 1A700) and the undomesticated strain B. subtilis NCIB 3610 (BGSC 3A1). The heat resistance of spores of these strains was initially screened; strains were selected based on these results, to include the largest variation possible (data not shown). All strains belong to the B. subtilis group and are listed in Table 1. For the two type strains the isolation source was not clear (38). Strain A163 is known to form spores with high thermal resistance properties (2, 13, 21, 23). Strains 4068, 4069, 4071, 4072, and 4073 correspond with strains CC2, IIC14, CC16, RL45, and MC85 that have been previously described (23). All strains were deposited in the NIZO culture collection and received a unique strain ID. For all industrial isolates a partial 16S rRNA sequence was
determined to verify the species level of the strains (12). Following amplification of performed by Baseclear (Leiden, The Netherlands). The sequences were used as query the partial 16S fragment using PCR, the product was purified and DNA sequencing was
32 Two distinct groups of heat resistant spores
Table 1. Strains used in this study, with corresponding strain numbers and isolation sources. Per strain the identification based on partial 16s rRNA are indicated and corresponding Genbank accession numbers.
Strain Received as Isolated from Identification Genbank Reference NIZO nr. based on 16S accession no. 1A700- type 4062 strain 168 Not relevant Not relevant Not relevant BGSC 3A1- type 4060 strain Not relevant Not relevant Not relevant BGSC NCIB3610 425 Sterilized milk B. amyloliquefaciens KF916630 This study Peanut chicken soup (2, 13, 21, 4067 A163 (sterilized in can) B. subtilis KF916631 23) Curry cream soup 2 4068 CC2 (sterilized in pouch) B. subtilis KF916632 (23) 4069 IIC14 B. subtilis KF916633 (23)
BindingCurry cream flour soup (ingredient) 4071 CC16 (sterilized in pouch) B. subtilis KF916634 (23) Red Lasagna sauce 4072 RL45 (pasteurized in glass jar) B. subtilis KF916635 (23) Curry soup 4073 MC85 (sterilized in glass jar) B. subtilis KF916636 (23) 4140 Pizza B. amyloliquefaciens KF916637 This study 4143 Surimi B. subtilis KF916638 This study 4144 Quiche B. vallismortis KF916639 This study 4145 Pasta B. subtilis KF916640 This study 4146 Curry sauce B. subtilis KF916641 This study
The designated species names per strain are presented in Table 1. For each strain, the input for identification against the database of the Ribosomal Database Project (RDP). nucleotide sequences were deposited in GenBank under accession numbers KF916630- KF916641.
Spore preparation Spore crops were prepared as described by Schaeffer et al. (1965) with slight
(NB, Difco), supplemented with 1mM MgSO , 13mM KCl, 0.13mM MnSO , 1mM CaCl , modifications (27). In short, the sporulation 4medium consisted of Nutrient4 Broth 8 g/L2 , 13mM KCl, 0.13mM MnSO , 1mM and a final pH of 7.0. For cultivation on plates the medium4 consisted of Nutrient4 Agar CaCl (NA, 2Difco) 23 g/L, supplemented with 1mM MgSO , with a final pH of 7.0 (NA). The Luria-Broth (LB) medium was inoculated from overnight cultures were diluted 100 times in sporulation medium and allowed to grow the -80°C stocks, and was incubated for 16 hours at 37°C, with shaking at 200 rpm. The until an OD600nm of 0.6, subsequently 200 µL of a culture was spread on three agar plates
33 Chapter 2
followed microscopically. The spores were harvested by swabbing the entire bacterial per strain. The plates were incubated at 37°C for seven days and spore formation was layer of three plates, combined in one tube, and washed by three successive steps in g The spore suspensions were stored in sterile water
sterile water (5000 x , 10 min, 4°C). at 4°C for at least one month to allow for spore maturation, before being used in heat- inactivation experiments. Two independent spore crops were prepared for each strain. Spore enumeration
minutes to inactivate germinated spores and vegetative cells and to allow for activation To determine the initial spore count, spore suspensions were heated at 80°C for 10 of germination. Subsequently, samples were serially diluted in peptone water, and appropriate dilutions were pour-plated in NA in duplicate. Based on the initial spore yields, the spore suspensions were further diluted prior to batch inactivation and
spores were determined following different heat treatments by serially diluting the continuous flow inactivation experiments, as described below. The number of surviving samples in peptone water and pour plating appropriate dilutions. All counts were
performed after incubation for five days at 37°C. Batch heating inactivation For each strain, the spore heat inactivation kinetics were determined in a batch heating
two independent spore preparations. For each spore preparation, the recoveries were system using capillary tubes. The experiments were performed twice per strain, using
points. The inactivation kinetics were determined as previously described by Xu et al. determined using three different temperatures, each with at least five different time
8 (37). In short, the spore suspensions were diluted to an initial count of approximately 1 with a pH of 7.4. A capillary tube (ø 1.0 mm, ø 0.8mm, length 150 mm, catalog no x 10 colony forming units per milliliter (CFU/mL,int in phosphate buffered saline (PBS), ext 50 µL, which was subsequently heat sealed. Each tube was completely submerged in 612-2806, VWR, Amsterdam, The Netherlands) was filled with a spore suspension of an oil bath at selected temperatures for a given time and subsequently transferred to an ice-water bath for 10 minutes. The sealed capillary tubes were then incubated in a hypochlorite solution (525 ppm) for 10 minutes and washed with sterile peptone water. The capillary tubes were then transferred to 5 mL sterile peptone water and crushed
as described before. Using the same method, the initial spore count was determined for with a magnetic stirrer by mixing on a vortex. The spores were subsequently enumerated minutes, and in the absence of a heat activation, to establish optimal germination, which each spore suspension following a heat treatment of 80°C for 10 minutes, 100°C for 10 might require heat activation.
34 Two distinct groups of heat resistant spores
Heat inactivation using continuous flow
For each strain, the continuous flow heat inactivation kinetics of spores were also on a small scale, as described by van der Veen et al. (32). The micro heater contains determined using an in-house continuous flow micro heater, mimicking UHT treatment a heating-up section in which the spore suspension is quickly heated to the desired submerged in an oil bath set to the desired temperature and a cooling section in which temperature using a heat exchanger, a holding section with a fixed length that is the spore suspension is rapidly cooled using a heat exchanger. The flow rate used for the in the heating-up and cooling section were 1.7 seconds for each section. The residence spore suspension in the micro heater was 5L/h. At this flow rate, the residence times times of the spore suspensions during heating in the three different holders with 2 different lengths were 3, 6 and 10 seconds. The heating experiments were performed spore suspension of 5 mL was inoculated in 5 L PBS, resulting in an initial spore count of for all strains and using6 one of the two spore crops of each strain. For each experiment, a strain the spores were pumped through the micro heater and subjected to different time- approximately 1 x 10 CFU/mL, which was determined before each experiment. For each temperature combinations: at each of the three set holding times, namely 3, 6 and 10 seconds, the spores suspensions were subjected to ten different temperatures. After each
Table 3). The viable spore counts before and after each time-temperature combination experiment the temperature of the holding section was lowered by 2°C (Supplementary were determined. In this way, spore suspensions of individual strains were subjected to result in outcomes ranging from complete inactivation to complete survival, with at least three set heating times and a temperature range spanning 20°C, which was selected to two data points showing detectable inactivation. Surviving spores were enumerated as described above.
Data analysis
For fourteen strains, extensive spore inactivation data were obtained from two log-linear model in equation 1, to determine the D-value, the decimal reduction time, independent spore crops using batch heating. The inactivation data were fitted with the suspension in the capillary tubes were calculated by taking the total time of submersion at the corresponding temperature, using Excel. The effective heating times of the spore in the oil bath minus the modeled time for heating-up and cooling down, which were calculated based on a z t (1): log(Nt)l= ogN()-value0 - of 10°C (3). D To determine the temperature dependency of the D-value, the z- value was determined. The z-value was calculated per strain based on the D-values of two independent spore
35 Chapter 2
crops, as the negative reciprocal of the slope of the plot of logD against the temperature, as displayed in equation 2.
(2): zs=−1/ lope (logDT,)
The logD values of all strains were plotted against the temperature to visualize strain variability. Based on this visualization, two groups of spore heat resistance were D values that cluster together. To compare the two groups with different spore heat resistances, the overall z-value, using equation 2, and subsequently identified with log the logDref equation 3. Based on the logD at the reference temperature, D-values can be estimated at a reference temperatureref of 120°C, were determined per group using at each desired temperature using equation 4.
(3): log(DDrefr=−intercept log,TT)/ef z
(4): loglDDTr=−og ef ()TT− ref / z
The 95% prediction interval (PI) of the logDref was calculated using the following equation: RSS (5): logDtrefD± F ,.10− 5α DF
Where tDF is the student t-value with degrees of freedom (DF), α is the confidence level deviating from the regression line. (α=0.05), and the residual sum of squares (RSS) is calculated from the data points
In the continuous flow system using the micro heater, the temperature is varied occurred a D-value was calculated using equation 1, based on the assumption of log- while the heating times are fixed. For each heating regime at which heat inactivation linear inactivation as determined in batch heating and using the effective heating time. D plotting the logD values against the temperature, a z-value was calculated for each strain -values that were higher than two times the experimental duration were excluded. By using equation 2. When plotting the logD values of all strains, the same two groups of
z-value and a logD and corresponding upper 95% PI were determined as described spore heat resistanceref were identified as in the batch experiments. For both groups a above.
Statistical analysis D values against the temperature. The F-test was performed to test if the slope and the intercept An F-test was used to test significant differences, based on the plotting of the log of the logD
of were significantly different. A confidence level of α = 0.05 was used. The
36 Two distinct groups of heat resistant spores
F-test was applied to test whether the two groups of with presumed different spore heat resistances were indeed significantly different. Additionally, the F-test was used to test for the two groups of heat resistant strains. significant differences between the batch and continuous flow heating, per strain and Comparison to literature data Literature data, in the form of D-values, was collected from 12 strains belonging to the B. subtilis group (13-16, 19). The D-values were log transformed and plotted within the 95% prediction intervals of the two groups of spore heat resistance as determined in 2 Resultsthe batch heating experiment.
Identification of strains For the twelve food isolates, the partial DNA sequences of 16S rRNA were determined belonged to the species B. subtilis, two strains belonged to the species B. amyloliquefaciens to identify the strains at the species level. The identification indicated that nine strains B. vallismortis (see Table 1). and one strain was identified as Spore heat inactivation kinetics following batch heating For fourteen strains of the B. subtilis group, the thermal inactivation kinetics were determined. The survival plots showed straight lines, without tailing (data not shown),
D-values based on at least five different time points per heating temperature. The inactivation were determined per strain per temperature. The D-values ranged from D of 1.15 plots were fitted with the log-linear inactivation model, by which the different minutes for strain 4144 to D of 0.53 minutes for strain 4067 as displayed100°C in Table 2.
Biological variation between125°C the different spore crops of the same strain was observed. The D-values per strain were log transformed and plotted against the temperature to determine the z-values per strain, based on two independent spore batches. The z-values
z-value estimation ranged ranged from 5.82°C (Standard Error (S.E.) ± 0.38°C) for strain 4073 to 8.32°C (± 0.93°C) from 0.90 to 1.00. for strain 4144 (Table 2). The regression coefficients of the Thereafter the logD values of all strains together were plotted against the temperature to visualize strain variation. Based on this visualization, spore heat resistance could be grouped in two clusters, as presented in Figure 1A. Strains 4060, 4062, 4140, 4143, 4144 belonged to the low spore heat resistance group, whereas strains 425, 4067, 4068, 4069, 4071, 4072, 4073, 4145, and 4146 all belonged to the high spore heat resistance
37 Chapter 2 - a Inter cept No No No N.T. No N.T. Slope F-test Significant difference No No No Yes No Yes 2 r 0.88 0.50 0.90 0.72 0.78 0.77 S.E 0.96 5.10 1.03 3.77 1.34 2.66 z - value (°C) Flow heating Flow 6.40 12.55 7.76 15.84 7.61 15.57 2 r 0.99 0.99 0.98 0.99 0.98 0.96 S.E 0.37 0.31 0.58 0.35 0.41 0.66 z - value (°C) 6.88 6.58 7.53 7.29 6.23 6.31 2 r 0.94 0.99 0.94 0.90 0.94 0.88 0.91 0.98 0.92 0.91 0.96 0.82 0.97 0.96 0.93 0.99 0.99 0.94 S.E. 0.22 0.05 0.05 0.06 0.53 0.01 0.42 0.04 0.02 0.06 0.15 0.02 0.41 0.06 0.01 0.08 0.01 0.61 D - value (min) Spore crop 2 crop Spore 2.97 1.58 0.53 0.84 5.81 0.13 2.93 0.79 0.16 0.65 2.63 0.13 8.23 0.58 0.14 1.56 0.23 10.24 2
r 0.96 0.99 0.99 0.91 0.96 0.67 0.90 0.98 0.99 0.90 0.95 0.90 0.97 0.98 0.92 1.00 0.98 0.89 S.E 0.21 0.07 0.01 0.08 0.40 0.02 0.38 0.02 0.00 0.09 0.21 0.02 0.79 0.02 0.01 0.17 0.01 1.93 Batch heating Batch Spore crop 1 crop Spore D - value (min) 3.53 1.79 0.24 0.65 4.64 0.10 4.39 0.66 0.15 0.83 3.73 0.21 12.59 0.57 0.12 2.36 0.28 18.14 Temperature Temperature (°C) 100 120 125 105 115 110 100 120 125 105 115 110 110 120 125 115 120 115 -value for each strain as determined using as determined each strain for z -value The calculated temperatures. different three at crops, spore the independent for per strain D -values calculated The Strain 4062 4068 4060 4069 425 4067 Table 2. Table heating the different between log D values, of the plotted intercept slope and the in the differences for significant test to test, F- The heating. flow and continuous batch methods used of the per strain.
38 Two distinct groups of heat resistant spores N.T. No N.T. No No No N.T. N.T. Yes No Yes No No No Yes Yes 0.90 0.67 0.82 0.91 0.73 0.77 0.88 0.85 1.50 3.47 4.55 0.83 3.70 2.36 1.11 2.18 2 12.94 10.96 13.59 6.03 13.74 12.34 10.10 11.56 0.91 0.97 0.98 1.00 0.90 0.95 0.97 0.96 1.03 0.66 0.38 0.17 1.22 0.93 0.56 0.70 6.68 7.80 5.82 7.21 7.50 8.32 6.09 6.90 0.98 0.92 0.77 0.93 0.96 0.90 0.90 0.97 0.96 0.85 0.95 0.94 0.93 0.75 0.87 0.91 0.87 0.96 0.97 0.99 0.99 0.95 0.89 0.97 0.53 0.08 0.04 0.14 0.02 0.02 0.64 0.04 0.01 0.64 0.09 0.02 0.13 0.10 0.01 0.13 0.04 0.01 0.33 0.07 0.01 0.55 0.13 0.02 10.36 1.31 0.30 2.66 0.60 0.18 4.77 0.79 0.13 3.32 0.58 0.14 1.62 0.80 0.07 1.15 0.25 0.09 9.15 1.52 0.33 9.27 2.25 0.48 0.83 0.88 0.97 0.91 0.96 0.96 0.92 0.98 0.93 0.94 0.96 0.98 0.99 0.99 0.91 0.88 0.74 0.91 0.91 0.92 0.97 0.92 0.99 0.95 2.48 0.08 0.03 0.27 0.05 0.01 0.92 0.03 0.01 0.36 0.06 0.02 0.14 0.07 0.02 0.24 0.14 0.01 1.99 0.36 0.02 1.94 0.10 0.03 18.64 1.18 0.65 3.14 0.99 0.12 9.64 0.92 0.13 3.30 0.60 0.13 3.47 0.85 0.17 1.73 0.54 0.08 17.64 2.96 0.26 22.83 3.03 0.56 110 115 120 115 120 125 115 120 125 100 105 110 100 105 110 100 105 110 115 120 125 105 110 115 4071 4072 4073 4140 4143 4144 4145 4146 ) 2. ( continued Table = Not tested a. N.T.
39 Chapter 2
group. The variation within the lower resistant group was smaller compared to the variation within the high heat resistant group. The slopes of the two groups of spore
z-values for the low heat resistance were not significantly different (p=0.09), whereas the intercepts of the z-value for the high heat resistant group two groups were significantly different (p<0.0001). The calculated D and corresponding upper 95% upper heat resistant group was 7.6°C (± 0.4°C) and theref prediction interval, were calculated (Table 3) and corresponding D , which was 0.34 was 9.5°C (± 0.8°C). For both groups the log 120°C
seconds (upper 95% PI = 0.74 seconds) for the low spore heat resistance group and 45.7 the literature data of twelve strains belonging to the B. subtilis group (Supplementary seconds (upper 95% PI = 242 seconds) for the high spore heat resistance group. Plotting material 1), displayed that most data points fell within the 95% PI of the two groups of
spore heat resistance identified in this study. Spore heat inactivation kinetics following continuous flow heating D-value was calculated for each data point where inactivation occurred (Supplementary material 2). The z-values were calculated For the analysis of the flow heating data, a
z-value ranged from 0.50 to 0.90, per strain and ranged from 6.03°C (± 0.83°C) for strain 4140 to 15.84°C (± 3.77°C) D values for strain 4069. The regression coefficients for the against the temperature showed the same separation in two groups of spore heat indicating a large variation in the goodness of the fit. The plotting of all the log
the same strains (Figure 1B). The slopes of the plotted logD-values, and thus the z-value, resistance as observed in the batch heating experiment, with both groups encompassing
z-value for the low did not differ significantly between the two groups (p=0.068), while the intercept z-value for the high was again found significantly different (p<0.0001). The calculated spore heat resistance group was 12.7°C (± 1.8°C), whereas the were 0.55 and 0.47 for the low and high spore heat resistance groups, respectively. For heat resistance group was 18.3°C (± 2.2°C). The corresponding regression coefficients both groups the logDref and corresponding upper 95% upper prediction interval were calculated (Table 3), and corresponding D
120°C which was 0.07 seconds (upper 95% PI = 26.9 seconds ) for the high spore heat resistance group. 2.34 seconds) for the low spore heat resistance group and 8.5 seconds (upper 95% PI = Spore inactivation during batch and continuous flow heating Per strain the plotted logD
values of the batch heating and the continuous flow heating of the plotted logD values, signifying the z-value, during batch heating and continuous were tested for significant differences in the slope and the intercept (Table 2). The slopes
flow heating did not differ significantly for eight strains. Additionally, from these eight strains, for six strains the intercept did not differ significantly. For the other two strains,
40 Two distinct groups of heat resistant spores
2
Figure 1. Plot of the estimated logD values, plotted against the temperature of fourteen strains of the B. subtilis group and corresponding 95% prediction intervals, determined in capillary tubes (A), determined in a micro- heater (B), and the combined data sets (C). The literature logD values were plotted in the 95% prediction interval of the batch heating (D) The symbol ● represents the data points from the lower spore heat resistance group and ■ represents the data points of the higher spore heat resistance group, determined using batch heating. The ○ symbol represents the data points from the low spore heat resistance group and □ represents the data points from the high spore heat resistance group, determined in the micro-heater. The symbol▲ represents low spore heat resistance data and represents high spore heat resistance data from literature. the slopes of the plotted logD z values during batch heating and continuous flow heating heating. For the groups with either low or high spore heat resistances, the slopes of differed significantly, and the -value was higher in flow heating compared to batch the plotted logD z -values differed significantly when comparing the batch- and the system than in the batch heating system. continuous flow heating system. The -value was generally higher in the flow heating Discussion In this study we established that spores of different B. subtilis group isolates display based on a thorough analysis of the spore heat resistances of fourteen strains, using highly significant differences in heat resistance. Two distinct groups could be identified provides a detailed description of variation in spore heat resistance of B. subtilis group a wide range of time-temperature combinations for heat exposure. This study thus
41 Chapter 2
Table 3. The calculated z-values and logDref for the two groups of spore heat resistance, for batch heating and continuous flow heating.
2 Spore heat resistance Heating z-value S.E. r logDref Upper D n group method (min) 95% PI (s) 120 °C Low spore heat Batch 7.5 0.4 0.92 -2.24 -1.91 0.34 30 resistance Flow 12.7 1.8 0.55 -1.92 -1.41 0.72 40 High spore heat Batch 9.3 0.8 0.72 -0.12 0.61 45.7 54 resistance Flow 18.3 2.2 0.47 -0.85 -0.35 8.5 81
strains, and renders a modeling approach using two spore inactivation kinetics for highly heat resistant strains versus lower heat resistant strains. The spore heat resistance varied from a D of 0.34 seconds for the low spore heat resistance group to a D
of 45.7 seconds120°C for the high spore heat resistance group, thus a factor 130 different.120°C Moreover, spore heat resistance is commonly determined under laboratory conditions
widely applied, often using higher temperatures and shorter heating times, leaving using batch heating systems, while in industry, continuous flow heat inactivation is
the inactivation kinetics for fourteen strains of B. subtilis the question whether extrapolation of batch data to flow data is justified. In this study, differences in the z group showed significant -value between batch heating and continuous flow heating, hence extrapolation from one heating system to the other is not justified. While the heating strain variability was much greater than the impact of this variable. systems have an influence on the efficacy of spore inactivation, overall, the impact of Based on spore heat resistance, strains of the B. subtilis group could be grouped into two clusters when plotting the logD values against temperature. This holds true for
cases, the same strains clustered together. Variation in spore heat resistance of strains both the batch inactivation data and the continuous flow inactivation data, and in both within the B. subtilis species and B. subtilis group has been reported before (15, 23). For Clostridium perfringens, strain variation in spore heat resistance was observed with varying D values ranging from 5.5 minutes to 120.6 minutes (24). In addition for B.
cereus, where90°C spore inactivation kinetics were globally assessed, strain variation was
allowed for a statistical analysis that rendered two groups with respect to spore heat identified as significant factor (31). The high number of strains used in the current study resistance. In our analysis, strain B. subtilis A163 was incorporated (corresponding with strain nr. 4067) and showed D values of 1.79 and 1.53 minutes, which is higher than
the previously reported D 120°Cof 0.7 minutes by Kort et al. (13). However, the reported
z- 120°C , i.e. D -value is the different value of 6.1°C for this strain (13) was similar to the z-values foundC in this study preparation method of spores, on plates in this study, and in liquid medium for the other 6.3°C (± 0.7°C). A possible explanation for the difference in 120°
experiment (13). The phenomenon that spores produced on surfaces are more heat
42 Two distinct groups of heat resistant spores
resistant than spores produced from planktonic cells in liquid media has previously been reported by Rose et al. (25), who observed higher spore heat resistances for B. subtilis when spores were prepared following growth on agar plates compared with heat resistance. Generally, the higher the sporulation temperature, the higher the liquid medium. There are multiple other factors known to contribute to the final spore B. subtilis in a natural final spore heat resistance properties (20). The sporulation of allows the formation of more heat resistant spores (17, 34). The composition of the or a processing environment might occur in biofilms, and complex colony growth sporulation medium is also important, including different salts added to the medium, such as magnesium, manganese, potassium, and in particular calcium, are known to B. subtilis (2, 21, 22). Calcium is also 2 required for a spore to reach full heat resistance, after release from the mother cell, in increase the final heat resistance of spores of the maturation process (26). In this study, the spores of all strains were allowed to form and mature under the same conditions, to rule out the effect of variation in sporulation conditions on spore heat resistance. No variations in sporulation conditions were applied; the observed differences in spore heat resistance between strains are thus heat resistance decreases after re-sporulation under laboratory conditions (15, 33). It a specific property of the strain. A generally observed phenomenon is that the spore such as the sporulation and maturation conditions, is not known. The points obtained is important to consider that the exact history of spores encountered in food matrices, by plotting of the literature data fell mainly within the prediction intervals of the two groups of spore heat resistance. This suggests that variation in spore heat resistance under different conditions. is strain specific, since the literature data originated from strains that were sporulated
In continuous flow heating using the micro heater the main variable factor was the temperature, with fixed times. The time-temperature combinations in continuous flow heating consisted of relatively short times and high temperatures, while heat exposure in batch heating was characterized by longer heating times and somewhat the plotted logD values, signifying the z lower temperatures. For eight strains there was no significant difference in the slope of heating. However, for two out of the eight strains, the intercept, signifying the spore heat -value, comparing batch- and continuous flow z resistance, did differ significantly. For the other six strains, the -value was significantly higher determined in continuous flow heating compared to batch heating. Thus, the strain within the B. subtilis group. justification of extrapolation from one heating system to the other, varies from strain to Additionally, for the two groups of spore heat resistance that clustered together, in both cases the slopes of the plotted logD values, signifying the z
-value, were significantly different when comparing batch and continuous flow heating. For the two groups of 43 Chapter 2
The z spore heat resistance, extrapolation from one heating system to the other is not justified. -value was higher when determined in the continuous flow heating, and thus at ranges, generally higher z-values were observed (6). Dogan et al. (2009). observed a higher temperatures. This is consistent with the finding that at higher temperature B. flexus and G. stearothermophilus spores (5). In accordance, Wescott et al. (1995) determined a higher higher lethality for continuous flow heating compared to batch heating for B. cereus compared to batch heating (35). However, in contrast to the results from this study, for G. stearothermophilus a lethatlity for continuous flow heating for spores of
z- higher lethality for batch heating was observed compared to continuous flow heating. In in lethality would depend on the time-temperature combination selected. To globally this study significant differences in the value were identified, therefore the difference assess the impact of variation in the z-value on inactivation kinetics, the D and D
were calculated for the two groups of spore heat resistance and for the 100°Ctwo different145°C heating systems. Due to the difference in z-value, the inactivation of spores from stains
in both the low and high spore heat resistance groups was more efficient in continuous flow heating than in batch heating at 100°C, whereas batch heating was more efficient is important to consider the two groups of spore heat resistance and the variation in than continuous flow heating at 145°C. When designing a heat inactivation process it z-value among strains and between the different heating methods.
Multiple time-temperature combinations can be proposed, based on batch heating in capillary tubes, to distinguish the two groups of spore heat resistance within the B. subtilis the low spore heat resistance group and a 0.1 log reduction for the high spore heat group. Heating for one hour at 100°C, will result in a 10.2 log reduction for resistance group, using the logDref from the batch heating experiment. Using a similar spore heat resistance group, and a 0.1 log reduction for the high spore heat resistance approach, heating for 5 minutes at 110°C will result in a 18.6 log reduction for the low group. It should be noted that the proposed time-temperature combinations are based on spores prepared under laboratory conditions, and do not include variations in spore heat resistance based on the history of the spores and a potential effect of the food
matrix.Conclusions In this study the spore heat inactivation kinetics were determined in detail for fourteen strains belonging to the B. subtilis group. Two distinct groups of spore heat resistance
heating using a micro-heater. The spore heat resistance within B. subtilis can be were identified, with batch heating using capillary tubes, and with continuous flow separated in two groups, suggesting that spore heat resistance is not a species, but
rather a strains specific property.
44 Two distinct groups of heat resistant spores
Acknowledgements The authors would like to thank Adriana Sterian and Verena Klaus for technical
Referencesassistance during the inactivation experiments. 1. Anonymous. Bacillus cereus and other Bacillus spp. in foodstuffs. The EFSA Journal 175:1-48. 2. Cazemier, A. E.,2005. S. F. Opinion M. Wagenaars, of the Scientific and P. F. PanelTer Steeg. on Biological 2001. Effect Hazards of sporulation on and recovery medium on the heat resistance and amount of injury of spores from spoilage bacilli. Journal of Applied Microbiology 90:761-770. 3. David, J. R. D., and R. L. Merson. 1990. Kinetic parameters for inactivation of Bacillus stearothermophilus at high temperatures. Journal of Food Science 55:488-493. 4. De Jonghe, V., A. Coorevits, J. De Block, E. Van Coillie, K. Grijspeerdt, L. Herman, P. De Vos, and 2 M. Heyndrickx. raw milk. International Journal of Food Microbiology 136:318-325. 5. Dogan, Z., K. Weidendorfer, 2010. Toxinogenic M. Müller-Merbach, and spoilage potential F. Lembke, of aerobic and J. Hinrichs.spore-formers 2009. isolated Inactivation from kinetics of Bacillus spores in batch- and continuous-heating systems. LWT - Food Science and Technology 42:81-86. 6. Edwards, J. L., F. F. Busta, and M. L. Speck. 1965. Thermal inactivation characteristics of Bacillus subtilis spores at ultrahigh temperatures. Applied Microbiology 13:851-857. 7. Eijlander, R. T., T. Abee, and O. P. Kuipers. 2011. Bacterial spores in food: how phenotypic variability complicates prediction of spore properties and bacterial behavior. Current Opinion in Biotechnology 22:180-186. 8. Esteban, M. D., J. P. Huertas, P. S. Fernandez, and A. Palop. 2013. Effect of the medium characteristics and the heating and cooling rates on the nonisothermal heat resistance of Bacillus sporothermodurans IC4 spores. Food Microbiology 34:158-63. 9. Gould, G. W. 2006. History of science – spores. Journal of Applied Microbiology 101:507-513. 10. Hornstra, L. M., A. Ter Beek, J. P. Smelt, W. W. Kallemeijn, and S. Brul. 2009. On the origin of heterogeneity in (preservation) resistance of Bacillus spores: Input for a ‘systems’ analysis approach of bacterial spore outgrowth. International Journal of Food Microbiology 134:9-15. 11. Huemer, I. A., N. Klijn, H. W. J. Vogelsang, and L. P. M. Langeveld. 1998. Thermal death kinetics of spores of Bacillus sporothermodurans isolated from UHT milk. International Dairy Journal 8:851- 855. 12. Klijn, N., A. H. Weerkamp, and W. M. de Vos.
probes. Applied and Environmental Microbiology 1991. 57: Identification3390-3393. of mesophilic lactic acid bacteria 13. Kort,by using R., A. polymerase C. O’Brien, chain I. H. M. reaction-amplified van Stokkum, S. variable J. C. M. Oomes, regions W. of Crielaard, 16S rRNA K. and J. Hellingwerf, specific DNA and S. Brul. 2005. Assessment of heat resistance of bacterial spores from food product isolates
71:3556-3564. 14. Leguerinel,by fluorescence I., O.monitoring Couvert, ofand dipicolinic P. Mafart. acid release. Applied and Environmental Microbiology temperature upon the bacterial spore heat resistance, application to heating process calculation. International Journal of Food Microbiology 114: 2007.100-4. Modelling the influence of the sporulation 15. Lima, L. J. R., H. J. Kamphuis, M. J. R. Nout, and M. H. Zwietering. 2011. Microbiota of cocoa powder with particular reference to aerobic thermoresistant spore-formers. Food Microbiology 28:573-582. 16. Lima, L. S. R. 2012. Microbial ecology of the cocoa chain: Quality aspects and insight into heat- resistant bacterial spores Wageningen University Wageningen. 17. Lindsay, D., Br, V. S. zel, and A. von Holy. Bacillus cereus and Bacillus subtilis during nutrient limitation. Journal of Food Protection 69:1168-1172. 18. Logan, N. A., and P. Vos. 2009. Bergey’s Manual 2006. ofBiofilm-spore Systematic Bacteriology, response in vol. Volume 3: The Firmicutes. 19. Nakayama, A., Y. Yano, S. Kobayashi, M. Ishikawa, and K. Sakai. 1996. Comparison of pressure
45 Chapter 2
bacillus strains with their heat resistances. Applied and Environmental Microbiology 62:3897-900. 20. resistancesNicholson, ofW. spores L., N. ofMunakata, six G. Horneck, H. J. Melosh, and P. Setlow. 2000. Resistance of Bacillus Molecular Biology Reviews 64:548-572. 21. Oomes, endosporesS. J. C. M., and to S.extreme Brul. 2004. terrestrial The effect and extraterrestrialof metal ions commonly environments. present Microbiology in food on gene and Bacillus subtilis cells in relation to spore wet heat resistance. Innovative Food Science & Emerging Technologies 5:307-316. 22. Oomes,expression S. J. of C. sporulating M., M. J. Jonker, F. R. A. Wittink, J. O. Hehenkamp, T. M. Breit, and S. Brul. 2009. The effect of calcium on the transcriptome of sporulating B. subtilis cells. International Journal of Food Microbiology 133:234-242. 23. Oomes, S. J. C. M., A. C. M. van Zuijlen, J. O. Hehenkamp, H. Witsenboer, J. M. B. M. van der Vossen, and S. Brul. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 24. Orsburn, B., S. B. Melville, and D. L. Popham. 2008. Factors contributing to heat resistance of Clostridium perfringens endospores. Applied and Environmental Microbiology 74:3328-3335. 25. Rose, R., B. Setlow, A. Monroe, M. Mallozzi, A. Driks, and P. Setlow. 2007. Comparison of the properties of Bacillus subtilis spores made in liquid or on agar plates. Journal of Applied Microbiology 103:691-699. 26. Sanchez-Salas, J.-L., B. Setlow, P. Zhang, Y.-q. Li, and P. Setlow. 2011. Maturation of released spores is necessary for acquisition of full spore heat resistance during Bacillus subtilis sporulation. Applied and Environmental Microbiology 77:6746-6754. 27. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolic repression of bacterial sporulation. Proceedings of the National Academy of Sciences 54:704-711. 28. Scheldeman, P., L. Herman, S. Foster, and M. Heyndrickx. 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 29. Scheldeman, P., A. Pil, L. Herman, P. De Vos, and M. Heyndrickx. 2005. Incidence and diversity of potentially highly heat-resistant spores isolated at dairy farms. Applied and Environmental Microbiology 71:1480-94. 30. te Giffel, M. C., A. Wagendorp, A. Herrewegh, and F. Driehuis. 2002. Bacterial spores in silage and raw milk. Antonie van Leeuwenhoek 81:625-630. 31. van Asselt, E. D., and M. H. Zwietering. 2006. A systematic approach to determine global thermal inactivation parameters for various food pathogens. International Journal of Food Microbiology 107:73-82. 32. van der Veen, S., A. Wagendorp, T. Abee, and M. H. J. Wells-Bennik. 2009. Diversity assessment of heat resistance of Listeria monocytogenes Food Protection 72:999-1004. 33. van Zuijlen, A., P. M. Periago, A. Amézquita, strains A. in Palop, a continuous-flow S. Brul, and heating P. S. Fernández. system. Journal 2010. of Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilisation. Food Research International 43:1895- 1901. 34. Veening, J.-W., O. P. Kuipers, S. Brul, K. J. Hellingwerf, and R. Kort. 2006. Effects of phosphorelay Bacillus subtilis. Journal of Bacteriology 188:3099-3109. 35. perturbationsWescott, G. G., on T. architecture, M. Fairchild, sporulation, and P. M. and Foegeding. spore resistance 1995. inBacillus biofilms cereus of and Bacillus stearothermophilus Science 60:446-450. 36. Witthuhn, M., G. Lucking, spore Z. inactivation Atamer, M. in Ehling-Schulz, batch and continuous and J. Hinrichs. flow systems. 2011. Thermal Journal resistance of Food of aerobic spore formers isolated from food products. International Journal of Dairy Technology 64:486-493. 37. Xu, S., T. P. Labuza, and F. Diez-Gonzalez. 2006. Thermal inactivation of Bacillus anthracis spores in cow’s milk. Applied and Environmental Microbiology 72:4479-4483. 38. Zeigler, D. R., Z. Pragai, S. Rodriguez, B. Chevreux, A. Muffler, T. Albert, R. Bai, M. Wyss, and J. B. Perkins. 2008. The origins of 168, W23, and other Bacillus subtilis legacy strains. Journal of Bacteriology 190:6983-95.
46 Chapter 3
A mobile genetic element profoundly increases heat resistance of bacterial spores
Erwin M. Berendsen Jos Boekhorst Oscar P. Kuipers Marjon H.J. Wells-Bennik
Accepted for publication as: Berendsen EM, Boekhorst J, Kuipers OP, Wells-Bennik MHJ (Accepted). A mobile genetic element profoundly increases heat resistance of bacterial spores. ISME J. Chapter 3
Abstract Bacterial endospores are among the most resilient forms of life on earth and are
intrinsically resistant to extreme environments and antimicrobial treatments. developmental process often initiated in response to nutrient deprivation. Although the Their resilience is explained by unique cellular structures formed by a complex macromolecular structures of spores from different bacterial species are similar, their resistance to environmental insults differs widely. It is not know which of the factors attributed to spore resistance confer very high-level heat resistance. Here, we provide conclusive evidence that in B. subtilis this is due to the presence of a mobile genetic element (Tn1546 that encode homologs of SpoVAC, SpoVAD and SpoVAEb and four other genes encoding -like) carrying five predicted operons, one of which contains genes proteins with unknown functions. This operon, named spoVA2mob, confers high-level heat resistance to spores. Deletion of spoVA2mob in a B. subtilis strain carrying Tn1546 renders heat-sensitive spores while transfer of spoVA2mob into B. subtilis 168 yields highly heat-resistant spores. Based on the genetic conservation of different spoVA operons among sporeforming species of Bacillaceae we propose an evolutionary scenario for B. subtilis, B. licheniformis and B. amyloliquefaciens. This discovery opens up avenues for improved detection and control the emergence of extremely heat resistant spores in of sporeforming bacteria able to produce highly heat resistant spores.
48 A mobile genetic element profoundly increases heat resistance of spores
Introduction The bacterial endospore is one of the most resistant life-forms on earth with astounding longevity that may exceed thousands of years (9, 49). Endospores can survive exposure and disinfectants (44). Sporeforming species belonging to the Firmicutes have broad to extremes of temperature but also other stresses such as desiccation, radiation, biotechnological applications in fermentation processes, gut health promotion (probiotics), crop protection and increasing crop yields, as carriers for vaccine antigens, and in the production of a range of useful chemicals, enzymes and fuels (13, 14). However, some of the species are pathogenic and their spores play a pivotal role in the spread of infection (e.g. Bacillus anthracis, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Clostridium botulinum) (21, 34, 36, 38). Pathogenic sporeformers are estimated to cause over 1 million cases of foodborne illness in the USA alone (e.g. due to C. perfringens and Bacillus cereus) (40, 39). Furthermore, several non-pathogenic the presence of heat-resistant spores that survive processes such as pasteurization bacterial sporeformers are a cause of major financial losses to the food industry through or even sterilization, leading to reduced shelf life, food spoilage and subsequent food waste (39, 41). 3
The tremendous importance of spores has prompted considerable effort to understand the molecular mechanisms responsible for their resistance properties (16, 18, 31, 45). coat and membranes, contribute to resistance properties (8, 44). However, it remains It is known that different features of the spore, including components in the core, cortex, while others succumb quickly (7, 28, 33). unknown why spores of some strains are able to withstand extreme heat treatments, In this study, we investigated determinants of high-level heat resistance of spores of Bacillus subtilis strains that were isolated from diverse sources. Therefore, the genome sequences and the heat resistance properties of spores of these strains were determined. A comparative genomics approach revealed the presence of a transposon only in strains producing high-level heat resistant spores. The genes in the transposon were shown to contribute to high-level heat resistance of spores and their occurrence was assessed in other species belonging to the family of Bacillaceae.
Materials and methods
Strains, sporulation, and establishing spore heat resistance For eighteen strains of B. subtilis, nine strains of B. amyloliquefaciens and nine strains of B. licheniformis the heat resistance of spores was characterized as described previously (7) (Supplementary Table 1). Detailed spore heat inactivation kinetics were previously
49 Chapter 3
determined for eleven strains of B. subtilis and two strains of B. amyloliquefaciens (7). For the other strains, spores were prepared and detailed inactivation kinetics were determined. The heat resistance of spores was visualized by plotting the calculated decimal reduction time (D- for spores of different strains (7). value) at a given temperature (for example 100°C or 112.5°C) The genome sequences of eight B. subtilis strains were publicly available, and the genomes of the other ten B. subtilis strains were sequenced (Supplementary Table 2) (6). In addition, the genomes of two strains of B. amyloliquefaciens and all nine strains of B. licheniformis were sequenced (Supplementary Table 2).
