Diabetes Page 2 of 76

1

Impaired mitochondrial biogenesis in adipose tissue in acquired obesity Running title: Impaired mitochondrial function in obesity

Sini Heinonen1#, Jana Buzkova2#, Maheswary Muniandy1, Risto Kaksonen1,3, Miina Ollikainen4, Khadeeja Ismail4,Antti Hakkarainen5, Jesse Lundbom5,6, Nina Lundbom5, Katriina Vuolteenaho7, Eeva Moilanen7, Jaakko Kaprio8,9,10, Aila Rissanen1,11, Anu Suomalainen2,12, Kirsi H. Pietiläinen1,8,13

1Obesity Research Unit, Research Programs Unit, Diabetes and Obesity, University of Helsinki, Helsinki, Finland 00014, 2Research Programs Unit, Molecular Neurology, BiomedicumHelsinki, University of Helsinki, Helsinki, Finland 00290, 3Siluetti Hospital, Helsinki, Finland, 4Department of Public Health, University of Helsinki, Helsinki, Finland 00014,5Helsinki Medical Imaging Center, University of Helsinki, Helsinki, Finland 00014, 6Institute for Clinical Diabetology, German Diabetes Center, Leibniz Center for Diabetes Research, Heinrich Heine University, Düsseldorf, Germany, 7The Immunopharmacology Research Group, University of Tampere School of Medicine and Tampere University Hospital, Tampere, Finland 33520, 8FIMM, Institute for Molecular Medicine, University of Helsinki, Helsinki, Finland 00014, 9Finnish Twin Cohort Study, Department of Public Health, Hjelt Institute, University of Helsinki, Helsinki Finland 00014, 10National Institute for Health and Welfare, Department of Mental Health and Substance Abuse Services, Helsinki, Finland 00271, 11Department of Psychiatry and 12Neurology, , Helsinki University Central Hospital, Helsinki, Finland, 13Abdominal Center, Endocrinology, Helsinki University Central Hospital and University of Helsinki, Helsinki, Finland 00290. #Shared first authorship

Corresponding author: Kirsi H. Pietiläinen, MD, PhD Obesity Research Unit, Biomedicum Helsinki, C424b Po Box 700 00029 Helsinki University Central Hospital Phone: +358 9 47171876, Fax: +358 50 5992295, Email: [email protected]

Word count: 4415 Tables and figures: 8

Diabetes Publish Ahead of Print, published online May 13, 2015 Page 3 of 76 Diabetes

2

Abstract

Low mitochondrial number and activity have been suggested as underlying factors in obesity, type

2 diabetes, and metabolic syndrome. However, the stage at which mitochondrial dysfunction

manifests in adipose tissue after the onset of obesity remains unknown. Here we examined

subcutaneous adipose tissue (SAT) samples from healthy monozygotic twin pairs, aged 22.8 – 36.2

years, who were discordant (BMI >3 kg/m2, mean length of discordance 6.3 ± 0.3 years, n = 26)

and concordant (BMI <3 kg/m2, n = 14) for body weight and assessed their detailed mitochondrial

metabolic characteristics: mitochondrialrelated transcriptomes with dysregulated pathways,

mitochondrial DNA (mtDNA) amount, mtDNAencoded transcripts, and mitochondrial oxidative

phosphorylation (OXPHOS) protein levels. We report global expressional downregulation of

mitochondrial oxidative pathways, with concomitant downregulation of mtDNA amount, mtDNA

dependent translation system, and protein levels of the OXPHOS machinery in the obese compared

with the lean cotwins. Pathway analysis indicated downshifting of fatty acid oxidation, ketone

body production and breakdown, and the tricarboxylic acid cycle, which inversely correlated with

adiposity, insulin resistance, and inflammatory cytokines. Our results suggest that mitochondrial

biogenesis, oxidative metabolic pathways and OXPHOS proteins in SAT are downregulated in

acquired obesity, and associated with metabolic disturbances already at the preclinical stage.

Diabetes Page 4 of 76

3

Adipocytes are important contributors to energy balance and metabolic homeostasis. Within these highly dynamic cells, mitochondria are at the center of energy metabolism, using carbohydrates, lipids, and proteins to produce ATP and metabolites for growth, as well as contributing to adipocyte differentiation and maturation (1). Mitochondria possess their own multicopy genome, a 16.6 kb circular mitochondrial DNA (mtDNA) that encodes two ribosomal RNAs (12S and 16S), 22 transfer RNAs, and 13 polypeptides (2). These proteins are the core catalytic components of electron transport chain complexes I, III and IV, and ATP synthase (3). Together, these complexes form the oxidative phosphorylation system (OXPHOS) in the inner mitochondrial membrane.

MtDNAencoded proteins are translated on mitochondrial ribosomes that, together with OXPHOS complexes, are the only cellular entities encoded by both nuclear and mitochondrial genomes.

However, about 1500 other nuclearencoded proteins—8% of all nuclear genes—encode mitochondrial targeted proteins, emphasizing the central role of mitochondria in cellular metabolism (4).

Evidence from various study systems suggests that mitochondrial function and biogenesis is compromised in subcutaneous adipose tissue (SAT) in type 2 diabetes (5), morbid obesity (6), and insulin resistance (7). Recently, a reduction of total oxygen consumption rates, but not mtDNA content, was shown to occur in visceral and subcutaneous adipocytes of obese adults (8), as well as after betaadrenergic stimulation (9), suggesting a decrease in mitochondrial oxidative activity. We have previously shown in SAT of monozygotic (MZ) weightdiscordant twin pairs that mtDNA depletion, together with downregulation of mitochondrial branchedchain amino acid (BCAA) catabolism characterizes obesity, insulin resistance, fatty liver (10), and poor fitness (11). However, we still lack a thorough understanding of how mitochondrial biogenesis and function in human adipose tissue changes in obesity, at which stage this process begins, and whether it contributes to the early development of metabolic disturbances. Moreover, it is not known whether the possible Page 5 of 76 Diabetes

4

link between mitochondrial dysfunction and obesityrelated metabolic disorders is genetic or

acquired.

MZ twins discordant for obesity are, despite their different phenotype, completely matched for

genetic variants, age and sex. This allows research of acquired obesity without interference of

genetic and familial factors that confound studies comparing groups of unrelated lean and obese

individuals. Here, we focus on rare weightdiscordant, healthy young adult MZ twins to investigate

in detail the mitochondrial pathways in SAT and their association with whole body metabolism in

acquired obesity.

Research Design and Methods

Subjects

The present study included 26 rare, healthy MZ pairs discordant for obesity (withinpair difference,

BMI ≥3 kg/m2, males n = 9, females n = 17, aged 29.9 ± 0.6 years), identified from two

populationbased twin cohorts, FinnTwin16 (n = 2839 pairs) and FinnTwin12 (n = 2578 pairs) (12).

In addition, 14 MZ twin pairs concordant for BMI (BMI <3 kg/m2, males n = 9, females n = 5,

aged 31.6 ± 0.6 years) were included as control pairs and to provide a wider range of BMI values

for transcriptomics analyses. A detailed description of the twin material has been published

previously (13, 14). Written informed consent was obtained from all participants. The study was

approved by the Ethical Committee of the Helsinki University Central Hospital.

Clinical assessments

Weight and height were measured for the calculation of body mass index (BMI). Body composition

was determined by dualenergy Xray absorptiometry (Lunar Prodigy, Madison, WI, software

version 8.8) (15), the amount of SAT and visceral adipose tissue (VAT) by magnetic resonance

imaging (MRI) and liver fat by proton magnetic resonance spectroscopy with a 1.5 Tesla MRI

imager (Avanto, Siemens, Erlangen Germany) (13). Physical activity was assessed by Baecke Diabetes Page 6 of 76

5 questionnaire and its’ three subcompartments (sport, leisure time and work indexes). Parental weight, height and age were asked at the twin age of 16.

Analytical measurements

The concentrations of fasting plasma glucose, leptin, adiponectin, adipsin and serum high sensitivity Creactive protein (hsCRP) were measured, and homeostatic model assessment

(HOMA)insulin resistance and Matsuda insulin sensitivity indexes were calculated, as previously described (16).

SAT specimens and analyses

Surgical biopsy samples of abdominal SAT under the umbilicus were obtained under local anesthesia and snap frozen in liquid nitrogen. Based on the availability of sample material, the frozen SAT specimens were used for transcriptomics analyses (all 26 discordant and 14 concordant twin pairs), determination of the mtDNA amount, mtDNAencoded transcript levels (15 discordant twin pairs) and an OXPHOS protein analysis (seven discordant twin pairs). Twentyfour discordant and 11 concordant twin pairs were available for DNA methylation analyses. Clinical characteristics of the selected and unselected twin pairs were similar. Part of the fresh SAT sample was digested with collagenase and used for measurement and calculation of adipocyte volume and number in all

26 discordant and 14 concordant twin pairs (16). The discordant twin pairs were divided into two groups with regard to hyperplastic and hypertrophic obesity (16).

Transcriptomics and pathway analyses

Total RNA was extracted from SAT by RNeasy Lipid Tissue Mini Kit (Qiagen) and treated with

DNase I (Qiagen). Transcriptomics analyses were performed by using Affymetrix U133 Plus 2.0 array and validated as in (14). Preprocessing of the expression data was done using BioConductor and the GCRMA algorithm. We first analyzed the differentially expressed transcripts genomewide Page 7 of 76 Diabetes

6

between the obese and the lean cotwins in the discordant pairs by paired moderated ttests (17),

and then looked whether they were found in MitoCarta (4), an online atlas of 1013 human proteins

with mitochondrial localization. Fortynine of the 1013 Mitocarta protein transcripts were not

detectable by Affymetrix probes, including the 13 mtDNAencoded OXPHOS transcripts. Identified

mitochondrialrelated transcripts were further subjected to QIAGEN´s Ingenuity® Pathway

Analysis (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity) to reveal the pathways and

the upstream regulators of the transcripts. Top 10 significant pathways were selected for further

examination and for calculation of overall pathway activity (the mean centroid, Table 3) (10). In

addition, the mean centroids were calculated for the expression of the small (MRPS, n = 30

subunits) and large (MRPL, n = 50 subunits) mitochondrial ribosomal proteins, (Supplementary

data S4).

DNA methylation values of all probes mapping to the differentially expressed MitoCarta genes and

PGC1α were picked from the Illumina HumanMethylation BeadChip. Differential methylation

analysis of the CpG sites on these genes was performed by using paired moderated ttests (18) in

the discordant pairs, and relationships between methylation in significant CpG sites and the

expression of their associated genes by Spearman correlations in the individual twins.

DNA extraction and analysis of mtDNA amount

The amount of mtDNA, extracted by standard phenol/chloroform and ethanol precipitation method,

was determined by quantitative realtime PCR (qPCR) of mitochondrial cytochrome B (CYTB) gene

normalized to the nuclear amyloid beta precursor protein (APP) gene (10). The qPCR was

performed with 25 ng of total DNA using SYBR Green PCR Master Mix (iQ Custom SYBR Green

Supermix, BioRad, USA) according to the manufacturer´s instructions. The qPCR data were

analyzed by the comparative “delta delta Ct method” ( Ct) with BioRad CFX Manager v.1.6

software. The primer sequences are available in Table S1. Diabetes Page 8 of 76

7

Reverse transcription PCR and qPCR for the measurement of mtDNAencoded transcripts and the upstream regulator PGC1α

Total extracted RNA (250 ng) was used to generate cDNA with the Maxima synthesis kit (Maxima

First Strand cDNA synthesis kit for RTqPCR, Thermo Scientific) according to the manufacturer’s instructions. Expression levels of mtDNAencoded 12S rRNA (MTRNR1), 16S rRNA (MTRNR2), and mRNAs (MTCOX1, MTND5, and MTCYTB), normalized with nuclear 18S rRNA, were analyzed in 1/100 cDNA dilutions by qRTPCR with iQ RealTime PCR Detection System (Bio

Rad) and the comparative Ct method.

The expression of the upstream regulator PGC1α was validated in 1/30 dilution with 18S rRNA as a housekeeping gene. The PGC1alpha probes were targeted to 3´UTR region of the longest mRNA isoform (ENSG00000109819) that is not shared with other protein coding PGC1α isoforms. The primer sequences are available in Table S1.

Quantitative Western Blot analysis for OXPHOS protein levels

SAT lysates were obtained by homogenization in icecold 1% ndodecyl βDmaltoside (DDM) in

PBS with protease inhibitors (Roche). Quantitative Western blot analysis was performed of 20 µg of total SAT lysates for measurement of OXPHOS protein levels: complex I NDUFA9 (MS111), complex II 70 kDa subunit (MS204), complex III core 2 subunit (MS304), complex IV subunit I

(MS404), and complex V subunit α (MS507), as well as PORIN (Abcam), βTUBULIN (Cell

Signaling) and ACTIN (Santa Cruz Biotechnology). Antibodies were diluted in 1% BSA/Tris buffered saline and 0.1% Tween 20 (TBST) at 1:2000 (CI), 1:5000 (CII), 1:2500 (CIII), 1:500

(CIV), and 1:1000 (PORIN, TUBULIN) and incubated at 4°C overnight. Secondary HRP conjugated antimouse or antirabbit antibodies (1:10 000, Molecular Probes) were incubated with the membranes in 5% milk/TBST. The proteins were quantified with Image Lab v3.0 software. Page 9 of 76 Diabetes

8

Statistical analyses

Statistical analyses were performed by using Stata statistical software (Release 12.0, Stata

Corporation, College Station, TX). Differences between cotwins were calculated by paired

Wilcoxon’s signed rank tests. Correlations between mitochondrial and metabolic variables in all

concordant and discordant twin individuals were calculated by using Pearson correlations, corrected

for clustered sampling of cotwins by survey methods (19) and adjusted for multiple comparisons

by the number of principal components. The variables in Table 5 produced one principal

component, which explained 88% of the variance. Therefore, the adjusted significance level for

analyses in Table 5 was P < 0.05 divided by 1, that is, P < 0.05. Logarithmic corrections were used

were used for nonnormally distributed variables.

Results

Characteristics of the twins are presented in Table 1. The obese (BMI 31.2 ± 1.0 kg/m2) and the

lean (25.3 ± 0.9 kg/m2) cotwins of the discordant pairs (n = 26) had a mean difference of 18 ± 0.5

kg (P <0.001) in body weight. The obese cotwins had significantly more SAT, VAT, and liver fat;

larger adipocytes; higher plasma leptin levels; lower plasma adiponectin levels; and were more

insulin resistant than the lean cotwins. The concordant cotwins (n = 14) had similar body

composition and metabolic measures (Table 1). As no differences in mitochondrial measures were

found within the concordant pairs, results are presented only for the discordant pairs.

Downregulation of mitochondrialrelated transcripts in the obese cotwins’ SAT

We first investigated the withinpair differences in the expression of mitochondrial proteins in SAT

(n = 26) by linking the results from the transcriptomics data with those of MitoCarta. Among the

2108 significantly differentially expressed genes 222 genes were listed in MitoCarta

(Supplementary data S1). Most of these transcripts (187 of 222, 84%) were downregulated in the Diabetes Page 10 of 76

9 obese compared with the lean cotwins´ SAT. The top significantly up and downregulated genes are shown in Table 2.

Downregulation of key mitochondrial pathways in the obese cotwins’ SAT

To investigate which functional entities the 222 mitochondrial transcripts represented, we subjected the transcripts to IPA (Ingenuity Pathway Analysis). Among the most significantly different and downregulated pathways in the obese compared to the lean cotwins were the key mitochondrial functions: OXPHOS (P <0.0001), BCAA degradation (P <0.0001), ketogenesis/ketolysis (P

<0.0001), the tricarboxylic acid cycle (TCA, P <0.0001), glutarylCoA degradation (P <0.0001), and fatty acid βoxidation (FAO, P <0.0001; Table 3, Supplementary data S2).

Next we analyzed whether the most significant pathways were associated with obesityrelated pathology by correlating the mean centroids of the pathways to measures of adiposity (SAT, VAT and liver fat, adipocyte volume), insulin sensitivity (Matsuda index), insulin resistance (HOMA index), inflammation (adipsin, hsCRP), leptin and adiponectin. After multiple testing, the mean centroid values of OXPHOS and TCA cycle pathways correlated with SAT, VAT, liver fat, adipocyte volume, Matsuda and HOMA indexes, adipsin and hsCRP (Table 4). The TCA cycle also correlated with adiponectin. GlutarylCoA degradation, ketogenesis, and tryptophan degradation pathways correlated with all of the selected clinical variables except adiponectin.

BCAA degradation (valine, isoleucine, and leucine degradation pathways), FAO, and ketolysis correlated with all clinical variables.

Upstream Regulator analysis

We performed IPA Upstream Regulator analysis to identify the transcriptional regulators that can explain the observed gene expression changes and pathways between the cotwins (n = 26) (20).

We identified Forkhead Box protein O1 (FOXO1, P <0.0001), peroxisomeproliferatoractivated receptor gamma coactivator alpha (PGC1α) (PPARGC1A, P <0.0001) and beta (PGC1β) Page 11 of 76 Diabetes

10

(PPARGC1B, P <0.0001), and lysine methyltransferase 2D (KMT2D, P = 0.027; Table 5,

Supplementary data S3) as the most significant upstream transcription factors regulating the 222

transcripts. Based on the predicted Zscores calculated in IPA, the biological activation state of all

of these genes was lower in the obese compared with the lean cotwins. In our transcriptomics data,

the expression level of PGC1α was highly downregulated in the obese cotwins (lean 51.6 ± 5.1

AU vs. obese 34.1 ± 4.9 AU; arbitrary Affymetrix units, adjusted P <0.001). The reduction of

PGC1α expression was verified with qRTPCR (P = 0.004, Fig. 1). The expression of other

upstream regulators was not different between the cotwins, but the expression levels of their target

genes were reduced, suggesting posttranscriptional regulation (Table 5).

Differential methylation of the mitochondriarelated transcripts and upstream regulators in

the obese cotwins’ SAT

Next, we investigated whether any of the 222 differentially expressed genes were also differentially

methylated within the twin pairs thus providing a potential molecular mechanism underlying the

expression differences. Altogether 130 CpG sites within 74 genes showed differential methylation

(P <0.05) within the discordant pairs (n = 24, Supplementary data S5). Most of these sites (96/130,

74%) were hypermethylated in the obese compared with the lean cotwins. When investigating the

CpG sites in relation to CpG density, 89% (116/130) were outside any CpG islands. Approximately

half (68/130, 52%) of the differentially methylated CpG sites were located in the gene bodies and

42% (55/130) in promoters. There was no difference between the promoter and gene body

associated CpG sites in regards to their methylation status (hyper vs. hypomethylation). We then

explored whether there are any significant associations between the differentially expressed and

methylated genes. Of the 74 genes, 40 showed significant correlation between expression and

methylation (r = 0.24 to 0.70 and 0.25 to 0.44, P <0.05, Supplementary data S6). There was in Diabetes Page 12 of 76

11 general an inverse relationship between expression and DNA methylation and only 12 genes showed positive correlations.

Furthermore, we explored whether the methylation levels differed between the cotwins for PGC1α gene, the only upstream regulator that was differentially expressed between the cotwins. We found hypermethylation in the obese cotwins in two CpG sites within the gene body of PGC1α, but no differences in other regions of the gene (Supplementary data S5). Methylation in one of the CpG sites correlated significantly with PGC1α expression (r = 0.31, P = 0.01, Supplementary data S6).

Reduction of mtDNA amount, mtDNAencoded transcripts, and MRP transcripts in the obese cotwins’ SAT

To further investigate the effect of obesity on mitochondrial amount and biogenesis in SAT, we measured the amount of mtDNA and the expression of mtDNAencoded genes (12S rRNA, 16S rRNA, COX1, ND5, and CYTB, n = 15 discordant pairs). The mtDNA amount was reduced by

~20% (P = 0.031, Fig. 2A) in SAT of the obese compared with the lean cotwins. Significant negative correlations were observed between the mtDNA amount and HOMA (insulin resistance) and adipsin (inflammation) (Table 4).

