US 2016O158294A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0158294 A1 Von MaltZahn et al. (43) Pub. Date: Jun. 9, 2016

(54) METHODS OF POPULATINGA on Feb. 4, 2013, provisional application No. 61/760, GASTRONTESTINAL TRACT 574, filed on Feb. 4, 2013, provisional application No. 61/760,606, filed on Feb. 4, 2013, provisional applica (71) Applicant: SERES THERAPEUTICS, INC., tion No. 61/926,918, filed on Jan. 13, 2014. Cambridge, MA (US) Publication Classification (72) Inventors: Geoffrey Von Maltzahn, Boston, MA (US); Matthew R. Henn, Somerville, (51) Int. C. MA (US); David N. Cook, Brooklyn, A6135/742 (2006.01) NY (US); David Arthur Berry, A 6LX35/747 (2006.01) Brookline, MA (US); Noubar B. A 6LX35/745 (2006.01) Afeyan, Lexington, MA (US); Brian A6135/74 (2006.01) Goodman, Boston, MA (US); A6135/744 (2006.01) Mary-Jane Lombardo McKenzie, (52) U.S. C. Arlington, MA (US); Marin Vulic, CPC ...... A61K 35/742 (2013.01); A61K 35/74 Boston, MA (US) (2013.01); A61 K35/744 (2013.01); A61 K 35/745 (2013.01); A61 K35/747 (2013.01) (21) Appl. No.: 14/765,810 (57) ABSTRACT (22) PCT Fled: Feb. 4, 2014 Methods and compositions for populating the gastrointestinal (86) PCT NO.: PCT/US14f14738 tract of a subject are described. Methods include administer ing to a Subject a therapeutic composition comprising a puri S371 (c)(1), fied population of spore-forming bacteria produced by pro (2) Date: Aug. 4, 2015 viding a fecal material and Subjecting the material to a treatment step resulting in purification of spore forming bac Related U.S. Application Data teria. Methods include administering an amount effective to (60) Provisional application No. 61/760,584, filed on Feb. engraft and/or augment in the gastrointestinal tract in order to 4, 2013, provisional application No. 61/760,585, filed treat or prevent a dysbiosis in the mammalian subject. Patent Application Publication Jun. 9, 2016 Sheet 1 of 16 US 2016/0158294 A1

V 1 2 3 4 5 6 7 8 9

200 400 600 8OO 1000 1200 1400 Patent Application Publication Jun. 9, 2016 Sheet 2 of 16 US 2016/0158294 A1

s & Ess s 3&&.3ssissississississississ, SS 3.88 SSSSSSSsssssss?sssssssss SS s st is £SSSSSSSSSSSSSSSSSIs S$ 338ACC CGSSC CSCCAF CSSAGGCCCASA 3GSA A&E is

SS Šiššššššššššš Šssssssssssssssssssss $$$ $353 is isssssssssssssssssssssssssssssss Š's SSSSS is is is SSS siè& SSSE::s

s organarcoccaGGrcAAccrgosaac 5 ississisi S.S. ssissississšš is ^:8&SSSSSSSSS & SS S. SSSSSSS & SSS six&

Y s S SSSSSS &;8& sists s AACGC is sis: $3. SSSAcariccac Patent Application Publication Jun. 9, 2016 Sheet 3 of 16 US 2016/0158294 A1

FIG. 2 Patent Application Publication Jun. 9 9 2016 Sheet 4 of 16 US 2016/0158294 A1

Patent Application Publication Jun. 9, 2016 Sheet 5 of 16 US 2016/0158294 A1

|09 |09 |02 |01 0 Patent Application Publication Jun. 9, 2016 Sheet 6 of 16 US 2016/0158294 A1

?·~~~~~~~~~~~~#~ sists 3. Patent Application Publication Jun. 9, 2016 Sheet 7 of 16 US 2016/0158294 A1

& s & 8. se: shi sa s. s SS s i-S

&S SS SS Sas :as

Xs s s

is is is is

Sifset is steesty

Patent Application Publication Jun. 9, 2016 Sheet 8 of 16 US 2016/0158294 A1

xx. a.

C: s

h O R rf N teauaoseonio Patent Application Publication Jun. 9, 2016 Sheet 9 of 16 US 2016/0158294 A1

SWB SwBLys M2GSC M2GSCLys

is BHS Ox 3 Ca-DPA : RF & SGF EMUC

M2GSC M2GSCLys

FIG. 8 Patent Application Publication Jun. 9, 2016 Sheet 10 of 16 US 2016/0158294 A1

1019 EtOHIoxgall plated on GAM/mannitol & GAM/FOSlnulinn-83

Blautia Wexlerae S ex-Butyrivibrio CroSSotus *Clostridiales sp SS3 4

Ruminococcus obelum RuminoCOCCuS albuS S. Lachnospirap x^ 8 ectinoschiza

1019 EtOH plated on PEA sheep blood n-262 Ruminococcus sp K-1 Ruminococcus albus NCBI Ruminococcus albus 7

& & $: 8 & 8

FIG. 9 Patent Application Publication Jun. 9, 2016 Sheet 11 of 16 US 2016/0158294 A1

& is is is at x is is a X & S E & E.

r: y s

Patent Application Publication Jun. 9, 2016 Sheet 12 of 16 US 2016/0158294 A1

otysozyme + lysozyme

S-lysozyme + lysozyre

FIG 11 Patent Application Publication Jun. 9, 2016 Sheet 13 of 16 US 2016/0158294 A1

daedues:tog?, *g?

{}{}()| is to insey is exits ???????????????, Patent Application Publication Jun. 9, 2016 Sheet 14 of 16 US 2016/0158294 A1

(%97)|Od

->IESSzPuedLiv?,60|| LuupLled'||LVd

7|.C.9C] (%72)ÇOd Patent Application Publication Jun. 9, 2016 Sheet 15 of 16 US 2016/0158294 A1

*????????????????

sæpædsdnouºsubpu?saprouanoo, :&&&&&&&&&zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

& &%zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz! ass & Patent Application Publication Jun. 9, 2016 Sheet 16 of 16 US 2016/0158294 A1

?? , :&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& ‘;?????¿??¿?%22&zzzzzzzzzzzzzzzzzzz -?,…ae,•?-- ×

%& SSSSSSSSSSSSSSSSSSSSSS &zzzzzzzzzzzzzzºzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzžºzzzzzzzzz?·

*?:

?????????????????????????????????????????????????????????????????????????:

SSSSSSSSSSSSSSSSSSSSSSSS SSSSSSSSSSSSSSSSSSSSSSSSSzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzº, S& S S.S

S.

S.S 8

S.

S.

S.

S

S.

8S

S.

S.

S.

S.S

8

ael

S.

S.

S US 2016/0158294 A1 Jun. 9, 2016

METHODS OF POPULATINGA ited to a very narrow group of genera and a correspondingly GASTRONTESTINAL TRACT limited number of species; as such, they do not adequately replace the missing natural microflora of the GI tract in many RELATED APPLICATIONS situations. 0006 Thus, there is a need for methods of populating a 0001. This application is related to U.S. Provisional Appli subject’s gastrointestinal tract with a wider selection of cation No. 61/760,584, filed on Feb. 4, 2013, and to U.S. microbiota in order to alter a dysbiosis. There is also a need to Provisional Application No. 61/760,585, filed on Feb. 4, design microbial compositions of isolated bacterial strains 2013, and to U.S. Provisional Application No. 61/760,574, with a plurality of beneficial properties based on current filed on Feb. 4, 2013, and to U.S. Provisional Application No. understanding of bacterial Strains and analysis of the proper 61/760,606, filed on Feb. 4, 2013, and to U.S. Provisional ties that would enhance the utility and commercialization of a Application No. 61/926,928, filed on Jan. 13, 2014, which are microbial composition. each incorporated by reference in its entirety. 0007. Therefore, there exists a need for durable, efficient, and effective compositions and methods for treatment of GI REFERENCE TO ASEQUENCE LISTING diseases by way of restoring or enhancing microbiota func 0002 This application includes a Sequence Listing sub tions and for addressing these and other shortcomings in the mitted electronically as a text file named 25967PCT CRF art. sequencelisting..txt, created on Feb. 4, 2013, with a size of 911,074 bytes. The sequence listing is incorporated by refer SUMMARY OF THE INVENTION CCC. 0008 Disclosed herein are methods of populating the gas trointestinal tract of a mammalian Subject, including the step BACKGROUND of orally administering to the mammalian Subject an effective 0003 Mammals are colonized by microbes in the gas amount of a therapeutic composition comprising a purified trointestinal (GI) tract, on the skin, and in other epithelial and population of spore-forming bacteria produced by the steps of tissue niches such as the oral cavity, eye surface and vagina. a) providing a fecal material and b) Subjecting the material to The gastrointestinal tract harbors an abundant and diverse a treatment step resulting in purification of spore-forming microbial community. It is a complex system, providing an bacteria, wherein the purified population is present in an environment or niche for a community of many different amount effective to engraft and/or augment in the gastrointes Species or organisms, including diverse Strains of bacteria. tinal tract in order to treat or prevent a dysbiosis in the mam Hundreds of different species may form a commensal com malian Subject. munity in the GI tract in a healthy person, and this comple 0009 Disclosed herein are methods for populating the ment of organisms evolves from the time of birth to ultimately gastrointestinal tract of a mammalian Subject, comprising the form a functionally mature microbial population by about 3 step of orally administering to the Subject an effective amount years of age. Interactions between microbial strains in these of a therapeutic composition comprising a purified popula populations and between microbes and the host, e.g., the host tion of spore-forming bacteria in an amount effective to immune system, shape the community structure, with avail engraft and/or augment in the gastrointestinal tract in order to ability of and competition for resources affecting the distri treat or prevent a dysbiosis in a mammalian Subject. bution of microbes. Such resources may be food, location and 0010 Also described are therapeutic compositions com the availability of space to grow or a physical structure to prising a purified population of spore-forming bacteria or which the microbe may attach. For example, host diet is bacteria having a substantial activity of spore-forming bacte involved in shaping the GI tract flora. ria in an amount effective to populate the gastrointestinal tract 0004. A healthy microbiota provides the host with mul ofa mammalian Subject to whom the therapeutic composition tiple benefits, including colonization resistance to a broad is administered. In some embodiments, the population is spectrum of pathogens, essential nutrient biosynthesis and effective to i) treat a gastrointestinal dysbiosis, and/or ii) absorption, and immune stimulation that maintains a healthy engraft at least one type of bacteria present in the therapeutic gut epithelium and an appropriately controlled systemic composition but not present in a mammalian Subject prior to immunity. In settings of dysbiosis or disrupted Symbiosis, treatment; and/or iii) augment at least one type of bacteria not microbiota functions can be lost or deranged, resulting in present in the therapeutic composition in a mammalian Sub increased Susceptibility to pathogens, altered metabolic pro ject to whom the therapeutic composition is administered. files, or induction of proinflammatory signals that can result 0011. Also provided are therapeutic compositions com in local or systemic inflammation or autoimmunity. Thus, the prising a purified population of spore-forming bacteria in an intestinal microbiota plays a significant role in the pathogen amount effective to populate the gastrointestinal tract of a esis of many diseases and disorders, including a variety of mammalian Subject to whom the therapeutic composition is pathogenic infections of the gut. For instance, Subjects administered, wherein the purified population is obtained by become more Susceptible to pathogenic infections when the the steps of a) providing a fecal material comprising spore normal intestinal microbiota has been disturbed due to use of forming bacteria and b) Subjecting the spore-forming bacteria broad-spectrum antibiotics. Many of these diseases and dis to a treatment step resulting in purification of the spore orders are chronic conditions that significantly decrease a forming bacteria. subject’s quality of life and can be ultimately fatal. 0012. Also provided are methods for production of a com 0005. Manufacturers of probiotics have asserted that their position comprising a population of bacterial spores Suitable preparations of bacteria promote mammalian health by pre for therapeutic administration to a mammalian Subject in serving the natural microflora in the GI tract and reinforcing need thereof, comprising the steps of: (a) providing a fecal the normal controls on aberrant immune responses. See, e.g., material obtained from a mammalian donor Subject; and (b) U.S. Pat. No. 8,034,601. Probiotics, however, have been lim Subjecting the fecal material to at least one purification step US 2016/0158294 A1 Jun. 9, 2016

under conditions such that a purified population of spore BRIEF DESCRIPTION OF THE DRAWINGS forming bacteria is produced from the fecal material. Also (0020 FIG. 1A provides a schematic of 16S rRNA gene provided are methods of treating or preventing a dysbiosis in and denotes the coordinates of hypervariable regions 1-9 a human Subject, comprising administering to the human (V1-V9), according to an embodiment of the invention. Coor Subject the therapeutic compositions of the invention. dinates of V1-V9 are 69-99, 137-242, 433-497, 576-682, 0013 The invention also includes therapeutic composi 822-879,986-1043, 1117-1173, 1243-1294, and 1435-1465 tions comprising a purified bacterial spore population com respectively, based on numbering using E. coli system of prising at least about 1x10, 1x10, 1x10, or 1x10° spores, nomenclature defined by Brosius et al., Complete nucleotide wherein the composition does not exceed about 1 gram in sequence of a 16S ribosomal RNA gene (16S rRNA) from weight, formulated for oral administration to populate the Escherichia coli, PNAS 75(10):4801-4805 (1978). gastrointestinal trace in a mammalian Subject in need thereof, 0021 FIG. 1B highlights in bold the nucleotide sequences in order to i) engraft in the mammalian recipient and/or ii) for each hypervariable region in the exemplary reference E. augment a bacterial population in the mammalian recipient coli 16S sequence described by Brosius et al. and thereby treat or prevent a dysbiosis. 0022 FIG. 2 shows a photograph of a CsCl gradient dem onstrating the spore separation from other residual habitat 0014. The invention includes kits comprising in one or material, according to an embodiment of the invention. more containers a fecal material collection apparatus and a 0023 FIG. 3 shows three phase contrast images demon Solvent Solution, and instructions for use thereof for generat strating the progressive enrichment of spores from a fecal ing purified populations of spore-forming bacteria. Suspension (ethanol treated, CsCl purified spore preparation, 0015 The invention includes methods of populating the and an ethanol treated, CsCl purified. Sucrose purified spore gastrointestinal tract of a human Subject, comprising the step preparation). of administering to the human Subject a therapeutic compo 0024 FIG. 4 shows a set of survival curves demonstrating sition comprising a purified population of spore-forming bac efficacy of the spore population in a hamster prophylaxis teria, under conditions such that a microbial population model of C. difficile. (Circles are ethanol-treated spores-- present in the gastrointestinal tract and/or a microbial popu Vancomycin (orange); Squares are ethanol-treated, gradient lation outside the gastrointestinal tract is modulated. purified spores+Vancomycin (light blue); X's are Vancomy cin control (green); and Diamonds are the vehicle control 0016. The invention also includes methods of populating a (dark blue)). bacterial population in the gastrointestinal tract of a human 0025 FIG.5 provides a set of survival curves demonstrat Subject, comprising the step of administering to the human ing efficacy of the spore population in a hamster relapse Subject a therapeutic composition comprising a purified prevention model of C. difficile. (Opaque diamonds are etha population of spore-forming bacteria, under conditions such nol-treated spores +Vancomycin (blue diamond): squares are that at least i) a Subset of the spore-forming bacteria Sustain ethanol-treated, gradient purified spores +Vancomycin (red ably engraft within the gastrointestinal tract, orii) at least one squares); X's are Vancomycin control; and Clear Diamonds type of bacteria not present in the therapeutic composition is are vehicle control (green)). augmented within the gastrointestinal tract. 0026 FIG. 6 demonstrates the cell viability under a variety 0017. In some embodiments, the invention includes meth of ethanol and heat treatments for varying lengths of time. ods of populating the gastrointestinal tract of a mammalian 0027 FIG. 7 shows the strong correlation and linear cor Subject, comprising the step of orally administering to the respondence between the measurement of DPA concentration Subject an effective amount of a bacterial composition com by a coupled fluorescence assay and the viable spore colony prising at least a first type of isolated bacteria and a second forming units. type of isolated bacteria, wherein the first type and the second 0028 FIG. 8 demonstrates the effect on various germina type are not identical, under conditions such that the first type tion treatments on the ability to cultivate vegetative bacteria of isolated bacteria and the second type of isolated bacteria from a spore population. functionally populate the gastrointestinal tract of the Subject. 0029 FIG.9 demonstrates the increase in bacterial diver sity from using a germinant treatment to grow vegetative 0.018. In other embodiments, the invention includes meth bacteria from spore populations. ods of populating the gastrointestinal tract of a mammalian 0030 FIG. 10 demonstrates the role of heat activation at Subject, comprising the step of orally administering to the various temperatures on spores from three different donor Subject an effective amount of a therapeutic composition fecal samples. comprising a purified population of spore-forming bacteria 0031 FIG. 11 demonstrates that a lysozyme treatment produced by the steps of a) providing a fecal material and b) with heat activation improves germination at most tempera Subjecting the material to a treatment step resulting in purifi tures. cation of spore-forming bacteria, wherein the purified popu 0032 FIG. 12 demonstrates the microbial diversity mea lation is present in an amount effective to treat or prevent a Sured in the ethanol treated spore treatment sample and dysbiosis in a mammalian recipient Subject to whom the patient pre- and post-treatment samples. Total microbial therapeutic composition is administered. diversity is defined using the Chao 1 Alpha-Diversity Index 0019. The invention also includes methods of populating and is measured at the same genomic sampling depths to the gastrointestinal tract of a mammalian Subject, comprising confirm adequate sequence coverage to assay the microbiome the step of orally administering to the subject an effective in the target samples. The patient pretreatment (purple) har amount of a therapeutic composition comprising a purified bored a microbiome that was significantly reduced in total population of spore-forming bacteria, in an amount effective diversity as compared to the ethanol treated spore treatment to treat or prevent a dysbiosis in a mammalian recipient Sub (red) and patient post treatment at days 5 (blue), 14 (orange), ject to whom the therapeutic composition is administered. and 25 (green). US 2016/0158294 A1 Jun. 9, 2016

0033 FIG. 13 demonstrates how the patient microbial population of microbes that are (i) absent or undetectable (as ecology is shifted by treatment with an ethanol treated spore determined by the use of standard genomic and microbiologi treatment from a dysbiotic state to a state of health. Principle cal techniques) from the administered therapeutic microbial coordinates analysis based on the total diversity and structure composition, (ii) absent, undetectable, or present at low fre of the microbiome (Bray Curtis Beta Diversity) of the patient quencies in the host niche (for example: gastrointestinal tract, pre- and post-treatment delineates that the combination of skin, anterior-nares, or vagina) before the delivery of the engraftment of the OTUs from the spore treatment and the microbial composition, and (iii) are found after the adminis augmentation of the patient microbial ecology leads to a tration of the microbial composition or significantly increase, microbial ecology that is distinct from both the pretreatment for instance 2-fold, 5-fold, 1x10, 1x10, 1x10, 1x10, microbiome and the ecology of the ethanol treated spore 1x10, 1x10", or greater than 1x10, in cases where they were treatment. present at low frequencies. The microbes that comprise an 0034 FIG. 14 demonstrates the augmentation of bacteroi augmented ecology can be derived from exogenous sources des species in patients treated with the spore population. Such as food and the environment, or grow out from micro Comparing the number of Bacteroides colonies from fecal niches within the host where they reside at low frequency. The Suspensions pre-treatment and in week 4 post treatment administration of the therapeutic microbial composition reveals an increase of 4 logs or greater. Colonies were enu induces an environmental shift in the target niche that pro merated by serial dilution and plating on Bacteroides Bile motes favorable conditions for the growth of these commen Esculin agar which is highly selective for the B. fragilis sal microbes. In the absence of treatment with a therapeutic group. Species were determined by 16S full-length sequence microbial composition, the host can be constantly exposed to identification. these microbes; however, Sustained growth and the positive 0035 FIG. 15 demonstrates the increase in number of health effects associated with the stable population of species engrafting and species augmenting inpatient’s micro increased levels of the microbes comprising the augmented biomes after treatment with an ethanol-treated spore popula ecology are not observed. tion. Relative abundance of species that engrafted or aug 0041. “Microbial Engraftment' or simply “engraftment' mented as described were determined based on the number of refers to the establishment of OTUs comprising a therapeutic 16S sequence reads. Each plot is from a different patient microbial composition in a target niche that are absent in the treated with the ethanol-treated spore population for recurrent treated host prior to treatment. The microbes that comprise C. difficile. the engrafted ecology are found in the therapeutic microbial 0036. The figures depict various embodiments of the composition and establish as constituents of the host micro present invention for purposes of illustration only. One skilled bial ecology upon treatment. Engrafted OTUs can establish in the art will readily recognize from the following discussion for a transient period of time, or demonstrate long-term sta that alternative embodiments of the structures and methods bility in the microbial ecology that populates the host post illustrated herein may be employed without departing from treatment with a therapeutic microbial composition. The the principles of the invention described herein. engrafted ecology can induce an environmental shift in the target niche that promotes favorable conditions for the growth DETAILED DESCRIPTION of commensal microbes capable of catalyzing a shift from a dysbiotic ecology to one representative of a health state. Definitions 0042 “Ecological Niche” or simply “Niche” refers to the 0037 “Microbiota” refers to the community of microor ecological space in which an organism or group of organisms ganisms that occur (Sustainably or transiently) in and on an occupies. Niche describes how an organism or population or animal Subject, typically a mammal Such as a human, includ organisms responds to the distribution of resources, physical ing eukaryotes, archaea, bacteria, and viruses (including bac parameters (e.g., host tissue space) and competitors (e.g., by terial viruses i.e., phage). growing when resources are abundant, and when predators, 0038. “Microbiome' refers to the genetic content of the parasites and pathogens are scarce) and how it in turn alters communities of microbes that live in and on the human body, those same factors (e.g., limiting access to resources by other both Sustainably and transiently, including eukaryotes, organisms, acting as a food source for predators and a con archaea, bacteria, and viruses (including bacterial viruses Sumer of prey). (i.e., phage)), wherein genetic content includes genomic 0043 “Dysbiosis” refers to a state of the microbiota or DNA, RNA such as ribosomal RNA, the epigenome, plas microbiome of the gut or other body area, including mucosal mids, and all other types of genetic information. or skin surfaces in which the normal diversity and/or function 0039) “Microbial Carriage” or simply “Carriage” refers to of the ecological network is disrupted. Any disruption from the population of microbes inhabiting a niche within or on the preferred (e.g., ideal) state of the microbiota can be con humans. Carriage is often defined in terms of relative abun sidered a dysbiosis, even if such dysbiosis does not result in a dance. For example, OTU1 comprises 60% of the total micro detectable decrease in health. This state of dysbiosis may be bial carriage, meaning that OTU1 has a relative abundance of unhealthy, it may be unhealthy under only certain conditions, 60% compared to the other OTUs in the sample from which or it may prevent a subject from becoming healthier. Dysbio the measurement was made. Carriage is most often based on sis may be due to a decrease in diversity, the overgrowth of genomic sequencing data where the relative abundance or one or more pathogens or pathobionts, symbiotic organisms carriage of a single OTU or group of OTUs is defined by the able to cause disease only when certain genetic and/or envi number of sequencing reads that are assigned to that OTU/s ronmental conditions are present in a patient, or the shift to an relative to the total number of sequencing reads for the ecological network that no longer provides a beneficial func sample. tion to the host and therefore no longer promotes health. 0040 “Microbial Augmentation” or simply “augmenta 0044) The term "pathobiont' refer to specific bacterial tion” refers to the establishment or significant increase of a species found in healthy hosts that may trigger immune US 2016/0158294 A1 Jun. 9, 2016

mediated pathology and/or disease in response to certain in the art of phylogenetics. Clades are constructed to ensure genetic or environmental factors. Chow etal. (2011) Curr Op that all OTUs in a given clade are: (i) within a specified Immunol. Pathobionts of the intestinal microbiota and inflam number of bootstrap Supported nodes from one another, and matory disease. 23: 473-80. Thus, a pathobiont is a pathogen (ii) within 5% genetic similarity. OTUs that are within the that is mechanistically distinct from an acquired infectious same clade can be distinguished as genetically and phyloge organism. Thus, the term "pathogen' includes both acquired netically distinct from OTUs in a different clade based on infectious organisms and pathobionts. 16S-V4 sequence data, while OTUs falling within the same 0045. The terms “pathogen”, “pathobiont' and “patho clade are closely related. OTUs falling within the same clade genic’ in reference to a bacterium or any other organism or are evolutionarily closely related and may or may not be entity includes any such organism or entity that is capable of distinguishable from one another using 16S-V4 sequence causing or affecting a disease, disorder or condition of a host data. Members of the same clade, due to their evolutionary organism containing the organism or entity. relatedness, play similar functional roles in a microbial ecol 0046 “Phylogenetic tree' refers to a graphical represen ogy Such as that found in the human gut. Compositions Sub tation of the evolutionary relationships of one genetic stituting one species with another from the same clade are sequence to another that is generated using a defined set of likely to have conserved ecological function and therefore are phylogenetic reconstruction algorithms (e.g. parsimony, useful in the present invention. All OTUs are denoted as to maximum likelihood, or Bayesian). Nodes in the tree repre their putative capacity to form spores and whether they are a sent distinct ancestral sequences and the confidence of any Pathogen or Pathobiont (see Definitions for description of node is provided by a bootstrap or Bayesian posterior prob “Pathobiont'). NIAID Priority Pathogens are denoted as ability, which measures branch uncertainty. Category-A, Category-13, or Category-C, and Opportu 0047. “Operational taxonomic units.” “OTU (or plural, nistic Pathogens are denoted as OP. OTUs that are not “OTUs) refer to a terminal leaf in a phylogenetic tree and is pathogenic or for which their ability to exist as a pathogen is defined by a nucleic acid sequence, e.g., the entire genome, or unknown are denoted as N. The SEQID Number denotes a specific genetic sequence, and all sequences that share the identifier of the OTU in the Sequence Listing File and sequence identity to this nucleic acid sequence at the level of Public DB Accession denotes the identifier of the OTU in a species. In some embodiments the specific genetic sequence public sequence repository. may be the 16S sequence or a portion of the 16S sequence. In 0049 Table 2 contains bacterial OTUs identified from the other embodiments, the entire genomes of two entities are 16s analysis of the ethanol treated spore population before sequenced and compared. In another embodiment, select and after a CsCl gradient purification. regions such as multilocus sequence tags (MLST), specific 0050 “Residual habitat products” refers to material genes, or sets of genes may be genetically compared. In 16S derived from the habitat for microbiota within or on a human embodiments, OTUs that share >97% average nucleotide or animal. For example, microbiota live in feces in the gas identity across the entire 16S or some variable region of the trointestinal tract, on the skin itself, in saliva, mucus of the 16S are considered the same OTU (see e.g. Claesson M J. respiratory tract, or secretions of the genitourinary tract (i.e., Wang Q, O'Sullivan O, Greene-Diniz R. Cole J R, Ross RP. biological matter associated with the microbial community). and O’Toole PW. 2010. Comparison of two next-generation Substantially free of residual habitat products means that the sequencing technologies for resolving highly complex micro bacterial composition no longer contains the biological mat biota composition using tandem variable 16S rRNA gene ter associated with the microbial environment on or in the regions. Nucleic Acids Res 38: e200. Konstantinidis KT, human or animal subject and is 100% free, 99% free, 98% Ramette A, and Tiede J.M. 2006. The bacterial species defi free, 97% free, 96% free, or 95% free of any contaminating nition in the genomic era. Philos Trans R Soc Lond B Biol Sci biological matter associated with the microbial community. 361: 1929-1940). In embodiments involving the complete Residual habitat products can include abiotic materials (in genome, MLSTs, specific genes, or sets of genes OTUS that cluding undigested food) or it can include unwanted micro share >95% average nucleotide identity are considered the organisms. Substantially free of residual habitat products same OTU (see e.g. Achtman M, and Wagner M. 2008. may also mean that the bacterial composition contains no Microbial diversity and the genetic nature of microbial spe detectable cells from a human or animal and that only micro cies. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, bial cells are detectable. In one embodiment, substantially Ramette A, and Tiede J.M. 2006. The bacterial species defi free of residual habitat products may also mean that the bac nition in the genomic era. Philos Trans R Soc Lond B Biol Sci terial composition contains no detectable viral (including 361: 1929-1940). OTUs are frequently defined by comparing bacterial viruses (i.e., phage)), fungal, mycoplasmal contami sequences between organisms. Generally, sequences with nants. In another embodiment, it means that fewer than 1x10 less than 95% sequence identity are not considered to form 2%, 1x10%, 1x10%, 1x10%, 1x10%, 1x107%, part of the same OTU. OTUs may also be characterized by 1x10 of the viable cells in the bacterial composition are any combination of nucleotide markers or genes, in particular human or animal, as compared to microbial cells. There are highly conserved genes (e.g., "house-keeping genes), or a multiple ways to accomplish this degree of purity, none of combination thereof. Such characterization employs, e.g., which are limiting. Thus, contamination may be reduced by WGS data or a whole genome sequence. isolating desired constituents through multiple steps of 0048 Table 1 below shows a List of Operational Taxo streaking to single colonies on Solid media until replicate nomic Units (OTU) with taxonomic assignments made to (such as, but not limited to, two) streaks from serial single Genus, Species, and Phylogenetic Clade. Clade membership colonies have shown only a single colony morphology. Alter of bacterial OTUs is based on 16S sequence data. Clades are natively, reduction of contamination can be accomplished by defined based on the topology of a phylogenetic tree that is multiple rounds of serial dilutions to single desired cells (e.g., constructed from full-length 16S sequences using maximum a dilution of 10 or 10), such as through multiple 10-fold likelihood methods familiar to individuals with ordinary skill serial dilutions. This can further be confirmed by showing that US 2016/0158294 A1 Jun. 9, 2016

multiple isolated colonies have similar cell shapes and Gram 0056. The term “Network Ecology” refers to a consortium staining behavior. Other methods for confirming adequate of OTUs that co-occur in some number of subjects. As used purity include genetic analysis (e.g. PCR, DNA sequencing), herein, a “network” is defined mathematically by a graph serology and antigen analysis, enzymatic and metabolic delineating how specific nodes (i.e. OTUs) and edges (con analysis, and methods using instrumentation Such as flow nections between specific OTUs) relate to one another to cytometry with reagents that distinguish desired constituents define the structural ecology of a consortium of OTUs. Any from contaminants. given Network Ecology will possess inherent phylogenetic 0051. “Clade” refers to the OTUs or members of a phylo diversity and functional properties. A Network Ecology can genetic tree that are downstream of a statistically valid node in also be defined in terms of function where for example the a phylogenetic tree. The clade comprises a set of terminal nodes would be comprised of elements such as, but not lim leaves in the phylogenetic tree that is a distinct monophyletic ited to, enzymes, clusters of orthologous groups (COGS: evolutionary unit and that share some extent of sequence http://www.ncbi.nlm.nih.gov/books/NBK21090/), or KEGG similarity. pathways (www.genome.jp/kegg/). 0052) 16s Sequencing, 16s, 16s-rRNA, 16s-NGS: In 0057 Network Class, Core Network, Core Network Ecol microbiology, “16S sequencing” or “16S-rRNA' or “16S” ogy: The terms “Network Class”, “Core Network” and “Core refers to sequence derived by characterizing the nucleotides Network Ecology” refer to a group of network ecologies that that comprise the 16S ribosomal RNA gene(s). The bacterial in general are computationally determined to comprise ecolo 16S rDNA is approximately 1500 nucleotides in length and is gies with similar phylogenetic and/or functional characteris used in reconstructing the evolutionary relationships and tics. A Core Network therefore contains important biological sequence similarity of one bacterial isolate to another using features, defined either phylogenetically or functionally, of a phylogenetic approaches. 16S sequences are used for phylo group (i.e., a cluster) of related network ecologies. One rep genetic reconstruction as they are in general highly con resentation of a Core Network Ecology is a designed consor served, but contain specific hyperVariable regions that harbor tium of microbes, typically non-pathogenic bacteria, that rep sufficient nucleotide diversity to differentiate genera and spe resents core features of a set of phylogenetically or cies of most bacteria. functionally related network ecologies seen in many different Subjects. In many occurrences, a Core Network, while 0053. The “V1-V9 regions” of the 16S rRNA refers to the designed as described herein, exists as a Network Ecology first through ninth hypervariable regions of the 16S rRNA observed in one or more subjects. Core Network ecologies are gene that are used for genetic typing of bacterial samples. useful for reversing or reducing a dysbiosis in subjects where These regions in bacteria are defined by nucleotides 69-99, the underlying, related Network Ecology has been disrupted. 137-242, 433-497, 576-682,822-879,986-1043, 1117-1173, 1243-1294 and 1435-1465 respectively using numbering 0058. The term “Keystone OTU refers to one or more based on the E. coli system of nomenclature. Brosius et al., OTUS that are common to many network ecologies and are Complete nucleotide sequence of a 16S ribosomal RNA gene members of networks ecologies that occur in many Subjects from Escherichia coli, PNAS 75(10):4801-4805 (1978). In (i.e. are pervasive). Due to the ubiquitous nature of Keystone some embodiments, at least one of the V1,V2, V3, V4, V5, OTUs, they are central to the function of network ecologies in V6, V7, V8, and V9 regions are used to characterize an OTU. healthy Subjects and are often missing or at reduced levels in In one embodiment, the V1,V2, and V3 regions are used to subjects with disease. Keystone OTUs may exist in low, mod characterize an OTU. In another embodiment, the V3, V4, and erate, or high abundance in Subjects. V5 regions are used to characterize an OTU. In another 0059. The term “non-Keystone OTU refers to an OTU embodiment, the V4 region is used to characterize an OTU. A that is observed in a Network Ecology and is not a keystone person of ordinary skill in the art can identify the specific OTU. hypervariable regions of a candidate 16S rRNA by comparing 0060. The term “Phylogenetic Diversity” refers to the the candidate sequence in question to a reference sequence biodiversity present in a given Network Ecology or Core and identifying the hyperVariable regions based on similarity Network Ecology based on the OTUs that comprise the net to the reference hyperVariable regions, or alternatively, one work. Phylogenetic diversity is a relative term, meaning that can employ Whole Genome Shotgun (WGS) sequence char a Network Ecology or Core Network that is comparatively acterization of microbes or a microbial community. more phylogenetically diverse than another network contains 0054 The term “subject” refers to any animal subject a greater number of unique species, genera, and taxonomic including humans, laboratory animals (e.g., primates, rats, families. Uniqueness of a species, genera, or taxonomic fam mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, and ily is generally defined using a phylogenetic tree that repre chickens), and household pets (e.g., dogs, cats, and rodents). sents the genetic diversity all species, genera, or taxonomic The Subject may be suffering from a dysbiosis, including, but families relative to one another. In another embodiment phy not limited to, an infection due to a gastrointestinal pathogen logenetic diversity may be measured using the total branch or may be at risk of developing or transmitting to others an length or average branch length of a phylogenetic tree. infection due to a gastrointestinal pathogen. 0061. A “spore' or a population of “spores” includes bac 0055. The term “phenotype” refers to a set of observable teria (or other single-celled organisms) that are generally characteristics of an individual entity. As example an indi viable, more resistant to environmental influences such as vidual subject may have a phenotype of “health' or “disease'. heat and bacteriocidal agents than vegetative forms of the Phenotypes describe the state of an entity and all entities same bacteria, and typically capable of germination and out within a phenotype share the same set of characteristics that growth. “Spore-formers' or bacteria “capable of forming describe the phenotype. The phenotype of an individual spores' are those bacteria containing the genes and other results in part, or in whole, from the interaction of the entities necessary abilities to produce spores under Suitable environ genome and/or microbiome with the environment. mental conditions. US 2016/0158294 A1 Jun. 9, 2016