Phenotype-genotype matching and genome analysis To compare the genome content of members of the Bacillaceae family, orthology matrices were constructed based on the predicted protein content of the strains using Ortho-MCL (26). Three different orthology matrices were constructed, namely, one for the 18 strains of B. subtilis (Dataset 1), another for the strains of B. licheniformis, the B. amyloliquefaciens strains with available genome sequences, B. subtilis strain 168 and strain B4146 (Dataset 2), and a third one for 103 spore forming members of the Bacillaceae to the B. subtilis group, 33 strains of B. cereus, Anoxybacillus flavithermus, (Dataset 3) (26). The latter orthology matrix contained 35 strains belonging 23 strains of Geobacillus spp., two strains of Caldibacillus debilis, one strain of B. five strains of sporothermodurans, and four strains of B. thermoamylovorans (Supplementary Table 2).
Phenotype-genotype matching was performed for the eighteen B. subtilis strains using Phenolink (4), with low- or high-level heat resistance of spores as the phenotypic input,
target genes were visualized using Artemis (10) and Artemis Comparison Tool (ACT) and the orthology matrix (Dataset 1) as genotypic input. The genomic locations of (11). For B. subtilis strains, detailed gene and operon predictions within the Tn1546 transposon were made using FGENESB (www.softberry.com) and predictions were
manually inspected. Specific insertion locations of the transposon and the number of Supplementary Table 3. transposon elements present per strain was verified by PCR using primers as listed in
predicted protein sequences of all genes that are conserved in a single copy in all 103 A maximum likelihood core genome phylogenetic tree was constructed based on the Bacillaceae strains that were selected. Protein alignments were made using MUSCLE (15) and the phylogenetic trees were constructed using PHYML (20). The number and organization of spoVA
genes in the genomes was verified using the orthology Model (HMM) was constructed per orthologous group (OG), that was used to search matrix of the 103 strains. To find potential functional equivalents, a Hidden Markov
50 A mobile genetic element profoundly increases heat resistance of spores
spore forming Bacillaceae for predicted SpoVAC and SpoVAD. Protein alignments and against all genomes (22). Protein sequences were extracted from the 103 genomes of phylogenetic protein trees were prepared as described above, and manually inspected spoVA genes. Additionally, it was determined whether the genomic location of the spoVA for evolutionary relatedness of the proteins. The operon structures were verified for all operon was on the chromosome or on a plasmid, and it was established whether the operon was part of transposable genetic elements.
Carry over of transposon Natural transfer of the Tn1546 transposon was achieved by generalized transduction from strain B4067, which produces high-level heat resistant spores, to recipient strain 168-spR which produces low-level heat resistant spores (Supplementary Figure 1). Details of this procedure are given below. Strain B4067 carries a prophage in the genome (locus tags B4067_4636 to B4067_4698, comprising 39 kb) that was induced with mitomycin C (1 µg/mL, Sigma) to produce phages as described previously (30). was centrifuged (10 minutes, 6000 g 3 The phages were isolated for DNA sequencing as follows. Briefly, the lysed culture ) and the supernatant was filter sterilized using a filter with a pore size of 0.22 µm (Merck Millipore). The filtered supernatant was hour. Subsequently, NaCl (1M) and PEG (10%) were added to the phages, followed by incubated with RNAse (10µg/mL, Sigma) and DNAse (1µg/mL, Sigma) at 37°C for 1 g) and re-suspended in phage buffer (100 mM NaCl, 5 mM CalCl , 1 mM MgSO , 0.01 % gelatin, incubation for 18 hours at 4°C. The phages were centrifuged2 (10 minutes,4 6000 pH 7.5). DNA was isolated from the phages followed by DNA sequencing as described previously (24). The sequence of the DNA isolated from the phages and the gene coverage were visualized on the B. subtilis B4067 genome using Artemis (10) and found to contain the whole genome sequence of the strain.
Transfer of the Tn1546 transposon element from strain B4067 to strain 168-spR was achieved as follows. Upon induction of the prophage in strain B4067 by adding cells of recipient strain B. subtilis 168-spR mitomycin C (1 µg/mL), a phage lysate was obtained. This lysate was mixed with and incubated for one hour at 37°C on a plate (as described by Auchtung et al. (2)). The recipient cells (with some assumed to nitrocellulose filter (0.2 µm pore size, Nalgene) that was placed on a Luria Broth (LB) have received the Tn1546 transposon element) were transferred to sporulation plates and spores were prepared as described above. The resulting spores were subjected to of spores that were produced by cells of strain 168-spR that had incorporated a DNA a heat treatment of 100°C for 60 min. This high heat treatment allowed for the survival element encompassing the Tn1546 transposon in the genome, while spores of cells that received DNA elements unrelated to high-level spore heat resistance were fully inactivated and not recovered. In addition to selection on the basis of heat resistance
51 Chapter 3
of spores, resulting strains were also selected based on antibiotic resistance (due to the spec grow in the presence of spectinomycin in the concentrations used. The presence of the marker, 100 µg/mL) and tryptophan deficiency. The donor strain B4067 could not Tn1546 transposon in the resulting colonies of 168–spR listed in Supplementary Table 3). One of the colonies containing the Tn1546 transposon was verified by PCR (primers are was selected (designated 168HR, NIZO culture collection strain B4417) and the genome sequence was determined as described previously (24).
Gene deletion and cloning
168HR using the cre/lox system, as previously described, with slight alterations (25, Specific deletion mutants (Supplementary Table 1) were constructed in strain 50). The PCR fragment lox66-P32-cat-lox71 cassette from pNZ5319 was fused by
in Supplementary Table 3). The fused fragments were cloned into pNZ5319 using the overhang PCR with the flanking regions of the genes to be deleted (Primers are listed yitF was deleted from B. subtilis 168, and in strain 168HR, deletion of the entire Tn1546 transposon SwaI/Ecl136II restriction sites (25). Following this strategy, the gene and predicted operons and genes in Tn1546 was achieved (Supplementary Table 1). Deletions of target genes or operons by replacement with the lox66-P32-cat-lox71 spoVA2mob operon from B. subtilis B4067 amyE locus in B. subtilis cassette in mutants were verified by PCR. The 168. The construct was integrated into the amyE locus of B. subtilis 168, yielding strain was cloned into pDG1730 (19), for ectopic expression from the 168 amyE::spoVA2mob. Heat resistance of spores for the constructed strains was assessed
by exposure to 100°C for 1 hour as described above. Spore characterization The DPA contents of spores were determined for B. subtilis strain 168 and 168HR, as described previously (23). For analysis of proteins of spores of strain 168HR, total
10 colony forming units (CFU) ml-1), followed by addition of 1 mL Urea protein was extracted by bead beating (4 rounds, 40 seconds, 5m/s) of 0.5 mL of spore (8M) Tris (10mM) at pH 8 and incubation at room temperature for 1 hour. From the suspension (1 x 10
total protein extract, 10 µg was digested in-solution with trypsin upon reduction and alkylation. The resulting peptide fragments were purified and concentrated, and the (Bruker Daltonics). For B. subtilis 168 and 168HR, the dimensions of the spore core and peptide mixture was analyzed by nanoflow C18 reversed phase liquid chromatography microscopy (TEM), as described previously (29). Measurement of the dimensions of cortex were measured by imaging of cross sections of spores using transmission electron sporoplast and core volume were performed using ImageJ (43). The spore dimensions B. subtilis 168 and 254 individual spores for B. subtilis 168HR. of the cortex and core were determined for 308 individual spores for
52 A mobile genetic element profoundly increases heat resistance of spores
a *** p<0.001 10000 ° C 00 1 1000
100
10
Decimal reduction time (min) at 1 Low-level heat resistant spores High-level heat resistant spores 3 b DR IIR IIR DR
ATAAA tnpA tnpR ATAAA TATTT TATTT Tn1546 backbone
Tn1546 composition L-alanine amidase N-acetylmuramoyl - ger(x)A ger(x)C Unknonw function Unknonw function Unknonw function spoVAC spoVAD spoVAEb Mn Catalase Unknonw function Unknonw function yetF N-terminal yetF C-terminal Cardiolipin synthase Bacillus subtilis 2mob 2mob 2mob
Operon 1 Operon 2 Operon 3 Gene 4 Gene 5 (spoVA2mob)
Figure 1. A) Time needed to achieve one decimal reduction at 100°C of spores of 18 strains of B. subtilis (assessed for two independent spore crops). Based on heat resistance of spores, strains belonged to one of two significantly different groups. One group contained nine strains with low-level heat resistant spores (168, B4055, B4056, B4057, B4058, B4059, B4060, B4061, B4143), the other group nine strains with high-level heat resistant spores (B4067, B4068, B4069, B4070, B4071. B4072, B4073, B4145, B4146). B) Overview of the Tn1546-like transposon exclusively present in B. subtilis strains producing high-level heat resistant spores.
53 Chapter 3
Results and discussion
of B. subtilis with either high or low spore heat-resistance properties were analysed. To find the cause of extreme heat resistance in spores, the genomes of eighteen strains Nine of these strains were isolated from diverse food products and produced spores
decimal reduction), while the other nine, including laboratory strain 168, produced that easily survived prolonged periods of boiling (10.5 h at 100°C needed for one decimal reduction) (Figure 1A). The analysis of the genomes of all eighteen strains spores that were much more readily heat-inactivated (only 2.9 min at 100°C led to one (Supplementary Table 4 and Dataset 1) revealed that only the highly heat-resistant strains contained a unique transposon Tn1546, related to the class II cointegrative Tn3- Enterococcus faecium conferring antibiotic resistance (1), with integration in the genomic locus yitF (BSU10970) in all cases (Figure 1B). The type transposon first described in backbone of the transposon contains the transposase tnpA (showing 93% similarity at the nucleotide level with tnpA in E. faecium, but fragmented in all B. subtilis strains), a resolvase tnpR (present in only two B. subtilis strains), two 38 bp imperfect inverted repeats (IIR) at the ends of the transposon, and a direct repeat (DR) of 5 bp at the site of integration. Although the Tn1546 elements present in B. subtilis strains vary in
units (gene organization, putative functions and domains are shown in Figure 1B). As length from 12 kb to 16 kb, they all contained the same five predicted transcriptional 1546 element present in strain B4146 can be found with the locus tags B4146_1165 to B4146_1182. The Tn1546 transposon found in B. an example, the genes in the Tn subtilis includes the following genes: operon 1 encompasses a gene encoding a putative N-acetylmuramoyl-L-alanine amidase, ger(x)A and ger(x)C; operon 2 contains a gene with unknown function and a gene encoding a putative manganese catalase; operon 3 (designated spoVA2mob) carries one gene of unknown function with a predicted DUF1657 spoVAC2mob, spoVAD2mob, spoVAEb2mob, one gene of unknown function with a predicted DUF1657 domain, one gene of unknown function with a predicted YhcN/YlaJ domain, domain and one gene of unknown function with a predicted DUF421domain and a DUF1657 domain; gene 4 encodes a YetF N-terminal part and a YetF C-terminal part;
and lastlyG geneK 5 encodes a putative cardiolipin synthetase. Each of the five predicted transcriptional units is preceded by a sporulation-specific binding site for sigma factor G (σ ) or K (σ ), which are known to target RNA polymerase to specific promotor K, and spoVA2mob, gene 4 and gene 5 were predicted to sequences that drive gene expression during spore development. Operons 1 and 2 were G. predicted to be under control of σ beGenes under encoded control by of σthe Tn1546 transposon were directly responsible for high-level heat resistance of spores as evidenced by the introduction of Tn1546 into the model laboratory strain B. subtilis 168. Active transposition of the Tn1546-like transposon was
54 A mobile genetic element profoundly increases heat resistance of spores
N(0) 80 °C 10 min ) 12 a -1 N 100 °C 60 min (t)
10 CFU mL 10
g 8 o ( l
6
4
2 Viable spore count 0
8 tF 6 A 1 2 7 6 i 4 p p p 2mob 6 1 y 5 tn o o 2mob 2mob 0 ∆ 1 ∆ ∆ 4 8 168HR n ∆ VA VA gene4 gene5 VA B 6 T o o ∆ ∆ o 1 ∆ p p p 3 s ∆ 168HR 168HR 168HR 168HR 168HR 168HR amyE::s 8 6 168HR last gene s 1 ∆
168HR b 168 c 168HR
200 nm 200 nm
Figure 2. A) Survival of spores of B. subtilis strains. The initial counts of spores were determined following heating for 10 min at 80°C (grey bars). Survival of spores after 60 min at 100°C is indicated by black bars. A downward arrows means that counts were below the detection limit, i.e. 1.7 log units. Heating was applied to spores of the following strains: 168, 168ΔyitF, 168HR (which is 168 including the Tn1546 transposon encompassing 5 operons), 168HR without Tn1546 (168HRΔTn1546), 168HR without tnpA (168HRΔtnpA), 168HR without operon 1 (168HRΔop1), 168HR without operon 2 (168HRΔop2), 168HR without spoVA2mob (168HRΔspoVA2mob), 168 HR without gene 4 (168HRΔgene 4), 168HR without gene 5 (168HRΔgene 5), strain 168 amyE::spoVA2mob, in which spoVA2mob was inserted on the amyE locus, and strain B4067, a food isolate producing high-level heat resistant spores. B) and C) Representative pictures of transmisison electron microscopy cross-sections of spores of B. subtilis strain 168 and 168HR, respectively.
55 Chapter 3
not possible as only remnants of the transposase gene (tnpA) were found in all nine strains that produce high-level heat resistant spores, suggesting that the active transfer of Tn1546-like transposon is prone to evolutionary decay. Therefore, natural transfer of this element to B. subtilis 168 was achieved by generalized transduction, upon induction of a prophage (locus tags B4067_4636 to B4067_4698) in strain B4067 which produces spores with high-level heat resistance. A transductant was selected that produced spores
with significantly higher heat resistance than spores of strain 168. Heat treatment of reduction in viable counts, while viable spores of strain 168 were reduced more than 10 spores of this strain, designated 168HR, for 1 h at 100°C resulted in less than 100-fold billion fold (Figure 2A). Sequencing of the genome of strain 168HR showed the presence of a 100 kb DNA fragment from B4067 that was recombined between metC and yitA with the Tn1546-like transposon inserted in yitF potential effect of other mutations in the 100 kb region on the heat resistance of spores, (Supplementary Figure 1). To exclude the the Tn1546-like transposon was deleted from the 168HR strain to verify its role in high level heat resistance. Subsequent deletion of the Tn1546 transposon from strain 168HR rendered spores that were much more sensitive to heat treatment than those of 168HR, and similar to those of strain 168 (Figure 2A). The appearance of spores of strains 168
different (Figure 2B and 2C); thus, genes on the Tn1546 transposon do not seem to and 168HR was very similar and their core/sporoplast ratios were not significantly
confer major structural changes. The core/sporoplast ratios were not significantly 2 different for the analysed spores of 168 and 168HR, with ratios of 0.52 ± 0.06 and 0.55 2, for 168 and 168HR, respectively. The average dimensions of ± 0.07, respectively. Average dimensions of the spore core were 107453 ± 24635 nm 2 2, for 168 and 168HR, and 115363 ± 26063 nm respectively. Moreover, disruption of yitF due to Tn1546 insertion does not play a role in the spore cortex were 97088 ± 19098 nm and 94668 ± 20591 nm yitF showing similar heat resistance characteristics as spores of the parental strain 168 (Figure 2A). increased heat resistance of spores, with spores of constructed strain 168Δ The third operon on the Tn1546 element, carrying genes that encode SpoVA homologues and four other genes (designated spoVA2mob), was demonstrated to confer high-level heat resistance of spores. After deletion of only the spoVA2mob operon from spoVA2mob), the spores could be heat inactivated under the same conditions as demonstrated for spores of strain 168 (Figure2A). In addition, strain 168HR (i.e. 168HRΔ introduction of the spoVA2mob operon into the amyE locus of strain 168 rendered a strain (168amyE::spoVA2mob) that produces spores with high-level heat resistance. Survival of
of spores of B. subtilis 168HR (containing the spoVA2mob operon as part of the Tn1546 these spores upon heating for 60 minutes at 100°C was not quite as high as survival transposon inserted in yitF B. subtilis 168; the latter were not recovered after this heat treatment, i.e. showing more than ), but significantly higher than survival of spores of 10 log units reduction (with a calculated reduction of 17.4 log units) (Figure 2A). The
56 A mobile genetic element profoundly increases heat resistance of spores
a P-sigG spoVAA spoVAB spoVAC1 spoVAD1 spoVAEb1 spoVAEa spoVAF spoVA1 operon
55 % 49% 59% AA AA AA identitiy identitiy identitiy
spoVA2mob operon
P-sigG DUF Yhcn / spoVAC2mob spoVAD2mob spoVAEb2mobDUF DUF 421 1657 YlaJ 1657 DUF1657 b
C c d
° Bacillus subtilis Bacillus licheniformis Bacillus amyloliquefaciens 5 . 2
1 ** p<0.01 *** p<0.001 *** p<0.001 1 *** p<0.001 *** p<0.001 100 100 100
10 10 10
1 1 1
0.1 0.1 0.1
0.01 0.01 0.01 6 6 6 6 4 4 4 4 2mob 2mob 2mob 2mob 5 5 5 5 A A A A 1 1 1 1 V V V V n n n n o o o o T T T T p p p p o o s s s s N N o Decimal reduction time (min) at N One Two Three 3 Figure 3. A). Overview of the native spoVA operon (spoVA1) in B. subtilis 168 and the spoVA2mob operon found in B. subtilis strains producing spores with high-level heat resistance. B) The calculated time to achieve a decimal reduction at 112.5°C for spores of strains of B. subtilis that possess zero, one, two or three spoVA2mob operons. C) The calculated time to achieve a decimal reduction at 112.5°C of spores of nine strains of B. licheniformis. Three strains possess one Tn1546 transposon (including the spoVA2mob operon), and spores of these strains had significantly higher heat resistances than those of the six strains that did not contain this transposon.D) The calculated time to achieve a decimal reduction at 112.5°C of spores of nine strains of B. amyloliquefaciens. Two strains possess at least one Tn1546 transposon impact of the spoVA2mob element on spore heat resistance is much greater than some Bacillus spore heat-resistance, such as of the previously reported factors influencing lead up to 10-fold increases in the times times required to inactivate spores (3, 12, 37). altered temperature, pH, salts and matrix composition during sporulation, which may The other four transcriptional units present on the Tn1546 element were not required for high-level heat resistance as the spores retained high-level heat resistance following deletion of each of these transcriptional units in strain 168HR (Figure 2A). Sporulation- 1546 fourth transcriptional unit containing the fragmented gene yetF, was seen in strain specific expression of all transcriptional units in the Tn transposon except for the 168HR and food isolate B4067 by RNA sequence analysis (data not shown). The encoded products may also determine spore properties other than heat resistance. mass spectrometry, revealing peptide fragments of the Mn catalase homologue and of Some of the encoded proteins were detected in extracts of spores of strain 168HR using spoVA2mob operon (Supplementary Table 5). proteins encoded by the first and the last gene on the
57 Chapter 3
Additional evidence for the crucial role of spoVA2mob genes in high-level heat resistance of spores came from detailed genome analysis of the B. subtilis isolates from foods. The level of spore heat-resistance was found to correlate with the number of spoVA2mob operons present in the chromosome. Spores of nine strains (168, B4055, B4056, B4057, B4058, B4059, B4060, B4061, B4143) that lack the spoVA2mob operon showed
that produce high-level heat resistant spores, one strain (B4146) carried one spoVA2mob one decimal reduction in viable count after 0.2 minutes at 112.5°C. Of the nine strains operon on a Tn1546-like transposon element inserted in yitF, and the average time
B4069, B4070, B4071, B4072, B4073, and B4145 contained the same element inserted to achieve one decimal reduction was 1.2 minutes at 112.5°C. Strains B4067, B4068, in yitF and a second spoVA2mob operon on a Tn1546-like transposon between the two divergently transcribed genes yxjA (BSU39020) and yxjB (BSU39010) and their
inactivation. In addition to these two Tn1546-like transposons, three strains (B4067, spores needed even longer average heating times of 8.8 min at 112.5°C for the same B4070 and B4145) contained a third spoVA2mob
operon which was flanked by genes of another mobile genetic element, but further genomic context could not be determined. decimal reduction of viable counts (Figure 3B). Spores of these strains required as much as 25.6 minutes on average at 112.5°C for one spo genes of B. subtilis 168, knowledge of the precise function of individual spoVA-encoded proteins is rather limited. The spoVA operon of B. Despite extensive studies on many subtilis 168 (for clarity reasons named spoVA1) encompasses spoVAA, spoVAB, spoVAC, spoVAD, spoVAEb, spoVAEa and spoVAF for completion of sporulation (46). Only the functions of SpoVAC1 and SpoVAD1, , of which the first five genes are essential which are associated with the inner membrane of the spore, are known (27, 47, 48). Structural analysis of SpoVAD1 revealed a binding pocket that is important for uptake
(27). SpoVAC1 was recently shown to function as a mechanosensitive channel during of pyridine-2,6-dicarboxylic acid (known as dipicolinic acid (DPA)) during sporulation germination, with increased probability of opening at increased membrane tension (47). The spoVA2mob operon mediating high-level heat resistance carries spoVAC, spoVAD and spoVAEb (hereafter called spoVAC2mob, spoVAD2mob and spoVAEb2mob) and four genes with unknown functions (shown in Figure 3A). The SpoVAC, SpoVAD and SpoVAEb proteins encoded in the spoVA1 and spoVA2mob loci share 55%, 49%, and 59% amino acid identity, respectively. Given the known roles of SpoVAC1 and SpoVAD1 in DPA uptake during sporulation, we hypothesize that proteins encoded by the spoVA2mob operon play
of spores. This was indeed the case: the introduction of the spoVA2mob operon in strain an important auxiliary role in this process, ultimately leading to higher heat resistance 168 resulted in 50% higher DPA concentrations in B. subtilis spores. Spores of strains 168HR and 168amyE::spoVA2mob
contain 63.1 ± 2.3 and 58.1 ± 0.1 µg DPA/mg dry weight, respectively, both significantly higher than the concentration in spores of strain 168 58 A mobile genetic element profoundly increases heat resistance of spores
Core genome Strain name Current spoVA Proposed evolutionary Phylogenetic tree operons scenario
Bacillus sporothermodurans B4102 Incomplete operon Geobacillus debilis B4135 Geobacillus debilis DSM 16016 Bacillus thermoamylovorans B4167 Bacillus thermoamylovorans B4166 Bacillus thermoamylovorans B4065 Bacillus thermoamylovorans B4064 Geobacillus caldoxylosilyticus G10 Acquisition by HGT Anoxybacillus flavithermus WK1 Anoxybacillus flavithermus TNO 09 014 Anoxybacillus flavithermus TNO 09 016 Anoxybacillus flavithermus TNO 09 006 Geobacillus caldoxylosilyticus B4119 Geobacillus WCH70 Geobacillus toebii B4110 Geobacillus thermoglucosidasius C56 YS93 Geobacillus Y4 1MC1 Geobacillus thermoglucosidans TNO 09 020 Geobacillus thermoglucosidans TNO 09 023 Anoxybacillus flavithermus B4168 Geobacillus sp G11MC16 Geobacillus thermodenitrificans NG80 2 Geobacillus sp C56-T2 Geobacillus group B4113 Geobacillus stearothermophilus B4114 Geobacillus stearothermophilus B4109 Geobacillus stearothermophilus TNO 09 027 Geobacillus stearothermophilus TNO 09 008 Geobacillus HH01 Geobacillus thermoleovorans CCB US3 UF5 Geobacillus kaustophilus HTA426 Geobacillus C56 T3 Geobacillus stearothermophilus 10 Geobacillus Y412MC52 Geobacillus Y412MC61 Bacillus licheniformis B4123 Bacillus licheniformis B4125 Bacillus licheniformis B4121 Bacillus licheniformis B4089 Bacillus licheniformis B4094 Bacillus licheniformis B4090 Bacillus licheniformis B4092 Bacillus licheniformis B4091 Bacillus licheniformis B4124 Bacillus licheniformis B4164 Bacillus amyloliquefaciens FZB42 Bacillus amyloliquefaciens B4140 Bacillus amyloliquefaciens LL3 Bacillus amyloliquefaciens B425 Bacillus amyloliquefaciens DSM7 Bacillus vallismortis B4144 Bacillus subtilis spizizenii TU B 10 Bacillus subtilis spizizenii W23 Bacillus subtilis spizizenii DV1 B 1 Bacillus subtilis RO NN 1 Operon loss Bacillus subtilis B4143 Bacillus subtilis PY79 Bacillus subtilis 168 Acquisition by HGT Bacillus subtilis NCIB 3610 3 Bacillus subtilis JH642 Bacillus subtilis B4122 Bacillus subtilis B4146 Bacillus subtilis B4071 Bacillus subtilis B4069 Bacillus subtilis B4072 Bacillus subtilis B4073 Bacillus subtilis B4068 Bacillus subtilis B4070 Bacillus subtilis B4067 Bacillus subtilis B4145 Bacillus cereus B4083 Bacillus cereus B4117 Bacillus cereus G9842 Bacillus cereus B4080 Bacillus cereus B4084 Bacillus cereus B4158 Bacillus cereus B4264 Bacillus cereus B4118 Bacillus cereus B4081 Bacillus cereus B4120 Bacillus cereus ATCC 14579 Bacillus cereus B4155 Bacillus cereus B4082 Bacillus cereus B4088 Bacillus cereus B4147 Bacillus cereus B4077 Bacillus cereus E33L Bacillus cereus biovar anthracis CI spoVA1 Bacillus cereus F837 76 Bacillus cereus 03BB102 Bacillus cereus AH820 2 Bacillus cereus B4087 spoVA Bacillus cereus B4079 Bacillus cereus ATCC 10987 Bacillus cereus FRI 35 2mob Bacillus cereus Q1 spoVA Bacillus cereus B4086 Bacillus cereus B4153 Bacillus cereus AH187 Bacillus cereus NC7401 Bacillus cereus B4078 Bacillus cereus B4085 0.1 Bacillus cereus B4116 Operon duplication onto pXOI-like plasmid
Figure 4. Maximum likelihood core genome phylogenetic tree of 103 sporeforming Bacillaceae, with indication of the number and type of spoVA operons present in the genomes, and proposed evolutionary scenarios. Three types of spoVA operons were identified in this analysis and are indicated in the tree. Firstly a spoVA1 operon, encompassing spoVAA, spoVAB, spoVAC1, spoVAD1, spoVAEb1, spoVAEa and spoVAF. Secondly a spoVA2 operon, encompassing a gene with a predicted DUF1657 domain, a gene with a YhcN/YljA domain, spoVAC2, spoVAD2, spoVAEb2, a gene with a predicted DUF1657 domain and a gene with a predicted DUF 421 domain and DUF1657 domain. Thirdly, a spoVA2mob operon, which is a duplication of the spoVA2 operon, but present on a mobile genetic element e.g. Tn1546 in B. subtilis strains. The proposed evolutionary scenarios were based on protein trees of SpoVAC and SpoVAD and the genomic context of the spoVA operons. Strains of B. cereus, Geobacillus spp., and A. flavithermus all carry spoVA1 and spoVA2 operons. Six strains of B. cereus carry spoVA2mob on a pXO1 like plasmid, as part of a Tn1546 transposon. Members of the B. subtilis group (B. subtilis, B. vallismortis, B. amyloliquefaciens, B. licheniformis) lost the spoVA2 operon during evolution, but the spoVA2mob operon re-entered in some strains as part of a Tn1546 transposon. Similarly, spoVA2mob entered strains of B. thermoamylovorans and B. sporothermodurans. Incomplete spoVA1 and spoVA2 operons were observed in strains of B. thermoamylovorans, B. sporothermodurans, and C. debilis.
59 Chapter 3
reported in spores of a B. subtilis strain with high-level heat resistance (isolated from (40.1 ± 2.3 µg DPA/mg dry weight). Interestingly, high levels of DPA were previously foods) (23), and this phenomenon can now be linked to the presence of spoVA2mob genes. At present, it has not been established which gene or which combinations of genes in the spoVA2mob
operon are essential and sufficient to convey high-level heat resistance of high-level heat resistance of spores (Figure 2A), indicating at least its essential role. The spores, but we did find that deletion of the last gene of unknown function fully abolished last gene of the spoVA2mob operon encodes a protein that is predicted to be membrane bound by three transmembrane segments, and contains a DUF421 domain and a DUF1657 domain. Homologs of this protein were neither found in B. subtilis 168 nor in other Bacillus spp. unless they carried spoVA2 or spoVA2mob operons. Two other genes in the spoVA2mob operon encode proteins with DUF1657 domains, for which no homologs were found in B. subtilis 168 and other Bacillus spp. unless they contained the spoVA2 or spoVA2mob operon. The DUF421 encoded in the last gene in the spoVA2mob operon was found in other predicted proteins in absence of DUF1657; in B. subtilis 168 this yetF, yrbG, ykjA, ydfR, ydfS, but their functions have not been established or predicted. It is not clear at this stage what roles domain was encoded by five different genes, namely, the proteins containing these domains play in heat resistance of spores.
It is conceivable that the Tn1546 transposon found in the B. subtilis group originates from B. cereus pXO1-like plasmids that can carry this transposon including the spoVA2mob operon (Figure 4) (35), given similarities in gene presence and GC content (Supplementary Table 6) and because the Tn3-like transposon requires a plasmid intermediate for active transposition (1). It is not clear whether the presence of the spoVA2mob operon in B. cereus spores. Limited sequence variation in key genes in the spoVA2mob operon found in the B. strains has an influence on the heat resistance of these subtilis group strains suggests that genomic incorporation of the Tn1546 transposon, including the spoVA2mob operon, involves a recent evolutionary event.
Genes encoding SpoVAC, SpoVAD and SpoVAEb are conserved amongst sporeforming Bacillaceae and Clostridium spp. (17), and were also present in the analysed genomes of 103 Bacillaceae species (Figure 4). Three types of spoVA operons could be distinguished: spoVA1, spoVA2 and spoVA2mob (where mob indicates presence on a mobile genetic element). The division between spoVA1 and spoVA2 is based on the difference in operon structure (Figure 3A) and separate clustering of the SpoVAC and SpoVAD proteins in the evolutionary trees (Supplementary Figure 2).
Both the spoVA1 and spoVA2 operons are present in the sporeforming Geobacillus spp., Anoxybacillus flavithermus, and species of the B. cereus group sensu strictu, but not as parts of mobile genetic elements (Figure 4). Interestingly, all evaluated strains
60 A mobile genetic element profoundly increases heat resistance of spores
belonging to the B. subtilis group possess the spoVA1 operon while lacking the spoVA2 operon. However, some strains gained spoVA2mob on the Tn1546 transposon (Figure 4). The determining role of the spoVA2mob element in high-level spore heat resistance B. licheniformis and B. amyloliquefaciens (Figures 3C and 3D). was experimentally confirmed for strains of Interestingly, the genomes of species notorious for very high-level heat resistance of their spores, namely Bacillus thermoamylovorans, B. sporothermodurans and Caldibacillus debilis (5, 41, 42), showed diverse compositions of their spoVA of the spoVA1, spoVA2, and spoVA2mob operons in determining spore properties in these operons. The exact roles species remains to be established.
Horizontal gene transfer plays an important role in bacteria to acquire resistance against selective pressures (32). The transfer of the spoVA2mob operon to sporeformers occurs in the vegetative growth phase, subsequently leading to production of highly heat resistant spores that can survive heat treatments routinely used in food processing. The acquisition of the spoVA2mob operon in food isolates may take place during growth in a food processing environment, but it is also possible that such events occur during 3 growth in other niches, such as soil or compost. The competitive advantage of acquisition of these genes may also be related to properties other than merely heat resistance of spores.
Conclusions This study shows that horizontal gene transfer can profoundly affect heat resistance spoVA2mob operon on a Tn1546-like transposon plays an important role in high-level heat resistance of Bacillus spores characteristics of spores. Our finding that the offers new opportunities for dealing with the problem of highly heat-resistant spores in food and health. Studying phenotypic properties of strains other than the well-studied laboratory strain in conjunction with analysis of their genomes proved to be a powerful approach to match phenotypes with underlying genetic traits.
Acknowledgements The authors would like to thank Rosella Koning for technical assistance with the heat inactivation of spores, Antonina Krawczyk, Anne de Jong, and Robyn Eijlander for sharing of RNA sequencing data and valuable discussions, and Michiel Kleerebezem and Jerry Wells for critical reading of the manuscript. This work was supported by the Top Institute Food and Nutrition, The Netherlands.
61 Chapter 3
References 1. Arthur M, Molinas C, Depardieu F, Courvalin P. 1993. Characterization of Tn1546, a Tn3- related transposon conferring glycopeptide resistance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. Journal of Bacteriology 175:117-127. 2. Auchtung JM, Lee CA, Monson RE, Lehman AP, Grossman AD. 2005. Regulation of a Bacillus subtilis mobile genetic element by intercellular signaling and the global DNA damage response. Proceedings of the National Academy of Sciences 102:12554-12559. 3. Baril E, Coroller L, Couvert O, Leguérinel I, Postollec F, Boulais C, Carlin F, Mafart P. 2012. Modeling heat resistance of Bacillus weihenstephanensis and Bacillus licheniformis spores as function of sporulation temperature and pH. Food Microbiology 30:29-36. 4. Bayjanov JR, Molenaar D, Tzeneva V, Siezen RJ, van Hijum SA. 2012. PhenoLink--a web-tool for linking phenotype to ~omics data for bacteria: application to gene-trait matching for Lactobacillus plantarum strains. BMC Genomics 13:170. 5. Berendsen EM, Krawczyk AO, Klaus V, de Jong A, Boekhorst J, Eijlander RT, Kuipers OP, Wells- Bennik MH. 2015. Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger
6. Berendsen EM, Wells-Bennik MHJ, Krawczykclusters, AO, de but Jong efficiently A, Holsappel upon non-nutrient S, Eijlander Ca-DPA RT, Kuipersexposure. OP. Applied Accepted. and Environmental Draft genome Microbiology;81(22):7791-801sequences of ten Bacillus subtilis strains that form spores with a high or low heat-resistance. Genome Announcements. 7. Berendsen EM, Zwietering MH, Kuipers OP, Wells-Bennik MHJ. 2015. Two distinct groups within the Bacillus subtilis Food Microbiology 45, Part A:18-25. 8. Brul S, van Beilen J, Caspers group M, O’Briendisplay significantlyA, de Koster different C, Oomes spore S, Smelt heat J,resistance Kort R, Ter properties. Beek A. 2011. Challenges and advances in systems biology analysis of Bacillus spore physiology; molecular Bacillus subtilis food isolate and a laboratory strain. Food Microbiology 28:221-227. 9. differencesCano R, Borucki between M. an extreme heat resistant spore forming old Dominican amber. Science 268:1060-1064. 10. Carver T, Harris SR,1995. Berriman Revival andM, Parkhillidentification J, McQuillan of bacterial JA. spores 2012. in Artemis: 25- to 40-million-year- an integrated
Bioinformatics 28:464-469. 11. Carverplatform TJ, for Rutherford visualization KM, andBerriman analysis M, of Rajandream high-throughput MA, Barrell sequence-based BG, Parkhill experimental J. 2005. ACT: data. the Artemis Comparison Tool. Bioinformatics 21:3422-3423. 12. Cazemier AE, Wagenaars SFM, Ter Steeg PF. 2001. Effect of sporulation and recovery medium on the heat resistance and amount of injury of spores from spoilage bacilli. Journal of Applied Microbiology 90:761-770. 13. Cutting SM. 2011. Bacillus probiotics. Food Microbiology 28:214-220. 14. Duc LH, Hong HA, Fairweather N, Ricca E, Cutting SM. 2003. Bacterial Spores as Vaccine Vehicles. Infect Immun 71:2810-2818. 15. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797. 16. Errington J. 2003. Regulation of endospore formation in Bacillus subtilis. Nature Reviews Microbiology 1:117-126. 17. Galperin MY, Mekhedov SL, Puigbo P, Smirnov S, Wolf YI, Rigden DJ. 2012. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation- 14:2870-2890. 18. Gould GW. 2006. History of science – spores. Journal of Applied Microbiology 101:507-513. 19. Guerout-Fleuryspecific genes. Environmental AM, Frandsen Microbiology N, Stragier P. 1996. Plasmids for ectopic integration in Bacillus subtilis. Gene 180:57-61. 20. Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies 52:696-704. 21. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznikby maximum G, Mikhailova likelihood. N, Systematic Lapidus A, Biology Chu L, Mazur M, Goltsman E, Larsen N, D’Souza M, Walunas
62 A mobile genetic element profoundly increases heat resistance of spores
T, Grechkin Y, Pusch G, Haselkorn R, Fonstein M, Dusko Ehrlich S, Overbeek R, Kyrpides N. 2003. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423:87-91. 22. Johnson LS, Eddy S, Portugaly E. 2010. Hidden Markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics 11:431. 23. Kort R, O’Brien AC, van Stokkum IHM, Oomes SJCM, Crielaard W, Hellingwerf KJ, Brul S.
monitoring of dipicolinic acid release. Applied and Environmental Microbiology 71:3556-3564. 24. Krawczyk2005. Assessment AO, Berendsen of heat resistance EM, Eijlander of bacterial RT, de spores Jong fromA, Wells-Bennik food product MHJ, isolates Kuipers by fluorescence OP. 2015. Draft genome sequences of four Bacillus thermoamylovorans strains isolated from milk and acacia gum, a food ingredient. Genome Announcements 3. 25. Lambert JM, Bongers RS, Kleerebezem M. deletions and selectable-marker removal in Lactobacillus plantarum. Applied and Environmental Microbiology 73:1126-1135. 2007. Cre-lox-based system for multiple gene 26. Li L, Stoeckert CJ, Jr., Roos DS. genomes. Genome Res 13:2178-2189. 27. Li Y, Davis A, Korza G, Zhang P, Li2003. YQ, SetlowOrthoMCL: B, Setlow identification P, Hao B. of 2012. ortholog Role groups of a SpoVA for eukaryotic protein in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 194:1875- 1884. 28. Lima LJR, Kamphuis HJ, Nout MJR, Zwietering MH. 2011. Microbiota of cocoa powder with particular reference to aerobic thermoresistant spore-formers. Food Microbiology 28:573-582. 29. Lima LSR. 2012. Microbial ecology of the cocoa chain: Quality aspects and insight into heat- resistant bacterial spores PhD. Wageningen University Wageningen. 30. Moineau S, Pandian S, Klaenhammer TR. 1994. Evolution of a lytic bacteriophage via DNA 3 acquisition from the Lactococcus lactis chromosome. Applied and Environmental Microbiology 60:1832-1841. 31. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. Resistance of Bacillus
Biology Reviews 64:548-572. 32. Ochmanendospores H, toLawrence extreme JG,terrestrial Groisman and EA.extraterrestrial 2000. Lateral environments. gene transfer Microbiology and the nature and of Molecular bacterial innovation. Nature 405:299-304. 33. Oomes SJCM, van Zuijlen ACM, Hehenkamp JO, Witsenboer H, van der Vossen JMBM, Brul S. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 34. Peck MW, Stringer SC, Carter AT. 2011. Clostridium botulinum in the post-genomic era. Food Microbiology 28:183-191. 35. Rasko DA, Rosovitz MJ, Okstad OA, Fouts DE, Jiang L, Cer RZ, Kolsto AB, Gill SR, Ravel J. 2007. Complete sequence analysis of novel plasmids from emetic and periodontal Bacillus cereus isolates reveals a common evolutionary history among the B. cereus-group plasmids, including Bacillus anthracis pXO1. Journal of Bacteriology 189:52-64. 36. Read TD, Peterson SN, Tourasse N, Baillie LW, Paulsen IT, Nelson KE, Tettelin H, Fouts DE, Eisen JA, Gill SR, Holtzapple EK, Okstad OA, Helgason E, Rilstone J, Wu M, Kolonay JF, Beanan MJ, Dodson RJ, Brinkac LM, Gwinn M, DeBoy RT, Madpu R, Daugherty SC, Durkin AS, Haft DH, Nelson WC, Peterson JD, Pop M, Khouri HM, Radune D, Benton JL, Mahamoud Y, Jiang L, Hance IR, Weidman JF, Berry KJ, Plaut RD, Wolf AM, Watkins KL, Nierman WC, Hazen A, Cline R, Redmond C, Thwaite JE, White O, Salzberg SL, Thomason B, Friedlander AM, Koehler TM, Hanna PC, et al. 2003. The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423:81-86. 37. Rose R, Setlow B, Monroe A, Mallozzi M, Driks A, Setlow P. 2007. Comparison of the properties of Bacillus subtilis spores made in liquid or on agar plates. Journal of Applied Microbiology 103:691- 699. 38. Rupnik M, Wilcox MH, Gerding DN. 2009. Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat Rev Microbiol 7:526-536. 39. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, Jones JL, Griffin PM. 2011. Foodborne illness acquired in the United States—major pathogens. Emerging Infectious
63 Chapter 3
Diseases 17:7-15. 40. Scallan E HR, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL, et al. 2011. Foodborne illness acquired in the United States—major pathogens. Emerg Infect Dis 17. 41. Scheldeman P, Herman L, Foster S, Heyndrickx M. 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 42. Scheldeman P, Pil A, Herman L, De Vos P, Heyndrickx M. 2005. Incidence and diversity of potentially highly heat-resistant spores isolated at dairy farms. Applied and Environmental Microbiology 71:1480-1494. 43. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Meth 9:671-675. 44. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. Journal of Applied Microbiology 101:514-525. 45. Sunde EP, Setlow P, Hederstedt L, Halle B. 2009. The physical state of water in bacterial spores. Proceedings of the National Academy of Sciences 106:19334-19339. 46. Tovar-Rojo F, Chander M, Setlow B, Setlow P. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 184:584-587. 47. Velasquez J, Schuurman-Wolters G, Birkner JP, Abee T, Poolman B. 2014. Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel. Molecular Microbiology 92:813-823. 48. Vepachedu VR, Setlow P. 2005. Localization of SpoVAD to the inner membrane of spores of Bacillus subtilis. Journal of Bacteriology 187:5677-5682. 49. Vreeland RH, Rosenzweig WD, Powers DW. 2000. Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal. Nature 407:897-900. 50. Yan X, Yu HJ, Hong Q, Li SP. Bacillus subtilis. Applied and Environmental Microbiology 74:5556-5562. 2008. Cre/lox system and PCR-based genome engineering in
64 A mobile genetic element profoundly increases heat resistance of spores
Supplementary materials Supplementary Table 1. Strains and plasmids used in this study. The operons and genes in the Tn1546 transposon are indicated with operon 1, operon 2, spoVA2mob, gene 4, and gene 5. The abbreviations cmr amr spr emr correspond to antibiotic resistance against chloramphenicol, ampicillin, spectinomycin and erythromycin, respectively.