Furthermore, mitochondrial 12S (MTRNR1, P = 0.0064) and 16S (MTRNR2, P = 0.0090) rRNAs, as well as mRNAs COX1 (P = 0.0064, CIV subunit), ND5 (P = 0.027, CI subunit), and CYTB (P =

0.0015, CIII subunit, Fig. 2B), were decreased in SAT of the obese cotwins compared with their lean counterparts. We also studied the expression of 30 nuclear transcripts for the small subunit

(MRPS) and 50 nuclear transcripts for the large subunit (MRPL) of the mitochondrial ribosome using the Affymetrix data (n = 26 discordant pairs). In line with 12S and 16S rRNA expression, the average value of the total expression (a mean centroid) of both MRPS (lean 0.03 ± 0.09 AU vs. obese 0.31 ± 0.1 AU, P <0.001) and MRPL (lean 0.04 ± 0.1 AU vs. obese 0.26 ± 0.1 AU, P =

0.0034) was lower in the obese compared with the lean cotwins (Fig.2C). Page 13 of 76 Diabetes

12

Reduction of mitochondrial mass and OXPHOS proteins in the obese twins’ SAT

Finally, we measured mitochondrial content and the level of OXPHOS protein subunits in SAT

lysates of seven discordant pairs by Western blot. Mitochondrial mass per cell (porin, a

mitochondrial outer membrane protein compared with a cytoskeletal protein βtubulin), trended

downwards in the obese cotwins (P = 0.09, Fig. 2DE). Mitochondrial OXPHOS protein subunits

of CIII, CIV and CV were reduced in obesity: the level of CIIIcore 2 (CIII subunit, P = 0.018),

MTCO1 (CIV subunit, P = 0.018) and CVα (CV subunit, P = 0.028), compared with the levels of

βtubulin, were all lower in the obese than in the lean cotwins (Fig. 2E). As the different complex

subunits typically follow the amounts of full holocomplexes, these results support deficiency of

CIII, CIV, and CV. Fully nuclearencoded CII did not differ between the cotwins. Furthermore, we

analyzed whether the OXPHOS levels were reduced per mitochondria in obesity. Thus, we

normalized the OXPHOS protein signals against the mitochondrial protein porin. The amount of CI

(P = 0.063) trended downwards, and complexes CIII (P = 0.018) and CIV (P = 0.028) were reduced

in the obese cotwins (Fig. 2E). Overall, the protein results suggest a trend of lower mitochondrial

mass (porin), and a decrease of OXPHOS levels per cell and per mitochondria as a downstream

effect of the reduced mtDNA amount.

Hyperplastic versus hypertrophic obesity

Because the mitochondrial pathways had significant negative correlations with adipocyte volume (P

<0.01, Table 4), we analyzed whether the mitochondrial measures differed in discordant pairs with

hyperplastic vs. hypertrophic pattern of adipocyte morphology. In the discordant pairs where the

obese cotwins had a solely hypertrophic pattern (larger and less adipocytes than their cotwins), the

obese cotwins had significantly reduced mtDNA amount compared with their lean cotwins (lean

1.05 ± 0.7 vs. obese 0.82 ± 0.07, P = 0.028) but no other differences in the mitochondrial measures

were found between the two groups. Diabetes Page 14 of 76

13

Sex, onset of obesitydiscordance, family history and lifestyle factors in the discordant pairs

The withinpair differences in all measures of adiposity and metabolism (Table 1), as well as those in mitochondrial measures were similar in males and females. The onset of obesitydiscordance was

22.6 ± 0.6 years. Consequently, the length of obesitydiscordance was on average 6.3 ± 0.3 years.

Of the total 44 parents of the discordant pairs, for whom data was available, 15.9% were obese

(4/23 of the mothers and 3/21 of the fathers), including one twin pair where both parents were obese. The parents were examined when the twins were 16 years of age. The age of the mothers was

42.2 ± 0.7 years and the fathers 45.4 ± 0.8 years. The total as well as sport, leisure time and work physical activity levels of the obese and the lean cotwins were similar (Table 1) and did not correlate with mitochondrial measures.

Discussion

We performed a comprehensive set of experiments to test a hypothesis that mitochondrial biogenesis is downregulated in human SAT in obesity. We used a unique study design: rare MZ weightdiscordant twin pairs, which enabled us to control for sex, age, and genetic background between the lean and the obese groups — a major advantage for conclusions regarding a multifactorial trait such as obesity. We demonstrate a widespread reduction in the expression of both mitochondrial and nuclearencoded mitochondrial genes leading to downregulation of mitochondrial biogenesis in SAT of the obese twins compared with their leaner cotwins. Many of the differentially expressed transcripts were also differentially methylated within the twin pairs.

Reduction of the mitochondrial oxidative metabolism in SAT correlated with whole body insulin resistance and inflammation. Our findings provide evidence of a substantial insufficiency of mitochondrial biogenesis in SAT in acquired obesity already prior to the onset of clinical metabolic complications.

The OXPHOS system is unique because it is encoded by both the nuclear and the mitochondrial genome. We showed that mtDNA, its transcripts, OXPHOS subunits as well as nuclear genes Page 15 of 76 Diabetes

14

encoding OXPHOS proteins are reduced in the obese cotwins suggesting a major downregulation

in mitochondrial oxidative ATP production and catabolic functions in SAT in acquired obesity.

Similar reduction of mtDNA in SAT in obesity has been found in previous studies by us and by

others (10) (21), but the generalized downregulation of mitochondrial proteins and metabolism has

not been reported previously. After mtDNA transcription, mitochondria translate their mRNAs on

mitochondrial ribosomes that comprise two mtDNAencoded rRNAs and more than 80 nuclear

encoded proteins (22). We report an extensive reduction in the transcript levels of rRNAs and

MRPs, emphasizing the downregulation of the translation machinery both the nuclear and

mitochondrial expression systems. These findings are in agreement with previous findings in two

mouse models of obesity and type 2 diabetes, which showed a low abundance of MRP transcripts

and mitochondrial biogenesis in inguinal adipose tissue (23), as well as in a rat model for lateonset

obesity, in which a truncation of MRP S26 was associated with the accumulation of visceral fat and

insulin sensitivity (24). Finally, the OXPHOS complexes partially encoded by mtDNA, were

downregulated without significant decrease of mitochondrial mass (porin/tubulin), showing that the

mitochondrial OXPHOS level within the cell and within the mitochondria is reduced in SAT of the

obese cotwins.

Pathway analysis of nuclearencoded mitochondrial transcripts revealed changes in mitochondrial

oxidative pathways, including FAO, TCA cycle, ketogenesis, ketolysis, and BCAA degradation

pathways in the obese cotwins. We found that a downregulation in oxidative metabolic pathways

in SAT inversely correlated with several clinical parameters. Mitochondrial pathways correlated

negatively with all adiposity measures, insulin resistance, and inflammation, and positively with

adiponectin levels. We also observed that the larger the adipocyte volume, the more severe was the

decrease in mitochondrial oxidative metabolic pathways. Recently, it has been proposed that

decrease in mitochondrial oxidative metabolism measured by oxygen consumption rate in isolated

adipocytes is caused by obesity rather than the adipocyte size (8). Our study design controls for Diabetes Page 16 of 76

15 genetic factors between the obese and the lean groups, and suggests that the hypertrophic but not the hyperplastic pattern of obesity relates to decreased mtDNA amount. Thus, our findings are in line with previous studies reporting associations between hypertrophy and metabolic abnormalities

(16, 2527).

Although mitochondrial function and the development of type 2 diabetes are suggested to be linked

(28), previous studies on mitochondrial biogenesis in relation to insulin sensitivity in adipocytes and adipose tissue in human subjects are surprisingly few. In one study, the exposure of 3T3L1 mouse preadipocytes to high glucose and free fatty acids resulted in decreased mitochondrial size and membrane potential and downregulation of PGC1α, indicating mitochondrial dysfunction (29).

In another study, highfat feeding of rats resulted in impaired glucose homeostasis and decreased

PGC1α expression, mtDNA content, and CI and CIV protein levels in epididymal adipose tissue

(30). These studies supported a relationship between abundant glucose or fatty acids, decreased mitochondrial function, and impaired glucose tolerance, whereas studies on mouse adipocytes did not confirm a causal link between reduced mitochondrial biogenesis and impaired wholebody glucose homeostasis (31). Our study, combining molecular analysis of mtDNA metabolism with mitochondrial pathway analyses suggests that impaired mitochondrial biogenesis in SAT in humans is related to insulin resistance and to other mild metabolic alterations already before the clinical diagnosis of type 2 diabetes or other obesityrelated diseases.

PGC1α was the only predicted upstream regulator whose expression was different between the co twins. PGC1α is a transcription coactivator and a master regulator of mitochondrial biogenesis that controls and coordinates the expression of nuclear and mitochondrial genes in white adipocytes

(3235). Low PGC1α expression in SAT has also been found to correlate with increased BMI (21) and to be associated with morbid obesity (6), type 2 diabetes (5), and insulin resistance (7). PGC

1αresponsive OXPHOS genes showed reduced expression in VAT in type 2 diabetes (36). Fat Page 17 of 76 Diabetes

16

specific PGC1α knockout mice displayed a significant reduction in transcripts of OXPHOS, FAO,

and TCA genes in inguinal SAT and developed glucose intolerance and insulin resistance when

challenged with a highfat diet, demonstrating the necessity of oxidative metabolism in fat for

wholebody metabolism (37). FOXO1 was the first predicted upstream regulator of our 222

transcripts. The expression of FOXO1 has been shown to be downregulated in VAT compared to

SAT of obese and nonobese individuals (38) and its protein levels reduced in a dosedependent

manner in 3T3L1 adipocytes treated with free fatty acids as well as in intraperitoneal adipose

tissue of db/db mice (39). We did not find significantly changed FOXO1 transcript levels, but

FOXO1 and also PGC1α are posttranslationally regulated (40, 41), and therefore the transcript

levels do not fully reflect the gene activity. We show that three CpG sites in the body of PGC1α

were hypermethylated in the obese cotwins. This hypermethylation correlated negatively with gene

expression, suggesting that DNA methylation may reduce the transcription of the gene. Previous

studies have reported that compared with the lean controls, obese patients with type 2 diabetes have

a PGC1α promotor hypermethylation in SAT (42). Our data also show that 74 out of the 222

differentially expressed genes targeting mitochondria are differentially methylated between the co

twins, and in general inversely correlated with expression. This poses an interesting possibility that

epigenetic modifications in certain nuclear genes associate with the decrease in mitochondrial

biogenesis in SAT in acquired obesity. In obesitydiscordant MZ twins, such an effect is acquired,

and independent of the genetic background.

Healthy young adult MZ twins discordant for obesity are extremely rare, as they share both genes

and family. We succeeded in finding 26 highly discordant pairs — mainly in their third decade of

life, with relatively recent onset of weightdiscordance — from 10 birth cohorts of Finnish twins.

Because the twins are matched on multiple factors, including genes, our study has increased power

over a study comparing unrelated obese and lean subjects. Our study is crosssectional and therefore

does not allow definitive conclusions about causality. However, genetic variants and shared Diabetes Page 18 of 76

17 exposures/experiences can be excluded as confounders of the observed associations. All analyses in this study were done with whole SAT biopsies that include stromavascular fraction cells, the contribution of which cannot be distinguished from that of the adipocytes.

In summary, we observed strong evidence for association between acquired obesity and downregulation of mitochondrial biogenesis in SAT. Our findings suggest that obesity is related to suppressed mitochondrial oxidative activity in SAT. Importantly, we showed that the downregulation of mitochondrial biogenesis and oxidative metabolic pathways in SAT is a phenomenon in obesity associated with a range of mild metabolic alterations, insulin resistance, and lowgrade inflammation. The genes targeting mitochondria may be epigenetically regulated. These data suggest that obesityrelated disease development may be halted by improving mitochondrial activity in SAT.

Acknowledgments

We thank the twins for their invaluable contributions to the study. We also thank Barbara Every, of

BioMedical Editor, for English language editing and Eija Pirinen for her valuable comments.

Funding

The study was supported by Helsinki University Hospital Research Funds and grants from the Novo

Nordisk Foundation, Diabetes Research Foundation, Jalmari and Rauha Ahokas Foundation,

Finnish Foundation for Cardiovascular Research (for K.H.P.), Academy of Finland (for A.S., grants

265240, 263278 for J.K., 272376 and 266286 for K.H.P.), Orion Foundation (for S.H.), University of Helsinki, European Research Council, and Sigrid Jusélius Foundation (for A.S.).

Duality of Interest

No potential conflicts of interest relevant to this article.

Author Contributions Page 19 of 76 Diabetes

18

S.H. and J.B. performed and designed the research, analyzed the data, and wrote the manuscript.

K.H.P. and A.S. designed the research, supervised the work, and participated in revision and

discussion of the results. K.H.P. and S.H. collected the data. M.M. performed the transcriptomics

data analysis. K.I. performed and M.O. wrote the epigenetic analyses. A.H, J.L., and N.L.

participated in the imaging of the twins. E.M. and K.V. participated in analyzing adiponectin and

leptin. A.R., J.K., and R.K. participated in the revision of the work. K.H.P. is the guarantor of this

work and as such had full access to the data and takes responsibility for the integrity of the data and

the accuracy of the data analysis. Diabetes Page 20 of 76

19

References

1. De Pauw A, Tejerina S, Raes M, Keijer J, Arnould T: Mitochondrial (dys)function in adipocyte

(de)differentiation and systemic metabolic alterations. Am J Pathol. 175:927939, 2009

2. Falkenberg M, Larsson NG, Gustafsson CM: DNA replication and transcription in mammalian mitochondria. Annu Rev Biochem. 76:679699, 2007

3. Nunnari J, Suomalainen A: Mitochondria: In sickness and in health. Cell. 148:11451159, 2012

4. Pagliarini DJ, Calvo SE, Chang B, Sheth SA, Vafai SB, Ong SE, Walford GA, Sugiana C, Boneh

A, Chen WK, Hill DE, Vidal M, Evans JG, Thorburn DR, Carr SA, Mootha VK: A mitochondrial protein compendium elucidates complex I disease biology. Cell. 134:112123, 2008

5. Bogacka I, Xie H, Bray GA, Smith SR: Pioglitazone induces mitochondrial biogenesis in human subcutaneous adipose tissue in vivo. Diabetes. 54:13921399, 2005

6. Semple RK, Crowley VC, Sewter CP, Laudes M, Christodoulides C, Considine RV, VidalPuig

A, O'Rahilly S: Expression of the thermogenic nuclear hormone receptor coactivator PGC1alpha is reduced in the adipose tissue of morbidly obese subjects. Int J Obes Relat Metab Disord. 28:176

179, 2004

7. Hammarstedt A, Jansson PA, Wesslau C, Yang X, Smith U: Reduced expression of PGC1 and insulinsignaling molecules in adipose tissue is associated with insulin resistance. Biochem Biophys

Res Commun. 301:578582, 2003

8. Yin X, Lanza IR, Swain JM, Sarr MG, Nair KS, Jensen MD: Adipocyte mitochondrial function is reduced in human obesity independent of fat cell size. J Clin Endocrinol Metab. 99:E20916, 2014 Page 21 of 76 Diabetes

20

9. YehudaShnaidman E, Buehrer B, Pi J, Kumar N, Collins S: Acute stimulation of white

adipocyte respiration by PKAinduced lipolysis. Diabetes. 59:24742483, 2010

10. Pietilainen KH, Naukkarinen J, Rissanen A, Saharinen J, Ellonen P, Keranen H, Suomalainen

A, Gotz A, Suortti T, YkiJarvinen H, Oresic M, Kaprio J, Peltonen L: Global transcript profiles of

fat in monozygotic twins discordant for BMI: Pathways behind acquired obesity. PLoS Med. 5:e51,

2008

11. Mustelin L, Silventoinen K, Pietilainen K, Rissanen A, Kaprio J: Physical activity reduces the

influence of genetic effects on BMI and waist circumference: A study in young adult twins. Int J

Obes (Lond). 33:2936, 2009

12. Kaprio J: Twin studies in finland 2006. Twin Res Hum Genet. 9:772777, 2006

13. Graner M, SeppalaLindroos A, Rissanen A, Hakkarainen A, Lundbom N, Kaprio J, Nieminen

MS, Pietilainen KH: Epicardial fat, cardiac dimensions, and lowgrade inflammation in young adult

monozygotic twins discordant for obesity. Am J Cardiol. 109:12951302, 2012

14. Naukkarinen J, Heinonen S, Hakkarainen A, Lundbom J, Vuolteenaho K, Saarinen L,

Hautaniemi S, Rodriguez A, Fruhbeck G, Pajunen P, Hyotylainen T, Oresic M, Moilanen E,

Suomalainen A, Lundbom N, Kaprio J, Rissanen A, Pietilainen KH: Characterising metabolically

healthy obesity in weightdiscordant monozygotic twins. Diabetologia. 57:167176, 2014

15. Pietrobelli A, Formica C, Wang Z, Heymsfield SB: Dualenergy Xray absorptiometry body

composition model: Review of physical concepts. Am J Physiol. 271:E94151, 1996

16. Heinonen S, Saarinen L, Naukkarinen J, Rodriguez A, Fruhbeck G, Hakkarainen A, Lundbom J,

Lundbom N, Vuolteenaho K, Moilanen E, Arner P, Hautaniemi S, Suomalainen A, Kaprio J, Diabetes Page 22 of 76

21

Rissanen A, Pietilainen KH: Adipocyte morphology and implications for metabolic derangements in acquired obesity. Int J Obes (Lond). 38:14231431, 2014

17. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge

Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M,

Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JY, Zhang J: Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R80, 2004

18. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK: Limma powers differential expression analyses for RNAsequencing and microarray studies. Nucleic Acids Research. doi:

10.1093/nar/gkv007, 2015

19. Rao J, Scott A: On chisquared tests for multiway contingency tables with cell proportions estimated from survey data. Annals of Statistics. 12:4660, 1984

20. Kramer A, Green J, Pollard J,Jr, Tugendreich S: Causal analysis approaches in ingenuity pathway analysis. Bioinformatics. 30:523530, 2014

21. Kaaman M, Sparks LM, van Harmelen V, Smith SR, Sjolin E, Dahlman I, Arner P: Strong association between mitochondrial DNA copy number and lipogenesis in human white adipose tissue. Diabetologia. 50:25262533, 2007

22. Attardi G, Schatz G: Biogenesis of mitochondria. Annu Rev Cell Biol. 4:289333, 1988

23. Rong JX, Qiu Y, Hansen MK, Zhu L, Zhang V, Xie M, Okamoto Y, Mattie MD, Higashiyama

H, Asano S, Strum JC, Ryan TE: Adipose mitochondrial biogenesis is suppressed in db/db and highfat dietfed mice and improved by rosiglitazone. Diabetes. 56:17511760, 2007 Page 23 of 76 Diabetes

22

24. Bains RK, Wells SE, Flavell DM, Fairhall KM, Strom M, Le Tissier P, Robinson IC: Visceral

obesity without insulin resistance in lateonset obesity rats. Endocrinology. 145:26662679, 2004

25. Weyer C, Foley JE, Bogardus C, Tataranni PA, Pratley RE: Enlarged subcutaneous abdominal

adipocyte size, but not obesity itself, predicts type II diabetes independent of insulin resistance.