0062. A “spore population” refers to a plurality of spores about 99%, or more than about 99% pure. In the instance of present in a composition. Synonymous terms used herein bacterial compositions provided herein, the one or more bac include spore composition, spore preparation, ethanol treated terial types present in the composition can be independently spore fraction and spore ecology. A spore population may be purified from one or more other bacteria produced and/or purified from a fecal donation, e.g. via ethanol or heat treat present in the material or environment containing the bacte ment, or a density gradient separation or any combination of rial type. Bacterial compositions and the bacterial compo methods described herein to increase the purity, potency and/ nents thereof are generally purified from residual habitat or concentration of spores in a sample. Alternatively, a spore products. population may be derived through culture methods starting 0065 “Inhibition' of a pathogen encompasses the inhibi from isolated spore former species or spore former OTUs or tion of any desired function or activity of the bacterial com from a mixture of Such species, either in vegetative or spore positions of the present invention. Demonstrations of patho form. gen inhibition, Such as decrease in the growth of a pathogenic 0063. In one embodiment, the spore preparation com bacterium or reduction in the level of colonization of a patho prises spore forming species wherein residual non-spore genic bacterium are provided herein and otherwise recog forming species have been inactivated by chemical or physi nized by one of ordinary skill in the art. Inhibition of a cal treatments including ethanol, detergent, heat, Sonication, pathogenic bacterium’s “growth' may include inhibiting the and the like; or wherein the non-spore forming species have increase in size of the pathogenic bacterium and/or inhibiting been removed from the spore preparation by various separa the proliferation (or multiplication) of the pathogenic bacte tions steps including density gradients, centrifugation, filtra rium. Inhibition of colonization of a pathogenic bacterium tion and/or chromatography; or wherein inactivation and may be demonstrated by measuring the amount or burden of separation methods are combined to make the spore prepara a pathogen before and after a treatment. An “inhibition” or the tion. In yet another embodiment, the spore preparation com act of “inhibiting includes the total cessation and partial prises spore forming species that are enriched over viable reduction of one or more activities of a pathogen, Such as non-spore formers or vegetative forms of spore formers. In growth, proliferation, colonization, and function. this embodiment, spores are enriched by 2-fold, 5-fold, 0066. A “germinant' is a material or composition or 10-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold or greater physical-chemical process capable of inducing vegetative than 10,000-fold compared to all vegetative forms of bacteria. In yet another embodiment, the spores in the spore prepara growth of a bacterium that is in a dormant spore form, or tion undergo partial germination during processing and for group of bacteria in the spore form, either directly or indi mulation Such that the final composition comprises spores rectly in a host organism and/or in vitro. and vegetative bacteria derived from spore forming species. 0067. A “sporulation induction agent' is a material or physical-chemical process that is capable of inducing sporu 0064. The term "isolated encompasses a bacterium or other entity or substance that has been (1) separated from at lation in a bacterium, either directly or indirectly, in a host least some of the components with which it was associated organism and/or in vitro. when initially produced (whether in nature or in an experi 0068 To “increase production of bacterial spores' mental setting), and/or (2) produced, prepared, purified, and/ includes an activity or a sporulation induction agent. "Pro or manufactured by the hand of man. Isolated bacteria include duction' includes conversion of vegetative bacterial cells into those bacteria that are cultured, even if such cultures are not spores and augmentation of the rate of Such conversion, as monocultures. Isolated bacteria may be separated from at well as decreasing the germination of bacteria in spore form, least about 10%, about 20%, about 30%, about 40%, about decreasing the rate of spore decay in vivo, or ex vivo, or to 50%, about 60%, about 70%, about 80%, about 90%, or more increasing the total output of spores (e.g. via an increase in of the other components with which they were initially asso volumetric output of fecal material). ciated. In some embodiments, isolated bacteria are more than 0069. The “colonization of a host organism includes the about 80%, about 85%, about 90%, about 91%, about 92%, non-transitory residence of a bacterium or other microscopic about 93%, about 94%, about 95%, about 96%, about 97%, organism. As used herein, “reducing colonization of a host about 98%, about 99%, or more than about 99% pure. As used Subject's gastrointestinal tract (or any other microbiotal herein, a substance is “pure' if it is substantially free of other niche) by a pathogenic bacterium includes a reduction in the components. The terms “purify.” “purifying and “purified’ residence time of the pathogen in the gastrointestinal tract as refer to a bacterium or other material that has been separated well as a reduction in the number (or concentration) of the from at least some of the components with which it was pathogen in the gastrointestinal tractor adhered to the luminal associated either when initially produced or generated (e.g., Surface of the gastrointestinal tract. Measuring reductions of whether in nature or in an experimental setting), or during any adherent pathogens may be demonstrated, e.g., by a biopsy time after its initial production. A bacterium or a bacterial sample, or reductions may be measured indirectly, e.g., by population may be considered purified if it is isolated at or measuring the pathogenic burden in the stool of a mammalian after production, such as from a material or environment host. containing the bacterium or bacterial population, or by pas sage through culture, and a purified bacterium or bacterial 0070 A “combination of two or more bacteria includes population may contain other materials up to about 10%, the physical co-existence of the two bacteria, either in the about 20%, about 30%, about 40%, about 50%, about 60%, same material or productor in physically connected products, about 70%, about 80%, about 90%, or above about 90% and as well as the temporal co-administration or co-localization still be considered "isolated.” In some embodiments, purified of the two bacteria. bacteria and bacterial populations are more than about 80%, 0071. A “cytotoxic' activity or bacterium includes the about 85%, about 90%, about 91%, about 92%, about 93%, ability to kill a bacterial cell. Such as a pathogenic bacterial about 94%, about 95%, about 96%, about 97%, about 98%, cell. A “cytostatic' activity or bacterium includes the ability US 2016/0158294 A1 Jun. 9, 2016

to inhibit, partially or fully, growth, metabolism, and/or pro commensal bacteria not directly delivered increases the over liferation of a bacterial cell. Such as a pathogenic bacterial all diversity of the subsequent microbiome with healthy com cell. mensal bacteria and improves host health. 0072. Non-comestible products: To be free of “non-co 0079. Inhibition of pathogens includes those pathogens mestible products’ means that a bacterial composition or Such as C. difficile, Salmonella spp., enteropathogenic Ecoli, other material provided herein does not have a substantial multi-drug resistant bacteria Such as Klebsiella, and E. coli, amount of a non-comestible product, e.g., a product or mate Carbapenem-resistent Enterobacteriaceae (CRE), extended rial that is inedible, harmful or otherwise undesired in a spectrum beta-lactam resistant Enterococci (ESBL), and van product Suitable for administration, e.g., oral administration, comycin-resistant Enterococci (VRE). In particular, provided to a human subject. Non-comestible products are often found are synergistic combinations that treat, prevent, delay or in preparations of bacteria from the prior art. reduce the symptoms of diseases, disorders and conditions 0073. As used herein the term “vitamin' is understood to associated with a dysbiosis. Representative diseases, disor include any of various fat-soluble or water-soluble organic ders and conditions potentially associated with a dysbiosis, Substances (non-limiting examples include vitamin A, Vita which are suitable for treatment with the compositions and min B1 (thiamine), Vitamin B2 (riboflavin), Vitamin B3 (nia methods as described herein, are provided in Tables 3 and 4. cin or niacinamide), Vitamin B5 (pantothenic acid), Vitamin 0080. As used herein, a “type' or more than one “types of B6 (pyridoxine, pyridoxal, or pyridoxamine, or pyridoxine bacteria may be differentiated at the genus level, the species, hydrochloride), Vitamin B7 (biotin), Vitamin B9 (folic acid), level, the sub-species level, the strain level or by any other and Vitamin B12 (various cobalamins; commonly cyanoco taxonomic method, as described herein and otherwise known balamin in Vitamin Supplements), vitamin C, Vitamin D. Vita in the art. min E, vitamin K. K1 and K2 (i.e. MK-4, MK-7), folic acid I0081 Bacterial compositions may comprise two types of and biotin) essential in minute amounts for normal growth bacteria (termed “binary combinations” or “binary pairs') or and activity of the body and obtained naturally from plant and greater than two types of bacteria. For instance, a bacterial animal foods or synthetically made, pro-Vitamins, deriva composition may comprise at least 2, at least 3, at least 4, at tives, analogs. least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at 0.074 As used herein, the term “minerals” is understood to least 11, at least 12, at least 13, at least 14, at least 15, at least include boron, calcium, chromium, copper, iodine, iron, mag 16, at least 17, at least 18, at least 19, at least 20, or at least 21, nesium, manganese, molybdenum, nickel, phosphorus, 22, 23, 24, 25, 26, 27, 28, 29 30, 31, 32,33, 34,35, 36, 37,38, potassium, selenium, silicon, tin, vanadium, zinc, or combi 39, or at least 40, at least 50 or greater than 50 types of nations thereof. bacteria, as defined by species or operational taxonomic unit 0075. As used herein, the term “antioxidant’ is understood (OTU), or otherwise as provided herein. to include any one or more of various Substances such as I0082 In another embodiment, the number of types of bac beta-carotene (a vitamin A precursor), Vitamin C, Vitamin E, teria present in a bacterial composition is at or below a known and selenium) that inhibit oxidation or reactions promoted by value. For example, in Such embodiments the bacterial com Reactive Oxygen Species (“ROS) and other radical and non position comprises 50 or fewer types of bacteria, such as 49. radical species. Additionally, antioxidants are molecules 48, 47,46, 45, 44, 43,42, 41,40,39,38, 37, 36,35,34, 33, 32, capable of slowing or preventing the oxidation of other mol 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, ecules. Non-limiting examples of antioxidants include astax 14, 13, 12, 11, or 10 or fewer, or 9 or fewer types of bacteria, anthin, carotenoids, coenzyme Q10 (“CoQ10), flavonoids, 8 or fewer types of bacteria, 7 or fewer types of bacteria, 6 or glutathione, Goji (wolfberry), hesperidin, lactowolfberry, lig fewer types of bacteria, 5 or fewer types of bacteria, 4 or fewer nan, lutein, lycopene, polyphenols, selenium, vitaminA, Vita types of bacteria, or 3 or fewer types of bacteria. In another min C, Vitamin E. zeaxanthin, or combinations thereof. embodiment, a bacterial composition comprises from 2 to no 0076 Compositions of the Invention more than 40, from 2 to no more than 30, from 2 to no more 0077 Bacterial Compositions than 20, from 2 to no more than 15, from 2 to no more than 10, 0078 Provided are bacteria and combinations of bacteria or from 2 to no more than 5 types of bacteria. In some of the human gut microbiota with the capacity to meaning embodiments, bacterial compositions are provided with the fully provide functions of a healthy microbiota when admin ability to exclude pathogenic bacteria. Exemplary bacterial istered to mammalian hosts. Without being limited to a spe compositions are demonstrated to reduce the growth rate of cific mechanism, it is thought that such compositions inhibit one pathogen, C. difficile, as provided in the Examples, the growth, proliferation, and/or colonization of one or a wherein the ability of the bacterial compositions is demon plurality of pathogenic bacteria in the dysbiotic microbiotal strated by assessing the antagonism activity of a combination niche, so that a healthy, diverse and protective microbiota of OTUS or strains towards a given pathogen using in vitro colonizes and populates the intestinal lumen to establish or assayS. reestablish ecological control over pathogens or potential I0083 Bacterial Compositions Described by Species pathogens (e.g., some bacteria are pathogenic bacteria only I0084. Bacterial compositions may be prepared compris when present in a dysbiotic environment). In some embodi ing at least two types of isolated bacteria, chosen from the ments, bacterial composition engraft in the host gut are species in Table 1. detectable 1, 2, 3, 4, 5, or 6 days, 1 or 2 weeks, 1, 3 or 6 I0085. In one embodiment, the bacterial composition com months, 1 year or greater than 1 year after the administration prises at least one and preferably more than one of the fol of composition when the bacteria compositions were not lowing: Enterococcus faecalis (previously known as Strepto present before treatment. In some embodiments, the bacteria coccus faecalis), Clostridium innocuum, Clostridium compositions delivered shift the gut environment to a state ramosum, Bacteroides ovatus, Bacteroides vulgatus, allowing other healthy commensal bacteria to augment the Bacteroides the taoiotaomicron, Escherichia coli (1109 and delivered population. In this manner, augmentation of the 1108-1), Clostridum bifermentans, and Blautia producta US 2016/0158294 A1 Jun. 9, 2016

(previously known as Peptostreptococcus productus). In an losum. In an alternative embodiment, at least one of the pre alternative embodiment, at least one of the preceding species ceding species is not Substantially present in the bacterial is not Substantially present in the bacterial composition. composition. I0086. In one embodiment, the bacterial composition com 0090. In one embodiment, the bacterial composition com prises at least one and preferably more than one of the fol prises at least one and preferably more than one of the fol lowing: Enterococcus faecalis (previously known as Strepto lowing: Clostridium innocuum, Clostridum bifermentans, coccus faecalis), Clostridium innocuum, Clostridium Clostridium butyricum, Bacteroides fragilis, Bacteroides ramosum, Bacteroides ovatus, Bacteroides vulgatus, thetaiotaomicron, Bacteroides uniformis, three Strains of Bacteroides thetaoiotaOmicron, Escherichia coli (1109 and Escherichia coli, and Lactobacillus sp. In an alternative 1108-1), Clostridum bifermentans, and Blautia producta embodiment, at least one of the preceding species is not (previously known as Peptostreptococcus productus). In an Substantially present in the bacterial composition. alternative embodiment, at least one of the preceding species 0091. In one embodiment, the bacterial composition com is not Substantially present in the bacterial composition. prises at least one and preferably more than one of the fol lowing: Clostridium bifermentans, Clostridium innocuum, 0087. In another embodiment, the bacterial composition Clostridium butyricum, three strains of Escherichia coli, comprises at least one and preferably more than one of the three strains of Bacteroides, and Blautia producta. In an following: Acidaminococcus intestinalis, Bacteroides ova alternative embodiment, at least one of the preceding species tus, two strains of Bifidobacterium adolescentis, two strains is not substantially present in the bacterial composition. of Bifidobacterium longum, Blautia producta, Clostridium 0092. In one embodiment, the bacterial composition com cocleaturn, Collinsella aerofaciens, two strains of Dorea lon prises at least one and preferably more than one of the fol gicatena, Escherichia coli, Eubacterium desmolans, Eubac lowing: Bacteroides sp., Escherichia coli, and non patho terium eligens, Eubacterium limosum, four strains of Eubac genic Clostridia, including Clostridium innocuum, terium rectale, Eubacterium ventriosumi, Faecalibacterium Clostridium bifermentans and Clostridium ramosum. In an prausnitzii, Lachnospira pectinoshiza, Lactobacillus casei, alternative embodiment, at least one of the preceding species Lactobacillus casei/paracasei, Paracateroides distasonis, is not substantially present in the bacterial composition. Raoultella sp., one strain of Roseburia (chosen from Rose 0093. In one embodiment, the bacterial composition com buria faecalis or Roseburia faecis), Roseburia intestinalis, prises at least one and preferably more than one of the fol two strains of Ruminococcus torques, two strains of Rumino lowing: Bacteroides species, Escherichia coli and non-patho coccus obeum, and Streptococcus mitis. In an alternative genic Clostridia, such as Clostridium butyricum, Clostridium embodiment, at least one of the preceding species is not bifermentans and Clostridium innocuum. In an alternative Substantially present in the bacterial composition. embodiment, at least one of the preceding species is not 0088. In yet another embodiment, the bacterial composi Substantially present in the bacterial composition. tion comprises at least one and preferably more than one of 0094. In one embodiment, the bacterial composition com the following: Bamesiella intestinihominis, Lactobacillus prises at least one and preferably more than one of the fol reuteri; a species characterized as one of Enterococcus hirae, lowing: Bacteroides Caccae, Bacteroides capillosus, Enterococus faecium, or Enterococcus durans; a species Bacteroides coagulans, Bacteroides distasonis, Bacteroides characterized as one of Anaerostipes caccae or Clostridium eggerthii, Bacteroides forsythus, Bacteroides fragilis, indolis; a species characterized as one of Staphylococcus Bacteroides fragilis-ryhn, Bacteroides gracilis, Bacteroides warneri or Staphylococcus pasteuri; and Adlercreutzia levi, Bacteroides macacae, Bacteroides merdae, Bacteroides equolifaciens. In an alternative embodiment, at least one of ovatus, Bacteroides pneumosintes, Bacteroides putredinis, the preceding species is not Substantially present in the bac Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroi terial composition. des Stercoris, Bacteroides tectum, Bacteroides thetaiotaomi 0089. In other embodiments, the bacterial composition cron, Bacteroides uniformis, Bacteroides ureolyticus, and comprises at least one and preferably more than one of the Bacteroides vulgatus. In an alternative embodiment, at least following: Clostridium absonium, Clostridium argentinense, one of the preceding species is not substantially present in the Clostridium baratii, Clostridium bartlettii, Clostridium bifer bacterial composition. mentans, Clostridium botulinum, Clostridium butyricum, 0095. In one embodiment, the bacterial composition com Clostridium cadaveris, Clostridium Camis, Clostridium cella prises at least one and preferably more than one of the fol turn, Clostridium chauvoei, Clostridium clostridioforme, lowing: Bacteroides, Eubacteria, Fusobacteria, Propioni Clostridium cochlearium, Clostridium difficile, Clostridium bacteria, Lactobacilli, anaerobic cocci, Ruminococcus, fallax, Clostridium felsineum, Clostridium ghonii, Escherichia coli, Gemmiger; Desulfomonas, and Peptostrep Clostridium glycolicum, Clostridium haemolyticum, tococcus. In an alternative embodiment, at least one of the Clostridium hastiforme, Clostridium histolyticum, preceding species is not substantially present in the bacterial Clostridium indolis, Clostridium innocuum, Clostridium composition. irregulare, Clostridium limosum, Clostridium malenomina 0096. In one embodiment, the bacterial composition com tum, Clostridium novyi, Clostridium Oroticum, Clostridium prises at least one and preferably more than one of the fol paraputrificum, Clostridium perfingens, Clostridium pili lowing: Bacteroides fragilis SS. Vulgatus, Eubacterium aero forme, Clostridium putrefaciens, Clostridium putrificum, faciens, Bacteroides fragilis SS. Thetaiotaomicron, Blautia Clostridium ramosum, Clostridium sardiniense, Clostridium producta (previously known as Peptostreptococcus produc Sartagoforme, Clostridium scindens, Clostridium septicum, tus II), Bacteroides fragilis SS. Distasonis, Fusobacterium Clostridium sordellii, Clostridium sphenoides, Clostridium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens spiroforme, Clostridium sporogenes, Clostridium subtermi III, Blautia producta (previously known as Peptostreptococ male, Clostridium symbiosum, Clostridium tertium, cus productus I), Ruminococcus bronii, Bifidobacterium ado Clostridium tetani, Clostridium welchii, and Clostridium vil lescentis, Gemmiger formicilis, Bifidobacterium longum, US 2016/0158294 A1 Jun. 9, 2016

Eubacterium Siraeum, Ruminococcus torques, Eubacterium 0102. In another embodiment, the bacterial composition rectale III-H, Eubacterium rectale IV. Eubacterium eligens, does not comprise at least one of Acidaminococcus intestina Bacteroides eggerthii, Clostridium leptum, Bacteroides fra lis, Bacteroides ovatus, two species of Bifidobacterium ado gilis SS. A., Eubacterium biforme, Bifidobacterium infantis, lescentis, two species of Bifidobacterium longum, Collinsella Eubacterium rectale III-F. Coprococcus comes, Bacteroides aerofaciens, two species of Dorea longicatena, Escherichia capillosus, Ruminococcus albus, Eubacterium formicigener coli, Eubacterium eligens, Eubacterium limosum, four spe ans, Eubacterium hallii, Eubacterium ventriosum I, Fuso cies of Eubacterium rectale, Eubacterium ventriosumi, bacterium russii, Ruminococcus obeum, Eubacterium rectale Faecalibacterium prausnitzii, Lactobacillus casei, Lactoba II, Clostridium ramosum I, Lactobacillus leichmanii, Rumi cillus paracasei, Paracateroides distasonis, Raoultella sp., nococcus Cailidus, Butyrivibrio crossotus, Acidaminococcus one species of Roseburia (chosen from Roseburia faecalis or fermentans, Eubacterium ventriosum, Bacteroides fragilis SS. Roseburia faecis), Roseburia intestinalis, two species of fragilis, Bacteroides AR, Coprococcus catus, Eubacterium Ruminococcus torques, and Streptococcus mitis. hadrum, Eubacterium cylindroides, Eubacterium ruminan 0103) In yet another embodiment, the bacterial composi tium, Eubacterium CH-1, Staphylococcus epidermidis, Pep tion does not comprise at least one of Bamesiella intestini to streptococcus BL, Eubacterium limosum, Bacteroides hominis, Lactobacillus reuteri; a species characterized as one praeacutus, Bacteroides L., Fusobacterium mortiferum I. of Enterococcus hirae, Enterococus faecium, or Enterococ Fusobacterium naviforme, Clostridium innocuum, cus durans; a species characterized as one of Anaerostipes Clostridium ramosum, Propionibacterium acnes, Rumino caccae or Clostridium indolis; a species characterized as one coccus flavefaciens, Ruminococcus AT, Peptococcus AU-1. of Staphylococcus warneri or Staphylococcus pasteuri; and Eubacterium AG, -AK, -AL -AL-1, -AN; Bacteroides fragi Adlercreutzia equolifaciens. lis SS. ovatus, -SS. d, -SS. f. Bacteroides L-1, L-5. Fusobacte 0104. In other embodiments, the bacterial composition rium nucleatum, Fusobacterium mortiferum, Escherichia does not comprise at least one of Clostridium absonium, coli, Streptococcus morbilliorum, Peptococcus magnus, Pep Clostridium argentinense, Clostridium baratii, Clostridium tococcus G, AU-2; Streptococcus intermedius, Ruminococ bifermentans, Clostridium botulinum, Clostridium butyri cus lactaris, Ruminococcus CO Gemmiger X, Coprococcus cum, Clostridium cadaveris, Clostridium camis, Clostridium BH, -CC, Eubacterium tenue, Eubacterium ramulus, Eubac cellatum, Clostridium chauvoei, Clostridium clostridioforme, terium AE, -AG-H, -AG-M, -AJ, -BN-1; Bacteroides clostri Clostridium cochlearium, Clostridium difficile, Clostridium diiformis SS. clostridliformis, Bacteroides coagulans, fallax, Clostridium felsineum, Clostridium ghonii, Bacteroides Orails, Bacteroides ruminicola SS. brevis, -SS. Clostridium glycolicum, Clostridium haemolyticum, ruminicola, Bacteroides splanchnicus, Desuifomonas pigra, Clostridium hastiforme, Clostridium histolyticum, Bacteroides L-4, -N-i: Fusobacterium H, Lactobacillus G, Clostridium indolis, Clostridium innocuum, Clostridium and Succinivibrio A. In an alternative embodiment, at least irregulare, Clostridium limosum, Clostridium malenomina one of the preceding species is not substantially present in the tum, Clostridium novyi, Clostridium Oroticum, Clostridium bacterial composition. paraputrificum, Clostridium perfingens, Clostridium pili 0097. Bacterial Compositions Described by Operational forme, Clostridium putrefaciens, Clostridium putrificum, Taxonomic Unit (OTUs) Clostridium ramosum, Clostridium sardiniense, Clostridium 0098 Bacterial compositions may be prepared compris Sartagoforme, Clostridium Scindens, Clostridium septicum, ing at least two types of isolated bacteria, chosen from Table Clostridium sordellii, Clostridium sphenoides, Clostridium 1 spiroforme, Clostridium sporogenes, Clostridium subtermi 0099. In one embodiment, the OTUs can be characterized male, Clostridium symbiosum, Clostridium tertium, by one or more of the variable regions of the 16S sequence Clostridium tetani, Clostridium welchii, and Clostridium vil (V1-V9). These regions in bacteria are defined by nucleotides losum. 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and 1435-1465 respectively using 0105. In another embodiment, the bacterial composition numbering based on the E. coli system of nomenclature. (See, does not comprise at least one of Clostridium innocuum, e.g., Brosius et al., Complete nucleotide sequence of a 16S Clostridum bifermentans, Clostridium butyricum, Bacteroi ribosomal RNA gene from Escherichia coli, PNAS 75(10): des fragilis, Bacteroides thetaiotaomicron, Bacteroides uni 4801-4805 (1978)). In some embodiments, at least one of the formis, three strains of Escherichia coli, and Lactobacillus sp. V1,V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to 0106. In another embodiment, the bacterial composition characterize an OTU. In one embodiment, the V1,V2, and V3 does not comprise at least one of Clostridium bifermentans, regions are used to characterize an OTU. In another embodi Clostridium innocuum, Clostridium butyricum, three strains ment, the V3, V4, and V5 regions are used to characterize an of Escherichia coli, three strains of Bacteroides, and Blautia OTU. In another embodiment, the V4 region is used to char producta (previously known as Peptostreptococcus produc acterize an OTU. tus). 0100 Bacterial Compositions Exclusive of Certain Bac 0107. In another embodiment, the bacterial composition terial Species or Strains does not comprise at least one of Bacteroides sp., Escherichia 0101. In one embodiment, the bacterial composition does coli, and non pathogenic Clostridia, including Clostridium not comprise at least one of Enterococcus faecalis (previ innocuum, Clostridium bifermentans and Clostridium ramo ously known as Streptococcus faecalis), Clostridium St. innocuum, Clostridium ramosum, Bacteroides ovatus, 0108. In another embodiment, the bacterial composition Bacteroides vulgatus, Bacteroides thetaoiotaomicron, does not comprise at least one of more than one Bacteroides Escherichia coli (1109 and 1108-1), Clostridum bifermen species, Escherichia coli and non-pathogenic Clostridia, Such tans, and Blautia producta (previously known as Peptostrep as Clostridium butyricum, Clostridium bifermentans and tococcus productus). Clostridium innocuum. US 2016/0158294 A1 Jun. 9, 2016

0109. In another embodiment, the bacterial composition 0.115. In some embodiments, the pathogenic bacterium or does not comprise at least one of Bacteroides caccae, pathobiont is selected from the group categorized as patho Bacteroides capillosus, Bacteroides coagulans, Bacteroides gens or pathobionts in Table 1. In another embodiment, the distasonis, Bacteroides eggerthii, Bacteroides forsythus, pathogenic bacterium is selected from the group consisting of Bacteroides fragilis, Bacteroides fragilis-ryhn, Bacteroides Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, gracilis, Bacteroides levi, Bacteroides macacae, Bacteroides Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, merdae, Bacteroides ovatus, Bacteroides pneumosintes, Neisseria, Mycoplasma, Mycobacterium, Listeria, Lep Bacteroides putredinis, Bacteroides pyogenes, Bacteroides to spira, Legionella, Klebsiella, Helicobacter, Haemophilus, splanchnicus, Bacteroides Stercoris, Bacteroides tectum, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Bacteroides thetaiotaomicron, Bacteroides uniformis, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Bacteroides ureolyticus, and Bacteroides vulgatus. Campylobacter, Burkholderia, Brucella, Borrelia, Borde 0110. In another embodiment, the bacterial composition tella, Bifidobacterium, Bacillus, multi-drug resistant bacte does not comprise at least one of Bacteroides, Eubacteria, ria, extended spectrum beta-lactam resistant Enterococci Fusobacteria, Propionibacteria, Lactobacilli, anaerobic (ESBL), Carbapenem-resistent Enterobacteriaceae (CRE), cocci, Ruminococcus, Escherichia coli, Gemmiger; Des and Vancomycin-resistant Enterococci (VRE). ulfomonas, and Peptostreptococcus. 0116. In some embodiments, these pathogens include, but are not limited to, Aeromonas hydrophila, Campylobacter 0111. In another embodiment, the bacterial composition fetus, Plesiomonas Shigelloides, Bacillus cereus, Campylo does not comprise at least one of Bacteroides fragilis SS. bacter jejuni, Clostridium botulinum, Clostridium difficile, Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis SS. Clostridium perfingens, enteroaggregative Escherichia coli, ThetaiotaOmicron, Blautia producta (previously known as enterohemorrhagic Escherichia coli, enteroinvasive Escheri Peptostreptococcus productus II), Bacteroides fragilis SS. chia coli, enterotoxigenic Escherichia coli (such as, but not Distasonis, Fusobacterium prausnitzii, Coprococcus eutac limited to, LT and/or ST), Escherichia coli O157:H7, Helico tus, Eubacterium aerofaciens III, Blautia producta (previ bacter pylori, Klebsiellia pneumonia, Lysteria monocytoge ously known as Peptostreptococcus productus I), Rumino nes, Plesiomonas Shigelloides, Salmonella spp., Salmonella coccus bromii, Bifidobacterium adolescentis, Geminiger typhi, Salmonella paratyphi, Shigella spp., Staphylococcus formicilis, Bifidobacterium longum, Eubacterium Siraeum, Ruminococcus torques, Eubacterium rectale III-H. Eubacte spp., Staphylococcus aureus, Vancomycin-resistant entero rium rectale IV, Eubacterium eligens, Bacteroides eggerthii, coccus spp., Vibrio spp., Vibrio cholerae, Vibrio para Clostridium leptum, Bacteroides fragilis SS. A., Eubacterium haemolyticus, Vibrio vulnificus, and Yersinia enterocolitica. biforme, Bifidobacterium infantis, Eubacterium rectale III-F, 0117. In one embodiment, the pathogen of interest is at Coprococcus comes, Bacteroides capillosus, Ruminococcus least one pathogen chosen from Clostridium difficile, Salmo albus, Eubacterium formicigenerans, Eubacterium hallii, nella spp., pathogenic Escherichia coli, Vancomycin-resis Eubacterium ventriosum I, Fusobacterium russii, Rumino tant Enterococcus spp., and extended spectrum beta-lactam coccus obeum, Eubacterium rectale II, Clostridium ramosum resistant Enterococci (ESBL). I, Lactobacillus leichmanii, Ruminococcus Cailidus, Butyriv 0118 Purified Spore Populations ibrio crossotus, Acidaminococcus fermentans, Eubacterium 0119. In some embodiments, the bacterial compositions ventriosum, Bacteroides fragilis SS. fragilis, Bacteroides AR, comprise purified spore populations. Purified spore popula Coprococcus catus, Eubacterium hadrum, Eubacterium tions contain combinations of commensal bacteria of the cylindroides, Eubacterium ruminantium, Eubacterium CH-1, human gut microbiota with the capacity to meaningfully pro Staphylococcus epidermidis, Peptostreptococcus BL, Eubac vide functions of a healthy microbiota when administered to terium limosum, Bacteroides praeacutus, Bacteroides L. a mammalian Subject. Without being limited to a specific Fusobacterium mortiferum I, Fusobacterium naviforme, mechanism, it is thought that Such compositions inhibit the Clostridium innocuum, Clostridium ramosum, Propionibac growth of a pathogen Such as C. difficile, Salmonella spp., terium acnes, Ruminococcus flavefaciens, Ruminococcus AT, enteropathogenic E. coli, and Vancomycin-resistant Entero Peptococcus AU-1, Eubacterium AG, -AK. -AL -AL-1, coccus spp., so that a healthy, diverse and protective micro -AN; Bacteroides fragilis SS. ovatus, -SS. d, -SS. f. Bacteroides biota can be maintained or, in the case of pathogenic bacterial L-1, L-5. Fusobacterium nucleatum, Fusobacterium mor infections such as C. difficile infection, repopulate the intes tiferum, Escherichia coli, Streptococcus morbilliorum, Pepto tinal lumen to reestablish ecological control over potential coccus magnus, Peptococcus G, AU-2; Streptococcus inter pathogens. Spore forming bacteria often exist in both a spore medius, Ruminococcus lactaris, Ruminococcus CO form and a vegetative form in a given population of cells. The Gemmiger X, Coprococcus BH, -CC: Eubacterium tenue, biological activity and resistance to environmental stress can Eubacterium ramulus, Eubacterium AE, -AG-H, -AG-M, vary in each form and as a result both forms might be advan -AJ, -BN-1; Bacteroides clostridiiformis ss. Clostridliformis, tageous for different purposes. Bacterial compositions and Bacteroides coagulans, Bacteroides Orails, Bacteroides methods described allow one to purify compositions contain ruminicola SS. brevis, -SS. ruminicola, Bacteroides splanch ing spores to produce bacterial compositions that are resistant nicus, Desuifomonas pigra, Bacteroides L-4, -N-i; Fusobac to environmental stresses such as but not limited to aerobic terium H, Lactobacillus G, and Succinivibrio A. conditions, lack of nutrients, low pH, and temperature varia tions to populate the gut. In vegatitative form, the proper 0112 Inhibition of Bacterial Pathogens bacterial compositions disclosed herein can produce benefi 0113. In some embodiments, the bacterial composition cial health effects. provides a protective ortherapeutic effect against infection by I0120 Disclosed herein are therapeutic compositions con one or more GI pathogens of interest. taining non-pathogenic, germination-competent bacterial 0114. A list of exemplary bacterial pathogens is provided spores, for the prevention, control, and treatment of gas in Table 1, demarcated by the pathogen status column. trointestinal diseases, disorders and conditions and for gen US 2016/0158294 A1 Jun. 9, 2016 eral nutritional health. These compositions are advantageous 5%, 1x10%, 1x107%, 1x10% of the cells in the bacterial in being Suitable for safe administration to humans and other composition are human or animal, as compared to microbial mammalian Subjects and are efficacious in numerous gas cells. In another embodiment, the residual habitat product trointestinal diseases, disorders and conditions and in general present in the purified population is reduced at least a certain nutritional health. While spore-based compositions are level from the fecal material obtained from the mammalian known, these are generally prepared according to various donor subject, e.g., reduced by at least about 10%, 20%, 30%, techniques such as lyophilization or spray-drying of liquid 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, bacterial cultures, resulting in poor efficacy, instability, Sub 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than stantial variability and lack of adequate safety. 99.9999%. 0121. It has now been found that populations of bacterial 0.125. In one embodiment, substantially free of residual spores can be obtained from biological materials obtained habitat products or substantially free of a detectable level of a from mammalian Subjects, including humans. These popula pathogenic material means that the bacterial composition tions are formulated into compositions as provided herein, contains no detectable viral (including bacterial viruses (i.e., and administered to mammalian Subjects using the methods phage)), fungal, or mycoplasmal or toxoplasmal contami as provided herein. nants, or a eukaryotic parasite such as a helminth. Alterna 0122) Provided herein are therapeutic compositions con tively, the purified spore populations are substantially free of taining a purified population of bacterial spores. As used an acellular material, e.g., DNA, viral coat material, or non herein, the terms “purify”, “purified’ and “purifying refer to viable bacterial material. the state of a population (e.g., a plurality of known or I0126. As described herein, purified spore populations can unknown amount and/or concentration) of desired bacterial be demonstrated by genetic analysis (e.g., PCR, DNA spores, that have undergone one or more processes of purifi sequencing), serology and antigen analysis, and methods cation, e.g., a selection or an enrichment of the desired bac using instrumentation Such as flow cytometry with reagents terial spore, or alternatively a removal or reduction of residual that distinguish desired bacterial spores from non-desired, habitat products as described herein. In some embodiments, a contaminating materials. purified population has no detectable undesired activity or, I0127 Exemplary biological materials include fecal mate alternatively, the level or amount of the undesired activity is at rials such as feces or materials isolated from the various or below an acceptable level or amount. In other embodi segments of the Small and large intestines. Fecal materials are ments, a purified population has an amount and/or concentra obtained from a mammalian donor Subject, or can be obtained tion of desired bacterial spores at or above an acceptable from more than one donor subject, e.g.,2,3,4,5,6,7,8,9, 10, amount and/or concentration. In other embodiments, the puri 15, 20, 25, 30,35, 40, 45,50, 75, 100,200,300,400,500,750, fied population of bacterial spores is enriched as compared to 1000 or from greater than 1000 donors, where such materials the starting material (e.g., a fecal material) from which the are then pooled prior to purification of the desired bacterial population is obtained. This enrichment may be by 10%, spores. 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 0128. In alternative embodiments, the desired bacterial 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or spores are purified from a single fecal material sample greater than 99.9999% as compared to the starting material. obtained from a single donor, and after Such purification are 0123. In certain embodiments, the purified populations of combined with purified spore populations from other purifi bacterial spores have reduced or undetectable levels of one or cations, either from the same donorata different time, or from more pathogenic activities, such as toxicity, an infection of one or more different donors, or both. the mammalian recipient Subject, an immunomodulatory I0129. Preferred bacterial genera include Acetonema, activity, an autoimmune response, a metabolic response, oran Alkaliphilus, Alicyclobacillus, Amphibacillus, Ammonifex, inflammatory response or a neurological response. Such a Anaerobacter, Anaerofustis, Anaerostipes, Anaerotruncus, reduction in a pathogenic activity may be by 10%, 20%, 30%, Anoxybacillus, Bacillus, Blautia, Brevibacillus, Bryantella, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, Caldicellulosiruptor; Caloramator; Candidatus, Carboxydi 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than brachium, Carboxydothermus, Clostridium, Cohnella, 99.9999% as compared to the starting material. In other Coprococcus, Dendrosporobacter Desulfitobacterium, Des embodiments, the purified populations of bacterial spores ulfosporosinus, Desulfotomaculum, Dorea, Eubacterium, have reduced sensory components as compared to fecal mate Faecalibacterium, Filifactor, Geobacillus, Halobacteroides, rial. Such as reduced odor, taste, appearance, and umami. Heliobacillus, Heliobacterium, Heliophilum, Heliorestis, 0.124 Provided are purified populations ofbacterial spores Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceano that are substantially free of residual habitat products. In bacillus, Orenia (S.), Oxalophagus, Oxobacter, Paenibacil certain embodiments, this means that the bacterial spore com lus, Pelospora, Pelotomaculum, Propionispora, Roseburia, position no longer contains a Substantial amount of the bio Ruminococcus, Sarcina, Sporobacterium, Sporohalobacter, logical matter associated with the microbial community Sporolactobacillus, Sporomusa, Sporosarcina, Sporoto while living on or in the human or animal Subject, and the maculum, Subdoligranulum, Symbiobacterium, Syntropho purified population of spores may be 100% free, 99% free, botulus, Syntrophospora, Terribacillus, Thermoanaero 98% free, 97% free, 96% free, or 95% free of any contami bacter, and Thermosinus. nation of the biological matter associated with the microbial I0130 Preferred bacterial species are provided at Table 1, community. Substantially free of residual habitat products demarcated as spore former or non-spore former. Where spe may also mean that the bacterial spore composition contains cific strains of a species are provided, one of skill in the art no detectable cells from a human or animal, and that only will recognize that other strains of the species or species in the microbial cells are detectable, in particular, only desired same Glade can be substituted for the named strain. microbial cells are detectable. In another embodiment, it I0131. In some embodiments, spore-forming bacteria are means that fewer than 1x10%, 1x10%, 1x10%, 1x10 identified by the presence of nucleic acid sequences that US 2016/0158294 A1 Jun. 9, 2016 modulate sporulation. In particular, signature sporulation malian Subject. In particularembodiments, the composition is genes are highly conserved across members of distantly formulated for oral administration as a solid, semi-solid, gel. related genera including Clostridium and Bacillus. Tradi or liquid form, such as in the form of a pill, tablet, capsule, or tional approaches of forward genetics have identified many, if lozenge. In some embodiments, such formulations contain or not all, genes that are essential for sporulation (spo). The are coated by an enteric coating to protect the bacteria through developmental program of sporulation is governed in part by the stomach and Small intestine, although spores are generally the Successive action of four compartment-specific sigma resistant to the stomach and Small intestines. factors (appearing in the order OF, OE, OG and OK), whose 0.137 The bacterial spore compositions may be formu activities are confined to the forespore (OF and OG) or the lated to be effective in a given mammalian Subject in a single mother cell (OE and OK). administration or over multiple administrations. For example, 0132) Provided are spore populations containing more a single administration is substantially effective to reduce Cl. than one type of bacterium. As used herein, a “type' or more difficile and/or Cl. difficile toxin content in a mammalian than one “types of bacteria may be differentiated at the genus Subject to whom the composition is administered. Substan level, the species, level, the sub-species level, the strain level tially effective means that Cl. difficile and/or Cl. difficile toxin or by any other taxonomic method, as described herein and content in the subject is reduced by at least 10%, 20%, 30%, otherwise known in the art. 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or greater 0133. In some embodiments, all or essentially all of the than 99% following administration of the composition. bacterial spores present in a purified population are obtained 0.138 Methods of the Invention from a fecal material treated as described herein or otherwise (0.139. In Vitro Assays Substantiating Protective Effect of known in the art. In alternative embodiments, one or more Bacterial Compositions than one bacterial spores or types of bacterial spores are 0140. In one embodiment, provided is an In Vitro Assay generated in culture and combined to form a purified spore utilizing competition between the bacterial compositions or population. In other alternative embodiments, one or more of subsets thereof and C. difficile. Exemplary embodiments of these culture-generated spore populations are combined with this Assay are provided herein and in the Examples. a fecal material-derived spore population to generate a hybrid 0.141. In another embodiment, provided is an In Vitro spore population. Bacterial compositions may contain at least Assay utilizing 10% (wt/vol) Sterile-Filtered Feces. Provided two types of these preferred bacteria, including strains of the is an in vitro assay to test for the protective effect of the same species. For instance, a bacterial composition may com bacterial compositions and to screen in vitro for combinations prise at least 2, at least 3, at least 4, at least 5, at least 6, at least of microbes that inhibit the growth of a pathogen. The assay 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least can operate in automated high-throughput or manual modes. 13, at least 14, at least 15, at least 16, at least 17, at least 18, Under either system, human or animal feces may be re-sus at least 19, or at least 20 or more than 20 types of bacteria, as pended in an anaerobic buffer solution, such as pre-reduced defined by species or operational taxonomic unit (OTU) PBS or other suitable buffer, the particulate removed by cen encompassing such species. trifugation, and filter sterilized. This 10% sterile-filtered 0134. Thus, provided herein are methods for production of feces material serves as the base media for the in vitro assay. a composition containing a population of bacterial spores To test a bacterial composition, an investigator may add it to Suitable for therapeutic administration to a mammalian Sub the sterile-filtered feces material for a first incubation period ject in need thereof. And the composition is produced by and then may inoculate the incubated microbial solution with generally following the steps of: (a) providing a fecal material the pathogen of interest for a second incubation period. The obtained from a mammalian donor Subject; and (b) Subjecting resulting titer of the pathogen may be quantified by any num the fecal material to at least one purification treatment or step ber of methods such as those described below, and the change under conditions such that a population of bacterial spores is in the amount of pathogen is compared to standard controls produced from the fecal material. The composition is formu including the pathogen cultivated in the absence of the bac lated such that a single oral dose contains at least about 1x10' terial composition. The assay is conducted using at least one colony forming units of the bacterial spores, and a single oral control. Feces from a healthy Subject may be used as a posi dose will typically contain about 1x10, 1x10, 1x10, tive control. As a negative control, antibiotic-treated feces or 1x107, 1x10, 1x10, 1x10", 1x10'', 1x10", 1x10", heat-treated feces may be used. Various bacterial composi 1x10", 1x10', or greater than 1 x 10' CFUs of the bacterial tions may be tested in this material and the bacterial compo spores. The presence and/or concentration of a given type of sitions optionally compared to the positive and/or negative bacteria spore may be known or unknown in a given purified controls. The ability to inhibit the growth of the pathogen may spore population. If known, for example the concentration of be measured by plating the incubated material on C. difficile spores of a given strain, or the aggregate of all strains, is e.g., selective media and counting colonies. After competition 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, 1x10", 1x10'', between the bacterial composition and C. difficile, each well 1x10", 1x10", 1x10, 1x10', or greater than 1x10' of the in vitro assay plate is serially diluted ten-fold six times, viable bacterial spores per gram of composition or per admin and plated on selective media, Such as but not limited to istered dose. cycloserine cefoxitin mannitol agar (COMA) or cycloserine 0135) In some formulations, the composition contains at cefoxitin fructose agar (CCFA), and incubated. Colonies of least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, C. difficile are then counted to calculate the concentration of 90% or greater than 90% spores on a mass basis. In some viable cells in each well at the end of the competition. Colo formulations, the administered dose does not exceed 200, nies of C. difficile are confirmed by their characteristic diffuse 300, 400, 500, 600, 700, 800, 900 milligrams or 1, 1.1, 1.2, colony edge morphology as well as fluorescence under UV 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass. light. 0136. The bacterial spore compositions are generally for 0142. In another embodiment, the in vitro assay utilizes mulated for oral orgastric administration, typically to a mam Antibiotic-Treated Feces. In an alternative embodiment, and US 2016/0158294 A1 Jun. 9, 2016