Strain Species Description Reference B4055 B. subtilis Known as BGSC1A96; JH642 (6, 31) B4056 B. subtilis Known as BGSC1A747; PY79 (36) B4057 B. subtilis Known as BGSC2A9; NRRLB14472; ATCC23059; W23 (22, 36, 35) B4058 B. subtilis Known as BGSC2A11; TU-B-10T; NRRLB-23049T, isolated (22) from Sahara desert B4059 B. subtilis Known as BGSC2A12; DV1B-1; NRRLB-23054, isolated (22) from Death valley national monument B4060 B. subtilis Known as BGSC3A1T; NCIB3610T (36) B4061 B. subtilis Known as BGSC3A27; RO-NN-1; NRRLB-14823, isolated (22) from Mojave desert 168 (B4062) B. subtilis Type strain 168 trpC2 (20, 2, 36) B4067 B. subtilis Known as A163, isolated form peanut chicken soup (9, 16, 23, 24) B4068 B. subtilis Known as CC2, isolated rom curry cream soup (25) B4069 B. subtilis (25) B4070 B. subtilis Known as A162, isolated from peanut chicken soup (8) 3 Known as IIC14, isolated from binding flour ingredient B4071 B. subtilis Known as CC16, isolated from curry cream soup (25) B4072 B. subtilis Known as RL45, isolated from red lasagna sauce (25) B4073 B. subtilis Knowns as MC85, isolated from curry soup (25) B4143 B. subtilis Isolated from surimi (5) B4145 B. subtilis Isolated from pasta (5) B4146 B. subtilis Isolated from curry sauce (5) yitF B. subtilis 168 yitF::lox66-P32-cat-lox71 This study 168-spR B. subtilis 168 amyE::spec trpC2 (12) 168Δ 168HR B. subtilis Strain 168-spR transduced with DNA fragment from This study B4067, ranging from yitA to metC including Tn1546 transposon in yitF 168HR- B. subtilis 168HR amyE::spec derivative with Tn1546::lox66-P32- This study 1546 cat-lox71 tnpA B. subtilis 168HR amyE::spec derivative with tnpA::lox66-P32-cat- This study ΔTn lox71 168HR- Δ - B. subtilis 168HR amyE::spec derivative with operon 1::lox66-P32- This study on 1F cat-lox71 168HR- Δoper- B. subtilis 168HR amyE::spec derivative with operon 2::lox66-P32- This study on 2 cat-lox71 168HR- Δoperspo- B. subtilis 168HR amyE::spec derivative with spoVA2mob::lox66-P32- This study VA2mob cat-lox71 168HR- Δ B. subtilis 168HR amyE::spec derivative with last gene of spoVA- gene spoVA2mob 2mob::lox66-P32-cat-lox71 168HR- Δ last B. subtilis 168HR amyE::spec derivative with gene 4::lox66-P32-cat- This study lox71 168HR- Δgene 4 B. subtilis 168HR amyE::spec derivative with gene 5::lox66-P32-cat- This study lox71 168HR-168- amyE Δgene::spo 5- B. subtilis 168 amyE::spoVA2mob (cloned from B4067) This study VA2mob
65 Chapter 3
Supplementary Table 1. (Continued)
B425 B. amyloliquefa- Sterilized milk (5) ciens B4140 B. amyloliquefa- Pizza (5) ciens - B. amyloliquefa- Known as 10A5; NRRL B-14393, isolated from soil (27) ciens - B. amyloliquefa- Known as 10A6; FZB42, isolated from plant soil (10) ciens - B. amyloliquefa- Known as 10A18; CU8004 (34) ciens - B. amyloliquefa- Known as DSM7, isolated from soil (29) ciens - B. amyloliquefa- Known as DSM1060 (26) ciens - B. amyloliquefa- 101 This study ciens - B. amyloliquefa- SB42 This study ciens B4089 B. licheniformis (25) B4090 B. licheniformis Known as T1, isolated from pea soup (25) Known as E5/T12, isolated from pea soup B4091 B. licheniformis Known as T29, isolated from mushroom soup (25) B4092 B. licheniformis Isolated from buttermilk powder This study B4094 B. licheniformis Isolated from camomile tea This study B4121 B. licheniformis Isolated from sateh pastry This study B4123 B. licheniformis Isolated from sateh pastry This study B4124 B. licheniformis Isolated form pancakes This study B4125 B. licheniformis Isolated from pancakes This study Plasmid pNZ5319 cmr emr (21) pNZ5319+11 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of yitF pNZ5319+13 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of Tn1546 pNZ5319+14 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of tnpA pNZ5319+15 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of operon 1 pNZ5319+16 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of operon 2 pNZ5319+20 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of spoVA2mob pNZ5319+22 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of gene 4 pNZ5319+19 cmr emr; pNZ5319 containing homologous regions up- This study and downstream of gene 5 pDG1730 amr spr emr (12) pDG1730+23 amr spr emr; pDG1730 containing spoVA2mob operon from This study B4067
66 A mobile genetic element profoundly increases heat resistance of spores
Supplementary Table 2. Strains of sporeforming Bacillaceae used in genome comparisons to evaluate the presence of spoVA operons. Species Strain name Genbank accession Reference number Anoxybacillus flavithermus B4168 LQYU00000000 (4) (*Geobacillus thermoglucosidans) Anoxybacillus flavithermus TNO_9_6 AMCM01 (7) Anoxybacillus flavithermus TNO_9_14 LUFB00000000 Unpublished Anoxybacillus flavithermus TNO_9_16 LUCQ00000000 Unpublished Anoxybacillus flavithermus WK1 NC_011567 (30) Bacillus amyloliquefaciens DSM7 NC_014551 (29) Bacillus amyloliquefaciens FZB42 NC_009725 (10) Bacillus amyloliquefaciens LL3 NC_017189 (11) NC_017190 Bacillus cereus 03BB102 NC_012472 Unpublished NC_012473 Bacillus cereus AH187 NC_011654 Unpublished NC_011655 NC_011656 NC_011657 NC_011658 Bacillus cereus AH820 NC_011771 Unpublished NC_011773 NC_011776 NC_011777 3 Bacillus cereus ATCC_10987 NC_003909 (28) NC_005707 Bacillus cereus ATCC_14579 NC_004721 (14) NC_004722 Bacillus cereus B4147 LCYN00000000 (18) Bacillus cereus B4153 LCYO00000000 (18) Bacillus cereus B4158 LCYP00000000 (18) Bacillus cereus B4264 CP001176 Unpublished Bacillus cereus B4077 LCYI00000000 (18) Bacillus cereus biovar_anthracis_CI NC_014331 (15) NC_014332 NC_014333 NC_014335 Bacillus cereus B4086 LCYL00000000 (18) Bacillus cereus B4080 LCYK00000000 (18) Bacillus cereus E33L NC_006274 (13) NC_007103 NC_007104 NC_007105 NC_007106 NC_007107 Bacillus cereus F837_76 NC_016779 (1) NC_016780 NC_016794 Bacillus cereus FRI_35 NC_018491 - NC_018492 NC_018493 NC_018494 NC_018499 Bacillus cereus G9842 NC_011772 Unpublished NC_011774 NC_011775 Bacillus cereus B4087 LCYM00000000 (18) Bacillus cereus B4078 LCYJ00000000 (18)
67 Chapter 3
Supplementary Table 2. (Continued) Bacillus cereus NC7401 NC_016771 (32) NC_016772 NC_016773 NC_016774 NC_016792 NC_016793 Bacillus cereus B4079 LJIT00000000 Unpublished Bacillus cereus B4081 LJJZ00000000 Unpublished Bacillus cereus B4082 LJKA00000000 Unpublished Bacillus cereus B4083 LJKB00000000 Unpublished Bacillus cereus B4084 LJKC00000000 Unpublished Bacillus cereus B4085 LJKD00000000 Unpublished Bacillus cereus B4088 LJKE00000000 Unpublished Bacillus cereus B4116 LJKF00000000 Unpublished Bacillus cereus B4117 LJKG00000000 Unpublished Bacillus cereus B4118 LJKH00000000 Unpublished Bacillus cereus B4120 LJKI00000000 Unpublished Bacillus cereus B4155 LJKJ00000000 Unpublished Bacillus cereus Q1 NC_011969 (33) NC_011971 NC_011973 Bacillus licheniformis B4092 LQYK00000000 (19) Bacillus licheniformis B4089 LKPM00000000 This study Bacillus licheniformis B4094 LKPN00000000 This study Bacillus licheniformis B4121 LKPO00000000 This study Bacillus licheniformis B4122 LJZV00000000 This study (*Bacillus subtilis) Bacillus licheniformis B4123 LKPP00000000 This study Bacillus licheniformis B4124 LKPQ00000000 This study Bacillus licheniformis B4125 LKPR00000000 This study Bacillus licheniformis B4090 LQYL00000000 (19) Bacillus licheniformis B4091 LQYM00000000 (19) Bacillus sporothermodurans B4102 LQYN00000000 (19) Bacillus subtilis 168; B4062 NC_000964 (20, 2) Bacillus subtilis A162; B4070 JXHM00000000 (3) Bacillus subtilis A163; B4067 JSXS01000000 (3) Bacillus subtilis B4140 LQYO00000000 (19) (*Bacillus amyloliquefaciens) Bacillus subtilis B4143 JXLQ01000000 (3) Bacillus subtilis B4144 LQYR00000000 (19) (*Bacillus vallismortis) Bacillus subtilis B4145 JXHQ00000000 (3) Bacillus subtilis B4146 NZ_JXHR01000000 (3) Bacillus subtilis B425 LQYP00000000 (19) (*Bacillus amyloliquefaciens) Bacillus subtilis CC16; B4071 JXHN00000000 (3) Bacillus subtilis CC2; B4068 JXHK00000000 (3) Bacillus subtilis IIC14; B4069 JXHL00000000 (3) Bacillus subtilis BGSC1A96; JH642; B4055 NZ_CM000489 (6, 31) Bacillus subtilis MC85; B4073 JXHP00000000 (3) Bacillus subtilis BGSC3A1T; NCIB3610T; NZ_CM000488 (36) B4060 Bacillus subtilis BGSC1A747; PY79; B4056 NC_022898 (35)
68 A mobile genetic element profoundly increases heat resistance of spores
Supplementary Table 2. (Continued) Bacillus subtilis RL45; B4072 JXHO00000000 (3) Bacillus subtilis BGSC3A27; RO-NN-1; NR- NC_017195 (22) RLB-14823; B4061 Bacillus subtilis BGSC2A12; DV1B-1; NR- AFSG01 (22) RLB-23054; B4059 Bacillus subtilis BGSC2A11; TU-B-10T; NR- NC_016047 (22) RLB-23049T; B4058 Bacillus subtilis BGSC2A9; NRRLB14472; NC_014479 (22) ATCC23059; W23; B4057 Bacillus thermoamylovorans B4064 JXLR00000000 (17) Bacillus thermoamylovorans B4065 JXLS00000000 (17) Bacillus thermoamylovorans B4166 JXLT00000000 (17) Bacillus thermoamylovorans B4167 JXLU00000000 (17) Geobacillus sp. C56_T3 NC_014206 - Geobacillus caldoxylosilyticus B4119 LQYS00000000 (4) Geobacillus caldoxylosilyticus G10 NZ_ALJT00000000.1 (**Anoxybacillus kamchatkensis.) Geobacillus debilis B4135 LQYT00000000 (4) (**Caldibacillus debilis) Geobacillus debilis DSM_16016 NZ_ARVR01000000 (**Caldibacillus debilis) Geobacillus group B4113 LQYX00000000 (4) Geobacillus sp. HH01 NC_020210 3 Geobacillus kaustophilus HTA426 NC_006509 NC_006510 Geobacillus sp. C56-T2 GC56T2 Geobacillus sp. G11MC16 NZ_ABVH00000000 Geobacillus stearothermophilus 10 NZ_CP008934.1 (*Geobacillus sp.) Geobacillus stearothermophilus B4114 LQYY00000000 (4) Geobacillus stearothermophilus B4109 LQYV00000000 (4) Geobacillus stearothermophilus TNO_9_8 LUCS00000000 Geobacillus stearothermophilus TNO_9_27 LUCR00000000 Geobacillus thermodenitrificans NG80_2 NC_009328 NC_009329 Geobacillus thermoglucosidans TNO_9_20 AJJN01 (37) Geobacillus thermoglucosidans TNO_9_23 LUCT00000000 Geobacillus thermoglucosidasius C56YS93 NC_015660 (*Geobacillus thermoglucosidans) NC_015661 NC_015665 Geobacillus thermoleovorans CCBUS3UF5 NC_016593 Geobacillus toebii B4110 LQYW00000000 (4) Geobacillus vulcani B4164 LQYQ00000000 (19) (*Bacillus licheniformis) Geobacillus sp. WCH70 NC_012790 NC_012793 NC_012794 Geobacillus sp. Y4_1MC1 NC_014650 (*Geobacillus thermoglucosidans) NC_014651 Geobacillus sp. Y412MC52 NC_014915 NC_014916 Geobacillus sp. Y412MC61 NC_013411 NC_013412 * Proposed new species name, based on the core genome phylogenetic tree. ** Species name after recent renaming.
69 Chapter 3
Supplementary Table 3. Primers used in this study for detection, deletion and complementation. Primer used for detection Name primer DNA sequence 5’ to 3’ Localization tnpA tnpA-F TTCTATTCGGCCCATCTCAC Localization tnpA tnpA-R TGGCTACAGCCTTACGTGAG Localization cls cls-F GGTTCCTCGCCACAATAATC Localization cls cls-R AATAGTCTTGGTCGCCTGTG Location 1 yitF yitF-F TGGGCTTCAACATTGGAGAC Location 1 yitG yitG-R CGCCCTGCTTGTCTGGTATG Location 2 yxjA yxjA-R TCTTTAGGCGGTGTATAGATG Location 2 yxjB yxjB-F CAAATGTATGTCCTCGTTCTG Universal spoVAC2mob-Tn1546 Uni-spoVAC-F TGAGCAAACGGCCGGAAATC Universal spoVAC2mob-Tn1546 Uni-spoVAC-R ACCTACGCCCAGTACAAATC Universal cls-Tn1546 Uni-cls-F TGAGACATTCGGTGCTTCAG Universal cls-Tn1546 Uni-cls-R ATCAAGGGTGCTCAACTCTG Universal tnpA-Tn1546 Uni-tnpA-F CAGCTTGGCTACAGCCTTAC Universal tnpA-Tn1546 Uni-tnpA-R GGTTCGTTCCCTAAGCTCTC spoVAC2mob* Det-spoVAC-F TCTGTCTGATCGGTCAGTGTAT spoVAC2mob* Det-spoVAC-R TGATGAGGGCAATGACAA spoVAEb2mob* Det-spoVAEb-F ACACCGGGACATACGTTA spoVAEb2mob* Det-spoVAEb-R CGCACCTAGAAACCCAAA hyp2mob* Det-hyp-F GGCTAAATGTTGTTTCTC hyp2mob* Det-hyp-R GTTCACCATAGGAATTTAC Primer used for deletion lox66-P32-cat-lox71 IS128 AAATCTACCGTTCGTATAATGTATGC lox66-P32-cat-lox71 IS129-tag CTCATGCCCGGGCTGTACCG EMB11 – yitF EMB11-LF-F CAGCGGCGATGTCAGGTTTC EMB11 – yitF EMB11-LF-R GCATACATTATACGAACGGTAGATTTGGCTCAGCCTAT- TAAGCTGG EMB11 – yitF EMB11-RF-F CGGTACAGCCCGGGCATGAGCCGTACAATTTTCA- CACTGG EMB11 – yitF EMB11-RF-R GACGAGCGTTACAGGGAATC EMB13 – Tn1546 EMB13-LF-F TTCCAATGCCTTTTCCTTTC EMB13 – Tn1546 EMB13-LF-R GCATACATTATACGAACGGTAGATTTAGAAAAGCCAT- ACGGAGATG EMB13 – Tn1546 EMB13-RF-F CGGTACAGCCCGGGCATGAGACACCGAGAAATTAGACT EMB13 – Tn1546 EMB13-RF-R AACCGGCCCAATTGCCAT EMB14 – tnpA EMB14-LF-F TTTCCTTTCGGGATATGG EMB14 – tnpA EMB14-LF-R GCATACATTATACGAACGGTAGATTTGAAATGGGCT- TAGCGTTG EMB14 – tnpA EMB14-RF-F CGGTACAGCCCGGGCATGAGGAATGCTTATAGCG- GTCTCATC EMB14 – tnpA EMB14-RF-R AGCTGAGTGGCGCTAAACG EMB15 – operon 1 EMB15-LF-F TGTCCACGTAAAATGACTTC EMB15 – operon 1 EMB15-LF-R GCATACATTATACGAACGGTAGATTTCTGCATC- CCATTGCCAATAG EMB15 – operon 1 EMB15-RF-F CGGTACAGCCCGGGCATGAGTCGCCAAATGCATA- AAAATAG EMB15 – operon 1 EMB15-RF-R GAATAACGGGCATCCTTTC
70 A mobile genetic element profoundly increases heat resistance of spores
Supplementary Table 3. (Continued)
EMB16 – operon 2 EMB16-LF-F TTACTTGGCCCCAATATC EMB16 – operon 2 EMB16-LF-R GCATACATTATACGAACGGTAGATTTATACGGAT- CACTAAGTTTCC EMB16 – operon 2 EMB16-RF-F CGGTACAGCCCGGGCATGAGAAACGTTTAAAAAG- CAATATG EMB16 – operon 2 EMB16-RF-R CAGTCTTTGCTCGACCTTTTC EMB20 – spoVA2mob EMB17-LF-F TATTACAGCGGAGGAATTTGG EMB20 – spoVA2mob EMB17-LF-R GCATACATTATACGAACGGTAGATTTAGAGCTGTTTTA- ACGTCAT EMB20 – spoVA2mob EMB20-RF-F CGGTACAGCCCGGGCATGAGAATTTTTTTTACGAGGT- GTTAG EMB20 – spoVA2mob EMB20-RF-R GAGAATTAAGGTTGGGAAAG EMB21 – last gene spoVA2mob EMB18-LF-F AGCTGCGGTTGATACCATTG EMB21 – last gene spoVA2mob EMB18-LF-R GCATACATTATACGAACGGTAGATTTCCATTCAGG- CACTGCTTACAC EMB21 – last gene spoVA2mob EMB21-RF-F CGGTACAGCCCGGGCATGAGTACCATTTTTAATT- GAAATAAG EMB21 – last gene spoVA2mob EMB21-RF-R ATGATCTGGGCACTGTCC EMB22 – gene 4 EMB22-LF-F ATGGTAGTACACGAAGTAAC EMB22 – gene 4 EMB22-LF-R GCATACATTATACGAACGGTAGATTTATTCACCT- TAGTCCGAAATTG 3 EMB22 – gene 4 EMB18-RF-F CGGTACAGCCCGGGCATGAGGATGTTAACGACTA- ATTTTAAG EMB22 – gene 4 EMB18-RF-R CATACCCAACGTTCATAC EMB19 – gene 5 EMB19-LF-F AGTGACCCCTATTTTAAAAGG EMB19 – gene 5 EMB19-LF-R GCATACATTATACGAACGGTAGATTTAATCCACTC- CAACTGGAATC EMB19 – gene 5 EMB19-RF-F CGGTACAGCCCGGGCATGAGGTGCTTTCTCCATTAT- TATAAG EMB19 – gene 5 EMB19-RF-R CACCCAGTGTGAAAATTG Primer used for complementation EMB23 – spoVA2mob EMB1-F CGCCGGATCCTGGAAAAGGGGTTATTATCG EMB23 – spoVA2mob EMB23-R GCGCCGGTCTCCAGCTTAAAAAATAGACACTTCTAAC
71 Chapter 3
Supplementary Table 4. Genotype - phenotype matching of 18 B. subtilis strains, based on heat resistance of spores, classified as low- or high-level heat resistant. The table displays the top 50 correlated genomic features, as orthologous groups (OG), in relation to the heat resistance of spores (Class High or Class Low). The FeatureID corresponds with an OG from the orthology matrix of 18 B. subtilis strains (Supplementary Dataset 1).
Feature- Class_ Class_ Id High Low Continued Continued OG_3695 0,00 0,89 OG_3050 0,89 0,22 OG_3875 1,00 0,11 OG_3929 0,00 1,00 OG_3451 0,89 0,22 OG_3891 1,00 0,11 OG_3930 0,00 1,00 OG_3977 0,89 0,11 OG_3895 1,00 0,11 OG_3933 0,00 0,89 OG_3979 0,89 0,11 OG_3898 1,00 0,00 OG_4014 0,00 0,89 OG_3983 0,89 0,11 OG_3944 1,00 0,00 OG_4099 0,00 0,78 OG_3986 0,89 0,11 OG_3945 1,00 0,00 OG_4138 0,00 0,78 OG_3988 0,89 0,11 OG_3946 1,00 0,00 OG_4139 0,00 0,78 OG_3990 0,89 0,11 OG_3947 1,00 0,00 OG_4140 0,00 0,78 OG_3991 0,89 0,00 OG_3949 1,00 0,00 OG_4141 0,00 0,78 OG_4031 0,89 0,00 OG_3950 1,00 0,00 OG_4144 0,00 0,78 OG_4032 0,89 0,00 OG_3951 1,00 0,00 OG_3852 0,11 1,00 OG_4034 0,89 0,00 OG_3952 1,00 0,00 OG_3861 0,11 1,00 OG_4036 0,89 0,00 OG_3953 1,00 0,00 OG_3864 0,11 1,00 OG_4061 0,89 0,00 OG_3954 1,00 0,00 OG_3865 0,11 1,00 OG_4063 0,89 0,00 OG_3955 1,00 0,00 OG_3866 0,11 1,00 OG_4064 0,89 0,00 OG_3959 1,00 0,00 OG_3876 0,11 0,89 OG_4065 0,89 0,00 OG_3974 1,00 0,00 OG_3922 0,11 0,89 OG_4066 0,89 0,00 OG_3980 1,00 0,00 OG_3926 0,11 0,89 OG_4070 0,89 0,00 OG_48 1,00 0,33 OG_3927 0,11 0,89 OG_4071 0,89 0,00 OG_3934 0,11 0,89 OG_4072 0,89 0,00 OG_3937 0,11 0,89 OG_4073 0,89 0,00 OG_3938 0,11 0,89 OG_4079 0,89 0,00 OG_3948 0,11 0,89 OG_4080 0,89 0,00 OG_3958 0,11 0,89 OG_4081 0,89 0,00 OG_4052 0,11 0,78 OG_4082 0,89 0,00 OG_4262 0,67 0,00 OG_4084 0,89 0,00 OG_4114 0,78 0,00 OG_3607 1,00 0,11 OG_4116 0,78 0,00 OG_3672 1,00 0,00 OG_4120 0,78 0,00 OG_3719 1,00 0,33 OG_4122 0,78 0,00 OG_3749 1,00 0,33 OG_4123 0,78 0,00 OG_3769 1,00 0,22 OG_4124 0,78 0,00 OG_3783 1,00 0,22 OG_4130 0,78 0,00 OG_3788 1,00 0,22 OG_4145 0,78 0,00 OG_3829 1,00 0,22 OG_4146 0,78 0,00 OG_3830 1,00 0,22 OG_4147 0,78 0,00 OG_3831 1,00 0,22 OG_4148 0,78 0,00 OG_3833 1,00 0,22 OG_4152 0,78 0,00 OG_3869 1,00 0,11 OG_4173 0,78 0,00 OG_3870 1,00 0,11
72 A mobile genetic element profoundly increases heat resistance of spores
Supplementary Table 5. Detection of peptides in total protein extracts from spores of B. subtilis 168HR using LC-MS/MS. Peptide fragments specified in the table are encoded by genes present in the Tn1546 transposon in B. subtilis 168HR (B4417).
Protein Molecular #Peptides Sequence coverage Sequence Weight [kDa] [%] R.DINQIWK.G K.ALEVATGVDVGK.M B4417_4127 32,9 5 16,6 K.MLPVPSLDNNK.F K.FMDQGLYNVLYTWGEADYR.D K.FMDQGLYNVLYTWGEADYR.D K.QLYQDAAK.Q K.QTQSVVDSIEPR.V B4417_4126 7,6 4 75 R.VQQIEQEEPQYK.Q K.SAQASFETFALGTDNQQAK.Q B4417_4121 32,1 1 7,3 K.EPQTIIMDGTIMDEPLATIGR.S
3
73 Chapter 3
Supplementary Table 6. Composition of Tn1546 transposon of four B. cereus strains present on pXO1-like plasmids. The protein sizes are indicated behind the locus tags. The predicted functions of the proteins are indicated in the last column.
Bacillus cereus Bacillus cereus Bacillus cereus Bacillus cereus Predicted function AH187 NC7401 NIZO4085 NIZO4116 C0202|247aa P183|314aa sc65|0639|614aa sc66|0119|614aa transposase for transposon Tn1546 C0203|739aa P184|739aa C0204|192aa P185|192aa sc41|0193|192aa sc45|0120|192aa transposon Tn1546 resolvase C0205|282aa P186|282aa sc41|0194|282aa sc45|0121|282aa AraC family transcriptional regu- lator C0206|170aa P187|165aa sc41|0195|165aa sc45|0122|165aa transposon Tn1546 resolvase C0207|151aa P188|151aa hypothetical protein C0208|233aa P189|233aa sc41|0196|233aa sc45|0123|233aa N-acetylmuramoyl-L-alanine amidase C0209|190aa P190|190aa sc41|0197|190aa sc45|0124|190aa phosphoglycerate mutase family protein P191|58aa hypothetical protein C0210|418aa P192|418aa sc41|0198|410aa sc45|0125|410aa transposase, IS21 family C0211|253aa P193|239aa sc41|0199|253aa sc45|0126|253aa transposition helper protein, IS21 family C0212|70aa P194|38aa sc41|0200|70aa sc45|0127|70aa resolvase C0213|288aa P195|288aa sc41|0201|288aa sc45|0128|288aa transcriptional regulator, AraC family protein C0214|118aa P196|118aa sc41|0202|118aa sc45|0129|118aa C0215|1016aa P197|1018aa sc41|0203|1016aa sc45|0130|1018aa transposase glyoxalase family protein C0216|209aa P198|209aa sc41|0204|209aa sc45|0131|209aa C0217|159aa P199|159aa sc41|0205|159aa sc45|0132|159aa YoaS resolvase/recombinase C0218|77aa P200|77aa sc41|0206|77aa sc45|0133|77aa DNA-binding protein C0219|146aa P201|146aa sc41|0207|146aa sc45|0134|146aa hydrolase C0220|42aa P202|42aa sc41|0208|42aa sc45|0135|42aa hypothetical protein C0221|137aa P205|137aa sc41|0209|113aa sc45|0136|113aa hypothetical protein C0222|498aa P204|498aa sc41|0210|498aa sc45|0137|498aa cardiolipin synthetase P205|53aa hypothetical protein C0223|183aa P206|145aa sc41|0211|151aa sc45|0138|151aa conserved membrane protein YetF P207|38aa hypothetical protein P208|41aa hypothetical protein C0224|47aa sc41|0212|47aa sc45|0139|47aa transposase, Tn3 family C0225|69aa P209|69aa sc57|4511|69aa sc59|1958|69aa hypothetical protein C0226|162aa P210|181aa sc57|4512|162aa sc59|1957|162aa hypothetical protein C0227|159aa P211|159aa sc57|4513|159aa sc59|1956|159aa stage V sporulation protein AC C0228|339aa P212|339aa sc57|4514|339aa sc59|1955|339aa stage V sporulation protein AD C0229|117aa P213|117aa sc57|4515|117aa sc59|1954|117aa stage V sporulation protein AE C0230|49aa P214|69aa sc57|4516|49aa sc59|1953|49aa hypothetical protein C0231|290aa P215|290aa sc57|4517|290aa sc59|1952|290aa hypothetical protein C0232|194aa P216|194aa sc57|4518|194aa sc59|1951|194aa hypothetical protein C0233|184aa P217|168aa sc55|4886|77aa sc58|4189|85aa resolvase P218|53aa hypothetical protein C0234|377aa P219|377aa sc554888|377aa sc58|4187|377aa spore germination protein, Ger C0235|365aa P220|369aa sc554889|365aa sc58|4186|365aa spore germination protein C0236|512aa P221|498aa sc554890|495aa sc58|4185|495aa spore germination protein, gerabka family C0237|500aa P222|500aa sc554891|500aa sc58|4184|500aa transposase, putative C0238|614aa P224|314aa transposase for transposon Tn1546 C0239|247aa P223|614aa
74 A mobile genetic element profoundly increases heat resistance of spores
Recipient Donor B. subtilis 168-spR B. subtilis B4067
Induction Mitomycin C
Phage sequencing 3
Sporulation
Prophage region B4067
zoom Select survivors 100 °C 60 minutes 2500
1500
500 Read coverage 1x106 2x106 3x106 4x106 Genocmic location B4067 in bp Sequencing of B4417
Supplementary Figure 1. Overview of the construction of B. subtilis strain 168HR. Strain B. subtilis 168-spr (amyE::specr, trpC2), producing low-level heat resistant spores, was used as a recipient strain and B. subtilis B4067, producing high-level heat resistant spores, was used as donor strain. B. subtilis strain B4067 carries a prophage of 39kb in its genome (Genbank accession numbers B4067_4636 to B4067_4698), which was induced with mitomycin C to form phages. DNA was extracted from phages and sequenced, revealing the presence of the entire chromosome of strain B4067, with an overrepresentation (>2500 times) of the prophage region (a more detailed description can be found in the Materials and Methods section). Phages of B4067 and cells of strain 168-spr were combined on a filter to allow for transfer of DNA. Subsequently, cells were allowed to form spores on sporulation plates. Spores that obtained the Tn1546 transposon were selected based on their increased heat resistance, namely, survival of a heat treatment at 100 ˚C for 60 minutes. One strain, designated 168HR (culture collection number B4417), was selected and the genome was sequenced (Genbank accession number LJSM00000000). The sequencing revealed the carry-over of a 100 kb DNA fragment that recombined between metC and yitA and included the Tn1546 transposon integrated in yitF (BSU10970).
75 Chapter 3
Geobacillus caldoxylosilyticus G10~GeobacilluscaldoxylosilyticusG10 2208 Anoxybacillus flavithermus WK1 uid59135~Aflv 1008 Anoxybacillus flavithermus TNO 09 014~AF14 0347 Anoxybacillus flavithermus TNO 09 006 uid184762~AF6 1025 Anoxybacillus flavithermus TNO 09 016~AF16 1805 Geobacillus toebii T27 S Oomes B4110~B4110 2432 Geobacillus WCH70 uid59045~GWCH70 2246 Geobacillus Y4 1MC1 uid55779~GY4MC1 1253 Geobacillus thermoglucosidans TNO 09 020 uid181720~GT20 1130 Anoxybacillus flavithermus B4168~B4168 1105 Geobacillus thermoglucosidans TNO 09 023~GT23 0528 Geobacillus thermoglucosidasius C56 YS93 uid48129~Geoth 1363 Geobacillus caldoxylosilyticus B4119~B4119 2631 Geobacillus thermodenitrificans NG80 2 uid58829~GTNG 2235 Geobacillus sp G11MC16~G11MC16DRAFT 1222 Geobacillus group T22S B4113~B4113 2454 Geobacillus sp C56−T2~GC56T2 2275 Geobacillus stearothermophilus 10~Geobacillusstearothermophilus10 987 Geobacillus stearothermophilus TNO 09 008~GS8 2013 Geobacillus stearothermophilus T14 B4109~B4109 1834 Geobacillus stearothermophilus TNO 09 027~GS27 2239 Geobacillus stearothermophilus A B4114~B4114 1915 Geobacillus Y412MC61 uid41171~GYMC61 0378 Geobacillus HH01 uid188479~GHH c23910 Geobacillus thermoleovorans CCB US3 UF5 uid82949~GTCCBUS3UF5 25990 Geobacillus Y412MC52 uid55381~GYMC52 2284 Geobacillus C56 T3 uid49467~GC56T3 1199 Geobacillus kaustophilus HTA426 uid58227~GK2304 Bacillus cereus NIZO4117~NIZO4117 1519 Bacillus cereus NIZO4083~NIZO4083 3540 Bacillus cereus G9842 uid58759~BCG9842 B1062 Bacillus cereus B4158~B4158 4061 Bacillus cereus B4264 uid58757~BCB4264 A4176 Bacillus cereus CMCC2818 B4080~B4080 4006 Bacillus cereus NIZO4118~NIZO4118 3712 Bacillus cereus NIZO4084~NIZO4084 5119 Bacillus cereus NIZO4155~NIZO4155 2083 1 Bacillus cereus ATCC 14579 uid57975~BC4067 SpoVAD Bacillus cereus NIZO4120~NIZO4120 5017 Bacillus cereus NIZO4081~NIZO4081 3494 Bacillus cereus NIZO4088~NIZO4088 2318 Bacillus cereus BCM2 134A B4077~B4077 5003 Bacillus cereus B4147~B4147 4325 Bacillus cereus NIZO4082~NIZO4082 3014 Bacillus cereus E33L uid58103~BCZK3824 Bacillus cereus NC7401 uid82815~BCN 3980 Bacillus cereus CMCC2724 B4086~B4086 3936 Bacillus cereus AH187 uid58753~BCAH187 A4199 Bacillus cereus NIZO4116~NIZO4116 2296 Bacillus cereus Q1 uid58529~BCQ 3858 Bacillus cereus L29 16 B4078~B4078 4211 Bacillus cereus B4153~B4153 4402 Bacillus cereus NIZO4085~NIZO4085 3683 Bacillus cereus 03BB102 uid59299~BCA 4179 Bacillus cereus F837 76 uid83611~bcf 20230 Bacillus cereus biovar anthracis CI uid50615~BACI c40350 Bacillus cereus group PEA26 B4087~B4087 4359 Bacillus cereus AH820 uid58751~BCAH820 4088 Bacillus cereus FRI 35 uid173403~BCK 14860 Bacillus cereus NIZO4079~NIZO4079 3519 Bacillus cereus ATCC 10987 uid57673~BCE 4136 Bacillus licheniformis NIZO4125~NIZO4125 2129 Bacillus licheniformis NIZO4121~NIZO4121 3532 Bacillus licheniformis NIZO4123~NIZO4123 3634 Geobacillus vulcani B4164~B4164 2464 Bacillus licheniformis NIZO4094~NIZO4094 2483 Bacillus licheniformis C B4092~B4092 2679 Bacillus licheniformis NIZO4089~NIZO4089 1869 Bacillus licheniformis T29 B4091~B4091 3309 Bacillus licheniformis T1 fatty acid B4090~B4090 2676 Bacillus licheniformis NIZO4124~NIZO4124 2694 Bacillus subtilis B4144~B4144 2764 Bacillus subtilis B4140~B4140 2573 Bacillus amyloliquefaciens FZB42 uid58271~RBAM 021520 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 2237 Bacillus subtilis B425~B425 2576 Bacillus amyloliquefaciens LL3 uid158133~LL3 02525 Bacillus subtilis spizizenii TU B 10 uid73967~GYO 2575 Bacillus subtilis spizizenii W23 uid51879~BSUW23 11490 Bacillus subtilis spizizenii DV1 B 1~BSDV1B 0269 Bacillus subtilis RO NN 1 uid158879~I33 2411 Bacillus subtilis CC16 B4071~B4071 2201 Bacillus subtilis CC2 B4068~B4068 2367 Bacillus subtilis A162 B4070~B4070 2220 Bacillus subtilis MC85 B4073~B4073 2360 Bacillus subtilis B4145~B4145 2340 Bacillus subtilis A163 B4067~B4067 2564 Bacillus subtilis JH642 uid55255~BsubsJ 010100012688 Bacillus subtilis RL45 B4072~B4072 2384 Bacillus subtilis IIC14 B4069~B4069 2370 Bacillus subtilis B4146~B4146 2491 Bacillus subtilis NCIB 3610 uid55265~BsubsN3 010100012767 Bacillus subtilis 168 uid57675~BSU23410 Bacillus licheniformis NIZO4122~NIZO4122 2223 Bacillus subtilis B4143~B4143 2310 Bacillus subtilis PY79 uid229877~U712 11380 Geobacillus debilis DSM 16016~A3EQDRAFT 02553 Geobacillus debilis B4135~B4135 0402 Bacillus thermoamylovorans B4064~B4064 3112 Bacillus thermoamylovorans B4065~B4065 2009 Bacillus thermoamylovorans B4167~B4167 3717 Bacillus thermoamylovorans B4166~B4166 3482 Bacillus sporothermodurans IC4 B4102~B4102 3005 Anoxybacillus flavithermus WK1 uid59135~Aflv 2085 Anoxybacillus flavithermus TNO 09 016~AF16 1389 Anoxybacillus flavithermus TNO 09 006 uid184762~AF6 2073 Anoxybacillus flavithermus TNO 09 014~AF14 1880 Geobacillus caldoxylosilyticus G10~GeobacilluscaldoxylosilyticusG10 1476 Geobacillus toebii T27 S Oomes B4110~B4110 0894 Geobacillus WCH70 uid59045~GWCH70 0789 Anoxybacillus flavithermus B4168~B4168 2908 Geobacillus thermoglucosidasius C56 YS93 uid48129~Geoth 3024 Geobacillus thermoglucosidans TNO 09 020 uid181720~GT20 2655 Geobacillus Y4 1MC1 uid55779~GY4MC1 3006 Geobacillus thermoglucosidans TNO 09 023~GT23 2090 Geobacillus caldoxylosilyticus B4119~B4119 0885 Geobacillus sp C56−T2~GC56T2 0873 Geobacillus group T22S B4113~B4113 0910 Geobacillus thermodenitrificans NG80 2 uid58829~GTNG 0734 Geobacillus sp G11MC16~G11MC16DRAFT 0440 Geobacillus stearothermophilus TNO 09 027~GS27 1040 Geobacillus stearothermophilus TNO 09 008~GS8 1558 Geobacillus stearothermophilus T14 B4109~B4109 0694 Geobacillus thermoleovorans CCB US3 UF5 uid82949~GTCCBUS3UF5 10150 Geobacillus stearothermophilus A B4114~B4114 0733 Geobacillus kaustophilus HTA426 uid58227~GK0854 Geobacillus HH01 uid188479~GHH c07980 Geobacillus C56 T3 uid49467~GC56T3 2691 Geobacillus Y412MC61 uid41171~GYMC61 1655 Geobacillus Y412MC52 uid55381~GYMC52 0780 Geobacillus stearothermophilus 10~Geobacillusstearothermophilus10 1270 Bacillus thermoamylovorans B4064~B4064 1751 Bacillus thermoamylovorans B4065~B4065 2832 Bacillus thermoamylovorans B4167~B4167 2484 Bacillus thermoamylovorans B4166~B4166 2822 Bacillus thermoamylovorans B4167~B4167 2401 Bacillus thermoamylovorans B4166~B4166 2585 Bacillus thermoamylovorans B4064~B4064 1742 Bacillus thermoamylovorans B4065~B4065 2823 Bacillus subtilis A162 B4070~B4070 4524 Bacillus subtilis B4145~B4145 4582 Bacillus subtilis A163 B4067~B4067 4788 Bacillus sporothermodurans IC4 B4102~B4102 0634 Bacillus subtilis A162 B4070~B4070 4541 Bacillus subtilis B4145~B4145 4636 Bacillus subtilis A163 B4067~B4067 4766 Bacillus subtilis B4146~B4146 1177 Bacillus licheniformis NIZO4122~NIZO4122 0623 2 Bacillus subtilis CC2 B4068~B4068 4212 SpoVAD Bacillus subtilis RL45 B4072~B4072 4307 2mob Bacillus subtilis MC85 B4073~B4073 4321 SpoVAD Bacillus subtilis IIC14 B4069~B4069 4294 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 3820 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 1963 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 1841 Bacillus licheniformis C B4092~B4092 2245 Bacillus subtilis CC16 B4071~B4071 4285 Bacillus subtilis B425~B425 4213 Bacillus amyloliquefaciens LL3 uid158133~LL3 04142 Bacillus amyloliquefaciens LL3 uid158133~LL3 02056 Bacillus licheniformis NIZO4094~NIZO4094 1464 Bacillus licheniformis T1 fatty acid B4090~B4090 2275 Bacillus cereus 03BB102 uid59299~BCA 5275 Bacillus cereus CMCC2818 B4080~B4080 5533 Bacillus cereus NIZO4082~NIZO4082 1185 Bacillus cereus F837 76 uid83611~bcf 25700 Bacillus cereus NC7401 uid82815~BCN P212 Bacillus cereus CMCC2724 B4086~B4086 5078 Bacillus cereus AH187 uid58753~BCAH187 C0228 Bacillus cereus NIZO4116~NIZO4116 1955 Bacillus cereus Q1 uid58529~BCQ PI170 Bacillus cereus biovar anthracis CI uid50615~BACI c51290 Bacillus cereus group PEA26 B4087~B4087 5058 Bacillus cereus AH820 uid58751~BCAH820 B0207 Bacillus cereus NIZO4085~NIZO4085 4514 Bacillus cereus E33L uid58103~BCZK4840 Bacillus cereus group PEA26 B4087~B4087 5263 Bacillus cereus NIZO4079~NIZO4079 3932 Bacillus cereus AH820 uid58751~BCAH820 5232 Bacillus cereus G9842 uid58759~BCG9842 B5691 Bacillus cereus Q1 uid58529~BCQ 4968 Bacillus cereus FRI 35 uid173403~BCK 09665 Bacillus cereus ATCC 10987 uid57673~BCE 5250 Bacillus cereus NC7401 uid82815~BCN 5059 Bacillus cereus AH187 uid58753~BCAH187 A5308 Bacillus cereus L29 16 B4078~B4078 4996 Bacillus cereus NIZO4118~NIZO4118 3703 Bacillus cereus B4264 uid58757~BCB4264 A5266 Bacillus cereus B4158~B4158 5221 Bacillus cereus NIZO4084~NIZO4084 0636 Bacillus cereus NIZO4120~NIZO4120 1779 Bacillus cereus ATCC 14579 uid57975~BC5148 Bacillus cereus NIZO4081~NIZO4081 5036 Bacillus cereus NIZO4117~NIZO4117 2579 Bacillus cereus NIZO4083~NIZO4083 1440 Bacillus cereus NIZO4088~NIZO4088 4071 0.1 Bacillus cereus BCM2 134A B4077~B4077 5879 Bacillus cereus B4147~B4147 5477
Supplementary Figure 2. Phylogenetic tree of SpoVAD proteins encoded in the 103 genomes of spore forming Bacillaceae. Based on the genomic context of the spoVAD genes, with organization spoVAA-AF for spoVA1, and organization hypothetical DUF1657, yhcn/ylaJ, spoVAC-AEb, hypothetical DUF1657, hypothetical DUF421/1657 for the spoVA2/spoVA2mob operon (see also Fig 3A), the SpoVAD proteins are found in the two major branches of the phylogenetic tree. A nucleotide based phylogenetic tree was also constructed for spoVAD genes and, similar to the protein tree, resulted in separation in two major branches (data not shown).