Diabetologia. 43:14981506, 2000

26. Salans LB, Knittle JL, Hirsch J: The role of adipose cell size and adipose tissue insulin

sensitivity in the carbohydrate intolerance of human obesity. J Clin Invest. 47:153165, 1968

27. Lonn M, Mehlig K, Bengtsson C, Lissner L: Adipocyte size predicts incidence of type 2

diabetes in women. FASEB J. 24:326331, 2010

28. Turner N, Heilbronn LK: Is mitochondrial dysfunction a cause of insulin resistance? Trends

Endocrinol Metab. 19:324330, 2008

29. Gao CL, Zhu C, Zhao YP, Chen XH, Ji CB, Zhang CM, Zhu JG, Xia ZK, Tong ML, Guo XR:

Mitochondrial dysfunction is induced by high levels of glucose and free fatty acids in 3T3L1

adipocytes. Mol Cell Endocrinol. 320:2533, 2010

30. Sutherland LN, Capozzi LC, Turchinsky NJ, Bell RC, Wright DC: Time course of highfat diet

induced reductions in adipose tissue mitochondrial proteins: Potential mechanisms and the

relationship to glucose intolerance. Am J Physiol Endocrinol Metab. 295:E107683, 2008

31. Enguix N, Pardo R, Gonzalez A, Lopez VM, Simo R, Kralli A, Villena JA: Mice lacking PGC

1beta in adipose tissues reveal a dissociation between mitochondrial dysfunction and insulin

resistance. Mol Metab. 2:215226, 2013 Diabetes Page 24 of 76

23

32. Puigserver P, Spiegelman BM: Peroxisome proliferatoractivated receptorgamma coactivator 1 alpha (PGC1 alpha): Transcriptional coactivator and metabolic regulator. Endocr Rev. 24:7890,

2003

33. Scarpulla RC: Nuclear activators and coactivators in mammalian mitochondrial biogenesis.

Biochim Biophys Acta. 1576:114, 2002

34. Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D: Acquirement of brown fat cell features by human white adipocytes. J Biol Chem. 278:3337033376, 2003

35. WilsonFritch L, Nicoloro S, Chouinard M, Lazar MA, Chui PC, Leszyk J, Straubhaar J, Czech

MP, Corvera S: Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone. J Clin Invest. 114:12811289, 2004

36. Dahlman I, Forsgren M, Sjogren A, Nordstrom EA, Kaaman M, Naslund E, Attersand A, Arner

P: Downregulation of electron transport chain genes in visceral adipose tissue in type 2 diabetes independent of obesity and possibly involving tumor necrosis factoralpha. Diabetes. 55:17921799,

2006

37. Kleiner S, Mepani RJ, Laznik D, Ye L, Jurczak MJ, Jornayvaz FR, Estall JL, Chatterjee

Bhowmick D, Shulman GI, Spiegelman BM: Development of insulin resistance in mice lacking

PGC1alpha in adipose tissues. Proc Natl Acad Sci U S A. 109:96359640, 2012

38. Hammes TO, Costa Cdos S, Rohden F, Margis R, de Almeida JC, Padoin AV, Mottin CC,

Guaragna RM: Parallel downregulation of FOXO1, PPAR and adiponectin mRNA expression in visceral adipose tissue of class III obese individuals. Obes Facts. 5:452459, 2012

39. Subauste AR, Burant CF: Role of FoxO1 in FFAinduced oxidative stress in adipocytes. Am J

Physiol Endocrinol Metab. 293:E15964, 2007 Page 25 of 76 Diabetes

24

40. Li X, Monks B, Ge Q, Birnbaum MJ: Akt/PKB regulates hepatic metabolism by directly

inhibiting PGC1alpha transcription coactivator. Nature. 447:10121016, 2007

41. Barthel A, Schmoll D, Unterman TG: FoxO proteins in insulin action and metabolism. Trends

Endocrinol Metab. 16:183189, 2005

42. Chen M, Macpherson A, Owens J, Wittert G, Heilbronn LK: Obesity alone or with type 2

diabetes is associated with tissue specific alterations in DNA methylation and gene expression of

PPARGC1A and IGF2. Journal of Diabetes Research and Clinical Metabolism. 1:16, 2012

Diabetes Page 26 of 76

25

Table 1

Characteristics of the monozygotic (MZ) twins

Weightdiscordant MZ pairs Weightconcordant MZ pairs

Variable (BMI >3 kg/m2, n = 26) (BMI <3 kg/m2, n = 14)

males n = 9, females n = 17 males n = 9, females n = 5

Lean cotwin Obese cotwin P value* Both cotwins

Age (years) 29.9 ± 0.9 29.9 ± 0.9 0.33 31.6 ± 0.6

Weight (kg) 75.4 ± 3.5 93.3 ± 4.0 < 0.0001 79.3 ± 2.5

Height (cm) 171.9 ± 2.0 172.2 ± 1.9 0.38 171.5 ± 2.0

BMI (kg/m2) 25.3 ± 0.9 31.3 ± 1.0 < 0.0001 26.9 ± 0.7

Body fat (%) 32.3 ± 1.8 41.1 ± 1.3 < 0.0001 29.2 ± 1.7

Fat (kg) 24.9 ± 2.2 38.2 ± 2.1 < 0.0001 23.5 ± 1.7

Fatfree mass (kg) 48.0 ± 2.1 52.1 ± 2.5 0.0001 53.4 ± 2.0

SAT (dm3) 3813.7 ± 416.8 6358.9 ± 540.4 < 0.0001 3256.3 ± 261.2

VAT (dm3) 790.2 ± 178.9 1643.7 ± 247.4 < 0.0001 1065.2 ± 130.0

Liver fat (%) 1.12 ± 0.32 4.52 ± 0.99 < 0.0001 2.87 ± 0.98

Adipocyte volume (pL) 355.6 ± 34 547 ± 59 0.0008 412.0 ± 46.2

Adipocyte number (1013) 8.4 ± 0.74 8.3 ± 0.60 0.95 7.82 ± 0.60 fPglucose (mmol/L)† 5.1 ± 0.1 5.3 ± 0.1 0.17 5.4 ± 0.1 fSinsulin (mU/L)† 4.9 ± 0.5 8.5 ± 1.2 0.0011 5.5 ± 0.6

HOMA index† 1.1 ± 0.1 2.1 ± 0.3 0.0010 1.3 ± 0.2

Matsuda index† 8.6 ± 0.9 6.0 ± 0.7 0.0089 9.9 ± 1.3

AUC insulin in OGTT 87.6 ± 8.0 129.3 ± 24.6 0.031 77.5 ± 10.9

(mU/L)

Total cholesterol (mmol/l) 4.4 ± 0.2 4.7 ± 0.2 0.14 4.5 ± 0.2 Page 27 of 76 Diabetes

26

LDL cholesterol (mmol/L) 2.6 ± 0.1 3.0 ± 0.2 0.034 2.8 ± 0.2

HDL cholesterol (mmol/L) 1.6 ± 0.1 1.3 ± 0.1 0.0004 1.3 ± 0.1

Triglycerides (mmol/L) 0.94 ± 0.1 1.32 ± 0.2 0.014 1.02 ± 0.13

fPleptin (mg/mL) 18.9 ± 4.1 34.6 ± 5.5 0.0015 28.4 ± 10.2

fPadiponectin (µg/mL) 2.8 ± 0.3 2.2 ± 0.2 0.0023 2.2 ± 0.1

fShsCRP (mg/dL) 2.6 ± 0.7 4.0 ± 1.1 0.065 1.2 ± 0.3

Adipsin (ng/mL) 1190 ± 45 1310 ± 47 0.0063 1070 ± 71

Total physical activity 8.9 ± 0.2 8.3 ± 0.2 0.213 8.9 ± 0.3

Sportindex 3.2 ±0.2 2.7 ± 0.2 0.061 3.3 ± 0.2

Leisureindex 2.8 ± 0.1 2.8 ± 0.1 0.837 2.8 ± 0.1

Workindex 2.8 ± 0.1 2.8 ± 0.1 0.466 2.8 ± 0.1

*Wilcoxon’s rank sum test was used to compare values of the leaner versus the heavier cotwin. †n

= 25 obesitydiscordant MZ pairs. AUC, area under the curve; fP, fasting plasma; fS, fasting serum;

HOMA, homeostatic model assessment; hsCRP, highsensitivity Creactive protein; OGTT, oral

glucose tolerance test; SAT, subcutaneous adipose tissue; VAT, visceral adipose tissue. Data

represent means with SE.

Diabetes Page 28 of 76

27

Table 2

Top up and downregulated genes in the obese compared with the lean cotwins (n = 26 discordant pairs)

Adjusted

Symbol Description P value FC

Upregulated genes

VAMP8 vesicleassociated membrane protein 8 0.0041 1.51

HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 0.0108 1.47

FTH1 ferritin, heavy polypeptide 1 0.0003 1.41

TOMM40L translocase of outer mitochondrial membrane 40 homolog (yeast) 0.0012 1.38

like

TMEM160 transmembrane protein 160 0.0037 1.33

PLA2G15 phospholipase A2, group XV 0.0132 1.32

TXNRD1 thioredoxin reductase 1 0.0016 1.30

SLC25A43 solute carrier family 25, member 43 0.0018 1.24

Downregulated genes

NIPSNAP3B nipsnap homolog 3B (C. elegans) 0.0002 1.92

LDHD lactate dehydrogenase D 0.0025 1.71

ALDH1L1 aldehyde dehydrogenase 1 family, member L1 0.0010 1.62

AASS aminoadipatesemialdehyde synthase 0.0006 1.59

GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 0.0010 1.58

ECHDC3 enoyl CoA hydratase domain containing 3 0.0006 1.56

ALDH6A1 aldehyde dehydrogenase 6 family, member A1 0.0006 1.56

C10orf10 chromosome 10 open reading frame 10 0.0186 1.54

PXMP2 peroxisomal membrane protein 2, 22kDa 0.0004 1.52 Page 29 of 76 Diabetes

28

ACP6 acid phosphatase 6, lysophosphatidic 0.0022 1.48

PC pyruvate carboxylase 0.0015 1.41

ECI1 enoylCoA delta isomerase 1 0.0002 1.41

PCCB propionyl CoA carboxylase, beta polypeptide 0.0006 1.38

SHMT1 serine hydroxymethyltransferase 1 (soluble) 0.0016 1.38

ACACA acetylCoA carboxylase alpha 0.0042 1.37

LIAS lipoic acid synthetase 0.0010 1.36

PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 0.0141 1.35

HADH hydroxyacylCoA dehydrogenase 0.0002 1.34

FC, fold change.

Diabetes Page 30 of 76

29

Table 3

Pathways significantly changed in the obese compared with the lean cotwin (IPA analysis of the differentially expressed genes, n = 26 discordant pairs)

Ingenuity canonical pathways P value Regulation Molecules

Oxidative < 0.0001 Downregulated SDHB,COX6C,COX5B,NDUFB5,COX8A,A phosphorylation TP5L,ATP5G2,NDUFB8,ATP5S,NDUFA2,

NDUFB10,NDUFS1,NDUFAB1,ATPAF1,A

TP5I,COX4I1,NDUFA8,NDUFS4,ATP5O,A

TP5A1,COX7C,NDUFS3,UQCRB,ATP5C1,

COX11,NDUFB11,ATP5B,NDUFA6,CYC1,

UQCRC2,COX7A2,NDUFA12,SDHD,UQC

RC1

Valine degradation I < 0.0001 Downregulated HADHB,HIBADH,BCKDHA,AUH,ACAD8,

ACADSB,DBT,ALDH6A1,

HADHA,BCKDHB

GlutarylCoA < 0.0001 Downregulated HADHB,ACAT2,ACAT1,HADHA,HADH,G degradation CDH,HSD17B8

Isoleucine degradation I < 0.0001 Downregulated HADHB,ACAT2,AUH,ACAD8,ACAT1,AC

ADSB,HADHA

Ketogenesis < 0.0001 Downregulated HADHB,BDH1,ACAT2,ACAT1,HMGCL,H

ADHA

Fatty acid βoxidation I < 0.0001 Downregulated HADHB,ECI2,AUH,ACADM,ECI1,HADHA

,HADH,HSD17B8

Tryptophan degradation < 0.0001 Downregulated HADHB,ACAT2,ACAT1,HADHA,HADH,G Page 31 of 76 Diabetes

30

III (eukaryotic) CDH,HSD17B8

Ketolysis < 0.0001 Downregulated HADHB,BDH1,ACAT2,ACAT1,HADHA

TCA cycle II < 0.0001 Downregulated SDHB,DHTKD1,SUCLG1,DLST,SDHD,FH,

(eukaryotic) IDH3B

Leucine degradation I < 0.0001 Downregulated AUH,MCCC1,HMGCL,ACADM,MCCC2

IPA, Ingenuity Pathway Analysis.

Diabetes Page 32 of 76

31

Table 4

Correlations of mitochondrial variables with metabolic measures in individual MZ twins (n = 80)

Adipocyte fPadipo SAT VAT Liver fat Matsuda HOMA fPleptin hsCRP Adipsin volume nectin mtDNA 0.2544 0.0835 0.1761 0.2076 0.2954 0.4582* 0.2413 0.0408 0.0166 0.4007*

Oxidative 0.367† 0.603‡ 0.420† 0.497† 0.445‡ 0.322† 0.191 0.353* 0.384† 0.3402* phosphorylation

Fatty acid beta 0.622‡ 0.669‡ 0.518‡ 0.584‡ 0.669‡ 0.595‡ 0.519‡ 0.378† 0.476‡ 0.4174† oxidation

TCA cycle 0.315† 0.660‡ 0.432† 0.452† 0.483‡ 0.388‡ 0.147 0.456‡ 0.416‡ 0.4241†

GlutarylCoA 0.690‡ 0.644‡ 0.469‡ 0.586‡ 0.634‡ 0.558‡ 0.543‡ 0.330* 0.470‡ 0.4484‡ degradation

Ketogenesis 0.661‡ 0.652‡ 0.480‡ 0.569‡ 0.623‡ 0.570‡ 0.488† 0.358* 0.437† 0.4337‡

Ketolysis 0.657‡ 0.627‡ 0.478‡ 0.541† 0.626‡ 0.587‡ 0.490† 0.387* 0.437† 0.4671‡

Valine 0.585‡ 0.702‡ 0.559‡ 0.596‡ 0.658‡ 0.638‡ 0.425† 0.524‡ 0.486‡ 0.5377‡ degradation

Leucine 0.430† 0.649‡ 0.485‡ 0.489† 0.578‡ 0.506‡ 0.306† 0.411† 0.412‡ 0.4003† Page 33 of 76 Diabetes

32

degradation

Isoleucine 0.533‡ 0.641‡ 0.472‡ 0.512‡ 0.602‡ 0.581‡ 0.391* 0.486‡ 0.430‡ 0.5187‡ degradation

Tryptophan 0.630‡ 0.644‡ 0.469‡ 0.586‡ 0.634‡ 0.558‡ 0.543‡ 0.330* 0.470‡ 0.4484‡ degradation

*P < 0.05, †P < 0.01, ‡P < 0.001. fP, fasting plasma; HOMA, homeostatic model assessment; hsCRP, highsensitivity Creactive protein; SAT,

subcutaneous adipose tissue; TCA, tricarboxylic acid cycle; VAT, visceral adipose tissue.

Diabetes Page 34 of 76

33

Table 5

Upstream transcription factors regulating the mitochondrialrelated genes (IPA analysis of the differentially expressed genes, n = 26 discordant pairs)

Upstream Predicted Activation P value Target molecules in the dataset regulator activation state zscore of overlap

↓ ACACA,↓ ATP5B,↓ MAVS,↓ MRPL45,↓ MRPL46,↓ MRPL57,

FOXO1 Inhibited 3.162 4.42e06 ↓ MRPS18A,↓ MRPS2,↓ MRPS22,↓ MRPS30,↓ MRPS7,↓ NDUFA12,

↓ NDUFA8,↓ PDHB

↓ ACACA,↓ ACACB,↓ ACADM,↑ ALAS1,↓ ATP5B,↓ ATP5O,↓ COX4I1,↓ PPARGC1A Inhibited 2.823 3.28e09 NDUFB5,↓ NDUFS1,↓ PDK4,↓ TXN2

KMT2D Inhibited 2.236 0.0272 ↓ ACADM,↓ ECI2,↓ HDDC2,↓ OXR1,↓ SFXN4

PPARGC1B Inhibited 2.219 7.19e06 ↓ ACACA,↓ ACACB,↓ ACADM,↓ COX4I1,↓ PDK4

↓ ACADM,↓ DECR1,↓ HADHA,↓ HADHB,↓ MLYCD,↓ PDK4, KLF15 Inhibited 2.121 1.29e09 ↓ PXMP2,↑ SLC25A20

↓ CCBL2, ↓ COQ7, ↓ FH, ↑ GARS, ↓ MCCC1, ↓ PDK1, ↓ SFXN2, HNF1A Inhibited 2.000 0.0062 ↓ UQCRC2

IPA, Ingenuity Pathway Analysis; ↓, downregulated; ↑, upregulated in the obese compared with the lean cotwins.

Page 35 of 76 Diabetes

34

Figure legends

Fig. 1. Reduction of PGC1α in SAT of the obese MZ twins. Reduced expression of PGC1α was

confirmed by qRTPCR in SAT of the MZ obese compared with the lean cotwins (n = 15

discordant pairs). The bars indicate mean with SE. ** P < 0.01 (TTEST).

Fig.2. Reduction of mtDNA amount, mtDNA transcripts, MRPS/L and OXPHOS protein

amounts in SAT of obese MZ twins. Relative mtDNA amount measured by qPCR (A) and

mtDNA transcripts measured by qRTPCR (B) in SAT of the MZ obese compared with the lean co

twins (n = 15 discordant pairs). (C) The mean centroid values of MRPS and MRPL in SAT of the

obese compared with the lean cotwins (n = 26 discordant pairs). (D) Western blot analysis of SAT

lysates. (E and F), Relative amount of OXPHOS proteins in SAT (n = 7 discordant pairs). Western

blot signals were normalized against βTUBULIN (E) and PORIN (F). The bars indicate mean with

SE. * P < 0.05, ** P < 0.01, ***P < 0.001 (paired Wilcoxon signed rank test). MRPS, small

mitochondrial ribosomal proteins; MRPL, large mitochondrial ribosomal proteins.

Fig. 3. Downregulation of mitochondrial biogenesis in SAT of MZ obese cotwins. Twentysix

weightdiscordant healthy young MZ twin pairs (BMI >3 kg/m2) were enrolled in the study. Red

denotes the downregulated transcripts protein subunits in the obese cotwins compared with their

lean cotwins. In addition, 222 of more than 1000 nuclearencoded mitochondrial genes were

downregulated. OXPHOS, phosphorylation; FAO, fatty acid oxidation; MRPS and MRPL, small

and large subunit proteins of the mitochondrial ribosome, respectively; 12S and 16S, 12S rRNA and

16S rRNA, respectively; ND5, CYTB, and COX1, mRNAs; IV, OXPHOS protein complexes IV.

Diabetes Page 36 of 76

35

Supplementary figure legends

Table S1: Primer sequences

Supplementary data S1: Significantly changed transcripts in the obese twins found in MitoCarta (n

= 26 discordant pairs).

Supplementary data S2: Pathway analysis of significantly changed transcripts in the obese cotwins

(n = 26 discordant pairs).

Supplementary data S3: Upstream regulator analysis of significantly changed transcripts in the obese cotwins (n = 26 discordant pairs).

Supplementary data S4: Genes for mean centroid analysis of mitochondrial small and large ribosomal protein subunits MRPS and MRPL, respectively (n = 26 discordant pairs).