instead of using 10% sterile-filtered feces, human or animal positions may be given after (optional) Vancomycin treatment feces may be resuspended in an anaerobic buffer solution, (see below) to assess their ability to prevent recurrence and such as pre-reduced PBS or other suitable buffer. The resus thus Suppress the pathogen in vivo. The outcomes assessed pended feces is treated with an antibiotic, such as clindamy each day from day -1 to day 6 (or beyond, for prevention of cin, or a cocktail of several antibiotics in order to reduce the recurrence) are weight, clinical signs, mortality and shedding ability of feces from a healthy subject to inhibit the growth of of C. difficile in the feces. Weight loss, clinical signs of dis C. difficile; this material is termed the antibiotic-treated ease, and C. difficile shedding are typically observed without matrix. While not being bound by any mechanism, it is treatment. Vancomycin provided by oral gavage on days -1 to believed that beneficial bacteria in healthy subjects protects 4 protects against these outcomes and serves as a positive them from infection by competing out C. difficile. Treating control. Clinical signs are subjective, and scored each day by feces with antibiotics kills or reduces the population of those the same experienced observer. Animals that lose greater than beneficial bacteria, allowing C. difficile to grow in this assay or equal to 25% of their body weight are euthanized and matrix. Antibiotics in addition to clindamycin that inhibit the counted as infection-related mortalities. Feces are gathered normal flora include ceftriaxone and piperacillin-taZobactam from mouse cages (5 mice per cage) each day, and the shed and may be substituted for the clindamycin. The antibiotic ding of C. difficile spores is detected in the feces using a treated matrix is centrifuged, the Supernatant removed, and selective plating assay as described for the in vitro assay the pelleted material resuspended in filter-sterilized, diluted above, or via qPCR for the toxin geneas described herein. The feces in order to remove any residual antibiotic. This washed effects of test materials including 10% suspension of human antibiotic-treated matrix may be used in the in vitro assay feces (as a positive control), bacterial compositions, or PBS described above in lieu of the 10% sterile-filtered feces. (as a negative vehicle control), are determined by introducing 0143 Alternatively, the ability to inhibit the growth of the the test article in a 0.2 mL volume into the mice via oral pathogen may be measured by quantitative PCR (qPCR). gavage on day -1, one day prior to C. difficile challenge, on Standard techniques may be followed to generate a standard day 1, 2 and 3 as treatment or post-Vancomycin treatment on curve for the pathogen of interest. Genomic DNA may be days 5, 6, 7 and 8. Vancomycin, as discussed above, is given extracted from samples using commercially-available kits, on days 1 to 4 as another positive control. Alternative dosing such as the Mo Bio Powersoil(R)-htp 96 Well Soil DNA. Iso schedules and routes of administration (e.g. rectal) may be lation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the Mo employed, including multiple doses of test article, and 103 to Bio Powersoil(R) DNA. Isolation Kit (Mo Bio Laboratories, 101 of a given organism or composition may be delivered. Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit 0146 Methods for Determining 16S Sequences (QIAGEN, Valencia, Calif.) according to the manufacturers 0147 OTUs can be defined either by full 16S sequencing instructions. The qPCR may be conducted using HotMaster of the rRNA gene, by sequencing of a specific hyperVariable Mix (5PRIME, Gaithersburg, Md.) and primers specific for region of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or the pathogen of interest, and may be conducted on a Micro V9), or by sequencing of any combination of hyperVariable AmpR Fast Optical 96-well Reaction Plate with Barcode (0.1 regions from this gene (e.g. V1-3 or V3-5). The bacterial 16S mL) (Life Technologies, Grand Island, N.Y.) and performed rDNA is approximately 1500 nucleotides in length and is on a BioRad C1000TM Thermal Cycler equipped with a used in reconstructing the evolutionary relationships and CFX96TM Real-Time System (BioRad, Hercules, Calif.), sequence similarity of one bacterial isolate to another using with fluorescent readings of the FAM and ROX channels. The phylogenetic approaches. 16S sequences are used for phylo Cd value for each well on the FAM channel is determined by genetic reconstruction as they are in general highly con the CFX ManagerTM software version 2.1. The logo (cfu/ml) served, but contain specific hyperVariable regions that harbor of each experimental sample is calculated by inputting a sufficient nucleotide diversity to differentiate genera and spe given sample's Cd value into linear regression model gener cies of most microbes. ated from the standard curve comparing the Cd values of the 0.148. Using well known techniques, in order to determine standard curve wells to the known logo (cfu/ml) of those the full 16S sequence or the sequence of any hypervariable samples. The skilled artisan may employ alternative qPCR region of the 16S sequence, genomic DNA is extracted from modes. a bacterial sample, the 16S rDNA (full region or specific 0144. In Vitro Assays Substantiating Protective Effect of hyperVariable regions) amplified using polymerase chain Bacterial Compositions reaction (PCR), the PCR products cleaned, and nucleotide 0145 Also provided are in vivo assays establishing the sequences delineated to determine the genetic composition of protective effect of bacterial compositions. Provided is an in 16S gene or Subdomain of the gene. If full 16S sequencing is vivo mouse model to test for the protective effect of the performed, the sequencing method used may be, but is not bacterial compositions against C. difficile. In this model limited to, Sanger sequencing. If one or more hyperVariable (based on Chen, et al. A mouse model of Clostridium difficile regions are used. Such as the V4 region, the sequencing can associated disease, Gastroenterology 135(6):1984-1992 be, but is not limited to being, performed using the Sanger (2008)), mice are made susceptible to C. difficile by a 7 day method or using a next-generation sequencing method. Such treatment (days - 12 to -5 of experiment) with 5 to 7 antibi as an Illumina (sequencing by synthesis) method using bar otics (including kanamycin, colistin, gentamycin, metronida coded primers allowing for multiplex reactions. Zole and Vancomycin and optionally including amplicillin and 0149 OTUs can be defined by a combination of nucleotide ciprofloxacin) delivered via their drinking water, followed by markers or genes, in particular highly conserved genes (e.g., a single dose with Clindamycin on day -3, then challenged "house-keeping genes), or a combination thereof, full-ge three days later on day 0 with 10 spores of C. difficile via oral nome sequence, or partial genome sequence generated using gavage (i.e., oro-gastric lavage). Bacterial compositions may amplified genetic products, or whole genome sequence be given either before (prophylactic treatment) or after (thera (WGS). Using well defined methods DNA extracted from a peutic treatment) C. difficile gavage. Further, bacterial com bacterial sample will have specific genomic regions amplified US 2016/0158294 A1 Jun. 9, 2016 using PCR and sequenced to determine the nucleotide by Sublimation (e.g., for freeze drying, spray freeze drying). sequence of the amplified products. In the whole genome Removal of water improves long-term bacterial composition shotgun (WGS) method, extracted DNA will be directly storage Stability attemperatures elevated above cryogenic. If sequenced without amplification. Sequence data can be gen the bacterial composition comprises spore forming species erated using any sequencing technology including, but not and results in the production of spores, the final composition limited to Sanger, Illumina, 454 Life Sciences, Ion Torrent, can be purified by additional means, such as density gradient ABI, Pacific Biosciences, and/or Oxford Nanopore. centrifugation preserved using the techniques described 0150 Methods for Preparing a Bacterial Composition for above. Bacterial composition banking can be done by cultur Administration to a Subject ing and preserving the Strains individually, or by mixing the 0151 Methods for producing bacterial compositions can strains together to create a combined bank. As an example of include three main processing steps, combined with one or cryopreservation, a bacterial composition culture can be har more mixing steps. The steps include organism banking, vested by centrifugation to pellet the cells from the culture organism production, and preservation. medium, the Supernate decanted and replaced with fresh cul 0152 For banking, the strains included in the bacterial ture broth containing 15% glycerol. The culture can then be composition may be (1) isolated directly from a specimen or aliquoted into 1 mL cryotubes, sealed, and placed at -80° C. taken from a banked stock, (2) optionally cultured on a nutri for long-term viability retention. This procedure achieves ent agar or broth that Supports growth to generate viable acceptable viability upon recovery from frozen storage. biomass, and (3) the biomass optionally preserved in multiple 0156 Organism production can be conducted using simi aliquots in long-term storage. lar culture steps to banking, including medium composition 0153. In embodiments that use a culturing step, the agar or and culture conditions. It can be conducted at larger scales of broth can contain nutrients that provide essential elements operation, especially for clinical development or commercial and specific factors that enable growth. An example would be production. At larger scales, there can be several Subcultiva a medium composed of 20 g/L glucose, 10 g/L yeast extract, tions of the bacterial composition prior to the final cultivation. 10 g/L Soy peptone, 2 g/L citric acid, 1.5 g/L Sodium phos At the end of cultivation, the culture is harvested to enable phate monobasic, 100 mg/L ferric ammonium citrate, 80 further formulation into a dosage form for administration. mg/L magnesium Sulfate, 10 mg/L hemin chloride, 2 mg/L This can involve concentration, removal of undesirable calcium chloride, 1 mg/L menadione. A variety of microbio medium components, and/or introduction into a chemical logical media and variations are well known in the art (e.g. R. milieu that preserves the bacterial composition and renders it M. Atlas, Handbook of Microbiological Media (2010) CRC acceptable for administration via the chosen route. For Press). Medium can be added to the culture at the start, may be example, a bacterial composition can be cultivated to a con added during the culture, or may be intermittently/continu centration of 10' CFU/mL, then concentrated 20-fold by ously flowed through the culture. The strains in the bacterial tangential flow microfiltration; the spent medium can be composition may be cultivated alone, as a Subset of the bac exchanged by diafiltering with a preservative medium con terial composition, or as an entire collection comprising the sisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium bacterial composition. As an example, a first strain may be phosphate buffer. The suspension can then be freeze-dried to cultivated together with a second strain in a mixed continuous a powder and titrated. culture, at a dilution rate lower than the maximum growth rate 0157. After drying, the powder can be blended to an of either cell to prevent the culture from washing out of the appropriate potency, and mixed with other cultures and/or a cultivation. filler Such as microcrystalline cellulose for consistency and 0154 The inoculated culture is incubated under favorable ease of handling, and the bacterial composition formulated as conditions for a time sufficient to build biomass. For bacterial provided herein. compositions for human use, this is often at 37°C. tempera 0158 Methods of Treating a Subject ture, pH, and other parameter with values similar to the nor 0159. In some embodiments, the compositions disclosed mal human niche. The environment can be actively con herein are administered to a patient or a user (sometimes trolled, passively controlled (e.g., via buffers), or allowed to collectively referred to as a “subject”). As used herein drift. For example, for anaerobic bacterial compositions (e.g., “administer” and “administration' encompasses embodi gut microbiota), an anoxic/reducing environment can be ments in which one person directs another to consume a employed. This can be accomplished by addition of reducing bacterial composition in a certain manner and/or for a certain agents such as cysteine to the broth, and/or stripping it of purpose, and also situations in which a user uses a bacteria oxygen. As an example, a culture of a bacterial composition composition in a certain manner and/or for a certain purpose can be grown at 37° C. pH 7, in the medium above, pre independently of or in variance to any instructions received reduced with 1 g/L cysteine HC1. from a second person. Non-limiting examples of embodi 0155. When the culture has generated sufficient biomass, ments in which one person directs another to consume a it can be preserved for banking. The organisms can be placed bacterial composition in a certain manner and/or for a certain into a chemical milieu that protects from freezing (adding purpose include when a physician prescribes a course of tryoprotectants'), drying (lyoprotectants), and/or osmotic conduct and/or treatment to a patient, when a parent com shock (osmoprotectants), dispensing into multiple (option mands a minor user (Such as a child) to consume a bacterial ally identical) containers to create a uniform bank, and then composition, whena trainer advises a user (such as an athlete) treating the culture for preservation. Containers are generally to follow a particular course of conduct and/or treatment, and impermeable and have closures that assure isolation from the when a manufacturer, distributor, or marketer recommends environment. Cryopreservation treatment is accomplished by conditions of use to an end user, for example through adver freezing a liquid at ultra-low temperatures (e.g., at or below tisements or labeling on packaging or on other materials -80°C.). Dried preservation removes water from the culture provided in association with the sale or marketing of a prod by evaporation (in the case of spray drying or cool drying) or uct. US 2016/0158294 A1 Jun. 9, 2016

0160 The bacterial compositions offer a protective and/or colon, this application means removing at least 75%, at least therapeutic effect against infection by one or more GI patho 80%, at least 90%, at least 95%, or about 100% of the contents gens of interest and can be administered after an acute case of of the ordinary volume of colon contents. Antibiotic treat infection has been resolved in order to prevent relapse, during ment can precede the colon-cleansing protocol. an acute case of infection as a complement to antibiotic 0.167 If a patient has received an antibiotic for treatment therapy if the bacterial composition is not sensitive to the ofan infection, orifa patient has received an antibiotic as part same antibiotics as the GI pathogen, or to prevent infection or of a specific pretreatment protocol, in one embodiment, the reduce transmission from disease carriers. In some embodi antibiotic can be stopped in sufficient time to allow the anti ments a bacterial compositions administered to the gut are biotic to be substantially reduced in concentration in the gut used to treat disorders that are not gut-related. Altering the gut before the bacterial composition is administered. In one microbiome can have effects on the skin and vagina of mam embodiment, the antibiotic can be discontinued 1, 2, or 3 days malian hosts (Levkovich et al. Probiotic bacteria induce a before the administration of the bacterial composition. In glow of health, PlosQne, Vol 8, Issue 1, e53867. 2013) and another embodiment, the antibiotic can be discontinued 3, 4, can treat distal bacterial infections including mastitis (Jime 5, 6, or 7 antibiotic half-lives before administration of the nez et al. Oral Administration of Lactobacillus Strains isolate bacterial composition. In another embodiment, the antibiotic from breast milk as an alternative for the treatment of Infec can be chosen so the constituents in the bacterial composition tious mastitis during lactation. Applied and Environmental have an MIC50 that is higher than the concentration of the Microbiology (74) No. 15. 2008). Because the gut serves as a antibiotic in the gut. reservoir for bacteria for the rest of the body, the bacterial 0168 MIC50 of a bacterial composition or the elements in compositions described herein can be used to treat non-GI the composition can be determined by methods well known in related health problems. the art. Reller et al., Antimicrobial Susceptibility Testing: A 0161 The present bacterial compositions can be useful in Review of General Principles and Contemporary Practices, a variety of clinical situations. For example, the bacterial Clinical Infectious Diseases 49(11):1749-1755 (2009). In compositions can be administered as a complementary treat such an embodiment, the additional time between antibiotic ment to antibiotics when a patient is suffering from an acute administration and administration of the bacterial composi infection, to reduce the risk of recurrence after an acute infec tion is not necessary. If the pretreatment protocol is part of tion has subsided, or when a patient will be in close proximity treatment of an acute infection, the antibiotic can be chosen so to others with or at risk of serious gastrointestinal infections that the infection is sensitive to the antibiotic, but the con (physicians, nurses, hospital workers, family members of stituents in the bacterial composition are not sensitive to the those who are ill or hospitalized). antibiotic. 0162 The present bacterial compositions can be adminis (0169. Routes of Administration tered to animals, including humans, laboratory animals (e.g., 0170 The bacterial compositions of the invention are suit primates, rats, mice), livestock (e.g., cows, sheep,goats, pigs, able for administration to mammals and non-mammalian ani turkeys, chickens), and household pets (e.g., dogs, cats, mals in need thereof. In certain embodiments, the mammalian rodents). Subject is a human Subject who has one or more symptoms of 0163. In the present method, the bacterial composition can a dysbiosis. be administered enterically, in other words, by a route of 0171 When a mammalian subject is suffering from a dis access to the gastrointestinal tract. This includes oral admin ease, disorder or condition characterized by an aberrant istration, rectal administration (including enema, Supposi microbiota, the bacterial compositions described herein are tory, or colonoscopy), by an oral or nasal tube (nasogastric, suitable for treatment thereof. In some embodiments, the nasojejunal, oral gastric, or oral jejunal), as detailed more mammalian Subject has not received antibiotics in advance of fully herein. treatment with the bacterial compositions. For example, the (0164 Pretreatment Protocols mammalian Subject has not been administered at least two 0.165 Prior to administration of the bacterial composition, doses of Vancomycin, metronidazole and/or or similar anti the patient can optionally have a pretreatment protocol to biotic compound within one week prior to administration of prepare the gastrointestinal tract to receive the bacterial com the therapeutic composition. In other embodiments, the mam position. In certain embodiments, the pretreatment protocol is malian Subject has not previously received an antibiotic com advisable, such as when a patient has an acute infection with pound in the one month prior to administration of the thera a highly resilient pathogen. In other embodiments, the pre peutic composition. In other embodiments, the mammalian treatment protocol is entirely optional. Such as when the Subject has received one or more treatments with one or more pathogen causing the infection is not resilient, or the patient different antibiotic compounds and such treatment(s) resulted has had an acute infection that has been Successfully treated in no improvement or a worsening of symptoms. but where the physician is concerned that the infection may 0172. In some embodiments, the gastrointestinal disease, recur. In these instances, the pretreatment protocol can disorder or condition is diarrhea caused by C. difficile includ enhance the ability of the bacterial composition to affect the ing recurrent C. difficile infection, ulcerative colitis, colitis, patient’s microbiome. Crohn's disease, or irritable bowel disease. Beneficially, the 0166 As one way of preparing the patient for administra therapeutic composition is administered only once prior to tion of the microbial ecosystem, at least one antibiotic can be improvement of the disease, disorder or condition. In some administered to alter the bacteria in the patient. As another embodiments, the therapeutic composition is administered at way of preparing the patient for administration of the micro intervals greater than two days, Such as once every three, four, bial ecosystem, a standard colon-cleansing preparation can five or six days, or every week or less frequently than every be administered to the patient to Substantially empty the con week. In other embodiments, the preparation can be admin tents of the colon, Such as used to prepare a patient for a istered intermittently according to a set schedule, e.g., once a colonoscopy. By 'substantially emptying the contents of the day, once weekly, or once monthly, or when the Subject US 2016/0158294 A1 Jun. 9, 2016

relapses from the primary illness. In another embodiment, the form. In another embodiment, an effective amount can be preparation may be administered on a long-term basis to provided in from 1 to 500 ml or from 1 to 500 grams of the subjects who are at risk for infection with or who may be bacterial composition having from 107 to 10' bacteria perml carriers of these pathogens, including Subjects who will have or per gram, or a capsule, tablet or Suppository having from 1 an invasive medical procedure (such as Surgery), who will be mg to 1000 mg lyophilized powder having from 10 to 10' hospitalized, who live in a long-term care or rehabilitation bacteria. Those receiving acute treatment can receive higher facility, who are exposed to pathogens by virtue of their doses than those who are receiving chronic administration profession (livestock and animal processing workers), or who (such as hospital workers or those admitted into long-term could be carriers of pathogens (including hospital workers care facilities). Such as physicians, nurses, and other health care profession 0179 Any of the preparations described herein can be als). administered once on a single occasion or on multiple occa 0173. In certain embodiments, the bacterial composition sions, such as once a day for several days or more than once is administered enterically. This preferentially includes oral a day on the day of administration (including twice daily, administration, or by an oral or nasal tube (including naso three times daily, or up to five times daily). In another gastric, nasojejunal, oral gastric, or oral jejunal). In other embodiment, the preparation can be administered intermit embodiments, administration includes rectal administration tently according to a set schedule, e.g., once weekly, once (including enema, Suppository, or colonoscopy). The bacte monthly, or when the patient relapses from the primary ill rial composition can be administered to at least one region of ness. In one embodiment, the preparation can be administered the gastrointestinal tract, including the mouth, esophagus, on a long-term basis to individuals who are at risk for infec stomach, Small intestine, large intestine, and rectum. In some tion with or who may be carriers of these pathogens, includ embodiments, it is administered to all regions of the gas ing individuals who will have an invasive medical procedure trointestinal tract. The bacterial compositions can be admin (such as Surgery), who will be hospitalized, who live in a istered orally in the form of medicaments such as powders, long-term care or rehabilitation facility, who are exposed to capsules, tablets, gels or liquids. The bacterial compositions pathogens by virtue of their profession (livestock and animal can also be administered in gel or liquid form by the oral route processing workers), or who could be carriers of pathogens or through a nasogastric tube, or by the rectal route in a gel or (including hospital workers such as physicians, nurses, and liquid form, by enema or instillation through a colonoscope or other health care professionals). by a Suppository. 0180 Patient Selection (0174 If the composition is administered colonoscopically 0181 Particular bacterial compositions can be selected for and, optionally, if the bacterial composition is administered individual patients or for patients with particular profiles. For by other rectal routes (such as an enema or Suppository) or example, 16S sequencing can be performed for a given even if the Subject has an oral administration, the Subject can patient to identify the bacteria present in his or her micro have a colon-cleansing preparation. The colon-cleansing biota. The sequencing can either profile the patient’s entire preparation can facilitate proper use of the colonoscope or microbiome using 16S sequencing (to the family, genera, or other administration devices, but even when it does not serve species level), a portion of the patient's microbiome using a mechanical purpose, it can also maximize the proportion of 16S sequencing, or it can be used to detect the presence or the bacterial composition relative to the other organisms pre absence of specific candidate bacteria that are biomarkers for viously residing in the gastrointestinal tract of the Subject. health or a particular disease state, Such as markers of multi Any ordinarily acceptable colon-cleansing preparation may drug resistant organisms or specific genera of concern Such as be used such as those typically provided when a subject Escherichia. Based on the biomarker data, a particular com undergoes a colonoscopy. position can be selected for administration to a patient to 0175 Dosages and Schedule for Administration Supplement or complement a patient’s microbiota in order to 0176). In some embodiments, the bacteria and bacterial restore health or treat or prevent disease. In another embodi compositions are provided in a dosage form. In certain ment, patients can be screened to determine the composition embodiments, the dosage form is designed for administration of their microbiota to determine the likelihood of successful of at least one OTU or combination thereof disclosed herein, treatment. wherein the total amount of bacterial composition adminis tered is selected from 0.1 ng to 10g, 10 ng to 1 g, 100ng to 0.1 0182 Combination Therapy g, 0.1 mg to 500 mg, 1 mg to 100 mg, or from 10-15 mg. In 0183 The bacterial compositions can be administered other embodiments, the bacterial composition is consumed at with other agents in a combination therapy mode, including a rate of from 0.1 ng to 10 g a day, 10 ng to 1 g a day, 100 ng anti-microbial agents and prebiotics. Administration can be to 0.1 g a day, 0.1 mg to 500 mg a day, 1 mg to 100 mg a day, sequential, over a period of hours or days, or simultaneous. or from 10-15 mg a day, or more. 0184. In one embodiment, the bacterial compositions are 0177. In certain embodiments, the treatment period is at included in combination therapy with one or more anti-mi least 1 day, at least 2 days, at least 3 days, at least 4 days, at crobial agents, which include anti-bacterial agents, anti-fun least 5 days, at least 6 days, at least 1 week, at least 2 weeks, gal agents, anti-viral agents and anti-parasitic agents. at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 0185. Anti-bacterial agents can include cephalosporin months, at least 3 months, at least 4 months, at least 5 months, antibiotics (cephalexin, cefuroxime, cefadroxil, cefazolin, at least 6 months, or at least 1 year. In some embodiments the cephalothin, cefaclor, cefamandole, cefoxitin, cefprozil, and treatment period is from 1 day to 1 week, from 1 week to 4 ceftobiprole); fluoroquinolone antibiotics (cipro, Levacquin, weeks, from 1 month, to 3 months, from 3 months to 6 floxin, tequin, avelox, and norflox); tetracycline antibiotics months, from 6 months to 1 year, or for over a year. (tetracycline, minocycline, oxytetracycline, and doxycy (0178. In one embodiment, 10 and 10' microorganisms cline); penicillin antibiotics (amoxicillin, amplicillin, penicil total can be administered to the patient in a given dosage lin V, dicloxacillin, carbenicillin, Vancomycin, and methicil US 2016/0158294 A1 Jun. 9, 2016 17 lin); and carbapenem antibiotics (ertapenem, doripenem, quantitative PCR (qPCR), described below, or by using tra imipenem/cilastatin, and meropenem). ditional microbiological techniques and counting colony for 0186 Anti-viral agents can include Abacavir, Acyclovir, mation. Adefovir, Amprenavir, Atazanavir, Cidofovir, Darunavir, 0193 Optionally, the mice can receive an antibiotic treat Delavirdine, Didanosine, Docosanol, Efavirenz, Elvitegravir, ment to mimic the condition of dysbiosis. Antibiotic treat Emtricitabine, Enfluvirtide, Etravirine, Famciclovir, Foscar ment can decrease the taxonomic richness, diversity, and net, Fomivirsen, Ganciclovir, Indinavir, Idoxuridine, Lami evenness of the community, including a reduction of abun Vudine, Lopinavir Maraviroc, MK-2048, Nelfinavir, Nevi dance of a significant number of bacterial taxa. Dethlefsen et rapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir, al., The pervasive effects of an antibiotic on the human gut Saquinavir, Stavudine, Tenofovir Trifluridine, Valaciclovir, microbiota, as revealed by deep 16S rRNA sequencing, PLoS Valganciclovir, Vidarabine, Ibacitabine, Amantadine, Oselta Biology 6(11):3280 (2008). At least one antibiotic can be mivir, Rimantidine, Tipranavir, Zalcitabine, Zanamivir and used, and antibiotics are well known. Antibiotics can include Zidovudine. aminoglycoside antibiotic (amikacin, arbekacin, gentamicin, 0187. Examples of antifungal compounds include, but are kanamycin, neomycin, netilmicin, paromomycin, rhodos not limited to polyene antifungals such as natamycin, rimo treptomycin, streptomycin, tobramycin, and apramycin), cidin, filipin, nystatin, amphotericin B, candicin, and hamy amoxicillin, ampicillin, Augmentin (an amoxicillin/clavulan cin, imidazole antifungals such as miconazole, ketoconazole, ate potassium combination), cephalosporin (cefaclor, clotrimazole, econazole, omoconazole, bifonazole, buto defadroxil, cefazolin, cefixime, fefoxitin, cefprozil, ceftazim conazole, fenticonazole, isoconazole, oxiconazole, Serta dime, cefuroxime, cephalexin), clavulanate potassium, clin conazole, Sulconazole, and tioconazole; triazole antifungals damycin, colistin, gentamycin, kanamycin, metronidazole, or Such as fluconazole, itraconazole, isaVuconazole, ravucona Vancomycin. As an individual, nonlimiting specific example, Zole, posaconazole, Voriconazole, terconazole, and albacona the mice can be provided with drinking water containing a Zole; thiazole antifungals such as abafungin; allylamine anti mixture of the antibiotics kanamycin, colistin, gentamycin, fungals such as terbinafine, naftifine, and butenafine; and metronidazole and Vancomycin at 40 mg/kg, 4.2 mg/kg, 3.5 echinocandin antifungals such as anidulafungin, caspofun mg/kg, 21.5 mg/kg, and 4.5 mg/kg (mg per average mouse gin, and micafungin. Other compounds that have antifungal body weight), respectively, for 7 days. Alternatively, mice can properties include, but are not limited to polygodial, benzoic be administered ciprofloxacin at a dose of 15-20 mg/kg (mg acid, ciclopiroX, tolnaftate, undecylenic acid, flucytosine or per average mouse body weight), for 7 days. 5-fluorocytosine, griseofulvin, and haloprogin. (0194 If the mice are provided with an antibiotic, a wash 0188 In one embodiment, the bacterial compositions are out period of from one day to three days may be provided with included in combination therapy with one or more corticos no antibiotic treatment and no bacterial composition treat teroids, mesalazine, mesalamine, SulfaSalazine, SulfaSalazine ment. derivatives, immunosuppressive drugs, cyclosporin A, mer 0.195 Subsequently, the test bacterial composition is captopurine, azathiopurine, prednisone, methotrexate, anti administered to the mice by oral gavage. The test bacterial histamines, glucocorticoids, epinephrine, theophylline, cro composition may be administered in a Volume of 0.2 ml molyn Sodium, anti-leukotrienes, anti-cholinergic drugs for containing 10 CFUs of each type of bacteria in the bacterial rhinitis, anti-cholinergic decongestants, mast-cell stabilizers, composition. Dose-response may be assessed by using a monoclonal anti-IgE antibodies, vaccines, and combinations range of doses, including, but not limited to 10, 10, 10, 10. thereof. 10, 107, 10, 10, and/or 10'. 0189 A prebiotic is a selectively fermented ingredient that 0196. The mice can be evaluated using 16S sequencing, allows specific changes, both in the composition and/or activ full genome sequencing, whole genome shotgun sequencing ity in the gastrointestinal microbiota that confers benefits (WGS), or traditional microbiological techniques to deter upon host well-being and health. Prebiotics can include com mine whether the test bacterial composition has populated the plex carbohydrates, amino acids, peptides, or other essential gastrointestinal tract of the mice. For example only, one day, nutritional components for the survival of the bacterial com three days, one week, two weeks, and one month after admin position. Prebiotics include, but are not limited to, amino istration of the bacterial composition to the mice, 16S profil acids, biotin, fructooligosaccharide, galactooligosaccha ing is conducted to determine whether the test bacterial com rides, inulin, lactulose, mannan oligosaccharides, oligofruc position has populated the gastrointestinal tract of the mice. tose-enriched inulin, oligofructose, oligodextrose, tagatose, Quantitative assessments, including qPCR and traditional trans-galactooligosaccharide, and Xylooligosaccharides. microbiological techniques such as colony counting, can additionally or alternatively be performed, at the same time 0.190 Methods for Testing Bacterial Compositions for intervals. Populating Effect 0.197 Furthermore, the number of sequence counts that (0191). In Vivo Assay for Determining Whether a Bacterial correspond exactly to those in the bacterial composition over Composition Populates a Subject's Gastrointestinal Tract time can be assessed to determine specifically which compo 0.192 In order to determine that the bacterial composition nents of the bacterial composition reside in the gastrointesti populates the gastrointestinal tract of a subject, an animal nal tract over a particular period of time. In one embodiment, model. Such as a mouse model, can be used. The model can the strains of the bacterial composition persist for a desired begin by evaluating the microbiota of the mice. Qualitative period of time. In another embodiment, the components of the assessments can be accomplished using 16S profiling of the bacterial composition persist for a desired period of time, microbial community in the feces of normal mice. It can also while also increasing the ability of other microbes (such as be accomplished by full genome sequencing, whole genome those present in the environment, food, etc.) to populate the shotgun sequencing (WGS), or traditional microbiological gastrointestinal tract, further increasing overall diversity, as techniques. Quantitative assessments can be conducted using discussed below. US 2016/0158294 A1 Jun. 9, 2016

0198 Ability of Bacterial compositions to Populate Dif acid resistance, and/or antibiotic sensitivity, either individu ferent Regions of the Gastrointestinal Tract ally on a constituent-by-constituent basis or collectively as a 0199 The present bacterial compositions can also be bacterial composition comprised of multiple bacterial con assessed for their ability to populate different regions on the stituents (collectively referred to in this section as bacterial gastrointestinal tract. In one embodiment, a bacterial compo composition). sition can be chosen for its ability to populate one or more than one region of the gastrointestinal tract, including, but not 0206 pH Sensitivity Testing limited to the stomach, the Small intestine (duodenum, 0207. If a bacterial composition will be administered other jejunum, and ileum), the large intestine (the cecum, the colon than to the colon or rectum (i.e., for example, an oral route), (the ascending, transverse, descending, and sigmoid colon), optionally testing for pH resistance enhances the selection of and the rectum). bacterial compositions that will survive at the highest yield 0200. An in vivo study can be conducted to determine possible through the varying pH environments of the distinct which regions of the gastrointestinal tract a given bacterial regions of the GI tract. Understanding how the bacterial com composition will populate. A mouse model similar to the one positions react to the pH of the GI tract also assists in formu described above can be conducted, except instead of assess lation, so that the number of bacteria in a dosage form can be ing the feces produced by the mice, particular regions of the increased if beneficial and/or so that the composition may be gastrointestinal tract can be removed and studied individu administered in an enteric-coated capsule or tablet or with a ally. For example, at least one particular region of the gas buffering or protective composition. As the pH of the stomach trointestinal tract can be removed and a qualitative or quan can drop to a pH of 1 to 2 after a high-protein meal for a short titative determination can be performed on the contents of time before physiological mechanisms adjust it to a pH of 3 to that region of the gastrointestinal tract. In another embodi 4 and often resides at a resting pH of 4 to 5, and as the pH of ment, the contents can optionally be removed and the quali the small intestine can range from a pH of 6 to 7.4, bacterial tative or quantitative determination may be conducted on the compositions can be prepared that Survive these varying pH tissue removed from the mouse. ranges (specifically wherein at least 1%. 5%, 10%, 15%, 0201 qPCR 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or as 0202 As one quantitative method for determining much as 100% of the bacteria can survive gut transit times whether a bacterial composition populates the gastrointesti through various pH ranges). This can be tested by exposing nal tract, quantitative PCR (qPCR) can be performed. Stan the bacterial composition to varying pH ranges for the dard techniques can be followed to generate a standard curve expected gut transit times through those pH ranges. There for the bacterial composition of interest, either for all of the fore, as a nonlimiting example only, 18-hour cultures of bac components of the bacterial composition collectively, indi terial compositions can be grown in standard media, Such as vidually, or in subsets (if applicable). Genomic DNA can be gut microbiota medium (“GMM, see Goodman et al., Exten extracted from samples using commercially-available kits, sive personal human gut microbiota culture collections char such as the Mo Bio Powersoil(R)-htp 96 Well Soil DNA. Iso acterized and manipulated in gnotobiotic mice, PNAS 108 lation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the Mo (15):6252-6257 (2011)) or another animal-products-free Bio Powersoil(R) DNA. Isolation Kit (Mo Bio Laboratories, medium, with the addition of pH adjusting agents for a pH of Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit 1 to 2 for 30 minutes, a pH of 3 to 4 for 1 hour, a pH of 4 to 5 (QIAGEN, Valencia, Calif.) according to the manufacturers for 1 to 2 hours, and a pH of 6 to 7.4 for 2.5 to 3 hours. An instructions. alternative method for testing stability to acid is described in 0203. In some embodiments, qPCR can be conducted U.S. Pat. No. 4,839,281. Survival of bacteria may be deter using HotMasterMix (5PRIME, Gaithersburg, Md.) and mined by culturing the bacteria and counting colonies on primers specific for the bacterial composition of interest, and appropriate selective or non-selective media. may be conducted on a MicroAmpR Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, 0208 Bile Acid Sensitivity Testing Grand Island, N.Y.) and performed on a BioRad C1000TM 0209 Additionally, in some embodiments, testing forbile Thermal Cycler equipped with a CFX96TM Real-Time Sys acid resistance enhances the selection of bacterial composi tem (BioRad, Hercules, Calif.), with fluorescent readings of tions that will survive exposures to bile acid during transit the FAM and ROX channels. The Cd value for each well on through the GI tract. Bile acids are secreted into the small the FAM channel is determined by the CFX ManagerTM soft intestine and can, like pH, affect the survival of bacterial ware version 2.1. The logo (cfu/ml) of each experimental compositions. This can be tested by exposing the bacterial sample is calculated by inputting a given sample's Cd value compositions to bile acids for the expected gut exposure time into linear regression model generated from the standard to bile acids. For example, bile acid solutions can be prepared curve comparing the Cd values of the standard curve wells to at desired concentrations using 0.05 mM Tris at pH 9 as the the known logo (cfu/ml) of those samples. The skilled artisan solvent. After the bile acid is dissolved, the pH of the solution may employ alternative qPCR modes. may be adjusted to 7.2 with 10% HC1. Bacterial compositions 0204 Methods for Characterization of Bacterial Compo can be cultured in 2.2 ml of a bile acid composition mimick sitions ing the concentration and type of bile acids in the patient, 1.0 0205. In certain embodiments, provided are methods for ml of 10% sterile-filtered feces media and 0.1 ml of an testing certain characteristics of bacterial compositions. For 18-hour culture of the given strain of bacteria. Incubations example, the sensitivity of bacterial compositions to certain may be conducted for from 2.5 to 3 hours or longer. An environmental variables is determined, e.g., in order to select alternative method for testing stability to bile acid is for particular desirable characteristics in a given composition, described in U.S. Pat. No. 4,839,281. Survival of bacteria formulation and/or use. For example, the constituents in the may be determined by culturing the bacteria and counting bacterial composition can be tested for pH resistance, bile colonies on appropriate selective or non-selective media. US 2016/0158294 A1 Jun. 9, 2016