76 A mobile genetic element profoundly increases heat resistance of spores
References supplementary materials 1. Auger S, Galleron N, Ségurens B, Dossat C, Bolotin A, Wincker P, Sorokin A. 2012. Complete genome sequence of the highly hemolytic strain Bacillus cereus 194:1630. 2. Barbe V, Cruveiller S, Kunst F, Lenoble P, Meurice G, SekowskaF837/76. A, Vallenet Journal D, Wang of Bacteriology T, Moszer I, Medigue C, Danchin A. Bacillus subtilis 168 reference genome a decade later. Microbiology 155:1758-1775. 3. Berendsen EM, Wells-Bennik2009. FromMHJ, aKrawczyk consortium AO, sequence de Jong to A,a unifiedHolsappel sequence: S, Eijlander the RT, Kuipers OP. Submitted. Draft genome sequences of ten Bacillus subtilis strains that form spores with a high or low heat-resistance. Genome Announcements. 4. Berendsen EM, Wells-Bennik MHJ, Krawczyk AO, de Jong A, Van Heel AJ, Holsappel S, Eijlander RT, Kuipers OP. Submitted. Draft genome sequences of seven thermophilic sporeforming bacteria isolated from foods that produce highly heat resistant spores, comprising Geobacillus spp., Caldibacillus debilis and Anoxybacillus flavithermus. Genome Announcements. 5. Berendsen EM, Zwietering MH, Kuipers OP, Wells-Bennik MHJ. 2015. Two distinct groups within the Bacillus subtilis Food Microbiology 45, Part A:18-25. 6. Brehm SP, Staal SP, Hoch groupJA. 1973. display Phenotypes significantly of pleiotropic-negative different spore heat sporulation resistance mutantsproperties. of Bacillus subtilis. Journal of Bacteriology 115:1063-1070. 7. Caspers MPM, Boekhorst J, Abee T, Siezen RJ, Kort R. 2013. Complete genome sequence of Anoxybacillus flavithermus TNO-09.006, a thermophilic sporeformer associated with a dairy- processing environment. Genome Announcements 1. 8. Caspers MPM, Schuren FHJ, van Zuijlen ACM, Brul S, Montijn RC, Abee T, Kort R. 2011. A 3 bacilli. Food Microbiology 28:245- 251. 9. mixed-speciesCazemier AE, Wagenaars microarray forSFM, identification Ter Steeg PF. of 2001. food spoilageEffect of sporulation and recovery medium on the heat resistance and amount of injury of spores from spoilage bacilli. Journal of Applied Microbiology 90:761-770. 10. Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O, Junge H, Voigt B, Jungblut PR, Vater J, Sussmuth R, Liesegang H, Strittmatter A, Gottschalk G, Borriss R. 2007. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 25:1007-1014. 11. Geng W, Cao M, Song C, Xie H, Liu L, Yang C, Feng J, Zhang W, Jin Y, Du Y, Wang S. 2011. Complete genome sequence of Bacillus amyloliquefaciens 193:3393-3394. 12. Guerout-Fleury AM, Frandsen N, Stragier P. 1996.LL3, Plasmids which exhibits for ectopic glutamic integration acid-independent in Bacillus productionsubtilis. Gene of 180: poly-γ-glutamic57-61. acid. Journal of Bacteriology 13. Han CS, Xie G, Challacombe JF, Altherr MR, Bhotika SS, Bruce D, Campbell CS, Campbell ML, Chen J, Chertkov O, Cleland C, Dimitrijevic M, Doggett NA, Fawcett JJ, Glavina T, Goodwin LA, Hill KK, Hitchcock P, Jackson PJ, Keim P, Kewalramani AR, Longmire J, Lucas S, Malfatti S, McMurry K, Meincke LJ, Misra M, Moseman BL, Mundt M, Munk AC, Okinaka RT, Parson- Quintana B, Reilly LP, Richardson P, Robinson DL, Rubin E, Saunders E, Tapia R, Tesmer JG, Thayer N, Thompson LS, Tice H, Ticknor LO, Wills PL, Brettin TS, Gilna P. 2006. Pathogenomic sequence analysis of Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus anthracis. Journal of Bacteriology 188:3382-3390. 14. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A, Chu L, Mazur M, Goltsman E, Larsen N, D’Souza M, Walunas T, Grechkin Y, Pusch G, Haselkorn R, Fonstein M, Dusko Ehrlich S, Overbeek R, Kyrpides N. 2003. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423:87-91. 15. Klee SR, Brzuszkiewicz EB, Nattermann H, Brüggemann H, Dupke S, Wollherr A, Franz T, Pauli G, Appel B, Liebl W, Couacy-Hymann E, Boesch C, Meyer F-D, Leendertz FH, Ellerbrok H, Gottschalk G, Grunow R, Liesegang H. 2010. The genome of a Bacillus
isolate causing anthrax in
77 Chapter 3
chimpanzees combines chromosomal properties of B. cereus with B. anthracis virulence plasmids. PLoS ONE 5:e10986. 16. Kort R, O’Brien AC, van Stokkum IHM, Oomes SJCM, Crielaard W, Hellingwerf KJ, Brul S.
monitoring of dipicolinic acid release. Applied and Environmental Microbiology 71:3556-3564. 17. Krawczyk2005. Assessment AO, Berendsen of heat resistance EM, Eijlander of bacterial RT, de spores Jong fromA, Wells-Bennik food product MHJ, isolates Kuipers by fluorescence OP. 2015. Draft genome sequences of four Bacillus thermoamylovorans strains isolated from milk and acacia gum, a food ingredient. Genome Announcements 3. 18. Krawczyk AO, de Jong A, Eijlander RT, Berendsen EM, Holsappel S, Wells-Bennik MHJ, Kuipers OP. Bacillus cereus, isolated from food. Genome Announcements. 19. Krawczyk AO,Submitted. de Jong NextA, Holsappel generation S, wholeEijlander genome RT, sequencingVan Heel AJ, of Berendsen eight strains EM, of Wells- Bennik MHJ, Kuipers OP. Submitted. Genome sequences of twelve sporeforming Bacillus species, comprising Bacillus coagulans, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus sporothermodurans, and Bacillus vallismortis, isolated from foods. Genome Announcements. 20. Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V, Bertero MG, Bessieres P, Bolotin A, Borchert S, Borriss R, Boursier L, Brans A, Braun M, Brignell SC, Bron S, Brouillet S, Bruschi CV, Caldwell B, Capuano V, Carter NM, Choi SK, Codani JJ, Connerton IF, Cummings NJ, Daniel RA, Denizot F, Devine KM, Dusterhoft A, Ehrlich SD, Emmerson PT, Entian KD, Errington J, Fabret C, Ferrari E, Foulger D, Fritz C, Fujita M, Fujita Y, Fuma S, Galizzi A, Galleron N, Ghim SY, Glaser P, Goffeau A, Golightly EJ, Grandi G, Guiseppi G, Guy BJ, Haga K, et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390:249- 256. 21. Lambert JM, Bongers RS, Kleerebezem M. deletions and selectable-marker removal in Lactobacillus plantarum. Applied and Environmental Microbiology 73:1126-1135. 2007. Cre-lox-based system for multiple gene 22. Nakamura LK, Roberts MS, Cohan FM. 1999. Note: Relationship of Bacillus subtilis clades associated with strains 168 and W23: A proposal for Bacillus subtilis subsp. subtilis subsp. nov. and Bacillus subtilis subsp. spizizenii subsp. nov. International Journal of Systematic Bacteriology 49:1211-1215. 23. Oomes SJCM, Brul S. of sporulating Bacillus subtilis cells in relation to spore wet heat resistance. Innovative Food Science & Emerging Technologies2004. 5: The307-316. effect of metal ions commonly present in food on gene expression 24. Oomes SJCM, Jonker MJ, Wittink FRA, Hehenkamp JO, Breit TM, Brul S. 2009. The effect of calcium on the transcriptome of sporulating B. subtilis cells. International Journal of Food Microbiology 133:234-242. 25. Oomes SJCM, van Zuijlen ACM, Hehenkamp JO, Witsenboer H, van der Vossen JMBM, Brul S. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 26. Priest FG, Goodfellow M, Shute LA, Berkeley RCW. 1987. Bacillus amyloliquefaciens sp. nov., nom. rev. International Journal of Systematic Bacteriology 37:69-71. 27. Priest FG, Goodfellow M, Todd C. Microbiol 134:1847-1882. 28. Rasko DA, Ravel J, Okstad OA, Helgason1988. E,A numericalCer RZ, Jiang classification L, Shores KA,of the Fouts genus DE, Bacillus. Tourasse J Gen NJ, Angiuoli SV, Kolonay J, Nelson WC, Kolsto AB, Fraser CM, Read TD. 2004. The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Research 32:977-988. 29. Ruckert C, Blom J, Chen X, Reva O, Borriss R. 2011. Genome sequence of B. amyloliquefaciens type strain DSM7(T) reveals differences to plant-associated B. amyloliquefaciens FZB42. Journal of Biotechnology 155:78-85. 30. Saw J, Mountain B, Feng L, Omelchenko M, Hou S, Saito J, Stott M, Li D, Zhao G, Wu J, Galperin M, Koonin E, Makarova K, Wolf Y, Rigden D, Dunfield P, Wang L, Alam M. 2008. Encapsulated in silica: genome, proteome and physiology of the thermophilic bacterium Anoxybacillus flavithermus WK1. Genome Biology 9:R161. 31. Smith JL, Goldberg JM, Grossman AD. 2014. Complete genome sequences of Bacillus subtilis
78 A mobile genetic element profoundly increases heat resistance of spores
subsp. subtilis laboratory strains JH642 (AG174) and AG1839. Genome Announcements 2. 32. Takeno A, Okamoto A, Tori K, Oshima K, Hirakawa H, Toh H, Agata N, Yamada K, Ogasawara N, Hayashi T, Shimizu T, Kuhara S, Hattori M, Ohta M. 2012. Complete genome sequence of Bacillus cereus 194:4767-4768. 33. Xiong Z,NC7401, Jiang Y, which Qi D, Lu produces H, Yang high F, Yang levels J, Chen of the L, Sunemetic L, Xu toxin X, Xue cereulide. Y, Zhu Y,Journal Jin Q. 2009.of Bacteriology Complete Bacillus cereus strain Q1 with industrial applications. Journal of Bacteriology 191:1120-1121. 34. genomeZahler SA, sequence Korman of RZ, the Thomas extremophilic C, Fink PS, Weiner MP, Odebralski JM. 1987. H2, a temperate bacteriophage isolated from Bacillus amyloliquefaciens strain H. Journal of General Microbiology 133:2937-2944. 35. Zeigler DR. 2011. The genome sequence of Bacillus subtilis subsp. spizizenii W23: insights into speciation within the B. subtilis B. subtilis genetics. Microbiology 157:2033-2041. 36. Zeigler DR, Pragai Z, Rodriguezcomplex S, Chevreux and into B, Muffler the history A, Albert of T, Bai R, Wyss M, Perkins JB. 2008. The origins of 168, W23, and other Bacillus subtilis legacy strains. Journal of Bacteriology 190:6983-6995. 37. Zhao Y, Caspers MP, Abee T, Siezen RJ, Kort R. 2012. Complete genome sequence of Geobacillus thermoglucosidans TNO-09.020, a thermophilic sporeformer associated with a dairy-processing environment. Journal of Bacteriology 194:4118.
3
79
Chapter 4
High-level heat resistance of spores of Bacillus amyloliquefaciens and Bacillus licheniformis results from the presence of a spoVA operon in a Tn1546 transposon
Erwin M. Berendsen Rosella A. Koning Jos Boekhorst Anne de Jong Oscar P. Kuipers Marjon H.J. Wells-Bennik Chapter 4
Abstract Bacterial endospore formers can produce spores that are resistant against many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon present on a Tn1546 transposon in Bacillus subtilis profoundly increases the wet heat resistance of spores. In this study, the presence of the Tn1546 transposon was assessed in nine strains of Bacillus amyloliquefaciens and nine strains of Bacillus licheniformis, and was found to be naturally present in several strains. Its effect on the wet heat resistance of spores was investigated. The presence of the Tn1546 transposon homologues and spoVA PCR detection. Strains of B. amyloliquefaciens and B. licheniformis carrying a Tn1546 operon was confirmed by whole genome sequencing and
counterparts that lacked this transposon. The spoVA operons encoded on the Tn1546 transposon produced spores with significantly higher resistance to wet heat than their transposons of B. licheniformis and B. amyloquefaciens were cloned into B. subtilis 168,
spoVA genes on a transposon determine heat resistance properties of spores of strains and resulted in strains that produced high-level heat resistant spores. The finding that belonging to the B. subtilis group can contribute to improved control of these spores in the food chain.
82 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
Introduction Bacterial spore formers can survive harsh environmental conditions due to the formation of endospores (spores) and they are ubiquitously found in nature (27, 40). Since bacterial spores are widely present in nature, they can enter the food chain from of spores potentially result in survival during food processing, in which heating is one many different sources, for example via soil (13). The intrinsic resistance properties of the most commonly applied treatments to reduce bacterial loads. Such treatments strains that produce spores with high heat resistance (32). Surviving spores may put selective pressure on the microflora that is present, allowing for survival of those resume vegetative growth, potentially resulting in food pathogenicity or food spoilage, germinate upon exposure to certain environmental triggers, and can subsequently depending on the species (39).
Spores of mesophilic species belonging to the B. subtilis group are commonly found in various food ingredients and food products. The B. subtilis group encompasses the species B. subtilis, B. amyloliquefaciens, B. licheniformis, B. vallismortis, B. mojavensis, B. atropheus and B. sonorensis, which are phylogenetically close, yet distinguishable (22). growth temperatures of B. licheniformis B. subtilis, B. These species can generally grow between temperatures of 30°C to 50°C, with reported amyloliquefaciens and B. licheniformis, are commonly found in various food ingredients up to 58°C (51). The spores of and food products including cocoa, herbs, spices, bread, soups, milk and milk powders (20, 23, 26, 29, 42). These species are for instance well-known contaminants of raw materials used in bread making (36, 41), and the spores can potentially even survive the 4 bread baking process (44). After spore survival, germination, and outgrowth, vegetative cells of B. amyloliquefaciens, B. subtilis or B. licheniformis can result in spoiled bread, by ropy bread (41, 44, 45). Certain strains of B. licheniformis degradation of starch and the formation of extracellular polysaccharide, resulting in A, that can lead to foodborne illness (21, 28, 38). Lichenisyn is a non-ribosomally can produce a toxin, lichenisyn synthesized lipo-peptide that is heat-stable (14). Due to the pathogenic potential of strains of B. licheniformis, it is critical to control these spores in the food chain (24).
The resistances of spores toward wet heat treatments that are applied in food processing B. subtilis group (4, 15, 20, 29). A detailed analysis of the heat resistance of spores for fourteen strains of the B. subtilis can vary significantly between strains within the group revealed the presence of two distinct groups of strains that produce spores with B. subtilis strains, we recently demonstrated that the high-level heat resistance of spores resulted from the presence significantly different heat resistances of spores (4). For of a spoVA operon (designated spoVA2mob, where mob indicates the presence on a mobile genetic element) that is encoded on a Tn1546 transposon (3). In another study, we
83 Chapter 4
observed high-level heat resistance of spores of two B. amyloliquefaciens strains (B4140 and B425), with spores of strain B425 showing heat resistance levels similar to those of spores of B. subtilis strains with a Tn1546 transposon (4). Given the fact that B. subtilis, B. amyloliquefaciens and B. licheniformis are closely related, variation in resistance of spores to wet heat in the latter two species may also result from the presence or absence of a transposon.
In this study, we evaluated presence or absence of the Tn1546 transposon homologue that mediates heat resistance of spores in B. subtilis in nine strains of B. amyloliquefaciens and nine strains of B. licheniformis. This was performed by either genome analysis or by PCR detection. In addition, the detailed spore heat inactivation kinetics were determined for all eighteen strains, and phenotypic data on spore heat resistance correlated with the presence or absence of the Tn1546 transposon. The spoVA2mob operons found in B. amyloliquefaciens and B. licheniformis were introduced into B. subtilis to assess their role in spore heat resistance.
Materials and methods Bacterial strains used in this study The strains used in this study for genomic and phenotypic analyses are listed in Table 1. In this study, nine strains of B. amyloliquefaciens and nine strains of B. licheniformis were analyzed. For B. amyloliquefaciens strains B425 and B4140, the heat inactivation kinetics of their spores were described previously (4). Strains of B. subtillis 168 and B. subtilis B4146 were included in the genome analysis, and were previously analysed for heat resistance of spores (4).
Genome analysis Multiple sequence alignments were made for protein sequences of conserved genes that were present in single copy in all genomes using MUSCLE (10). The core genome phylogenetic tree was constructed using PHYML (12). To verify the presence of the Tn1546 transposon and the encoded spoVA (designated spoVA2mob) operon, an
B. amyloliquefaciens strains, the nine B. licheniformis strains, B. subtilis B4146 as a strain orthology matrix was constructed using Ortho-MCL (18) with the genomes of the four that produces spores with high heat resistance and B. subtilis 168 as a reference strain, producing spores of normal heat resistance. The genomic organization of the Tn1546 transposon was visualized using Artemis, the Artemis comparison tool (ACT), and 1546 transposons, operon predictions were performed using FGENESB (www.softberry. using microbial genomic context viewer (MGcV) (5, 6, 31). For the identified Tn com). Additionally, manual sequence comparisons and searches for pseudogenes were performed for all genes in the transposon.
84 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
Table 1. Strains used in this study.
Strain No Species Description Tn1546 Genome sequence Reference B425 B. amyloliquefaciens Isolated from sterilized Yes LQYP00000000 (4) milk B4140 B. amyloliquefaciens Isolated from pizza No LQYO00000000 (4) 10A5 B. amyloliquefaciens Known as 10A5; NRRL No (PCR) No (34) B-14393, isolated from soil FZB42- B. amyloliquefaciens Known as 10A6; FZB42, No NC_009725 (9) isolated from plant soil 10A18 B. amyloliquefaciens Known as 10A18; No (PCR) No (52) CU8004 DSM7- B. amyloliquefaciens Known as DSM7, isolat- Yes FN597644 (37) ed from soil DSM1060 B. amyloliquefaciens Known as DSM1060 No (PCR) No (33) 101 B. amyloliquefaciens Received as 101 No (PCR) No This study SB42 B. amyloliquefaciens Received as SB42 No (PCR) No This study B4089 B. licheniformis - No LKPM00000000 (29) lated from pea soup B4090 B. licheniformis Known as T1,E5/T12,iso isolated Yes LQYL00000000 (29) from pea soup B4091 B. licheniformis Known as T29, isolated No LQYM00000000 (29) from mushroom soup B4092 B. licheniformis Isolated from butter- Yes LQYK00000000 This study milk powder B4094 B. licheniformis Isolated from camomile Yes LKPN00000000 This study tea B4121 B. licheniformis Isolated from sateh No LKPO00000000 This study pastry B4123 B. licheniformis Isolated from sateh No LKPP00000000 This study pastry 4 B4124 B. licheniformis Isolated from pancakes No LKPQ00000000 This study B4125 B. licheniformis Isolated from pancakes No LKPR00000000 This study B4062 B. subtilis Type strain 168 No NC_000964 (17) B4146 B. subtilis Isolated from curry Yes NZ_JXHR01000000 (4) sauce 168- B. subtilis 168 amyE::spoVA2mob - - This study spoVA2mob (B4090) specR (B4090) 168- B. subtilis 168 amyE::spoVA2mob - - This study spoVA2mob (DSM7) specR (DSM7)
Generic PCR primers were designed for the detection of the Tn1546 encoded genes tnpA, spoVAC2mob and cls in the other strains of B. amyloliquefaciens. The primers were designed based on aligned nucleotide sequences of the corresponding genes found in B. subtilis, B. licheniformis and B. amyloliquefaciens using MUSCLE (10). These primers B. amyloliquefaciens (10A5, FZB42, 10A18, 101 and SB42) for which no genome sequence (Table 2) were used for verification of the presence of these genes in the five strains of was available.
85 Chapter 4
Table 2 . Primers used in this study. Primers were designed for detection of tree genes of the Tn1546 transposon: tnpA, spoVAC2mob and cardiolipin synthase (cls). The expected PCR fragment sizes for tnpA, spoVAC and cls, are 181 bp, 192 bp, and 687 bp, respectively. For the B. amyloliquefaciens strains 101, SB42, DSM1060, 10A5, and 10A18 a PCR was performed on genomic DNA for the detection of Tn1546 encoded tnpA, spoVAC and cls genes. The spoVA2mob operon was cloned from B4090 and DSM7 into pDG1730 (11) using the primers EMB-1-F and EMB- 23-R. Primer used for Name primer DNA sequence 5’ to 3’ Universal spoVAC2mob Uni-spoVAC-F TGAGCAAACGGCCGGAAATC Universal spoVAC2mob Uni-spoVAC-R ACCTACGCCCAGTACAAATC Universal cls Uni-cls-F TGAGACATTCGGTGCTTCAG Universal cls Uni-cls-R ATCAAGGGTGCTCAACTCTG Universal tnpA Uni-tnpA-F CAGCTTGGCTACAGCCTTAC Universal tnpA Uni-tnpA-R GGTTCGTTCCCTAAGCTCTC EMB23 EMB1-F CGCCGGATCCTGGAAAAGGGGTTATTATCG EMB23 EMB23-R GCGCCGGTCTCCAGCTTAAAAAATAGACACTTCTAAC
Heat inactivation kinetics of spores To verify whether the presence of the Tn1546 resistance of spores, spores were prepared as described previously and subjected to transposon influences the heat heat treatments. For the B. amyloliquefaciens strains B4140 and B425, the inactivation kinetics were previously determined, and those data were included in the current analysis (4). For all other B. amyloliquefaciens and B. licheniformis strains, spore crops
were prepared. The initial spore concentrations were8 determined by heating at 80°C for 10 minutes, followed by pour plating in nutrient agar, and incubation for 5 days at 37°C. salt. The heat inactivation kinetics of spores were determined for one spore crop per Spores were suspended at a concentration of 1 x 10 CFU/mL in peptone physiological temperatures were selected on the basis of the resistance of the spores of a strain strain, at three different temperatures, using at least five time points. The inactivation
reduction times (D-values) were calculated using equation 1. (4). The inactivation data obtained were fitted with a log linear model, and decimal t log(Nt)l=−ogN()0 Equation 1: D The D in heat resistance of spores in relation to the presence or absence of the Tn1546 -values at 110°C were plotted versus temperature to visualize the strain variation transposon. Additionally, for all strains and groups of strains the z-value (i.e. the increase in temperature required to achieve an additional log unit reduction), and the reference
D-value (Dref) at reference temperature (Tref ) 110°C were calculated (46). Cloning of the spoVA2mob operon The spoVA2mob operon, including predicted promotor region, was cloned from B. licheniformis B4090 and B. amyloliquefaciens DSM7 into plasmid pDG1730, as
86 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
previously described (3). The obtained constructs were transformed to B. subtilis 168 and integrated in the amyE locus, to verify the role of this operon in increased heat resistance of spores. Spores were prepared for strains 168 amyE::spoVA2mob (DSM7), 168 amyE::spoVA2mob (B4090) and 168 as described above, and the heat resistance of incubation and enumeration of survivors. spores of these strains was assessed by heating at 100°C for 1 hour, followed by plating, Results and discussion Genome mining for the Tn1546 transposon For B. subtilis strains, it has been demonstrated that the presence of a Tn1546 transposon leads to a profound increase in heat resistance of the spores (3). Here, the presence of the Tn1546 transposon was assessed in nine strains of B. amyloliquefaciens and nine strains of B. licheniformis. The genome sequences of all nine strains of B. licheniformis were available and in three of these strains the Tn1546 transposon was found (namely, strains B4090, B4092 and B4094) (Figure 1). The genome sequences of four strains of B. amyloliquefaciens were available, and the Tn1546 transposon was found in two of these strains of B. amyloliquefaciens (namely in B425 and DSM7) (Figure 1). The predicted protein for the transposase TnpA, which is part of the Tn1546 transposon, was found in orthologous group OG3133 for all of the strains that carry the Tn1546 B. amyloliquefaciens. PCR-based detection of the genes tnpA, spoVAC and cls (that are transposon. Genome sequences were not available for the other five strains of present on the transposon and very well conserved) did not reveal the transposon in 4 positive for B. amyloliquefaciens strains B425 and DSM7. In short, two out of nine these five strains, whereas the PCRs using primers for these three target genes were strains of B. amyloliquefaciens and three out of nine strains of B. licheniformis contained the Tn1546 transposon.
Heat resistance of spores is related to the presence of the Tn1546 transposon The heat resistances of spores of B. amyloliquefaciens and B. licheniformis were assessed in relation to the presence or absence of the Tn1546 transposon. Detailed heat inactivation kinetics of spores were obtained for seven strains of B. amyloquefaciens (including the two strains carrying the Tn1546 transposon) and nine strains of B. licheniformis (Table 3). The inactivation kinetics of spores of B. amyloliquefaciens strains B4140 and B425 have been reported previously (4) and are included in the current analysis (Figure 2B). The heat resistance of spores was visualized by plotting the reference decimal reduction time of spores per strain at the reference temperature D -values) in relation to the presence or absence of the Tn1546 transposon (Table 3). The heat resistance of spores was plotted for nine strains of B. licheniformis of 110°C ( 110°C (Figure 2A) and nine strains of B. amyloliquefaciens (Figure 2B).
87 Chapter 4
A 2mob 2mob 2mob tnpA tnpA tnpR N-acetylmuramoyl - L-alanine amidase ger(x)A ger(x)C Unknonw fuction Unknonw fuction Mn Catalase Unknonw fuction Unknonw fuction spoVAC spoVAD spoVAEb Unknonw fuction Unknonw fuction N-terminal yetF C-terminal yetF Cardiolipin synthase (B. subtilis B4146)
(Site specific recombination)
(B. amyloliquefaciens B425) (B. amyloliquefaciens DSM7)
(B. licheniformis B4090) (Gene loss)
(B. licheniformis B4094) (B. licheniformis B4092)
B Core genome Strain name Tn1546 transposon Phylogentic tree Present / absent Bacillus subtilis 168 - Bacillus subtilis B4146 + (1x) Bacillus amyloliquefaciens B425 + Bacillus amyloliquefaciens DSM7 + (3x) Bacillus amyloliquefaciens B4140 - Bacillus amyloliquefaciens FZB42 - Bacillus licheniformis B4123 - Bacillus licheniformis B4121 - Bacillus licheniformis B4125 - Bacillus licheniformis B4090 + (1x) Bacillus licheniformis B4089 - Bacillus licheniformis B4094 + (1x) Bacillus licheniformis B4092 + (1x) Bacillus licheniformis B4124 - 0.1 Bacillus licheniformis B4091 -
Figure 1. A) Overview of the Tn1546 transposons found in B. subtilis B4146, B. amyloliquefaciens B425 and DSM7, and B. licheniformis B4090, B4092 and B4090. The predicted gene functions are indicated for the transposon of B. subtilis B4146: a transposase gene (tnpA), a resolvase gene (res), an operon of N-acetylmuramoyl-L-alanine amidase, gerKA and ger(X)C (Operon 1), an operon of a gene with unknown function and a manganese catalase (Operon2), an operon of two genes with unknown functions, spoVAC, spoVAD, spoVAEb and two genes with unknown functions (Operon 3, spoVA2mob), a fragmented yetF gene (Gene 4), and a cardiolipin synthase gene (Gene 5). The transposons in B. amyloliquefaciens are smaller, probably due to site specific recombination events, whereby operon 1 and operon 2 were lost. In B. licheniformis B4092 and B4094 the resolvase gene was not present, which is most likely a result of gene loss. B) Maximum likelihood phylogenetic tree based on core genome of single genes of fifteen strains of theB. subtilis group. The presence and copy number of the Tn1546 transposon was indicated behind the corresponding strains. B. subtilis B4146, B. licheniformis B4090, B4092, and B4094 carry a single transposon. The B. amyloliquefaciens strain DSM7 carries three copies of the transposon, while for strain B425 the copy number could not be determined. Two strains of B. amyloliquefaciens, namely B425 and DSM7, contained the Tn1546
transposon. These strains produced spores that required significantly longer heating than spores of the other seven strains without this transposon. To illustrate the difference times (p<0.001) at 110°C, i.e. approximately 15 times, to achieve one decimal reduction,
the strains with Tn1546 transposon, whereas the group without the Tn1546 transposon in heat resistance of spores: heating at 110°C for 5 minutes results in 0.6 log reduction for would show more than 10.5 log reduction. Strains B. licheniformis B4090, B4092 and B4094 contained the Tn1546 transposon, and the spores of these strains all required
88 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
longer heating times (p<0.001) (2.5 times) to reach a decimal reduction than the spores B. licheniformis strains that did not possess the Tn1546 transposon. Heating at of the six Tn1546 transposon, whereas the other group without the Tn1546 transposon would 110°C for 5 minutes results in a calculated 3.4 log reduction for the strains carrying the show 8.5 log reduction.
The number of spoVA2mob operons in B. subtilis was found to correlate with the level of heat resistance of spores; strains carrying three copies produced spores with the highest level of heat resistance (3). B. licheniformis strains B4090, B4092 and B4094 contained a single copy of the Tn1546 transposon with a single spoVA2mob operon. The heat resistances of spores of B. licheniformis with or without this operon were B. amyloliquefaciens, spores of strains B425 and DSM7 showed comparable high-levels of heat resistance, which were significantly different, but relatively modest. For B. amyloliquefaciens strains. Strain DSM7 contains three Tn1546 transposable elements, and it is likely that strain B425 significantly higher than those of the spores of other also contains multiple copies, however this remains to be established.
A B. licheniformis B B. amyloliquefaciens *** p<0.001 *** p<0.001 C
° 10 10 10 1
1 1 4
0.1 0.1
Decimal reduction time (min) at No Tn1546 Tn1546 No Tn1546 Tn1546
Figure 2. Spore heat inactivation kinetics at 110 °C of A) Nine strains of B. licheniformis and B) Nine strains of B. amyloliquefaciens. The closed circles and squares indicate the absence of a Tn1546 transposon in the strains of B. licheniformis and B. amyloliquefaciens, respectively. The open circles and squares indicate the presence of at least one Tn1546 transposon in the strains of B. licheniformis and B. amyloliquefaciens, respectively.
The spoVA2mob operon is responsible for increased heat resistance of spores The introduction of the spoVA2mob operon originating from B. subtilis strain B4067 in laboratory strain B. subtilis 168, has been shown to result in high-level heat resistance of spores (3). To establish whether the spoVA2mob operons present in the Tn1546 transposons of B. licheniformis B4090 and B. amyloliquefaciens DSM7 have a functional role, these were introduced into B. subtilis 168. The B. subtilis 168 mutants carrying the spoVA2mob genes from B. licheniformis B4090 and B. amyloliquefaciens produced spores °C with significantly higher heat resistance than the parent strains: after heating at 100
89 Chapter 4
Table 3. Detailed spore heat inactivation kinetics and calculated reference D-value (Dref) at a reference temperature (Tref) of 110 °C of spores of nine strains of B. amyloliquefaciens and spores of nine strains of B. licheniformis.
Species Strain Tn1546 Dref 110 °C 95% 95% z-value S.E. (min) upper PI lower PI (°C) 10A5 No 1.02 103.26 0.01 11.13 1.09 10A6 No 0.54 2.06 0.14 13.88 1.54 10A18 No 0.61 8.74 0.04 10.32 2.53 101 No 0.55 0.98 0.31 11.66 0.88 B. amyloliquefaciens SB42 No 0.59 1.36 0.26 11.44 0.68 B4140a No 0.13 2.54 0.01 7.21 0.17 DSM1060 No 0.41 1.78 0.09 12.00 0.33 DSM7 Yes 5.71 99.87 0.33 8.48 2.12 B425a Yes 10.80 25.62 4.55 6.23 0.41 B4089 No 0.50 4.21 0.06 9.99 2.31 B4091 No 0.58 3.33 0.10 9.53 1.74 B4121 No 0.65 3.64 0.12 9.33 1.45 B4123 No 0.50 1.95 0.13 9.97 1.30 B. licheniformis B4124 No 0.72 6.40 0.08 10.01 2.18 B4125 No 0.69 12.01 0.04 16.32 2.72 B4090 Yes 1.48 5.17 0.42 22.10 3.01 B4092 Yes 1.64 3.48 0.77 16.07 0.85 B4094 Yes 1.24 22.24 0.07 12.51 1.65
a : The D110 °C was calculated based on previously published data (4).
for 60 minutes, the spores of B. subtilis 168 amyE::spoVA2mob (containing the spoVA2mob
operon of B. licheniformis B4090) showed survival of 4.0 log10 B. subtilis 168 amyE::spoVA2mob (containing the spoVA2mob operon of B. amyloliquefaciens DSM7) unit (± 0.4), and showed survival of 1.7 log10 B. subtilis 168 were inactivated below the detection limit. The control strain B. subtilis 168 amyE::spoVA2mob 2mob unit (± 0.5), whereas the spores of (containing the spoVA operon of B. subtilis B4067) (3), showed survival of 2.8 log10
Theunit spoVA(± 0.05).2mob operon differs from the spoVA operon (designated spoVA1) that is encoded on the chromosome of B. subtilis (43), B. amyloliquefaciens and B. licheniformis. The SpoVA proteins encoded in the spoVA1 operon are required for uptake of DPA during the sporulation process and upon deletion or disruption of these genes in B. subtilis 168, sporulation is not completed (43). In addition, the SpoVA proteins are involved in the release of Ca-DPA during the germination process (49, 50), with the SpoVAC protein functioning as a mechano sensitive channel during germination (48). The SpoVAD protein has a binding pocket whereby it can directly bind DPA (19). Both the spoVA1 and the spoVA2mob operons contain genes encoding for SpoVAC, SpoVAD and SpoVAEb, while the other genes in the operons are different.
90 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
It is known that environmental conditions during sporulation, such as temperature, B. subtilis group (8, 25, 35). To allow for a direct comparison of the resistance properties matrix and medium composition, can influence the heat resistance of spores of the of spores of the different strains, the sporulation conditions were kept constant in this of the sporulation medium, and it is known that the addition of salts (Ca2+, Mn2+, Mg2+ study. Factors that are known to influence spore heat resistance include the composition and K+) results in higher resistances of spores to heat (8). Furthermore, the temperature B. subtilis B. licheniformis during sporulation is an important factor that influences heat resistance of spores (25). In line with these findings, the heat resistance of spores of a strain was higher upon sporulation at 45°C, with a modeled optimum at 49°C, than at the presence or absence of genetic elements such as the spoVA2mob operon, and the lower temperatures such as 20°C (2). Overall, the environmental sporulation conditions, storage conditions will ultimately determine the heat resistance properties of spores.