Page 37 of 76 Diabetes A B C 1.5 1.5 Diabetes 0.2 *** Page 38 of 76 ** ** ** * ** ** * 0.0 1.0 1.0 -0.2 0.5 0.5 -0.4 mtDNA amount mtDNA 0.0 mRNA/ 18S rRNA 0.0 -0.6 12S 16S COX1 ND5 CYTB expression (AU) Total MRPS MRPL

Lean twins Obese twins E 1.5 .09 * * * .09

D 1.0

TUBULIN

Obese Obese Lean Lean Obese Lean CI (NDUFA9) 0.5 CII (SDHA) 0.0 CIII (UQCRC2)

CI CII CIII CIV CV PORIN Protein level/ level/ Protein CIV (MT-CO1) F 1.5 .06 CV (CV-α) * * Porin 1.0 Tubulin 0.5 Actin 0.0

Twins Twins Twins PORIN level/ Protein CI CII CIII CIV CV Page 39 of 76 Diabetes

MZ TWINS PGC1α OXPHOS FAO BCAA MRPS MRPL >1000 Nucleus prote NORMAL ins WEIGHT OBESITY I 12S CYTB tRNAs II 16S MRPS OX III mtDNA ND5 rRNAs PHOS mRNAs MRPL 13 IV Small Large COX1 proteins V adipocytes adipocytes ΔBMI > 3 kg/m2 Mitochondria Mitochondrial biogenesis Diabetes Page 40 of 76

TableS1: Primers

Gene name Forward primer sequence (5´->3´) Reverse primer sequence (5´->3´) qPCR primers for mtDNA amount analysis

MTCYTB GCCTGCCTGATCCTCCAAAT AAGGTAGCGGATGATTCAGCC

APP TGTGTGCTCTCCCAGGTCTA CAGTTCTGGATGGTCACTGG qRT-PCR primers for mtDNA-encoded transcripts and microarray results validation

MTRNR1 (12S) AAACTGCTCGCCAGAACACT TAGGCTGAGCAAGAGGTGGT

MTRNR2 (16S) ACTTTGCAAGGAGAGCCAAA GCTATCACCAGGCTCGGTAG

MTND5 CAAAACCTGCCCCTACTCCT GGGTTGAGGTGATGATGGAG

MTCOX1 CGATGCATACACCACATGAA AGCGAAGGCTTCTCAAATCA

MTCYTB AATTCTCCGATCCGTCCCTA GGAGGATGGGGATTATTGCT

PGC1α TGTGAACTGCTGATTTGATGG AGAATTGGCAGGTGGAAAAA

18S RNA AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA

PGC1α targeted sequence:

>HGU133_PLUS_2:219195_AT

5799 acaacagttgggctgtcaacattcaaagcagcagagagggaactttgcactattggggta tgatgtttgggtcagttgataaaaggaaaccttttcatgcctttagatgtgagcttccag taggtaatgattatgtgtcctttcttgatggctgtaatgagaacttcaatcactgtagtc taagacctgatctatagatacctagaatagccatgtactataatgtgatgattctaaatt tgtacctatgtgacagacattttcaataatgtgaactgctgatttgatggagctacttta Page 41 of 76 Diabetes

agatttgtaggtgaaagtgtaatactgttggttgaactatgctgaagagggaaagtgagc gattagttgagcccttgcc 6178

Diabetes Page 42 of 76

probes.ALL ID.ALL symbol.ALL GeneName.ALL 1 55335_at 55335 NIPSNAP3B nipsnap homolog 3B (C. elegans) 2 197257_at 197257 LDHD lactate dehydrogenase D 3 10840_at 10840 ALDH1L1 aldehyde dehydrogenase 1 family, member L1 4 10157_at 10157 AASS aminoadipate-semialdehyde synthase 5 84706_at 84706 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 6 79746_at 79746 ECHDC3 enoyl CoA hydratase domain containing 3 7 4329_at 4329 ALDH6A1 aldehyde dehydrogenase 6 family, member A1 8 11067_at 11067 C10orf10 chromosome 10 open reading frame 10 9 5827_at 5827 PXMP2 peroxisomal membrane protein 2, 22kDa 10 51205_at 51205 ACP6 acid phosphatase 6, lysophosphatidic 11 5091_at 5091 PC pyruvate carboxylase 12 1632_at 1632 ECI1 enoyl-CoA delta isomerase 1 13 5096_at 5096 PCCB propionyl CoA carboxylase, beta polypeptide 14 6470_at 6470 SHMT1 serine hydroxymethyltransferase 1 (soluble) 15 31_at 31 ACACA acetyl-CoA carboxylase alpha 16 11019_at 11019 LIAS lipoic acid synthetase 17 5106_at 5106 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 18 3033_at 3033 HADH hydroxyacyl-CoA dehydrogenase 19 622_at 622 BDH1 3-hydroxybutyrate dehydrogenase, type 1 20 56997_at 56997 ADCK3 aarF domain containing kinase 3 21 32_at 32 ACACB acetyl-CoA carboxylase beta 22 5164_at 5164 PDK2 pyruvate dehydrogenase kinase, isozyme 2 23 137872_at 137872 ADHFE1 alcohol dehydrogenase, iron containing, 1 24 57546_at 57546 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 25 1350_at 1350 COX7C cytochrome c oxidase subunit VIIc 26 6576_at 6576 SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 27 2108_at 2108 ETFA electron-transfer-flavoprotein, alpha polypeptide 28 5166_at 5166 PDK4 pyruvate dehydrogenase kinase, isozyme 4 29 25875_at 25875 LETMD1 LETM1 domain containing 1 30 549_at 549 AUH AU RNA binding protein/enoyl-CoA hydratase 31 5163_at 5163 PDK1 pyruvate dehydrogenase kinase, isozyme 1 32 51116_at 51116 MRPS2 mitochondrial ribosomal protein S2 33 400916_at 400916 CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 34 4357_at 4357 MPST mercaptopyruvate sulfurtransferase 35 39_at 39 ACAT2 acetyl-CoA acetyltransferase 2 36 593_at 593 BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide 37 8165_at 8165 AKAP1 A kinase (PRKA) anchor protein 1 38 56922_at 56922 MCCC1 methylcrotonoyl-CoA carboxylase 1 (alpha) 39 54996_at 54996 MARC2 mitochondrial amidoxime reducing component 2 40 34_at 34 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 41 670_at 670 BPHL biphenyl hydrolase-like (serine hydrolase) 42 84987_at 84987 COX14 cytochrome c oxidase assembly homolog 14 (S. cerevisiae) 43 2639_at 2639 GCDH glutaryl-CoA dehydrogenase 44 11112_at 11112 HIBADH 3-hydroxyisobutyrate dehydrogenase 45 1743_at 1743 DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) 46 23417_at 23417 MLYCD malonyl-CoA decarboxylase 47 9481_at 9481 SLC25A27 solute carrier family 25, member 27 48 594_at 594 BCKDHB branched chain keto acid dehydrogenase E1, beta polypeptide 49 51110_at 51110 LACTB2 lactamase, beta 2 Page 43 of 76 Diabetes

50 4711_at 4711 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa 51 1537_at 1537 CYC1 cytochrome c-1 52 154791_at 154791 C7orf55 chromosome 7 open reading frame 55 53 118980_at 118980 SFXN2 sideroflexin 2 54 54675_at 54675 CRLS1 cardiolipin synthase 1 55 8801_at 8801 SUCLG2 succinate-CoA ligase, GDP-forming, beta subunit 56 92259_at 92259 MRPS36 mitochondrial ribosomal protein S36 57 7385_at 7385 UQCRC2 ubiquinol-cytochrome c reductase core protein II 58 64757_at 64757 MARC1 mitochondrial amidoxime reducing component 1 59 54148_at 54148 MRPL39 mitochondrial ribosomal protein L39 60 38_at 38 ACAT1 acetyl-CoA acetyltransferase 1 61 10247_at 10247 HRSP12 heat-responsive protein 12 62 64756_at 64756 ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 63 4522_at 4522 MTHFD1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 64 5095_at 5095 PCCA propionyl CoA carboxylase, alpha polypeptide 65 10352_at 10352 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 66 6341_at 6341 SCO1 SCO1 cytochrome c oxidase assembly protein 67 5018_at 5018 OXA1L oxidase (cytochrome c) assembly 1-like 68 7923_at 7923 HSD17B8 hydroxysteroid (17-beta) dehydrogenase 8 69 9588_at 9588 PRDX6 peroxiredoxin 6 70 4594_at 4594 MUT methylmalonyl CoA mutase 71 56945_at 56945 MRPS22 mitochondrial ribosomal protein S22 72 414919_at 414919 C8orf82 chromosome 8 open reading frame 82 73 26589_at 26589 MRPL46 mitochondrial ribosomal protein L46 74 7263_at 7263 TST thiosulfate sulfurtransferase (rhodanese) 75 2271_at 2271 FH fumarate hydratase 76 64983_at 64983 MRPL32 mitochondrial ribosomal protein L32 77 5264_at 5264 PHYH phytanoyl-CoA 2-hydroxylase 78 55178_at 55178 RNMTL1 RNA methyltransferase like 1 79 84311_at 84311 MRPL45 mitochondrial ribosomal protein L45 80 55288_at 55288 RHOT1 ras homolog family member T1 81 64087_at 64087 MCCC2 methylcrotonoyl-CoA carboxylase 2 (beta) 82 55005_at 55005 RMND1 required for meiotic nuclear division 1 homolog (S. cerevisiae) 83 4719_at 4719 NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) 84 6390_at 6390 SDHB succinate dehydrogenase complex, subunit B, iron sulfur (Ip) 85 128387_at 128387 TATDN3 TatD DNase domain containing 3 86 10128_at 10128 LRPPRC leucine-rich pentatricopeptide repeat containing 87 124995_at 124995 MRPL10 mitochondrial ribosomal protein L10 88 54543_at 54543 TOMM7 translocase of outer mitochondrial membrane 7 homolog (yeast) 89 2631_at 2631 GBAS glioblastoma amplified sequence 90 55526_at 55526 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 91 10240_at 10240 MRPS31 mitochondrial ribosomal protein S31 92 10455_at 10455 ECI2 enoyl-CoA delta isomerase 2 93 517_at 517 ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 94 55074_at 55074 OXR1 oxidation resistance 1 95 51650_at 51650 MRPS33 mitochondrial ribosomal protein S33 96 51277_at 51277 DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 97 27034_at 27034 ACAD8 acyl-CoA dehydrogenase family, member 8 98 10884_at 10884 MRPS30 mitochondrial ribosomal protein S30 99 4724_at 4724 NDUFS4 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) Diabetes Page 44 of 76

100 92106_at 92106 OXNAD1 oxidoreductase NAD-binding domain containing 1 101 3030_at 3030 HADHA hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit 102 10939_at 10939 AFG3L2 AFG3-like AAA ATPase 2 103 506_at 506 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 104 192286_at 192286 HIGD2A HIG1 hypoxia inducible domain family, member 2A 105 119559_at 119559 SFXN4 sideroflexin 4 106 6208_at 6208 RPS14 ribosomal protein S14 107 1666_at 1666 DECR1 2,4-dienoyl CoA reductase 1, mitochondrial 108 65080_at 65080 MRPL44 mitochondrial ribosomal protein L44 109 64965_at 64965 MRPS9 mitochondrial ribosomal protein S9 110 51660_at 51660 MPC1 mitochondrial pyruvate carrier 1 111 293_at 293 SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 112 54539_at 54539 NDUFB11 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa 113 4702_at 4702 NDUFA8 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa 114 56267_at 56267 CCBL2 cysteine conjugate-beta lyase 2 115 1329_at 1329 COX5B cytochrome c oxidase subunit Vb 116 51081_at 51081 MRPS7 mitochondrial ribosomal protein S7 117 28973_at 28973 MRPS18B mitochondrial ribosomal protein S18B 118 80273_at 80273 GRPEL1 GrpE-like 1, mitochondrial (E. coli) 119 10131_at 10131 TRAP1 TNF receptor-associated protein 1 120 8802_at 8802 SUCLG1 succinate-CoA ligase, alpha subunit 121 4722_at 4722 NDUFS3 NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) 122 11331_at 11331 PHB2 prohibitin 2 123 64978_at 64978 MRPL38 mitochondrial ribosomal protein L38 124 27247_at 27247 NFU1 NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) 125 57506_at 57506 MAVS mitochondrial antiviral signaling protein 126 4714_at 4714 NDUFB8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa 127 1351_at 1351 COX8A cytochrome c oxidase subunit VIIIA (ubiquitous) 128 55186_at 55186 SLC25A36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 129 55168_at 55168 MRPS18A mitochondrial ribosomal protein S18A 130 7381_at 7381 UQCRB ubiquinol-cytochrome c reductase binding protein 131 3032_at 3032 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 132 27109_at 27109 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B) 133 65005_at 65005 MRPL9 mitochondrial ribosomal protein L9 134 3396_at 3396 ICT1 immature colon carcinoma transcript 1 135 6392_at 6392 SDHD succinate dehydrogenase complex, subunit D, integral membrane protein 136 91689_at 91689 SMDT1 single-pass membrane protein with aspartate-rich tail 1 137 9804_at 9804 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast) 138 5162_at 5162 PDHB pyruvate dehydrogenase (lipoamide) beta 139 26520_at 26520 TIMM9 translocase of inner mitochondrial membrane 9 homolog (yeast) 140 4700_at 4700 NDUFA6 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa 141 84545_at 84545 MRPL43 mitochondrial ribosomal protein L43 142 8050_at 8050 PDHX pyruvate dehydrogenase complex, component X 143 10632_at 10632 ATP5L ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G 144 81689_at 81689 ISCA1 iron-sulfur cluster assembly 1 145 60488_at 60488 MRPS35 mitochondrial ribosomal protein S35 146 3420_at 3420 IDH3B isocitrate dehydrogenase 3 (NAD+) beta 147 56474_at 56474 CTPS2 CTP synthase 2 148 36_at 36 ACADSB acyl-CoA dehydrogenase, short/branched chain 149 54931_at 54931 TRMT10C tRNA methyltransferase 10 homolog C (S. cerevisiae) Page 45 of 76 Diabetes

150 122961_at 122961 ISCA2 iron-sulfur cluster assembly 2 151 26355_at 26355 FAM162A family with sequence similarity 162, member A 152 539_at 539 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit 153 10845_at 10845 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 154 7384_at 7384 UQCRC1 ubiquinol-cytochrome c reductase core protein I 155 3735_at 3735 KARS lysyl-tRNA synthetase 156 51020_at 51020 HDDC2 HD domain containing 2 157 4528_at 4528 MTIF2 mitochondrial translational initiation factor 2 158 55972_at 55972 SLC25A40 solute carrier family 25, member 40 159 27430_at 27430 MAT2B methionine adenosyltransferase II, beta 160 65008_at 65008 MRPL1 mitochondrial ribosomal protein L1 161 521_at 521 ATP5I ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E 162 25828_at 25828 TXN2 thioredoxin 2 163 64976_at 64976 MRPL40 mitochondrial ribosomal protein L40 164 1327_at 1327 COX4I1 cytochrome c oxidase subunit IV isoform 1 165 4706_at 4706 NDUFAB1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa 166 1345_at 1345 COX6C cytochrome c oxidase subunit VIc 167 54948_at 54948 MRPL16 mitochondrial ribosomal protein L16 168 1347_at 1347 COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) 169 55149_at 55149 MTPAP mitochondrial poly(A) polymerase 170 509_at 509 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 171 55967_at 55967 NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 172 498_at 498 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 173 4716_at 4716 NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa 174 3155_at 3155 HMGCL 3-hydroxymethyl-3-methylglutaryl-CoA lyase 175 64969_at 64969 MRPS5 mitochondrial ribosomal protein S5 176 54940_at 54940 OCIAD1 OCIA domain containing 1 177 29088_at 29088 MRPL15 mitochondrial ribosomal protein L15 178 57038_at 57038 RARS2 arginyl-tRNA synthetase 2, mitochondrial 179 10229_at 10229 COQ7 coenzyme Q7 homolog, ubiquinone (yeast) 180 1629_at 1629 DBT dihydrolipoamide branched chain transacylase E2 181 78988_at 78988 MRPL57 mitochondrial ribosomal protein L57 182 291_at 291 SLC25A4 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 183 9868_at 9868 TOMM70A translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) 184 7818_at 7818 DAP3 death associated protein 3 185 4695_at 4695 NDUFA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa 186 23410_at 23410 SIRT3 sirtuin 3 187 1353_at 1353 COX11 cytochrome c oxidase assembly homolog 11 (yeast) 188 8673_at 8673 VAMP8 vesicle-associated membrane protein 8 189 27129_at 27129 HSPB7 heat shock 27kDa protein family, member 7 (cardiovascular) 190 2495_at 2495 FTH1 ferritin, heavy polypeptide 1 191 84134_at 84134 TOMM40L translocase of outer mitochondrial membrane 40 homolog (yeast)-like 192 54958_at 54958 TMEM160 transmembrane protein 160 193 23659_at 23659 PLA2G15 phospholipase A2, group XV 194 7296_at 7296 TXNRD1 thioredoxin reductase 1 195 203427_at 203427 SLC25A43 solute carrier family 25, member 43 196 7295_at 7295 TXN thioredoxin 197 211_at 211 ALAS1 aminolevulinate, delta-, synthase 1 198 4830_at 4830 NME1 NME/NM23 nucleoside diphosphate kinase 1 199 2744_at 2744 GLS glutaminase Diabetes Page 46 of 76

200 10981_at 10981 RAB32 RAB32, member RAS oncogene family 201 23788_at 23788 MTCH2 mitochondrial carrier 2 202 2745_at 2745 GLRX glutaredoxin (thioltransferase) 203 2617_at 2617 GARS glycyl-tRNA synthetase 204 57143_at 57143 ADCK1 aarF domain containing kinase 1 205 7084_at 7084 TK2 thymidine kinase 2, mitochondrial 206 788_at 788 SLC25A20 solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 207 4141_at 4141 MARS methionyl-tRNA synthetase 208 10440_at 10440 TIMM17A translocase of inner mitochondrial membrane 17 homolog A (yeast) 209 80146_at 80146 UXS1 UDP-glucuronate decarboxylase 1 210 55312_at 55312 RFK riboflavin kinase 211 116228_at 116228 COX20 COX20 cytochrome C oxidase assembly factor 212 2936_at 2936 GSR glutathione reductase 213 1312_at 1312 COMT catechol-O-methyltransferase 214 23395_at 23395 LARS2 leucyl-tRNA synthetase 2, mitochondrial 215 201626_at 201626 PDE12 phosphodiesterase 12 216 57486_at 57486 NLN neurolysin (metallopeptidase M3 family) 217 128240_at 128240 APOA1BP apolipoprotein A-I binding protein 218 4942_at 4942 OAT ornithine aminotransferase 219 51651_at 51651 PTRH2 peptidyl-tRNA hydrolase 2 220 9673_at 9673 SLC25A44 solute carrier family 25, member 44 221 60491_at 60491 NIF3L1 NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae) 222 4677_at 4677 NARS asparaginyl-tRNA synthetase Page 47 of 76 Diabetes

logFC FC AveExpr t P.Value adj.P.Val B 1 -0.94221 -1.92 down-regulated 8.984137 -6.79266 3.72E-07 0.000214 4.925964 2 -0.77473 -1.71 down-regulated 4.933953 -4.8684 5.04E-05 0.002454 -0.03961 3 -0.69329 -1.62 down-regulated 9.181829 -5.52883 9.05E-06 0.000951 1.687389 4 -0.66649 -1.59 down-regulated 7.595143 -5.94497 3.11E-06 0.000592 2.76749 5 -0.66183 -1.58 down-regulated 7.633482 -5.51919 9.28E-06 0.00097 1.662266 6 -0.63898 -1.56 down-regulated 11.33819 -6.00683 2.66E-06 0.000566 2.927118 7 -0.63719 -1.56 down-regulated 9.282727 -5.98558 2.80E-06 0.000573 2.872311 8 -0.62673 -1.54 down-regulated 9.866951 -3.6234 0.001271 0.018576 -3.23907 9 -0.5999 -1.52 down-regulated 8.365579 -6.33521 1.16E-06 0.00039 3.769308 10 -0.56681 -1.48 down-regulated 6.41574 -4.95152 4.05E-05 0.002159 0.177899 11 -0.49194 -1.41 down-regulated 9.125381 -5.21907 2.02E-05 0.001506 0.878246 12 -0.49178 -1.41 down-regulated 8.833637 -6.90131 2.85E-07 0.000191 5.197512 13 -0.46803 -1.38 down-regulated 8.823861 -5.93968 3.15E-06 0.000592 2.753844 14 -0.46388 -1.38 down-regulated 8.951824 -5.18726 2.19E-05 0.001564 0.795004 15 -0.45907 -1.37 down-regulated 9.598832 -4.51018 0.000128 0.004202 -0.97479 16 -0.44045 -1.36 down-regulated 7.782149 -5.47921 1.03E-05 0.001031 1.558001 17 -0.43718 -1.35 down-regulated 7.978244 -3.77882 0.000855 0.014062 -2.85084 18 -0.42685 -1.34 down-regulated 12.18605 -7.3873 8.81E-08 0.000172 6.395746 19 -0.42047 -1.34 down-regulated 2.757085 -4.27901 0.000235 0.006016 -1.57432 20 -0.41714 -1.34 down-regulated 8.781706 -6.45798 8.52E-07 0.00034 4.081749 21 -0.40538 -1.32 down-regulated 12.00487 -4.32779 0.000207 0.005526 -1.44817 22 -0.40186 -1.32 down-regulated 5.668571 -5.3828 1.32E-05 0.0012 1.306308 23 -0.39929 -1.32 down-regulated 8.496178 -4.5856 0.000105 0.003732 -0.77838 24 -0.39019 -1.31 down-regulated 7.254569 -4.17513 0.000307 0.007178 -1.84212 25 -0.38528 -1.31 down-regulated 9.628168 -5.64087 6.78E-06 0.000833 1.979164 26 -0.36322 -1.29 down-regulated 8.513516 -3.29342 0.002912 0.033015 -4.04488 27 -0.35863 -1.28 down-regulated 12.29748 -5.30011 1.64E-05 0.001332 1.090214 28 -0.35781 -1.28 down-regulated 11.90496 -4.21975 0.000274 0.00671 -1.72724 29 -0.35678 -1.28 down-regulated 10.16411 -5.84317 4.03E-06 0.000652 2.504258 30 -0.35426 -1.28 down-regulated 9.622679 -5.3239 1.54E-05 0.001283 1.152403 31 -0.34923 -1.27 down-regulated 4.397002 -4.80506 5.94E-05 0.002716 -0.20531 32 -0.3449 -1.27 down-regulated 7.498737 -4.66458 8.58E-05 0.003354 -0.57235 33 -0.34129 -1.27 down-regulated 9.555155 -4.11113 0.000363 0.008123 -2.00653 34 -0.33458 -1.26 down-regulated 8.370372 -5.88908 3.59E-06 0.000616 2.623063 35 -0.33202 -1.26 down-regulated 8.547199 -3.59912 0.001352 0.019437 -3.29928 36 -0.32504 -1.25 down-regulated 7.12743 -5.27875 1.73E-05 0.001346 1.03436 37 -0.32315 -1.25 down-regulated 8.2055 -3.81702 0.000775 0.013218 -2.7547 38 -0.31667 -1.25 down-regulated 9.699762 -3.82733 0.000755 0.01294 -2.72869 39 -0.31429 -1.24 down-regulated 9.154598 -4.92739 4.32E-05 0.002241 0.114739 40 -0.31406 -1.24 down-regulated 11.96748 -4.36755 0.000186 0.005183 -1.3452 41 -0.31384 -1.24 down-regulated 9.029936 -4.21275 0.000279 0.006783 -1.74528 42 -0.31021 -1.24 down-regulated 10.85901 -4.05356 0.000421 0.008957 -2.15396 43 -0.30736 -1.24 down-regulated 6.701822 -4.26152 0.000245 0.006198 -1.61948 44 -0.29961 -1.23 down-regulated 10.6143 -5.44891 1.11E-05 0.001071 1.478926 45 -0.29664 -1.23 down-regulated 9.97781 -5.78762 4.65E-06 0.000699 2.360293 46 -0.29551 -1.23 down-regulated 7.263371 -4.29094 0.000227 0.005878 -1.54349 47 -0.29383 -1.23 down-regulated 5.505809 -3.222 0.003475 0.037156 -4.21538 48 -0.28783 -1.22 down-regulated 7.498665 -3.86667 0.000682 0.012177 -2.62935 49 -0.2871 -1.22 down-regulated 9.157136 -4.37159 0.000184 0.00516 -1.33474 Diabetes Page 48 of 76