0210 Antibiotic Sensitivity Testing 0219 Mechanical Treatments 0211. As a further optional sensitivity test, bacterial com 0220 Provided herein is the physical disruption of the positions can be tested for sensitivity to antibiotics. In one fecal material, particularly by one or more mechanical treat embodiment, bacterial compositions can be chosen so that the ment such as blending, mixing, shaking, Vortexing, impact bacterial constituents are sensitive to antibiotics such that if pulverization, and Sonication. As provided herein, the necessary they can be eliminated or Substantially reduced mechanical disrupting treatment Substantially disrupts a non from the patient’s gastrointestinal tract by at least one antibi spore material present in the fecal material and does not otic targeting the bacterial composition. Substantially disrupt a spore present in the fecal material. 0212. Adherence to Gastrointestinal Cells Mechanical treatments optionally include filtration treat 0213. The bacterial compositions may optionally be tested ments, where the desired spore populations are retained on a for the ability to adhere to gastrointestinal cells. A method for filter while the undesirable (non-spore) fecal components to testing adherence to gastrointestinal cells is described in U.S. pass through, and the sporefraction is then recovered from the Pat. No. 4,839,281. filter medium. Alternatively, undesirable particulates and 0214 Methods for Purifying Spores eukaryotic cells may be retained on a filter while bacterial 0215 Solvent Treatments cells including spores pass through. In some embodiments the 0216) To purify the bacterial spores, the fecal material is spore fraction retained on the filter medium is subjected to a Subjected to one or more solvent treatments. A solvent treat diafiltration step, wherein the retained spores are contacted ment is a miscible solvent treatment (either partially miscible with a wash liquid, typically a sterile Saline-containing solu or fully miscible) or an immiscible solvent treatment. Misci tion or other diluent, in order to further reduce or remove the bility is the ability of two liquids to mix with each to form a undesirable fecal components. homogeneous Solution. Water and ethanol, for example, are 0221. Thermal Treatments fully miscible Such that a mixture containing water and etha 0222 Provided herein is the thermal disruption of the fecal nol in any ratio will show only one phase. Miscibility is material. Generally, the fecal material is mixed in a saline provided as a wit/wt %, or weight of one solvent in 100 g of containing solution such as phosphate-buffered saline (PBS) final solution. If two solvents are fully miscible in all propor and Subjected to a heated environment, such as a warm room, tions, their miscibility is 100%. Provided as fully miscible incubator, water-bath, or the like, such that efficient heat Solutions with water are alcohols, e.g., methanol, ethanol, transfer occurs between the heated environment and the fecal isopropanol, butanol, etc. The alcohols can be provided material. Preferably the fecal material solution is mixed dur already combined with water; e.g., a solution containing ing the incubation to enhance thermal conductivity and dis 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, rupt particulate aggregates. Thermal treatments can be modu 65%, 70%, 75%, 89%, 85%, 90%. 95% or greater than 95% lated by the temperature of the environment and/or the Other solvents are only partially miscible, meaning that only duration of the thermal treatment. For example, the fecal some portion will dissolve in water. Diethyl ether, for material or a liquid comprising the fecal material is Subjected example, is partially miscible with water. Up to 7 grams of to a heated environment, e.g., a hot water bath of at least about diethyl ether will dissolve in 93 g of water to give a 7% (wit/wt 20, 25, 30,35, 40, 45,50,55,60, 65,70, 75,80, 85,90,95, 100 %) solution. If more diethyl ether is added, a two phase or greater than 100 degrees Celsius, for at least about 1, 5, 10. solution will result with a distinct diethyl ether layer above 15, 20, 30, 45 seconds, or 1,2,3,4,5,6,7,8,9, 10, 15, 20, 25, the water. Other miscible materials include ethers, 30, 40, or 50 minutes, or 1,2,3,4,5,6,7,8,9, 10 or more than dimethoxyethane, or tetrahydrofuran. In contrast, an oil Such 10 hours. In certain embodiments the thermal treatment as an alkane and water are immiscible and form two phases. occurs at two different temperatures, such as 30 seconds in a Further, immiscible treatments are optionally combined with 100 degree Celsius environment followed by 10 minutes in a a detergent, eitheranionic detergent or a non-ionic detergent. 50 degree Celsius environment. In preferred embodiments Exemplary detergents include Triton X-100. Tween 20, the temperature and duration of the thermal treatment are Tween 80, Nonidet P40, a pluronic, or a polyol. sufficient to kill or remove pathogenic materials while not 0217 Chromatography Treatments Substantially damaging or reducing the germination-compe 0218. To purify spore populations, the fecal materials are tency of the spores. Subjected to one or more chromatographic treatments, either 0223 Irradiation Treatments sequentially or in parallel. In a chromatographic treatment, a 0224 Provided are methods of treating the fecal material Solution containing the fecal material is contacted with a solid or separated contents of the fecal material with ionizing radia medium containing a hydrophobic interaction chromato tion, typically gamma irradiation, ultraviolet irradiation or graphic (HIC) medium or an affinity chromatographic electron beam irradiation provided at an energy level suffi medium. In an alternative embodiment, a Solid medium cient to kill pathogenic materials while not substantially dam capable of absorbing a residual habitat product present in the aging the desired spore populations. For example, ultraviolet fecal material is contacted with a solid medium that adsorbs a radiation at 254 nm provided at an energy level below about residual habitat product. In certain embodiments, the HIC 22,000 microwatt seconds per cm will not generally destroy medium contains Sepharose or a derivatized Sepharose Such desired spores. as butyl Sepharose, octyl Sepharose, phenyl Sepharose, or 0225 Centrifugation and Density Separation Treatments butyl-s Sepharose. In other embodiments, the affinity chro 0226 Provided are methods of separating desired spore matographic medium contains material derivatized with populations from the other components of the fecal material mucin type I, II, III, IV, V, or VI, or oligosaccharides derived by centrifugation. A solution containing the fecal material is from or similar to those of mucins type I, II, III, IV, V, or VI. Subjected to one or more centrifugation treatments, e.g., at Alternatively, the affinity chromatographic medium contains about 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, 6000xg, material derivatized with antibodies that recognize spore 7000xg, 8000xg or greater than 8000xg. Differential cen forming bacteria. trifugation separates desired spores from undesired non US 2016/0158294 A1 Jun. 9, 2016 20 spore material; at low forces the spores are retained in Solu garic acid (17:0), heptadecenoic acid (17:1), stearic acid (18: tion, while at higher forces the spores are pelleted while O), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3), Smaller impurities (e.g., virus particles, phage) are retained in octadecatetraenoic acid (18:4), arachidic acid (20:0), eicose Solution. For example, a first low force centrifugation pellets noic acid (20:1), eicosadienoic acid (20:2), eicosatetraenoic fibrous materials; a second, higher force centrifugation pel acid (20:4), eicosapentaenoic acid (20:5) (EPA), docosanoic lets undesired eukaryotic cells, and a third, still higher force acid (22:0), docosenoic acid (22:1), docosapentaenoic acid centrifugation pellets the desired spores while Small contami (22:5), docosahexaenoic acid (22:6) (DHA), and tetra nants remain in Suspension. In some embodiments density or cosanoic acid (24:0). In other embodiments, the composition mobility gradients or cushions (e.g., step cushions). Such as comprises at least one modified lipid, for example, a lipid that Percoll, Ficoll, Nycodenz. Histodenz or sucrose gradients, has been modified by cooking. are used to separate desired spore populations from other 0233. In some embodiments, the composition comprises materials in the fecal material. at least one Supplemental mineral or mineral source. 0227. Also provided herein are methods of producing Examples of minerals include, without limitation: chloride, spore populations that combine two or more of the treatments Sodium, calcium, iron, chromium, copper, iodine, Zinc, mag described herein in order to synergistically purify the desired nesium, manganese, molybdenum, phosphorus, potassium, spores while killing or removing undesired materials and/or and selenium. Suitable forms of any of the foregoing minerals activities from the spore population. It is generally desirable include soluble mineral salts, slightly soluble mineral salts, to retain the spore populations under non-germinating and insoluble mineral salts, chelated minerals, mineral com non-growth promoting conditions and media, in order to plexes, non-reactive minerals such as carbonyl minerals, and minimize the growth of pathogenic bacteria present in the reduced minerals, and combinations thereof. spore populations and to minimize the germination of spores 0234. In certain embodiments, the composition comprises into vegetative bacterial cells. at least one Supplemental vitamin. The at least one vitamin 0228 Pharmaceutical Compositions and Formulations of can be fat-soluble or water soluble vitamins. Suitable vita the Invention mins include but are not limited to Vitamin C, Vitamin A, 0229. Formulations vitamin E, vitamin B12, vitamin K, riboflavin, niacin, vitamin 0230 Provided are formulations for administration to D. Vitamin B6, folic acid, pyridoxine, thiamine, pantothenic humans and other subjects in need thereof. Generally the acid, and biotin. Suitable forms of any of the foregoing are bacterial compositions are combined with additional active salts of the vitamin, derivatives of the vitamin, compounds and/or inactive materials in order to produce a final product, having the same or similar activity of the vitamin, and which may be in single dosage unit or in a multi-dose format. metabolites of the vitamin. 0231. In some embodiments, the composition comprises 0235. In other embodiments, the composition comprises at least one carbohydrate. A “carbohydrate' refers to a sugar an excipient. Non-limiting examples of Suitable excipients or polymer of Sugars. The terms 'saccharide.” “polysaccha include a buffering agent, a preservative, a stabilizer, a binder, ride.” “carbohydrate.” and "oligosaccharide' may be used a compaction agent, a lubricant, a dispersion enhancer, a interchangeably. Most carbohydrates are aldehydes or disintegration agent, a flavoring agent, a Sweetener, and a ketones with many hydroxyl groups, usually one on each coloring agent. carbon atom of the molecule. Carbohydrates generally have 0236. In another embodiment, the excipient is a buffering the molecular formula CH2O. A carbohydrate can be a agent. Non-limiting examples of Suitable buffering agents monosaccharide, a disaccharide, trisaccharide, oligosaccha include sodium citrate, magnesium carbonate, magnesium ride, or polysaccharide. The most basic carbohydrate is a bicarbonate, calcium carbonate, and calcium bicarbonate. monosaccharide. Such as glucose. Sucrose, galactose, man 0237. In some embodiments, the excipient comprises a nose, ribose, arabinose, Xylose, and fructose. Disaccharides preservative. Non-limiting examples of suitable preservatives are two joined monosaccharides. Exemplary disaccharides include antioxidants, such as alpha-tocopherol and ascorbate, include Sucrose, maltose, cellobiose, and lactose. Typically, and antimicrobials, such as parabens, chlorobutanol, and phe an oligosaccharide includes between three and six monosac nol. charide units (e.g., raffinose, stachyose), and polysaccharides 0238. In other embodiments, the composition comprises a include six or more monosaccharide units. Exemplary binder as an excipient. Non-limiting examples of Suitable polysaccharides include starch, glycogen, and cellulose. Car binders include starches, pregelatinized starches, gelatin, bohydrates can contain modified saccharide units, such as polyvinylpyrolidone, cellulose, methylcellulose, Sodium car 2'-deoxyribose wherein a hydroxyl group is removed. 2'-fluo boxymethylcellulose, ethylcellulose, polyacrylamides, poly roribose wherein a hydroxyl group is replace with a fluorine, vinyloxoazolidone, polyvinylalcohols, C-Cls fatty acid or N-acetylglucosamine, a nitrogen-containing form of glu alcohol, polyethylene glycol, polyols, saccharides, oligosac cose (e.g., 2'-fluororibose, deoxyribose, and hexose). Carbo charides, and combinations thereof. hydrates can exist in many different forms, for example, 0239. In another embodiment, the composition comprises conformers, cyclic forms, acyclic forms, Stereoisomers, tau a lubricant as an excipient. Non-limiting examples of suitable tomers, anomers, and isomers. lubricants include magnesium Stearate, calcium Stearate, Zinc 0232. In some embodiments, the composition comprises Stearate, hydrogenated vegetable oils, sterotex, polyoxyeth at least one lipid. As used herein, a “lipid includes fats, oils, ylene monostearate, talc, polyethyleneglycol, Sodium ben triglycerides, cholesterol, phospholipids, fatty acids in any Zoate, Sodium lauryl Sulfate, magnesium lauryl Sulfate, and form including free fatty acids. Fats, oils and fatty acids can light mineral oil. be saturated, unsaturated (cis or trans) or partially unsaturated 0240. In other embodiments, the composition comprises a (cis or trans). In some embodiments, the lipid comprises at dispersion enhancer as an excipient. Non-limiting examples least one fatty acid selected from lauric acid (12:0), myristic of Suitable dispersants include starch, alginic acid, polyvi acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), mar nylpyrrolidones, guar gum, kaolin, bentonite, purified wood US 2016/0158294 A1 Jun. 9, 2016 cellulose, sodium starch glycolate, isoamorphous silicate, intrasternal injection and infusion techniques. In an exem and microcrystalline cellulose as high HLB emulsifier sur plary embodiment, the bacterial composition is administered factants. orally. 0241. In some embodiments, the composition comprises a 0247 Solid dosage forms for oral administration include disintegrant as an excipient. In other embodiments, the dis capsules, tablets, caplets, pills, troches, lozenges, powders, integrant is a non-effervescent disintegrant. Non-limiting and granules. A capsule typically comprises a core material examples of Suitable non-effervescent disintegrants include comprising a bacterial composition and a shell wall that starches Such as corn starch, potato starch, pregelatinized and encapsulates the core material. In some embodiments, the modified Starches thereof, Sweeteners, clays, such as bento core material comprises at least one of a solid, a liquid, and an nite, micro-crystalline cellulose, alginates, sodium starch emulsion. In other embodiments, the shell wall material com glycolate, gums such as agar, guar, locust bean, karaya, prises at least one of a soft gelatin, a hard gelatin, and a pecitin, and tragacanth. In another embodiment, the disinte polymer. Suitable polymers include, but are not limited to: grant is an effervescent disintegrant. Non-limiting examples cellulosic polymers such as hydroxypropyl cellulose, of suitable effervescent disintegrants include sodium bicar hydroxyethyl cellulose, hydroxypropyl methyl cellulose bonate in combination with citric acid, and sodium bicarbon (HPMC), methyl cellulose, ethyl cellulose, cellulose acetate, ate in combination with tartaric acid. cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropylm 0242. In another embodiment, the excipient comprises a ethyl cellulose succinate and carboxymethylcellulose flavoring agent. Flavoring agents can be chosen from Syn Sodium; acrylic acid polymers and copolymers, such as those thetic flavor oils and flavoring aromatics; natural oils; extracts formed from acrylic acid, methacrylic acid, methyl acrylate, from plants, leaves, flowers, and fruits; and combinations ammonio methylacrylate, ethyl acrylate, methyl methacry thereof. In some embodiments the flavoring agent is selected late and/or ethyl methacrylate (e.g., those copolymers sold from cinnamon oils; oil of wintergreen; peppermint oils; clo under the trade name “Eudragit); vinyl polymers and Veroil; hay oil; anise oil; eucalyptus; Vanilla; citrus oil Such as copolymers such as polyvinyl pyrrolidone, polyvinyl acetate, lemon oil, orange oil, grape and grapefruit oil; and fruit polyvinylacetate phthalate, vinylacetate crotonic acid essences including apple, peach, pear, Strawberry, raspberry, copolymer, and ethylene-vinyl acetate copolymers; and shel cherry, plum, pineapple, and apricot. lac (purified lac). In yet other embodiments, at least one 0243 In other embodiments, the excipient comprises a polymer functions as taste-masking agents. Sweetener. Non-limiting examples of suitable sweeteners 0248 Tablets, pills, and the like can be compressed, mul include glucose (corn syrup), dextrose, invert Sugar, fructose, tiply compressed, multiply layered, and/or coated. The coat and mixtures thereof (when not used as a carrier); saccharin ing can be single or multiple. In one embodiment, the coating and its various salts such as the sodium salt; dipeptide Sweet material comprises at least one of a saccharide, a polysaccha eners such as aspartame; dihydrochalcone compounds, gly ride, and glycoproteins extracted from at least one of a plant, cyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives a fungus, and a microbe. Non-limiting examples include corn of Sucrose Such as Sucralose; and Sugar alcohols such as starch, wheat starch, potato starch, tapioca starch, cellulose, Sorbitol, mannitol, Sylitol, and the like. Also contemplated are hemicellulose, dextrans, maltodextrin, cyclodextrins, inulins, hydrogenated Starch hydrolysates and the synthetic Sweet pectin, mannans, gum arabic, locust bean gum, mesquite ener 3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-diox gum, guar gum, gum karaya, gum ghatti, tragacanth gum, ide, particularly the potassium salt (acesulfame-K), and funori, carrageenans, agar, alginates, chitosans, or gellan Sodium and calcium salts thereof. gum. In some embodiments the coating material comprises a 0244. In yet other embodiments, the composition com protein. In another embodiment, the coating material com prises a coloring agent. Non-limiting examples of Suitable prises at least one of a fat and an oil. In other embodiments, coloragents include food, drug and cosmetic colors (FD&C), the at least one of a fat and an oil is high temperature melting. drug and cosmetic colors (D&C), and external drug and cos In yet another embodiment, the at least one of a fat and an oil metic colors (Ext. D&C). The coloring agents can be used as is hydrogenated or partially hydrogenated. In one embodi dyes or their corresponding lakes. ment, the at least one of a fatandan oil is derived from a plant. In other embodiments, the at least one of a fat and an oil 0245. The weight fraction of the excipient or combination comprises at least one of glycerides, free fatty acids, and fatty of excipients in the formulation is usually about 99% or less, acid esters. In some embodiments, the coating material com such as about 95% or less, about 90% or less, about 85% or prises at least one edible wax. The edible wax can be derived less, about 80% or less, about 75% or less, about 70% or less, from animals, insects, or plants. Non-limiting examples about 65% or less, about 60% or less, about 55% or less, 50% include beeswax, lanolin, bayberry wax, carnauba wax, and or less, about 45% or less, about 40% or less, about 35% or rice bran wax. Tablets and pills can additionally be prepared less, about 30% or less, about 25% or less, about 20% or less, with enteric coatings. about 15% or less, about 10% or less, about 5% or less, about 0249. Alternatively, powders or granules embodying the 2% or less, or about 1% or less of the total weight of the bacterial compositions disclosed herein can be incorporated composition. into a food product. In some embodiments, the food product 0246 The bacterial compositions disclosed herein can be is a drink for oral administration. Non-limiting examples of a formulated into a variety of forms and administered by a suitable drink include fruit juice, a fruit drink, an artificially number of different means. The compositions can be admin flavored drink, an artificially sweetened drink, a carbonated istered orally, rectally, or parenterally, in formulations con beverage, a sports drink, a liquid diary product, a shake, an taining conventionally acceptable carriers, adjuvants, and alcoholic beverage, a caffeinated beverage, infant formula vehicles as desired. The term “parenteral as used herein and so forth. Other suitable means for oral administration includes Subcutaneous, intravenous, intramuscular, or include aqueous and nonaqueous solutions, emulsions, Sus US 2016/0158294 A1 Jun. 9, 2016 22 pensions and Solutions and/or Suspensions reconstituted from First, individual colonies can be picked into liquid media in a non-effervescent granules, containing at least one of Suitable 96 well format, grown up and saved as 15% glycerol stocks at Solvents, preservatives, emulsifying agents, Suspending -80°C. Aliquots of the cultures can be placed into cell lysis agents, diluents, Sweeteners, coloring agents, and flavoring buffer and colony PCR methods can be used to amplify and agents. sequence the 16S rDNA gene (Example 2 and described 0250 In some embodiments, the food product can be a above). Alternatively, colonies may be streaked to purity in solid foodstuff. Suitable examples of a solid foodstuffinclude several passages on Solid media. Well separated colonies are without limitation a foodbar, a Snack bar, a cookie, a brownie, streaked onto the fresh plates of the same kind and incubated a muffin, a cracker, an ice cream bar, a frozen yogurt bar, and for 48-72 hours at 37° C. The process is repeated multiple the like. times in order to ensure purity. Pure cultures can be analyzed 0251. In other embodiments, the compositions disclosed by phenotypic- or sequence-based methods, including 16S herein are incorporated into a therapeutic food. In some rDNA amplification and sequencing as described in embodiments, the therapeutic food is a ready-to-use food that Examples 2 and 3. Sequence characterization of pure isolates optionally contains some or all essential macronutrients and or mixed communities e.g. plate Scrapes and spore fractions micronutrients. In another embodiment, the compositions can also include whole genome shotgun sequencing. The disclosed herein are incorporated into a Supplementary food latter is valuable to determine the presence of genes associ that is designed to be blended into an existing meal. In one ated with sporulation, antibiotic resistance, pathogenicity, embodiment, the Supplemental food contains some or all and virulence. Colonies can also be scraped from plates en essential macronutrients and micronutrients. In another masse and sequenced using a massively parallel sequencing embodiment, the bacterial compositions disclosed herein are method as described in Examples 2 and 3, such that individual blended with or added to an existing food to fortify the foods 16S signatures can be identified in a complex mixture. protein nutrition. Examples include food staples (grain, salt, Optionally, the sample can be sequenced prior to germination Sugar, cooking oil, margarine), beverages (coffee, tea, Soda, (if appropriate DNA isolation procedures are used to lyse and beer, liquor, sports drinks), Snacks, Sweets and other foods. release the DNA from spores) in order to compare the diver 0252. In one embodiment, the formulations are filled into sity of germinable species with the total number of species in gelatin capsules for oral administration. An example of an a spore sample. As an alternative or complementary approach appropriate capsule is a 250 mg gelatin capsule containing to 16S analysis, MALDI-TOF-mass spec can also be used for from 10 (up to 100 mg) of lyophilized powder (10 to 10' species identification (as reviewed in Anaerobe 22:123). bacteria), 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium Stearate. In an alternative embodi Example 2 ment, from 10 to 10' bacteria may be used, 10 to 10, 10° to 107, or 10 to 10', with attendant adjustments of the 16S Sequencing to Determine Operational excipients if necessary. In an alternative embodiment, an Taxonomic Unit (OTU) enteric-coated capsule or tablet or with a buffering or protec (0256 Method for Determining 16S Sequence tive composition can be used. (0257 OTUs can be defined either by full 16S sequencing EXAMPLES of the rRNA gene, by sequencing of a specific hyperVariable region of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or 0253 Below are examples of specific embodiments for V9), or by sequencing of any combination of hyperVariable carrying out the present invention. The examples are offered regions from this gene (e.g. V1-3 or V3-5). The bacterial 16S for illustrative purposes only, and are not intended to limit the rDNA is approximately 1500 nucleotides in length and is scope of the present invention in any way. Efforts have been used in reconstructing the evolutionary relationships and made to ensure accuracy with respect to numbers used (e.g., sequence similarity of one bacterial isolate to another using amounts, temperatures, etc.), but some experimental error phylogenetic approaches. 16S sequences are used for phylo and deviation should, of course, be allowed for. genetic reconstruction as they are in general highly con 0254 The practice of the present invention will employ, served, but contain specific hyperVariable regions that harbor unless otherwise indicated, conventional methods of protein sufficient nucleotide diversity to differentiate genera and spe chemistry, biochemistry, recombinant DNA techniques and cies of most microbes. pharmacology, within the skill of the art. Such techniques are 0258 Using well known techniques, in order to determine explained fully in the literature. See, e.g., T. E. Creighton, the full 16S sequence or the sequence of any hypervariable Proteins. Structures and Molecular Properties (W.H. Free region of the 16S sequence, genomic DNA is extracted from man and Company, 1993); A. L. Lehninger, Biochemistry a bacterial sample, the 16S rDNA (full region or specific (Worth Publishers, Inc., current addition); Sambrook, et al., hyperVariable regions) amplified using polymerase chain Molecular Cloning: A Laboratory Manual (2nd Edition, reaction (PCR), the PCR products cleaned, and nucleotide 1989); Methods In Enzymology (S. Colowick and N. Kaplan sequences delineated to determine the genetic composition of eds. Academic Press, Inc.); Remington's Pharmaceutical 16S gene or Subdomain of the gene. If full 16S sequencing is Sciences, 18th Edition (Easton, Pa.; Mack Publishing Com performed, the sequencing method used may be, but is not pany, 1990); Carey and Sundberg Advanced Organic Chem limited to, Sanger sequencing. If one or more hyperVariable istry 3" Ed. (Plenum Press) Vols A and B (1992). regions are used, such as the V4 region, the sequencing may be, but is not limited to being, performed using the Sanger Example 1 method or using a next-generation sequencing method. Such as an Illumina (sequencing by synthesis) method using bar Species Identification coded primers allowing for multiplex reactions. 0255. The identity of the bacterial species which grew up 0259. In addition to the 16S rRNA gene, one can define an from a complex fraction can be determined in multiple ways. OTU by sequencing a selected set of genes that are known to US 2016/0158294 A1 Jun. 9, 2016

be marker genes for a given species or taxonomic group of seconds, 51° C. for 30 seconds, and 68° C. for 1 minute 30 OTUS. These genes may alternatively be assayed using a seconds, followed by a 7 minute extension at 72° C. and an PCR-based screening strategy. As example, various strains of indefinite hold at 4°C. Following PCR, gel electrophoresis of pathogenic Escherichia coli can be distinguished using a portion of the reaction products is used to confirm Success DNAs from the genes that encode heat-labile (LTI, LTIIa, and ful amplification of a ~1.5 kb product. LTIIb) and heat-stable (STI and STII) toxins, verotoxin types 0265. To remove nucleotides and oligonucleotides from 1, 2, and 2e (VT1, VT2, and VT2e, respectively), cytotoxic the PCR products, 2 ul of HT ExoSap-IT (Affymetrix, Santa necrotizing factors (CNF 1 and CNF2), attaching and effacing Clara, Calif.) is added to 5ul of PCR product followed by a 15 mechanisms (eaeA), enteroaggregative mechanisms (Eagg), minute incubation at 37° C. and then a 15 minute inactivation and enteroinvasive mechanisms (Einv). The optimal genes to at 80° C. utilize for taxonomic assignment of OTUs by use of marker 0266 Amplification of 16S Sequences For Downstream genes will be familiar to one with ordinary skill of the art of Characterization. By Massively Parallel Sequencing Tech sequence based taxonomic identification. nologies 0260 Genomic DNA Extraction 0267 Amplification performed for downstream sequenc 0261 Genomic DNA is extracted from pure microbial ing by short read technologies such as Illumina require ampli cultures using a hot alkaline lysis method. 1 ul of microbial fication using primers known to those skilled in the art that culture is added to 9 ul of Lysis Buffer (25 mM NaOH, 0.2 additionally include a sequence-based barcoded tag. As mM EDTA) and the mixture is incubated at 95° C. for 30 example, to amplify the 16S hyperVariable region V4 region minutes. Subsequently, the samples are cooled to 4°C. and of bacterial 16S rDNA, 2 ul of extracted gldNA is added to a neutralized by the addition of 10 ul of Neutralization Buffer 20 ul final volume PCR reaction. The PCR reaction also (40 mM Tris-HCl) and then diluted 10-fold in Elution Buffer contains 1x HotMasterMix (5PRIME, Gaithersburg, Md.), (10 mM Tris-HCl). Alternatively, genomic DNA is extracted 200 nM of V4 515f adapt (AATGATACGGCGACCAC from pure microbial cultures using commercially available CGAGATCTACACTATGGTAATTGTGTGCCAGCMGCC kits such as the Mo Bio Ultraclean R. Microbial DNA Isola GCGGTAA, IDT, Coralville, Iowa), and 200 nMofbarcoded tion Kit (Mo Bio Laboratories, Carlsbad, Calif.) or by stan 806rbc (CAAGCAGAAGACGGCATACGAGAT 12bpGo dard methods known to those skilled in the art. layBarcode AGTCAGTCAGCCGG ACTACH 0262 Amplification of 16S Sequences for Downstream VGGGTWTCTAAT, IDT, Coralville, Iowa), with PCR Water Sanger Sequencing (Mo Bio Laboratories, Carlsbad, Calif.) for the balance of the 0263. To amplify bacterial 16S rDNA (FIG. 1A), 2 ul of Volume. These primers incorporate barcoded adapters for extracted g|DNA is added to a 20 ul final volume PCR reac Illumina sequencing by synthesis. Optionally, identical rep tion. For full-length 16 sequencing the PCR reaction also licate, triplicate, or quadruplicate reactions may be per contains 1x HotMasterMix (5PRIME, Gaithersburg, Md.), formed. Alternatively other universal bacterial primers or 250 nM of 27f (AGRGTTTGATCMTGGCTCAG, IDT, Cor thermostable polymerases known to those skilled in the art alville, Iowa), and 250 nM of 1492r (TACGGYTACCTTGT are used to obtain different amplification and sequencing TAYGACTT, IDT, Coralville, Iowa), with PCR Water (Mo error rates as well as results on alternative sequencing tech Bio Laboratories, Carlsbad, Calif.) for the balance of the nologies. volume. Alternatively, other universal bacterial primers or 0268. The PCR amplification is performed on commer thermostable polymerases known to those skilled in the art cially available thermocyclers such as a BioRad MyCyclerTM are used. For example primers are available to those skilled in Thermal Cycler (BioRad, Hercules, Calif.). The reactions are the art for the sequencing of the “V1-V9 regions of the 16S run at 94° C. for 3 minutes followed by 25 cycles of 94° C. for rRNA (FIG. 1A). These regions refer to the first through ninth 45 seconds, 50° C. for 1 minute, and 72° C. for 1 minute 30 hypervariable regions of the 16S rRNA gene that are used for seconds, followed by a 10 minute extension at 72° C. and a genetic typing of bacterial samples. These regions in bacteria indefinite hold at 4°C. Following PCR, gel electrophoresis of are defined by nucleotides 69-99, 137-242, 433-497, 576 a portion of the reaction products is used to confirm Success 682, 822-879,986-1043, 1117-1173, 1243-1294 and 1435 ful amplification of a ~1.5 kb product. PCR cleanup is per 1465 respectively using numbering based on the E. coli sys formed as specified in the previous example. tem of nomenclature. Brosius et al., Complete nucleotide 0269 Sanger Sequencing of Target Amplicons From Pure sequence of a 16S ribosomal RNA gene from Escherichia Homogeneous Samples coli, PNAS 75(10):4801-4805 (1978). In some embodiments, 0270. To detect nucleic acids for each sample, two at least one of the V1,V2, V3, V4, V5, V6, V7, V8, and V9 sequencing reactions are performed to generate a forward and regions are used to characterize an OTU. In one embodiment, reverse sequencing read. For full-length 16S sequencing the V1,V2, and V3 regions are used to characterize an OTU. primers 27f and 1492r are used. 40ng of ExoSap-IT-cleaned In another embodiment, the V3, V4, and V5 regions are used PCR products are mixed with 25 pmol of sequencing primer to characterize an OTU. In another embodiment, the V4 and Mo Bio Molecular Biology Grade Water (Mo Bio Labo region is used to characterize an OTU. A person of ordinary ratories, Carlsbad, Calif.) to 15ul total volume. This reaction skill in the art can identify the specific hypervariable regions is Submitted to a commercial sequencing organization such as of a candidate 16S rRNA (in FIG. 1A) by comparing the Genewiz (South Plainfield, N.J.) for Sanger sequencing. candidate sequence in question to the reference sequence 0271 Massively Parallel Sequencing of Target Amplicons (FIG. 1B) and identifying the hypervariable regions based on From Heterogeneous Samples similarity to the reference hypervariable regions. 0272 DNA Quantification & Library Construction. 0264. The PCR can be performed on commercially avail 0273. The cleaned PCR amplification products are quan able thermocyclers such as a BioRad MyCyclerTM Thermal tified using the Quant-iTTM PicoGreen(R) dsDNA Assay Kit Cycler (BioRad, Hercules, Calif.). The reactions are run at (Life Technologies, Grand Island, N.Y.) according to the 94° C. for 2 minutes followed by 30 cycles of 94° C. for 30 manufacturers instructions. Following quantification, the US 2016/0158294 A1 Jun. 9, 2016 24 barcoded cleaned PCR products are combined such that each assignment is defined with confidence at the the level of distinct PCR product is at an equimolar ratio to create a Family, Genus, Species, or Strain with the confidence deter prepared Illumina library. mined based on the position of bootstrap Supported branches 0274 Nucleic Acid Detection. in the reference phylogenetic tree relative to the placement of 0275. The prepared library can be sequenced on Illumina the OTU sequence being interrogated. HiSeq or MiSeq sequencers (Illumina, San Diego, Calif.) 0278 Clade Assignments with cluster generation, template hybridization, iso-thermal (0279. The ability of 16S-V4 OTU identification to assign amplification, linearization, blocking and denaturization and an OTU as a specific species depends in part on the resolving hybridization of the sequencing primers performed according power of the 16S-V4 region of the 16S gene for a particular to the manufacturer's instructions. 16SV4SeqFw (TATGG species or group of species. Both the density of available TAATTGTGTGCCAGCMGCCGCGGTAA), reference 16S sequences for different regions of the tree as 16SV4SeqRev (AGTCAGTCAGCCGGACTACH well as the inherent variability in the 16S gene between dif VGGGTWTCTAAT), and 16SV4Index (ATTAGAWAC ferent species will determine the definitiveness of a taxo CCBDGTAGTCCGGCTGACTGACT) (IDT, Coralville, nomic annotation. Given the topological nature of a phyloge Iowa) are used for sequencing. Other sequencing technolo netic tree and the fact that tree represents hierarchical gies can be used such as but not limited to 454, Pacific Bio relationships of OTUs to one another based on their sequence Sciences, Helicos, Ion Torrent, and Nanopore using protocols similarity and an underlying evolutionary model, taxonomic that are standard to someone skilled in the art of genomic annotations of a read can be rolled up to a higher level using sequencing. a clade-based assignment procedure (Table 1). Using this approach, clades are defined based on the topology of a phy Example 3 logenetic tree that is constructed from full-length 16S sequences using maximum likelihood or other phylogenetic Sequence Read Annotation models familiar to individuals with ordinary skill in the art of 0276 Primary Read Annotation phylogenetics. Clades are constructed to ensure that all OTUs 0277 Nucleic acid sequences can be analyzed and anno in a given clade are: (i) within a specified number of bootstrap tated to define taxonomic assignments using sequence simi Supported nodes from one another (generally, 1-5 bootstraps), larity and phylogenetic placement methods or a combination and (ii) within a 5% genetic similarity. OTUs that are within of the two strategies. A similar approach can be used to the same clade can be distinguished as genetically and phy annotate protein names, transcription factor names, and any logenetically distinct from OTUs in a different clade based on other classification schema for nucleic acid sequences. 16S-V4 sequence data. OTUs falling within the same clade Sequence similarity based methods include those familiar to are evolutionarily closely related and may or may not be individuals skilled in the art including, but not limited to distinguishable from one another using 16S-V4 sequence BLAST, BLASTX, tBLASTn, tBLASTX, RDP-classifier, data. The power of clade based analysis is that members of the DNAclust, and various implementations of these algorithms same Glade, due to their evolutionary relatedness, are likely Such as Qilime or Mothur. These methods rely on mapping a to play similar functional roles in a microbial ecology Such as sequence read to a reference database and selecting the match that found in the human gut. Compositions Substituting one with the best score and e-value. Common databases include, species with another from the same clade are likely to have but are not limited to the Human Microbiome Project, NCBI conserved ecological function and therefore are useful in the non-redundant database, Greengenes, RDP, and Silva. Phy present invention. logenetic methods can be used in combination with sequence 0280. Notably, 16S sequences of isolates of a given OTU similarity methods to improve the calling accuracy of an are phylogenetically placed within their respective clades, annotation or taxonomic assignment. Here tree topologies Sometimes in conflict with the microbiological-based assign and nodal structure are used to refine the resolution of the ment of species and genus that may have preceded 16S-based analysis. In this approach we analyze nucleic acid sequences assignment. Discrepancies between taxonomic assignment using one of numerous sequence similarity approaches and based on microbiological characteristics versus genetic leverage phylogenetic methods that are well known to those sequencing are known to exist from the literature. skilled in the art, including but not limited to maximum like lihood phylogenetic reconstruction (see e.g. Liu K, Linder C Example 4 R, and Warnow T. 2011. RAXML and FastTree: Comparing Germinating Spores Two Methods for Large-Scale Maximum Likelihood Phylog eny Estimation. PLoS ONE 6: e27731. McGuire G, Denham 0281 Mixtures of bacteria can include species that are in MC, and Balding DJ. 2001. Models of sequence evolution spore form. Germinating a spore fraction increases the num for DNA sequences containing gaps. Mol. Biol. Evol 18: ber of viable bacteria that will grow on various media types. 481-490. Wróbel B. 2008. Statistical measures ofuncertainty To germinate a population of spores, the sample is moved to for branches in phylogenetic trees inferred from molecular the anaerobic chamber, resuspended in prereduced PBS, sequences by using model-based methods. J. Appl. Genet. 49: mixed and incubated for 1 hour at 37 C to allow for germina 49-67.) Sequence reads are placed into a reference phylogeny tion. Germinants can include amino-acids (e.g., alanine, gly comprised of appropriate reference sequences. Annotations cine), Sugars (e.g., fructose), nucleosides (e.g., inosine), bile are made based on the placement of the read in the phyloge salts (e.g., cholate and taurocholate), metal cations (e.g., netic tree. The certainty or significance of the OTU annotation Mg2+, Ca2+), fatty acids, and long-chain alkyl amines (e.g., is defined based on the OTU’s sequence similarity to a refer dodecylamine, Germination of bacterial spores with alkyl ence nucleic acid sequence and the proximity of the OTU primary amines' J. Bacteriology, 1961). Mixtures of these or sequence relative to one or more reference sequences in the more complex natural mixtures, such as rumen fluid or phylogeny. As an example, the specificity of a taxonomic Oxgall, can be used to induce germination. Oxgall is dehy US 2016/0158294 A1 Jun. 9, 2016