A
P-sigG DUF Yhcn / YlaJ spoVAC2mob spoVAD2mob spoVAEb2mob DUF DUF 421 1657 1657 DUF1657 spoVA2mob operon
B )
-1 12 N 80 °C 10 min (0) 4
10 N(t)100 °C 60 min CFU mL
10 8 g o ( l
6
4
2
Viable spore count 0 Bacillus subtilis Bacillus subtilis Bacillus subtilis Bacillus subtilis 168 168 168 168 amyE::spoVA2mob amyE::spoVA2mob amyE::spoVA2mob (B4067) (B4090) (DSM7) Figure 3. A) Overview of the spoVA2mob operon, as initially found in B. subtilis strain B4146. The spoVA2mob operon has a predicted sigma G binding site upstream of the first gene. The operon consists of seven genes: a gene of unknown function with a predicted DUF1657 domain, a gene of unknown function with a predicted YhcN/YlaJ domain, spoVAC, spoVAD, spoVAEb, a gene of unknown function with a predicted DUF1657 domain, and a gene of unknown function with a predicted DUF421 and a DUF1657 domain. B) Spore counts after heating at 80 °C for 10 minutes and at 100°C for 60 minutes for strains of B. subtilis 168, B. subtilis 168 amyE::spoVA2mob (B4067, data from (3)), B. subtilis 168 amyE::spoVA2mob (B4090), and B. subtilis 168 amyE::spoVA2mob (DSM7). The downward arrow indicates that the spores were inactivated below detection limit.
91 Chapter 4
It is therefore conceivable that spores produced under laboratory conditions do not necessarily reach the heat resistance levels of spores that are present in food products (20, 47).
Detailed analysis of the Tn1546 transposon The composition of the Tn1546 transposon in B. licheniformis strains B4090, B4092 and B4094 is shown in Figure 1A. In these strains, the Tn1546 transposon is highly similar to the one found in B. subtilis B4146 (Figure 1A). The transposons found in B. subtilis and B. licheniformis consist of genes that are required for transposition, and furthermore contain three operons and two single genes. The Tn1546 transposon found in the B. amyloliquefaciens strains DSM7 and B425 was smaller than the transposon found in B. subtilis and B. licheniformis. In both B. amyloliquefaciens
strains, the first two operons and a hypothetical gene were present at that genomic location. were absent, possibly due to a site-specific recombination event, as a recombinase gene The evolutionary relatedness of the different strains and species was visualized in a
sequences of conserved genes present in single copy in all genomes (Figure 1B). maximum likelihood core genome phylogenetic tree, based on concatenated protein The species B. amyloliquefaciens, B. licheniformis and B. subtilis clustered in separate branches of the phylogenetic tree. For B. amyloliquefaciens, the strains with the Tn1546 transposon clustered together, whereas this was not the case for B. licheniformis strains carrying the Tn1546 transposon.
The genomic locations of the Tn1546 transposons were different for B. subtilis, B. amyloliquefaciens and B. licheniformis. In B. subtilis, the transposon was found at two genomic locations, namely in yitF and between yxjA and yxjB (3). In B. amyloliquefaciens, three Tn1546 transposons were found in strain DSM7 at three different genomic locations, namely between a gene encoding for a fructose-1,6-bisphophatase and a hypothetical gene, between two hypothetical genes, and between a hypothetical gene and rapK. For B. amyloliquefaciens strain B425 it was not possible to determine the genomic locations and copy number of the Tn1546 transposon, since contig breaks were present on both sides of the Tn1546 transposon. In B. licheniformis strains B4090, B4092 and B4094, a single Tn1546 transposon was found integrated in a gene that B. subtilis, it has been shown that different insertion locations of the Tn1546 transposon led to high-level heat resistance encodes a D-alanyl-D-alanine carboxypeptidase. For of B. subtilis spores (3). It remains to be established whether the location of the insertion of the transposon in the genome of B. amyloliquefaciens and B. licheniformis plays a role in the level of heat resistance of spores.
92 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
Detailed analysis revealed that some genes in the Tn1546 transposon were mutated and present as pseudogenes in the transposon of some strains. The genes tnpA and tnpR in the Tn1546 transposon (which are required for active transposition) were intact and present in B. licheniformis strain B4090, and in B. amyloliquefaciens strains B425 and DSM7. This suggests that active transposition of the element may be possible for these strains, although active transposition of the Tn1546 transposon is believed to require a plasmid intermediate, as has been described in Enterococcus faecium (2). Interestingly, B. amyloliquefaciens DSM7, containing the intact tnpA and tnpR genes, contained three Tn1546 transposons. The encoded proteins required for transposition potentially allowed for internal transposition within the chromosome of strain DSM7. In B. subtilis strain B4146 and in B. licheniformis strains B4092 and B4094, the transposition genes are absent or not intact, suggesting that active transposition of the Tn1546 transposon is not likely to occur in these strains. This does not mean that the transposons cannot be transferred; transfer of genetic material including the Tn1546 transposon can be mediated by other transfer mechanisms, such as phage transduction, as described previously for B. subtilis (16). (3), or via the uptake of external DNA via natural competence Conclusions species (4, 20, 29, 30). In this study, a genomic analysis revealed the presence of Tn1546 Variation in heat resistance of spores exists between strains of different spore forming transposons in three strains of B. licheniformis and in two strains of B. amyloliquefaciens. The presence of this transposon, containing the spoVA2mob operon, correlated with high- 4 level heat resistance of spores. A functional role of the spoVA2mob operon in increasing the heat resistance of spores was demonstrated by cloning these operons in B. subtilis of the species of spores in food products does not provide information on the heat 168, resulting in spores with high-level heat resistance. Clearly, mere identification resistance levels of these spores. The knowledge obtained in this study on the spoVA2mob B. subtilis group that produce spores with high-level heat resistance. Multiple DNA based methods can be used for operon can be used for specific detection of strains of the PCR detection, among others (1, 7). The data presented in this study can be used for the detection of such genetic elements, such as whole genome sequencing and specific improved control of bacterial spores in the food chain. Acknowledgements by TI Food and Nutrition, a public-private partnership on pre-competitive research in The authors have declared that no competing interests exist. The research was funded food and nutrition. The funding organization had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
93 Chapter 4
Supplementary Dataset 1 B. amyloliquefaciens strains, the nine B. licheniformis strains, B. subtilis B4146 as a strain Orthology matrix constructed using Ortho-MCL with the genomes of the four that produces spores with high heat resistance and B. subtilis 168 as a reference strain that produces spores with normal heat resistance.
References 1. Alkema, W., J. Boekhorst, M. Wels, and S. A. van Hijum. 2015. Microbial bioinformatics for food
2. Baril, E., L. Coroller, O. Couvert, I. Leguérinel, F. Postollec, C. Boulais, F. Carlin, and P. Mafart. 2012.safety Modelingand production. heat resistance Briefings of in Bacillus Bioinformatics. weihenstephanensis and Bacillus licheniformis spores as function of sporulation temperature and pH. Food Microbiology 30:29-36. 3. Berendsen, E. M., J. Boekhorst, O. P. Kuipers, and M. H. Wells-Bennik. Accepted. A mobile genetic element profoundly increases heat resistance of bacterial spores. 4. Berendsen, E. M., M. H. Zwietering, O. P. Kuipers, and M. H. J. Wells-Bennik. 2015. Two distinct groups within the Bacillus subtilis properties. Food Microbiology 45, Part A:18-25. 5. Carver, T., S. R. Harris, M. Berriman, groupJ. Parkhill, display and significantly J. A. McQuillan. different 2012. sporeArtemis: heat an integrated resistance
Bioinformatics 28:464-9. 6. Carver,platform T. forJ., K. visualization M. Rutherford, and analysisM. Berriman, of high-throughput M. A. Rajandream, sequence-based B. G. Barrell, experimental and J. Parkhill. data. 2005. ACT: the Artemis Comparison Tool. Bioinformatics 21:3422-3. 7. Caspers, M. P. M., F. H. J. Schuren, A. C. M. van Zuijlen, S. Brul, R. C. Montijn, T. Abee, and R. Kort. bacilli. Food Microbiology 28:245-251. 8. Cazemier,2011. A mixed-species A. E., S. F. M. microarrayWagenaars, for and identification P. F. Ter Steeg. of food2001. spoilage Effect of sporulation and recovery medium on the heat resistance and amount of injury of spores from spoilage bacilli. Journal of Applied Microbiology 90:761-770. 9. Chen, X. H., A. Koumoutsi, R. Scholz, A. Eisenreich, K. Schneider, I. Heinemeyer, B. Morgenstern, B. Voss, W. R. Hess, O. Reva, H. Junge, B. Voigt, P. R. Jungblut, J. Vater, R. Sussmuth, H. Liesegang, A. Strittmatter, G. Gottschalk, and R. Borriss. 2007. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 25:1007-14. 10. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797. 11. Guerout-Fleury, A. M., N. Frandsen, and P. Stragier. 1996. Plasmids for ectopic integration in Bacillus subtilis. Gene 180:57-61. 12. Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large 52:696-704. 13. Heyndrickx, M. 2011. The importance of endospore-forming bacteria originating from soil for contaminationphylogenies by ofmaximum industrial likelihood. food processin Systematic Applied Biology and Environmental Soil Science 2011:11. 14. Konz, D., S. Doekel, and M. A. Marahiel. 1999. Molecular and biochemical characterization of the protein template controlling biosynthesis of the lipopeptide lichenysin. Journal of Bacteriology 181:133-140. 15. Kort, R., A. C. O’Brien, I. H. M. van Stokkum, S. J. C. M. Oomes, W. Crielaard, K. J. Hellingwerf, and S. Brul. 2005. Assessment of heat resistance of bacterial spores from food product isolates
71:3556-3564. 16. Kovacs,by fluorescence A. T., W.monitoring K. Smits, of dipicolinicA. M. Mironczuk, acid release. and Applied O. P. Kuipers.and Environmental 2009. Ubiquitous Microbiology late competence genes in Bacillus species indicate the presence of functional DNA uptake machineries. Environmental Microbiology 11:1911-22.
94 High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis
17. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, N. J. Cummings, R. A. Daniel, F. Denizot, K. M. Devine, A. Dusterhoft, S. D. Ehrlich, P. T. Emmerson, K. D. Entian, J. Errington, C. Fabret, E. Ferrari, D. Foulger, C. Fritz, M. Fujita, Y. Fujita, S. Fuma, A. Galizzi, N. Galleron, S. Y. Ghim, P. Glaser, A. Goffeau, E. J. Golightly, G. Grandi, G. Guiseppi, B. J. Guy, K. Haga, J. Haiech, C. R. Harwood, A. Henaut, H. Hilbert, S. Holsappel, S. Hosono, M. F. Hullo, M. Itaya, L. Jones, B. Joris, D. Karamata, Y. Kasahara, M. Klaerr-Blanchard, C. Klein, Y. Kobayashi, P. Koetter, G. Koningstein, S. Krogh, M. Kumano, K. Kurita, A. Lapidus, S. Lardinois, J. Lauber, V. Lazarevic, S. M. Lee, A. Levine, H. Liu, S. Masuda, C. Mauel, C. Medigue, N. Medina, R. P. Mellado, M. Mizuno, D. Moestl, S. Nakai, M. Noback, D. Noone, M. O’Reilly, K. Ogawa, A. Ogiwara, B. Oudega, S. H. Park, V. Parro, T. M. Pohl, D. Portetelle, S. Porwollik, A. M. Prescott, E. Presecan, P. Pujic, B. Purnelle, et al. 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390:249-256. 18. Li, L., C. J. Stoeckert, Jr., and D. S. Roos. eukaryotic genomes. Genome Res 13:2178-89. 19. Li, Y., A. Davis, G. Korza, P. Zhang, Y. Q. Li, 2003.B. Setlow, OrthoMCL: P. Setlow, identification and B. Hao. of 2012. ortholog Role groupsof a SpoVA for protein in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 194:1875-84. 20. Lima, L. J. R., H. J. Kamphuis, M. J. R. Nout, and M. H. Zwietering. 2011. Microbiota of cocoa powder with particular reference to aerobic thermoresistant spore-formers. Food Microbiology 28:573-582. 21. Logan, N. A. 2012. Bacillus and relatives in foodborne illness. Journal of Applied Microbiology 112:417-429. 22. Logan, N. A., and P. Vos. 2009. Bergey’s Manual of Systematic Bacteriology, vol. Volume 3: The Firmicutes. 23. Lucking, G., M. Stoeckel, Z. Atamer, J. Hinrichs, and M. Ehling-Schulz. 2013. Characterization of aerobic spore-forming bacteria associated with industrial dairy processing environments and product spoilage. International Journal of Food Microbiology 166:270-9. 24. Madslien, E. H., H. T. Rønning, T. Lindbäck, B. Hassel, M. A. Andersson, and P. E. C. Granum. 2013. Lichenysin is produced by most Bacillus licheniformis strains. Journal of Applied Microbiology 115:1068-1080. 4 25. Melly, E., P. C. Genest, M. E. Gilmore, S. Little, D. L. Popham, A. Driks, and P. Setlow. 2002. Analysis of the properties of spores of Bacillus subtilis prepared at different temperatures. Journal of Applied Microbiology 92:1105-1115. 26. Miller, R. A., D. J. Kent, M. J. Watterson, K. J. Boor, N. H. Martin, and M. Wiedmann. 2015. Spore
Dairy Science 98:8492-8504. 27. populationsNicholson, W.among L., N. bulk Munakata, tank raw G. milk Horneck, and dairy H. J.powders Melosh, are and significantly P. Setlow. different.2000. Resistance Journal of Bacillus Molecular Biology Reviews 64:548-572. 28. Nieminen, endospores T., N. Rintaluoma, to extreme M.terrestrial Andersson, and extraterrestrialA. M. Taimisto, environments. T. Ali-Vehmas, Microbiology A. Seppälä, and O. Priha, and M. Salkinoja-Salonen. Bacillus pumilus and Bacillus licheniformis from mastitic milk. Veterinary Microbiology 124:329-339. 29. Oomes, S. J. C. M., A. C. M. van Zuijlen, 2007. J.Toxinogenic O. Hehenkamp, H. Witsenboer, J. M. B. M. van der Vossen, and S. Brul. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 30. Orsburn, B., S. B. Melville, and D. L. Popham. 2008. Factors contributing to heat resistance of Clostridium perfringens endospores. Applied and Environmental Microbiology 74:3328-3335. 31. Overmars, L., R. Kerkhoven, R. J. Siezen, and C. Francke. 2013. MGcV: the microbial genomic 14:209. 32. Postollec, F., A. G. Mathot, M. Bernard, M. L. Divanac’h, S. Pavan, and D. Sohier. 2012. Tracking spore-formingcontext viewer bacteriafor comparative in food: genomefrom natural analysis. biodiversity BMC Genomics to selection by processes. International Journal of Food Microbiology 158:1-8. 33. Priest, F. G., M. Goodfellow, L. A. Shute, and R. C. W. Berkeley. 1987. Bacillus amyloliquefaciens
95 Chapter 4
sp. nov., nom. rev. International Journal of Systematic Bacteriology 37:69-71. 34. Priest, F. G., M. Goodfellow, and C. Todd. Gen Microbiol 134:1847-82. 35. Rose, R., B. Setlow, A. Monroe, M. Mallozzi, 1988. AA. numerical Driks, and classification P. Setlow. of2007. the genusComparison Bacillus. of J the properties of Bacillus subtilis spores made in liquid or on agar plates. Journal of Applied Microbiology 103:691-699. 36. Rosenkvist, H., and Å. Hansen. Bacillus species in wheat bread and raw materials for bread production. International Journal of Food Microbiology 26:353-363. 1995. Contamination profiles and characterisation of 37. Ruckert, C., J. Blom, X. Chen, O. Reva, and R. Borriss. 2011. Genome sequence of B. amyloliquefaciens type strain DSM7(T) reveals differences to plant-associated B. amyloliquefaciens FZB42. Journal of Biotechnology 155:78-85. 38. Salkinoja-Salonen, M. S., R. Vuorio, M. A. Andersson, P. Kämpfer, M. C. Andersson, T. Honkanen-Buzalski, and A. C. Scoging. Bacillus licheniformis related to food poisoning. Applied and Environmental Microbiology 65:4637-4645. 39. Scheldeman, P., L. Herman, S. Foster, and 1999. M. Heyndrickx. Toxigenic strains 2006. of Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 40. Setlow, P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. Journal of Applied Microbiology 101:514-525. 41. Sorokulova, I. B., O. N. Reva, V. V. Smirnov, I. V. Pinchuk, S. V. Lapa, and M. C. Urdaci. 2003. Genetic diversity and involvement in bread spoilage of Bacillus bread. Letters in Applied Microbiology 37:169-173. 42. te Giffel, M. C., R. R. Beumer, S. Leijendekkers, and F. M. Rombouts.strains isolated 1996. Incidence from flour of and Bacillus ropy cereus and Bacillus subtilis in foods in the Netherlands. Food Microbiology 13:53-58. 43. Tovar-Rojo, F., M. Chander, B. Setlow, and P. Setlow. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 184:584-587. 44. Valerio, F., P. De Bellis, M. Di Biase, S. L. Lonigro, B. Giussani, A. Visconti, P. Lavermicocca, and A. Sisto. Bacillus amyloliquefaciens as a species frequently associated with the ropy spoilage of bread. International Journal of Food Microbiology 2012. 156: Diversity278-85. of spore-forming bacteria and identification of 45. Valerio, F., M. Di Biase, V. Huchet, N. Desriac, S. L. Lonigro, P. Lavermicocca, D. Sohier, and F. Postollec. 2015. Comparison of three Bacillus amyloliquefaciens strains growth behaviour and evaluation of the spoilage risk during bread shelf-life. Food Microbiology 45, Part A:2-9. 46. van Asselt, E. D., and M. H. Zwietering. 2006. A systematic approach to determine global thermal inactivation parameters for various food pathogens. International Journal of Food Microbiology 107:73-82. 47. van Zuijlen, A., P. M. Periago, A. Amézquita, A. Palop, S. Brul, and P. S. Fernández. 2010. Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilisation. Food Research International 43:1895- 1901. 48. Velasquez, J., G. Schuurman-Wolters, J. P. Birkner, T. Abee, and B. Poolman. 2014. Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel. Molecular Microbiology 92:813-23. 49. Vepachedu, V. R., and P. Setlow. 2004. Analysis of the germination of spores of Bacillus subtilis with temperature sensitive spo mutations in the spoVA operon. FEMS Microbiol Lett 239:71-7. 50. Vepachedu, V. R., and P. Setlow. 2007. Role of SpoVA proteins in release of dipicolinic acid during germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme. Journal of Bacteriology 189:1565-1572. 51. Warth, A. D. 1978. Relationship between the heat resistance of spores and the optimum and Bacillus species. Journal of Bacteriology 134:699-705. 52. Zahler, S. A., R. Z. Korman, C. Thomas, P. S. Fink, M. P. Weiner, and J. M. Odebralski. 1987. H2, amaximum temperate growth bacteriophage temperatures isolated of from Bacillus amyloliquefaciens strain H. Journal of General Microbiology 133:2937-2944.
96 Chapter 5
Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger clusters, but efficiently upon non-nutrient Ca- DPA exposure. Erwin M. Berendsen Antonina O. Krawczyk Verena Klaus Anne de Jong Jos Boekhorst Robyn T. Eijlander Oscar P. Kuipers Marjon H.J. Wells-Bennik
Published as: Berendsen EM, Krawczyk AO, Klaus V, de Jong A, Boekhorst J, Eijlander RT, Kuipers OP, Wells-Bennik MHJ (2015). Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger clusters, but efficiently upon non-nutrient Ca-DPA exposure. Applied and Environmental Microbiology 81(22):7791-7801 Chapter 5
Abstract High heat resistance of spores of Bacillus thermoamylovorans poses challenges to the food industry as industrial sterilization processes may not inactivate such spores, resulting in food spoilage upon germination and outgrowth. In this study, the germination and heat resistance properties of spores of four food-spoiling isolates were determined. Flow cytometry counts of spores were much higher than their counts on rich medium
of spores of all four isolates despite the presence of most known germination-related (maximum 5%). Microscopic analysis revealed inefficient nutrient-induced germination genes, including two operons encoding nutrient germinant receptors (GRs), in their
genomes. In contrast, exposure to non-nutrient germinant calcium-dipicolinic acid cwlJ and gerQ genes, which are known to be essential for Ca-DPA-induced germination (Ca-DPA) resulted in efficient 50 to 98% spore germination. All four strains harbored in Bacillus subtilis. When determining spore survival upon heating, low viable counts can be due to spore inactivation and an inability to germinate. To dissect these two phenomena, the recoveries of spores upon heat treatment were determined on
as observed in this study (D z plates with and without pre-exposure to Ca-DPA. The high heat resistance of spores is in line with survival of sterilization processes in the food industry. The recovery of 120°C 1.9 ± 0.2 and 1.3 ± 0.1 minutes, -value 12.3 ± 1.8°C) B. thermoamylovorans spores can be improved via non-nutrient germination, thereby avoiding gross underestimation of their levels in food ingredients.
98 Germination and heat resistance of B. thermoamylovorans spores
Introduction Bacillus endospores (or spores) are widely present in nature and may contaminate food ingredients and food products. Due to the intrinsic stability of spores, which allows them sterile food products is a major challenge for the food industry (6, 53, 54, 63). to withstand environmental insults, sufficient inactivation of spores in commercially Bacillus thermoamylovorans produces spores with high heat resistance (54), and the spores are known to survive industrial food sterilization processes. The organism is
B. thermoamylovorans are able to grow at facultatively anaerobic and has the ability to grow at temperatures between 40°C and
58°C (11, 31). In our experience, strains of (10, 11), but in an amended species description the formation of spores was reported 37°C but not at 30°C. The organism was first described as a non-sporogenous species (13). The occurrence of B. thermoamylovorans has been reported in a gelatin production plant and at dairy farms (14, 54). The genome sequence of one non-food-related B. thermoamylovarans strain from a biogas plant was published recently (31). Overall, the species has not been well characterized and little is known about the spore properties that are important for control in foods, including spore resistance to various processing conditions and germination of spores that survive.
These processes have been well studied in Bacillus subtilis (38, 42, 56, 57). Germination When spores exit dormancy via germination, food spoilage can occur upon outgrowth. can be induced both by nutrient and non-nutrient triggers, called germinants. Nutrients can initiate germination via interaction with germinant receptors (Ger receptors, GRs) that are localized in the inner membrane of the spore and consist of three or four different subunits (A, B, C and D) (41, 47, 51, 60). The responsiveness of GRs to nutrient so-called heat activation step (30, 56). In contrast, germination via the non-nutrient triggers can be enhanced by exposure of spores to sub-lethal temperatures during a germinant dipicolinic acid chelated with Ca2+ ions (Ca-DPA) occurs by direct activation 5 of the cortex lytic enzyme (CLE) CwlJ, thereby bypassing the requirement of GRs rehydration of the spore core (9). Ca-DPA-induced germination has been reported to be (40). Activated CwlJ then hydrolyzes the protective peptidoglycan cortex resulting in independent of a heat activation treatment (8). The germination behavior of spores is or the emergence of so-called superdormant spores that do not respond to the applied a heterogeneous process (17), which is reflected by varying germination kinetics and/ germination trigger (22, 23, 44, 50). For B. subtilis it has previously been described that spores superdormant to nutrients harbor lower numbers of germination receptor proteins (21), whereas spores that were superdormant to Ca-DPA, showed decreased levels of CwlJ (44).
99 Chapter 5
Improved understanding and control of bacterial food spoilage can be facilitated by in silico analysis of genome content (48). In this study, spore germination of four food isolates of B. thermoamylovorans (isolated from combining experimental findings with either acacia gum or milk) was investigated in response to nutrient and non-nutrient triggers, and the genome sequences of the strains were determined (32). The strain-
germination-related genes. In addition, spore heat resistance kinetics were determined specific spore germination data were linked with presence or absence of important using standard plating techniques, with and without a Ca-DPA pre-treatment, based on the insights into germination of this species obtained in this study. This approach led to a more accurate assessment of viable spore counts and heat resistance properties of spores of this species.
Materials and methods
Strains Four strains of B. thermoamylovorans isolated from different sources were used in this study for characterization of the spore properties. Strains B4064 and B4065 were isolated from acacia gum, whereas strains B4166 and B4167 were isolated from milk. For all strains the genome sequences were determined (32).
Spore preparation Spores of B. thermoamylovorans were prepared as previously described for B. subtilis
(BHI-B, Merck) (4, 52) with slight modifications. The strains were pre-cultured for 1216 hours at 45°C and subsequently spread on Schaeffer sporulation agar plates supplemented with in Brain Heart Infusion Broth supplemented with 1 mg/L vitamin B 12 were harvested and washed successively in sterile water, as described before (4). Prior 1 mg/L vitamin B (54). These plates were incubated at 45°C for 7 days, and spores the spore suspensions (>95 % phase-bright spores) was checked using phase-contrast to experiments, spore suspensions were stored at 4°C for 2 to 4 weeks. The purity of microscopy (see below). For each strain, three independent spore crops were prepared.
Spore quantification Spore suspensions were enumerated in two ways, namely by plate counting and
flow cytometry. The spore counts were assessed by plate counting as follows. Spore (in suspensions were heat-activated at 80, 90 and 100°C for 10 minutes, followed12 by pour-plating in BHI-agar (BHI-A) plates supplemented with 1 mg/L vitamin B duplicate). Plates were incubated for 5 days at 45°C, after which colony forming units (CFUs) were enumerated. An increase in the heat activation temperature (up to 100°C 100 Germination and heat resistance of B. thermoamylovorans spores
routinely to assess the spore CFU counts. Based on the initial counts obtained, the spore for 10 minutes) did not affect the CFU counts, therefore 80°C for 10 minutes8 was used in phosphate buffered saline (PBS), with a pH of 7.4. suspensions were diluted to a working spore suspension of approximately 10 CFU/mL,
Absolute spore counts were also determined by flow cytometry using a BD FACSAria II flow cytometer operated with BD FACSDiva Software (version 6.0, BD Biosciences). to obtain event rates below 2000 events s-1, while at least 20.000 events were measured Spore suspensions were diluted 100 times in sheath fluid (BD FACSFlow, BD Biosciences) for each spore crop (19). A predetermined amount of reference beads (Microsphere
5 beads per mL. For each standard (ø 6 µm) Live/Dead BacLight Bacterial Viability and Counting Kit L34856) strain, three independent spore crops were measured in duplicate. was added to each spore suspension, corresponding to 5 x 10 Spore germination
Spore germination was studied and quantified using phase-contrast microscopy (see below). Prior to the experiments, spore crops were washed with ice-cold sterile Milli-Q water. If not stated otherwise, spores were heat-activated at 80˚C for 10 minutes or of 1 in 200 µl of BHI or Luria- at 70˚C for 30 minutes and subsequently cooled on ice600 and washed again with cold Bertani (LB) medium supplemented with vitamin B water. Heat-activated spores were diluted to a final OD12 (1 mg/L) and chloramphenicol (7.5 mg/L) to prevent outgrowth of vegetative cells (26, 59). Alternatively, spores were diluted in mixtures of various nutrient-based germinants dissolved in 25 mM (all 50 mM); iii) L-alanine, L-arginine, L-asparagine, aspartic acid, L-cysteine-HCl, Tris-HCl, pH=7.4: i) 100 mM L-alanine; ii) L-asparagine, D-fructose, D-glucose, KCl glutamic acid, L-glutamine, glycine, L-histidine, inosine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-valine (all 10 mM); iv) L-alanine, L-arginine, L-asparagine, aspartic acid, L-cysteine- 5 HCl, glutamic acid, L-glutamine, glycine, L-histidine, inosine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan,
L-valine, D-fructose, D-glucose, KCl (all 10 mM), chloramphenicol (7.5 mg/L). For non- nutrient-induced germination experiments, non-heat-activated2 spores were diluted in equimolar mixtures of 20, 40, 60, 80 mM CaCl and DPA (pH = 7.4). A preliminary analysis indicated that 40 mM Ca-DPA was the most efficient concentration to trigger As negative controls, both non-heat-activated and heat-activated spores were diluted in germination (data not shown) and this concentration was used in further experiments. rpm). After 3, 6 and 24 hours, the transition of phase-bright dormant spores to phase- 25 mM Tris-HCl, pH=7.4. Spore dilutions were then incubated at 42˚C while shaking (220 dark germinated spores was monitored using phase-contrast microscopy. Microscopic
101 Chapter 5
imaging was performed using an IX71 microscope (Olympus) with a CoolSNAP HQ2
camera (Princeton Instruments), using a 100x phase contrast objective, and DeltaVision softWoRx 3.6.0 (Applied Precision) software. Images were taken using 32% APLLC White LED light and 0.3 s exposure. The pixel size was 0.0643 µm and binning was set to 1x1. Images obtained were analyzed using Fiji software (http://fiji.sc/Fiji (55)). For quantification of ratios of germinated and dormant spores, a minimum of 300 spores independent spore crops. per condition was examined. All experiments were performed in duplicate using two Spore heat inactivation Spore heat inactivation was determined using capillary tubes using two independent spore crops for each of the four strains, as previously described (4, 64). For all strains the spore working suspensions (108
spores/mL in PBS) were heated at 110°C, at ten different time points up to 23 minutes. For strain B4064 the inactivation experiments kinetics determination. Upon heat treatment, one part of the spore suspension was 10- were additionally performed at 115°C and 120°C to allow for detailed inactivation fold serially diluted in peptone water and appropriate dilutions were pour-plated in
12. The other part of
duplicate in BHI-agar plates supplemented with 1 mg/L vitamin B the heated spore suspension was exposed to 40 mM Ca-DPA in sterile peptone water . Per for 3 hours at 45°C, followed by pour-plating 10-fold serial dilutions (made in peptone12 water) in duplicate in BHI-agar plates supplemented with 1 mg/L vitamin B CFUs were enumerated and recovery of spores determined. experiment, plating was performed in duplicate. After incubation for 5 days at 45°C, The survivor count was plotted against the inactivation time, and based on the shape of
the inactivation plot a model was selected for fitting. Model fitting was performed with Microsoft Excel using the Solver Add-in. D-value was determined, as For the experiments that included an incubation step with Ca-DPA prior to plating, presented in equation 1. the data were fitted with the log-linear model where the t 1: log(Nt)l=−ogN()0 D
With Nt being the surviving spore count at time t, N0 being the initial spore concentration, t the time (time unit), and D the decimal reduction time.
prior to plating showed the presence of a heat sensitive and a heat resistant population; The inactivation plots of the experiments that did not include a Ca-DPA incubation step 2 (20). therefore these were fitted with the biphasic Geeraerd model as described in Equation
102 Germination and heat resistance of B. thermoamylovorans spores
kres k ⋅S k ⋅S sen sen ksen Nt −k ⋅t e −k ⋅t e 2: logl=−og ()1 fe⋅ sen ⋅ +⋅feres ⋅ ksens⋅S −k en ⋅t ksens⋅S −k en ⋅t N0 11+−()ee⋅ 11+−()ee⋅
Where Nt is the survivor count at time t, N0 is the initial spore count, (1-f) and f the heat sensitive and heat resistant fraction, respectively, ksen and kres the inactivation rates (time unit-1) of the sensitive and the resistant populations, respectively, t the time (time unit) and S the duration of the shoulder (time unit). The D-value, was calculated by dividing the reciprocal of the inactivation rates by the natural logarithm of 10. plating, additionally the z-value, the increase in temperature required to achieve an For the experiments with strain B4064 that included incubation with Ca-DPA prior to additional log unit reduction, the reference D-value (Dref) at reference temperature (Tref)
(62). 121.1°C, and the 95 % prediction interval (PI) were calculated as previously described Genome mining For all of the predicted protein sequences of the four B. thermoamylovorans strains and reference strain B. subtilis 168, an orthology prediction was performed using Ortho-MCL of germination-related genes (Table 1), corresponding protein sequence alignments (33) (Supplementary Dataset 1). To find potential functional equivalents for a selection were made using MUSCLE (16), followed by construction of a hidden Markov model (HMM) that was subsequently used to scan all genomes (29). For selected proteins likelihood phylogeny program PHYML (25). Phylogenetic trees were manually inspected found in this manner, maximum likelihood trees were constructed using the maximum for evolutionary relatedness of the proteins. Additionally, the genomic context was server (2). Prediction of binding sites for sporulation sigma factors (18) upstream of manually verified after visualization in the SEED Viewer (39) on the RAST annotation 5 selected genes was performed with use of the database of transcriptional regulation in B. subtilis operon structures of genes: ger(x1)ABC, ger(x2)ABC, spoVAA-AF, cwlJ, gerQ, cwlJ2, gerQ2 (DBTBS; http://dbtbs.hgc.jp) (37). Schematic visualization of the predicted genome2d.molgenrug.nl) (3). (Figure 3) was made with the draw context tool on the Genome2D server (http:// Results
Quantification of spores Spores, prepared on Schaeffer agar plates, were characterized with respect to spore germination and heat resistance. The number of spores in 1 mL of the working spore
103 Chapter 5
suspension was quantified using flow cytometry or CFU enumeration. The obtained numbers of spores per mL were strikingly different depending on the quantification spore suspensions of strains B4064, B4065, B4166 and B4167 were 1.9, 1.3, 1.8 and technique used (Figure 1). Using flow cytometry, the absolute number of spores in 1.6 log units higher, respectively, than when enumerated using plating in BHI-A with
vitamin B12. Since CFU plate counting enumeration depends on spore germination and
outgrowth, this discrepancy indicates that only a small fraction (1.3% ± 1.0% , 5.3% and B4167, respectively) of the absolute number of spores undergoes germination and ± 2.4%, 1.6% ± 0.9%, and 2.5% ± 2.1% for spores of strains B4064, B4065, B4166, subsequent outgrowth on the BHI-A plates.
Germination with nutrient germinants To establish whether the discrepancy between absolute spore counts and CFU counts
spores in the nutrient-rich BHI medium was assessed using phase-contrast microscopy. was caused by inefficient germination, the germination efficiency of the heat-activated
The analysis showed that the fraction of spores that germinated in BHI did not exceed 2.6% ± 0.8%, 13.6% ± 3.6%, 4.8% ± 0.5% and 5.8% ± 2.1% for strains B4064, B4065, B4166 and B4167, respectively (Figure 2). These numbers hardly exceeded the percentage of phase-dark spores in the negative controls (2.2% ± 0.7%, 6.2% ± 0.5%, 2.7% ± 2.2% B. and 4.8% ± 2.3%, respectively) (Figure 2). Moreover, the percentage of germinated thermoamylovorans germinate very poorly in BHI. In addition, spore germination was spores did not increase significantly in time (Figure 2). This implies that spores of
Figure 1. Comparison of the spore count (log10 CFU/mL) obtained per strain by flow cytometry and plating on BHI after a heat treatment of 80°C for 10 minutes. Mean counts of three independent experiments were plotted and errors bars display the standard deviation.
104 Germination and heat resistance of B. thermoamylovorans spores
Methods), which resulted in similar observations (data not shown). Likewise, altering assessed in LB and simple nutrient mixtures: i, ii, iii, and iv (details in Materials and medium (data not shown). Altogether, these results indicated that the tested nutrient or omitting the heat-activation treatment did not increase germination efficiency in rich germinants were not triggering germination of B. thermoamylovorans
spores efficiently. Germination with Ca-DPA Besides germination of spores in response to nutrients, which requires the presence of GRs in the spores (42, 56), germination can also be induced by non-nutrient germinants, for instance Ca-DPA, or by very high hydrostatic pressure (400–800 MPa) via mechanisms that are independent of GRs (5, 15, 42, 56). A weak germination response of B. thermoamylovorans spores was observed for nutrient triggers (Figure 2A). In addition, the germination of spores in response to addition of the non- nutrient germinant Ca-DPA was assessed; this type of germination does not require
GRs (40). Exposure of spores to 40 mM Ca-DPA for 3 hours resulted in very efficient spore germination for strains B4064 and B4065 (75.3% ± 7.2% and 95.7% ± 2.1% of germinated spores, respectively) and moderately efficient germination for strains B4166 and B4167 (32.8.7% ± 5.4% and 43.0% ± 9.4%, respectively) (Figure 2). After 24 hours of incubation, spore germination increased to 95.6% ± 3.0 % and 97.6% ± 1.2% for strains B4064 and B4065, respectively, whereas it reached 49.7% ± 5.5% and B. thermoamylovorans 58.3% ± 5.6% for strains B4166 and B4167, respectively (Figure 2). Altogether, these spores, but the germination responses varied between the different isolates. results indicate that Ca-DPA is an efficient germination trigger for Genome mining for germination genes to nutrient triggers, and different responses to Ca-DPA between strains, the presence To explain the observed germination phenotypes, i.e. inefficient germination in response of germination genes was evaluated in the genomes of the four B. thermoamylovorans 5 isolates through genome mining (Table 1). In B. subtilis, nutrient-induced germination by several proteins, such as GerD (43), and GerPABCDEF (7). The analysis of the requires specific GRs that bind nutrient germinants (41, 51) and is facilitated specifically genomes of the four B. thermoamylovorans strains revealed the presence of GR genes which are deemed important for sensing nutrient germinants (Table 1), but despite their presence, only weak germination of spores was observed in the presence of rich media and various nutrients. The GR genes included two complete tri-cistronic operons, referred to further as ger(x1)ABC and ger(x2)ABC, both encoding putative GRs (Table 1 and Figure 3). Both ger operons are predicted to be preceded by single (in the case of ger(x1)ABC) or double (in the case of ger(x2)ABC) binding sites for the sporulation
105 Chapter 5
Figure 2. Quantification of spore germination efficiency using phase-contrast microscopy. Spores were either
heat-activated (HA) or not (n-HA) and exposed to BHI plus vitamin B12 (A), Ca-DPA (B) or Tris buffer (control). Germination was calculated as the percentage of phase-dark spores on phase-contrast microscopic images made after 3, 6 and 24 hours of incubation with germinant (images are shown for 24h only). Mean percentages of two independent experiments were plotted, including error bars based on standard deviations. Scale bar, 2 μm.
106 Germination and heat resistance of B. thermoamylovorans spores
sigma factor SigG (Figure 3). In addition, the following genes encoding proteins that are four stains: gerD, gerF, gerPA, gerPB, gerPC, gerPD, gerPE, gerPF (Table 1). expected to facilitate responses to nutrients (7, 28, 43) were found in the genomes of all Genes other than the ones directly involved in sensing nutrients, but which play a role in subsequent germination events, were also found in the B. thermoamylovorans genomes (Table 1). These included the cwlJ, sleB, gerQ and ypeB genes which encode proteins that spoVA genes (spoVAA, spoVAB, spoVAC, spoVAD, spoVAEb, spoVAF), some of which encode proteins that are important for lysis of the protective cortex layer, and nearly all of the are responsible for release of DPA from the spore core (42, 56). The germination gene spoVAEa was absent in the four sequenced B. thermoamylovorans strains but SpoVAEa is considered to play only a minor role in germination (45). Interestingly, some spoVA genes, namely spoVAC, spoVAD, spoVAEb, occurred in multiple copies in the genome of the sequenced strains of B. thermoaylovorans (Table 1). Thus, besides single spoVAA and spoVAB genes, all strains possessed three spoVAC and spoVAD genes as well as two spoVAEb and two spoVAF genes. The spoVA genes of B. thermoamylovorans were found spo(VA1) operon comprising spoVAA-spoVAB-spoVAF; ii) spo(VA2) consisting of spoVAC-spoVAD genes; iii) spo(VA3) and iv) spo(VA4) operons, in five different operons: i) the both containing spoVAC-spoVAD-spoVAEb genes; and v) spoVA5, which comprises a single spoVAF gene (Table 1 and Figure 3).