50 -0.28634 -1.22 down-regulated 12.34661 -5.816 4.32E-06 0.000682 2.433869 51 -0.28479 -1.22 down-regulated 9.745339 -4.79372 6.12E-05 0.002771 -0.23497 52 -0.28478 -1.22 down-regulated 9.128644 -4.38431 0.000178 0.005064 -1.30176 53 -0.28116 -1.22 down-regulated 5.635248 -4.2102 0.000281 0.006811 -1.75185 54 -0.27365 -1.21 down-regulated 9.213116 -6.48672 7.93E-07 0.000335 4.154702 55 -0.27224 -1.21 down-regulated 11.1113 -6.23637 1.49E-06 0.000424 3.516784 56 -0.26106 -1.20 down-regulated 9.631845 -5.04972 3.14E-05 0.001899 0.434998 57 -0.25894 -1.20 down-regulated 11.83337 -5.31735 1.56E-05 0.001294 1.135265 58 -0.25887 -1.20 down-regulated 11.81852 -3.23602 0.003357 0.036249 -4.18202 59 -0.25375 -1.19 down-regulated 8.273289 -4.69358 7.95E-05 0.003213 -0.49665 60 -0.24665 -1.19 down-regulated 9.118663 -3.81293 0.000783 0.013322 -2.765 61 -0.24615 -1.19 down-regulated 10.19074 -3.57192 0.001448 0.020434 -3.36654 62 -0.24556 -1.19 down-regulated 10.90364 -4.97435 3.82E-05 0.002073 0.23768 63 -0.24488 -1.18 down-regulated 11.59315 -3.7011 0.001043 0.016121 -3.04558 64 -0.24483 -1.18 down-regulated 9.314865 -3.7101 0.001019 0.015923 -3.0231 65 -0.24476 -1.18 down-regulated 6.157694 -4.21412 0.000278 0.006767 -1.74175 66 -0.24465 -1.18 down-regulated 7.925868 -4.29314 0.000226 0.005852 -1.53779 67 -0.24391 -1.18 down-regulated 10.09839 -3.88335 0.000654 0.011773 -2.58714 68 -0.24387 -1.18 down-regulated 7.618411 -3.82921 0.000751 0.0129 -2.72397 69 -0.2428 -1.18 down-regulated 13.58825 -5.03651 3.25E-05 0.001929 0.400396 70 -0.24122 -1.18 down-regulated 10.29055 -5.82293 4.25E-06 0.000681 2.451815 71 -0.23728 -1.18 down-regulated 9.440346 -7.20134 1.38E-07 0.000173 5.940501 72 -0.23169 -1.17 down-regulated 7.835882 -4.05939 0.000415 0.008871 -2.13905 73 -0.23124 -1.17 down-regulated 8.387402 -4.89102 4.75E-05 0.002373 0.019576 74 -0.23008 -1.17 down-regulated 10.74602 -4.26561 0.000243 0.006165 -1.60893 75 -0.22626 -1.17 down-regulated 8.207546 -3.25401 0.003211 0.035268 -4.13916 76 -0.22621 -1.17 down-regulated 10.5619 -4.37364 0.000183 0.005147 -1.32943 77 -0.2236 -1.17 down-regulated 12.08957 -5.41112 1.23E-05 0.001136 1.38028 78 -0.22352 -1.17 down-regulated 7.602952 -4.28176 0.000233 0.005989 -1.5672 79 -0.22186 -1.17 down-regulated 8.173681 -4.77763 6.38E-05 0.002816 -0.27703 80 -0.22184 -1.17 down-regulated 10.80221 -4.9186 4.42E-05 0.002254 0.091757 81 -0.2204 -1.17 down-regulated 7.684852 -4.04669 0.000429 0.009088 -2.17153 82 -0.21987 -1.16 down-regulated 8.390554 -3.72138 0.00099 0.015554 -2.99489 83 -0.21777 -1.16 down-regulated 8.626012 -3.1094 0.004581 0.04424 -4.48095 84 -0.21599 -1.16 down-regulated 10.52579 -4.77015 6.51E-05 0.002852 -0.29658 85 -0.2147 -1.16 down-regulated 7.686309 -4.45476 0.000148 0.00454 -1.1189 86 -0.21118 -1.16 down-regulated 9.595842 -6.1303 1.94E-06 0.000505 3.244812 87 -0.21054 -1.16 down-regulated 9.747585 -4.4196 0.000163 0.004802 -1.2102 88 -0.20996 -1.16 down-regulated 13.65655 -7.42787 7.99E-08 0.000172 6.494498 89 -0.20757 -1.15 down-regulated 12.1162 -4.3486 0.000196 0.005343 -1.39429 90 -0.20752 -1.15 down-regulated 7.908193 -3.54189 0.001562 0.021473 -3.44062 91 -0.20603 -1.15 down-regulated 9.022436 -5.20286 2.11E-05 0.001524 0.835829 92 -0.20472 -1.15 down-regulated 10.4766 -4.19006 0.000296 0.007011 -1.80371 93 -0.20395 -1.15 down-regulated 11.45596 -4.59526 0.000103 0.003689 -0.75319 94 -0.20384 -1.15 down-regulated 10.85048 -4.40076 0.000171 0.004938 -1.25909 95 -0.20313 -1.15 down-regulated 9.492654 -4.52934 0.000122 0.00406 -0.92493 96 -0.20274 -1.15 down-regulated 4.79238 -5.17648 2.26E-05 0.00158 0.766804 97 -0.20115 -1.15 down-regulated 8.577675 -3.14281 0.004222 0.041823 -4.40258 98 -0.20053 -1.15 down-regulated 7.295929 -6.01965 2.57E-06 0.000565 2.960158 99 -0.19996 -1.15 down-regulated 10.55053 -6.62337 5.65E-07 0.000276 4.500361 Page 49 of 76 Diabetes

100 -0.19962 -1.15 down-regulated 6.613389 -3.8571 0.000699 0.012322 -2.65354 101 -0.19937 -1.15 down-regulated 10.41646 -5.56583 8.22E-06 0.000908 1.783809 102 -0.19921 -1.15 down-regulated 9.336067 -5.35526 1.42E-05 0.001223 1.234356 103 -0.19873 -1.15 down-regulated 12.4589 -3.95995 0.000536 0.010402 -2.39273 104 -0.19858 -1.15 down-regulated 10.19993 -5.59914 7.55E-06 0.000862 1.870568 105 -0.19845 -1.15 down-regulated 7.65738 -3.94607 0.000556 0.010643 -2.42803 106 -0.19722 -1.15 down-regulated 14.02814 -5.70128 5.80E-06 0.000781 2.136216 107 -0.19509 -1.14 down-regulated 12.26843 -3.55154 0.001525 0.021044 -3.41685 108 -0.19469 -1.14 down-regulated 7.737046 -5.35289 1.43E-05 0.001223 1.228161 109 -0.19395 -1.14 down-regulated 8.179246 -6.47852 8.10E-07 0.000335 4.133886 110 -0.19351 -1.14 down-regulated 10.77568 -4.22094 0.000273 0.006702 -1.72416 111 -0.19206 -1.14 down-regulated 12.40669 -5.92991 3.23E-06 0.000596 2.72859 112 -0.18756 -1.14 down-regulated 11.11584 -6.12401 1.97E-06 0.000505 3.228678 113 -0.18678 -1.14 down-regulated 10.40902 -4.4894 0.000136 0.004314 -1.02885 114 -0.18581 -1.14 down-regulated 10.26341 -4.71162 7.58E-05 0.003157 -0.44953 115 -0.18533 -1.14 down-regulated 11.75872 -5.21646 2.03E-05 0.001508 0.871415 116 -0.18415 -1.14 down-regulated 8.620591 -4.36716 0.000186 0.005183 -1.34622 117 -0.18361 -1.14 down-regulated 9.055891 -4.45809 0.000147 0.00454 -1.11025 118 -0.18126 -1.13 down-regulated 8.07742 -4.00253 0.000481 0.009769 -2.28429 119 -0.17861 -1.13 down-regulated 7.835013 -4.18575 0.000299 0.007051 -1.81479 120 -0.17808 -1.13 down-regulated 12.35198 -3.50617 0.00171 0.022936 -3.52848 121 -0.17736 -1.13 down-regulated 9.646418 -6.73279 4.31E-07 0.000241 4.775803 122 -0.17708 -1.13 down-regulated 11.59759 -4.89953 4.64E-05 0.002339 0.041836 123 -0.17667 -1.13 down-regulated 3.493692 -3.18107 0.003844 0.039436 -4.31239 124 -0.1763 -1.13 down-regulated 11.64308 -4.34847 0.000196 0.005343 -1.39465 125 -0.17236 -1.13 down-regulated 7.339723 -3.32968 0.002661 0.031163 -3.95774 126 -0.17005 -1.13 down-regulated 9.324128 -5.41089 1.23E-05 0.001136 1.379678 127 -0.16921 -1.12 down-regulated 11.89163 -5.2125 2.05E-05 0.001508 0.861056 128 -0.1686 -1.12 down-regulated 10.01284 -3.97317 0.000518 0.010156 -2.35908 129 -0.16536 -1.12 down-regulated 7.586004 -4.65821 8.72E-05 0.003393 -0.58899 130 -0.16475 -1.12 down-regulated 7.561672 -4.08034 0.000393 0.008552 -2.08543 131 -0.15743 -1.12 down-regulated 12.79961 -4.24256 0.000258 0.006437 -1.66842 132 -0.15464 -1.11 down-regulated 7.366273 -3.81861 0.000772 0.013187 -2.75068 133 -0.15209 -1.11 down-regulated 9.613857 -4.91666 4.44E-05 0.002254 0.086661 134 -0.15186 -1.11 down-regulated 8.977531 -4.70159 7.79E-05 0.00319 -0.47572 135 -0.15069 -1.11 down-regulated 11.48052 -3.16792 0.00397 0.040239 -4.34345 136 -0.1503 -1.11 down-regulated 10.60273 -4.60149 0.000101 0.003647 -0.73694 137 -0.14953 -1.11 down-regulated 12.5752 -4.16231 0.000318 0.007339 -1.87509 138 -0.1469 -1.11 down-regulated 10.79252 -3.05957 0.005172 0.048394 -4.59713 139 -0.14674 -1.11 down-regulated 9.345275 -3.40464 0.002207 0.027247 -3.77642 140 -0.14667 -1.11 down-regulated 9.918443 -3.61945 0.001284 0.018693 -3.24886 141 -0.14626 -1.11 down-regulated 8.786284 -3.83244 0.000745 0.012839 -2.7158 142 -0.14624 -1.11 down-regulated 10.18965 -3.48374 0.001809 0.023805 -3.58348 143 -0.14595 -1.11 down-regulated 11.05087 -6.07666 2.23E-06 0.000535 3.106943 144 -0.14544 -1.11 down-regulated 10.6932 -4.42942 0.000158 0.004736 -1.18472 145 -0.14487 -1.11 down-regulated 9.034176 -5.42682 1.18E-05 0.001128 1.421267 146 -0.14464 -1.11 down-regulated 9.175067 -3.08739 0.004834 0.046109 -4.53237 147 -0.14463 -1.11 down-regulated 6.681396 -3.64363 0.001207 0.017926 -3.18883 148 -0.1442 -1.11 down-regulated 9.226939 -3.12299 0.004432 0.043136 -4.44911 149 -0.14223 -1.10 down-regulated 8.581528 -3.46189 0.001912 0.02466 -3.63692 Diabetes Page 50 of 76

150 -0.14097 -1.10 down-regulated 8.511001 -4.19748 0.00029 0.006962 -1.78461 151 -0.14014 -1.10 down-regulated 11.63164 -3.42452 0.0021 0.026341 -3.72807 152 -0.13955 -1.10 down-regulated 13.71899 -5.759 5.00E-06 0.000722 2.28606 153 -0.13937 -1.10 down-regulated 9.502674 -3.71841 0.000998 0.015647 -3.0023 154 -0.13878 -1.10 down-regulated 9.520937 -3.61397 0.001302 0.018899 -3.26246 155 -0.13831 -1.10 down-regulated 11.41487 -4.26241 0.000245 0.006198 -1.61718 156 -0.13813 -1.10 down-regulated 8.629579 -5.06179 3.04E-05 0.001875 0.466583 157 -0.1346 -1.10 down-regulated 10.27617 -4.544 0.000118 0.003974 -0.88675 158 -0.13233 -1.10 down-regulated 7.165532 -3.94572 0.000557 0.010643 -2.42891 159 -0.13038 -1.09 down-regulated 10.86993 -3.72796 0.000974 0.015369 -2.97842 160 -0.12987 -1.09 down-regulated 9.296414 -3.95214 0.000547 0.010561 -2.41261 161 -0.12939 -1.09 down-regulated 12.31226 -4.55801 0.000113 0.003885 -0.85025 162 -0.12814 -1.09 down-regulated 9.00681 -3.7521 0.000915 0.014674 -2.91792 163 -0.12637 -1.09 down-regulated 10.16075 -3.85936 0.000695 0.012313 -2.64783 164 -0.12514 -1.09 down-regulated 13.08046 -5.36098 1.40E-05 0.001221 1.249301 165 -0.12304 -1.09 down-regulated 12.5197 -4.3651 0.000187 0.005203 -1.35156 166 -0.11991 -1.09 down-regulated 13.22954 -4.4702 0.000142 0.00447 -1.07878 167 -0.11822 -1.09 down-regulated 9.584257 -4.47801 0.00014 0.004408 -1.05846 168 -0.11369 -1.08 down-regulated 13.23613 -3.78733 0.000836 0.013884 -2.82944 169 -0.11232 -1.08 down-regulated 8.501687 -3.23183 0.003392 0.036532 -4.19201 170 -0.10941 -1.08 down-regulated 12.25682 -3.69085 0.00107 0.016419 -3.07119 171 -0.10931 -1.08 down-regulated 12.03262 -3.66716 0.001137 0.017166 -3.13026 172 -0.10896 -1.08 down-regulated 13.98319 -3.47476 0.001851 0.024099 -3.60547 173 -0.1086 -1.08 down-regulated 11.20595 -3.52533 0.001629 0.022188 -3.4814 174 -0.10765 -1.08 down-regulated 8.876278 -3.55557 0.001509 0.020915 -3.40692 175 -0.10312 -1.07 down-regulated 7.852712 -3.97333 0.000518 0.010156 -2.35867 176 -0.09704 -1.07 down-regulated 10.71391 -3.49695 0.00175 0.023268 -3.5511 177 -0.09561 -1.07 down-regulated 10.27755 -3.13504 0.004303 0.042333 -4.42084 178 -0.0895 -1.06 down-regulated 8.029751 -3.26346 0.003137 0.034715 -4.11659 179 -0.08479 -1.06 down-regulated 5.416217 -3.14342 0.004216 0.041782 -4.40115 180 -0.08172 -1.06 down-regulated 6.221616 -3.10724 0.004606 0.044342 -4.48601 181 -0.08138 -1.06 down-regulated 9.344014 -3.08094 0.004911 0.046634 -4.54741 182 -0.08011 -1.06 down-regulated 6.328542 -3.64501 0.001203 0.017904 -3.18539 183 -0.07922 -1.06 down-regulated 9.423938 -3.5747 0.001438 0.020364 -3.35967 184 -0.0767 -1.05 down-regulated 11.18443 -3.76857 0.000878 0.014315 -2.87659 185 -0.07636 -1.05 down-regulated 10.72632 -3.46046 0.001918 0.024718 -3.64043 186 -0.07042 -1.05 down-regulated 5.027274 -3.84821 0.000715 0.012517 -2.676 187 -0.06058 -1.04 down-regulated 8.275431 -3.3326 0.002642 0.03103 -3.9507 188 0.598721 1.51 up-regulated 9.481274 4.526934 0.000123 0.00407 -0.93119 189 0.55789 1.47 up-regulated 8.605054 3.934186 0.000573 0.010815 -2.45822 190 0.497652 1.41 up-regulated 12.03413 6.553979 6.71E-07 0.000305 4.325068 191 0.462559 1.38 up-regulated 7.759116 5.354583 1.42E-05 0.001223 1.232592 192 0.415227 1.33 up-regulated 7.064907 4.5915 0.000104 0.003689 -0.763 193 0.402428 1.32 up-regulated 5.566234 3.816622 0.000776 0.013219 -2.75569 194 0.382008 1.30 up-regulated 8.971949 5.181275 2.23E-05 0.001576 0.779346 195 0.312045 1.24 up-regulated 8.939853 5.087791 2.84E-05 0.001789 0.534653 196 0.311189 1.24 up-regulated 11.98184 4.031919 0.000445 0.009281 -2.20927 197 0.302078 1.23 up-regulated 9.085455 5.094872 2.79E-05 0.001776 0.553191 198 0.291442 1.22 up-regulated 9.455701 3.442413 0.002007 0.025526 -3.68448 199 0.286099 1.22 up-regulated 6.893296 4.619207 9.66E-05 0.003574 -0.69075 Page 51 of 76 Diabetes