drated bovine bile composed of fatty acids, bile acids, inor mannitol, 0.2% glucose, 1 mMinosine, 2.5 mM Ca-DPA, and ganic salts, Sulfates, bile pigments, cholesterol, mucin, leci 5 mM KC1. BHIS medium+DPA is a germinant mixture and thin, glycuronic acids, porphyrins, and urea. The germination contains BHIS medium and 2 mM Ca-DPA. Escherichia coli can also be performed in a growth medium like prereduced spent medium supernatant referred to herein as EcSN is a BHIS/oxgall germination medium, in which BHIS (Brain germinant and is prepared by growing E. coli MG 1655 in heart infusion powder (37 g/L), yeast extract (5 g/L), L-cys SweetB/Fos inulin medium anaerobically for 48 hr, spinning teine HCl (1 g/L)) provides peptides, amino acids, inorganic down cells at 20,000 rcf for 20 minutes, collecting the super ions and Sugars in the complex BHI and yeast extract mix natant and heating to 60 C for 40 min. Finally, the solution is tures and Oxgall provides additional bile acid germinants. filter sterilized and used as a germinant solution. 0282. In addition, pressure may be used to germinate spores. The selection of germinants can vary with the microbe Example 5 being sought. Different species require different germinants and different isolates of the same species can require different Selection of Media for Growth germinants for optimal germination. Finally, it is important to 0285 Provided are appropriate media to support growth, dilute the mixture prior to plating because Some germinants including preferred carbon sources. For example, some are inhibitory to growth of the vegetative-state microorgan organisms prefer complex Sugars Such as cellobiose over isms. For instance, it has been shown that alkyl amines must simple Sugars. Examples of media used in the isolation of be neutralized with anionic lipophiles in order to promote sporulating organisms include EYA, BHI, BHIS, and GAM optimal growth. Bile acids can also inhibit growth of some (see below for complete names and references). Multiple organisms despite promoting their germination, and must be dilutions are plated out to ensure that some plates will have diluted away prior to plating for viable cells. well isolated colonies on them for analysis, or alternatively 0283 For example, BHIS/oxgall solution is used as a ger plates with dense colonies may scraped and Suspended in minant and contains 0.5xBHIS medium with 0.25% oxgall PBS to generate a mixed diverse community. (dehydrated bovine bile) where 1xEHIS medium contains the 0286 Plates are incubated anaerobically or aerobically at following per L of solution: 6 g Brain Heart Infusion from 37C for 48-72 or more hours, targeting anaerobic or aerobic Solids, 7 g peptic digest of animal tissue, 14.5g of pancreatic spore formers, respectively. digest of casein, 5g of yeast extract, 5 g sodium chloride, 2g (0287. Solid plate media include: glucose, 2.5g disodium phosphate, and 1 g cysteine. Addi (0288 Gifu Anaerobic Medium (GAM, Nissui) without tionally, Ca-DPA is a germinant and contains 40 mM CaCl2, dextrose supplemented with fructooligosaccharides/inulin and 40 mM dipicolinic acid (DPA). Rumen fluid (Bar Dia (0.4%), mannitol (0.4%), inulin (0.4%), or fructose (0.4%), or mond, Inc.) is also a germinant. Simulated gastric fluid (Ricca a combination thereof. Chemical) is a germinant and is 0.2% (w/v) Sodium Chloride (0289 Sweet GAM Gifu Anaerobic Medium (GAM, Nis in 0.7% (v/v) Hydrochloric Acid. Mucin medium is a germi Sui) modified, Supplemented with glucose, cellobiose, mal nant and prepared by adding the following items to 1 L of tose, L-arabinose, fructose, fructooligosaccharides/inulin, distilled sterile water: 0.4 g KHPO, 0.53 g Na HPO, 0.3g mannitol and Sodium lactate) NHCl, 0.3 g NaCl, 0.1 g MgClx6H2O, 0.11g CaCl, 1 ml 0290 Brucella Blood Agar (BBA, Atlas, Handbook of alkaline trace element Solution, 1 ml acid trace element Solu Microbiological Media, 4th ed, ASM Press, 2010) tion, 1 ml vitamin solution, 0.5 mg resaZurin, 4 g NaHCO 0291 PEA sheep blood (Anaerobe Systems; 5% Sheep 0.25 g NaSx9H2O. The trace element and vitamin solutions Blood Agar with Phenylethyl Alcohol) prepared as described previously (Stams et al., 1993). All 0292. Egg Yolk Agar (EYA) (Atlas, Handbook of Micro compounds were autoclaved, except the Vitamins, which biological Media, 4th ed, ASM Press, 2010) were filter-sterilized. The basal medium was supplemented 0293 Sulfite polymyxin milk agar (Mevissen-Verhage et with 0.7% (v/v) clarified, sterile rumen fluid and 0.25% (v/v) al., J. Clin. Microbiol. 25:285-289 (1987)) commercial hog gastric mucin (Type III: Sigma), purified by 0294 Mucin agar (Derrien et al., IJSEM 54: 1469-1476 ethanol precipitation as described previously (Miller & Hosk (2004)) ins, 1981). This medium is referred herein as mucin medium. 0295 Polygalacturonate agar (Jensen & Canale-Parola, 0284 Fetal Bovine Serum (Gibco) can be used as a ger Appl. Environ. Microbiol. 52:880-997 (1986)) minant and contains 5% FBS heat inactivated, in Phosphate 0296 M2GSC (Atlas, Handbook of Microbiological Buffered Saline (PBS, Fisher Scientific) containing 0.137M Media, 4th ed, ASM Press, 2010) Sodium Chloride, 0.0027M Potassium Chloride, 0.01 19M 0297 M2 agar (Atlas, Handbook of Microbiological Phosphate Buffer. Thioglycolate is a germinant as described Media, 4th ed, ASM Press, 2010) supplemented with starch previously (Kamiya et al Journal of Medical Microbiology (1%), mannitol (0.4%), lactate (1.5 g/L) or lactose (0.4%) 1989) and contains 0.25M (pH10) sodium thioglycollate. 0298 Sweet B. Brain Heart Infusion agar (Atlas, Hand Dodecylamine solution containing 1 mM dodecylamine in book of Microbiological Media, 4th ed, ASM Press, 2010) PBS is a germinant. A Sugar Solution can be used as a germi supplemented with yeast extract (0.5%), hemin, cysteine nant and contains 0.2% fructose, 0.2% glucose, and 0.2% (0.1%), maltose (0.1%), cellobiose (0.1%), soluble starch mannitol. Amino acid solution can also be used as a germi (sigma, 1%), MOPS (50 mM, pH 7). nant and contains 5 mM alanine, 1 mM arginine, 1 mM 0299 PY-salicin (peptone-yeast extract agar supple histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 mented with salicin) (Atlas, Handbook of Microbiological mMaspartic acid, 1 mM phenylalanine. A germinant mixture Media, 4th ed, ASM Press, 2010). referred to herein as Germix 3 can be a germinant and con (0300 Modified Brain Heart Infusion (M-BHI) sweet and tains 5 mMalanine, 1 mMarginine, 1 mM histidine, 1 mM sour contains the following per L: 37.5 g Brain Heart Infu lysine, 1 mM proline, 1 mMasparagine, 1 mMaspartic acid, sion powder (Remel), 5 gyeast extract, 2.2g meat extract, 1.2 1 mM phenylalanine, 0.2% taurocholate, 0.2% fructose, 0.2% g liver extract, 1 g cystein HCl, 0.3 g sodium thioglycolate, 10 US 2016/0158294 A1 Jun. 9, 2016 26 mg hemin, 2 g soluble starch, 2 g FOS/Inulin, 1 g cellobiose, 0305 Furthermore, growth of spores after treatment with a 1 g L-arabinose, 1 g mannitol. 1 Na-lactate, 1 mL Tween 80, germinant can also be used to quantify a viable spore popu 0.6 g. MgSO4x7H2O, 0.6 g CaCl2, 6 g (NH4)2SO4, 3 g lation. Briefly, samples were incubated with a germinant (OX KH2PO4, 0.5g K2HPO4, 33 mM Acetic acid, 9 mM propi gall, 0.25% for up to 1 hour), diluted and plated anaerobically onic acid, 1 mM Isobutyric acid, 1 mM isovaleric acid, 15 g. on BBA (Brucella Blood Agar) or similar media (e.g. see agar, and after autoclaving add 50 mL of 8% NaHCO, solu Examples 4 and 5). Individual colonies were picked and DNA tion and 50 mL 1MMOPS-KOH (pH 7). isolated for full-length 16S sequencing to identify the species 0301 Noack-Blaut Eubacterium agar (See Noacket al. J. composition (e.g. see Examples 2 and 3). Analysis revealed Nutr. (1998) 128:1385-1391) that 22 species were observed in total (Table 2) with a vast 0302 BHIS az1/ge2 BHIS az/ge agar (Reeves et. al. majority present in both the material purified with the gradi Infect. Immun. 80:3786-3794 (2012)) Brain Heart Infusion ent and without the gradient, indicating no or inconsequential agar (Atlas, Handbook of Microbiological Media, 4th ed, shift in the ecology as a result of gradient purification. Spore ASM Press, 2010) supplemented with yeast extract 0.5%, yield calculations demonstrate an efficient recovery of 38% cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, of the spores from the initial fecal material as measured by aztreonam 1 mg/L, gentamycin 2 mg/L germination and plating of spores on BBA or measuring DPA count in the sample. 0303 BHIS CInM az1/ge2 BHIS CInM Brain Heart Infusion agar (Atlas, Handbook of Microbiological Media, Example 7 4th ed, ASM Press, 2010) supplemented with yeast extract 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% Bacterial Compositions Prevent C. difficile Infection maltose, aztreonam 1 mg/L, gentamycin 2 mg/L in a Mouse Model 0306 To test the therapeutic potential of the bacterial com Example 6 position Such as but not limited to a spore population, a prophylactic mouse model of C. difficile infection (model Purification and Isolation of a Spore Forming based on Chen, et al. A mouse model of Clostridium difficile Fraction from Feces associated disease, Gastroenterology 135(6):1984-1992) was used. Two cages offive mice each were tested for each arm of 0304) To purify and selectively isolate efficacious spores the experiment. All mice received an antibiotic cocktail con from fecal material a donation is first blended with saline sisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin using a homogenization device (e.g., laboratory blender) to (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 produce a 20% slurry (w/v). 100% ethanol is added for an mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) inactivation treatment that lasts 10 seconds to 1 hour. The and Vancomycin (0.056 mg/ml) in their drinking water on final alcohol concentration can range from 30-90%, prefer days -14 through -5 and a dose of 10 mg/kg. Clindamycin by ably 50-70%. High speedcentrifugation (3200 rcffor 10 min) oral gavage on day-3. On day-1, they received either the test is performed to remove solvent and the pellet is retained and article or vehicle control via oral gavage. On day 0 they were washed. Subsequently, once the washed pellet is resus challenged by administration of approximately 4.5 log 10 cfu pended, a low speed centrifugation step (200 rcf for 4 min) is of C. difficile (ATCC 43255) via oral gavage. Optionally a performed to remove large particulate vegetative matter and positive control group received Vancomycin from day -1 the Supernatant containing the spores is retained. High speed through day 3 in addition to the antibiotic protocol and C. centrifugation (3200 rcf for 10 min) is performed on the difficile challenge specified above. Feces were collected from Supernatant to concentrate the spore material. The pellet is the cages for analysis of bacterial carriage, mortality was then washed and resuspended to generate a 20% slurry. This assessed every day from day 0 to day 6 and the weight and is the ethanol treated spore preparation. The concentrated Subsequent weight change of the animal was assessed with slurry is then separated with a density based gradient e.g. a weight loss being associated with C. difficile infection. Mor CsCl gradient, Sucrose gradient or combination of the two tality and reduced weight loss of the test article compared to generating a ethanol treated, gradient-purified spore prepara the vehicle were used to assess the success of the test article. tion. For example, a CsCl gradient is performed by loading a Additionally, a C. difficile symptom scoring was performed 20% volume of spore suspension on top a 80% volume of a each day from day-1 through day 6. Clinical Score was based stepwise CsCl gradient (w/v) containing the steps of 64%, on a 0-4 scale by combining scores for Appearance (0-2 pts 50%, 40% CsCl (w/v) and centrifuging for 20 minat3200 rcf. based on normal, hunched, piloerection, or lethargic), and The spore fraction is then run on a Sucrose step gradient with Clinical Signs (0-2 points based on normal, wet tail, cold-to steps of 67%, 50%, 40%, and 30% (w/v). When centrifuged in the-touch, or isolation from other animals). a swinging bucket rotor for 10 minat 3200 rcf. The spores run 0307. In a naive control arm, animals were challenged roughly in the 30% and 40% sucrose fractions. The lower with C. difficile. In the Vancomycin positive control arm ani spore fraction (FIG. 2) is then removed and washed to pro mals were dosed with C. difficile and treated with Vancomycin duce a concentrated ethanol treated, gradient-purified spore from day -1 through day 3. The negative control was gavaged preparation. Taking advantage of the refractive properties of with PBS alone and no bacteria. The test arms of the experi spores observed by phase contrast microscopy (spores are ment tested 1x, 0.1x, 0.01 x dilutions derived from a single bright and refractive while germinated spores and vegetative donor preparation of ethanol treated spores (e.g. see example cells are dark) one can see an enrichment of the sporefraction AAAF) or the heat treated feces prepared by treating a 20% from a fecal bacterial cell suspension (FIG. 3, left) compared slurry for 30 min at 80 C. Dosing for CFU counts was deter to an ethanol treated, CsCl gradient purified, spore prepara mined from the final ethanol treated spores and dilutions of tion (FIG. 3, center), and to an ethanol treated, CsCl gradient total spores were administered at 1x, 0.1x, 0.01 x of the spore purified, sucrose gradient purified, spore preparation (FIG.3, mixture for the ethanol treated fraction and a 1x dose for the right). heat treated fraction. US 2016/0158294 A1 Jun. 9, 2016 27

0308 Weight loss and mortality were assessed on day 3. Example 9 The negative control, treated with C. difficile only, exhibits 20% mortality and weight loss on Day 3, while the positive Clinical Treatment of Recurrent C. difficile in control of 10% human fecal Suspension displays no mortality Patients or weight loss on Day 3 (Table 5). Table 5 contains the mortality and weight change of mice treated with a donor 0313 To assess the efficacy of test articles like bacterial fecal Suspension and an ethanol and/or heat-treated spore composition including but not limited to a ethanol treated preparation at various dilutions. EtOH-treated feces prevents spore preparations (e.g. see Example 6) to treat recurrent C. mortality and weight loss at three dilutions, while the heat difficile in human patients, the following procedure was per treated fraction was protective at the only dose tested. These formed to take feces from a healthy donor, inactivate via the data indicate that the spore fraction is efficacious in prevent ethanol treated spore preparation protocol described below, ing C. difficile infection in the mouse. and treat recurrent C. difficile in patients presenting with this indication. Non-related donors were screened for general Example 8 health history for absence of chronic medical conditions (in cluding inflammatory bowel disease; irritable bowel syn drome; Celiac disease; or any history of gastrointestinal Prophylactic and Relapse Prevention Hamster malignancy or polyposis), absence of risk factors for trans Models missible infections, antibiotic non-use in the previous 6 0309 Previous studies with hamsters using toxigenic and months, and negative results in laboratory assays for blood nontoxigenic strains of C. difficile demonstrated the utility of borne pathogens (HIV, HTLV. HCV. HBV. CMV, HAV and the hamster model in examining relapse post antibiotic treat Treponema pallidum) and fecal bacterial pathogens (Salmo ment and the effects of prophylaxis treatments with cecal nella, Shigella, Yersinia, Campylobacter, E. coli 0157), ova flora in C. difficile infection (Wilson et al. 1981, Wilson et al. and parasites, and other infectious agents (Giardia, 1983, Borriello et al. 1985) and more broadly gastrointestinal Cryptosporidium Cyclospora, Isospora) prior to stool dona infectious disease. To demonstrate prophylactic use of a bac tion. terial composition Such as but not limited to a spore popula 0314 Donor stool was frozen shortly after donation and tion, spore preparation, vegetative cell population, to amelio sampled for testing. At the time of use, approximately 75 g of rate C. difficile infection, the followinghamster model is used. donor stool was thawed and resuspended in 500 mL of non In a prophylactic model, Clindamycin (10 mg/kg, s.c.) is given bacteriostatic normal saline and mixed in a single use glass or on day -5, the bacterial composition or control is adminis plastic blender. The resulting slurry was sequentially passed tered on day-3, and C. difficile challenge occurs on day 0. In through sterile, disposable mesh screens that remove particles the positive control arm, Vancomycin is then administered on of size 600, 300 and 200 microns. The slurry was then cen day 1-5 (and vehicle control is delivered on day -3). Feces are trifuged briefly (200 rcf for 4 min) to separate fibrous and collected on day -5,-4, -1,1,3,5,7,9 and fecal samples are particulate materials, and the Supernatant (containing bacte assessed for pathogen carriage and reduction by microbio rial cells and spores) was transferred to a fresh container. logical methods, 16S sequencing approaches or other meth Ethanol was added to a final concentration of 50% and the ods utilized by one skilled in the art. Mortality is assessed resulting ~1500 ml slurry was incubated at room temperature throughout the experiment through 21 days post C. difficile for 1 hr with continuous mixing to inactivate vegetative bac challenge. The percentage Survival curves show that ethanol terial cells. Midway through inactivation the slurry was trans treated spores and ethanol treated, gradient-purified spores ferred to a new bottle to ensure complete contact with the better protect the hamsters compared to the Vancomycin con ethanol. The solid matter was pelleted in a centrifuge and trol, and vehicle control. washed 3 times with normal saline to remove residual etha nol. The final pellet was resuspended in 100% sterile, USP 0310 FIG. 4 shows a prophylaxis model with the ethanol glycerol at a minimum Volume, and filled into approximately treated spore preparation and the ethanol treated, gradient 30 size 0 delayed release capsules (hypromellose DRcaps, purified spore preparation. Capsugel, Inc.) at 0.65 mL Suspension each. The capsules 0311. In the relapse prevention model, hamsters are chal were immediately capped and placed onto an aluminum lenged with toxigenic C. difficile strains on day 0, and treated freezing block held at -80° C. via dry ice to freeze. The frozen with clindamycin by oral gavage on day 1, and Vancomycin capsules were in turn over-capsulated with size 00 DRcaps to dosing day 2-6. Test or control treatment was then adminis enhance capsule stability, labeled, and placed into <-65 C. tered on day 7, 8, and 9. The groups of hamsters for each arm storage immediately. The final product was stored at <-65°C. consist of 8 hamsters per group. Fecal material is collected on until the day and time of use. Encapsulated product may be day-1. 1, 3, 5, 7, 10 and 13 and hamster mortality is assessed stored for indefinitely at <-65° C. On the day of dosing throughout. Survival curves are used to assess the Success of capsules were warmed on wet ice for 1 to 2 hours to improve the testarticle e.g. ethanol treated or ethanol treated, gradient tolerability, and were then dosed with water ad libitium. purified spores versus the control treatment in preventing 0315 Patient 1 is a 45-year old woman with a history of C. hamster death. The Survival curves demonstrate maximum difficile infection and diarrhea for at least 1 year prior to efficacy for the ethanol treated, gradient-purified spores fol treatment. She has been previously treated with multiple lowed by the ethanol treated spores. Both treatments courses of antibiotics followed each time by recurrence of C. improved Survival percentage over Vancomycin treatment difficile-associated diarrhea. alone. 0316 Patient 2 is an 81-year old female who has experi 0312 FIG. 5 shows the relapse prevention model with enced recurrent C. difficile infection for 6 months prior to ethanol treated spores and ethanol treated, gradient purified treatment despite adequate antibiotic therapy following each spores CCUCC. US 2016/0158294 A1 Jun. 9, 2016 28

0317 24 hours prior to starting oral treatment, CDAD frozen glycerol stocks to Brucella blood agar with Hemin or antibiotic therapy was discontinued. Each patient received a Vitamin K (Atlas, Handbook of Microbiological Media, 4th colon preparation procedure intended to reduce the compet ed, ASM Press, 2010), M2GSC (Atlas, Handbook of Micro ing microbial burden in the gastrointestinal tract and to facili biological Media, 4th ed. ASM Press, 2010) or other solid tate repopulation by the spore forming organisms in the inves growth media and incubated for 24 to 48 h at 37° C. in an tigational product. anaerobic chamber with a gas mixture of H:CON of 0318. On the morning of the first treatment day, the 10:10:80. Single colonies were then picked and used to inocu patients received a dose of delayed release capsules contain late 250 ml to 1 L of Wilkins-Chalgren broth, Brain-Heart ing the investigational product with water ad libitum. Patients Infusion broth, M2GSC broth or other growth media, and were requested to avoid food for 1 hour thereafter. The next grown to mid to late exponential phase or into the stationary day, the patient returned to the clinic to receive an additional phase of growth. Alternatively, the single colonies may be dose. Patients were asked to avoid food for 4 hours prior to used to inoculate a pilot culture of 10 ml, which were then receiving their second dose and for 1 hour following dosing. used to inoculate a large Volume culture. The growth media 0319 Both patients were followed closely for evidence of and the growth phase at harvest were selected to enhance cell relapse or adverse symptoms following treatment. Patients titer, sporulation (if desired) and phenotypes that might be were contacted by phone on Day 2, Day 4, and Weeks 1, 2 and associated desired in vitro or in vivo. Optionally, Cultures 4 and each was queried about her general status and the were grown static or shaking, depending which yielded maxi condition of her CDAD and related symptoms. Stool samples mal cell titer. The cultures were then concentrated 10 fold or were collected at baseline and Weeks 1, 2, 4 and 8 post more by centrifugation at 5000 rpm for 20 min, and resus treatment to assess changes in the gut microbiota via 16S pended in sterile phosphate buffered saline (PBS) plus 15% sequencing and spore count with methods explained previ glycerol. 1 ml aliquots were transferred into 1.8 ml cryovials ously (e.g. see Examples 2 and 3). Through 4 weeks post which were then frozen on dry ice and stored at -80 C. The treatment, each patient has gradually improved with no evi identity of a given cell bank was confirmed by PCR amplifi dence of C. difficile recurrence. cation of the 16S rDNA gene, followed by Sanger direct cycle 0320 Six other patients with recurrent C. difficile-associ sequencing, and comparison to a curated rNA database to ated diarrhea were treated in a similar fashion, with no CU determine a taxonomic ID. Each bank was confirmed to yield recurrence and no requirement for resumption of antibiotics colonies of a single morphology upon streaking to Brucella (total of 8 patients). Additionally, there were no treatment blood agar or M2GSC agar. When more than one morphology related serious adverse events. was observed, colonies were confirmed to be the expected 0321. The above protocol could be modified to deliver species by PCR and sequencing analysis of the 16S rDNA other bacterial compositions e.g. vegetative cells, spore gene. Variant colony morphologies can be observed within preparations, and combinations thereof. pure cultures, and in a variety of bacteria the mechanisms of varying colony morphologies have been well described (van Example 10 der Woude, Clinical Microbiology Reviews, 17:518, 2004), Enrichment and Purification of Bacteria including in Clostridium species (Wadsworth-KTL Anaero 0322 To purify individual bacterial strains, dilution plates bic Bacteriology Manual, 6th Ed. Jousimie-Somer, et al were selected in which the density enables distinct separation 2002). For obligate anaerobes, RCBs were confirmed to lack of single colonies. Colonies were picked with a sterile imple aerobic colony forming units at a limit of detection of 10 ment (either a sterile loop or toothpick) and re-streaked to cfu/ml. BBA or other Solid media. Plates were incubated at 37°C. for 3-7 days. One or more well-isolated single colonies of the Example 12 major morphology type were re-streaked. This process was repeated at least three times until a single, stable colony Titer Determination morphology is observed. The isolated microbe was then cul 0324. The number of viable cells per ml was determined tured anaerobically in liquid media for 24 hours or longer to on the freshly harvested, washed and concentrated culture by obtain a pure culture of 10°-10" cfu/ml. Liquid growth plating serial dilutions of the RCB to Brucella blood agar or medium might include Brain Heart Infusion-based medium other solid media, and varied from 10° to 10' cfu/ml. The (Atlas, Handbook of Microbiological Media, 4th ed, ASM impact of freezing on viability was determined by titering the Press, 2010) supplemented with yeast extract, hemin, cys banks after one or two freeze-thaw cycles on dry ice or at -80° teine, and carbohydrates (for example, maltose, cellobiose, C., followed by thawing in an anaerobic chamber at room soluble starch) or other media described previously (e.g. see temperature. Some strains displayed a 1-3 log drop in viable example AAAE). The culture was centrifuged at 10,000xg for cfu/ml after the 1st and/or 2nd freeze thaw, while the viability 5 min to pellet the bacteria, the spent culture media was of others were unaffected. removed, and the bacteria were resuspended in sterile PBS. Sterile 75% glycerol was added to a final concentration of Example 13 20%. An aliquot of glycerol stock was titered by serial dilu tion and plating. The remainder of the stock was frozen on dry Preparation of Bacterial Compositions ice for 10-15 min and then placed at -80C for long term 0325 Individual strains were typically thawed on ice and Storage. combined in an anaerobic chamber to create mixtures, fol Example 11 lowed by a second freeze at -80° C. to preserve the mixed samples. When making combinations of strains for in vitro or Cell Bank Preparation in vivo assays, the cfu in the final mixture was estimated 0323 Cell banks (RCBs) of bacterial strains were pre based on the second freeze-thaw titer of the individual strains. pared as follows. Bacterial strains were struck from -80° C. For experiments in rodents, strains may be combined at equal US 2016/0158294 A1 Jun. 9, 2016 29 counts in order to deliver between 1e4 and le10 per strain. trointestinal tract. Bacteria were grown as described in Additionally, Some bacteria may not grow to sufficient titer to Example 13. Compositions were pre-made under anaerobic yield cell banks that allowed the production of compositions conditions and suspended in PBS+15% glycerol and stored at where all bacteria were present at le10. -70° C. prior to use. 0329 Groups of mice (10 females/group; 5 per cage) were Example 14 pre-treated on Days -14 to -5 with an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentami Provision of Gut Microbiome Sample Material cin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole 0326 Fresh gut microbiome samples e.g. fecal samples (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), amplicillin (0.1 were obtained from healthy human donors who have been mg/ml) and Vancomycin (0.056 mg/ml) in their drinking screened for general good health and for the absence of infec water. On Day -3 they received 10 mg/kg. Clindamycin by tious diseases, and meet inclusion and exclusion criteria, oral gavage. On Day -1, they were dosed with a microbial inclusion criteria include being in good general health, with compositions by oral gavage in a Volume of 0.2 mL (Table 6). out significant medical history, physical examination find Microbial compositions comprised approximately equal ings, or clinical laboratory abnormalities, regular bowel numbers of each OTU and were dosed at approximately movements with stool appearance typically Type 2, 3, 4, 5 or 1x10, 1x10' and 1x107 per OTU for each composition (e.g. 6 on the Bristol Stool Scale, and having a BMI 18 kg/m and microbial composition 1, comprising 15 strains, was dosed at s25 kg/m. Exclusion criteria generally included significant approximately 1.5x10', 1.5x10, and 1.5x10 total CFU). chronic or acute medical conditions including renal, hepatic, Fecal samples were collected from each cage on Day -1 pulmonary, gastrointestinal, cardiovascular, genitourinary, (approximately 1 hour before dosing) and on Days 2, 3 and 4 endocrine, immunologic, metabolic, neurologic or hemato post-dosing. Feces were stored frozen prior to processing and logical disease, a family history of inflammatory bowel dis sequencing. Weight gain of mice treated with either microbial ease including Crohn's disease and ulcerative colitis, Irritable compositions was similar to that of naive, control mice. bowel syndrome, colon, stomach or other gastrointestinal 0330. In parallel, groups of animals treated with the same malignancies, or gastrointestinal polyposis syndromes, or microbial compositions on Day -1 were challenged on Day 0 recent use of yogurt or commercial probiotic materials in with approximately 10" spores of Clostridium difficile which an organism(s) is a primary component. Samples were (ATCC 43255) via oral gavage. Mortality for C. difficile chal collected directly using a commode specimen collection sys lenged animals was assessed every day from Day 0 to Day 6 tem, which contains a plastic support placed on the toilet seat and the weight and subsequent weight change of the animal and a collection container that rests on the Support. Gut was assessed with weight loss being associated with C. diffi microbiome samples e.g. feces were deposited into the con cile infection. Mortality and reduced weight loss of the test tainer, and the lid was then placed on the container and sealed article compared to the empty vehicle was used to assess the tightly. The sample was then delivered on ice within 1–4 hours Success of the test article. for processing. Samples were mixed with a sterile disposable 0331 Fecal samples were processed by isolating and tool, and 2-4 g aliquots were weighed and placed into tubes sequencing DNA according to Examples 2 and 3. The OTU and flash frozen in a dry ice/ethanol bath. Aliquots are frozen assignment of fecal samples from Days -1, 2, 3 and 4 was at -80 degrees Celsius until use. determined by analyzing 16S-V4 sequence reads and assign 0327 Optionally, the microbiome sample was suspended ing OTUS as described in Example 2. Clades were assigned as in a solution, and/or fibrous and/or particulate materials were described in Example 2. Total read counts were determined removed. A frozen aliquot containing a known weight of for each OTU or each clade by summing the results from sample was removed from storage at-80 degrees Celsius and cages of the same experimental group. Samples with 10 or allowed to thaw at room temperature. Sterile 1 xPBS was fewer sequence reads for a given OTU or clade were consid added to create a 10% w/v Suspension, and vigorous Vortex ered to be below background and were not included in the ing was performed to suspend the sample until the material summation process. Results are shown by OTU (Table 7) and appeared homogeneous. The sample was then left to sit for 10 by clade (Table 8). minutes at room temperature to sediment fibrous and particu 0332 Upon examining the OTU data in Table 7, several late matter. The Suspension above the sediment was then patterns emerge. First, there are a group of OTUs with no carefully removed into a new tube and contains a purified sequence reads on Day -1 that populate large numbers of spore population. Optionally, the Suspension was then centri sequence reads on Days 2, 3, or 4; this group includes Cl. fuged at a low speed, e.g., 1000xg, for 5 minutes to pellet butyricum, Cl. hylemonae, Cl. Orbiscindens, Cl. Symbiosum, particulate matter including fibers. The pellet was discarded and L. bacterium 5 1 57 FAA. Cl. disporicum is compa and the Supernatant, which contained vegetative organisms rable to this group as it has sequence reads on Day -1 that are and spores, was removed into a new tube. The Supernatant very close to background (10 and 29 in compositions 1 and 2. was then centrifuged at 6000xg for 10 minutes to pellet the respectively), which Subsequently increase their population Vegetative organisms and spores. The pellet was then resus by as much as 1000-fold on Days 2, 3 or 4. Second, there are pended in 1xEBS with vigorous vortexing until the sample OTUs such as Co. aerofaciens, C. comes, R. bromii, B. pro material appears homogenous. ducta, Cl. bolteae, Cl. mayombei, Cl. innocuum, Cl. tedium and R. gnavus which are not detectable at the OTU level in Example 15 either the Day -1 sample or in Subsequent samples. In com position 2, Co. aerofaciens is detected transiently on Day 2 in Bacterial Compositions Populating the Gut in a the 1x10 and 1x10" dose groups; E. rectale in the same Mouse Model experimental groups is detected on Day 3, Suggesting a pos 0328. Two bacterial compositions were evaluated in a sible relationship between transient population by Co. aero mouse model to demonstrate the ability to populate the gas faciens followed by E. rectale in these groups of mice. A US 2016/0158294 A1 Jun. 9, 2016 30 striking observation is that the observed population of OTU that DPA chelates Terbium3+ to form aluminescent complex sequence reads is not highly dose dependent. Overall, the data (Fichteletal, FEMS Microbiology Ecology, 2007; Kort etal, is consistent with a model whereby OTUs populate rapidly Applied and Environmental Microbiology, 2005; Shafaat and following oral administration. Ponce, Applied and Environmental Microbiology, 2006; 0333. The clade-based analysis in Table 8 was performed Yang and Ponce, International Journal of Food Microbiology, to more thoroughly evaluate the population of the GI tract. 2009: Hindle and Hall, Analyst, 1999). A time-resolved fluo Clade-based analysis obscures some of the details afforded rescence assay detects terbium luminescence in the presence by an OTU analysis. For instance, Cl. tedium and Cl. butyri of DPA giving a quantitative measurement of DPA concen cum are members of the same clade and thus a clade-based tration in a solution. analysis cannot distinguish the dynamics of these individual 0336 To perform the assay 1 mL of the spore standard to OTUS. However, clade-based analysis has the compensatory be measured was transferred to a 2 mL microcentrifuge tube. benefit that it is sensitive to measuring population changes The samples were centrifuged at 13000 RCF for 10 min and that can be missed by an OTU-based analysis. The ability of the sample is washed in 1 mL sterile deionized H2O. Wash an 16S-V4 OTU identification to assign an OTU as a specific additional time by repeating the centrifugation. Transfer the 1 species depends in part on the resolving power of the 16S-V4 mL solution to hungate tubes and autoclave samples on a region for a particular species or group of species. Both the steam cycle for 30 min at 250 C. Add 100 uL of 30 uMTbCl, density of available reference 16S sequences for different solution (400 mM sodium acetate, pH 5.0, 30 uMTbCl) to regions of the tree as well as the inherent variability in the 16S the sample. Make serial dilutions of the autoclaved material gene between different species will determine the definitive and measure the fluorescence of each sample by exciting with ness of a taxonomic annotation. So in some cases, the popu 275 nm light and measuring the emission wavelength of 543 lation of a species can be followed using clade-based assign nm for an integration time of 1.25 ms and a 0.1 ms delay. ments when OTU based-detection is insensitive in a complex 0337 Purified spores are produced as described previ population. For instance, the clade-based analysis in Table 2B ously (e.g. see http://www.epa.gov/pesticides/methods/MB Supports the case that R. bromii, B. producta, Cl. innocuum, 28-00.pdf). Serial dilutions of purified spores from C. bifer and R. gnavus were able to populate since each OTU is a sole mentans, C. Sporogenes, and C. butyricum cultures were member of a clade in the microbial compositions and prepared and measured by plating on BBA media and incu sequence reads went from undetectable on Day -1 to well bating overnight at 37°C. to determine CFU/ml. FIG.7 shows above background on Days 2, 3 or 4. 16S V4 sequencing and the linear correspondence across different spore producing clade-based analysis could not determine whether Cl. tertium bacteria across several logs demonstrating the DPA assay as or Cl. bolteae populated due to the fact that other members of means to assess spore content (linear range of DPA assay their clades (Cl. butyricum and Cl. Symbiosum, respectively) compared to CFU counts/ml). were present and shown to populate at the OTU level in the 0338. The discrepancy for complex spore populations mice. between spore counts measured by germinable spore CFU 0334. In the mice challenged in parallel with C. difficile, and by DPA has important implications for determining the animals were significantly protected as shown in Table 9. potency of an ethanol treated spore preparation for clinical Mice gavaged with vehicle (phosphate buffered saline) expe use. Table 10 below shows spore content data from 3 different rienced 100% mortality while microbial compositions 1 and ethanol treated spore preparations used to Successfully treat 3 2 protected at all dose levels with between 0 and 10% mor patients suffering from recurrent C. difficile infection. The tality by Day 6, the last day of the experiment. In addition, spore content of each spore preparation is characterized using weight loss in animals treated with microbial compositions 1 the two described methods. and 2 was minimal compared to animals receiving the vehicle 0339 What is immediately apparent is that spore content gavage. These data confirm that population of the gastrointes varies greatly per 30 capsules. As measured by germinable tinal tract with microbial compositions confers a clinical ben SCFU, spore content varies by greater than 10,000-fold. As efit by restoring a state of dysbiosis so that animals can resist measured by DPA, spore content varies by greater than 100 infection by a pathogen. fold. In the absence of the DPA assay, it would be difficult to set a minimum dose for administration to a patient. For Example 16 instance, without data from the DPA assay, one would con clude that a minimum effective dose of spores is 4x10 or less Quantification of Spore Concentrations. Using DPA using the SCFU assay (e.g. Preparation 1. See Table 10 Assay below). If that SCFU dose was used to normalize dosing in a 0335 Methods to assess spore concentration in complex clinical setting, however, then the actual spore doses given to mixtures typically require the separation and selection of patients would be much lower for other ethanol treated spore spores and Subsequent growth of individual species to deter preparations as measured as by the DPA assay (See Table 11 mine the colony forming units. The art does not teach how to below). quantitatively germinate all the spores in a complex mixture 0340. It becomes immediately obvious from the variabil as there are many species for which appropriate germinants ity of SCFU and DPA counts across various donations that have not been identified. Furthermore, sporulation is thought using SCFU as the measure of potency would lead to signifi to be a stochastic process as a result of evolutionary selection, cant underdosing in certain cases. For instance, setting a dose meaning that not all spores from a single species germinate specification of 4x10 SCFU (the apparent effective dose with same response to germinant concentration, time and from donor Preparation 1) for product Preparation 3 would other environmental conditions. Alternatively, a key metabo lead to a potential underdosing of more than 100-fold. This lite of bacterial spores, dipicolinic acid (DPA) has been devel can be rectified only by setting potency specifications based oped to quantify spores particles in a sample and avoid inter on the DPA assay which better reflects total spore counts in an ference from fecal contaminants. The assay utilizes the fact ethanol treated spore preparation. The unexpected finding of US 2016/0158294 A1 Jun. 9, 2016

this work is that the DPA assay is uniquely suited to set most CFU units across all various combinations germinates potency and determine dosing for an ethanol treated spore and plate media tested. Furthermore, this protocol and ger preparation. mination treatment can be applied to mixtures of bacteria and spore forming species to enrich the population of spore-form Example 17 ing bacterial growth. In this manner, spore formers growth can be enhanced in a mixed population by addition of a Demonstration of Enhanced Growth with a germinate or germination treatment step as described above. Germinant 0341 To enhance the ethanol treated spores germination Example 18 capability and demonstrate spore viability, spores from three different donors were germinated by various treatments and Construction of an In Vitro Assay to Screen for plated on various media. Germination with BHIS/oxgall Combinations of Microbes Inhibitory to the Growth (BHIS ox), Ca-DPA, rumen fluid (RF), simulated gastric fluid of Clostridium difficile (SGF), mucin medium (Muc), fetal bovine serum (FBS), or 0348. The in vitro assay is a high-throughput assay thioglycollate (Thi) for 1 hour at 37C in anaerobic conditions designed to screen for combinations of microbes that inhibit was performed as described previously (e.g. see Examples 4 the growth of a pathogen or pathobiont. Feces from a human and 5) with samples derived from two independent donors donor is resuspended 10% w/v in pre-reduced PBS under (FIG. 8). The spore-germinant mixture was serially diluted anaerobic conditions and then is pelleted in an Eppendorf and plated on different plate media including BBA, Sweet B, Centrifuge 5810R, Rotor F34-6-38 at 8,500 rpm (9289 rcf) Sweet B+lysozyme (2 ug/ml), M2GSC and M2GSC+ for 5 minto remove cells and particulates. The Supernatant is lysozyme (2 ug/ml) as previously described (e.g. see then filter-sterilized using a 0.22 um filter to produce the Examples 4 and 5) to determine spore germination. Colony background media for in vitro competitions. The 10% sterile forming units were tallied and titers were determined using filtered feces media is then added in 178 uL aliquots to wells standard techniques by one skilled in the art. As FIG. 8 shows, of a 96-well plate. 20 uL of candidate bacterial strains or maximum colony forming units are derived from BHI-OXgall combinations of strains are added to each well. The in vitro treatment. This germination treatment also greatly increases assay plate is then incubated anaerobically at 37°C. for 3 hr. the diversity as measured by the number of OTUs identified before inoculation of Clostridium difficile ATCC 9689. The when samples were Submitted for 16S sequencing (e.g. see C. difficile inoculum is prepared by inoculating 5 mL BHI Examples 2 and 3) compared to plating without a germination (Brain Heart Infusion Broth) and incubating 37°C. for 18 hr. step (FIG. 9). The overnight culture is then diluted 100 fold in PBS before 0342 FIG. 8 shows different germinant treatments have inoculating 2 LL into each well to produce a final dilution of variable effects on CFU counts from donor A (upper left) and 10,000 fold from the overnight culture. In vitro assay plates donor B (lower right). The Y-Axes are spore CFU per ml. are then incubated anaerobically for 24hr. before assaying for 0343 FIG.9 shows germinates greatly increase the diver viable counts of C. difficile by plating serial dilutions on C. sity of cultured spore forming OTUs. difficile selective agar plates with cycloserine cefoxitin man 0344) To test the effect of heat activation to promoteger nitol agar (CCMA). mination, ethanol treated fecal samples were treated for 15 0349 Colonies of C. difficile are confirmed by their char minatroom temperature, 55° C., 65°C., 75° C. or 85°C. from acteristic diffuse colony edge morphology as well as fluores three different donors and germinated subsequently with cence under UV light. BHIS+Oxgall for 1 hr at 37° C. then plated on BBA media (FIG.10) as previously described (e.g. see Examples 4 and 5). Example 19 Pretreatment at room temperature produced equalifnot more spores than the elevated temperatures in all three donors. The uantification of Pathogen9. Using9. Ouantitative PCR temperature of germinating was also examined by incubating (qPCR) Standard Curve Preparation samples at room temperature or 37°C. for 1 hr in anaerobic conditions before plating on BBA. No difference in the num 0350. The standard curve is generated from wells contain ber of CFUs was observed between the two conditions. ing pathogenic C. difficile grown in 10% sterile-filtered feces Lysozyme addition to the plates (2 ug/ml) was also tested on media from Example 2 by selective spot plating. Serial dilu a single donor Sample by the testing of various activation tions of duplicate cultures are performed in sterile phosphate temperature followed by an incubation in the presence or buffered saline. Genomic DNA is then extracted from the absence of lysozyme. The addition of lysozyme had a small standard curve samples along with the other wells. effect when plated on Sweet B or M2GSC media but less so 0351 Genomic DNA Extraction than treatment with BHIS oxgall without lysozyme for 1 hr 0352 Genomic DNA can be extracted from 50 ul of each (FIG. 11). sample using the Mo Bio Powersoil(R)-htp 96 Well Soil DNA 0345 FIG.10 shows heat activation as a germination treat Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) accord ment with BHIS+oxgall. ing to the manufacturers instructions with two exceptions: 0346 FIG. 11 shows the effect of lysozyme slightly the bead beating is performed for 2x4:40 minutes using a enhances germination BioSpec Mini-Beadbeater-96 (BioSpec Products, Bartles 0347 Germination time was also tested by treating a 10% ville, Okla.) and the DNA is eluted in 50 ul of Solution C6. Suspension of a single donor ethanol treated feces (e.g. see Alternatively the genomic DNA could be isolated using the Example AAAF) incubated in either BHIS, taurocholate, Mo Bio Powersoil.R DNA. Isolation Kit (Mo Bio Laborato oxgall, or germix for 0, 15, 30, or 60 minutes and subse ries, Carlsbad, Calif.) or the QIAamp DNA Stool Mini Kit quently plated on BHIS, EYA, or BBA media (e.g. see (QIAGEN, Valencia, Calif.) according to the manufacturers Examples AAAD and AAAE). 60 minutes resulted in the instructions. US 2016/0158294 A1 Jun. 9, 2016 32