In B. subtilis CwlJ (36, 40), which requires GerQ for proper localization in the spore coat (46). Strains , Ca-DPA initiates germination by direct activation of the cortex lytic enzyme B4166 and B4167 contain a single cwlJ gene and gerQ gene, whereas strains B4064 and B4065 both carry two copies of cwlJ (further referred to as cwlJ and cwlJ2) and two copies of gerQ (referred to as gerQ and gerQ2) (Table 1). Both cwlJ and gerQ, as well as cwlJ2 and gerQ2 are adjacent to each other on the chromosome, possibly forming an operon preceded by the predicted SigE and SigK binding sites (Figure 3). Pairwise amino acid alignments revealed 81% sequence identity between the CwlJ and CwlJ2 5 proteins. Moreover, both CwlJ and CwlJ2 contain the probable key catalytic glutamate 21 residue (E21) (Supplementary Figure 1) (34). The same holds true for GerQ and
GerQ2, which also exhibit high sequence identity (61%). Spore heat inactivation and modelling treatment and with a Ca-DPA treatment to trigger non-nutrient germination before The heat inactivation of spores at 110°C was assessed for all strains, without a Ca-DPA plating. The inactivation curve of spores that were not treated with Ca-DPA prior to model from which the shoulder parameter was omitted (Figure 4) (20). For these data plating showed bi-phasic behaviors with tailing, and data were fitted with a biphasic
107 Chapter 5 thermoamylovorans B. Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) Nutrient germination, prelipoprotein diacylglycerol diacylglycerol Nutrient germination, prelipoprotein (28) transferase Nutrient germination, required for clustering of clustering for Nutrient germination, required (24, 43) inner membrane in the spore GRs Germinant receptor subunit C (41, 51) Germinant receptor Germinant receptor subunit B (41, 51) Germinant receptor Germinant receptor subunit A (41, 51) Germinant receptor Germinant receptor subunit C (41, 51) Germinant receptor Germinant receptor subunit B (41, 51) Germinant receptor Germinant receptor subunit A (41, 51) Germinant receptor Germinant receptor subunit C (41, 51) Germinant receptor Germinant receptor subunit B (41, 51) Germinant receptor Germinant receptor subunit A (41, 51) Germinant receptor Germinant receptor subunit C (41, 51) Germinant receptor Germinant receptor subunit B (41, 51) Germinant receptor Germinant receptor subunit A (41, 51) Germinant receptor Function (prediction ) (prediction Function ( x 2) C ( x 2) B ( x 2) A (x1) C (x1) B (x1) A gerPA gerF gerD ger ger ger N.A. N.A. N.A. N.A. N.A. N.A. ger ger ger Gene name B. thermo- amylovorans B4167_2306 B4167_3142 B4167_2160 B4167_3631 B4167_3630 B4167_3629 B4167_2412 B4167_2411 B4167_2413 Locus tag B4167 B4166_1505 B4166_2701 B4166_1566 B4166_2037 B4166_2036 B4166_2035 B4166_2486 B4166_2485 B4166_2487 Locus tag B4166 isolates. The table shows locus tags of the genes present in each in present genes the of tags locus shows table The isolates. thermoamylovorans B. B4065_2324 B4065_2064 B4065_1779 B4065_2777 B4065_2778 B4065_2779 B4065_1013 B4065_1014 B4065_1012 Locus tag B4065 B4064_3055 B4064_1353 B4064_2622 B4064_3195 B4064_3196 B4064_3197 B4064_2026 B4064_2027 B4064_2025 Locus tag B4064 - gerPA gerF gerD N.A. N.A. N.A. yfkQ yfkR yfkT yndF gerAC gerBC yndE gerAB gerBB yndD gerAA gerBA gerKC gerKB gerKA Gene name B. sub tilis
BSU10720 BSU34990 BSU01550 BSU07790 BSU07780 BSU07760 BSU17770 BSU33070 BSU35820 BSU17760 BSU33060 BSU35810 BSU17750 BSU33050 BSU35800 BSU03710 BSU03720 BSU03700 Locus tag B. subtilis 168 OG_1028 OG_1510 OG_1063 OG_2573 OG_2572 OG_2571 OG_5567 OG_5568 OG_5565 OG_3213 OG_3212 OG_3211 OG_1413 OG_1411 OG_1412 OG 168 was was subtilis 168 model laboratory also a B. strain, reference, For genes. germination different to corresponding orthologous the belong to (OG) that strain groups multiple In some cases, strains. of genes in the respective absence Empty indicate cells with locus tags and names of its germination genes. included in the set together thermoamylovorans in B. operons different in five which occur genes, For multiple spoVA to one OG in the individual strains. belong locus tags, different by listed genes, were these genes that (*) indicates An asterisk to the gene names. been added arbitrarily have of individual genes affiliation operon indicate the numbers that genomes, N.A. – not applicable. Abbreviations: tree. and phylogenetic alignment in one OG based on the multiple sequence combined Presence and absence of germination genes in four four in genes germination of absence and Presence 1. Table
108 Germination and heat resistance of B. thermoamylovorans spores Germination protease, SASPs degradation (61) degradation SASPs Germination protease, Role in cortex hydrolysis (58) hydrolysis in cortex Role Required for SleB presence in the spore (8) in the spore SleB presence for Required Cortex lytic enzyme (8) lytic Cortex Required for CwlJ localization in the spore coat (46) localization in the spore CwlJ for Required Required for CwlJ localization in the spore coat (46) localization in the spore CwlJ for Required Cortex lytic enzyme (8) lytic Cortex enzyme (8) lytic Cortex Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Ca-DPA release (42, 56) release Ca-DPA Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) Nutrient germination, spore coat permeability to coat permeability to Nutrient germination, spore nutrients (7) F F Eb Eb * D D D C C C B A 5) 1) 4) 3) 4) 2) 3) 3) 2) 4) 1) 1) 2 ( VA ( VA ( VA ( VA ( VA ( VA ( VA ( VA ( VA ( VA ( VA ( VA gpr gerM ypeB sleB gerQ 2 gerQ cwlJ cwlJ spo spo N.A. spo spo spo spo spo spo spo spo spo spo gerPF gerPE gerPD gerPC gerPB B4167_0959 B4167_0814 B4167_0628 B4167_0629 B4167_1270 B4167_1271 B4167_1024 B4167_0661 B4167_3716 B4167_2035 B4167_3717 B4167_2401 B4167_2484 B4167_2485 B4167_2402 B4167_3718 B4167_0662 B4167_0663 B4167_2311 B4167_2310 B4167_2309 B4167_2308 B4167_2307 B4166_0924 B4166_0779 B4166_0632 B4166_0631 B4166_1229 B4166_1228 B4166_0988 B4166_0598 B4166_3481 B4166_2944 B4166_3482 B4166_2585 B4166_2822 B4166_2823 B4166_2586 B4166_3483 B4166_0597 B4166_0596 B4166_1510 B4166_1509 B4166_1508 B4166_1507 B4166_1506 B4065_0354 B4065_3302 B4065_0504 B4065_0503 B4065_1230 B4065_2978 B4065_1231 B4065_2977 B4065_0417 B4065_0473 B4065_2008 B4065_2833 B4065_2009 B4065_2823 B4065_2832 B4065_2831 B4065_2822 B4065_2010 B4065_0472 B4065_0471 B4065_2329 B4065_2328 B4065_2327 B4065_2326 B4065_2325 5 B4064_0330 B4064_1518 B4064_0541 B4064_0540 B4064_1308 B4064_2404 B4064_1307 B4064_2405 B4064_0396 B4064_0507 B4064_3113 B4064_1752 B4064_3112 B4064_1742 B4064_1751 B4064_1750 B4064_1741 B4064_3111 B4064_0506 B4064_0505 B4064_3050 B4064_3051 B4064_3052 B4064_3053 B4064_3054 gpr gerM ypeB sleB N.A. gerQ cwlJ N.A. spoVAF spoVAEa N.A. spoVAEb N.A. N.A. spoVAD N.A. N.A. spoVAC spoVAB spoVAA gerPF gerPE gerPD gerPC gerPB BSU25540 BSU28380 BSU22920 BSU22930 BSU37920 BSU02600 BSU23390 BSU23401 BSU23402 BSU23410 BSU23420 BSU23430 BSU23440 BSU10670 BSU10680 BSU10690 BSU10700 BSU10710 OG_710 OG_615 OG_486 OG_485 OG_2275 OG_3282 OG_59 OG_2204 OG_461 OG_5841 OG_3062 OG_3436 OG_3868 OG_3063 OG_2782 OG_1543 OG_2872 OG_2783 OG_1852 OG_460 OG_459 OG_1033 OG_1032 OG_1031 OG_1030 OG_1029 ) 1. ( Continued Table
109 Chapter 5
sets, the D
110°C values ranged from 0.7 (standard error ± 0.1) min to 3.3 ± 0.5 min for the resistant fraction (Supplementary Table 1). In contrast, tailing was not observed for heat sensitive fraction of the spores, and from 9.3 ± 1.9 min to 33.7 ± 2.0 min for the heat any of the strains when spores were treated with Ca-DPA prior to dilution and plating.
D These inactivation curves were fitted with a log-linear model. For these data sets, the 110°C values ranged from 9.7 ± 0.5 min to 26.1 ± 3.2 min (Supplementary Table 1). For z strain B4064, the inactivation kinetics were determined at 110°C, and in addition also and calculation of a D of 1.4 min (upper 95% prediction interval 2.9 min) at 115°C and 120°C. This allowed for the determination of the -value (12.2 ± 1.8°C) (Supplementary Tableref 1). (Tref = 121.1°C) Discussion Spores of B. thermoamylovorans can pose problems in commercially sterile foods due to their high heat resistance and unpredictable germination. To improve our understanding of this problematic species and identify possible leads for spoilage control, we combined a phenotypic characterization of the germination behavior of four different food-related isolates with in silico analysis of their genome sequences (32). Based on our new insights into the germination properties of spores of this species, we subsequently determined heat resistance properties of spores of individual strains.
This study has shown that poor recovery of spores of B. thermoamylovorans on standard
rich cultivation media leads to a significant underestimation of the spore load that is plating on BHI-A showed that only a few percent (1.3%-5.0%) of B. thermoamylovorans actually present: enumeration of spores in spore suspensions using flow cytometry and spores formed colonies (Figure 1). Increase of the activation temperature did not improve spore counts (data not shown). This low number of colonies on BHI plates
2.6%-13.6% of spores germinated in the BHI broth (Figure 2). Notably, the germination resulted mainly from inefficient spore germination in response to nutrients, as only of B. thermoamylovorans spores was also very limited in the presence of LB broth and a variety of tested nutrient germinants, including L-alanine, a combination of L-asparagine,
without D-fructose, D-glucose and KCl (data not shown). Based on these observations, D-glucose, D-fructose, KCl, a mixture of 19 individual amino acids and inosine with or the absence of genes encoding one or more germination proteins would provide a B. thermoamylovorans spores to nutrients. In B. subtilis it is known that the initial stages of nutrient germination plausible explanation for a weak germination response of require at least one functional germinant receptor plus the GerD protein (43), and the germination process is facilitated by the GerP proteins (7). At a later stage, some of the SpoVA proteins enable release of Ca-DPA from the spore core to the environment and
In silico analysis of the genome sequences of finally, at least one of the two lytic enzymes, CwlJ or SleB, is required for hydrolysis of the spore protective cortex layer (42, 56). 110 Germination and heat resistance of B. thermoamylovorans spores
5
Figure 3. Schematic visualization of the predicted operon structures of: ger(x1)ABC and ger(x2)ABC encoding putative germinant receptors (A); cwlJ gerQ and cwlJ2, gerQ2 involved in Ca-DPA germination (B); five spoVA operons: spo(VA1), spo(VA2), spo(VA3), spo(VA4) and spo(VA5) (C). The sigma factor binding sites, together with the threshold p-values used for their prediction, are indicated with black arrows. The asterisk (*) indicates that cwlJ2 and gerQ2 are present only in strains B4064 and B4065 (A). The spoVA operons 2, 3 and 4: spo(VA2), spo(VA3) and spo(VA4) next to spoVA genes contain also genes encoding hypothetical proteins, indicated with light gray arrows, and predicted internal sigma factor binding sites (C). Operon spo(VA2) containing spo(VA2)C and spo(VA2)D genes is located on the edge of the contig in genomes of all B. thermoamylovorans food isolates. Thus, the nucleotide sequence, and predicted promoters, upstream of the two genes that encode hypothetical proteins indicated as “h**” are unknown.However, as the nucleotide sequence of the two h** genes encoding hypothetical proteins (h**) in the operon spo(VA2) is highly similar to the sequence of the h** gene in front of the spo(VA3)C gene in the operon spo(VA3), it is probable that the sequences upstream of the operons spo(VA2) and spo(VA3) are similar (C). Scales below each part of the figure indicate distances in nucleotide base pairs.
111 Chapter 5
B. thermoamylovorans spoVAEa, were present in the genomes of the four strains, some of them in showed that all known germination-specific genes, with the only multiple copies (Table 1). exception of Two tri-cistronic operons encoding putative GRs were found on the chromosome, as well as the gerD gene (Table 1), indicative of a potential of B. thermoamylovorans spores to respond to nutrient germination triggers. Despite the fact that one of the GR operons in strains B4064 and B4065 encoded proteins that belong to the same orthologous group as the B. subtilis GerK receptor subunits, spores of B. thermoamylovorans displayed very
L-asparagine, fructose, glucose and potassium ions). In B. subtilis, activation of the GerK little or no response to a nutrient mixture known to specifically trigger GerK (namely
indicated that subunits of the GerB receptor are absent in B. thermoamylovorans, which receptor in response to this mixture is also linked with the GerB receptor (1); our analysis literature that even small changes in a GR subunit sequence can alter or abolish activity may explain the lack of germination in response to this mixture. Also, it is known from B. thermoamylovorans,
of the GR complex in response to certain nutrients (9, 12, 35). For The genomic sequences of the germinant receptor operons showed intact genes with no specific response could be detected in any of the nutrient combinations tested. predicted binding sites for the SigG transcription factor, which typically regulates
expression of GR genes (18), upstream of the tri-cistronic operons. Assuming that these B. thermoamylovorans remains to be genes are expressed during sporulation and that the GR proteins are functional in the determined. spore, the specificity of the two GRs present in All other key genes related to germination, including the spoVA operon (required for release of Ca-DPA from the core upon germination in B. subtilis (42, 56)), as well as those sleB and cwlJ, were found in all four strains (Table 1). The only gene that was missing was spoVAEa, but the absence of this gene is in fact encoding the cortex lytic enzymes, not uncommon for spore-forming species of the Bacillales and Clostridiales orders (45). In B. subtilis, deletion of spoVAEa has been associated with a slower nutrient-induced
B. thermoamylovorans (Figure 2). In contrast, germination phenotype (45), but this fairly moderate decrease does not fully explain the some other spoVA genes, namely spoVAC and spoVAD and spoVAEb, were found in dramatic loss in germination efficiency in multiple copies in the genomes (Table 1). The impact of this duplication is so far unclear, although it may alter the release of Ca-DPA from the spore core upon germination. On the whole, the poor nutrient germination response of B. thermoamylovorans cannot be
linked directly to absence of key germination genes. Other explanations for the observed poor binding of nutrients to the GRs, lack of GR functionality or lack of adequate signal inefficient germination may be a weak penetration of nutrients through the coat layers, transduction downstream of the germination receptors (42, 56).
112 Germination and heat resistance of B. thermoamylovorans spores
Figure 4. Spore heat inactivation plots of B. thermoamlyovorans strains B4065 (A), B4166 (B) and B4167 (C), and B4064 (D), at 110°C. For strain B4064, this spore inactivation was additionally determined at 115°C (E) and 120°C (F). For all strains, two independent spore crops were exposed to a heat treatment followed by exposure to Ca- DPA (40 mM for 3 hours) or not before enumeration of survivors. The open circles and open squares correspond to spore crop 1 and 2, respectively, without Ca-DPA treatment. Closed circles and closed squares correspond to spore crop 1 and 2, respectively, with Ca-DPA treatment.
Interestingly, despite very weak germination responses to nutrients, spores of all four B. thermoamylovorans strains germinated well in response to a non-nutrient germinant,
CwlJ (40), which requires the GerQ protein for localization in the spore coat (46). CwlJ namely exogenous Ca-DPA. Ca-DPA is known to directly activate the cortex lytic enzyme and GerQ have been shown to be essential for Ca-DPA-induced germination in B. subtilis and B. megaterium (40, 46, 55). Assuming that the germination process of spores of B. thermoamylovorans is similar to B. subtilis, our results suggest that B. thermoamylovorans 5 nutrient germination is not impaired at the stage of peptidoglycan degradation and downstream events, but at the stage preceding cortex hydrolysis. However, a clear difference in germination efficiency in response to Ca-DPA was observed between the strains, with germination of spores of B4064 and B4065 being highly efficient, and AnalysisB4166 and of B4167the four being genomes moderately revealed efficient. the presence of two cwlJ and gerQ genes in strains B4064 and B4065, and single cwlJ and gerQ genes in strains B4166 and B4167. CwlJ and CwlJ2 on the one hand, and GerQ and GerQ2 on the other hand displayed high amino-acid sequence similarity (Supplementary Figure 1), suggesting that both copies of each protein potentially play similar or identical roles in spore germination of strains
113 Chapter 5
in response to Ca-DPA than spores of B4166 and B4167 (Table 1), but a direct link B4064 and B4065. Spores of B4064 and B4065 showed higher germination efficiencies
strains B4166 and B4167 and the presence of two cwlJ and gerQ genes remains to be between the higher Ca-DPA germination efficiency in strains B4064 and B4065 than in established.
Limited germination in response to nutrients has implications for counts obtained using standard plating techniques on rich media, as colony formation from single spores relies
enumeration on BHI plates strongly underestimates the number of viable spores. More on efficient germination of spores and subsequent outgrowth. We demonstrated that to Ca-DPA. To establish heat resistance, spores were subjected to heat treatments at efficient germination was observed following non-nutrient germination in response
110°C and plated directly or after a Ca-DPA treatment. For all four strains, much higher 3.4 log higher counts for spores of strain B4065), and tailing effects were absent. Heating recoveries were observed upon Ca-DPA exposure compared with direct plating (up to similar effects were observed (see Figure 4). was also performed at 115°C and 120°C for strain B4064, and at these temperatures,
prior to plating were more prominent for strains B4064 and B4065, than for spores of Interestingly, the differences in viable spore counts with or without Ca-DPA exposure strains B4166 and B4167. The latter two strains harbor only a single copy of the cwlJ and gerQ spores of strains B4064 and B4065, each harboring two cwlJ and gerQ genes (Figure genes, and their spores showed less efficient germination with Ca-DPA than
treatments were less prominent for the strains harboring the single cwlJ and gerQ 2). Following heating at 110°C, the differences in recoveries with and without Ca-DPA copies, which is likely due to the fact that spore germination was not complete for these
best in response to Ca-DPA, germination was not 100% after incubation for 3 hours spores, even following Ca-DPA exposure (Figure 4). Even for spores that germinated with Ca-DPA (Figure 2), indicating that counts on plates might still be underestimated.
B. thermoamylovorans was shown to produce highly heat resistant spores when compared to other spore-forming Bacillus spp. (D The decimal reduction times at 120°C B4064 (Supplementary Table 1) obtained with an additional Ca-DPA treatment prior 120°C) were 1.9 min ± 0.3 and 1.3 min ± 0.1 for two independent spore crops of strain to plating. This is comparable with reported D-values of B. subtilis strain A163, which is known to produce highly heat resistant spores (D 0.1) (4). The spore heat resistance of the B. thermoamylovorans strains is only slightly 120°C of 1.8 min ± 0.1 and 1.6 min ± lower than that of B. sporothermodurans, which is known to survive UHT processing and has reported D values of 2.25 min (27). When spores of strain B4064 were directly
plated on BHI, 120°Ca heat resistant fraction (tailing) was observed, with D values of 2.9
120°C
114 Germination and heat resistance of B. thermoamylovorans spores
D for spores of strain B4064, based on the inactivation data obtained after plating preceded by a Ca- ± 0.3 min and 2.7 ± 0.5 min (Supplementary Table 1). The calculated 140°C DPA treatment, was 2.3 s (upper 95% PI 5.0 s) which is very high, but still slightly below that of B. sporothermodurans spores, with reported D of 4.7 s and 5.0 s (27, 53).
When comparing the heat resistance of spores of B. thermoamylovorans140°C with spores of
G. stearothermophilus, the Dref of 1.4 minutes calculated for strain B4064 is lower than the D of 3.3 minutes that has been reported for G. stearothermophilus based on literature121.1°C data of 430 D-values of this species (49).
Based on the data obtained in this study, it can be concluded that the spores of B. thermoamylovorans are highly resistant, and are potentially able to survive UHT treatments. When conventional plating techniques are used to determine the initial spore concentration and to estimate spore heat resistance, it is likely that predictions are not accurate, especially for non-characterized species and strains. The lack of both of initial levels and of surviving spores after a heat treatment. When applied in a efficient nutrient germination of spores can lead to strong underestimations of counts, food processing setting, such large underestimations of the initial spore concentration can have detrimental effects on the safety boundaries of such processes.
In summary, we have demonstrated that spores of B. thermoamylovorans do not germinate efficiently upon nutrient-induced germination, despite the presence of DPA. Our results clearly show the importance of determining spore germination and the genes encoding two GRs. Spore germination was triggered upon exposure to Ca- outgrowth conditions prior to characterization of spore properties, including heat resistance, to avoid strong underestimation of viable spores that fail to germinate in response to regular nutrient germinants. The improved estimations of spore heat resistance obtained in this study will aid efforts in the food processing environment towards better control of spores of B. thermoamylovorans and assuring sterility of food products. 5 Acknowledgments by TI Food and Nutrition, a public-private partnership on pre-competitive research in The authors have declared that no competing interests exist. The research was funded food and nutrition. The funding organization had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The authors would like to thank Esmée Janssen and Gerwin Kamstra for technical assistance.
Supplementary Dataset 1 B. thermoamylovorans strains B4064, B4065, B4166 and B4167 and B. subtilis 168 based on the OrthoMCL analysis. Gene presence/absence matrix of
115 Chapter 5
References 1. Atluri, S., K. Ragkousi, D. E. Cortezzo, and P. Setlow. 2006. Cooperativity between different nutrient receptors in germination of spores of Bacillus subtilis and reduction of this cooperativity by alterations in the GerB receptor. Journal of Bacteriology 188:28-36. 2. Aziz, R. K., D. Bartels, A. A. Best, M. DeJongh, T. Disz, R. A. Edwards, K. Formsma, S. Gerdes, E. M. Glass, M. Kubal, F. Meyer, G. J. Olsen, R. Olson, A. L. Osterman, R. A. Overbeek, L. K. McNeil, D. Paarmann, T. Paczian, B. Parrello, G. D. Pusch, C. Reich, R. Stevens, O. Vassieva, V. Vonstein, A. Wilke, and O. Zagnitko. 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9:75. 3. Baerends, R., W. Smits, A. de Jong, L. Hamoen, J. Kok, and O. Kuipers. 2004. Genome2D: a visualization tool for the rapid analysis of bacterial transcriptome data. Genome Biology 5:R37. 4. Berendsen, E. M., M. H. Zwietering, O. P. Kuipers, and M. H. J. Wells-Bennik. 2015. Two distinct groups within the Bacillus subtilis properties. Food Microbiology 45, Part A:18-25. 5. Black, E. P., J. Wei, S. Atluri, D. E. Cortezzo, group display K. Koziol-Dube, significantly D. G. different Hoover, spore and P. heat Setlow. resistance 2007. Bacillus subtilis by very high pressure. Journal of Applied Microbiology 102:65-76. 6. AnalysisBrul, S., J.of van factors Beilen, influencing M. Caspers, the rate A. O’Brien, of germination C. de Koster, of spores S. Oomes, of J. Smelt, R. Kort, and A. Ter Beek. 2011. Challenges and advances in systems biology analysis of Bacillus spore physiology; Bacillus subtilis food isolate and a laboratory strain. Food Microbiology 28:221-227. 7. Butzin,molecular X. Y., differences A. J. Troiano, between W. H. an Coleman, extreme K. heat K. Griffiths, resistant C. spore J. Doona, forming F. E. Feeherry, G. Wang, Y.-q. Li, and P. Setlow. 2012. Analysis of the effects of a gerP mutation on the germination of spores of Bacillus subtilis. Journal of Bacteriology 194:5749-5758. 8. Chirakkal, H., M. O’Rourke, A. Atrih, S. J. Foster, and A. Moir. enzymes and related proteins in Bacillus subtilis endospore germination. Microbiology 148:2383- 2392. 2002. Analysis of spore cortex lytic 9. Christie, G., and C. R. Lowe. 2008. Amino acid substitutions in transmembrane domains 9 and 10 of GerVB that affect the germination properties of Bacillus megaterium spores. Journal of Bacteriology 190:8009-8017. 10. Combet-Blanc, Y., M. C. Dieng, and P. Y. Kergoat. on Bacillus thermoamylovorans growth and glucose fermentation. Applied and Environmental Microbiology 65:4582-4585. 1999. Effect of organic complex compounds 11. Combet-Blanc, Y., B. Ollivier, C. Streicher, B. K. C. Patel, P. P. Dwivedi, B. Pot, G. Prensier, and J.-L. Garcia. 1995. Bacillus thermoamylovorans sp. nov., a moderately thermophilic and amylolytic bacterium. International Journal of Systematic Bacteriology 45:9-16. 12. Cooper, G. R., and A. Moir. 2011. Amino acid residues in the GerAB protein important in the function and assembly of the alanine spore germination receptor of Bacillus subtilis 168. Journal of Bacteriology 193:2261-2267. 13. Coorevits, A., N. A. Logan, A. E. Dinsdale, G. Halket, P. Scheldeman, M. Heyndrickx, P. Schumann, A. Van Landschoot, and P. De Vos. 2011. Bacillus thermolactis sp. nov., isolated from dairy farms, and emended description of Bacillus thermoamylovorans. International Journal of Systematic and Evolutionary Microbiology 61:1954-1961. 14. De Clerck, E., T. Vanhoutte, T. Hebb, J. Geerinck, J. Devos, and P. De Vos. 2004. Isolation,
and Environmental Microbiology 70:3664-3672. 15. Doona,characterization, C. J., S. Ghosh, and identification F. F. Feeherry, of bacterial A. Ramirez-Peralta, contaminants inY. semifinalHuang, H. gelatin Chen, extracts. and P. AppliedSetlow. 2014. High pressure germination of Bacillus subtilis spores with alterations in levels and types of germination proteins. Journal of Applied Microbiology 117:711-720. 16. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797. 17. Eijlander, R. T., T. Abee, and O. P. Kuipers. 2011. Bacterial spores in food: how phenotypic variability complicates prediction of spore properties and bacterial behavior. Current Opinion in Biotechnology 22:180-186.
116 Germination and heat resistance of B. thermoamylovorans spores
18. Eijlander, R. T., A. de Jong, A. O. Krawczyk, S. Holsappel, and O. P. Kuipers. 2014. SporeWeb: an interactive journey through the complete sporulation cycle of Bacillus subtilis. Nucleic Acids Res 42:D685-91. 19. Gasol, J. M., and P. A. Del Giorgio. bacteria and understanding the structure of planktonic bacterial communities. Scientia marina 64:197-224. 2000. Using flow cytometry for counting natural planktonic 20. Geeraerd, A. H., V. P. Valdramidis, and J. F. Van Impe. 2006. Erratum to “GInaFiT, a freeware tool to assess non-log-linear microbial survivor curves” [Int. J. Food Microbiol. 102 (2005) 95–105]. International Journal of Food Microbiology 110:297. 21. Ghosh, S., M. Scotland, and P. Setlow. 2012. Levels of germination proteins in dormant and superdormant spores of Bacillus subtilis. Journal of Bacteriology 194:2221-7. 22. Ghosh, S., and P. Setlow. 2009. Isolation and characterization of superdormant spores of Bacillus species. Journal of Bacteriology 191:1787-1797. 23. Ghosh, S., and P. Setlow. 2010. The preparation, germination properties and stability of superdormant spores of Bacillus cereus. Journal of Applied Microbiology 108:582-590. 24. Griffiths, K. K., J. Zhang, A. E. Cowan, J. Yu, and P. Setlow. 2011. Germination proteins in the inner membrane of dormant Bacillus subtilis spores colocalize in a discrete cluster. Molecular Microbiology 81:1061-1077. 25. Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large 52:696-704. 26. Hu, H., J. Emerson, and A. I. Aronson. 2007. Factors involved in the germination and inactivation ofphylogenies Bacillus anthracis by maximum spores likelihood. in murine Systematic primary macrophages. Biology FEMS Microbiology Letters 272:245- 250. 27. Huemer, I. A., N. Klijn, H. W. J. Vogelsang, and L. P. M. Langeveld. 1998. Thermal death kinetics of spores of Bacillus sporothermodurans isolated from UHT milk. International Dairy Journal 8:851- 855. 28. Igarashi, T., B. Setlow, M. Paidhungat, and P. Setlow. 2004. Effects of a gerF (lgt) mutation on the germination of spores of Bacillus subtilis. Journal of Bacteriology 186:2984-2991. 29. Johnson, L. S., S. Eddy, and E. Portugaly. 2010. Hidden Markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics 11:431. 30. Keynan, A., W. G. Murrell, and H. O. Halvorson. 1962. Germination properties of spores with low dipicolinic acid content. Journal of Bacteriology 83:395-399. 31. Koeck, D. E., D. Wibberg, I. Maus, A. Winkler, A. Albersmeier, V. V. Zverlov, A. Pühler, W. H. Schwarz, W. Liebl, and A. Schlüter. 2014. First draft genome sequence of the amylolytic Bacillus thermoamylovorans wild-type strain 1A1 isolated from a thermophilic biogas plant. Journal of Biotechnology 192, Part A:154-155. 32. Krawczyk, A. O., E. M. Berendsen, R. T. Eijlander, A. de Jong, M. H. J. Wells-Bennik, and O. P. Kuipers. 2015. Draft genome sequences of four Bacillus thermoamylovorans strains isolated from milk and acacia gum, a food ingredient. Genome Announcements 3. 33. Li, L., C. J. Stoeckert, Jr., and D. S. Roos. 5 eukaryotic genomes. Genome Res 13:2178-89. 34. Li, Y., X. Y. Butzin, A. Davis, B. Setlow, G. 2003.Korza, OrthoMCL: F. I. Üstok, identification G. Christie, P.of Setlow,ortholog and groups B. Hao. for
peptidoglycan of spores of Bacillus species in vitro and during spore germination. Journal of Bacteriology2013. Activity 195: and2530-2540. regulation of various forms of CwlJ, SleB, and YpeB proteins in degrading cortex 35. Li, Y., P. Catta, K.-A. V. Stewart, M. Dufner, P. Setlow, and B. Hao. 2011. Structure-based functional studies of the effects of amino acid substitutions in GerBC, the C subunit of the Bacillus subtilis GerB spore germinant receptor. Journal of Bacteriology 193:4143-4152. 36. Magge, A., A. C. Granger, P. G. Wahome, B. Setlow, V. R. Vepachedu, C. A. Loshon, L. Peng, D. Chen, Y.-q. Li, and P. Setlow. 2008. Role of dipicolinic acid in the germination, stability, and viability of spores of Bacillus subtilis. Journal of Bacteriology 190:4798-4807. 37. Makita, Y., M. Nakao, N. Ogasawara, and K. Nakai. 2004. DBTBS: database of transcriptional regulation in Bacillus subtilis and its contribution to comparative genomics. Nucleic Acids Research 32:D75-D77. 38. Moir, A. 2006. How do spores germinate? Journal of Applied Microbiology 101:526-530.
117 Chapter 5
39. Overbeek, R., R. Olson, G. D. Pusch, G. J. Olsen, J. J. Davis, T. Disz, R. A. Edwards, S. Gerdes, B. Parrello, M. Shukla, V. Vonstein, A. R. Wattam, F. Xia, and R. Stevens. 2014. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Research 42:D206-D214. 40. Paidhungat, M., K. Ragkousi, and P. Setlow. 2001. Genetic requirements for induction of germination of spores of Bacillus subtilis by Ca2+-dipicolinate. Journal of Bacteriology 183:4886- 4893. 41. Paidhungat, M., and P. Setlow. 2000. Role of ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. Journal of Bacteriology 182:2513-2519. 42. Paredes-Sabja, D., P. Setlow, and M. R. Sarker. 2011. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends in Microbiology 19:85-94. 43. Pelczar, P. L., T. Igarashi, B. Setlow, and P. Setlow. 2007. Role of GerD in germination of Bacillus subtilis spores. Journal of Bacteriology 189:1090-1098. 44. Perez-Valdespino, A., S. Ghosh, E. P. Cammett, L. Kong, Y. Q. Li, and P. Setlow. 2013. Isolation and characterization of Bacillus subtilis spores that are superdormant for germination with dodecylamine or Ca2+ -dipicolinic acid. Journal of Applied Microbiology 114:1109-19. 45. Perez-Valdespino, A., Y. Li, B. Setlow, S. Ghosh, D. Pan, G. Korza, F. E. Feeherry, C. J. Doona, Y.-Q. Li, B. Hao, and P. Setlow. 2014. Function of the SpoVAEa and SpoVAF proteins of Bacillus subtilis spores. Journal of Bacteriology 196:2077-2088. 46. Ragkousi, K., P. Eichenberger, C. van Ooij, and P. Setlow. essential for germination of Bacillus subtilis spores with Ca2+-dipicolinate. Journal of Bacteriology 185:2315-2329. 2003. Identification of a new gene 47. Ramirez-Peralta, A., S. Gupta, X. Y. Butzin, B. Setlow, G. Korza, M.-A. Leyva-Vazquez, G. Christie, and P. Setlow. Bacillus species. Journal of Bacteriology 195:3009-3021. 48. Remenant, B., E.2013. Jaffrès, Identification X. Dousset, of M.-F. new Pilet, proteins and thatM. Zagorec. modulate 2015. the Bacterialgermination spoilers of spores of food: of 45, Part A:45-53. 49. Rigaux, C., J. B. Denis, I. Albert, and F. Carlin. 2013. A meta-analysis accounting for sources of variabilityBehavior, fitness to estimate and functional heat resistance properties. reference Food parameters Microbiology of bacteria using hierarchical Bayesian modeling: Estimation of D at 121.1 degrees C and pH 7, zT and zpH of Geobacillus stearothermophilus. International Journal of Food Microbiology 161:112-20. 50. Rodriguez-Palacios, A., and J. T. Lejeune. 2011. Moist-heat resistance, spore aging, and superdormancy in Clostridium difficile. Applied and Environmental Microbiology 77:3085-91. 51. Ross, C., and E. Abel-Santos. 2010. The ger receptor family from sporulating bacteria. Current issues in molecular biology 12:147-158. 52. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolic repression of bacterial sporulation. Proceedings of the National Academy of Sciences 54:704-711. 53. Scheldeman, P., L. Herman, S. Foster, and M. Heyndrickx. 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 54. Scheldeman, P., A. Pil, L. Herman, P. De Vos, and M. Heyndrickx. 2005. Incidence and diversity of potentially highly heat-resistant spores isolated at dairy farms. Applied and Environmental Microbiology 71:1480-94. 55. Setlow, B., L. Peng, C. A. Loshon, Y. Q. Li, G. Christie, and P. Setlow. 2009. Characterization of the germination of Bacillus megaterium of Applied Microbiology 107:318-328. 56. Setlow, P. 2014. Germination of sporesspores of Bacillus lacking Species: enzymes What that we degrade know andthe sporedo not cortex. know. Journal of Bacteriology 196:1297-1305. 57. Setlow, P. 2003. Spore germination. Current Opinion in Microbiology 6:550-556. 58. Slynn, G. M., R. L. Sammons, D. A. Smith, A. Moir, and B. M. Corfe. 1994. Molecular genetical and phenotypical analysis of the gerM spore germination gene of Bacillus subtilis 168. FEMS Microbiology Letters 121:315-320. 59. Smelt, J. P. P. M., A. P. Bos, R. Kort, and S. Brul. 2008. Modelling the effect of sub(lethal) heat treatment of Bacillus subtilis vegetative cells. International Journal of Food Microbiology 128:34-40. 60. Stewart, K.-A. V., and P. Setlow. spores 2013. on germinationNumbers of rateindividual and outgrowth nutrient germinantto exponentially receptors growing and
118 Germination and heat resistance of B. thermoamylovorans spores
other germination proteins in spores of Bacillus subtilis. Journal of Bacteriology 195:3575-3582. 61. Sussman, M. D., and P. Setlow. 1991. Cloning, nucleotide sequence, and regulation of the Bacillus subtilis gpr gene, which codes for the protease that initiates degradation of small, acid-soluble proteins during spore germination. Journal of Bacteriology 173:291-300. 62. van Asselt, E. D., and M. H. Zwietering. 2006. A systematic approach to determine global thermal inactivation parameters for various food pathogens. International Journal of Food Microbiology 107:73-82. 63. Witthuhn, M., G. Lucking, Z. Atamer, M. Ehling-Schulz, and J. Hinrichs. 2011. Thermal resistance of aerobic spore formers isolated from food products. International Journal of Dairy Technology 64:486-493. 64. Xu, S., T. P. Labuza, and F. Diez-Gonzalez. 2006. Thermal Inactivation of Bacillus anthracis Spores in Cow’s Milk. Applied and Environmental Microbiology 72:4479-4483.
5
119 Chapter 5
Supplementary materials Supplementary Table 1. Calculated inactivation kinetics for the B. thermoamylovorans strains B4064, B4065,
B4166 and B4167, pour-plated in Brain Heart Infusion Agar supplemented with 1mg/L vitamin B12, with prior exposure to Ca-DPA (condition Ca-DPA) and without prior exposure to Ca-DPA (condition normal plating). For the Ca-DPA condition, a log-linear model was fitted to the entire spore population expressed in decimal reduction times (D-value). For the normal plating, a bi-phasic model was fitted to the data and resulted in D-values for the sensitive and resistant subpopulations. For strain B4064, additionally, the temperature increase required to
achieve one extra log reduction, the z-value, the reference D-value (Dref), and the 95% prediction interval (PI) were calculated. Abbreviations: S.E. – standard error, Dref – reference D-value, Tref – reference temperature, N.A. – not applicable, PI – prediction interval. Strain Crop Condition Population D-value S.E. z-value S.E. (min) 1 Ca-DPA Total 110T (°C) 9,8 0,7 (°C) 1 Normal plating Sensitive 110 2,6 0,3 1 Normal plating Resistant 110 25,3 2,6 2 Ca-DPA Total 110 10,6 0,5 2 Normal plating Sensitive 110 1,2 0,2 2 Normal plating Resistant 110 18,9 3,5 1 Ca-DPA Total 115 3,7 0,3 1 Normal plating Sensitive 115 0,7 0,1 1 Normal plating Resistant 115 8,4 0,9 2 Ca-DPA Total 115 6,4 0,5 B4064 2 Normal plating Sensitive 115 0,4 0,1 2 Normal plating Resistant 115 7,1 1,3 1 Ca-DPA Total 120 1,9 0,2 1 Normal plating Sensitive 120 0,2 0,02 1 Normal plating Resistant 120 2,9 0,3 2 Ca-DPA Total 120 1,3 0,1 2 Normal plating Sensitive 120 0,2 0,03 2 Normal plating Resistant 120 2,7 0,5 Dref Ca-DPA Total 121.1 (Tref) 1,4 N.A. 12,2 1,8 95% PI Ca-DPA Total 121.1 (Tref) 2,9 N.A. 1 Ca-DPA Total 110 26,1 3,2 1 Normal plating Sensitive 110 2,8 0,3 1 Normal plating Resistant 110 15,9 0,7 B4065 2 Ca-DPA Total 110 14,3 0,6 2 Normal plating Sensitive 110 1,7 0,2 2 Normal plating Resistant 110 9,3 1,9 1 Ca-DPA Total 110 15,2 1,8 1 Normal plating Sensitive 110 2,3 0,3 1 Normal plating Resistant 110 26,1 1,7 B4166 2 Ca-DPA Total 110 9,9 0,5 2 Normal plating Sensitive 110 3,3 0,5 2 Normal plating Resistant 110 17,8 1,4 1 Ca-DPA Total 110 18,2 1,7 1 Normal plating Sensitive 110 1,1 0,6 1 Normal plating Resistant 110 26,2 1,3 B4167 2 Ca-DPA Total 110 9,7 0,5 2 Normal plating Sensitive 110 0,7 0,1 2 Normal plating Resistant 110 33,7 2,0
120 Germination and heat resistance of B. thermoamylovorans spores
Supplementary Figure 1. Multiple-sequence amino-acid alignment of the CwlJ (A) and GerQ proteins from the four B. thermoamylovorans food isolates (B4064, B4065, B4166, B4167). As mentioned in the text, strains B4064 and B4065 potentially encode two CwlJ and GerQ proteins referred to as CwlJ, CwlJ2 and GerQ, GerQ2, respectively. Conserved catalytic glutamate 21 residue (E21) in CwlJ proteins is marked above the alignment.