200 0.271571 1.21 up-regulated 8.650221 3.120434 0.00446 0.043299 -4.45511 201 0.26778 1.20 up-regulated 9.806244 3.2913 0.002928 0.03312 -4.04996 202 0.253132 1.19 up-regulated 10.88469 3.148734 0.004161 0.041389 -4.38865 203 0.251925 1.19 up-regulated 10.74965 4.606884 9.97E-05 0.003622 -0.72289 204 0.238109 1.18 up-regulated 4.067112 4.342021 0.000199 0.005388 -1.41134 205 0.229076 1.17 up-regulated 7.979302 5.032338 3.28E-05 0.001941 0.389481 206 0.219717 1.16 up-regulated 9.264595 4.532616 0.000121 0.00406 -0.9164 207 0.212264 1.16 up-regulated 8.97143 4.600363 0.000101 0.003651 -0.73989 208 0.20717 1.15 up-regulated 9.159642 4.611924 9.84E-05 0.003615 -0.70974 209 0.202957 1.15 up-regulated 8.780306 4.413265 0.000165 0.004858 -1.22665 210 0.198571 1.15 up-regulated 7.917239 3.927474 0.000583 0.010931 -2.47527 211 0.187965 1.14 up-regulated 9.539443 3.706392 0.001029 0.015986 -3.03236 212 0.175962 1.13 up-regulated 6.521726 3.210796 0.003573 0.037907 -4.24199 213 0.163106 1.12 up-regulated 7.442503 4.174688 0.000308 0.007178 -1.84326 214 0.155707 1.11 up-regulated 6.926153 3.140237 0.004249 0.042024 -4.40863 215 0.147293 1.11 up-regulated 7.6524 3.794349 0.000821 0.013698 -2.81178 216 0.138222 1.10 up-regulated 3.170792 3.737693 0.00095 0.015089 -2.95404 217 0.1251 1.09 up-regulated 9.194909 3.147219 0.004177 0.041479 -4.39222 218 0.118203 1.09 up-regulated 12.26698 3.073264 0.005003 0.047283 -4.56529 219 0.114998 1.08 up-regulated 8.048258 3.320629 0.002722 0.03157 -3.97952 220 0.104801 1.08 up-regulated 7.301186 4.408616 0.000167 0.004896 -1.23871 221 0.100938 1.07 up-regulated 9.303254 3.338389 0.002604 0.030623 -3.93675 222 0.080229 1.06 up-regulated 12.33276 3.30458 0.002833 0.032375 -4.0181 Diabetes Page 52 of 76

Ingenuity Canonical Pathways -log(p-value) 1 Oxidative Phosphorylation 4.03E+01

2 Mitochondrial Dysfunction 3.50E+01

3 Valine Degradation I 1.46E+01

4 Glutaryl-CoA Degradation 1.09E+01 5 Isoleucine Degradation I 9.89E+00 6 Ketogenesis 9.17E+00 7 Fatty Acid β-oxidation I 8.78E+00 8 Tryptophan Degradation III (Eukaryotic) 8.75E+00 9 Ketolysis 8.24E+00 10 TCA Cycle II (Eukaryotic) 8.08E+00 11 Leucine Degradation I 7.47E+00 12 tRNA Charging 6.44E+00 13 Branched-chain α-keto acid Dehydrogenase Complex 5.13E+00 14 Methylmalonyl Pathway 5.13E+00 15 Mevalonate Pathway I 4.98E+00 16 2-oxobutanoate Degradation I 4.74E+00 17 Superpathway of Geranylgeranyldiphosphate Biosynthesis I (via Mevalonate) 4.43E+00 18 Superpathway of Cholesterol Biosynthesis 3.49E+00 19 Glutathione Redox Reactions II 3.34E+00 20 Fatty Acid β-oxidation III (Unsaturated, Odd Number) 3.34E+00 21 Superpathway of Methionine Degradation 3.31E+00 22 Vitamin-C Transport 3.21E+00 23 2-ketoglutarate Dehydrogenase Complex 3.05E+00 24 Biotin-carboxyl Carrier Protein Assembly 3.05E+00 25 Folate Polyglutamylation 2.83E+00 26 Thioredoxin Pathway 2.65E+00 27 Acetyl-CoA Biosynthesis I (Pyruvate Dehydrogenase Complex) 2.65E+00 28 Citrulline Biosynthesis 2.39E+00 29 Folate Transformations I 2.29E+00 30 Ubiquinol-10 Biosynthesis (Eukaryotic) 2.11E+00 31 Methylglyoxal Degradation VI 1.91E+00 32 Superpathway of Citrulline Metabolism 1.90E+00 33 Glutathione Redox Reactions I 1.79E+00 34 UDP-D-xylose and UDP-D-glucuronate Biosynthesis 1.61E+00 35 β-alanine Degradation I 1.61E+00 36 Lipoate Biosynthesis and Incorporation II 1.61E+00 37 L-DOPA Degradation 1.61E+00 38 Alanine Degradation III 1.61E+00 39 Flavin Biosynthesis IV (Mammalian) 1.61E+00 40 Alanine Biosynthesis II 1.61E+00 41 L-cysteine Degradation III 1.61E+00 42 Thiosulfate Disproportionation III (Rhodanese) 1.61E+00 Page 53 of 76 Diabetes

43 Glycine Biosynthesis I 1.61E+00 44 Glutamine Degradation I 1.61E+00 45 Antioxidant Action of Vitamin C 1.58E+00 46 Pyrimidine Ribonucleotides Interconversion 1.45E+00 47 NADH Repair 1.44E+00 48 Ascorbate Recycling (Cytosolic) 1.44E+00 49 S-adenosyl-L-methionine Biosynthesis 1.44E+00 50 4-aminobutyrate Degradation I 1.44E+00 51 Pyrimidine Ribonucleotides De Novo Biosynthesis 1.39E+00 52 Arginine Degradation I (Arginase Pathway) 1.31E+00 53 Noradrenaline and Adrenaline Degradation 1.23E+00 54 Tetrahydrofolate Salvage from 5,10-methenyltetrahydrofolate 1.22E+00 55 Tetrapyrrole Biosynthesis II 1.22E+00 56 Lysine Degradation II 1.22E+00 57 dTMP De Novo Biosynthesis 1.22E+00 58 Glutamate Degradation III (via 4-aminobutyrate) 1.22E+00 59 Arginine Biosynthesis IV 1.14E+00 60 Proline Biosynthesis II (from Arginine) 1.14E+00 61 Arginine Degradation VI (Arginase 2 Pathway) 1.14E+00 62 Superpathway of Serine and Glycine Biosynthesis I 1.08E+00 63 Histidine Degradation III 1.02E+00 64 Salvage Pathways of Pyrimidine Deoxyribonucleotides 1.02E+00 65 Oleate Biosynthesis II (Animals) 9.74E-01 66 Heme Biosynthesis II 9.74E-01 67 NAD Phosphorylation and Dephosphorylation 9.31E-01 68 Glycine Betaine Degradation 9.31E-01 69 Induction of Apoptosis by HIV1 7.81E-01 70 Methionine Degradation I (to Homocysteine) 7.68E-01 71 NRF2-mediated Oxidative Stress Response 7.64E-01 72 PXR/RXR Activation 7.47E-01 73 Granzyme A Signaling 7.19E-01 74 Cysteine Biosynthesis III (mammalia) 7.19E-01 75 Dopamine Degradation 6.56E-01 76 AMPK Signaling 6.55E-01 77 Aryl Hydrocarbon Receptor Signaling 6.42E-01 78 NAD Salvage Pathway II 6.38E-01 79 Pyrimidine Deoxyribonucleotides De Novo Biosynthesis I 6.38E-01 80 Triacylglycerol Degradation 5.87E-01 81 Ethanol Degradation II 5.06E-01 82 Triacylglycerol Biosynthesis 4.72E-01 83 Stearate Biosynthesis I (Animals) 4.72E-01 84 tRNA Splicing 4.51E-01 85 Estrogen Biosynthesis 4.51E-01 86 Role of RIG1-like Receptors in Antiviral Innate Immunity 3.98E-01 87 LXR/RXR Activation 3.58E-01 88 Heparan Sulfate Biosynthesis (Late Stages) 3.53E-01 89 Serotonin Degradation 3.53E-01 90 Estrogen Receptor Signaling 3.34E-01 91 LPS/IL-1 Mediated Inhibition of RXR Function 3.33E-01 92 Phospholipases 3.27E-01 Diabetes Page 54 of 76

93 Semaphorin Signaling in Neurons 3.21E-01 94 Cardiac β-adrenergic Signaling 3.11E-01 95 Heparan Sulfate Biosynthesis 3.10E-01 96 Actin Nucleation by ARP-WASP Complex 2.99E-01 97 Glutamate Receptor Signaling 2.99E-01 98 Glioma Invasiveness Signaling 2.93E-01 99 Retinoic acid Mediated Apoptosis Signaling 2.88E-01 100 Eicosanoid Signaling 2.88E-01 101 Activation of IRF by Cytosolic Pattern Recognition Receptors 2.78E-01 102 Huntington's Disease Signaling 2.76E-01 103 Estrogen-Dependent Breast Cancer Signaling 2.73E-01 104 Role of MAPK Signaling in the Pathogenesis of Influenza 2.64E-01 105 Remodeling of Epithelial Adherens Junctions 2.60E-01 106 Aldosterone Signaling in Epithelial Cells 2.54E-01 107 Renal Cell Carcinoma Signaling 2.38E-01 108 Dopamine Receptor Signaling 2.09E-01 Page 55 of 76 Diabetes

p-value Ratio z-score Downregulated No change 1 5.01E-41 3.54E-01 34/96 (35%) 0/96 (0%)

2 1.00E-35 2.29E-01 35/157 (22%) 0/157 (0%)

3 2.51E-15 5.56E-01 10/18 (56%) 0/18 (0%)

4 1.26E-11 6.36E-01 7/11 (64%) 0/11 (0%) 5 1.29E-10 5E-01 7/14 (50%) 0/14 (0%) 6 6.76E-10 6E-01 6/10 (60%) 0/10 (0%) 7 1.66E-09 2.76E-01 8/29 (28%) 0/29 (0%) 8 1.78E-09 3.68E-01 7/19 (37%) 0/19 (0%) 9 5.75E-09 7.14E-01 5/7 (71%) 0/7 (0%) 10 8.32E-09 3.04E-01 7/23 (30%) 0/23 (0%) 11 3.39E-08 5.56E-01 5/9 (56%) 0/9 (0%) 12 3.63E-07 1.84E-01 3/38 (8%) 0/38 (0%) 13 7.41E-06 7.50E-01 3/4 (75%) 0/4 (0%) 14 7.41E-06 7.50E-01 3/4 (75%) 0/4 (0%) 15 1.05E-05 3.33E-01 4/12 (33%) 0/12 (0%) 16 1.82E-05 6E-01 3/5 (60%) 0/5 (0%) 17 3.72E-05 2.50E-01 4/16 (25%) 0/16 (0%) 18 0.00032 1.48E-01 4/27 (15%) 0/27 (0%) 19 0.00046 6.67E-01 0/3 (0%) 0/3 (0%) 20 0.00046 6.67E-01 2/3 (67%) 0/3 (0%) 21 0.00049 1.33E-01 4/30 (13%) 0/30 (0%) 22 0.00062 2.14E-01 0/14 (0%) 0/14 (0%) 23 0.00089 5E-01 2/4 (50%) 0/4 (0%) 24 0.00089 5E-01 2/4 (50%) 0/4 (0%) 25 0.00148 4E-01 2/5 (40%) 0/5 (0%) 26 0.00224 3.33E-01 0/6 (0%) 0/6 (0%) 27 0.00224 3.33E-01 2/6 (33%) 0/6 (0%) 28 0.00407 2.50E-01 0/8 (0%) 0/8 (0%) 29 0.00513 2.22E-01 2/9 (22%) 0/9 (0%) 30 0.00776 1.82E-01 2/11 (18%) 0/11 (0%) 31 0.01230 1E00 1/1 (100%) 0/1 (0%) 32 0.01259 1.43E-01 0/14 (0%) 0/14 (0%) 33 0.01622 1.25E-01 1/16 (6%) 0/16 (0%) 34 0.02455 5E-01 0/2 (0%) 0/2 (0%) 35 0.02455 5E-01 1/2 (50%) 0/2 (0%) 36 0.02455 5E-01 1/2 (50%) 0/2 (0%) 37 0.02455 5E-01 0/2 (0%) 0/2 (0%) 38 0.02455 5E-01 1/2 (50%) 0/2 (0%) 39 0.02455 5E-01 0/2 (0%) 0/2 (0%) 40 0.02455 5E-01 1/2 (50%) 0/2 (0%) 41 0.02455 5E-01 1/2 (50%) 0/2 (0%) 42 0.02455 5E-01 1/2 (50%) 0/2 (0%) Diabetes Page 56 of 76

43 0.02455 5E-01 1/2 (50%) 0/2 (0%) 44 0.02455 5E-01 0/2 (0%) 0/2 (0%) 45 0.02630 4.40E-02 1/91 (1%) 0/91 (0%) 46 0.03548 8.33E-02 1/24 (4%) 0/24 (0%) 47 0.03631 3.33E-01 0/3 (0%) 0/3 (0%) 48 0.03631 3.33E-01 0/3 (0%) 0/3 (0%) 49 0.03631 3.33E-01 1/3 (33%) 0/3 (0%) 50 0.03631 3.33E-01 1/3 (33%) 0/3 (0%) 51 0.04074 7.69E-02 1/26 (4%) 0/26 (0%) 52 0.04898 2.50E-01 0/4 (0%) 0/4 (0%) 53 0.05888 6.25E-02 1/32 (3%) 0/32 (0%) 54 0.06026 2E-01 1/5 (20%) 0/5 (0%) 55 0.06026 2E-01 0/5 (0%) 0/5 (0%) 56 0.06026 2E-01 1/5 (20%) 0/5 (0%) 57 0.06026 2E-01 1/5 (20%) 0/5 (0%) 58 0.06026 2E-01 1/5 (20%) 0/5 (0%) 59 0.07244 1.67E-01 0/6 (0%) 0/6 (0%) 60 0.07244 1.67E-01 0/6 (0%) 0/6 (0%) 61 0.07244 1.67E-01 0/6 (0%) 0/6 (0%) 62 0.08318 1.43E-01 1/7 (14%) 0/7 (0%) 63 0.09550 1.25E-01 1/8 (13%) 0/8 (0%) 64 0.09550 1.25E-01 0/8 (0%) 0/8 (0%) 65 0.10617 1.11E-01 1/9 (11%) 0/9 (0%) 66 0.10617 1.11E-01 0/9 (0%) 0/9 (0%) 67 0.11722 1E-01 1/10 (10%) 0/10 (0%) 68 0.11722 1E-01 1/10 (10%) 0/10 (0%) 69 0.16558 3.39E-02 2/59 (3%) 0/59 (0%) 70 0.17061 6.67E-02 1/15 (7%) 0/15 (0%) 71 0.17219 2.29E-02 2,000 0/175 (0%) 0/175 (0%) 72 0.17906 3.23E-02 1/62 (2%) 0/62 (0%) 73 0.19099 5.88E-02 0/17 (0%) 0/17 (0%) 74 0.19099 5.88E-02 1/17 (6%) 0/17 (0%) 75 0.22080 5E-02 0/20 (0%) 0/20 (0%) 76 0.22131 2.29E-02 3/131 (2%) 0/131 (0%) 77 0.22803 2.26E-02 2/133 (2%) 0/133 (0%) 78 0.23014 4.76E-02 1/21 (5%) 0/21 (0%) 79 0.23014 4.76E-02 0/21 (0%) 0/21 (0%) 80 0.25882 4.17E-02 1/24 (4%) 0/24 (0%) 81 0.31189 3.33E-02 1/30 (3%) 0/30 (0%) 82 0.33729 3.03E-02 1/33 (3%) 0/33 (0%) 83 0.33729 3.03E-02 1/33 (3%) 0/33 (0%) 84 0.35400 2.86E-02 0/35 (0%) 0/35 (0%) 85 0.35400 2.86E-02 1/35 (3%) 0/35 (0%) 86 0.39994 2.44E-02 1/41 (2%) 0/41 (0%) 87 0.43853 1.67E-02 2/120 (2%) 0/120 (0%) 88 0.44361 2.13E-02 1/47 (2%) 0/47 (0%) 89 0.44361 2.13E-02 1/47 (2%) 0/47 (0%) 90 0.46345 1.59E-02 2/126 (2%) 0/126 (0%) 91 0.46452 1.47E-02 2/204 (1%) 0/204 (0%) 92 0.47098 1.96E-02 1/51 (2%) 0/51 (0%) Page 57 of 76 Diabetes

93 0.47753 1.92E-02 1/52 (2%) 0/52 (0%) 94 0.48865 1.52E-02 1/132 (1%) 0/132 (0%) 95 0.48978 1.85E-02 1/54 (2%) 0/54 (0%) 96 0.50234 1.79E-02 1/56 (2%) 0/56 (0%) 97 0.50234 1.79E-02 0/56 (0%) 0/56 (0%) 98 0.50933 1.75E-02 1/57 (2%) 0/57 (0%) 99 0.51523 1.72E-02 1/58 (2%) 0/58 (0%) 100 0.51523 1.72E-02 1/58 (2%) 0/58 (0%) 101 0.52723 1.67E-02 1/60 (2%) 0/60 (0%) 102 0.52966 1.33E-02 2/225 (1%) 0/225 (0%) 103 0.53333 1.64E-02 1/61 (2%) 0/61 (0%) 104 0.54450 1.59E-02 1/63 (2%) 0/63 (0%) 105 0.54954 1.56E-02 0/64 (0%) 0/64 (0%) 106 0.55719 1.33E-02 1/150 (1%) 0/150 (0%) 107 0.57810 1.45E-02 1/69 (1%) 0/69 (0%) 108 0.61802 1.30E-02 0/77 (0%) 0/77 (0%) Diabetes Page 58 of 76

Upregulated No overlap with datasetMolecules 1 0/96 (0%) 62/96 (65%) SDHB,COX6C,COX5B,NDUFB5,COX8A,ATP5L,ATP5G2,NDUFB8,ATP5S,ND UFA2,NDUFB10,NDUFS1,NDUFAB1,ATPAF1,ATP5I,COX4I1,NDUFA8,NDU FS4,ATP5O,ATP5A1,COX7C,NDUFS3,UQCRB,ATP5C1,COX11,NDUFB11,A TP5B,NDUFA6,CYC1,UQCRC2,COX7A2,NDUFA12,SDHD,UQCRC1

2 1/157 (1%) 121/157 (77%) SDHB,COX6C,COX5B,NDUFB5,COX8A,ATP5L,ATP5G2,NDUFB8,ATP5S,ND UFA2,NDUFB10,NDUFS1,NDUFAB1,ATPAF1,ATP5I,COX4I1,NDUFA8,NDU FS4,ATP5O,ATP5A1,COX7C,NDUFS3,UQCRB,GSR,ATP5C1,COX11,NDUFB 11,ATP5B,NDUFA6,TXN2,CYC1,UQCRC2,COX7A2,NDUFA12,SDHD,UQCR C1 3 0/18 (0%) 8/18 (44%) HADHB,HIBADH,BCKDHA,AUH,ACAD8,ACADSB,DBT,ALDH6A1,HADHA,B CKDHB 4 0/11 (0%) 4/11 (36%) HADHB,ACAT2,ACAT1,HADHA,HADH,GCDH,HSD17B8 5 0/14 (0%) 7/14 (50%) HADHB,ACAT2,AUH,ACAD8,ACAT1,ACADSB,HADHA 6 0/10 (0%) 4/10 (40%) HADHB,BDH1,ACAT2,ACAT1,HMGCL,HADHA 7 0/29 (0%) 21/29 (72%) HADHB,ECI2,AUH,ACADM,ECI1,HADHA,HADH,HSD17B8 8 0/19 (0%) 12/19 (63%) HADHB,ACAT2,ACAT1,HADHA,HADH,GCDH,HSD17B8 9 0/7 (0%) 2/7 (29%) HADHB,BDH1,ACAT2,ACAT1,HADHA 10 0/23 (0%) 16/23 (70%) SDHB,DHTKD1,SUCLG1,DLST,SDHD,FH,IDH3B 11 0/9 (0%) 4/9 (44%) AUH,MCCC1,HMGCL,ACADM,MCCC2 12 4/38 (11%) 31/38 (82%) WARS2,NARS,RARS2,GARS,KARS,LARS2,MARS 13 0/4 (0%) 1/4 (25%) BCKDHA,DBT,BCKDHB 14 0/4 (0%) 1/4 (25%) PCCA,PCCB,MUT 15 0/12 (0%) 8/12 (67%) HADHB,ACAT2,ACAT1,HADHA 16 0/5 (0%) 2/5 (40%) PCCA,PCCB,MUT 17 0/16 (0%) 12/16 (75%) HADHB,ACAT2,ACAT1,HADHA 18 0/27 (0%) 23/27 (85%) HADHB,ACAT2,ACAT1,HADHA 19 2/3 (67%) 1/3 (33%) GSR,GLRX 20 0/3 (0%) 1/3 (33%) ECI2,ECI1 21 0/30 (0%) 26/30 (87%) PCCA,PCCB,MAT2B,MUT 22 3/14 (21%) 11/14 (79%) TXN,GLRX,TXNRD1 23 0/4 (0%) 2/4 (50%) DHTKD1,DLST 24 0/4 (0%) 2/4 (50%) ACACB,ACACA 25 0/5 (0%) 3/5 (60%) SHMT1,MTHFD1 26 2/6 (33%) 4/6 (67%) TXN,TXNRD1 27 0/6 (0%) 4/6 (67%) DBT,PDHB 28 2/8 (25%) 6/8 (75%) GLS,OAT 29 0/9 (0%) 7/9 (78%) SHMT1,MTHFD1 30 0/11 (0%) 9/11 (82%) BCKDHA,BCKDHB 31 0/1 (0%) 0/1 (0%) LDHD 32 2/14 (14%) 12/14 (86%) GLS,OAT 33 1/16 (6%) 14/16 (88%) GSR,PRDX6 34 1/2 (50%) 1/2 (50%) UXS1 35 0/2 (0%) 1/2 (50%) ALDH6A1 36 0/2 (0%) 1/2 (50%) LIAS 37 1/2 (50%) 1/2 (50%) COMT 38 0/2 (0%) 1/2 (50%) GPT2 39 1/2 (50%) 1/2 (50%) RFK 40 0/2 (0%) 1/2 (50%) GPT2 41 0/2 (0%) 1/2 (50%) MPST 42 0/2 (0%) 1/2 (50%) TST Page 59 of 76 Diabetes