0353 qPCR Composition and Conditions cus agar containing Sodium azide is selective for Enterococ 0354) The qPCR contains 1x HotMasterMix (5PRIME, cus spp. and a small number of other species. Probes specific Gaithersburg, Md.), 900 nM of Wr-tcdB-F (AGCAGT to the van genes conferring Vancomycin resistance are used in TGAATATAGTGGTTTAGTTAGAGTTG, IDT, Coralville, the qPCR. Iowa), 900 nM of Wr-tcdB-R (CATGCTTTTT TAGTTTCTGGATTGAA, IDT, Coralville, Iowa), 250 nM of Example 22 We-tcdB-P (6FAM-CATCCAGTCTCAATTGTATAT GTTTCTCCA-MGB, Life Technologies, Grand Island, Prophylactic Use and Treatment In a Mouse Model N.Y.), and PCR Water (Mo Bio Laboratories, Carlsbad, of Vancomycin Resistant Enterococcus (VRE) Calif.) to 18 ul (Primers adapted from: Wroblewski, D. et al., Colonization Rapid Molecular Characterization of Clostridium difficile and 0359 The emergence and spread of highly antibiotic-re Assessment of Populations of C. difficile in Stool Specimens, sistant bacteria represent a major clinical challenge (Snitkin Journal of Clinical Microbiology 47:2142-2148 (2009)). This et al Science Translational Medicine, 2012). In recent years, reaction mixture is aliquoted to wells of a MicroAmp(R) Fast the numbers of infections caused by organisms such as methi Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life cillin-resistant Staphylococcus aureus, carbapenem-resistant Technologies, Grand Island, N.Y.). To this reaction mixture, 2 Enterobacteriaceae, Vancomycin-resistant Enterococcus ul of extracted genomic DNA is added. The qPCR is per (VRE), and Clostridium difficile have increased markedly, formed on a BioRadC1000TM Thermal Cycler equipped with and many of these strains are acquiring resistance to the few a CFX96TM Real-Time System (BioRad, Hercules, Calif.). remaining active antibiotics. Most infections produced by The thermocycling conditions are 95°C. for 2 minutes fol highly antibiotic-resistant bacteria are acquired during hos lowed by 45 cycles of 95° C. for 3 seconds, 60° C. for 30 pitalizations, and preventing patient-to-patient transmission seconds, and fluorescent readings of the FAM and ROX chan of these pathogens is one of the major challenges confronting nels. hospitals and clinics. Most highly antibiotic-resistant bacte 0355 Data Analysis rial Strains belong to genera that colonize mucosal Surfaces, 0356. The Cd value for each well on the FAM channel is usually at low densities. The highly complex microbiota that determined by the CFX ManagerTM software version 2.1. The normally colonizes mucosal Surfaces inhibits expansion of logo (cfu/ml) of each experimental sample is calculated by and domination by bacteria Such as Enterobacteriaceae and inputting a given sample's Cd value into linear regression Enterococcaceae. Destruction of the normal flora by antibi model generated from the standard curve comparing the Cd otic administration, however, disinhibition antibiotic-resis values of the standard curve wells to the known logo (cfu/ml) tant members of these bacterial families, leading to their of those samples. expansion to very high densities (Ubeda et al Journal of Clinical Investigation 2010). High-density colonization by Example 20 these organisms can be calamitous for the Susceptible patient, Construction of an In Vitro Assay to Screen for resulting in bacteremia and sepsis (Taur et al. Clinical Infec Combinations of Microbes Inhibitory to the Growth tious Disease, 2012). of Pathogenic E. coli 0360. To test prophylactic use and treatment of a bacterial composition testarticle, a VRE infection mouse model is used 0357 The in vitro assay is used to screen for combinations as previously described (Ubeda et al. Infectious Immunity ofbacteria inhibitory to the growth of E. coli by modifying the 2013, Ubeda et al., Journal of clinical investigation, 2010). media used for growth of the pathogen inoculum. One of Briefly, experiments are done with 7-week-old C57BL/6J several choices of media is used for growth of the pathogen female mice purchased from Jackson Laboratory, housed such as Reinforced Clostridial Media (RCM), Brain Heart with irradiated food, and provided with acidified water. Mice Infusion Broth (BHI) or Luria Bertani Broth (LB) (also are individually housed to avoid contamination between mice known as Lysogeny Broth). E. coli is quantified by using due to coprophagia. For experimental infections with VRE, alternative selective media specific for E. coli or using qPCR mice are treated with amplicillin (0.5 g/liter) in their drinking probes specific for the pathogen. For example, aerobic growth water, which is changed every 3 days. on MacConkey lactose medium selects for enteric Gram 0361. In the treatment model, on day 1, mice are infected negatives, including E. coli. qPCR is conducted using probes by means of oral gavage with 10 CFU of the Vancomycin specific for the shiga toxin of pathogenic E. coli. resistant Enterococcus faecium strain purchased from ATCC (ATCC 700221). One day after infection (day 1), antibiotic Example 21 treatment is stopped and VRE levels are determined at differ ent time points by plating serial dilutions of fecal pellets on Construction of an In Vitro Assay to Screen for Enterococcosel agar plates (Difico) with Vancomycin (8 Combinations of Microbes Inhibitory to the Growth ug/ml; Sigma). VRE colonies are identified by appearance of Vancomycin-Resistant Enterococcus (VRE) and confirmed by Gram staining or other methods previously 0358. The in vitro assay is used to screen for combinations described (e.g. see Examples 1-3). In addition, as previously of bacteria inhibitory to the growth of Vancomycin-Resistant described (Ubeda et al. Journal of Clinical Investigation Enterococcus spp. (VRE) by modifying the media used for 2010), PCR of the van A gene, which confers resistance to growth of the pathogen inoculum. Several choices of media Vancomycin, confirms the presence of VRE in infected mice. are used for growth of the pathogen Such as Reinforced The bacterial composition test article such as but not limited Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) to an ethanol treated, gradient purified spore preparation (as or Luria Bertani Broth (LB). VRE is quantified by using described herein), fecal Suspension, orantibiotic treatment is alternative selective media specific for VRE or using qPCR delivered in PBS on days 1-3 while the negative control probes specific for the pathogen. For example, m-Enterococ contains only PBS and is also delivered on days 1-3 by oral US 2016/0158294 A1 Jun. 9, 2016 gavage. Fresh fecal stool pellets are obtained daily for the polymyxin E were evaluated by Etest susceptibility assays duration of the experiment from days -7 to day 10. The (AB bioMerieux, Solna, Sweden). Results for tigecycline samples are immediately frozen and stored at -80° C. DNA were interpreted as suggested by the U.S. Food and Drug was extracted using standard techniques and analyzed with Administration (FDA) and according to CLSI recommenda 16S or comparable methods (e.g. see Examples 2 and 3). tions (criteria for Pseudomonas) for polymyxin E. 0362. In the colonization model, ampicillin is adminis 0367 Mice (10 pergroup) areassigned to either a bacterial tered as described above for day -7 to day 1, treatment with composition (test article), ethanol treated, spore preparation the test article or vehicle control is administered on day 0-2 (e.g. see Example 6), antibiotic clindamycin, piperacillin and the VRE resistant bacteria at 10 CFU are administered taZobactam, tigecycline, ertapenem, cefepime, ciprofloxacin, on day 14. Fecal samples are taken throughout the experiment or combination thereof or control group receiving only the daily from -7 to day 21 and submitted for 16S sequencing as vehicle. They are administered the test article daily from day previously described (e.g. see Examples 2 and 3). -10 to day 0. On day 0, 10 CFU of KPC-Kp VA-367 diluted 0363. In both models titers of VRE in feces are used to in 0.5 ml phosphate-buffered saline (PBS) was administered evaluate the Success of the test article Versus the negative by oral gavage using a stainless-steel feeding tube (Perfek control. Furthermore, microbiota composition is assessed for tum; Popper & Sons, New Hyde Park, N.Y.). Stool samples the ability of the bacterial composition testarticle to induce a were collected 1, 4, 6, and 11 days after the administration of healthy microbiome. KPC-Kp in order to measure the concentration of carbap enem-resistant K. pneumoniae. Stool samples (100 mg Example 23 diluted in 800 ml of PBS) are plated onto MacConkey agar with and without 0.5ug/ml of imipenem, and the number of Prophylactic Use and Treatment of a Mouse Model CFU per gram of stool was determined. Alternatively other of Carbapenem Resistant Klebsiella (CRKB) methods may be used to measure the levels of carbapenem Colonization resistant K. pneumoniae e.g. per, antigentesting, as one who's 0364 The emergence of Klebsiella pneumoniae strains skilled in the art could perform. with decreased susceptibility to carbapenems is a significant 0368 Stool samples were collected after 5 days of treat threat to hospitalized patients. Resistance to carbapenems in ment to assess the effects of the antibiotics on the stool micro these organisms is most frequently mediated by K. pneumo flora and to measure antibiotic levels in stool. To assess the niae carbapenemase (KPC), a class Abeta-lactamase that also effects on the microflora, fresh stool samples as previously confers resistance to broad-spectrum cephalosporins and described (e.g. see Examples 2 and 3). Additional experi commercially available beta-lactam/beta-lactamase inhibitor ments are performed to examine whether the administration combinations (Queenan et al. Clinical Microbiology Review, the bacterial composition (test article) resulted in the elimi 2007). KPC-producing K. pneumoniae (KPC-Kp) strains nation or persistence of colonization with KPC-Kp VA-367. often harbor resistance determinants against several other 0369 Mice are treated with subcutaneous clindamycin to classes of antimicrobials, including aminoglycosides and reduce the normal intestinal flora 1 day before receiving 10 fluoroquinolones, resulting in truly multidrug-resistant CFU of KPC-Kp VA-367 by oral gavage, and the mice con (MDR) organisms (Hirsch et al., Journal of Antimicrobial tinued to receive Subcutaneous clindamycin every other day Chemotherapy, 2009). Considering the limited antimicrobial for 7 days. Concurrently, for 7 days after oral gavage with options, infections caused by KPC-Kp pose a tremendous KPC-Kp, mice received oral gavage of normal saline (control therapeutic challenge and are associated with poor clinical group), or the bacterial composition as specified. An addi OutCOmeS tional dose of Subcutaneous clindamycin was administered 0365 A treatment protocol in a mouse model as previ 20 days after the administration of KPC-Kp VA-367 to assess ously described (e.g. Perez et al. Antimicrobial Agents Che whether low levels of carbapenem-resistant K. pneumoniae motherapy, 2011) is used to evaluate the bacterial composi were present that could be augmented by the elimination of tion (test article) for treating carbapenem resistant Klebsiella the anaerobic microflora. Stool samples were collected at and reducing carriage in the GI tract. Female CF1 mice (Har baseline and at 3, 6, 8, 11, 16, and 21 days after KPC-Kp lan Sprague-Dawley, Indianapolis, Ind.) are used and are VA-367 was given by gavage. The bacterial composition will individually housed and weighed between 25 and 30 g. be examined by the reduction of CRKB in feces. 0366. The thoroughly characterized strain of K. pneumo Example 24 niae, VA-367 (8, 9, 25) is used in this study. This clinical isolate is genetically related to the KPC-Kp strain circulating in the Eastern United States. Characterization of the resis Identification of Keystone OTUs and Functions tance mechanisms in K. pneumoniae VA-367 with PCR and 0370. The human body is an ecosystem in which the DNA sequence analysis revealed the presence of bla, microbiota, and the microbiome, play a significant role in the blaze, blast-11, and blast-12 as Well as qnrB19 and basic healthy function of human systems (e.g. metabolic, aac(6')-lb. Additionally, PCR and DNA sequencing revealed immunological, and neurological). The microbiota and disruptions in the coding sequences of the following outer resulting microbiome comprise an ecology of microorgan membrane protein genes: ompK35, ompK36, and ompK37. isms that co-exist within single subjects interacting with one Antibiotic susceptibility testing (AST) was performed with another and their host (i.e., the mammalian Subject) to form a the agar dilution method and interpreted according to current dynamic unit with inherent biodiversity and functional char recommendations from the Clinical and Laboratory Stan acteristics. Within these networks of interacting microbes dards Institute (CLSI). A modified Hodge test were per (i.e. ecologies), particular members can contribute more sig formed, according to a method described previously (e.g. see nificantly than others; as Such these members are also found Anderson et al. Journal of Clinical Microbiology, 2007) with in many different ecologies, and the loss of these microbes ertapenem, meropenem, and imipenem. Tigecycline and from the ecology can have a significant impact on the func US 2016/0158294 A1 Jun. 9, 2016 34 tional capabilities of the specific ecology. Robert Paine was characterized by 16S-V4 sequencing prior to treatment coined the concept "Keystone Species” in 1969 (see Paine R (pretreatment) with an ethanol treated spore preparation and T. 1969. A note on trophic complexity and community stabil up to 25 days after receiving treatment. Alternatively, one ity. The American Naturalist 103: 91-93.) to describe the might use a bacterial composition in the vegetative state, or a existence of Such lynchpin species that are integral to a given mixture of vegetative bacteria and bacterial spores. As ecosystem regardless of their abundance in the ecological example, the treatment of patient 1 with an ethanol treated community. Paine originally describe the role of the starfish spore preparation led to microbial population via the engraft Pisaster ochraceus in marine systems and since the concept ment of OTUS from the spore treatment and augmentation in has been experimentally validated in numerous ecosystems. the microbiome of the patient (FIG. 12 and FIG. 13). By day 0371 Keystone OTUs and/or Functions are computation 25 following treatment, the total microbial carriage was ally-derived by analysis of network ecologies elucidated from dominated by species of the following taxonomic groups: a defined set of Samples that share a specific phenotype. Bacteroides, Sutterella, Ruminococcus, Blautia, Eubacte Keystone OTUs and/or Functions are defined as all Nodes rium, Gemmiger/Faecalibacterium, and the non-sporeform within a defined set of networks that meet two or more of the ing Lactobacillus (see Tables 2 and 12 for specific OTUs). following criteria. Using Criterion 1, the node is frequently The first two genera represent OTUs that do not form spores observed in networks, and the networks in which the node is while the latter taxonomic groups represent OTUs that are observed are found in a large number of individual subjects: believed to form spores. the frequency of occurrence of these Nodes in networks and 0374 Table 12 shows bacterial OTUs associated with the pervasiveness of the networks in individuals indicates engraftment and ecological augmentation and establishment these Nodes perform an important biological function in of a more diverse microbial ecology in patients treated with many individuals. Using Criterion 2, the node is frequently an ethanol treated spore preparation. OTUS that comprise an observed in networks, and each the networks in which the augmented ecology are not present in the patient prior to node is observed contain a large number of Nodes—these treatment and/or exist at extremely low frequencies such that Nodes are thus 'super-connectors', meaning that they form a they do not comprise a significant fraction of the total micro nucleus of a majority of networks and as such have high bial carriage and are not detectable by genomic and/or micro biological significance with respect to their functional con biological assay methods. OTUs that are members of the tributions to a given ecology. Using Criterion 3, the node is engrafting and augmented ecologies were identified by char found in networks containing a large number of Nodes (i.e. acterizing the OTUs that increase in their relative abundance they are large networks), and the networks in which the node post treatment and that respectively are: (i) present in the is found occur in a large number of Subjects; these networks ethanol treated spore preparation and absent in the patient are potentially of high interest as it is unlikely that large pretreatment (engrafting OTUs), or (ii) absent in the ethanol networks occurring in many individuals would occur by treated spore preparation, but increase in their relative abun chance alone strongly suggesting biological relevance. dance through time post treatment with the preparation due to Optionally, the required thresholds for the frequency at which the formation of favorable growth conditions by the treatment a node is observed in network ecologies, the frequency at (augmenting OTUs). Notably, the latter OTUs can grow from which a given network is observed across Subject samples, low frequency reservoirs in the patient, or be introduced from and the size of a given network to be considered a Keystone exogenous sources Such as diet. OTUS that comprise a “core” node are defined by the 50th, 70th, 80th, or 90th percentiles of augmented or engrafted ecology can be defined by the per the distribution of these variables. Optionally, the required centage of total patients in which they are observed to engraft thresholds are defined by the value for a given variable that is and/or augment; the greater this percentage the more likely significantly different from the mean or median value for a they are to be part of a core ecology responsible for catalyzing given variable using standard parametric or non-parametric a shift away from a dysbiotic ecology. The dominant OTUs in measures of statistical significance. In another embodiment a an ecology can be identified using several methods including Keystone node is defined as one that occurs in a sample but not limited to defining the OTUs that have the greatest phenotype of interest such as but not limited to “health' and relative abundance in either the augmented or engrafted simultaneously does not occur in a sample phenotype that is ecologies and defining a total relative abundance threshold. not of interest such as but not limited to “disease. Optionally, As example, the dominant OTUS in the augmented ecology of a Keystone Node is defined as one that is shown to be signifi Patient-1 were identified by defining the OTUs with the great cantly different from what is observed using permuted test est relative abundance, which together comprise 60% of the datasets to measure significance. microbial carriage in this patient's augmented ecology. Example 25 0375 Patient treatment with the ethanol treated spore preparation leads to the population of a microbial ecology Microbial Population (Engraftment and that has greater diversity than prior to treatment (FIG. 12). Augmentation) and Reduction of Pathogen Carriage Genomic-based microbiome characterization confirmed in Patients Treated with Spore Compositions engraftment of a range of OTUs that were absent in the patient pretreatment (Table 12). These OTUs comprised both bacte 0372 Complementary genomic and microbiological rial species that were capable and not capable of forming methods were used to characterize the composition of the spores, and OTUS that represent multiple phylogenetic microbiota from Patient 1, 2, 3, 4, and 5, 6, 7, 8, 9, and 10 at clades. Organisms absent in Patient 1 pre-treatment either pretreatment (pretreatment) and on up to 4 weeks post-treat engraft directly from the ethanol treated spore fraction or are ment. augmented by the creation of a gut environment favoring a 0373) To determine the OTUs that engraft from treatment healthy, diverse microbiota. Furthermore, Bacteroides fragi with an ethanol treated spore preparation in the patients and lis group species were increased by 4 and 6 logs in patients 1 how their microbiome changed in response, the microbiome and 2 (FIG. 14). US 2016/0158294 A1 Jun. 9, 2016

0376 FIG. 12 shows the microbial diversity measured in Examples 2 and 3, and primary stool samples were prepared the ethanol treated spore treatment sample and patient pre targeting the 16S-V4 region using the method for heteroge and post-treatment samples. Total microbial diversity is neous samples described herein. defined using the Chao 1 Alpha-Diversity Index and is mea Sured at different genomic sampling depths to confirm 0380. Notably, 16S sequences of isolates of a given OTU adequate sequence coverage to assay the microbiome in the are phylogenetically placed within their respective clades target samples. The patient pretreatment (purple) harbored a despite that the actual taxonomic assignment of species and microbiome that was significantly reduced in total diversity genus may suggest they are taxonomically distinct from other as compared to the ethanol treated spore treatment (red) and members of the clades in which they fall. Discrepancies patient post treatment at days 5 (blue), 14 (orange), and 25 between taxonomic names given to an OTU is based on (green). microbiological characteristics versus genetic sequencing are known to exist from the literature. The OTUs footnoted in this 0377 FIG. 13 shows patient microbial ecology is shifted by treatment with an ethanol treated spore treatment from a table are known to be discrepant between the different meth dysbiotic state to a state of health. Principle Coordinates ods for assigning a taxonomic name. Analysis based on the total diversity and structure of the 0381 Engraftment of OTUs from the ethanol treated spore microbiome (Bray-Curtis Beta-Diversity) of the patient pre preparation treatment into the patient as well as the resulting and post-treatment delineates that the engraftment of OTUs augmentation of the resident microbiome led to a significant from the spore treatment and the augmentation of the patient decrease in and elimination of the carriage of pathogenic microbial ecology leads to a microbial ecology that is distinct species other than C. difficile in the patient. 16S-V4 sequenc from both the pretreatment microbiome and the ecology of ing of primary stool samples demonstrated that at pretreat the ethanol treated spore treatment (Table 12). ment, 20% of reads were from the genus Klebsiella and an 0378 FIG. 14 shows the augmentation of Bacteroides spe additional 19% were assigned to the genus Fusobacterium. cies in patients. Comparing the number of Bacteroides fragi These striking data are evidence of a profoundly dysbiotic lis groups species percfu/g of feces pre-treatment and in week microbiota associated with recurrent C. difficile infection and 4 post treatment reveals an increase of 4 logs or greater. The chronic antibiotic use. In healthy individuals, Klebsiella is a ability of 16S-V4 OTU identification to assign an OTU as a resident of the human microbiome in only about 2% of sub specific species depends in part on the resolution of the 16S jects based on an analysis of HMP database (www.hmpdacc. V4 region of the 16S gene for a particular species or group of org), and the mean relative abundance of Klebsiella is only species. Both the density of available reference 16S about 0.09% in the stool of these people. Its surprising pres sequences for different regions of the tree as well as the ence at 20% relative abundance in Patient 1 before treatment inherent variability in the 16S gene between different species is an indicator of a proinflammatory gut environment will determine the definitiveness of ataxonomic annotation to enabling a "pathobiont' to overgrow and outcompete the a given sequence read. Given the topological nature of a commensal organisms normally found in the gut. Similarly, phylogenetic tree and that the tree represents hierarchical the dramatic overgrowth of Fusobacterium indicates a pro relationships of OTUs to one another based on their sequence foundly dysbiotic gut microbiota. One species of Fusobacte similarity and an underlying evolutionary model, taxonomic rium, F. nucleatum (an OTU phylogenetically indistinguish annotations of a read can be rolled up to a higher level using able from Fusobacterium sp. 3. 1 33 based on 16S-V4), has a clade-based assignment procedure (Table 1). Using this been termed “an emerging gut pathogen' based on its asso approach, clades are defined based on the topology of a phy ciation with IBD, Crohn's disease, and colorectal cancer in logenetic tree that is constructed from full-length 16S humans and its demonstrated causative role in the develop sequences using maximum likelihood or other phylogenetic ment of colorectal cancer in animal models Allen-Vercoe, models familiar to individuals with ordinary skill in the art of Gut Microbes (2011) 2:294-8. Importantly, neither Kleb phylogenetics. Clades are constructed to ensure that all OTUs siella nor Fusobacterium was detected in the 16S-V4 reads by in a given clade are: (i) within a specified number of bootstrap Day 25 (Table 13). Supported nodes from one another (generally, 1-5 bootstraps), 0382 To further characterize the colonization of the gut by and (ii) within a 5% genetic similarity. OTUs that are within Klebsiella and other Enterobacteriaceae and to speciate these the same clade can be distinguished as genetically and phy organisms, pretreatment and Day 25 fecal samples stored at logenetically distinct from OTUs in a different clade based on -80C as PBS-glycerol suspensions were plated on a variety 16S-V4 sequence data. OTUs falling within the same clade of selective media including MacConkey lactose media (se are evolutionarily closely related and may or may not be lective for gram negative enterobacteria) and Simmons Cit distinguishable from one another using 16S-V4 sequence rate Inositol media (selective for Klebsiella spp) Van Cregten data. The power of clade based analysis is that members of the et al., J. Clin. Microbiol. (1984) 20:936-41. Enterobacteria same Glade, due to their evolutionary relatedness, play simi identified in the patient samples included K. pneumoniae, lar functional roles in a microbial ecology Such as that found Klebsiella sp. Co. 9935 and E. coli. Strikingly, each Kleb in the human gut. Compositions Substituting one species with siella species was reduced by 2-4 logs whereas E. coli, a another from the same clade are likely to have conserved normal commensal organism present in a healthy microbiota, ecological function and therefore are useful in the present was reduced by less than 1 log (Table 14 below). This invention. decrease in Klebsiella spp. carriage is consistent across mul 0379 Stool samples were aliquoted and resuspended 10x tiple patients. Four separate patients were evaluated for the vol/wt in either 100% ethanol (for genomic characterization) presence of Klebsiella spp. pre treatment and 4 weeks post or PBS containing 15% glycerol (for isolation of microbes) treatment. Klebsiella spp. were detected by growth on selec and then stored at -80° C. until needed for use. For genomic tive Simmons Citrate Inositol media as previously described. 16S sequence analysis colonies picked from plate isolates had Serial dilution and plating, followed by determining cfu/mL their full-length 16S sequence characterized as described in titers of morphologically distinct species and 16S full length US 2016/0158294 A1 Jun. 9, 2016 36 sequence identification of representatives of those distinct Such as but not limited to an ethanol treated spore population morphological classes, allowed calculation of titers of spe itself: specifically the spore composition treatment itself and cific species. the engraftment of OTUs from the spore composition create a niche that enables the outgrowth of OTUs required to shift a 0383. The genus Bacteroides is an important member of dysbiotic microbiome to a microbial ecology that is associ the gastrointestinal microbiota; 100% of stool samples from ated with health. The diversity of Bacteroides species and the Human MicrobiomeProject contain at least one species of their approximate relative abundance in the gut of Patient 1 is Bacteroides with total relative abundance in these samples shown in Table 16, comprising at least 8 different species. ranging from 0.96% to 93.92% with a median relative abun 0385 FIG. 15 shows species engrafting versus species dance of 52.67% (www.hmpdacc.org reference data set augmenting in patients microbiomes after treatment with a HMSMCP). Bacteroides in the gut has been associated with bacterial composition Such as but not limited to an ethanol amino acid fermentation and degradation of complex treated spore population. Relative abundance of species that polysaccharides. Its presence in the gut is enhanced by diets engrafted or augmented as described were determined based rich in animal-derived products as found in the typical west on the number of 16S sequence reads. Each plot is from a ern diet David, L. A. et al. Nature (2013) doi:10.1038/na different patient treated with the bacterial composition such ture 12820. Strikingly, prior to treatment, fewer than 0.008% as but not limited to an ethanol-treated spore population for of the 16S-V4 reads from Patient 1 mapped to the genus recurrent C. difficile. Bacteroides strongly suggesting that Bacteroides species 0386 The impact of the bacterial composition such as but were absent or that viable Bacteroides were reduced to an not limited to an ethanol treated spore population treatment extremely minor component of the patient’s gut microbiome. on carriage of imipenem resistant Enterobacteriaceae was Post treatment, 42% of the 16S-V4 reads could be assigned assessed by plating pretreatment and Day 28 clinical samples to the genus Bacteroides within 5 days of treatment and by from Patients 2, 4 and 5 on MacConkey lactose plus 1 ug/mL Day 25 post treatment 59.48% of the patients gut microbiome of imipenem. Resistant organisms were scored by morphol was comprised of Bacteroides. These results were confirmed ogy, enumerated and DNA was submitted for full length 16S microbiologically by the absence of detectable Bacteroides in rDNA sequencing as described above. Isolates were identi the pretreatment sample plated on two different Bacteroides fied as Morganella morganii, Providencia rettgeri and Pro selective media: Bacteroides Bile Esculin (BBE) agar which teus pennerii. Each of these are gut commensal organisms; is selective for Bacteroides fragilis group species Living overgrowth can lead to bacteremia and/or urinary tract infec ston, S. J. et al J. Clin. Microbiol (1978). 7: 448-453 and tions requiring aggressive antibiotic treatment and, in some Polyamine Free Arabinose (PFA) agar Noacket al. J. Nutr. cases, hospitalization Kim, B-N, etal Scan J. Inf Dis (2003) (1998) 128: 1385-1391; modified by replacing glucose with 35: 98-103; Lee, I K and Liu, J-W J. Microbiol Immunol arabinose. The highly selective BBE agar had a limit of Infect (2006) 39: 328-334; O'Hara et al., Clin Microbiol Rev detection of <2x10 cfu/g, while the limit of detection for (2000) 13: 534. The titer of organisms at pretreatment and Bacteroides on PFAagar was approximately 2x107 cfu/g due Day 28 by patient is shown in Table 17. Importantly, admin to the growth of multiple non-Bacteroides species in the istration of the bacterial composition such as but not limited pretreatment sample on that medium. Colony counts of to an ethanol treated spore preparation resulted in greater than Bacteroides species on Day 25 were up to 2x10" cfu/g, 100-fold reduction in 4 of 5 cases of Enterobacteriaceae car consistent with the 16S-V4 sequencing, demonstrating a pro riage with multiple imipenem resistant organisms (See Table found reconstitution of the gut microbiota in Patient 1 (Table 17 which shows titers (in cfu/g) of imipenem-resistant M. 15 below). morganii, Prettgeri and P. pennerii from Patients 2, 4 & 5). 0384 The significant abundance of Bacteroides in Patient 0387. In addition to speciation and enumeration, multiple 1 on Day 25 (and as early as Day 5 as shown by 16S-V4 isolates of each organism from Patient 4 were grown over sequencing) is remarkable. Viable Bacteroides fragilis group night in 96-well trays containing a 2-fold dilution series of species were not present in the ethanol treated spore popula imipenem in order to quantitatively determine the minimum tion based on microbiological plating (limit of detection of 10 inhibitory concentration (MIC) of antibiotic. Growth of cfu/ml). Thus, administration of the ethanol treated spore organisms was detected by light scattering at 600 nm on a population to Patient 1 resulted in microbial population of the SpectraMax M5e plate reader. In the clinical setting, these patient's GI tract, not only due to the engraftment of bacterial species are considered resistant to imipenem if they have an species such as but not limited to spore forming species, but MIC of 1 lug/mL or greater. M. morganii isolates from pre also the restoration of high levels of non-spore forming spe treatment samples from Patient Dhad MICs of 2-4 ug/mL and cies commonly found in healthy individuals through the cre P. pennerii isolates had MICs of 4-8 ug/mL. Thus, the bacte ation of a niche that allowed for the repopulation of Bacteroi rial composition, Such as but not limited to, an ethanol treated des species. These organisms were most likely either present spores administered to Patient 4 caused the clearance of 2 at extremely low abundance in the GI tract of Patient 1, or imipenem resistant organisms (Table 12). While this example present in a reservoir in the GI tract from which they could specifically uses a spore preparation, the methods herein rebound to high titer. Those species may also be reinoculated describe how one skilled in the art would use a more general via oral uptake from food following treatment. We term this bacterial composition to achieve the same effects. The spe healthy repopulation of the gut with OTUs that are not present cific example should not be viewed as a limitation of the scope in the bacterial composition Such as but not limited to a spore of this disclosure. population or ethanol treated spore population, "Augmenta Example 26 tion.” Augmentation is an important phenomenon in that it shows the ability to use an ethanol treated spore ecology or Identifying the Core Ecology From the Bacterial other bacterial composition to restore a healthy microbiota by Combination seeding a diverse array or commensal organisms beyond the 0388 Ten different bacterial compositions were made by actual component organisms in the bacterial composition the ethanol treated spore preparation methods from 6 differ US 2016/0158294 A1 Jun. 9, 2016 37 ent donors (as described in Example 6). The spore prepara ber of patients represent a subset of the Core Ecology that are tions were used to treat 10 patients, each suffering from highly likely to catalyze the shift from a dysbiotic disease recurrent C. difficile infection. Patients were identified using ecology to a healthy microbiome. the inclusion/exclusion criteria described in Example 9, and 0391) A third lens was applied to further refine insights donors were identified using the criteria described in into the Core Ecology of the bacterial composition e.g. spore Example 10. None of the patients experienced a relapse of C. preparation. Computational-based, network analysis has difficile in the 4 weeks of follow up after treatment, whereas enabled the description of microbial ecologies that are the literature would predict that 70-80% of subjects would present in the microbiota of a broad population of healthy experience a relapse following cessation of antibiotic Van individuals. These network ecologies are comprised of mul Nood, et al., NEJM (2013). Thus, the ethanol treated spore tiple OTUs, some of which are defined as Keystone OTUs. preparations derived from multiple different donors and Keystone OTUs are computationally defined as described in donations showed remarkable clinical efficacy. These ethanol Example 24. Keystone OTUs form a foundation to the micro treated spore preparations are a Subset of the bacterial com bially ecologies in that they are found and as such are central positions described herein and the results should not be to the function of network ecologies in healthy Subjects. Key viewed as a limitation on the scope of the broader set of stone OTUS associated with microbial ecologies associated bacterial compositions. with healthy Subjects are often are missing or exist at reduced 0389. To define the Core Ecology underlying the remark levels in subjects with disease. Keystone OTUs may exist in able clinical efficacy of the bacterial compositions e.g. etha low, moderate, or high abundance in subjects. Table 18 further nol treated spore preparations, the following analysis was notes which of the OTUs in the bacterial composition e.g. carried out. The OTU composition of the spore preparation spore preparation are Keystone OTUS exclusively associated was determined by 16S-V4 rDNA sequencing and computa with individuals that are healthy and do not harbor disease. tional assignment of OTUs per Example 2. A requirement to 0392 There are several important findings from this data. detect at least ten sequence reads in the ethanol treated spore A relatively small number of species, 16 in total, are detected preparation was set as a conservative threshold to define only in all of the spore preparations from 6 donors and 10 dona OTUs that were highly unlikely to arise from errors during tions. This is surprising because the HMP database (www. amplification or sequencing. Methods routinely employed by himpdacc.org) describes the enormous variability of commen those familiar to the art of genomic-based microbiome char sal species across healthy individuals. The presence of a small acterization use a read relative abundance threshold of number of consistent OTUs lends support to the concept of a 0.005% (see e.g. Bokulich, A. et al. 2013. Quality-filtering Core Ecology. The engraftment data further supports this vastly improves diversity estimates from Illumina amplicon conclusion. A regression analysis shows a significant corre sequencing. Nature Methods 10: 57-59), which would equate lation between frequency of detection in a spore preparation to 22 reads given the sequencing depth obtained for the and frequency of engraftment in a donor: R=0.43 (p<0.001). samples analyzed in this example, as cut-off which is Sub While this may seem obvious, there is no a priori requirement stantially lower than the 10 reads used in this analysis. All that an OTU detected frequently in the bacterial composition taxonomic and clade assignments were made for each OTU as e.g. spore preparation will or should engraft. For instance, described in Example 3. The resulting list of OTUs, clade Lutispora thermophila, a spore former found in all ten spore assignments, and frequency of detection in the spore prepa preparations, did not engraft in any of the patients. Bilophila rations are shown in Table 18. Table 18 shows OTUs detected Wadsworthia, a gram negative anaerobe, is present in 9 of 10 by a minimum often 16S-V4 sequence reads in at least a one donations, yet it does not engraft in any patient, indicating ethanol treated spore preparation (pan-microbiome). OTUS that it is likely a non-viable contaminant in the ethanol treated that engraft in a treated patients and the percentage of patients spore preparation. Finally, it is worth noting the high prepon in which they engraft are denoted, as are the clades, spore derance of previously defined Keystone OTUs among the forming status, and Keystone OTU status. Starred OTUs most frequent OTUS in the spore preparations. occur in 80% of the ethanol preps and engraft in 50% of the 0393. These three factors—prevalence in the bacterial treated patients. composition Such as but not limited to a spore preparation, 0390 Next, it was reasoned that for an OTU to be consid frequency of engraftment, and designation as a Keystone ered a member of the Core Ecology of the bacterial compo OTUs—enabled the creation of a "Core Ecology Score” sition, that OTU must be shown to engraft in a patient. (CES) to rank individual OTUs. CES was defined as follows: Engraftment is important for two reasons. First, engraftment 0394 40% weighting for presence of OTU in spore is a sine qua non of the mechanism to reshape the microbiome preparation and eliminate C. difficile colonization. OTUs that engraft with 0395 multiplier of 1 for presence in 1-3 spore prepara higher frequency are highly likely to be a component of the tions Core Ecology of the spore preparation or broadly speaking a 0396 multiplier of 2.5 for presence in 4-8 spore prepa set bacterial composition. Second, OTUs detected by rations sequencing a bacterial composition (as in Table 18 may 0397 multiplier of 5 for presences in 9 spore prepara include non-viable cells or other contaminant DNA mol tions ecules not associated with the composition. The requirement 0398 40% weighting for engraftment in a patient that an OTU must be shown to engraft in the patient elimi 0399 multiplier of 1 for engraftment in 1-4 patients nates OTUS that represent non-viable cells or contaminating 0400 multiplier of 2.5 for engraftment in 5-6 patients sequences. Table 18 also identifies all OTUs detected in the bacterial composition that also were shown to engraft in at 04.01 multiplier of 5 for engraftment in 7 patients least one patient post-treatment. OTUS that are present in a 0402. 20% weighting to Keystone OTUs large percentage of the bacterial composition e.g. ethanol 04.03 multiplier of 1 for a Keystone OTU spore preparations analyzed and that engraft in a large num 04.04 multiplier of 0 for a non-Keystone OTU US 2016/0158294 A1 Jun. 9, 2016