5
121
Chapter 6
General discussion
Erwin M. Berendsen Chapter 6
Introduction Spore forming bacteria can survive harsh environmental conditions as endospores (spores). The spores are much more resistant to adverse conditions than their vegetative counterparts (35).They are widely present in nature and therefore the spores can end up in food ingredients and foods (25). The intrinsic resistance properties of some bacterial spores enable survival of food processing conditions, such as heating processes that are commonly applied (9, 10, 55). Preservation treatments aimed at inactivation of a wide variety of bacterial spores are not always fully effective to inactivate all spores (47). The survival of spores in food, followed by germination and outgrowth, can result in food spoilage or food borne illness due to spore formers, depending on the species (42, 47,
sporulation temperature, the presence of salts in sporulation medium, the sporulation 55). The heat resistance properties of spores are influenced by many factors, such as the vary greatly between species and between strains within species. Such variation matrix (discussed in Chapter 1). Furthermore, the heat resistance properties of spores in heat resistance of spores has been observed in various studies and for different species. For the aerobic spore formers of the B. subtilis group, variation in wet heat resistance of spores from different strains has been reported previously (28, 33, 37). Similarly, for spores of B. sporothermodurans, large differences in resistance to heating
greatly between different strains of B. cereus (59) and for the anaerobic spore formers at 100°C have been reported (55). Heat resistance of spores has also been shown to vary Clostridium perfringens and Clostridium botulinum (38, 42, 66). Given the fact that heat
species level does not directly provide information about the level of heat resistance of resistance of spores of a particular species can differ greatly, mere identification at the the spores.
The aim of the work presented in this thesis was to gain insight in factors that underlie high-level heat resistance of spores of Bacillus species. In Chapter 2, variation in heat resistance of spores was assessed for strains within the B. subtilis group. In Chapter 3, B. subtilis spoVA operon in genes were identified that correlate with high-level heat resistance of spores of based on a gene-trait matching approach. A transposon and a specific resistance of B. subtilis. Additionally, genome analysis was used to assess the occurrence this transposon were identified and demonstrated to be responsible for high-level heat of the transposon and the spoVA operon in other spore forming Bacillaceae. In Chapter B. subtilis strains of the spore formers B. licheniformis and B. amyloliquefaciens. In Chapter 5, 4, the findings of high-level heat resistance of spores in were extended to spore germination behavior and heat resistance properties of spores of four spoilage isolates of B. thermoamylovorans were characterized. Below, the various subjects are discussed in more detail and an outlook on future studies is presented.
124 General discussion
Variation in heat resistance of spores the B. subtilis group (28, 33, 37). To better characterize variation in heat resistance Strain specific variation in heat resistance of spores has previously been observed within of spores of different Bacillus subtilis strains, detailed heat inactivation kinetics were established for fourteen strains of the B. subtilis group (Chapter 2) (7). Based on the established spore heat inactivation kinetics, strains within the B. subtilis group could be clustered in two distinct groups. The group producing spores with high-level heat resistance required 100 times longer heating than their sensitive counterparts to achieve one decimal reduction of the viable spore counts (7). These results were obtained using two different heating methods, namely, static heating and continuous only eleven were B. subtilis. The heat resistance of spores was subsequently assessed flow heating using a microheater (7). Of the fourteen strains assessed in this analysis, for another nine B. subtilis strains. Upon assessment of spore heat resistance of twenty strains of B. subtilis, a division between two distinct groups was found (den Besten et
(Chapter 3). al., manuscript in preparation) and genetic determinants were subsequently identified Given the differences in heat resistance of spores of B. subtilis, differences in heat resistances of spores of other members of the B. subtilis groups were also assessed. To this end, detailed heat inactivation kinetics were determined for spores of nine strains of B. licheniformis and nine strains of B. amyloliquefaciens. Based on the wet heat these species (Chapter 4). phenotype of spores of these species, two distinct groups could also be classified for In this thesis, a genomic determinant for high-level heat resistance of spores was nine B. subtilis strains resulted in an average 200 fold increase in heat resistance of identified (discussed in more detail below). The presence of one particular operon in of this genetic element to heat resistance of spores is much higher than that of other spores at 100°C compared with strains lacking this operon (Chapter 3). The contribution in the introduction of this thesis, Chapter 1), such as sporulation temperatures (known factors that are known to influence the heat resistance properties of spores (discussed to influence the heat resistance properties of spores up to 10 fold (3)), and certain spore (SASPs) can result in a 8-fold reduction in heat resistance of spores (30, 46, 57). proteins. For instance, specific deletion of genes encoding small acid soluble proteins 6 A spoVA operon is responsible for high-level heat resistance of spores A gene-trait matching approach (described in Chapter 1) was applied to identify genes that correlate with high-level heat resistance of spores of B. subtilis (Chapter 3). Using
125 Chapter 6
this approach, a Tn1546 resistance of spores of B. subtilis. Natural transfer by generalized transduction of this transposon was identified that correlates with high-level heat Tn1546 transposon from B. subtilis strain B4067, that forms spores with high-level heat resistance, to the laboratory strain B. subtilis 168, resulted in increased heat resistance of spores of the obtained strain B. subtilis in Tn1546, namely a spoVA operon in B. subtilis 168HR, resulted in loss of the high-level 168HR. Specific deletion of one of the operons heat resistance of spores, indicating a role for this operon in high-level heat resistance of spores (Chapter 3).
The spoVA operon present on the Tn1546 transposon was designated spoVA2mob (with mob indicating the presence on a mobile genetic element). The spoVA2mob operon is different from the spoVA operon (designated spoVA1) encoded in the genome of B. subtilis 168 (Figure 1). For the spoVA1 operon it is known that the encoded proteins
DPA) during sporulation and germination, respectively (32, 44, 56, 62). Mutations in the are required for uptake and release of pyridine-2,6-dicarboxylic acid (dipicolinic acid, spoVA1 operon in spoVAA, spoVAB, spoVAC, spoVAD or spoVAEb result in a spo phenotype; sporulation is not completed (58). Both spoVA operons contain genes coding for SpoVAC, SpoVAD and SpoVAEb proteins, however, the other genes in the operons differ
A B. subtilis (B4146) Tn1546 transposon L-alanine amidase N-acetylmuramoyl - Cardiolipin synthase Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction yetF N-terminal yetF C-terminal Mn Catalase spoVAEb spoVAC spoVAD ger(x)C ger(x)A TnpR TnpA TnpA 2mob 2mob 2mob
16 kb
B P-sigG DUF Yhcn / spoVAC2mob spoVAD2mob spoVAEb2mobDUF DUF 421 1657 YlaJ 1657 DUF1657 spoVA2mob operon
spoVA1 operon
P-sigG spoVAA spoVAB spoVAC1 spoVAD1 spoVAEb1 spoVAEa spoVAF 3.7 kb
Figure 1A) Overview of the Tn1546 transposon in B. subtilis strain B4146. The predicted gene functions are indicated in the figure. B) Overview of the spoVA1 and spoVA2mob operon. Both operons are predicted to be preceded by promotor regions that are specific for sporulation specificG σ . The spoVA1 operon consists of spoVAA, spoVAB, spoVAC, spoVAD, spoVAEb, spoVAEa and spoVAF. The spoVA2mob operon, consists of a gene with unknown function with a DUF1657 domain, a gene of a predicted lipoprotein with a YhcN/YlaJ domain, spoVAC, spoVAD, spoVAEb, a gene with unknown function with a DUF1657 domain and a gene with unknown function with a DUF421 and a DUF1657 domain.
126 General discussion
between the two operons (Chapter 3). Analysis of the phylogenetic protein tree of the SpoVAD proteins shows that the SpoVAD proteins from the two different spoVA operons spoVA1 and spoVA2. This difference between the two operons suggests distinct evolutionary pathways of the cluster separately (Figure 2), hence the arbitrary classification in different SpoVA proteins in the different operons, and potentially slightly different roles in sporulation, although this remains to be established. The genes encoding SpoVAC, SpoVAD and SpoVAEb are conserved in all spore forming Bacillales and Clostridiales (20), suggesting that these genes are required for sporulation.
The sole introduction of the spoVA2mob operon in B. subtilis 168 (168 amyE::spoVA2mob trpC2) resulted in increased heat resistance of spores (Chapter 3). The Tn1546 transposon and spoVA2mob operon were also found in the genomes of some strains of B. licheniformis and B. amyloliquefaciens. For the strains of these species that possess the Tn1546 spores of strains that do not possess this transposon (Chapter 3 & 4). In accordance transposon, the heat resistance of spores was significantly higher than for with the role of the B. subtilis spoVA2mob operon, cloning of the spoVA2mob operon from B. licheniformis and B. amyloliquefaciens into B. subtilis 168 also rendered spores that were more resistant to heat than those of the parental strain B. subtilis 168 (Chapter 4). These studies conclusively linked the genes in the spoVA2mob operon with heat resistance of spores, providing novel insights in genes contributing to high-level heat resistance of spores.
spoVA2mob operon during sporulation and germination are not known. Based on the known role proteins of the The exact molecular functions of the proteins encoded in the spoVA1 operon, it is likely that the spoVA2mob encoded proteins play a role in the uptake and release of DPA during sporulation (Chapter 3). As anticipated, the DPA levels in spores of strain B. subtilis 168HR and B. subtilis 168 amyE::spoVA2mob trpC2 were indeed higher than the levels in spores of strain B. subtilis 168. At this moment, it is not clear whether the spoVA2mob encoded proteins are complementary to the SpoVA1 proteins, interact with spoVA1 encoded proteins, or function independently. The presence of spoVA2mob encoded altering the resistance properties of the spores. Alterations in the lipid composition of proteins in the inner membrane potentially influences the membrane fluidity, possibly spores of B. subtilis have been shown to alter the wet heat resistance and germination properties of spores (22). 6 The spoVA1 encoded proteins are known to be involved in germination of spores (21, 44, 56, 62-65). Given the potential similar roles of proteins of the spoVA1 and spoVA2mob operon in the spore, the germination properties of spores with high-level heat resistance B. subtilis that possess the spoVA2mob operon have a slower germination phenotype in response to nutrients might be influenced. It was shown that spores of strains of
127 Chapter 6
Geobacillus caldoxylosilyticus G10~GeobacilluscaldoxylosilyticusG10 2208 Anoxybacillus flavithermus WK1 uid59135~Aflv 1008 Anoxybacillus flavithermus TNO 09 014~AF14 0347 Anoxybacillus flavithermus TNO 09 006 uid184762~AF6 1025 Anoxybacillus flavithermus TNO 09 016~AF16 1805 Geobacillus toebii T27 S Oomes B4110~B4110 2432 Geobacillus WCH70 uid59045~GWCH70 2246 Geobacillus Y4 1MC1 uid55779~GY4MC1 1253 Geobacillus thermoglucosidans TNO 09 020 uid181720~GT20 1130 Anoxybacillus flavithermus B4168~B4168 1105 Geobacillus thermoglucosidans TNO 09 023~GT23 0528 Geobacillus thermoglucosidasius C56 YS93 uid48129~Geoth 1363 Geobacillus caldoxylosilyticus B4119~B4119 2631 Geobacillus thermodenitrificans NG80 2 uid58829~GTNG 2235 Geobacillus sp G11MC16~G11MC16DRAFT 1222 Geobacillus group T22S B4113~B4113 2454 Geobacillus sp C56−T2~GC56T2 2275 Geobacillus stearothermophilus 10~Geobacillusstearothermophilus10 987 Geobacillus stearothermophilus TNO 09 008~GS8 2013 Geobacillus stearothermophilus T14 B4109~B4109 1834 Geobacillus stearothermophilus TNO 09 027~GS27 2239 Geobacillus stearothermophilus A B4114~B4114 1915 Geobacillus Y412MC61 uid41171~GYMC61 0378 Geobacillus HH01 uid188479~GHH c23910 Geobacillus thermoleovorans CCB US3 UF5 uid82949~GTCCBUS3UF5 25990 Geobacillus Y412MC52 uid55381~GYMC52 2284 Geobacillus C56 T3 uid49467~GC56T3 1199 Geobacillus kaustophilus HTA426 uid58227~GK2304 Bacillus cereus NIZO4117~NIZO4117 1519 Bacillus cereus NIZO4083~NIZO4083 3540 Bacillus cereus G9842 uid58759~BCG9842 B1062 Bacillus cereus B4158~B4158 4061 Bacillus cereus B4264 uid58757~BCB4264 A4176 Bacillus cereus CMCC2818 B4080~B4080 4006 Bacillus cereus NIZO4118~NIZO4118 3712 Bacillus cereus NIZO4084~NIZO4084 5119 Bacillus cereus NIZO4155~NIZO4155 2083 1 Bacillus cereus ATCC 14579 uid57975~BC4067 SpoVAD Bacillus cereus NIZO4120~NIZO4120 5017 Bacillus cereus NIZO4081~NIZO4081 3494 Bacillus cereus NIZO4088~NIZO4088 2318 Bacillus cereus BCM2 134A B4077~B4077 5003 Bacillus cereus B4147~B4147 4325 Bacillus cereus NIZO4082~NIZO4082 3014 Bacillus cereus E33L uid58103~BCZK3824 Bacillus cereus NC7401 uid82815~BCN 3980 Bacillus cereus CMCC2724 B4086~B4086 3936 Bacillus cereus AH187 uid58753~BCAH187 A4199 Bacillus cereus NIZO4116~NIZO4116 2296 Bacillus cereus Q1 uid58529~BCQ 3858 Bacillus cereus L29 16 B4078~B4078 4211 Bacillus cereus B4153~B4153 4402 Bacillus cereus NIZO4085~NIZO4085 3683 Bacillus cereus 03BB102 uid59299~BCA 4179 Bacillus cereus F837 76 uid83611~bcf 20230 Bacillus cereus biovar anthracis CI uid50615~BACI c40350 Bacillus cereus group PEA26 B4087~B4087 4359 Bacillus cereus AH820 uid58751~BCAH820 4088 Bacillus cereus FRI 35 uid173403~BCK 14860 Bacillus cereus NIZO4079~NIZO4079 3519 Bacillus cereus ATCC 10987 uid57673~BCE 4136 Bacillus licheniformis NIZO4125~NIZO4125 2129 Bacillus licheniformis NIZO4121~NIZO4121 3532 Bacillus licheniformis NIZO4123~NIZO4123 3634 Geobacillus vulcani B4164~B4164 2464 Bacillus licheniformis NIZO4094~NIZO4094 2483 Bacillus licheniformis C B4092~B4092 2679 Bacillus licheniformis NIZO4089~NIZO4089 1869 Bacillus licheniformis T29 B4091~B4091 3309 Bacillus licheniformis T1 fatty acid B4090~B4090 2676 Bacillus licheniformis NIZO4124~NIZO4124 2694 Bacillus subtilis B4144~B4144 2764 Bacillus subtilis B4140~B4140 2573 Bacillus amyloliquefaciens FZB42 uid58271~RBAM 021520 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 2237 Bacillus subtilis B425~B425 2576 Bacillus amyloliquefaciens LL3 uid158133~LL3 02525 Bacillus subtilis spizizenii TU B 10 uid73967~GYO 2575 Bacillus subtilis spizizenii W23 uid51879~BSUW23 11490 Bacillus subtilis spizizenii DV1 B 1~BSDV1B 0269 Bacillus subtilis RO NN 1 uid158879~I33 2411 Bacillus subtilis CC16 B4071~B4071 2201 Bacillus subtilis CC2 B4068~B4068 2367 Bacillus subtilis A162 B4070~B4070 2220 Bacillus subtilis MC85 B4073~B4073 2360 Bacillus subtilis B4145~B4145 2340 Bacillus subtilis A163 B4067~B4067 2564 Bacillus subtilis JH642 uid55255~BsubsJ 010100012688 Bacillus subtilis RL45 B4072~B4072 2384 Bacillus subtilis IIC14 B4069~B4069 2370 Bacillus subtilis B4146~B4146 2491 Bacillus subtilis NCIB 3610 uid55265~BsubsN3 010100012767 Bacillus subtilis 168 uid57675~BSU23410 Bacillus licheniformis NIZO4122~NIZO4122 2223 Bacillus subtilis B4143~B4143 2310 Bacillus subtilis PY79 uid229877~U712 11380 Geobacillus debilis DSM 16016~A3EQDRAFT 02553 Geobacillus debilis B4135~B4135 0402 Bacillus thermoamylovorans B4064~B4064 3112 Bacillus thermoamylovorans B4065~B4065 2009 Bacillus thermoamylovorans B4167~B4167 3717 Bacillus thermoamylovorans B4166~B4166 3482 Bacillus sporothermodurans IC4 B4102~B4102 3005 Anoxybacillus flavithermus WK1 uid59135~Aflv 2085 Anoxybacillus flavithermus TNO 09 016~AF16 1389 Anoxybacillus flavithermus TNO 09 006 uid184762~AF6 2073 Anoxybacillus flavithermus TNO 09 014~AF14 1880 Geobacillus caldoxylosilyticus G10~GeobacilluscaldoxylosilyticusG10 1476 Geobacillus toebii T27 S Oomes B4110~B4110 0894 Geobacillus WCH70 uid59045~GWCH70 0789 Anoxybacillus flavithermus B4168~B4168 2908 Geobacillus thermoglucosidasius C56 YS93 uid48129~Geoth 3024 Geobacillus thermoglucosidans TNO 09 020 uid181720~GT20 2655 Geobacillus Y4 1MC1 uid55779~GY4MC1 3006 Geobacillus thermoglucosidans TNO 09 023~GT23 2090 Geobacillus caldoxylosilyticus B4119~B4119 0885 Geobacillus sp C56−T2~GC56T2 0873 Geobacillus group T22S B4113~B4113 0910 Geobacillus thermodenitrificans NG80 2 uid58829~GTNG 0734 Geobacillus sp G11MC16~G11MC16DRAFT 0440 Geobacillus stearothermophilus TNO 09 027~GS27 1040 Geobacillus stearothermophilus TNO 09 008~GS8 1558 Geobacillus stearothermophilus T14 B4109~B4109 0694 Geobacillus thermoleovorans CCB US3 UF5 uid82949~GTCCBUS3UF5 10150 Geobacillus stearothermophilus A B4114~B4114 0733 Geobacillus kaustophilus HTA426 uid58227~GK0854 Geobacillus HH01 uid188479~GHH c07980 Geobacillus C56 T3 uid49467~GC56T3 2691 Geobacillus Y412MC61 uid41171~GYMC61 1655 Geobacillus Y412MC52 uid55381~GYMC52 0780 Geobacillus stearothermophilus 10~Geobacillusstearothermophilus10 1270 Bacillus thermoamylovorans B4064~B4064 1751 Bacillus thermoamylovorans B4065~B4065 2832 Bacillus thermoamylovorans B4167~B4167 2484 Bacillus thermoamylovorans B4166~B4166 2822 Bacillus thermoamylovorans B4167~B4167 2401 Bacillus thermoamylovorans B4166~B4166 2585 Bacillus thermoamylovorans B4064~B4064 1742 Bacillus thermoamylovorans B4065~B4065 2823 Bacillus subtilis A162 B4070~B4070 4524 Bacillus subtilis B4145~B4145 4582 Bacillus subtilis A163 B4067~B4067 4788 Bacillus sporothermodurans IC4 B4102~B4102 0634 Bacillus subtilis A162 B4070~B4070 4541 Bacillus subtilis B4145~B4145 4636 Bacillus subtilis A163 B4067~B4067 4766 Bacillus subtilis B4146~B4146 1177 Bacillus licheniformis NIZO4122~NIZO4122 0623 2 Bacillus subtilis CC2 B4068~B4068 4212 SpoVAD Bacillus subtilis RL45 B4072~B4072 4307 2mob Bacillus subtilis MC85 B4073~B4073 4321 SpoVAD Bacillus subtilis IIC14 B4069~B4069 4294 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 3820 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 1963 Bacillus amyloliquefaciens DSM7 uid53535~BAMF 1841 Bacillus licheniformis C B4092~B4092 2245 Bacillus subtilis CC16 B4071~B4071 4285 Bacillus subtilis B425~B425 4213 Bacillus amyloliquefaciens LL3 uid158133~LL3 04142 Bacillus amyloliquefaciens LL3 uid158133~LL3 02056 Bacillus licheniformis NIZO4094~NIZO4094 1464 Bacillus licheniformis T1 fatty acid B4090~B4090 2275 Bacillus cereus 03BB102 uid59299~BCA 5275 Bacillus cereus CMCC2818 B4080~B4080 5533 Bacillus cereus NIZO4082~NIZO4082 1185 Bacillus cereus F837 76 uid83611~bcf 25700 Bacillus cereus NC7401 uid82815~BCN P212 Bacillus cereus CMCC2724 B4086~B4086 5078 Bacillus cereus AH187 uid58753~BCAH187 C0228 Bacillus cereus NIZO4116~NIZO4116 1955 Bacillus cereus Q1 uid58529~BCQ PI170 Bacillus cereus biovar anthracis CI uid50615~BACI c51290 Bacillus cereus group PEA26 B4087~B4087 5058 Bacillus cereus AH820 uid58751~BCAH820 B0207 Bacillus cereus NIZO4085~NIZO4085 4514 Bacillus cereus E33L uid58103~BCZK4840 Bacillus cereus group PEA26 B4087~B4087 5263 Bacillus cereus NIZO4079~NIZO4079 3932 Bacillus cereus AH820 uid58751~BCAH820 5232 Bacillus cereus G9842 uid58759~BCG9842 B5691 Bacillus cereus Q1 uid58529~BCQ 4968 Bacillus cereus FRI 35 uid173403~BCK 09665 Bacillus cereus ATCC 10987 uid57673~BCE 5250 Bacillus cereus NC7401 uid82815~BCN 5059 Bacillus cereus AH187 uid58753~BCAH187 A5308 Bacillus cereus L29 16 B4078~B4078 4996 Bacillus cereus NIZO4118~NIZO4118 3703 Bacillus cereus B4264 uid58757~BCB4264 A5266 Bacillus cereus B4158~B4158 5221 Bacillus cereus NIZO4084~NIZO4084 0636 Bacillus cereus NIZO4120~NIZO4120 1779 Bacillus cereus ATCC 14579 uid57975~BC5148 Bacillus cereus NIZO4081~NIZO4081 5036 Bacillus cereus NIZO4117~NIZO4117 2579 Bacillus cereus NIZO4083~NIZO4083 1440 Bacillus cereus NIZO4088~NIZO4088 4071 0.1 Bacillus cereus BCM2 134A B4077~B4077 5879 Bacillus cereus B4147~B4147 5477 Figure 2. Maximum likelihood phylogenetic tree of SpoVAD proteins encoded in the genomes of 103 spore forming Bacillaceae. The SpoVAD proteins of the spoVA1 and the spoVA2 andspoVA2mob operons are found in different branches of the phylogenetic protein tree. Unique DNA sequences can be found in the spoVAD2mob gene, which can be used for detection of this gene, based on the encoded genes in the species B. subtilis (B4067 B4068, B4069, B4070, B4071, B4072, B4073, B4122 B4145, B4146), B. amyloliquefaciens (DSM7 and B425), B. licheniformis (B4090, B4092, B4094), B. thermoamylovorans (B4064, B4065, B4166, B4167) and B. sporothermodurans (B4102). Additionally, unique DNA sequences can be identified in the spoVAD2 gene, which can be used for the detection of the spoVAD2 gene in the thermophilic spore formers A. flavithermus and Geobacillus spp.
128 General discussion
than spores of strains that lack this spoVA2mob operon (Krawczyk et al., manuscript in spoVA2mob operon from B. subtilis 168HR restored the rate of germination to the same level as that of spores B. subtilis 168 (Krawczyk et preparation). Specific deletion of the al., manuscript in preparation). This indicates that proteins encoded by the spoVA2mob operon play a crucial role in slowing down the germination rate of spores of B. subtilis. known at this moment. The germinant receptors and GerD, which are involved in the The exact molecular mechanisms leading to this reduced germination rate are not initial stage of germination, are known to cluster together in the inner membrane of the spores of B. subtilis and form the germinisome (23). However, the proteins encoded in the spoVA1 operon do not co-localize with the germinosome (23).
The relation between increased dormancy (superdormancy) and high-level spore wet heat resistance has previously been described for B. subtilis A163 and B. sporothermodurans IC4 (30). Superdormant spores of B. subtilis 168 that were isolated also showed high wet heat resistance and required a higher level of heat activation than their non-superdormant counterparts for triggering of germination (21). The role of the spoVA2mob operon in reduced germination indicates a direct genomic link between high- level heat resistance of spores and reduced germination rate.
In spores of B. subtilis spoVA2mob operon (Chapter 3). 168HR, specific peptide fragments were detected, corresponding spoVA2mob operon both encode a protein that is predicted to with proteins encoded by the first and the last gene of the be cytosolic and contains a DUF1657 domain. The DUF1657 domain is also found as part The first and sixth gene of the of proteins with predicted mechanosensitive channel functions in Yersinia ruckeri and in Enterobacteriaceae. The link of the DUF1657 domain to a mechanosensitive channel is interesting, since the SpoVAC1 protein was proven to act as a mechanosensitive channel in B. subtilis during spore germination (65). Mechanosensitive channels are known to sense changes in the membrane tension and osmotic changes (8, 48). However, the role of these small proteins with the DUF1657 domains in relation to the mechanosensitive channel SpoVAC1, if any, is not clear at this stage.
The last gene of the spoVA2mob operon encodes a protein that is predicted to be membrane bound by three transmembrane segments, and contains a DUF421 domain and a DUF1657 domain. The only crystal structure determined of a DUF421 domain (PDB:3c6F) is for YetF (BSU07140). Based on this crystal structure, the DUF421 domain 6 is predicted to form a tetramer. However, the protein organization is not clear for the last gene of the spoVA2mob operon. Additionally, the role of the DUF1657 domain in the last gene of the spoVA2mob operon is not clear. Potentially the DUF1657 domain can interact of the spoVA2mob operon, but this remains to be established. with the other DUF1657 domain containing proteins encoded by the first and sixth gene
129 Chapter 6
Interestingly, deletion of the last gene of the spoVA2mob operon (with DUF421 and DUF1657 domains) from B. subtilis 168HR resulted in the loss of high-level heat resistance of spores (Figure 1 and Chapter 3). Moreover, the deletion of the DUF1657 domain from the last gene of the spoVA2mob operon also resulted in the loss of high heat resistance of spores of strain 168HR (unpublished data). Sole introduction of this last gene of the spoVA2mob
operon under its native promoter (sigG) was not sufficient B. subtilis spores. to increase heat resistance of spores (unpublished data). This indicates that the final Single clean deletions of the seven individual genes of the spoVA2mob operon may provide gene is necessary, but not sufficient, for high-level heat resistance of more insight in gene(s) or combination of genes that are required for the high-level heat resistance phenotype of spores.
It is not known whether the proteins encoded by the spoVA2mob operon play a role in the resistance of spores to high hydrostatic pressure (HHP). The application of HHP is known to trigger germination via germinant receptors (~150 MPa), to trigger germination via the SpoVA channels (~500 MPa), and to inactivate spores at higher pressures (>600 MPa) (50-52, 54). The application of high hydrostatic pressure (HHP) may also provide insights in the reduced spore germination rate phenotype and might establish the link, if any, between the resistance to wet heat and high pressure resistance. Subjecting spores of the various strains constructed in this thesis to HHP could shed light on the roles of proteins encoded in the spoVA2mob operon in HHP triggered germination and resistance.
Horizontal gene transfer of the spoVA operon The transfer of genetic elements between strains and species contributes to the genetic diversity of bacterial spore formers, including B. subtilis (18). Given this genetic diversity in bacterial spore formers, food processing conditions may select for those spores that are able to survive the applied treatments (47). A potential risk in relation to heat resistance of spores is the use of bacterial spores and spore formers as probiotics (14).
Horizontal gene transfer is an important evolutionary driver for the adaptation of microorganisms (36). The transfer of DNA can be mediated via different processes, such
In this thesis, natural transfer of the Tn1546 transposon was achieved by generalized as conjugation, phage transduction, and uptake of external DNA from the environment. transduction, upon propagation of a prophage in B. subtilis B4067 (Chapter 3). This strategy was chosen, because active transposition was not likely to occur, as for most B. subtilis and B. licheniformis strains the tnpA and tnpR genes were either pseudogenes, contained internal stop codons, or were completely absent (Chapter 3). Genetic elements like the Tn1546 transposon may be transferred over species barriers, although this
remains to be established. In our study, the genetic modification was greatly facilitated
130 General discussion
B. subtilis (B4146) Tn1546 transposon
A L-alanine amidase N-acetylmuramoyl - Cardiolipin synthase Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction yetF N-terminal yetF C-terminal Mn Catalase spoVAEb spoVAC spoVAD ger(x)C ger(x)A TnpR TnpA TnpA 2mob 2mob 2mob
B B. sporothermodurans (B4102) Tn1546 transposon Contig break Contig break yetF L-alanine amidase N-acetylmuramoyl - ger(x)B ger(x)C ger(x)A ger(x)B TnpA TnpA TnpR Unknonw fuction TnpA Unknonw fuction Peptidase Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction Unknonw fuction spoVAC spoVAD Unknonw fuction Unknonw fuction spoVAEb 2mob 2mob 2mob
Figure 3. Overview of the Tn1546 transposons found in A) B. subtilis and B) B. sporothermodurans. Both transposon contain the spoVA2mob operon, shown to be responsible for high-level heat resistance in B. subtilis. The composition of the transposon varies between the two different species. In B. sporothermodurans, an additional tnpA gene is present, and it contains a complete ger(X) operon, whereas these are not found in B. subtilis. by the ability of the laboratory strain B. subtilis 168 to become naturally competent and
Thetake Tnup1546 external transposon DNA (29). is a Tn3 like transposon that requires a plasmid intermediate for active transposition (1, 60). The Tn1546 Enterococcus feacium and harbours genes that confer vancomycin resistance (1). The transposon was first identified in Tn1546 transposon in the B. subtilis during sporulation (Chapter 3, and unpublished results). In B. cereus the Tn1546 group strains harbors genes that are expressed transposon was found on the pXO1-like plasmid (49), and in B. anthracis the transposon was found on the pXO1 plasmid and described to contain a ger-operon (in that study the transposon was named TnXOI) (60). In Chapter 3, it was hypothesized that the Tn1546 transposon was transferred horizontally from B. cereus plasmids to strains of the B. subtilis group, B. thermoamylovorans strains and to B. sporothermodurans.
The Tn1546 transposon and the spoVA2mob operon are also found in B. sporothermodurans B4102 (Figure 3) (Chapter 3). Strains of B. sporothermodurans, including strain B4102,
The role of the spoVA2mob and other spoVA operons in B. sporothermodurans in the heat are known to produce spores with extreme high-level heat resistance (26, 27, 55, 61). resistance of its spores remains to be established. Based on gene composition, the Tn1546 transposon found in B. sporothermodurans closely resembles the Tn1546 transposon found in B. cereus (more than the B. subtilis group transposon). Therefore, the hypothesis arises that B. sporothermodurans, carrying the Tn1546 transposon, was an intermediate 6 strain from which the transposon spread to other spore forming Bacillus species. More detailed data analysis would be required to elucidate such an evolutionary scenario. Furthermore, data of either whole genome sequences or microbiome sequencing would facilitate the understanding of the spreading and evolution of the Tn1546 transposon in spore formers.
131 Chapter 6
The Tn1546 transposons found in the B. amyloliquefaciens strains are smaller than those in B. subtilis and B. licheniformis. The Tn1546 transposons in B. amyloliquefaciens
losing the gene encoding a N-acetylmuramoyl-L-Alanine-amidase, ger(X)A, ger(X)C, have most likely undergone an internal site-specific recombination event, thereby a gene with unknown function and a predicted manganese catalase. Furthermore, in the Tn1546 found in the B. amyloliquefaciens strains, the tnpA and tnpR genes were intact. The presence of these intact transposition genes potentially allowed for internal transposition in the strains DSM7 and LL3, resulting in multiple copies in the genome of these strains.
Evolution of spoVA operons in spore formers The presence of spoVA operons in the genomes is variable among the spore forming strains analysed in Chapter 3. All analysed strains carried spoVAC, spoVAD and spoVAEb genes, either as part of a spoVA1 or a spoVA2 operon. These genes were present on a
genes are conserved in all spore forming Bacillaceae and Clostridiales (20). Most strains mobile genetic element or as part of the genome. This is in line with the finding that these possessed intact spoVA1 B. thermoamylovorans, B. sporothermodurans and Caldibacillus debilis. For these species, incomplete spoVA1 operons, with the only exceptions being operons were observed, probably caused by gene loss (Chapter 3). For B. subtilis, it spoVA1 operon cause incomplete sporulation (58). The strains of B. thermoamylovorans, B. sporothermodurans and is known that deletions in the first five genes of the Caldibacillus debilis are still able to complete sporulation, despite the absence of spoVAC, spoVAD and spoVAEb in the spoVA1 operon. However, for these species, the genes spoVAC, spoVAD and spoVAEb were present in the spoVA2 operon, spoVA2mob operon, or both spoVA1 operon can be complemented by the versions encoded in the spoVA2 operon or spoVA2mob operons. These findings suggest that the role of proteins encoded in the operon. Possibly, the spoVA2mob operon can complement the role of the spoVA1 genes in B. subtilis strains. This can be assessed by deletion of the spoVA1 from strain 168HR and subsequent analysing the spore characteristics such as heat resistance and germination behavior of spores of the resulting strains.
Germination in relation to enumeration
ability of spores to germinate, grow out and to form a colony (34). Cultivation media The quantification of wet heat resistance of spores by plate counting depends on the for enumeration of spores must support spore germination and spore outgrowth and subsequent vegetative growth of the spore former of interest. An inability to complete one of these processes may lead to a gross underestimation of spore counts and viable
spore counts after a heat treatment. Specific knowledge of the germination, outgrowth
132 General discussion
and vegetative growth of the spore former of interest is required to develop methods to accurately assess the viable spore counts.
In Chapter 5, spores of four B. thermoamylovorans strains were characterized with respect to their germination and heat resistance properties. Spores of all four B. thermoamylovorans germination 14%). This resulted in underestimation of the number of spores present in strains germinated poorly in response to nutrients (maximum a solution: only 5% of the spores were enumerated after plating on brain heart infusion germination of spores up to 98%. For B. subtilis spores, it is known that Ca-DPA triggers medium. The germination that was induced by Ca-DPA was more efficient, showing lytic enzyme CwlJ that is localized in the spore coat (39, 48). germination independently of the germinant receptors by directly activating the cortex The hampered germination of spores of B. thermoamylovorans could not directly germination related genes. Analysis of the genomes of the four strains revealed two be explained by the absence of operons encoding for germinant receptors and other tri-cistronic operons encoding germinant receptors, indicative of a potential to produce the receptor complexes. Additionally, these operons were predicted to be preceded by binding sites specific for the sporulation specific sigma factor G, however, transcription observation was the presence of an incomplete spoVA1 operon, and the presence of a was not experimentally confirmed due to asynchronous sporulation. An interesting spoVA2 operon and two spoVA2mob operons in the genomes of all B. thermoamylovorans B. subtilis that the spoVA2mob operon plays a role in high-level heat resistance and reduced germination rate of spores, it seems strains (Chapter 3 & 5). Based on the findings in plausible that the observed high-level heat resistance of spores of B. thermoamylovorans and their inability to germinate in response to nutrients is linked to the presence of an incomplete spoVA1 operon and complete spoVA2 and spoVA2mob operons. However, the roles of these operons in impaired germination and high-level heat resistance of spores of B. thermoamylovorans remain to be established.
To improve enumeration of B. thermoamylovorans after heat treatments, a Ca-DPA treatment was implemented to trigger germination prior to plating. Viable spore counts forming units [CFU]) compared with those obtained with normal plating methods obtained after using a Ca-DPA treatment were significantly higher (up to 3.4 logs colony (Chapter 5) (6). Additionally, the tailing observed in the inactivation plots when using 6 the normal plating method was absent after implementation of a Ca-DPA trigger prior to plating (Chapter 5) (6).
For B. thermoamylovorans, the implementation of a Ca-DPA incubation step in the assessment of viable spore counts resulted in more accurate estimations of heat resistances of spores. The implementation of a Ca-DPA treatment may also improve
133 Chapter 6
yields of spores in enumeration methods of other species that are problematic in the food industry. This may result in better estimations of viable spore numbers and a more accurate assessment of the heat resistance of spores. However, the germination behavior of spores in response to nutrients and Ca-DPA can be strain and species
B. specific. Furthermore, it should be noted that germination in response to a Ca-DPA thermoamylovorans strains B4166 and B4167 germinated in response to Ca-DPA trigger did not occur for 100% of the spores. For example, only half of spores of (6). Moreover, Perez-Valdespino et al. reported the isolation of B. subtilis spores that are superdormant for Ca-DPA triggered germination (43). To circumvent a lack of germination in response to Ca-DPA, other treatments can be applied to trigger the
spores (16, 54). Furthermore, combinations of different germination triggers can be germination of spores. For example, HHP can be employed to trigger germination of applied to optimize the germination of spores, thereby allowing accurate estimations of viable spore counts.
Clearly, detection of bacterial spores based on cultivation methods of the vegetative
that permit outgrowth and growth (e.g. state of the bacterium requires efficient germination and suitable growth conditions composition). The spore former of interest must be able to metabolize substrates oxygen requirement, temperature, media present in the growth medium used for detection. The availability of genome sequences allows for predictions of metabolism pathways of the microorganism of interest (24). Knowledge of the metabolic pathways of microorganism may aid the development of media that support growth. Additionally, the availability of genome sequences may aid
theDetection development of of highly chromogenic heat media resistant for detection spores of specific microorganisms (19). The detection of the spoVA2mob operon in the food chain (when DNA of samples taken from food is analysed) can point to the presence of spores with high-level heat resistance. As mentioned above, in the food industry, the detection of bacterial spores often depends on cultivation methods of the vegetative state of the spore former. Alternatively, DNA-, RNA- and protein-based methods of detection can be used for detection of
spore formers and their spores. However, identification methods such as 16S rDNA level of the corresponding spores. Ideally, the target for detection of the spore former identification of spore formers does not provide information on the wet heat resistance provides information about the species present, and simultaneously about the level of wet resistance of the spores. The insights obtained in this thesis on genomic traits that determine high-level heat resistance of spores can be used for detection of spore formers that produce spores with high-level heat resistance. For the B. subtilis group, major strain-to-strain variation in heat resistance of spores was observed, relating to
134 General discussion
the number of spoVA2mob operons present in the genome of a strain (Chapter 3). The presence and number of spoVA2mob operons in the genome of a strain can be used as an spoVA2mob operon can thus potentially allow for a better control of high-level heat resistant spores indication of the level of heat resistance of spores. Specific detection of the and facilitate the avoidance of conditions that allow for transfer of this operon. Multiple techniques can be used for the detection of the spoVA2mob genes and will be discussed below.
To detect the spoVA2mob operon by qPCR, a primer set can be designed to detect the spoVAD2mob B. subtilis group, or to B. thermoamylovorans or B. sporothermodurans. The spoVAD2mob gene contains sequences gene that is specific to strains belonging to the that are unique for different species that can be problematic in foods upon survival of high-level heat treatments. Such primer sets would not detect spoVAD2mob gene homologs that may be present in other spore formers that are of less interest.
In addition, qPCR primers can be designed for the detection of the spoVAD2 gene of thermophilic spore formers that carry this gene as part of the core genome (i.e. Geobacillus spp. and Anoxybacillus flavithermus) (Chapter 3). The spoVAD2 genes of the different Geobacillus spp. and Anoxybacillus flavithermus strains contain unique DNA sequences that allow for specific detection of this gene. The detection of thermophilic processing. Thermophilic spore formers such as Geobacillus stearothermophilus produce spore formers can also be beneficial for improved control of such spores during food spores with high-level heat resistance (53). Generally, it is known that the obligate thermophiles produce spores with higher heat resistances than spores of mesophiles and psychrophiles (35). The high-level heat resistance of spores of thermophilic spore formers may also be related to the presence spoVA2 operon in the core genome of these species, but this is not known at this stage and remains to be elucidated.