43 0/2 (0%) 1/2 (50%) SHMT1 44 1/2 (50%) 1/2 (50%) GLS 45 3/91 (3%) 87/91 (96%) TXN,GLRX,TXNRD1,PRDX6 46 1/24 (4%) 22/24 (92%) NME1,CTPS2 47 1/3 (33%) 2/3 (67%) APOA1BP 48 1/3 (33%) 2/3 (67%) GLRX 49 0/3 (0%) 2/3 (67%) MAT2B 50 0/3 (0%) 2/3 (67%) SUCLG2 51 1/26 (4%) 24/26 (92%) NME1,CTPS2 52 1/4 (25%) 3/4 (75%) OAT 53 1/32 (3%) 30/32 (94%) COMT,ADHFE1 54 0/5 (0%) 4/5 (80%) MTHFD1 55 1/5 (20%) 4/5 (80%) ALAS1 56 0/5 (0%) 4/5 (80%) AASS 57 0/5 (0%) 4/5 (80%) SHMT1 58 0/5 (0%) 4/5 (80%) SUCLG2 59 1/6 (17%) 5/6 (83%) OAT 60 1/6 (17%) 5/6 (83%) OAT 61 1/6 (17%) 5/6 (83%) OAT 62 0/7 (0%) 6/7 (86%) SHMT1 63 0/8 (0%) 7/8 (88%) MTHFD1 64 1/8 (13%) 7/8 (88%) TK2 65 0/9 (0%) 8/9 (89%) ALDH6A1 66 1/9 (11%) 8/9 (89%) ALAS1 67 0/10 (0%) 9/10 (90%) ACP6 68 0/10 (0%) 9/10 (90%) SHMT1 69 0/59 (0%) 57/59 (97%) SLC25A6,SLC25A4 70 0/15 (0%) 14/15 (93%) MAT2B 71 4/175 (2%) 171/175 (98%) GSR,TXN,TXNRD1,FTH1 72 1/62 (2%) 60/62 (97%) PCK2,ALAS1 73 1/17 (6%) 16/17 (94%) NME1 74 0/17 (0%) 16/17 (94%) MAT2B 75 1/20 (5%) 19/20 (95%) COMT 76 0/131 (0%) 128/131 (98%) ACACB,ACACA,MLYCD 77 1/133 (1%) 130/133 (98%) ALDH1L1,HSPB7,ALDH6A1 78 0/21 (0%) 20/21 (95%) ACP6 79 1/21 (5%) 20/21 (95%) NME1 80 0/24 (0%) 23/24 (96%) PRDX6 81 0/30 (0%) 29/30 (97%) ADHFE1 82 0/33 (0%) 32/33 (97%) DBT 83 0/33 (0%) 32/33 (97%) DBT 84 1/35 (3%) 34/35 (97%) PDE12 85 0/35 (0%) 34/35 (97%) HSD17B8 86 0/41 (0%) 40/41 (98%) MAVS 87 0/120 (0%) 118/120 (98%) ACACA,HADH 88 0/47 (0%) 46/47 (98%) PRDX6 89 0/47 (0%) 46/47 (98%) ADHFE1 90 0/126 (0%) 124/126 (98%) PCK2,PHB2 91 1/204 (0%) 201/204 (99%) ALDH1L1,ALAS1,ALDH6A1 92 0/51 (0%) 50/51 (98%) PRDX6 Diabetes Page 60 of 76

93 0/52 (0%) 51/52 (98%) RHOT1 94 1/132 (1%) 130/132 (98%) PDE12,AKAP1 95 0/54 (0%) 53/54 (98%) PRDX6 96 0/56 (0%) 55/56 (98%) RHOT1 97 1/56 (2%) 55/56 (98%) GLS 98 0/57 (0%) 56/57 (98%) RHOT1 99 0/58 (0%) 57/58 (98%) DAP3 100 0/58 (0%) 57/58 (98%) PRDX6 101 0/60 (0%) 59/60 (98%) MAVS 102 1/225 (0%) 222/225 (99%) SDHB,ATP5B,GLS 103 0/61 (0%) 60/61 (98%) HSD17B8 104 0/63 (0%) 62/63 (98%) PRDX6 105 1/64 (2%) 63/64 (98%) NME1 106 1/150 (1%) 148/150 (99%) DNAJC27,HSPB7 107 0/69 (0%) 68/69 (99%) FH 108 1/77 (1%) 76/77 (99%) COMT Page 61 of 76 Diabetes

Predicted Upstream Activation Molecule Type Activation p-value of overlap Regulator z-score State 1 APOA2 transporter 4.90E-02 2 SLC2A1 transporter 3.70E-02 3 ABCB7 transporter 2.48E-02 4 SLC25A10 transporter 1.25E-02 5 IGF1R transmembrane receptor Inhibited -2.714 1.25E-08

6 IREB2 translation regulator 2.48E-02 7 FOXO1 transcription regulator Inhibited -3.464 4.31E-07

8 PPARGC1A transcription regulator Inhibited -2.823 1.08E-08

9 KMT2D transcription regulator Inhibited -2.236 0.0272 10 PPARGC1B transcription regulator Inhibited -2.219 1.25E-05 11 KLF15 transcription regulator Inhibited -2.121 3.19E-09

12 HNF1A transcription regulator Inhibited -2 6.16E-03

13 Esrra transcription regulator -1.86 5.23E-10

14 NRIP1 transcription regulator 1.134 4.69E-07

15 NFE2L2 transcription regulator 1.58 9.93E-03

16 HDAC5 transcription regulator 1.10E-02 17 NRF1 transcription regulator 5.26E-03 18 MED30 transcription regulator 1.86E-02 19 HAND1 transcription regulator 2.08E-02 20 BCL3 transcription regulator 3.57E-02 21 ATF4 transcription regulator 1.93E-02 22 TFAM transcription regulator 1.36E-03 23 MLXIPL transcription regulator 2.08E-02 24 SIRT1 transcription regulator 4.23E-02 25 HTT transcription regulator 3.25E-02

26 SERTAD2 transcription regulator 1.28E-02 27 LPIN1 phosphatase 1.46E-02 28 PTEN phosphatase Inhibited -2.543 6.45E-05

29 OMA1 peptidase 1.10E-02 30 PSME3 peptidase 4.90E-02 31 PSEN1 peptidase 2.02E-03

32 MALSU1 other 3.70E-02 33 PLIN5 other 3.19E-03 Diabetes Page 62 of 76

34 HIST1H1T other -1 2.09E-02 35 MRPL14 other 4.90E-02 36 RICTOR other Activated 5.099 4.16E-18

37 MAPT other 7.43E-05

38 ELAVL1 other 2.84E-02 39 APP other 6.35E-03

40 SCO2 other 1.25E-02 41 FANCD2 other 3.70E-02 42 INS other 0.218 1.78E-02 43 RPTOR other 2.08E-02 44 PLIN1 other 2.13E-07 45 Hist1h1a other -1 2.09E-02 46 PPARG ligand-dependent nuclear receptor -1.516 2.44E-05

47 PPARA ligand-dependent nuclear receptor Inhibited -2.226 1.32E-06

48 NR0B2 ligand-dependent nuclear receptor 4.43E-02 49 ESRRA ligand-dependent nuclear receptor -0.6 1.04E-04 50 CDK1 kinase 3.70E-02 51 PCK1 kinase 7.91E-03 52 MAP4K4 kinase Activated 4.583 2.83E-19

53 INSR kinase Inhibited -4.013 5.61E-11

54 ERBB2 kinase 1.53E-02

55 CLCN7 ion channel 1.25E-02 56 FGF21 growth factor -1.964 4.38E-04 57 GH1 growth factor -1 3.07E-04

58 HBEGF growth factor 4.90E-02 59 FGF19 growth factor 2.30E-02 60 Pde group 4.90E-02 61 NRG (family) group 1.25E-02 62 CPT1C enzyme 3.12E-03 63 NDUFAB1 enzyme 2.48E-02 64 ALDH1A1 enzyme 5.26E-03 65 FKBP4 enzyme 1.46E-02 Page 63 of 76 Diabetes

66 HSD11B1 enzyme 3.85E-02 67 ACLY enzyme 4.90E-02 68 ABHD5 enzyme 2.48E-02 69 POR enzyme 4.40E-02 70 FTL enzyme 2.48E-02 71 GNA12 enzyme 9.42E-03 72 FBXL5 enzyme 3.70E-02 73 APC enzyme 4.13E-05

74 GPX1 enzyme 6.44E-04 75 ACACB enzyme 1.28E-02 Diabetes Page 64 of 76

Mechanist Target molecules in dataset ic Network 1 ACADM 2 ACACA 3 TXN 4 ACACA 5 ACADM,ATP5A1,ATP5B,ATP5L,ATP5O,ATP5S,COX 4I1,FTH1,HADHA,NME1,SLC25A20,TXN,UQCRC1,U QCRC2 6 FTH1 7 ACACA,ATP5B,MAVS,MRPL45,MRPL46,MRPL57,M RPS18A,MRPS2,MRPS22,MRPS30,MRPS7,NDUFA1 2,NDUFA8,PDHB 8 ACACA,ACACB,ACADM,ALAS1,ATP5B,ATP5O,COX 4I1,NDUFB5,NDUFS1,PDK4,TXN2 9 ACADM,ECI2,HDDC2,OXR1,SFXN4 10 ACACA,ACACB,ACADM,COX4I1,PDK4 11 ACADM,DECR1,HADHA,HADHB,MLYCD,PDK4,PXM P2,SLC25A20 12 CCBL2,COQ7,FH,GARS,MCCC1,PDK1,SFXN2,UQCR C2 13 ACADM,ATP5B,ATP5O,COX8A,CYC1,NDUFA2,NDU FS3,PCK2,PDK1,PDK4,SDHB 14 ACACA,ACACB,HADHB,PDK2,PDK4,SDHB,SLC25A2 0 15 ALAS1,COQ7,FTH1,GSR,MRPS18B,NARS,OAT,TXN, TXNRD1 16 ACADM,ATP5B 17 FTH1,SDHD 18 SDHB,SDHD 19 ACACA,MLYCD 20 ACADM,PDK4 21 GARS,MRPS7,NARS,PCK2 22 ACADM,AUH,SLC25A20 23 ACACA,ACACB 24 ACADM,PC,PDK4 25 ACADM,ATP5A1,ATP5B,DLST,GSR,NDUFA12,NDU FS3,PC,SDHB,TRAP1 26 CYC1,PHYH 27 ACACA,ACADM 28 ACACA,HADH,HADHA,HADHB,IDH3B,PDHB,SDHB, SDHD,SUCLG1,SUCLG2 29 COX4I1,UQCRC2 30 ACACA 31 ATP5A1,ATP5B,ATP5C1,COX7A2,COX8A,NDUFA8, NDUFS4,NME1,PRDX6,SUCLG1,TXN 32 COX4I1 33 ACADM,PDK4,TXNRD1 Page 65 of 76 Diabetes

34 MARS,MRPL38,PCCB,PHB2 35 COX4I1 36 ATP5A1,ATP5B,ATP5C1,ATP5G2,ATP5L,ATP5O,CO X11,COX4I1,COX7A2,COX8A,CYC1,NDUFA2,NDUF A6,NDUFA8,NDUFAB1,NDUFB10,NDUFB5,NDUFB 8,NDUFS1,NDUFS3,NDUFS4,SDHB,SDHD,UQCRB, UQCRC1,UQCRC2 37 ATP5A1,ATP5B,ATP5C1,COX7A2,NDUFA8,NDUFS3 ,NDUFS4,NME1,PRDX6,SUCLG1,TXN 38 NDUFB8,RPS14,TIMM17A 39 ATP5A1,ATP5B,ATP5C1,COX7A2,NDUFA8,NDUFS4 ,NME1,PRDX6,SUCLG1,TXN 40 COX4I1 41 TXNRD1 42 ACACA,ACADM,ATP5A1,COX4I1 43 ACADM,COX4I1 44 ACACA,ACACB,ACADM,HADHA,HADHB 45 MARS,MRPL38,PCCB,PHB2 46 ACACA,ACADM,ATP5O,BDH1,HADHA,HADHB,MLY CD,OXR1,PC,PDHB,PDK4,SLC25A20,VAMP8

47 ACACA,ACADM,ACAT1,ACAT2,ATP5B,DECR1,ECI1, ECI2,HADH,HADHA,HADHB,MLYCD,PC,PDK4,PRDX 6,SLC25A20 48 ACACA,ACADM 49 ACADM,ALAS1,ATP5B,HADHA,MTCH2 50 NDUFB10 51 ACADM,MLYCD 52 ACACA,ACACB,AUH,BCKDHB,CCBL2,COX11,CYC1, DLST,GCDH,HADH,HADHA,HADHB,HMGCL,NDUFA B1,NDUFS1,NDUFS4,PDHX,PHYH,PXMP2,SUCLG1, UQCRC1 53 ACADM,ALDH6A1,ATP5A1,ATP5B,ATP5L,ATP5O,A TP5S,COX4I1,CYC1,DECR1,ECI1,ETFA,FH,HADHA,H ADHB,PDHB,PDK4,SLC25A20,TK2,UQCRC1,UQCRC 2 54 CHCHD10,DECR1,HADHB,MCCC1,NDUFAB1,PHYH

55 ATP5G2 56 ACACA,ACADM,BDH1,HMGCL 14 (2) 57 ACACA,ATP5G2,COMT,DECR1,FTH1,GCDH,HADH

58 PDK4 59 ACACA,ACACB 60 ATP5A1 61 GSR 62 ACADM,PDK4 63 DBT 64 ACACA,ACADM 65 PDK4,PRDX6 Diabetes Page 66 of 76

66 ACACA,PDK4 67 ACACA 68 PDK4 69 ACAT2,BDH1,ECI1,HADHB,PDK4 70 FTH1 71 GSR,TXNRD1 9 (2) 72 FTH1 73 FH,HADHB,PDK2,PDK4,SDHB,SUCLG1,SUCLG2

74 GLRX,PRDX6,TXN,TXN2 75 ACACA,ACACB Page 67 of 76 Diabetes

Mitochondrial ribosomal protein subunits used for the mean centroid

MRPL Mitochondrial MRPS Mitochondrial ribosomal protein ribosomal protein small large subunits subunits MRPL1 MRPS10 MRPL10 MRPS11 MRPL11 MRPS12 MRPL12 MRPS14 MRPL14 MRPS15 MRPL15 MRPS17 MRPL16 MRPS18A MRPL17 MRPS18B MRPL18 MRPS18C MRPL19 MRPS2 MRPL2 MRPS21 MRPL20 MRPS22 MRPL21 MRPS23 MRPL22 MRPS24/URGCP MRPL23 MRPS25 MRPL24 MRPS26 MRPL27 MRPS27 MRPL28 MRPS28 MRPL3 MRPS30 MRPL30 MRPS31 MRPL32 MRPS31P3/THSD1 MRPL33 MRPS33 MRPL34 MRPS34 MRPL35 MRPS35 MRPL36 MRPS36 MRPL37 MRPS5 MRPL38 MRPS6 MRPL39 MRPS7 MRPL4 MRPS9 MRPL40 MRPS16 MRPL41 MRPL42 MRPL43 MRPL44 MRPL45 MRPL46 MRPL47 MRPL48 MRPL49 MRPL50 MRPL51 MRPL52 MRPL54 MRPL55 Diabetes Page 68 of 76

MRPL9 MRPL53 MRPL13 MRPL30 MRPL57/MRP63 MRPL56/LACTB

The discordant twin pairs for the mean centroid calculation

Twins mean MRPS mean MRPL Lean_twin_1 -0.2996 -0.3897 Lean_twin_2 0.7387 0.9781 Lean_twin_3 -0.7013 -0.6937 Lean_twin_4 -0.0175 -0.4566 Lean_twin_5 0.5053 0.4007 Lean_twin_6 0.2993 0.2255 Lean_twin_7 -0.4546 -0.4847 Lean_twin_8 -0.4682 -0.5415 Lean_twin_9 0.1655 -0.3222 Lean_twin_10 1.0322 0.7125 Lean_twin_11 0.2490 -0.2780 Lean_twin_12 -0.3562 -0.2677 Lean_twin_13 -0.1645 -0.3363 Lean_twin_14 -0.7994 -0.4858 Lean_twin_15 -0.7263 -0.8094 Lean_twin_16 0.1624 0.2740 Lean_twin_17 0.0179 -0.2890 Lean_twin_18 0.9154 0.8843 Lean_twin_19 0.3598 -0.0834 Lean_twin_20 -0.1171 -0.1327 Lean_twin_21 -0.0657 0.0268 Lean_twin_22 -0.3427 -0.2707 Lean_twin_23 0.2975 0.7230 Lean_twin_24 -0.0198 0.0651 Lean_twin_25 0.4316 0.4633 Lean_twin_26 0.0611 -0.0546 Heavy_twin_1 -0.9954 -0.7044 Heavy_twin_2 0.6098 1.2012 Heavy_twin_3 -1.5610 -1.4428 Heavy_twin_4 -0.8437 -1.0060 Heavy_twin_5 0.0346 0.2515 Heavy_twin_6 -0.2063 -0.0274 Heavy_twin_7 -0.2996 -0.5106 Heavy_twin_8 -0.5270 -0.5783 Heavy_twin_9 -0.5881 -0.8764 Heavy_twin_10 0.7170 0.8097 Heavy_twin_11 -0.1888 -0.3673 Heavy_twin_12 -0.6033 -0.4571 Heavy_twin_13 -0.4157 -0.4154 Page 69 of 76 Diabetes

Heavy_twin_14 -0.5929 -0.3104 Heavy_twin_15 -1.1259 -1.2188 Heavy_twin_16 -0.1127 -0.2134 Heavy_twin_17 -0.5787 -0.7060 Heavy_twin_18 0.6507 0.6583 Heavy_twin_19 -0.4259 -0.5458 Heavy_twin_20 -0.2314 -0.2460 Heavy_twin_21 0.0258 0.3052 Heavy_twin_22 -0.4547 -0.4040 Heavy_twin_23 -0.3701 -0.2821 Heavy_twin_24 -0.3262 -0.1372 Heavy_twin_25 0.0429 0.2354 Heavy_twin_26 0.1980 0.3144 Diabetes Page 70 of 76