0405. Using this guide, the CES has a maximum possible Example 28 score of 5 and a minimum possible score of 0.8. As an example, an OTU found in 8 of the 10 bacterial composition Testing Subsets of the Core Ecology in the Mouse Such as but not limited to a spore preparations that engrafted Model in 3 patients and was a Keystone OTU would be assigned the follow CES: 0410 Several subsets of the Core Ecology were tested in the C. difficile mouse model. The negative control was phos phate buffered saline and the positive control was a 10% 04.06 Table 19 ranks the top 20 OTUs by CES with the human fecal suspension. The subsets are described in Table further requirement that an OTU must be shown to engraft to 20 (Subsets of the Core Ecology tested in the C. difficile be a considered an element of a core ecology. mouse model). 0411 Two cages of five mice each were tested for each arm of the experiment. All mice received an antibiotic cock Example 27 tail consisting of 10% glucose, kanamycin (0.5 mg/ml), gen tamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronida Defining Efficacious Subsets of the Core Ecology Zole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), amplicillin 0407. The number of organisms in the human gastrointes (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking tinal tract, as well as the diversity between healthy individu water on days -14 through -5 and a dose of 10 mg/kg. Clin als, is indicative of the functional redundancy of a healthy gut damycin by oral gavage on day -3. On day -1, they received microbiome ecology (see The Human Microbiome Consor either the test articles or control articles via oral gavage. On tia. 2012. Structure, function and diversity of the healthy day 0, they were challenged by administration of approxi human microbiome. Nature 486: 207-214). This redundancy mately 4.5 log 10 cfu of C. difficile (ATCC 43255) via oral makes it highly likely that subsets of the Core Ecology gavage. Mortality was assessed every day from day 0 to day 6 describe therapeutically beneficial components of the bacte and the weight and Subsequent weight change of the animal rial composition Such as but not limited to an ethanol treated was assessed with weight loss being associated with C. diffi spore preparation and that Such Subsets may themselves be cile infection. Mortality and reduced weight loss of the test useful compositions for populating the GI tract and for the article compared to the empty vehicle was used to assess the treatment of C. difficile infection given the ecologies func Success of the testarticle. Additionally, a C. difficile symptom tional characteristics. Using the CES, individual OTUs can be scoring was performed each day from day -1 through day 6. prioritized for evaluation as an efficacious subset of the Core Symptom scoring was based on Appearance (0-2 pts based on Ecology. normal, hunched, piloerection, or lethargic), Respiration (0-2 pts based on normal, rapid or shallow, with abdominal breath 0408. Another aspect of functional redundancy is that evo ing), Clinical Signs (0-2 points based on normal, wet tail, lutionarily related organisms (i.e. those close to one another cold-to-the-touch, or isolation from other animals). on the phylogenetic tree, e.g. those grouped into a single 0412. In addition to compiling the cumulative mortality clade) will also be effective substitutes in the Core Ecology or for each arm, the average minimum relative weight is calcu a subset thereof for treating C. difficile. lated as the mean of each mouse's minimum weight relative 04.09 To one skilled in the art, the selection of appropriate to Day -1 and the average maximum clinical score is calcu OTU subsets for testing in vitro (e.g. see Example 28 below) lated as the mean of each mouse's maximum combined clini or in vivo (e.g. see Examples 7 or 8) is straightforward. cal score with a score of 4 assigned in the case of death. The Subsets may be selected by picking any 2,3,4,5,6,7,8,9, 10. results are reported in Table 21 below (Results of bacterial or more than 10 OTUs from Table 18, with a particular compositions tested in a C. difficile mouse model). emphasis on those with higher CES, such as the OTUs described Table 19. In addition, using the clade relationships Example 29 defined in Example 2 and Table 1 above, related OTUs can be selected as substitutes for OTUs with acceptable CES values. Defining Subsets of the Core Ecology in the In Vitro These organisms can be cultured anaerobically in vitro using C. difficile Inhibition Assay the appropriate media (selected from those described in Example 5 above), and then combined in a desired ratio. A 0413 Vials of -80° C. glycerol stock banks were thawed typical experiment in the mouse C. difficile model utilizes at and diluted to le8 CFU/mL. Selected strains and their clade least 10 and preferably at least 10, 10, 107, 10, 10 or more assignmentare given in Table 22. Each strain was then diluted than 10 colony forming units of a each microbe in the com 10x (to a final concentration of 1e7 CFU/mL of each strain) position. Variations in the culture yields may sometimes into 200 uL of PBS+15% glycerol in the wells of a 96-well mean that organisms are combined in unequal ratios, e.g. plate. Plates were then frozen at -80° C. When needed for the 1:10, 1:100, 1:1,000, 1:10,000, 1:100,000, or greater than assay, plates were removed from -80°C. and thawed at room 1:100,000. What is important in these compositions is that temperature under anaerobic conditions when testing in a in each strain be provided in a minimum amount so that the vitro C. difficile inhibition assay (CivSim). strains contribution to the efficacy of the Core Ecology sub 0414. An overnight culture of Clostridium difficile is set can be measured. Using the principles and instructions grown under anaerobic conditions in SweetB-Fosin or other described here, it is straightforward for one of skill in the art suitable media for the growth of C. difficile. SweetB-Fos.In is to make clade-based substitutions to test the efficacy of sub a complex media composed of brain heart infusion, yeast sets of the Core Ecology. Table 18 describes the clades for extract, cysteine, cellobiose, maltose, Soluble starch, and each OTU detected in a spore preparation and Table 1 fructooligosaccharides/inulin, and hemin, and is buffered describes the OTUs that can be used for substitutions based with MOPs. After 24 hr of growth the culture is diluted on clade relationships. 100,000 fold into a complex media such as SweetB-Fos.In US 2016/0158294 A1 Jun. 9, 2016 39 which is suitable for the growth of a wide variety of anaerobic natively, the qPCR is performed with other standard methods bacterial species. The diluted C. difficile mixture is then ali known to those skilled in the art. quoted to wells of a 96-well plate (180 uL to each well). 20 uI. 0418. The Cd value for each well on the FAM channel is of a subset Core Ecology is then added to each well at a final determined by the CFX ManagerTM 3.0 software. The logo concentration of 1e6 CFU/mL of each species. Alternatively (cfu/mL) of C. difficile each experimental sample is calcu the assay can be tested each species at different initial con lated by inputting a given sample's Cd value into a linear centrations (1e9 CFU/mL, 1e8 CFU/mL, 1e7 CFU/mL, 1e5 regression model generated from the standard curve compar CFU/mL, 1e4 CFU/mL, 1e3 CFU/mL, 1e2 CFU/mL). Con ing the Cd values of the standard curve wells to the known trol wells only inoculated with C. difficile are included for a logo (cfu/mL) of those samples. The log inhibition is calcu comparison to the growth of C. difficile without inhibition. lated for each sample by subtracting the logo (cfu/mL) of C. Additional wells are used for controls that either inhibit or do difficile in the sample from the logo (cfu/mL) of C. difficile in not inhibit the growth of C. difficile. One example of a positive the sample on each assay plate used for the generation of the control that inhibits growth is a combination of Blautia pro standard curve that has no additional bacteria added. The ducta, Clostridium bifermentans and Escherichia coli. One mean log inhibition is calculated for all replicates for each example of a control that shows reduced inhibition of C. composition. difficile growth is a combination of Bacteroides thetaiotaomi cron, Bacteroides ovatus and Bacteroides Vulgatus. Plates are 0419. A histogram of the range and standard deviation of wrapped with parafilm and incubated for 24hr at 37°C. under each composition is plotted. Ranges or standard deviations of anaerobic conditions. After 24 hr the wells containing C. the log inhibitions that are distinct from the overall distribu difficile alone are serially diluted and plated to determine titer. tion are examined as possible outliers. If the removal of a The 96-well plate is then frozen at -80C before quantifying single log inhibition datum from one of the binary pairs that is C. difficile by qPCR assay. identified in the histograms would bring the range or standard deviation in line with those from the majority of the samples, 0415. A standard curve is generated from a well on each that datum is removed as an outlier, and the mean log inhibi assay plate containing only pathogenic C. difficile grown in tion is recalculated. SweetB+FosIn media and quantified by selective spot plat ing. Serial dilutions of the culture are performed in sterile 0420. The pooled variance of all samples evaluated in the phosphate-buffered saline. Genomic DNA is extracted from assay is estimated as the average of the sample variances the standard curve samples along with the other wells. weighted by the sample's degrees of freedom. The pooled standard error is then calculated as the square root of the 0416 Genomic DNA is extracted from 5ul of each sample pooled variance divided by the square root of the number of using a dilution, freeze? thaw, and heat lysis protocol. 5 L of samples. Confidence intervals for the null hypothesis are thawed samples is added to 45 uL of UltraPure water (Life determined by multiplying the pooled standard error to the z Technologies, Carlsbad, Calif.) and mixed by pipetting. The score corresponding to a given percentage threshold. Mean plates with diluted samples are frozen at -20°C. until use for log inhibitions outside the confidence interval are considered qPCR which includes a heated lysis step prior to amplifica to be inhibitory if positive or stimulatory if negative with the tion. Alternatively the genomic DNA is isolated using the Mo percent confidence corresponding to the interval used. Ter BioPowersoil(R)-htp 96 Well Soil DNA Isolation Kit (Mo Bio nary combinations with mean log inhibition greater than Laboratories, Carlsbad, Calif.), Mo Bio Powersoil.R DNA 0.312 are reported as ++++ (>99% confidence interval (C.I.) Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the of the null hypothesis), those with mean log inhibition QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) between 0.221 and 0.312 as +++ (95%80%; 36 of 56 with a Clinical Microbiology 47:2142-2148 (2009)). This reaction C.I.>90%; 36 of 56 with a C.I.>95%; 29 of 56 with a C.I. of mixture is aliquoted to wells of a Hard-shell Low-Profile Thin >99%. Non-limiting but exemplary ternary combinations Wall 96-well Skirted PCR Plate (BioRad, Hercules, Calif.). include those with mean log reduction greater than 0.171, e.g. To this reaction mixture, 2 ul of diluted, frozen, and thawed any combination shown in Table 22 with a score of ++++, samples are added and the plate sealed with a Microseal B Such as Colinsella aerofaciens, Coprococcus comes, and Adhesive Seal (BioRad, Hercules, Calif.). The qPCR is per Blautia producta. Equally important, the CivSim assay formed on a BioRadC1000TM Thermal Cycler equipped with describes ternary combinations that do not effectively inhibit a CFX96TM Real-Time System (BioRad, Hercules, Calif.). C. difficile. 5 of 56 combinations promote growth with >80% The thermocycling conditions are 95°C. for 15 minutes fol confidence; 2 of 56 promote growth with >90% confidence: 1 lowed by 45 cycles of 95° C. for 5 seconds, 60° C. for 30 of 56, Coprococcus comes, Clostridium symbiosum and seconds, and fluorescent readings of the FAM channel. Alter Eubacterium rectale, promote growth with >95% confidence. US 2016/0158294 A1 Jun. 9, 2016 40

12 of 56 combinations are neutral in the assay, meaning they 0427 Each strain is then be cultivated to a concentration of neither promote nor inhibit C. difficile growth to the limit of 10' CFU/mL, then concentrated 20-fold by tangential flow measurement. microfiltration; the spent medium is exchanged by diafilter 0422. It is straightforward for one of skill in the art to use ing with a preservative medium consisting of 2% gelatin, 100 the in vitro competition assay described below to determine mM trehalose, and 10 mM sodium phosphate buffer, or other efficacious subsets of the Core Ecology derived from the suitable preservative medium. The suspension is freeze-dried bacterial composition shown to be efficacious in treating C. to a powder and titrated. difficile in humans. 0428. After drying, the powder is blended with microcrys 0423. Use of InVitro Competition Assay to Test Potential talline cellulose and magnesium Stearate and formulated into Bacterial Competitor Consortia for Functionality a 250 mg gelatin capsule containing 10 mg of lyophilized 0424. An in vitro assay is performed to test the ability of a powder (10 to 10' bacteria), 160 mg microcrystalline cel chosen species or combination of species to inhibit the growth lulose, 77.5 mg gelatin, and 2.5 mg magnesium Stearate. of a pathogen Such as Clostridium difficile in media that is otherwise Suitable for growth of the pathogen. A liquid media Example 32 Suitable for growth of the pathogen is chosen, Such as Brain Heart Infusion Broth (BHI) for C. difficile (see Example 5). Method of Treating a Subject with a Bacterial The potential competitor species or a combination of com Composition petitor species are inoculated into 3 mL of the media and 0429. A patient has suffered from recurrent bouts of C. incubated anaerobically for 24 hr at 37°C. After incubation difficile. In the most recent acute phase of illness, the patient the cells are pelleted in a centrifuge at 10,000 ref for 5 min. is treated with an antibiotic sufficient to ameliorate the symp Supernatant is removed and filtered through a 0.22um filter to toms of the illness. In order to prevent another relapse of C. remove all cells. C. difficile or another pathogen of interest is difficile, the patient is administered one of the present bacte then inoculated into the filtered spent Supernatant and grown rial compositions. Specifically, the patient is administered anaerobically at 37° C. for 24hr. A control culture in fresh Bacillus circulans and Roseburia inulinivorans at a dose of media is incubated in parallel. After incubation, the titer of C. 10° bacteria total in a lyophilized form, specifically in a 250 difficile is determined by serially diluting and plating to Bru mg gelatin capsule containing 10 mg of lyophilized bacteria, cella Blood Agar (BBA) plates and incubated anaerobically 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 for 24 hr at 37° C. Colonies are counted to determine the final mg magnesium Stearate. The patient takes the capsule by titer of the pathogen after incubation in competitor condi mouth and resumes a normal diet after 4, 8, 12, or 24 hours. In tioned media and control media. The percent reduction in another embodiment, the patient may take the capsule by final titer is calculated and considered inhibitory if a statisti mouth before, during, or immediately after a meal. cally significant reduction in growth is measured. Alterna 0430 Feces is collected before and at 1 day, 3 days, 1 tively, the inhibition of pathogen growth is monitored by week, and 1 month after administration. The presence of C. ODoo measurement of the test and control cultures. difficile is found in the feces before administration of the bacterial composition, but feces collections after administra Example 30 tion show reducing (such as at least 50% less, 60%, 70%, 80%, 90%, or 95%) to no detectable levels of C. difficile, as Testing of Bacterial Composition Against measured by qPCR, as described above. ELISA for toxin Salmonella protein or traditional microbiological identification tech 0425 The in vitro assay is used to screen for combinations niques may also be used. of bacteria inhibitory to the growth of Salmonella spp. by 0431 AS another measure of patient Success, a positive modifying the media used for growth of the pathogen inocu response may be defined as absence of diarrhea, which itself lum. Several choices of media are used for growth of the is defined as 3 or more loose or watery stools per day for at pathogen such as Reinforced Clostridial Media (RCM), Brain least 2 consecutive days or 8 or more loose or watery stools in Heart Infusion Broth (BHI) or Luria Bertani Broth (LB). 48 hours, or persisting diarrhea (due to other causes) with Salmonella spp. are quantified by using alternative selective repeating (three times) negative stool tests for toxins of C. media specific for Salmonella spp. or using qPCR probes difficile. specific for the pathogen. For example, MacConkey agar is 0432 Treatment failure is defined as persisting diarrhea used to select for Salmonella spp. and the invA gene is tar with a positive C. difficile toxin stool test or no reduction in geted with qPCR probes; this gene encodes an invasion pro levels of C. difficile, as measured by qPCR sequencing. tein carried by many pathogenic Salmonella spp. and is used ELISA or traditional microbiological identification tech in invading eukaryotic cells. niques may also be used. Example 31 Example 33 Method of Preparing the Bacterial Composition for Method of Treating a Subject with a Bacterial Administration to a Patient Composition 0426 Two strains for the bacterial composition are inde 0433) A patient has suffered from recurrent bouts of C. pendently cultured and mixed together before administration. difficile. In the most recent acute phase of illness, the patient Both strains are independently be grown at 37°C., pH 7, in a is treated with an antibiotic sufficient to ameliorate the symp GMM or other animal-products-free medium, pre-reduced toms of the illness. In order to prevent another relapse of C. with 1 g/L cysteine YHC1. After each strain reaches a suffi difficile, the patient is administered one of the present bacte cient biomass, it is preserved for banking by adding 15% rial compositions. Specifically, the patient is administered a glycerol and then frozen at -80° C. in 1 ml cryotubes. bacterial composition containing two bacterial types from US 2016/0158294 A1 Jun. 9, 2016

Table 1, at a dose of 10 bacteria total in a lyophilized form At the very least, and not as an attempt to limit the application formulated in an enteric coated capsule. Example of the of the doctrine of equivalents to the scope of the claims, each patient or samples derived from the patient is expected to numerical parameter should be construed in light of the num demonstrate at least one measure of Success as described ber of significant digits and ordinary rounding approaches. herein (reducing levels of C. difficile as measured by qPCR. 0436. Unless otherwise indicated, the term “at least pre ELISA, or traditional microbiological identification; absence ceding a series of elements is to be understood to refer to of diarrhea, persisting diarrhea with repeating (three times) every element in the series. negative stool tests for toxins of C. difficile. 0437. While the invention has been particularly shown and 0434. Other embodiments will be apparent to those skilled described with reference to a preferred embodiment and vari in the art from consideration of the specification and practice ous alternate embodiments, it will be understood by persons of the embodiments. Consider the specification and examples skilled in the relevant art that various changes in form and as exemplary only, with a true scope and spirit being indicated details can be made therein without departing from the spirit by the following claims. and scope of the invention. 0435. Unless otherwise indicated, all numbers expressing 0438 All references, issued patents and patent applica quantities of ingredients, reaction conditions, and so forth tions cited within the body of the instant specification are used in the specification, including claims, are to be under hereby incorporated by reference in their entirety, for all stood as being modified in all instances by the term “about.” purposes. Accordingly, unless otherwise indicated to the contrary, the numerical parameters are approximations and may vary TABLES depending upon the desired properties sought to be obtained. 0439 TABLE 1 SEQID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium saburreum 858 ABS25414 clade 178 Y N Eubacterium sp. oral clone IR009 866 AY349376 clade 178 Y N Lachnospiraceae bacterium ICM62 1061 HQ616401 clade 178 Y N Lachnospiraceae bacterium MSX33 1062 HQ616384 clade 178 Y N Lachnospiraceae bacterium oral taxon 107 1063 ADDSO1000069 clade 178 Y N Alicyclobacilius acidocaidarius 122 NR 074721 clade 179 Y N Cliostridium barati 555 NR 029229 clade 223 Y N Cliostridium coicanis 576 FJ95.7863 clade 223 Y N Clostridium paraputrificum 611 ABS36771 clade 223 Y N Cliostridium sardiniense 621 NR 041006 clade 223 Y N Eubacterium budayi 837 NR 024682 clade 223 Y N Eubacterium moniiforme 851 HF558373 clade 223 Y N Eubacterium multiforme 852. NR 024683 clade 223 Y N Eubacterium nitritogenes 853 NR 024684 clade 223 Y N Anoxybacilius flavithermus 173 NR 074667 clade 238 Y N Bacilius aerophilus 196 NR 042339 clade 238 Y N Bacilius aestuarii 197 GQ980243 clade 238 Y N Bacilius amyloiquefaciens 199 NR 075005 clade 238 Y N Bacilius anthracis 200 AAENO1000020 clade 238 Y Category-A Bacilius atrophaeus 201 NR 075016 clade 238 Y OP Bacilius badius 202 NR 036893 clade 238 Y OP Bacilius cereus 203 ABDJO1OOOO15 clade 238 Y OP Bacilius circuians 204 AB271747 clade 238 Y OP Bacilius firmus 207 NR 025842 clade 238 Y OP Bacilius flexus 208 NR 024691 clade 238 Y OP Bacilius fordii 209 NR 025786 clade 238 Y OP Bacilius haimapalus 211 NR 026,144 clade 238 Y OP Bacilius herbersteinensis 213 NR 042286 clade 238 Y OP Bacilius idriensis 215 NR 043268 clade 238 Y OP Bacilius lenius 216 NR 04O792 clade 238 Y OP Bacilius licheniformis 217 NC OO6270 clade 238 Y OP Bacilius negaterium 218 GU2S2124 clade 238 Y OP Bacilius neaisonii 219 NR 044546 clade 238 Y OP Bacilius niabensis 220 NR 043334 clade 238 Y OP Bacilius niacini 221 NR 024.695 clade 238 Y OP Bacilius pocheonensis 222 NR 041377 clade 238 Y OP Bacilitispiimius 223 NR 074977 clade 238 Y OP Bacilius Safensis 224 JQ624766 clade 238 Y OP Bacilius simplex 225 NR 042136 clade 238 Y OP Bacilius Sonorensis 226 NR 025130 clade 238 Y OP Bacillus sp. 10403023 MM10403.188 227 CAETO1OOOO89 clade 238 Y OP Bacilius sp. 2. A 57 CT2 230 ACWDO1000095 clade 238 Y OP Bacillus sp. 2008724.126 228 GU2S2108 clade 238 Y OP Bacillus sp. 2008724139 229 GU2S2111 clade 238 Y OP Bacilius sp. 7 16AIA 231 FN397518 clade 238 Y OP Bacilius sp. AP8 233 JX101689 clade 238 Y OP Bacillus sp. B27(2008) 234 EU362173 clade 238 Y OP Bacillus sp. BT1B CT2 235 ACWCO100.0034 clade 238 Y OP US 2016/0158294 A1 Jun. 9, 2016 42

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former S taltu S Bacilius sp. GB1.1 236 FT897765 e 238 Bacilius sp. GB9 237 FT897766 e 238 Bacilius sp. HU19.1 238 FT897769 e 238 Bacilius sp. HU29 239 FJ897771 e 238 Bacilius sp. HU33.1 240 FT897772 e 238 Bacilius sp. JC6 241 JF8248OO e 238 Bacilius sp. oral taxon F79 248 HMO99654 e 238 Bacilius sp. SRC DSF1 243 GU797.283 e 238 Bacilius sp. SRC DSF10 242 GU797.292 e 238 Bacilius sp. SRC DSF2 244 GU797284 e 238 Bacilius sp. SRC DSF6 24S GU797.288 e 238 Bacilius sp. tc09 249 HQ844242 e 238 Bacilius sp. zh168 2SO FJ851424 e 238 Bacilius sphaericits 251 DQ286318 e 238 Bacilius sporothermodurans 252 NR 026010 e 238 Bacilius subtiis 253 EU627588 e 238 Bacilius thermoamylovorans 254 NR 029151 e 238 Bacilius thuringiensis 255 NC O08600 e 238 Bacilius weihenstephanensis 256 NR 074926 e 238 Geobacilius kaustophilus 933 NR 074989 e 238 Geobacilius Stearothermophilus 936 NR 040794 e 238 Geobacilius thermodenitrificans 938 NR 074976 e 238 Geobacilius thermoglucosidasius 939 NR 043022 e 238 Lysinibacilius sphaericits 1193 NR 074883 e 238 Clostridiales sp. SS3 4 543 AY305316 e 246 Clostridium beijerinckii 557 NR 074,434 e 252 Cliostridium bointinum 560 NC 01.0723 e 252 ategory-A Clostridium butyricum 561 ABDTO1OOOO17 e 252 Cliostridium chauvoei 568 EU106372 e 252 Clost ridium favososportin 582 X76749 e 252 Clostridium histolyticum 592 HF558362 e 252 Cliostridium isatidis 597 NR 026347 e 252 Cliostridium inosum 602 FR870444 e 252 Clostridium sartagoforme 622 NR 026490 e 252 Clostridium septicum 624 NR 026020 e 252 Clostridium sp. 7 2 43FAA 626 ACDKO1OOO1 O1 e 252 Clost ridium sporogenes 645 ABKWO2OOOOO3 e 252 Cliostridium tertium 653 Y18174 e 252 Cliostridium carnis 564 NR 044716 e 253 Cliostridium ceiatum S6S X77844 e 253 Clostridium disporicum 579 NR 026491 e 253 Clost ridium gasigenes 585 NR 024945 e 253 Clostridium quinii 616 NR 026149 e 253 Clostridium hyiemonae 593 ABO23973 e 260 Cliostridium scindens 623 AF262238 e 260 Lachnospiraceae bacterium 5 1 57FAA 1054 ACTRO1 OOOO20 e 260 Clostridium glycyrrhizinilyticum 588 AB233O29 e 262 Cliostridium nexile 6O7 X73443 e 262 Coprococci is comes 674 ABVRO1 OOOO38 e 262 Lachnospiraceae bacterium 1 1 57FAA 1048 ACTMO1 OOOO6S e 262 Lachnospiraceae bacterium 1 4 56FAA 1049 ACTNO1OOOO28 e 262 Lachnospiraceae bacterium 8 1 57FAA 1057 ACWQ01000079 e 262 Ruminococcus iaciaris 1663 ABOUO2OOOO49 e 262 Raiminococci is torques 1670 AAVPO2OOOOO2 e 262 Paenibacilius ialitus 1397 NR 04.0882 e 270 Paenibacilius polymyxa 1399 NR 037006 e 270 Paenibacillus sp. HGF5 14O2 AEXSO1 OOOO95 e 270 Paenibacillus sp. HGF7 1403 AFDHO1OOO147 e 270 Eubacterium sp. oral clone JIO12 868 AY3493.79 e 298 Alicyclobacilius contaminans 124 NR 041475 e 301 Alicyclobacilius herbarius 126 NR 024753 e 301 Alicyclobacilius pomorum 127 NR 024801 e 301 Bialitia coccoides 373 ABS71656 e 309 Bialitia glucerasea 3.74 ABS88O23 e 309 Bialitia glucerasei 375 AB439724 e 309 Biatitia hansenii 376 ABYUO2OOOO37 e 309 Biatitia initi 378 AB691576 e 309 Bialitia producia 379 AB600998 e 309 Biatitia Schinki 380 NR 026312 e 309 Blautia sp. M25 381 HM626178 e 309 Biatitia Stercoris 382 HM626177 e 309 Bialitia welerae 383 EFO36467 e 309 Bryantella formatexigens 439 ACCLO2OOOO18 e 309 Cliostridium coccoides 573 EFO25906 e 309 US 2016/0158294 A1 Jun. 9, 2016 43

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Eubacterium ceilutioSolvens 839 AY178842 e 309 Lachnospiraceae bacterium 6 1 63FAA 1056 ACTWO1OOOO14 e 309 Ruminococcus hansenii 1662 MS9114 e 309 Ruminococcus obeum 1664 AY169419 e 309 Ruminococcus sp. 5 1 39BFAA 1666 ACIIO1 OOO172 e 309 Raiminococci is sp. K. 1 1669 AB222208 e 309 Syntrophococci is sticromatians 1911 NR 036869 e 309 Bacilius alcalophilus 198 X76436 e 327 Bacilius clausii 205 FN397477 e 327 Bacilius gelatini 210 R 025595 e 327 Bacilius halodurans 212 Y144582 e 327 Bacilius sp. oral taxon F26 246 MO99642 e 327 Cliostridium innocuum 595 23732 e 351 Clostridium sp. HGF2 628 ENWO1OOOO22 e 351 Clostridium perfingens 612 BDWO1OOOO23 e 353 Category-B Sarcina ventrictii 1687 R 026146 e 353 Cliostridium bartietti 556 BEZO2OOOO12 e 354 Clostridium bifermenians 558 73437 e 354 Clostridium ghonii S86 BS42933 e 354 Clostridium glycolicum 587 384385 e 354 Clostridium mayombei 60S R733682 e 354 Cliostridium sordei 625 B448.946 e 354 Clostridium sp. MT4 E 635 159523 e 354 Eubacterium tennie 872 591.18 e 354 Clostridium argentinense 553 R 029232 e 355 Clostridium sp. JC122 630 AEVO1OOO127 e 355 Clostridium sp. NMBHI 1 636 JNO93130 e 355 Cliostridium subterminaie 6SO R 041795 e 355 Clostridium sulfidigenes 651 R 044161 e 355 Dorea formicigenerans 773 AAXAO2OOOOO6 e 360 Dorea longicatena 774 132842 e 360 Lachnospiraceae bacterium 2 1 46FAA 1OSO DLBO1OOOO3S e 360 Lachnospiraceae bacterium 2 1 58FAA 1051 CTOO1 OOOOS2 e 360 Lachnospiraceae bacterium 4 1 37FAA 1053 i DCRO1 OOOO3O e 360 Lachnospiraceae bacterium 9 1 43BFAA 1058 ACTXO1OOOO23 e 360 Raiminococcus gnavuts 1661 X94967 e 360 Ruminococcus sp. ID8 1668 AY960S64 e 360 Bialitia hydrogenotrophica 377 ACBZO1 OOO217 e 368 Lactonifactor longovifornis 1147 DQ100449 e 368 Robinsoniella peoriensis 1633 AF44S258 e 368 Eubacterium infirmum 849 U13039 e 384 Eubacterium sp. WAL 14571 864 FJ687606 e 384 Erysipelotrichaceae bacterium 5 2 54FAA 823 ACZWO1 OOOOS4 e 385 Eubacterium biforme 835 ABYTO1OOOOO2 e 385 Eubacterium cylindroides 842 FP929O41 e 385 Eubacterium doichum 844 L34682 e 385 Eubacterium sp. 3. 1 31 861 CTLO1 OOOO45 e 385 Eubacterium tortuosum 873 R 044648 e 385 Buileidia extrucia 441 DFRO1 OOOO11 e 388 Soiobacterium moorei 1739 ECQ01000039 e 388 Coprococciis Caius 673 U266SS2 e 393 Lachnospiraceae bacterium oral taxon F15 1064 MO99641 e 393 Cliostridium cochlearium 574 R 044717 e 395 Cliostridium maienominatium 604 R749893 e 395 Cliostridium tetani 654 C OO4557 e 395 Acetivibrio ethanolgigners 6 R749897 e 396 Anaerosporobacter mobilis 161 R 042953 e 396 Bacteroidespectinophilus 288 BVQ0100.0036 e 396 Cliostridium aminovaiericum 551 R 029245 e 396 Clostridium phytofermenians 613 R O74652 e 396 Eubacterium hai 848 L34621 e 396 Eubacterium xylanophilum 875 L34628 e 396 Ruminococcus calidus 1658 R 029160 e 406 Raiminococci is champanellensis 1659 FP929052 e 406 Ruminococcus sp. 18P13 1665 A. 515913 e 406 Ruminococcus sp. 9SE51 1667 FM954974 e 406 Anaerostipes caccae 162 ABAXO3OOOO23 e 408 Anaerostipes sp. 3 2 56FAA 163 ACWBO1OOOOO2 e 408 Clostridiales bacterium 1 7 47FAA 541 ABQRO1000074 e 408 Clostridiales sp. SM4 1 S42 FP929O60 e 408 Clostridiales sp. SSC 2 544 FP929061 e 408 Cliostridium aerotoierans S46 X761.63 e 408 Cliostridium aidenense 547 NR 043680 e 408 Clostridium algidiyyianolyticum 550 NR 028726 e 408 US 2016/0158294 A1 Jun. 9, 2016 44

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Clostridium amygdalinum 552 AY353957 e 408 Clost ridium asparagiforme SS4 ACCJO1OOOS22 e 408 Cliostridium boiteae SS9 ABCCO2OOOO39 e 408 Cliostridium celerecrescens 566 JQ246092 e 408 Cliostridium citroniae 569 ADLO1OOOOS9 e 408 Clostridium clostridiiformes 571 M59089 e 408 Clostridium clostridioforme 572 NR 044715 e 408 Clostridium hathewayi 590 AY552788 e 408 Cliostridium indois 594 AFO28351 e 408 Cliostridium iavaiense 600 EF564277 e 408 Clostridium saccharolyticum 620 CPOO2109 e 408 Clostridium sp. M62 1 633 ACFXO2OOOO46 e 408 Clostridium sp. SS2 1 638 ABGCO3OOOO41 e 408 Clostridium sphenoides 643 X73449 e 408 Clostridium symbiosum 652 ADLQ01000114 e 408 Clostridium xvianolyticum 658 NR 037068 e 408 Eubacterium hadrum 847 FR749933 e 408 Lachnospiraceae bacterium 3 1 57FAA CT1 1052 ACTPO1OOO124 e 408 Lachnospiraceae bacterium 5 1 63FAA 1OSS ACTSO1OOOO81 e 408 Lachnospiraceae bacterium A4 1059 DQ789118 e 408 Lachnospiraceae bacterium DJFVP30 1060 EU728771 e 408 Lachnospiraceae genomosp. C1 106S AY2786.18 e 408 Clostridium difficile 578 NC 013315 e 409 Eubacterium sp. AS15b 862 HQ616364 e 428 Eubacterium sp. OBRC9 863 HQ616354 e 428 Eubacterium sp. oral clone OH3A 871 AY947497 e 428 Eubacterium yuri 876 AEESO1 OOOO73 e 428 Clostridium acetobutyllicum 545 NR 074511 e 430 Clostridium algidicarnis 549 NR 041746 e 430 Cliostridium cadaveris S62 ABS42932 e 430 Cliostridium carboxidivorans 563 FR733710 e 430 Cliostridium esteriheticum 580 NR 042153 e 430 Clostridium fallax 581 NR 044714 e 430 Clostridium feisineum 583 AF2705O2 e 430 Clostridium frigidicarnis 584 NR 024919 e 430 Clostridium kluyveri 598 NR 0741.65 e 430 Clostridium magnum 603 X77835 e 430 Clostridium putrefaciens 615 NR 024995 e 430 Clostridium sp. HPB 46 629 AY862516 e 430 Clostridium tyrobutyricum 656 NR 044718 e 430 Sutterella parvirubra 1899 AB3OO989 e 432 Acetanaerobacterium elongatum 4 NR 042930 e 439 Cliostridium ceiliuliosi 567 NR 044624 e 439 Ethanoligenens harbinense 832 AY675965 e 439 Eubacterium reciaie 856 FP929.042 e 444 Eubacterium sp. oral clone GIO38 865 AY349374 e 444 Lachnobacterium bovis 1O4S GU324.407 e 444 Roseburia Cecicola 1634 GU233441 e 444 Roseburia faecalis 1635 AY804149 e 444 Roseburia faecis 1636 AY305310 e 444 Roseburia hominis 1637 A270482 e 444 Roseburia intestina is 1638 FP929OSO e 444 Roseburia intinivorans 1639 A270473 e 444 Brevibacilius brevis 410 NR 041524 e 448 Brevibacilius laterosporus 414 NR 037005 e 448 Bacilius coaglians 206 DQ297928 e 451 Sporolactobacilius inulinus 1752 NR 040962 e 451 Kochiria palustris 1041 EU333884 e 453 Nocardia farcinica 1353 NC OO6361 e 455 Bacilius sp. oral taxon F28 247 HMO996SO e 456 Catenibacterium mitsuokai 495 ABO3O224 e 469 Clostridium sp. TM 40 640 AB249652 e 469 Coprobacilius cateniformis 670 ABO3O218 e 469 Coprobacilius sp. 29 1 671 ADKXO1OOOOS7 e 469 Cliostridium recium 618 NR 029271 e 470 Eubacterium nodalium 854 U13O41 e 476 Etibacterium Saphentin 859 NR 026.031 e 476 Eubacterium sp. oral clone JHO12 867 AY349373 e 476 Eubacterium sp. oral clone JS001 870 AY3493.78 e 476 Faecalibacterium prausnitzii 880 ACOPO2OOOO11 e 478 Gemmiger formicilis 932 GUS 62446 e 478 Subdoigranulum variabile 1896 AJS18869 e 478 Clostridiaceae bacterium JC13 532 JF824.807 e 479 Clostridium sp. MLGO55 634 AF30443S e 479 US 2016/0158294 A1 Jun. 9, 2016 45