Methods other than PCR can be used for the detection of the spoVA2mob operon. For a spoVA2mob operon. A similar approach is already in use to screen strains of interest example, whole genome sequencing of strains can directly reveal the presence of for the presence of antibiotic-resistance genes and virulence factors (5). Alternatively, microarray based methods can be used that allow for detection by hybridization of of a certain environment by sequencing of DNA and RNA samples may show the presence specific target DNA sequences (10, 12). Furthermore, characterization of the microbiome of spoVA2mob genes in an environment of interest. Sequencing of bacterial DNA present 6 in different places in the food chain may provide useful information about spreading of the spoVA2mob operon, and thereby reveal critical control points in particular food chains. Additionally, microbiome sequencing may provide insights in the point of entry the design of improved control strategies of bacterial spore formers in the food chain. of specific spore formers in the food chain. This type of information may ultimately aid
135 Chapter 6
Other phenotypes affected by the Tn1546 transposon This thesis focused on the high-level heat resistance of bacterial spores. The adaptations encountered which allow spores to withstand heating at high temperatures, may also affect other properties of the spores. The Tn1546 transposon, harbouring the spoVA2mob
such as the germinant receptor genes ger(X)A and ger(X)C, a gene encoding a putative operon, also contains other genes and operons that may influence spore properties, manganese catalase and a gene encoding cardiolipin synthase (Figure 1). All genes yetF gene (unpublished 1546 transposon included are expressed during sporulation, except for the fragmented the Ger(X)A and Ger(X)C (Chapter 3), but these genes were not involved in the results). The proteins encoded in the first operon of the Tn reduced germination rate, which is discussed below (Krawczyk et al., manuscript in preparation). Deletion of these ger(X)A and ger(X)C genes from strain B. subtilis 168HR, and introduction of these genes in B. subtilis 168 did not alter the rate of germination (Krawczyk et al., manuscript in preparation).
The Tn1546 transposon found in the B. subtilis and B. licheniformis strains encodes a manganese catalase, of which protein fragments were detected in spores of B. subtilis 168HR (Chapter 3). Manganese catalase has been shown to play a role in the protection of spores of B. pumilis B. subtilis 168HR B. subtilis 168, but to hydrogen peroxide (13). Therefore, spores of this remains to be tested. For B. subtilis 168 it is known that deletion of the sporulation may display higher resistance to hydrogen peroxide than spores of katX yields mutant strains that produce spores that are sensitive to 1546 encoded specific catalase hydrogen peroxide during outgrowth (2). However, the role of the Tn should be noted that the Tn1546 transposon in the B. amyloliquefaciens strains does not manganese catalase, if any, in resistance to oxidative stress is not known at this stage. It recombination event (Chapter 4). contain the first two operons, including the manganese catalase, due to a site specific Wet heat resistance of anaerobic spore formers The work on wet heat resistance of spores in this thesis focused on the Bacillales and not on spores of the Clostridilales. Variation in heat resistances of spores is also known to occur within different Clostridia species, but the molecular mechanisms underlying these variations are not known. Variation in heat resistance between spores of C. perfringens strains has been described previously. Strains that encode the CPE
with spores of strains that carry plasmid-encoded CPE and with strains that do not enterotoxin on the chromosome produce spores with higher heat resistances compared carry a cpe gene at all (38, 66). One genomic determinant was described previously for C. perfringens, the gene ssp4, resulting in a seven fold difference in decimal reduction time of spores at namely a specific variant of the small acid soluble proteins encoded by
136 General discussion
have been described for C. botulinum. Spores of proteolytic C. botulinum strains are far 100°C (30, 31). Additionally, large strain specific differences in heat resistance of spores more resistant to wet heat than spores of non-proteolytic C. botulinum strains (41, 42). It is noteworthy that the genomes of the proteolytic and non-proteolytic botulinum strains are very diverse (41, 42), and therefore unravelling of molecular mechanisms anaerobic species that produces spores with the highest level of heat resistance reported underlying high-level heat resistance of proteolytic strains might be complex. The is Moorella thermoacectica (11). The genome sequence of a strain of this microorganism was reported (45) and genome analysis might provide insights in the mechanisms underlying this extreme level of heat resistance of its spores. different Clostridia species are possibly related to the variation in the spoVA operons The adaptations underlying strain specific variation in heat resistance of spores of the and horizontal gene transfer thereof, similar to what was found in species belonging to the Bacillus subtilis group. Recently, the genomes of 23 C. perfringens strains, mostly isolated from foods, were sequenced (unpublished results) (66, 67). All strains that carry a cpe gene on the chromosome were found to cluster in a separate branch of the a plasmid cpe gene or do not carry a cpe gene (Figure 4). Contrary to the occurrence of maximum likelihood core genome phylogenetic tree compared with strains that carry two different spoVA operons in the B. subtilis group, the spoVA genes in all C. perfringens strains were found on a single operon consisting of only the genes spoVAC, spovAD and spoVAEb, as was reported previously (40). variation in heat resistance of spores of C. perfringens Based on these results, the strain specific spoVA genes. The limited genome variation seen in C. can not be explained by the perfringens type A makes this bacterium a suitable model species to further unravel presence or absence of specific anaerobic spore formers. Variation in heat resistance of spores of different strains of mechanisms underlying strain specific variations in heat resistance of spores of Clostridium species thus appear to be mediated via different mechanisms.
To unravel the adaptations underlying high-level heat resistance of C. perfringens strains, a gene-trait matching approach (4) can be used as described in Chapter 1 and as applied in Chapter 3. Gene-trait matching based on the heat resistance of spores together with analysis of the genome contents may reveal genes that are uniquely present or absent
6 in the strains that produce spores with significantly higher heat resistances. Variation in heat resistance of spores can also be influenced by other factors that can not be polymorphisms (SNP) have a profound effect on the heat resistance of spores, like identified using a gene-trait matching approach. For example, when single nucleotide the ssp (17). Alternatively, if transcriptional differences are leading to differences in the heat 4 gene (30, 31), these can be identified using a SNP-trait matching approach resistance properties of spores, these can be identified using a transcriptome-trait 137 Chapter 6
A B Clostridium perfringens Clostridium perfringens VWA009 Clostridium perfringens NCTC8239 Clostridium perfringens SM101pub Clostridium perfringens SM101 Clostridium perfringens VWA031 VWA009 Clostridium perfringens VWA001 Clostridium perfringens VWA300 Clostridium perfringens VWA326 NCTC8239 Clostridium perfringens VWA085 Clostridium perfringens VWA019 Clostridium perfringens VWA020 SM101 Clostridium perfringens VWA202 pub Clostridium perfringens VWA003 SM101 Clostridium perfringens 13 Clostridium perfringens VWA331 X-CPE Clostridium perfringens VWA039 VWA326 Clostridium perfringens VWA121 Clostridium perfringens VWA080 VWA085 Clostridium perfringens VWA264 Clostridium perfringens VWA114 Clostridium perfringens NCTC11144 VWA019 Clostridium perfringens VWA200 Clostridium perfringens VWA198 VWA031 Clostridium perfringens VWA006 Clostridium perfringens ATCC 13124pub Clostridium perfringens VWA128 VWA300 Clostridium perfringens ATCC13124 Clostridium botulinum B Eklund 17B Clostridium botulinum E3 Alaska E43 VWA001 Clostridium saccharobutylicum DSM 13864 Clostridium beijerinckii NCIMB 8052 VWA020 Clostridium saccharoperbutylacetonicum ATCC 27021 Clostridium acidurici 9a Clostridium difficile 630 VWA202 Clostridium difficile BI1 Clostridium difficile R20291 VWA003 Clostridium difficile CD196 Clostridium lentocellum DSM 5427 Clostridium phytofermentans ISDg VWA331 Clostridium SY8519 Clostridium saccharolyticum WM1 Clostridium cf saccharolyticum K10 NCTC11144 Clostridium stercorarium DSM 8532 Clostridium stercorarium DSM 8532 VWA200 Clostridium cellulolyticum H10 Clostridium BNL1100 Clostridium clariflavum DSM 19732 VWA198 Clostridium thermocellum ATCC 27405 Clostridium thermocellum DSM 1313 VWA080 Clostridium cellulovorans 743B Clostridium pasteurianum BC1 P-CPE or CPE negative Clostridium acetobutylicum EA 2018 VWA121 Clostridium acetobutylicum ATCC 824 Clostridium acetobutylicum DSM 1731 VWA264 Clostridium botulinum BKT015925 Clostridium novyi NT pub Clostridium tetani 12124569 ATCC13124 Clostridium tetani E88 Clostridium kluyveri DSM 555 Clostridium kluyveri NBRC 12016 VWA128 Clostridium ljungdahlii DSM 13528 Clostridium autoethanogenum DSM 10061 ATCC13124 Clostridium botulinum A3 Loch Maree Clostridium botulinum Ba4 657 Clostridium botulinum B1 Okra VWA039 Clostridium botulinum F Langeland Clostridium botulinum F 230613 VWA006 Clostridium botulinum H04402 065 Clostridium botulinum A2 Kyoto Clostridium botulinum A ATCC 3502 VWA114 Clostridium botulinum A Hall 0.1 0.1 Clostridium botulinum A ATCC 19397
Figure 3. A) Maximum likelihood core genome phylogenetic tree of Clostridium spp. The genetic diversity between the Clostridium perfringens strains is limited compared with the diversity of other Clostridium spp. B) Maximum likelihood core genome phylogenetic tree of Clostridium perfringens type A strains based on protein sequences encoded by genes present in a single copy in the core genome. The presence of a chromosomal CPE gene, plasmid CPE gene or absence of a CPE gene is indicated in the tree. Two phylogenetic branches can be seen, where the chromosomal CPE strains cluster apart from the plasmid CPE and CPE negative strains.
matching approach. Such a transcriptome trait-matching approach has been described for Lactococcus lactis and Lactobacillus plantarum of spores may also be determined by protein levels, in which the process of translation (8, 15). Furthermore, final properties plays an important role.
Concluding remarks In this thesis, a new genomic determinant for Bacillus spore heat resistance was
a gene-trait matching approach, it was shown that strains of the B. subtilis group that identified that is responsible for a profound increase of spore heat resistance. Using produce spores with high-level heat resistance acquired a Tn1546 transposon. This transposon contained a spoVA2mob operon, which was proven to be responsible for high-level heat resistance of spores. The demonstrated role of this spoVA2mob operon in determining spore heat resistance of Bacillus species allows for detection of spore formers that are able to produce spores with high-level heat resistance. This genomic determinant for high-level heat resistance appears to be restricted to Bacillaceae, and was not found in C. perfringens genomes. The acquired knowledge will aid the implementation of improved measures to control (facultative) aerobic spore formers
138 General discussion
in food processing. The insight that this spoVA2mob operon can be transferred between strains and species illustrates the importance of avoidance of conditions that allow for such transfer events.
References 1. Arthur, M., C. Molinas, F. Depardieu, and P. Courvalin. 1993. Characterization of Tn1546, a Tn3- related transposon conferring glycopeptide resistance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. Journal of Bacteriology 175:117-27. 2. Bagyan, I., L. Casillas-Martinez, and P. Setlow. 1998. The katX gene, which codes for the catalase in spores of Bacillus subtilis 180:2057-2062. 3. Baril, E., L. Coroller, O. Couvert,, is a forespore-specific I. Leguérinel, F. Postollec,gene controlled C. Boulais, by σF, F.and Carlin, KatX andis essential P. Mafart. for hydrogen2012. Modeling peroxide heat resistance resistance of of the Bacillus germinating weihenstephanensis spore. Journal and of Bacteriology Bacillus licheniformis spores as function of sporulation temperature and pH. Food Microbiology 30:29-36. 4. Bayjanov, J. R., D. Molenaar, V. Tzeneva, R. J. Siezen, and S. A. van Hijum. 2012. PhenoLink--a web-tool for linking phenotype to ~omics data for bacteria: application to gene-trait matching for Lactobacillus plantarum strains. BMC Genomics 13:170. 5. Bennedsen, M., B. Stuer-Lauridsen, M. Danielsen, and E. Johansen. 2011. Screening for antimicrobial resistance genes and virulence factors via genome sequencing. Applied and Environmental Microbiology 77:2785-2787. 6. Berendsen, E. M., A. O. Krawczyk, V. Klaus, A. de Jong, J. Boekhorst, R. T. Eijlander, O. P. Kuipers, and M. H. Wells-Bennik. 2015. Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger
7. Berendsen, E. M., M. H. Zwietering, O. P. Kuipers, and M. H. J. Wells-Bennik.clusters, 2015. but Two efficiently distinct groupsupon non-nutrient within the Ca-DPABacillus exposure. subtilis Applied and Environmental Microbiology. properties. Food Microbiology 45, Part A:18-25. 8. Bron, P. A., M. Wels, R. S. Bongers, groupH. van display Bokhorst-van significantly de Veen, different A. Wiersma, spore heat L. Overmars, resistance M. L. Marco, and M. Kleerebezem. 2012. Transcriptomes reveal genetic signatures underlying physiological variations imposed by different fermentation conditions in Lactobacillus plantarum. PLoS ONE 7:e38720. 9. Brul, S., F. Schuren, R. Montijn, B. J. F. Keijser, H. van der Spek, and S. J. C. M. Oomes. 2006. The impact of functional genomics on microbiological food quality and safety. International Journal of Food Microbiology 112:195-199. 10. Brul, S., J. van Beilen, M. Caspers, A. O’Brien, C. de Koster, S. Oomes, J. Smelt, R. Kort, and A. Ter Beek. 2011. Challenges and advances in systems biology analysis of Bacillus spore physiology; Bacillus subtilis food isolate and a laboratory strain. Food Microbiology 28:221-227. 11. Byrer,molecular D. E., differences F. A. Rainey, between and anJ. Wiegel. extreme 2000. heat Novel resistant strains spore of formingMoorella thermoacetica form unusually heat-resistant spores. Archives of Microbiology 174:334-339. 12. Caspers, M. P. M., F. H. J. Schuren, A. C. M. van Zuijlen, S. Brul, R. C. Montijn, T. Abee, and R. Kort. bacilli. Food Microbiology 28:245-251. 13. Checinska,2011. A mixed-species A., M. Burbank, microarray and A. forJ. Paszczynski. identification 2012. of food Protection spoilage of Bacillus pumilus spores by catalases. Applied and Environmental Microbiology 78:6413-6422. 14. Cutting, S. M. 2011. Bacillus probiotics. Food Microbiology 28:214-20. 6 15. Dijkstra, A., W. Alkema, M. Starrenburg, J. Hugenholtz, S. van Hijum, and P. Bron. 2014. Lactococcus lactis MG1363 reveals transcriptome signatures for robustness. Microbial Cell Factories 13:148. 16. Fermentation-inducedDoona, C. J., S. Ghosh, variationF. F. Feeherry, in heat A. andRamirez-Peralta, oxidative stress Y. phenotypesHuang, H. Chen, of and P. Setlow. 2014. High pressure germination of Bacillus subtilis spores with alterations in levels and types of germination proteins. Journal of Applied Microbiology 117:711-720. 17. Dutilh, B. E., L. Backus, R. A. Edwards, M. Wels, J. R. Bayjanov, and S. A. F. T. van Hijum. 2013.
139 Chapter 6
Genomics 12:366-380. 18. ExplainingEarl, A. M., microbial R. Losick, phenotypes and R. Kolter. on a genomic2008. Ecology scale: andGWAS genomics for microbes. of Bacillus Briefings subtilis in .Functional Trends in Microbiology 16:269-275. 19. Fricker, M., R. Reissbrodt, and M. Ehling-Schulz. 2008. Evaluation of standard and new Bacillus cereus. International Journal of Food Microbiology 121:27-34. 20. Galperin,chromogenic M. Y.,selective S. L. Mekhedov, plating media P. Puigbo, for isolation S. Smirnov, and identification Y. I. Wolf, and of D. J. Rigden. 2012. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation- 14:2870-90. 21. Ghosh, S., M. Scotland, and P. Setlow. 2012. Levels of germination proteins in dormant and superdormantspecific genes. Environmentalspores of Bacillus Microbiology subtilis. Journal of Bacteriology 194:2221-7. 22. Griffiths, K. K., and P. Setlow. Bacillus subtilis sporulation and spore properties. Journal of Applied Microbiology 106:2064-78. 23. Griffiths, K. K., J. Zhang, A. E. 2009.Cowan, Effects J. Yu, of and modification P. Setlow. of2011. membrane Germination lipid compositionproteins in theon inner membrane of dormant Bacillus subtilis spores colocalize in a discrete cluster. Molecular Microbiology 81:1061-1077. 24. Henry, C. S., M. DeJongh, A. A. Best, P. M. Frybarger, B. Linsay, and R. L. Stevens. 2010. High- throughput generation, optimization and analysis of genome-scale metabolic models. Nature Biotechnology 28:977-982. 25. Heyndrickx, M. 2011. The importance of endospore-forming bacteria originating from soil for contamination of industrial food processing. Applied and Environmental Soil Science 2011:11. 26. Huemer, I. A., N. Klijn, H. W. J. Vogelsang, and L. P. M. Langeveld. 1998. Thermal death kinetics of spores of Bacillus sporothermodurans isolated from UHT milk. International Dairy Journal 8:851- 855. 27. Klijn, N., L. Herman, L. Langeveld, M. Vaerewijck, A. A. Wagendorp, I. Huemer, and A. H. Weerkamp. 1997. Genotypical and phenotypical characterization of Bacillus sporothermodurans strains, surviving UHT sterilisation. International Dairy Journal 7:421-428. 28. Kort, R., A. C. O’Brien, I. H. M. van Stokkum, S. J. C. M. Oomes, W. Crielaard, K. J. Hellingwerf, and S. Brul. 2005. Assessment of heat resistance of bacterial spores from food product isolates
71:3556-3564. 29. Kovacs,by fluorescence A. T., W.monitoring K. Smits, of dipicolinicA. M. Mironczuk, acid release. and Applied O. P. Kuipers.and Environmental 2009. Ubiquitous Microbiology late competence genes in Bacillus species indicate the presence of functional DNA uptake machineries. Environmental Microbiology 11:1911-22. 30. Li, J., and B. A. McClane. 2008. A novel small acid soluble protein variant is important for spore resistance of most Clostridium perfringens food poisoning isolates. PLoS Pathogens 4:e1000056. 31. Li, J., D. Paredes-Sabja, M. R. Sarker, and B. A. McClane. 2009. Further characterization of Clostridium perfringens 4:e6249. 32. Li, Y., A. Davis, G. Korza, small P. Zhang, acid solubleY. Q. Li, protein-4B. Setlow, (Ssp4) P. Setlow, properties and B. Hao.and expression. 2012. Role ofPLoS a SpoVA ONE protein in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 194:1875-84. 33. Lima, L. J. R., H. J. Kamphuis, M. J. R. Nout, and M. H. Zwietering. 2011. Microbiota of cocoa powder with particular reference to aerobic thermoresistant spore-formers. Food Microbiology 28:573-582. 34. Mafart, P., I. Leguérinel, O. Couvert, and L. Coroller. for assessment and optimization of heating processes: A never-ending story. Food Microbiology 27:568-572. 2010. Quantification of spore resistance 35. Nicholson, W. L., N. Munakata, G. Horneck, H. J. Melosh, and P. Setlow. 2000. Resistance of Bacillus Molecular Biology Reviews 64:548-572. 36. Ochman, endospores H., J. G. Lawrence, to extreme and terrestrial E. A. Groisman. and extraterrestrial 2000. Lateral environments. gene transfer Microbiologyand the nature and of bacterial innovation. Nature 405:299-304. 37. Oomes, S. J. C. M., A. C. M. van Zuijlen, J. O. Hehenkamp, H. Witsenboer, J. M. B. M. van der
140 General discussion
Vossen, and S. Brul. 2007. The characterisation of Bacillus spores occurring in the manufacturing of (low acid) canned products. International Journal of Food Microbiology 120:85-94. 38. Orsburn, B., S. B. Melville, and D. L. Popham. 2008. Factors contributing to heat resistance of Clostridium perfringens endospores. Applied and Environmental Microbiology 74:3328-3335. 39. Paidhungat, M., K. Ragkousi, and P. Setlow. 2001. Genetic requirements for induction of germination of spores of Bacillus subtilis by Ca2+-Dipicolinate. Journal of Bacteriology 183:4886- 4893. 40. Paredes-Sabja, D., P. Setlow, and M. R. Sarker. 2011. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends in Microbiology 19:85-94. 41. Peck, M. W. 2006. Clostridium botulinum and the safety of minimally heated, chilled foods: an emerging issue? Journal of Applied Microbiology 101:556-570. 42. Peck, M. W., S. C. Stringer, and A. T. Carter. 2011. Clostridium botulinum in the post-genomic era. Food Microbiology 28:183-191. 43. Perez-Valdespino, A., S. Ghosh, E. P. Cammett, L. Kong, Y. Q. Li, and P. Setlow. 2013. Isolation and characterization of Bacillus subtilis spores that are superdormant for germination with dodecylamine or Ca2+ -dipicolinic acid. Journal of Applied Microbiology 114:1109-19. 44. Perez-Valdespino, A., Y. Li, B. Setlow, S. Ghosh, D. Pan, G. Korza, F. E. Feeherry, C. J. Doona, Y.-Q. Li, B. Hao, and P. Setlow. 2014. Function of the SpoVAEa and SpoVAF proteins of Bacillus subtilis spores. Journal of Bacteriology 196:2077-2088. 45. Pierce, E., G. Xie, R. D. Barabote, E. Saunders, C. S. Han, J. C. Detter, P. Richardson, T. S. Brettin, A. Das, L. G. Ljungdahl, and S. W. Ragsdale. 2008. The complete genome sequence of Moorella thermoacetica (f. Clostridium thermoaceticum). Environmental Microbiology 10:2550-2573. 46. Popham, D., B. Illades-Aguiar, and P. Setlow. 1995. The Bacillus subtilis dacB gene, encoding
synthesis and spore core dehydration. Journal of Bacteriology 177:4721-4729. 47. penicillin-bindingPostollec, F., A. G. Mathot, protein 5*,M. Bernard, is part of M. a three-geneL. Divanac’h, operon S. Pavan, required and D. for Sohier. proper 2012. spore Tracking cortex spore-forming bacteria in food: from natural biodiversity to selection by processes. International Journal of Food Microbiology 158:1-8. 48. Ragkousi, K., P. Eichenberger, C. van Ooij, and P. Setlow. essential for germination of Bacillus subtilis spores with Ca2+-dipicolinate. Journal of Bacteriology 185:2315-2329. 2003. Identification of a new gene 49. Rasko, D. A., M. J. Rosovitz, O. A. Okstad, D. E. Fouts, L. Jiang, R. Z. Cer, A. B. Kolsto, S. R. Gill, and J. Ravel. 2007. Complete sequence analysis of novel plasmids from emetic and periodontal Bacillus cereus isolates reveals a common evolutionary history among the B. cereus-group plasmids, including Bacillus anthracis pXO1. Journal of Bacteriology 189:52-64. 50. Reineke, K., A. Mathys, V. Heinz, and D. Knorr. 2013. Mechanisms of endospore inactivation under high pressure. Trends in Microbiology 21:296-304. 51. Reineke, K., A. Mathys, and D. Knorr. 2011. The impact of high pressure and temperature on bacterial spores: inactivation mechanisms ofBacillus subtilis above 500 MPa. Journal of Food Science 76:M189-M197. 52. Reineke, K., K. Schlumbach, D. Baier, A. Mathys, and D. Knorr. 2013. The release of dipicolinic acid - The rate-limiting step of Bacillus endospore inactivation during the high pressure thermal sterilization process. International Journal of Food Microbiology 162:55-63. 53. Rigaux, C., J. B. Denis, I. Albert, and F. Carlin. 2013. A meta-analysis accounting for sources of variability to estimate heat resistance reference parameters of bacteria using hierarchical Bayesian modeling: Estimation of D at 121.1 degrees C and pH 7, zT and zpH of Geobacillus stearothermophilus. International Journal of Food Microbiology 161:112-20. 54. Sarker, M. R., S. Akhtar, J. A. Torres, and D. Paredes-Sabja. 2015. High hydrostatic pressure- 6 induced inactivation of bacterial spores. Critical Reviews in Microbiology 41:18-26. 55. Scheldeman, P., L. Herman, S. Foster, and M. Heyndrickx. 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. Journal of Applied Microbiology 101:542-555. 56. Setlow, P. 2014. Germination of spores of Bacillus species: What we know and do not know. Journal of Bacteriology 196:1297-1305. 57. Setlow, P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. Journal of Applied Microbiology 101:514-525.
141 Chapter 6
58. Tovar-Rojo, F., M. Chander, B. Setlow, and P. Setlow. 2002. The products of the spoVA operon are involved in dipicolinic acid uptake into developing spores of Bacillus subtilis. Journal of Bacteriology 184:584-587. 59. van Asselt, E. D., and M. H. Zwietering. 2006. A systematic approach to determine global thermal inactivation parameters for various food pathogens. International Journal of Food Microbiology 107:73-82. 60. Van der Auwera, G., and J. Mahillon. 2005. TnXO1, a germination-associated class II transposon from Bacillus anthracis. Plasmid 53:251-7. 61. van Zuijlen, A., P. M. Periago, A. Amézquita, A. Palop, S. Brul, and P. S. Fernández. 2010. Characterization of Bacillus sporothermodurans IC4 spores; putative indicator microorganism for optimisation of thermal processes in food sterilisation. Food Research International 43:1895- 1901. 62. Velasquez, J., G. Schuurman-Wolters, J. P. Birkner, T. Abee, and B. Poolman. 2014. Bacillus subtilis spore protein SpoVAC functions as a mechanosensitive channel. Molecular Microbiology 92:813-23. 63. Vepachedu, V. R., and P. Setlow. 2004. Analysis of the germination of spores of Bacillus subtilis with temperature sensitive spo mutations in the spoVA operon. FEMS Microbiol Lett 239:71-7. 64. Vepachedu, V. R., and P. Setlow. 2005. Localization of SpoVAD to the inner membrane of spores of Bacillus subtilis. Journal of Bacteriology 187:5677-5682. 65. Vepachedu, V. R., and P. Setlow. 2007. Role of SpoVA proteins in release of dipicolinic acid during germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme. Journal of Bacteriology 189:1565-1572. 66. Xiao, Y., A. Wagendorp, T. Abee, and M. H. J. Wells-Bennik. 2015. Differential outgrowth potential of Clostridium perfringens food-borne isolates with various cpe-genotypes in vacuum- 194:40-45. 67. Xiao, Y., A. Wagendorp, R. Moezelaar, T. Abee, and M. H. J. Wells-Bennik. 2012. A wide variety packedof Clostridium ground perfringens beef during type storage A food-borne at 12 °C. International isolates that Journalcarry a ofchromosomal Food Microbiology cpe gene belong to one multilocus sequence typing cluster. Applied and Environmental Microbiology 78:7060-7068.
142 Addenda
Nederlandse samenvatting About the author List of publications Acknowledgements
Erwin M. Berendsen Addenda
Nederlandse samenvatting Bacteriële sporen zijn ultieme overlevingscapsules. Sporen kunnen ongunstige omgevingscondities overleven die dodelijk zijn voor vegetatieve cellen, zoals hitte, uitdroging, UV-straling of chemicaliën. Wanneer de omstandigheden weer gunstig zijn kunnen sporen ontkiemen en uitgroeien als vegetatieve cellen. Doordat sporen veel voorkomen in de natuur is het onontkoombaar dat sporen terechtkomen in voedingsmiddelen, waar ze na ontkieming en uitgroei kunnen leiden tot voedselbederf. Een veelgebruikte methode om sporen af te doden en zo bederf te voorkomen is het verhitten op hoge temperaturen (boven 100°C). De resistentie van sporen tegen hittebehandelingen verschilt zowel per soort sporenvormer als binnen een soort, waardoor een deel van de sporen deze hittebehandelingen kan overleven. Het onderzoek zoals beschreven in dit proefschrift heeft zich gericht op het achterhalen van factoren die bepalend zijn voor de hoge hitteresistentie van sporen.
In hoofdstuk 2 is de hitteresistentie van sporen in kaart gebracht voor veertien stammen van de B. subtilis groep. Op basis van de hitteresistentie van de sporen konden twee groepen stammen worden onderscheiden. Van de eerste groep waren alle sporen volledig afgedood na een uur bij 100°C (koken), terwijl de sporen van de tweede groep
de verhittingsmethode die gebruikt werd; zowel stromend als stilstaand verhitten nagenoeg allemaal overleefden. De indeling in twee groepen was onafhankelijk van resulteerde in dezelfde tweedeling. Een aantal bekende factoren die hitteresistentie van sporen kunnen beïnvloeden, waaronder kweekomstandigheden, konden de grote verschillen niet verklaren.
In hoofdstuk 3 is onderzocht of genetische verschillen tussen stammen uit de twee gevonden groepen verantwoordelijk zijn voor de waargenomen verschillen in hitteresistentie van sporen. Na analyse van de volledige genoomsequenties van negen stammen van B. subtilis met hoog-hitteresistente sporen en negen stammen met
aanwezig is in stammen die hoog-hitteresistente sporen produceren. Dit cluster werd laag-hitteresistente sporen, werd een uniek genencluster geïdentificeerd dat altijd aangetroffen in een mobiel genetisch element, namelijk het transposon Tn1546. Door dit transposon over te brengen naar de labstam B. subtilis 168 , werd bevestigd dat dit element verantwoordelijk is voor de hoge hitteresistentie van sporen. Door genen uit het transposon gericht te bestuderen kon worden aangetoond dat het derde operon op het transposon, het zogenaamde spoVA2mob operon, een belangrijke rol speelt bij de hoge hitteresistentie van sporen.
Naast de hoog-hitteresistente sporen van B. subtilis worden ook hoog-hitteresistente sporen van B. amyloliquefaciens en B. licheniformis aangetroffen in de voedingsindustrie. In hoofdstuk 4 hebben we aangetoond dat het Tn1546 transposon, en daarmee het
144 Nederlandse samenvatting
spoVA2mob operon, ook in stammen van deze soorten verantwoordelijk is voor hoge hitteresistentie van sporen.
De sporenvormer B. thermoamylovorans is de afgelopen jaren meermaals geassocieerd met bederf van hoog verhitte voedingsmiddelen. In hoofdstuk 5 is aangetoond dat de telling van sporen van B. thermoamylovorans een grove onderschatting (95%) geeft vanwege de slechte ontkieming van de sporen. Goede ontkieming werd bereikt door resulteerde in een sterk verbeterde schatting van de hitteresistentie van de sporen van toevoeging van DPA, een verbinding die de afbraak van de sporencortex activeert. Dit B. thermoamylovorans.
Samenvattend is in dit proefschrift inzicht verkregen in factoren die de hitteresistentie van sporen bepalen. Allereerst hebben we aangetoond dat de aan- of afwezigheid van het spoVA2mob operon op een mobiel genetisch element, het Tn1546 transposon, verantwoordelijk is voor de grote verschillen in hitteresistentie van sporen van B. subtilis, B. amyloliquefaciens, en B. licheniformis. Ten tweede is voor B. thermoamylovorans aangetoond dat er een grote onderschatting plaatsvindt van de hitteresistentie van de sporen, doordat deze slecht ontkiemen ondanks de aanwezigheid van nutriënten.
De resultaten uit dit proefschrift bieden inzichten die een belangrijke bijdrage leveren aan verbeterde beheersing van hoog-hitteresistente sporen in de voedingsindustrie. spoVA2mob operon bezitten en aan het ontwikkelen van een verbeterde methode om onderschatting Specifiek kan gedacht worden aan het detecteren van sporenvormers die het van hitteresistentie van sporen te voorkomen.
145 Addenda
146 About the author
About the author Erwin Berendsen was born on July 5th, 1986 in Kampen, the Netherlands. In 2004 he graduated his pre-university education (VWO, Almere College in Kampen) and started studying biology at the University of Groningen, the Netherlands. In 2007 he obtained his BSc degree, with a specialization in molecular biology and biotechnology. During his MSc education in molecular biology, he studied folded protein secretion in Bacillus subtilis at the University of Groningen and studied the production of polyunsaturated fatty acid in marine algae at Newcastle University, United Kingdom. In 2010 he obtained his MSc degree. After graduating, he started a PhD project working on the heat resistance of bacterial spores. This work was carried out within the Top Institute Food and Nutrition, as part of the food safety and preservation theme, and was supervised by Prof. Dr. Oscar Kuipers and Dr. Marjon Wells-Bennik. During this work he studied the variation in heat resistance of spores between different strains of Bacillus spp. Furthermore, the were proven to be responsible for high-level heat resistance of spores. The results of underlying genetic factors for high-level heat resistance of spores were identified and this work are described in this thesis, are published in scientific journals and were presented at several scientific conferences. Since January 2016, Erwin is working as a scientist in the field of microbiology at TNO.
147 Addenda
List of publications
Articles Berendsen EM, Zwietering MH, Kuipers OP, Wells-Bennik MHJ (2015). Two distinct groups within the Bacillus subtilis resistance properties. Food Microbiology 45, Part A:18-25. group display significantly different spore heat Berendsen EM, Krawczyk AO, Klaus V, de Jong A, Boekhorst J, Eijlander RT, Kuipers OP, Wells-Bennik MHJ (2015). Spores of Bacillus thermoamylovorans with very high heat resistances germinate poorly in rich media despite the presence of ger clusters,
Microbiology 81(22):7791-801 but efficiently upon non-nutrient Ca-DPA exposure. Applied and Environmental Wells-Bennik MHJ, Eijlander RT, den Besten HMW, Berendsen EM, Warda AK, Krawczyk AO, Nierop Groot MN, Xiao Y, Zwietering MH, Kuipers OP, Abee T (2016). Bacterial Spores in Food: Survival, Emergence, and Outgrowth. Annual Review of Food Science and Technology 7:457-482.
Berendsen EM, Boekhorst J, Kuipers OP, Wells-Bennik MHJ (Accepted). A mobile genetic element profoundly increases heat resistance of bacterial spores. ISME J.
Krawczyk AO, Berendsen EM, de Jong A, Boekhorst J, Wells-Bennik MHJ, Kuipers OP, Eijlander RT Bacillus subtilis negatively affects nutrient- and dodecylamine-induced spore germination. (Submitted). A transposon present in specific strains of Environmental Microbiology.
Eijlander RT, Kolbusz MA, Berendsen EM, Kuipers OP (2009). Effects of altered TatC
Bacillus subtilis. Microbiology 155:1776-1785. proteins on protein secretion efficiency via the twin-arginine translocation pathway of den Besten HMW, Berendsen EM, Wells-Bennik MHJ, Straatsma H, Zwietering MH (Manuscript in preparation). Two complementary approaches to quantify variability in heat resistance of spores of Bacillus subtilis.
Berendsen EM, Koning RA, Boekhorst J, de Jong A, Kuipers OP, Wells-Bennik MHJ (Manuscript in preparation). High-level heat resistance of spores of B. amyloliquefaciens and B. licheniformis results from the presence of a spoVA operon in a Tn1546 transposon.
148 List of publications
Genome announcements Berendsen EM, Wells-Bennik MHJ, Krawczyk AO, de Jong A, Holsappel S, Eijlander RT, Kuipers OP (2016). Draft genome sequences of ten Bacillus subtilis strains that form spores with a high or low heat-resistance. Genome Announcements 4.
Berendsen EM, Wells-Bennik MHJ, Krawczyk AO, de Jong A, Van Heel AJ, Holsappel S, Eijlander RT, Kuipers OP (Accepted). Draft genome sequences of seven thermophilic sporeforming bacteria isolated from foods that produce highly heat resistant spores, comprising Geobacillus spp., Caldibacillus debilis and Anoxybacillus flavithermus. Genome Announcements. de Jong A, van Heel AJ, Montalban-Lopez M, Krawczyk AO, Berendsen EM, Wells-Bennik M, Kuipers OP (2015). Draft Genome Sequences of Five Spore-Forming Food Isolates of Bacillus pumilus. Genome Announcements 3.
Krawczyk AO, de Jong A, Eijlander RT, Berendsen EM, Holsappel S, Wells-Bennik MHJ,
Bacillus cereus, isolated from food. Genome Announcements 3. Kuipers OP (2015). Next generation whole genome sequencing of eight strains of Krawczyk AO, de Jong A, Holsappel S, Eijlander RT, Van Heel AJ, Berendsen EM, Wells- Bennik MHJ, Kuipers OP (Accepted). Genome sequences of twelve sporeforming Bacillus species, comprising Bacillus coagulans, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus sporothermodurans, and Bacillus vallismortis, isolated from foods. Genome Announcements.
Patent Berendsen EM, Wells-Bennik MHJ, Kuipers OP. 2015. Heat resistant microorganisms. WO2015126251 A1
149 Addenda
Acknowledgements There are many people I would like to thank that helped me one way or another during
Firstthe last of allfive I wouldyears completinglike to thank this my PhD copromotor work. Marjon. We had a great journey together Bacillus
exploring the fascinating world of spores. I learned a lot from your scientific attitude and your improvements on my scientific writing. Our collaboration was highly Secondly,enjoyable throughoutI would like the to project thank withmy somepromotor nice “high-five”Oscar. You momentshad a very in there. inspirational
never-ending stream of new ideas. They greatly contributed to the work described in involvement in this project and I highly appreciate your scientific enthusiasm and this thesis.
Everyone from the TIFN Food Safety and Preservation theme, thank you for the inspirational sessions and good times we had together. My fellow PhD students, it is
the PhD trip to Japan. Marcel, thank you for your contribution to the modelling paper. always nice to share experiences among each other and we had a great time during I was happy to be part of the spores team together with Robyn, Xiao, Tonia, Alicja, Jos, Anne, Masja, Marjon, Tjakko and Oscar. A special thanks to Jos and Anne for the many bioinformatical aspects that you guys handled. Where would a modern molecular biologist be without people like you? Jos, we collaborated closely during this project and I highly appreciate your input. Your contributions really helped to make most of the genomics data, and together we added biological sense to that data. Tonia, we happened to collaborate a lot during the project, and I really enjoyed that process. I wish you all
NIZOthe best was in my finishing daily working your thesis. location and I would like to thank all my colleagues there. A few I would like to mention in particular. Henk and Jacqueline, we had good fun together and thank you for the preparation of bacteriological media for all my plating
Annereinou, I-Chiao, Mariya, Kristian, Matthew, Simon and Joyce. A special thanks to experiments. A big thanks to all the NIZO PhD students Oylum, Onur, Xiao, Ellen, Sven, Xiao. Thank you for introducing me in the world of food microbiology. We shared a lot of thoughts about aerobic and anaerobic spore formers and spores. Arjen and Jan thank you for the good times we shared in the lab. Everyone needs to travel to their working location and that became more fun thanks to the carpoolers Sabina, Joyce, Robyn and Jos. Esther and Patrick thank you for your involvement in the project with a lot of plating of heat treated spores. Patrick and Anne, thank you for sharing both our coffee breaks and our sense of humor. Patrick, I am proud and happy that you are my paranymph during my PhD defence.
150 Acknowledgements
To all of the students that collaborated in my project, I would like to say that I learned a lot from you and hope that you also had the pleasure of learning during your time at NIZO. Adriana, Esmée, Verena, Rosella and Marc, thanks for your efforts. Rosella and Verena, your contributions can be found as co-authors on chapters 4 and 5, respectively.
Friends, where is a man without friends. Thank you to my friends who supported me throughout this period. Thank you for those friends with whom I share my sporty hobbies in the form of gymnastics or running. As some will agree, there is nothing better than making some giant swings on the high bar after a hard day of work. A special thanks to Douwe. We studied biology together, and stayed in close contact thereafter. during my PhD defence. We definitely share a good sense of humor and thank you for being my paranymph Uiteraard wil ik ook graag mijn ouders bedanken. Mama, jij bent altijd een inspiratie voor me geweest. Jouw positieve levenshouding geeft mij zoveel energie, en als het tegenzat en ik daaraan dacht, was alles weer makkelijk te relativeren en kon ik met hernieuwde inspiratie weer verder. Willy, bedankt! Jij als drukke enthousiaste man krijgt altijd alles toch maar mooi voor elkaar. Ik heb diep respect voor je en hoop dat je nog lang mag blijven hardlopen. Al begreep je lang niet altijd wat ik precies deed, vind ik het toch fijn dat je altijd klaarstond om te luisteren en te overleggen met me.
And finally, the most important person to thank. Eirlys, that is you of course. My gratitude that we will continue having a great time together. for you cannot be expressed in words. Thank you for your support, love, and care. I hope
151