Differentially methylated CpG sites in the differentially expressed 222 genes

Number Methylation Probe ENTRZ-ID Gene symbol logFC P.Value adj.P.Val 1 cg25654242 54148 MRPL39 0.386457 3.7E-05 0.023908036 2 cg12910830 27430 MAT2B 0.365976 3.75E-05 0.023908036 3 cg16707423 56997 ADCK3 0.414884 9.24E-05 0.03931979 4 cg00786909 56997 ADCK3 0.435924 0.000252 0.08048611 5 cg12178147 32 ACACB 0.441474 0.000327 0.083478177 6 cg08924256 55074 OXR1 -0.33495 0.000548 0.101765778 7 cg19913448 2936 GSR 0.250235 0.000558 0.101765778 8 cg19367436 1347 COX7A2 0.321744 0.000825 0.112172589 9 cg15784784 5091 PC 0.221223 0.000869 0.112172589 10 cg16268707 5091 PC 0.466626 0.000879 0.112172589 11 cg01631215 8801 SUCLG2 -0.33402 0.001005 0.116613973 12 cg25974484 56997 ADCK3 0.302991 0.001456 0.154821014 13 cg08866695 32 ACACB 0.249248 0.001996 0.176573079 14 cg06522179 5170 PDPK1 0.293302 0.002038 0.176573079 15 cg11654662 6470 SHMT1 0.378489 0.002174 0.176573079 16 cg02354658 2745 GLRX -0.31477 0.002267 0.176573079 17 cg06049177 2936 GSR -0.24855 0.002352 0.176573079 18 cg22230912 92106 OXNAD1 0.293889 0.002546 0.180507678 19 cg05380921 84706 GPT2 0.243497 0.003137 0.188332873 20 cg12422199 54931 TRMT10C -0.23236 0.003196 0.188332873 21 cg09326087 56997 ADCK3 0.292876 0.003467 0.188332873 22 cg06483820 8165 AKAP1 0.267345 0.003493 0.188332873 23 cg08690028 5624 PROC 0.223132 0.003848 0.188332873 24 cg06002638 32 ACACB 0.245997 0.003897 0.188332873 25 cg18941211 6646 SOAT1 -0.28729 0.003978 0.188332873 26 cg22628608 137872 ADHFE1 0.261564 0.004192 0.188332873 27 cg22758834 5166 PDK4 0.312913 0.004489 0.188332873 28 cg15534272 5091 PC 0.2509 0.004491 0.188332873 29 cg12250062 5624 PROC 0.221002 0.004524 0.188332873 30 cg08733553 4706 NDUFAB1 0.239001 0.004552 0.188332873 31 cg00806900 32 ACACB 0.305162 0.004583 0.188332873 32 cg18776287 51116 MRPS2 0.200636 0.004723 0.188332873 33 cg00715343 7083 TK1 0.391826 0.004923 0.190373535 34 cg07819926 154791 C7orf55 -0.19737 0.005104 0.191532159 35 cg11022519 5096 PCCB 0.241775 0.005596 0.204004067 36 cg11647493 10455 ECI2 0.176587 0.006173 0.215450754 37 cg05640320 5091 PC 0.242937 0.006443 0.215450754 38 cg18797132 26355 FAM162A -0.22686 0.006487 0.215450754 39 cg15971496 55178 RNMTL1 0.192178 0.006585 0.215450754 40 cg02022322 32 ACACB 0.227814 0.006894 0.21990647 41 cg02421553 5170 PDPK1 -0.24651 0.007192 0.223817811 42 cg16816961 10840 ALDH1L1 -0.19292 0.007771 0.227290105 43 cg16345055 9392 TGFBRAP1 0.207407 0.007895 0.227290105 44 cg06026545 31 ACACA 0.219851 0.007943 0.227290105 45 cg17336337 8802 SUCLG1 0.286061 0.008263 0.227290105 46 cg21157446 56997 ADCK3 0.285915 0.008419 0.227290105 47 cg00346883 23659 PLA2G15 -0.20651 0.008475 0.227290105 Page 71 of 76 Diabetes

48 cg08754294 8165 AKAP1 0.242239 0.00855 0.227290105 49 cg08115732 7083 TK1 0.267686 0.009221 0.240048527 50 cg09900253 39 ACAT2 0.227621 0.009406 0.240048527 51 cg07925633 55288 RHOT1 -0.17949 0.010289 0.255859901 52 cg04394641 6390 SDHB 0.218201 0.010427 0.255859901 53 cg15775217 7296 TXNRD1 0.188187 0.010978 0.264301817 54 cg06170683 10131 TRAP1 0.260212 0.01125 0.265833778 55 cg02224164 4141 MARS -0.22052 0.012806 0.297097927 56 cg06809298 1347 COX7A2 0.229134 0.013734 0.31294571 57 cg23665837 56922 MCCC1 -0.20926 0.014364 0.313767176 58 cg08982827 5091 PC 0.210671 0.01442 0.313767176 59 cg24062157 10131 TRAP1 0.241072 0.014578 0.313767176 60 cg20778688 31 ACACA 0.203826 0.014754 0.313767176 61 cg18291331 5091 PC 0.159916 0.015147 0.316845763 62 cg20123649 5091 PC 0.212043 0.015551 0.320047332 63 cg26588778 10229 COQ7 -0.18666 0.016309 0.330328347 64 cg08746653 3033 HADH 0.209929 0.01657 0.330344637 65 cg20988073 10840 ALDH1L1 0.140844 0.016923 0.330344637 66 cg10354495 27247 NFU1 0.19197 0.017238 0.330344637 67 cg27572510 31 ACACA -0.27347 0.017904 0.330344637 68 cg05607461 2744 GLS -0.24545 0.018013 0.330344637 69 cg04917258 5091 PC 0.212762 0.018193 0.330344637 70 cg05541125 539 ATP5O 0.174485 0.018421 0.330344637 71 cg13081498 27129 HSPB7 0.171716 0.018774 0.330344637 72 cg25350416 2744 GLS 0.171449 0.018889 0.330344637 73 cg18888403 3155 HMGCL -0.18155 0.018899 0.330344637 74 cg13561372 10157 AASS 0.164805 0.020532 0.349735159 75 cg05756136 10352 WARS2 0.202271 0.020557 0.349735159 76 cg12836610 23788 MTCH2 -0.20179 0.021269 0.356551206 77 cg15937861 5091 PC 0.201703 0.021516 0.356551206 78 cg06674117 55288 RHOT1 -0.20141 0.022353 0.365669034 79 cg08869857 7296 TXNRD1 0.172966 0.022748 0.367430844 80 cg18970151 5095 PCCA -0.19741 0.023061 0.367830447 81 cg04396721 64757 MARC1 0.206514 0.023596 0.368425959 82 cg15939920 31 ACACA -0.24049 0.023676 0.368425959 83 cg26909851 8165 AKAP1 0.186677 0.026664 0.406726335 84 cg21601837 10840 ALDH1L1 0.155169 0.026775 0.406726335 85 cg05467918 34 ACADM 0.167568 0.027308 0.409939039 86 cg02467794 8165 AKAP1 0.185528 0.027959 0.414830218 87 cg26477746 10131 TRAP1 0.246295 0.029839 0.423772471 88 cg19751789 3949 LDLR 0.302299 0.029949 0.423772471 89 cg22183448 4700 NDUFA6 0.192759 0.030124 0.423772471 90 cg21311644 80146 UXS1 0.181575 0.030127 0.423772471 91 cg21519872 7083 TK1 0.207354 0.030631 0.423772471 92 cg03831666 54931 TRMT10C -0.19677 0.030728 0.423772471 93 cg16051954 56997 ADCK3 0.253111 0.030886 0.423772471 94 cg16199098 25828 TXN2 -0.19 0.032691 0.440716625 95 cg15556672 92259 MRPS36 -0.156 0.034134 0.440716625 96 cg06988368 51205 ACP6 -0.13226 0.034385 0.440716625 97 cg05611719 64978 MRPL38 -0.1672 0.034841 0.440716625 Diabetes Page 72 of 76

98 cg07438401 8801 SUCLG2 0.146844 0.034914 0.440716625 99 cg00662273 5170 PDPK1 0.162675 0.03586 0.440716625 100 cg02275294 6646 SOAT1 0.16284 0.035958 0.440716625 101 cg14338062 4141 MARS -0.19561 0.036024 0.440716625 102 cg00276752 31 ACACA 0.167737 0.036097 0.440716625 103 cg02079111 9392 TGFBRAP1 0.167701 0.036192 0.440716625 104 cg13986762 64757 MARC1 0.145647 0.036458 0.440716625 105 cg25114693 64965 MRPS9 0.196494 0.036598 0.440716625 106 cg17963548 65080 MRPL44 0.231579 0.037142 0.440716625 107 cg15044146 31 ACACA -0.174 0.037254 0.440716625 108 cg03085549 197257 LDHD 0.158745 0.037356 0.440716625 109 cg07267067 8435 SOAT2 -0.16544 0.037647 0.440716625 110 cg09232068 23788 MTCH2 -0.17876 0.038006 0.440873105 111 cg22213449 54543 TOMM7 0.215204 0.038927 0.447386835 112 cg03743982 197257 LDHD 0.156778 0.039269 0.447386835 113 cg19842026 57143 ADCK1 0.162669 0.040272 0.454748362 114 cg02771673 5095 PCCA 0.179561 0.041818 0.468065512 115 cg21874514 11112 HIBADH 0.166772 0.043323 0.480697101 116 cg10201616 3949 LDLR 0.221698 0.045008 0.481714312 117 cg09610644 622 BDH1 0.150039 0.045305 0.481714312 118 cg05988266 8801 SUCLG2 0.155886 0.045324 0.481714312 119 cg26749844 8165 AKAP1 0.201405 0.0461 0.481714312 120 cg15346359 4722 NDUFS3 0.205194 0.046706 0.481714312 121 cg22020299 64928 MRPL14 0.146875 0.0469 0.481714312 122 cg09473613 3155 HMGCL -0.17226 0.047075 0.481714312 123 cg21429551 2617 GARS 0.14951 0.047109 0.481714312 124 cg11194398 5091 PC 0.195523 0.047194 0.481714312 125 cg25623473 26589 MRPL46 0.178413 0.047384 0.481714312 126 cg18933128 5164 PDK2 0.155013 0.048302 0.481714312 127 cg01011367 36 ACADSB -0.16559 0.048395 0.481714312 128 cg01979287 64978 MRPL38 0.180291 0.048654 0.481714312 129 cg07035454 55074 OXR1 -0.18098 0.0487 0.481714312 130 cg01277126 5166 PDK4 0.206687 0.049685 0.487675695

Differentially methylated CpG sites in the differentially expressed upstream regulator genes

Number Methylation Probe ENTRZ-ID Gene symbol logFC P.Value adj.P.Val 1 cg19701879 10891 PGC-1α 0.182678 0.040152 0.438116356 2 cg05158538 10891 PGC-1α 0.178713 0.04689 0.438116356 Page 73 of 76 Diabetes

Number Relation to gene Relation to CpG density 1 Body;Body N_Shelf 2 TSS1500 N_Shelf 3 Body S_Shelf 4 Body N_Shore 5 TSS1500 NA 6 Body;Body S_Shelf 7 TSS200 Island 8 TSS1500;TSS1500 NA 9 Body;Body;Body S_Shore 10 5UTR;5UTR;5UTR NA 11 TSS1500 S_Shore 12 Body N_Shore 13 Body S_Shelf 14 Body;Body NA 15 5UTR;5UTR N_Shelf 16 3UTR;3UTR NA 17 Body N_Shore 18 Body NA 19 Body;5UTR S_Shelf 20 Body S_Shelf 21 Body N_Shelf 22 5UTR S_Shelf 23 Body S_Shore 24 Body N_Shore 25 5UTR S_Shelf 26 Body S_Shore 27 Body N_Shelf 28 Body;Body;Body N_Shore 29 TSS1500 S_Shore 30 Body NA 31 Body N_Shelf 32 Body Island 33 Body NA 34 TSS1500 Island 35 TSS1500 N_Shore 36 Body;5UTR;Body;5UTR N_Shore 37 5UTR;5UTR;5UTR NA 38 3UTR NA 39 Body NA 40 TSS1500 NA 41 Body;Body NA 42 Body NA 43 Body;Body N_Shore 44 Body;TSS200;TSS200;Body;BodyNA 45 Body NA 46 Body NA 47 Body NA Diabetes Page 74 of 76

48 5UTR NA 49 Body NA 50 Body S_Shelf 51 TSS1500;TSS1500;TSS1500 N_Shore 52 Body NA 53 Body N_Shelf 54 Body NA 55 Body S_Shore 56 TSS1500;TSS1500 NA 57 Body S_Shore 58 5UTR;5UTR;5UTR NA 59 Body Island 60 TSS1500;Body;TSS1500;Body;BodyNA 61 Body;Body;Body S_Shore 62 Body;Body;Body N_Shore 63 Body S_Shore 64 Body S_Shelf 65 TSS1500 S_Shore 66 TSS1500;TSS1500;TSS1500;TSS1500S_Shore 67 Body;Body;Body;Body;BodyNA 68 TSS200 Island 69 5UTR;5UTR;5UTR NA 70 TSS1500 S_Shore 71 TSS200 NA 72 1stExon Island 73 TSS1500;TSS1500 NA 74 5UTR N_Shelf 75 Body;Body N_Shelf 76 Body N_Shore 77 Body;Body;Body S_Shore 78 Body;Body;Body NA 79 5UTR;5UTR;Body;Body;5UTRS_Shore 80 Body;Body NA 81 TSS1500 N_Shore 82 Body;Body;Body;Body;BodyNA 83 Body NA 84 TSS1500 S_Shore 85 TSS200;TSS200 Island 86 1stExon;5UTR Island 87 Body S_Shelf 88 TSS200 N_Shore 89 Body N_Shelf 90 TSS1500 S_Shore 91 Body NA 92 5UTR Island 93 5UTR NA 94 TSS1500 NA 95 TSS1500 N_Shore 96 TSS200 Island 97 TSS1500 S_Shore Page 75 of 76 Diabetes

98 Body NA 99 3UTR;3UTR NA 100 TSS1500 N_Shore 101 Body S_Shore 102 5UTR;Body S_Shelf 103 Body;Body Island 104 Body S_Shore 105 Body NA 106 Body S_Shelf 107 Body;Body;Body;Body;BodyNA 108 TSS200;TSS200 S_Shore 109 TSS200 NA 110 TSS200 Island 111 3UTR NA 112 TSS200;TSS200 S_Shore 113 Body;Body NA 114 Body;Body NA 115 TSS200 Island 116 TSS1500 N_Shelf 117 Body;Body;Body NA 118 Body NA 119 3UTR NA 120 3UTR NA 121 5UTR NA 122 TSS1500;TSS1500 NA 123 Body S_Shore 124 5UTR;TSS200;5UTR NA 125 Body N_Shelf 126 Body Island 127 Body NA 128 Body S_Shelf 129 Body NA 130 3UTR NA

Differentially methylated CpG sites in the differentially expressed upstream regulator genes

Number Relation to gene Relation to CpG density 1 Body NA 2 Body NA Diabetes Page 76 of 76

Correlation of methylation and gene expression, using differentially methylated CpG sites in the differentially expressed 222 genes

Methylation EntrezID Gene symbol Location Correlation* P-value FDR Probe cg24062157 10131 TRAP1 Body -0.56 8.33E-07 3.83E-05 cg26477746 10131 TRAP1 Body -0.32 6.99E-03 2.80E-02 cg04917258 10157 AASS Body -0.48 3.79E-05 6.98E-04 cg26588778 10229 COQ7 Body 0.29 1.60E-02 4.92E-02 cg05756136 10352 WARS2 Body -0.50 1.25E-05 3.29E-04 cg11647493 10455 ECI2 Body/Promoter -0.34 4.22E-03 2.04E-02 cg20988073 10840 ALDH1L1 Promoter -0.41 4.03E-04 3.53E-03 cg16816961 10840 ALDH1L1 Body 0.34 3.78E-03 1.93E-02 cg21874514 11112 HIBADH Promoter -0.27 2.23E-02 6.30E-02 cg22628608 137872 ADHFE1 Body -0.31 8.95E-03 3.30E-02 cg07819926 154791 C7orf55 Promoter 0.34 3.93E-03 1.96E-02 cg00346883 23659 PLA2G15 Body -0.34 4.33E-03 2.04E-02 cg16199098 25828 TXN2 Promoter 0.44 1.69E-04 1.94E-03 cg05640320 26355 FAM162A Promoter -0.30 1.26E-02 4.14E-02 cg10354495 27247 NFU1 Promoter -0.35 3.61E-03 1.90E-02 cg05607461 2744 GLS Promoter -0.26 3.08E-02 7.98E-02 cg08746653 3033 HADH Body -0.41 4.89E-04 4.09E-03 cg06026545 31 ACACA Body/Promoter -0.51 1.08E-05 3.29E-04 cg20778688 31 ACACA Body/Promoter -0.27 2.66E-02 7.20E-02 cg00806900 32 ACACB Body -0.45 1.05E-04 1.49E-03 cg12178147 32 ACACB Promoter -0.43 2.46E-04 2.26E-03 cg02022322 32 ACACB Promoter -0.29 1.56E-02 4.87E-02 cg19751789 3949 LDLR Promoter 0.31 9.83E-03 3.55E-02 cg14338062 4141 MARS Body -0.30 1.07E-02 3.70E-02 cg08733553 4706 NDUFAB1 Body -0.32 6.93E-03 2.80E-02 cg26749844 4722 NDUFS3 3UTR -0.25 3.43E-02 8.27E-02 cg15937861 5091 PC Body -0.46 6.85E-05 1.15E-03 cg15784784 5091 PC Body -0.46 9.00E-05 1.38E-03 cg08754294 5091 PC Promoter -0.38 1.18E-03 8.06E-03 cg18291331 5091 PC Body -0.33 4.90E-03 2.20E-02 cg20123649 5091 PC Body -0.25 3.79E-02 8.94E-02 cg11022519 5096 PCCB Promoter -0.39 8.31E-04 6.12E-03 cg18776287 51116 MRPS2 Body -0.39 8.21E-04 6.12E-03 cg06988368 51205 ACP6 Promoter 0.32 7.60E-03 2.91E-02 cg22758834 5166 PDK4 Body -0.70 0.00E+00 0.00E+00 cg02421553 5170 PDPK1 Body -0.51 8.81E-06 3.24E-04 cg25654242 54148 MRPL39 Body -0.29 1.39E-02 4.44E-02 cg12422199 54931 TRMT10C Body 0.25 3.36E-02 8.27E-02 cg08924256 55074 OXR1 Body 0.25 3.41E-02 8.27E-02 cg15971496 55178 RNMTL1 Body -0.24 4.88E-02 1.12E-01 cg06674117 55288 RHOT1 Body 0.37 1.48E-03 9.76E-03 cg16707423 56997 ADCK3 Body -0.57 4.25E-07 2.61E-05 cg09326087 56997 ADCK3 Body -0.44 1.50E-04 1.94E-03 cg00786909 56997 ADCK3 Body -0.39 9.00E-04 6.37E-03 cg21157446 56997 ADCK3 Body -0.36 2.16E-03 1.28E-02 Page 77 of 76 Diabetes

cg19842026 57143 ADCK1 Body 0.27 2.42E-02 6.75E-02 cg09610644 622 BDH1 Body -0.63 9.22E-09 8.48E-07 cg16268707 84706 GPT2 Promoter -0.40 6.55E-04 5.24E-03 cg05988266 8801 SUCLG2 Body -0.43 2.23E-04 2.26E-03 cg07438401 8801 SUCLG2 Body -0.30 1.24E-02 4.14E-02 cg17336337 8802 SUCLG1 Body -0.48 3.53E-05 6.98E-04 cg15556672 92259 MRPS36 Promoter 0.29 1.40E-02 4.44E-02 cg16345055 9392 TGFBRAP1 Body 0.36 2.34E-03 1.34E-02

Correlation of methylation and gene expression, using differentially methylated CpG sites in the differentially expressed upstream regulator genes

Methylation EntrezID Gene symbol Location Correlation* P-value FDR Probe cg19701879 10891 PGC-1α Body -0.31 1.03E-02 5.86E-02

*The Spearman method was used with the data adjusted for twin information