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Erysipelotrichaceae bacterium 3 1. 53 822 ACTO1OOO113 e 479 Cliostridium cocleatum 575 NR O26495 e 481 Cliostridium ranosum 617 M23731 e 481 Clostridium saccharogumia 619 DQ100445 e 481 Clostridium spiroforme 644 X73441 e 481 Coprobacilius sp. D7 672 ACDTO1OOO199 e 481 Clostridiales bacterium SY8519 535 B477431 e 482 Clostridium sp. SY8519 639 PO12212 e 482 Eubacterium ramitius 855 O11522 e 482 Erysipeiothrix inopinata 819 R 025594 e 485 Erysipeiothrix rhusiopathiae 820 CLKO1OOOO21 e 485 Erysipeiothrix tonsillarum 821 R 040871 e 485 Holdemania filiformis 1004 1466 e 485 Mollicutes bacterium pACH93 1258 Y297808 e 485 Coxieia burnetii 736 POOO890 e 486 ategory-B Cliostridium hiranonis 591 B023970 e 487 Clostridium irregulare 596 R 0292.49 e 487 Cliostridium orbiscindens 609 81.87 e 494 Clostridium sp. NML 04A032 637 U815224 e 494 Flavonifactor plautii 886 Y724678 e 494 Pseudoflavonifactor capiliosus 1591 Y136666 e 494 Ruminococcaceae bacterium D16 1655 DDXO1OOOO83 e 494 Acetivibrio cellulolyticus 5 R O25917 e 495 Cliostridium aidrichii S48 R 026099 e 495 Clostridium clarifiavum 570 R 041235 e 495 Cliostridium Stercorarium 647 R O251OO e 495 Cliostridium straminisolvens 649 R 024829 e 495 Cliostridium thermocelium 655 R 074629 e 495 Fusobacterium nucleatum 901 DVKO1 OOOO34 e 497 Eubacterium barkeri 834 R 044661 e 512 Eubacterium caiianderi 838 R 026330 e 512 Eubacterium inosum 850 POO2273 e 512 Anaerotruncus coihominis 164 BGDO2OOOO21 e 516 Clostridium methylpentosum 606 CECO1 OOOO59 e 516 Clostridium sp. YIT 12070 642 B491208 e 516 Hydrogenoanaerobacterium saccharov.orans 1OOS R 044.425 e 516 Ruminococcus aibus 1656 Y4456OO e 516 Raiminococci is fiavefaciens 1660 R O25931 e 516 Clostridium haemolyticum 589 R 024749 e 517 Clostridium novyi 608 R 074343 e 517 Clostridium sp. LMG 16094 632 95274 e 517 Eubacterium ventriosum 874 L34421 e 519 Bacteroides galactiironicus 28O Q497994 e 522 Etibacterium eigens 845 POO1104 e 522 Lachnospira multipara 1046 R733699 e 522 Lachnospira pectinoschiza 1047 4675 e 522 Lactobacilius rogosae 1114 U269S44 e 522 Bacilius horii 214 R 036860 e 527 Bacilius sp. 9 3AIA 232 FN397519 e 527 Eubacterium brachy 836 3O38 e 533 Filifactor alocis 881 POO2390 e 533 Filifactor villosus 882 R 041928 e 533 Clostridium leptum 6O1 3OS238 e 537 Clostridium sp. YIT 12069 641 B4912O7 e 537 Clost ridium sporosphaeroides 646 R 044835 e 537 Etibacterium coprostanoigenes 841 MO37995 e 537 Ruminococcus bromii 1657 U266549 e 537 Eubacterium Siraeum 860 BCAO3OOOOS4 e 538 Cliostridium viride 657 R 026.204 e 540 Oscillibacter sp. G2 1386 M626173 e 540 Oscillibacter valericigenes 1387 R 074793 e 540 Oscillospira guilliermondii 1388 BO40495 e 540 Butyrivibrio crossotus 455 BWNO1 OOOO12 e 543 Clostridium sp. L2 50 631 AAYWO2OOOO18 e 543 Coprococciis elitacius 675 EFO31543 e 543 Coprococcus sp. ART55 1 676 AY350746 e 543 Eubacterium ruminantium 857 NR 024661 e 543 Collinseila aerofaciens 659 AAVNO2OOOOO7 e 553 Alkaliphilus metailinedigenes 137 AY137848 e 554 Alkaliphilus oremlandii 138 NR 043674 e 554 Cliostridium Stickiandi 648 LO4167 e 554 Turicibacter sanguinis 196S AF349724 e 555 Fulvimonas sp. NML 060897 892 EF589680 e 557 Desulfitobacterium frappieri 753 A276,701 e 560 US 2016/0158294 A1 Jun. 9, 2016 46

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Desulfitobacterium hafniense 754 NR 074996 Desulfotomaculum nigrificans 756 NR 044832 Lutiispora thermophila 1191 NR 041236 Brachyspira pilosicoli 405 NR 075.069 Eggerihelia lenia 778 AF292375 Streptomyces albus 1888 A697941 Chlamydiales bacterium NS11 SOS JN606O74 Anaerofustis stercorihominis 159 ABILO2OOOOOS Butyricicocci is pullicaecorum 453 HEHA93440 Eubacterium desmoians 843 NR 044644 Papillibacter cinnamivorans 1415 NR 025.025 Sporobacter termitidis 1751 NR 044972 Deferribacteres sp. oral clone JV006 744 AY349371 Cliostridium coinum 577 NR 026151 Clostridium lactatifermenians 599 NR 025651 Clostridium piliforme 614 D14639 Saccharomonospora viridis 1671 XS4286 Thermobifida fisca 1921 NC 007333 Leptospira licerasiae 1164 EF612284 Moorelia thermoacetica 1259 NR 075001 Thermoanaerobacter pseudethanolicus 1920 CPOOO924 Flexistipes sinusarabici 888 NR 074881 Gioeobacter violaceus 942 NR 074282 Eubacterium sp. oral clone JN088 869 AY349377 Cliostridium oroticum 610 FR749922 Clostridium sp. D5 627 ADBGO1 OOO142 Eubacterium contorium 840 FR749946 Etibacterium fissicatena 846 FR74993S Corynebacterium coyleae 692 X96497 Corynebacterium mucifaciens 711 NR 026396 Corynebacterium ureicelerivorans 733 AM397636 Corynebacterium appendicis 684 NR 028951 Corynebacterium genitalium 698 ACLO1OOOO31 Corynebacterium glauctim 699 NR 028971 Corynebacterium imitans 703 AF537597 Corynebacterium riegelii 719 EU848548 Corynebacterium sp. L. 2012475 723 HE575405 Corynebacterium sp. NML 93 0481 724 GU2384.09 Corynebacterium sundsvallense 728 YO9655 Corynebacterium tuscaniae 730 AY677186 Prevoteia maculosa 1504 AGEKO1 OOOO3S Prevoteia or is 1513 ADDVO1 OOOO91 Prevoteiia Saivae 1517 AB108826 Prevotella sp. ICM55 1521 HQ616399 Prevoteila sp. oral clone AA020 1528 AYOO5057 Prevoteila sp. oral clone GIO32 1538 AY349396 Prevoteila sp. oral taxon G70 1558 GU4321.79 Prevoteila corporis 1491 L164.65 Bacteroides sp. 4 1 36 312 ACTCO1 OOO133 Bacteroides sp. AR20 31S AF139524 Bacteroides sp. D20 319 ACPTO1OOOOS2 Bacteroides sp. F 4 322 AB470322 Bacteroides uniformis 329 ABOSO110 Prevoteia nanceiensis S10 JN867228 Prevoteila sp. oral taxon 299 548 ACWZO1 OOOO26 Prevoteila bergensis 485 ACKSO1 OOO1 OO Prevoteia buccais 489 N867261 Prevoteia timonensis S64 ADEFO1 OOOO12 Prevoteia orais S12 AEPEO1 OOOO21 Prevotella sp. SEQ072 525 JN867238 LeticonoStoc Carnostin 177 NR 040811 Leticonostoc gasicomitatin 179 FN822744 Leticonostoc inhae 180 NR 025.204 Leuconostockinchi 181 NR 075O14 Edwardsielia tarda 777 CPOO2154 Photorhabdus asymbiotica 466 Z76752 Psychrobacter arcticus 607 CPOOOO82 Psychrobacter cibarius 608 HQ698586 Psychrobacter cryohaiolentis 609 CPOOO323 Psychrobacter faecalis 610 HQ698566 Psychrobacter nivimaris 611 HQ698587 Psychrobacter pulmonis 612 HQ698.582 Pseudomonas aeruginosa 592 AABQ07000001 Pseudomonas sp. 2. 1 26 600 ACWUO1 OOO257 US 2016/0158294 A1 Jun. 9, 2016 47

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Corynebacterium confusum 691 S886 58 Corynebacterium propinquin 712 R 037038 58 Corynebacterium pseudodiphtheriticum 713 84258 58 Bartonella baciliiformis 338 C 008783 59 Bartonella grahamii 339 POO1562 59 Bartoneia henseiae 340 C OO5956 59 Bartonelia quintana 341 X8977OO 59 Bartoneia tanniae 342 F672728 59 Bartoneia washoensis 343 719017 59 Bruceiia abortus 430 CBO1OOOO75 59 Category-B Bruceiia canis 431 R 044652 59 Category-B Bruceiia ceti 432 CJDO1 OOOOO6 59 Category-B Bruceiia neitensis 433 EOO9462 59 Category-B Bruceiia microti 434 R 042549 59 Category-B Bruceiia ovis 435 C OO9504 59 Category-B Brucella sp. 83 13 436 CBQ01000040 59 Category-B Brucella sp. BO1 437 UO532O7 59 Category-B Bruceiia Suis 438 ACBKO1 OOOO34 59 Category-B Ochrobactrum anthropi 360 NC 009667 59 Ochrobactrum intermedium 361 ACQAO1000001 59 Ochrobactrum pseudintermedium 362 DQ365921 59 Prevoteila genomosp. C2 496 AY278625 64 Prevoteia multisaccharivorax 509 FJEO1OOOO16 64 Prevoteia sp. oral clone IDR CEC 0055 543 Y55.0997 64 Prevoteia sp. oral taxon 292 547 Q422735 64 Prevoteia sp. oral taxon 300 549 U4O9549 64 Prevoteia marshii 505 EEIO1OOOO70 66 Prevoteia sp. oral clone IKO53 544 Y3494O1 66 Prevoteia sp. oral taxon 781 554 Q422744 66 Prevoteia sterCorea S62 B244774 66 Prevoteia brevis 487 R 041954 67 Prevoteia ruminicoia S16 POO2006 67 Prevoteila sp. sp24 S60 BOO3384 67 Prevoteila sp. sp34 S61 BOO338S 67 Prevoteia aibensis 483 R O25300 68 Prevoteila copri 490 CBXO2OOOO14 68 Prevoteia ottiorum S14 6472 68 Prevoteia sp. BI 42 S18 S81354 68 Prevoieia sp. oral clone P4PB 83 P2 S46 Y2O7050 68 Prevoteia sp. oral taxon G60 557 U4321.33 68 Prevoteia annii 484 B547670 69 Bacteroides caccae 268 U1366.86 70 Bacteroides finegoidii 277 B222699 70 Bacteroides intestinais 283 BLO2OOOOO6 71 Bacteroides sp. XB44A 326 M230649 71 Bifidobacteriaceae genomosp. C1 345 Y278612 72 Bifidobacterium adolescentis 346 AAXDO2OOOO18 72 Bifidobacterium angulatum 347 BYSO2OOOOO4 72 Bifidobacterium animalis 348 POO1606 72 Bifidobacterium breve 350 POO2743 72 Bifidobacterium catenulatum 351 BXYO1 OOOO19 72 Bifidobacterium dentium 352 POO1750 72 Bifidobacterium gallicum 353 BXBO3OOOOO4 72 Bifidobacterium infantis 3S4 Y151398 72 Bifidobacterium kashiwanohense 355 B491757 72 Bifidobacterium longum 356 BQQ01000041 72 Bifidobacterium pseudocatentiatin 357 BXXO2OOOOO2 72 Bifidobacterium pseudolongtim 358 R 043442 72 Bifidobacterium scardovii 359 3.07.005 72 Bifidobacterium sp. HM2 360 B42S276 72 Bifidobacterium sp. HMLN12 361 F519685 72 Bifidobacterium sp. M45 362 M626176 72 Bifidobacterium sp. MSX5B 363 Q616382 72 Bifidobacterium sp. TM 7 364 B218.972 72 Bifidobacterium thermophilum 365 Q340557 72 LeticonoStoc Citretin 11.78 M1574.44 75 Leticonostoc lactis 1182 R 040823 75 Alicyclobacilius acidoterrestris 123 R 040844 79 Alicyclobacilius cycloheptanicus 125 R 024754 79 Acinetobacter battmannii 27 CYQ01000014 81 Acinetobacter Caicoaceticus 28 M157426 81 Acinetobacter genomosp. C1 29 Y278.636 81 Acinetobacter haemolyticus 30 DMTO1 OOOO17 81 Acinetobacter johnsonii 31 ACPLO1OOO162 81 US 2016/0158294 A1 Jun. 9, 2016 48

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Acinetobacteriinii 32 ACPMO1(OOO13S Acinetobacter twofi 33 ACPNO1 OOO2O4 Acinetobacter parvus 34 AIEBO1 OOO124 Acinetobacterschindleri 36 NR O25412 Acinetobacter sp. 56A1 37 GQ178049 Acinetobacter sp. CIP 101934 38 JQ638573 Acinetobacter sp. CIP 102143 39 JQ638578 Acinetobacter sp. M16 22 41 HM366447 Acinetobacter sp. RUH2624 42 ACQFO1000094 Acinetobacter sp. SH024 43 DCHO1 OOOO68 Lactobacilitisiensenii O92 CQD01000066 Alcaligenes faecalis 119 B68O368 Alcaligenes sp. CO14 120 Q643040 Alcaligenes sp. S3 121 Q262549 Oigella ureolytica 366 R 041998 Oigella urethralis 367 R 041753 Eikeneia corrodens 784 CEAO1OOOO28 Kingeila denitrificans O19 EWVO1OOOO47 Kingeila genomosp. P1 oral cone MB2 C20 O20 Q003616 Kingeila kingae O21 FHSO1OOOO73 Kingeila oralis O22 CWO2OOOOOS Kingeila sp. oral clone ID059 O23 Y3 4 9 3 8 1 Neisseria elongata 330 DBFO1 OOOOO3 Neisseria genomosp. P2 oral clone MB5 P15 332 Q003630 Neisseria sp. oral clone JC012 345 34 9 3 8 8 Neisseria sp. SMC A9199 342 763637 Simonsieia matelieri 731 DCYO1OOO105 Corynebacterium glucuronolyticum 700 BYPO1 OOOO81 Corynebacterium pyruviciproducens 716 185225 Rothia aeria 649 Q673320 Rothia dentocariosa 6SO DDWO1 OOOO24 Rothia sp. oral taxon 188 653 J470892 Corynebacterium accolens 681 CGDO1OOOO48 Corynebacterium macginleyi 707 B3593.93 Corynebacterium pseudogenitalium 714 BYQ01000237 Corynebacterium tuberculostearicum 729 CVPO1 OOOOO9 Lactobacilius casei 1074 POOO423 Lactobacilius paracasei 1106 BQVO1000067 Lactobacilius zeae 1143 R 037122 Prevoteia denia is 1492 BS47678 Prevoteila sp. oral clone ASCG10 1529 AY923148 Prevoteila sp. oral clone HF050 1541 AY349399 Prevoteila sp. oral clone ID019 1542 AY3494.OO Prevoteila sp. oral clone IK062 1545 AY3494O2 Prevoteila genomosp. P9 oral clone MB7 G16 1499 DQ003633 Prevoteila sp. oral clone AU069 1531 AYOOSO62 Prevoteila sp. oral clone CY006 1532 AYOOSO63 Prevoteila sp. oral clone FLO19 1534 AY349392 Actinomyces genomosp. C1 56 AY27861O Actinomyces genomosp. C2 57 AY278611 Actinomyces genomosp. P1 oral clone MB6 C03 58 DQ003632 Actinomyces georgiae 59 GUS 61319 Actinomyces israeli 60 AF47927O Actinomyces massiliensis 61 ABS45934 Actinomyces meyeri 62 GUS 61321 Actinomyces Odontolyticits 66 ACYTO1OOO123 Actinomyces orihominis 68 AJS751.86 Actinomyces sp. CCUG 37290 71 A234058 Actinomyces sp. ICM34 75 HQ616391 Actinomyces sp. ICM41 76 HQ616392 Actinomyces sp. ICM47 77 HQ616395 Actinomyces sp. ICM54 78 HQ616398 Actinomyces sp. oral clone IP081 87 AY349366 Actinomyces sp. oral taxon 178 91 AEUHO1 OOOO60 Actinomyces sp. oral taxon 180 92 AEPPO1OOOO41 Actinomyces sp. TeS 8O GUS 61315 Haematobacter sp. BC14248 968 GU396991 Paracoccus denitrificans 1424 CPOOO490 Paracoccus marchisi 1425 NR 044922 Grimonia hoisae 967 ADAQ01000013 Shewanelia puttrefaciens 1723 CPOO2457 Afipia genomosp. 4 111 EU117385 Rhodopseudomonas palustris 1626 CPOOO3O1 Methyliobacterium extorquens 1223 NC 01.0172 US 2016/0158294 A1 Jun. 9, 2016 49

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Methyliobacterium podarium 1224 AY468.363 e 218 Methyliobacterium radiotolerans 122S GU294320 e 218 Methyliobacterium sp. 1Sub 1226 AY468371 e 218 Methyliobacterium sp. MM4 1227 AY468370 e 218 Achromobacter denitrificans 18 NR 042021 e 224 Achromobacter piechaudii 19 ADMSO1OOO149 e 224 Achromobacter xylosoxidans 2O ACRCO1OOOO72 e 224 Bordeteila bronchiseptica 384 NR 025949 e 224 Bordeteia hoinnesii 385 AB6831.87 e 224 Bordeteila parapertissis 386 NR 025950 e 224 Bordeteila pertissis 387 BX64O418 e 224 Microbacterium chocolatum 230 NR 037045 e 225 Microbacterium flavescens 231 EU714363 e 225 Microbacterium iacticum 233 EU714351 e 225 Microbacterium oieivorans 234 EU714381 e 225 Microbacterium oxydans 23S EU714348 e 225 Microbacterium paraOxydans 236 A491806 e 225 Microbacterium phyllosphaerae 237 EU714359 e 225 Microbacterium Schleiferi 238 NR 044936 e 225 Microbacterium sp. 768 239 EU714378 e 225 Microbacterium sp. oral strain C24KA 240 AF287752 e 225 Microbacterium testaceum 241 EU71436S e 225 Corynebacterium atypictim 686 NR 025540 e 229 Corynebacterium mastitidis 708 AB359395 e 229 Corynebacterium sp. NML 97 0186 72S GU2384.11 e 229 Mycobacterium elephantis 275 AF3.85898 e 237 Mycobacterium paraterrae 288 EU919229 e 237 Mycobacteriumphlei 289 GU142920 e 237 Mycobacterium sp. 1776 2.93 EU703152 e 237 Mycobacterium sp. 1781 294 EU703147 e 237 Mycobacterium sp. AQ1GA4 297 HM210417 e 237 Mycobacterium sp. GN 10546 299 FJ497243 e 237 Mycobacterium sp. GN 10827 300 FJ497247 e 237 Mycobacterium sp. GN 11124 301 F652846 e 237 Mycobacterium sp. GN 918.8 302 FJ497240 e 237 Mycobacterium sp. GR 2007 210 3O3 FJS55.538 e 237 Anoxybacilius contaminans 172 NR 029006 e 238 Bacilius aeolitis 195 NR 025557 e 238 Brevibacterium frigoritolerans 422 NR 042639 e 238 Geobacilius sp. E263 934 DQ647387 e 238 Geobacillus sp. WCH70 935 CPOO1638 e 238 Geobacilius thermocatentiaius 937 NR 043020 e 238 Geobacilius thermoleovorans 940 NR 074931 e 238 Lysinibacilius fusiformis 192 FN397522 e 238 Pianonicrobium koreense 468 NR 025O11 e 238 Sporosarcina newyorkensis 754 AFPZO1OOO142 e 238 Sporosarcina sp. 2681 7SS GU994081 e 238 Ureibacilius composti 968 NR 043746 e 238 Ureibacilius Suwonensis 969 NR 043232 e 238 Ureibacilius terrents 970 NR 025394 e 238 Ureibacilius thermophilus 971 NR 043747 e 238 Ureibacilius thermosphaericus 972 NR 040961 e 238 Prevoteia micans SO7 AGWKO1OOOO61 e 239 Prevoteila sp. oral clone DAO58 533 AYOO5065 e 239 Prevotella sp. SEQ053 S23 JN867222 e 239 Treponema Socranski 937 NR 024868 e 240 Treponema sp. 6:H:D15A 4 938 AYOOSO83 e 240 Treponema sp. oral taxon 265 953 GU4088SO e 240 Treponema sp. oral taxon G85 958 GU432215 e 240 Porphyromonas endodontalis 472 ACNNO1OOOO21 e 241 Porphyromonas sp. oral clone BB134 478 AYOOSO68 e 241 Porphyromonas sp. oral clone FO16 479 AYOOSO69 e 241 Porphyromonas sp. oral clone P2PB 52 P1 480 AY2O7054 e 241 Porphyromonas sp. oral clone P4GB 100 P2 481 AY2O7.057 e 241 Acidovorax sp. 98 63833 26 AY2S806S e 245 Comamonadaceae bacterium NML000135 663 JN5853.35 e 245 Comamonadaceae bacterium NML790751 664 JNS85331 e 245 Comamonadaceae bacterium NML910035 665 JN585332 e 245 Comamonadaceae bacterium NML910036 666 JNS85333 e 245 Comamonas sp. NSP5 668 ABO76850 e 245 Delfia acidovorans 748 CPOOO884 e 245 Xenophilus aeroiatus 2018 JNS85329 e 245 Oribacterium sp. oral taxon 078 1380 ACIQ02000009 e 246 Oribacterium sp. oral taxon 102 1381 GQ422713 e 246 US 2016/0158294 A1 Jun. 9, 2016 50

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Weisseiia cibaria 2007 NR 036924 clade 247 N N Weissella confusa 2008 NR 040816 clade 247 N N Weisseia heienica 2009 AB680902 clade 247 N N Weisseila kandieri 2010 NR 044659 clade 247 N N Weisseiia koreensis 2011 NR 075058 clade 247 N N Weissella paramesenteroides 2012 ACKUO1000017 clade 247 N N Weissella sp. KLDS 7.0701 2013 EU600924 clade 247 N N Mobiluncus curtisii 1251. AEPZO1000013 clade 249 N N Enhydrobacter aerosaccus 785 ACYIO1000081 clade 256 N. N Moraxeia Osiloensis 1262 JN17S341 clade 256 N. N Moraxella sp. GM2 1264 F837191 clade 256 N. N Brevibacterium casei 42O JF951998 clade 257 N N Brevibacterium epidermidis 421 NR 029262 clade 257 N N Brevibacterium sanguinis 426 NR 028O16 clade 257 N N Brevibacterium sp. H15 427 AB177640 clade 257 N N Acinetobacter radioresistens 35 ACVRO1000010 clade 261 N N Lactobacilius aimentarius O68 NR 044701 clade 263 N N Lactobacilius farciminis O82 NR 044707 clade 263 N N Lactobacilius kimchii O97 NR O25045 clade 263 N N Lactobacilius nodensis 101 NR 041629 clade 263 N N Lactobacilius tucceti 138 NR 042194 clade 263 N N Pseudomonas mendocina 595 AAULO1000021 clade 265 N N Pseudomonas pseudoalcaligenes 598 NR 037000 clade 265 N N Pseudomonas sp. NP522b 602 EU723211 clade 265 N N Pseudomonas Stutzeri 603 AM905854 clade 265 N N Paenibacilius barcinonensis 390 NR 042272 clade 270 N N Paenibacilius barengoitzi 391 NR 042756 clade 270 N N Paenibacilius chibensis 392 NR 04.0885 clade 270 N N Paenibacilius cooki 393 NR 025372 clade 270 N N Paenibacilius durus 394 NR 037017 clade 270 N N Paenibacillus glucanolyticus 395 D78470 clade 270 N N Paenibacilius iactis 396 NR 025739 clade 270 N N Paenibacilius pabuli 398 NR 040853 clade 270 N N Paenibacilius popilliae 400 NR 040888 clade 270 N N Paenibacillus sp. CIP 101062 401 HM212646 clade 270 N N Paenibacilius sp. JC66 404 JF824.808 clade 270 N N Paenibacilius sp. R 27413 40S HES86333 clade 270 N N Paenibacilius sp. R 27422 406 HES86.338 clade 270 N N Paenibacilius timonensis 408 NR 042844 clade 270 N N Rothia mucilaginosa 651 ACVOO1000020 clade 271 N N Rothia nasimurium 652 NR 025310 clade 271 N N Prevoteila sp. oral taxon 302 550 ACZKO1000043 clade 280 N N Prevoteila sp. oral taxon F68 SS6 HMO99652 clade 280 N N Prevoteia tannerae S63 ACIJO2OOOO18 clade 280 N N Prevotellaceae bacterium P4P 62 P1 566 AY207061 clade 280 N N Porphyromonas asaccharolytica 471 AENOO1000048 clade 281 N N Porphyromonas gingivais 473 AEO15924 clade 281 N N Porphyromonas macacae 475 NR 025908 clade 281 N N Porphyromonas sp. UQD 301 477 EUO12301 clade 281 N N Porphyromonas uenonis 482 ACLRO1000152 clade 281 N N Leptotrichia buccalis 16S CPOO1685 clade 282 N N Leptotrichia hofstadii 168 ACVB02000032 clade 282 N N Leptotrichia sp. oral clone HE012 173 AY349386 clade 282 N N Leptotrichia sp. oral taxon 223 176 GU408547 clade 282 N N Bacteroides fitivus 278 AFBNO1000029 clade 285 N N Bacteroides helicogenes 281 CPOO2352 clade 285 N N Parabacteroides johnsonii 419 ABYHO1000014 clade 286 N N Parabacteroides merdae 420 EU136685 clade 286 N N Treponema denticola 926 ADECO1000002 clade 288 N OP Treponema genomosp. P5 oral clone MB3 P23 929 DQ003624 clade 288 N N Treponema pittidum 935 AJS43428 clade 288 N OP Treponema sp. oral clone P2PB 53 P3 942 AY2O7055 clade 288 N N Treponema sp. oral taxon 247 949 GU408748 clade 288 N N Treponema sp. oral taxon 250 950 GU408776 clade 288 N N Treponema sp. oral taxon 251 951 GU408781 clade 288 N N Anaerococciis hydrogenais 144 ABXAO1000039 clade 289 N N Anaerococcus sp. 84.04299 148 HMS873.18 clade 289 N N Anaerococci is sp. gpac215 1S6 AM176540 clade 289 N N Anaerococcits vaginalis 158 ACXUO1000016 clade 289 N N Propionibacterium acidipropionici 1569 NC 019395 clade 290 N N Propionibacterium avidium 1571 AJOO3OSS clade 290 N N Propionibacterium granulosum 1573 FJT85716 clade 290 N N Propionibacterium jensenii 1574 NR 042269 clade 290 N N Propionibacterium propionicum 1575 NR 025.277 clade 290 N N US 2016/0158294 A1 Jun. 9, 2016 51

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Propionibacterium sp. H456 1577 AB177643 Propionibacterium thoenii 1581 NR 042270 Bifidobacterium bifidum 349 ABQPO1000027 Leticonostoc mesenteroides 1183 ACKVO1OOO113 Leticonostoc pseudomesenteroides 1184 NR 040814 Johnsonella ignava 1016 X871S2 Propionibacterium acnes 1570 ADMO1(OOOO10 Propionibacterium sp. 434 HC2 1576 AFILO1 OOOO3S Propionibacterium sp. LG 1578 AY354921 Propionibacterium sp. S555a 1579 AB264622 Alicyclobacillus sp. CCUG 53.762 128 HE613268 Actinomyces cardiffensis S3 GU470888 Actinomyces finkei 55 HQ906497 Actinomyces sp. HKU31 74 HQ335393 Actinomyces sp. oral taxon C55 94 HMO99646 Kerstersia gyiornim 1018 NR 025669 Pigmentiphaga daeguiensis 1467 JN585327 Aeromonas allosaccharophila 104 S39232 Aeromonas enteropelogenes 1 OS X71121 Aeromonas hydrophila 106 NC 008570 Aeromonasiandaei 107 X60413 Aeromonas Salmonicida 108 NC 009348 Aeromonastroia 109 X60415 Aeromonas Veronii 110 NR 044845 Marvinbryantia formatexigens 196 AJSOS973 Rhodobacter sp. oral taxon C30 62O HMO9964.8 Rhodobacter sphaeroides 621 CPOOO144 Lactobacilius aniri O71 ACLLO1 OOOO37 Lactobacilius coieohominis O76 ACOHO1OOOO3O Lactobacilius fermentum O83 CPOO2O33 Lactobacillus gastricus O8S AICNO1OOOO60 Lactobacilius mucosae O99 FR693800 Lactobacilius oris O3 AEKLO1 OOOO77 Lactobacilius pontis 11 HM21842O Lactobacilius rentieri 12 ACGWO2OOOO12 Lactobacilius sp. KLDS 1.0707 27 EU600911 Lactobacilius sp. KLDS 1.0709 28 EU6OO913 Lactobacilius sp. KLDS 1.0711 29 EU6OO915 Lactobacilius sp. KLDS 1.0713 31 EU600917 Lactobacilius sp. KLDS 1.0716 32 EU600921 Lactobacilius sp. KLDS 1.0718 33 EU6OO922 Lactobacilius sp. oral taxon 052 37 GQ422710 Lactobacilius vaginalis 40 ACGVO1OOO168 Brevibacterium aurantiacum 419 NR 044854 Brevibacterium inens 423 AJ315491 Lactobacilius peniosits O8 JN813103 Lactobacilius plantarum 10 ACGZO2OOOO33 Lactobacilius sp. KLDS 1.0702 23 EU6OO906 Lactobacilius sp. KLDS 1.0703 24 EU600907 Lactobacilius sp. KLDS 1.0704 2S EU600908 Lactobacilius sp. KLDS 1.0705 26 EU600909 Agrobacterium radiobacter 1S CPOOO628 Agrobacterium timefaciens 16 AJ389893 Corynebacterium argentoratense 685 EF463OSS Corynebacterium diphtheriae 693 NC OO2935 Corynebacterium pseudotuberculosis 715 NR 037070 Corynebacterium renale 717 NR 037069 Corynebacterium ulcerans 731 NR 074,467 Aurantimonas coralicida 191 AYO65627 Aireimonas aitamirensis 192 FN658986 Lactobacilius acidipiscis 1066 NR 024718 2 Lactobacilius Saivarius 1117 AEBAO1OOO145 Lactobacilius sp. KLDS 1.0719 1134 EU600923 s : g Lactobacilius butchneri 1073 ACGHO1OOO101 e 321 Lactobacilius genomosp. C1 1086 AY278619 e 321 Lactobacilius genomosp. C2 1087 AY27862O e 321 Lactobacilius hilgardii 1089 ACGPO1 OOO2OO e 321 Lactobacilius kefiri 1096 NR 04223O e 321 Lactobacilius parabuchneri 1105 NR 041294 e 321 Lactobacilius parakefiri 1107 NR 029039 e 321 Lactobacilius curvatus 1079 NR 042437 e 322 Lactobacilius Sakei 1116 DQ989236 e 322 Aneurinibacilius aneurinilyticus 167 AB101592 e 323 Aneurinibacilius danicus 168 NR 028657 e 323 US 2016/0158294 A1 Jun. 9, 2016 52

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Anetirinibacilius migilantis 169 NR 036799 e 323 N Aneurinibacilius terranovensis 170 NR 042271 e 323 N Staphylococcusatiretts 757 CPOO2643 e 325 Category-B Staphylococcusatiricularis 758 JQ624774 e 325 Staphylococci is capitis 759 ACFRO1 OOOO29 e 325 Staphylococci is caprae 760 ACRHO1 OOOO33 e 325 Staphylococci is carnostis 761 NR 075 003 e 325 Staphylococcus cohnii 762 JN175375 e 325 Staphylococcus condimenti 763 NR 029345 e 325 Staphylococci is epidermidis 764 ACHEO1OOOOS6 e 325 Staphylococci is equtorum 765 NR 02752O e 325 Staphylococciis haemolyticus 767 NC 0071.68 e 325 Staphylococcus hominis 768 AM157418 e 325 Staphylococci is lugdunensis 769 AEQAO1000024 e 325 Staphylococci is pastetiri 770 FJ189773 e 325 Staphylococci is pseudintermedius 771 CPOO2439 e 325 Staphylococci is saccharolyticus 772 NR 029158 e 325 Staphylococci is saprophyticus 773 NC 007350 e 325 Staphylococci is sp. clone bottae7 777 AF467424 e 325 Staphylococcus sp. H292 775 AB177642 e 325 Staphylococcus sp. H780 776 AB177644 e 325 Staphylococci is succinus 778 NR 028667 e 325 Staphylococciis warneri 780 ACPZO1OOOOO9 e 325 Staphylococci is xylost is 781 AY395O16 e 325 Cardiobacterium hominis 490 ACKYO1OOOO36 e 326 Cardiobacterium vaivarum 491 NR 028847 e 326 Pseudomonas fittorescens 593 AY622220 e 326 Pseudomonas gessardi 594 FJ943496 e 326 Pseudomonas monteii 596 NR 024910 e 326 Pseudomonas poae 597 GU188951 e 326 Pseudomonas putida 599 AFO94741 e 326 Pseudomonas sp. G1229 601 DQ910482 e 326 Pseudomonastoiaasi 604 AF320988 e 326 Pseudomonas viridifiava 605 NR 042764 e 326 Listeria gravi 185 ACCRO2OOOOO3 e 328 Listeria innoctia 186 JF96.7625 e 328 Listeria ivanovii 187 X56151 e 328 Listeria monocytogenes 188 CPOO2003 e 328 Cat e 9. O ry B Listeria weishineri 189 AM2631.98 e 328 Capnocytophaga sp. oral clone ASCH05 484 AY923149 e 333 Capnocytophaga splitigena 489 ABZVO1OOOOS4 e 333 Leptotrichia genomosp. C1 166 AY278621 e 334 Leptotrichia Shahi 169 AYO29806 e 334 Leptotrichia sp. neutropenicPatient 170 AF189244 e 334 Leptotrichia sp. oral clone GTO18 171 AY349384 e 334 Leptotrichia sp. oral clone GTO20 172 AY349385 e 334 Bacteroides sp. 20 3 296 ACROO1000064 e 335 Bacteroides sp. 3 1. 19 307 ADCJO1 OOOO62 e 335 Bacteroides sp. 3 2 5 311 ACIBO1OOOO79 e 335 Parabacteroides distasonis 416 CPOOO140 e 335 Parabacteroides goldsteinii 417 AY974O70 e 335 Parabacteroides gordonii 418 AB470344 e 335 Parabacteroides sp. D13 421 ACPWO1 OOOO17 e 335 Capnocytophaga genomosp. C1 477 AY278613 e 336 Capnocytophaga ochracea 480 AEOHO1 OOOOS4 e 336 Capnocytophaga sp. GEJ8 481 GUS 61335 e 336 Capnocytophaga sp. oral strain A47ROY 486 AYOOSO77 e 336 Capnocytophaga sp. S1b 482 U42009 e 336 Paraprevoteila clara 1426 AFFYO1OOOO68 e 336 Bacteroides heparinolyticus 282 JN867284 e 338 Prevoteila heparinolytica 1500 GQ422742 e 338 Treponema genomosp. P4 oral clone MB2 G19 1928 DQ003618 e 339 Treponema genomosp. P6 oral clone MB4 G11 1930 DQ003625 e 339 Treponema sp. oral taxon 254 1952 GU408803 e 339 Treponema sp. oral taxon 508 1956 GU413616 e 339 Treponema sp. oral taxon 518 1957 GU413640 e 339 Chlamydia muridarum SO2 AEOO2160 e 341 OP Chlamydia trachomatis SO4 U68443 e 341 OP Chlamydia psittaci 503 NR 036864 e 342 Category-B Chlamydophila pneumoniae 509 NC 002179 e 342 OP Chlamydophila psittaci 510 D85712 e 342 OP Anaerococci is Octavius 146 NR 026360 e 343 N Anaerococcus sp. 8405254 149 HMS87319 e 343 N Anaerococcus sp. 9401487 150 HMS87322 e 343 N US 2016/0158294 A1 Jun. 9, 2016 53

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Anaerococcus sp. 9403502 151 HM5873.25 e 343 Gardnerella vaginalis 923 CPOO1849 e 344 Campylobacter lari 466 CPOOO932 e 346 P Anaerobiospiriliim Sticciniciproducers 142 NR 026075 e 347 Anaerobiospirilium thomasii 143 A420985 e 347 Ruminobacter amylophilus 1654 NR O2645O e 347 Sticcinatimonas hippei 1897 AEVOO1 OOOO27 e 347 Actinomyces europaeus S4 NR 026363 e 348 Actinomyces sp. oral clone GU009 82 AY349361 e 348 Moraxeiia caiarrhais 1260 CPOO2005 e 349 Moraxeia incoini 1261 FR822735 e 349 Moraxella sp. 16285 1263 JF682466 e 349 Psychrobactersp. 13983 1613 HM2126.68 e 349 Actinobacilium massiae 49 AF487679 e 350 Actinobaculum Schaaiii 50 AY957507 e 350 Actinobaculum sp. BMH 101342 51 AY282578 e 350 Actinobaculum sp. P2P 19 P1 52 AY2O7066 e 350 Actinomyces sp. oral clone IO076 84 AY349363 e 350 Actinomyces sp. oral taxon 848 93 ACUYO1OOOO72 e 350 Actinomyces netiii 65 X71862 e 352 Mobiluncus mutieris 252 ACKWO1 OOOO3S e 352 Biastomonas natatoria 372 NR 040824 e 356 Novosphingobium aromaticivorans 357 AAAVO3OOOOO8 e 356 Sphingomonas sp. oral clone FIO12 745 AY3494.11 e 356 Sphingopyxis alaskensis 749 CPOOO356 e 356 Oxalobacter formigenes 389 ACDQ01000020 e 357 Veillonella atypica 974 AEDSO1 OOOOS9 e 358 Veillonella dispar 975 ACIKO2OOOO21 e 358 Veillonella genomosp. P1 oral clone MB5 P17 976 DQ003631 e 358 Veillonella parvula 978 ADFUO1OOOOO9 e 358 Veillonella sp. 3 1. 44 979 ADCVO1 OOOO19 e 358 Veillonella sp. 6 1 27 98O ADCWO1 OOOO16 e 358 Veillonella sp. ACP1 981 HQ616359 e 358 Veillonella sp. AS16 982 HQ616365 e 358 Veillonella sp. BS32b 983 HQ616368 e 358 Veillonella sp. ICM51a. 984 HQ616396 e 358 Veillonella sp. MSA12 985 HQ616381 e 358 Veillonella sp. NVG 100cf 986 EF108443 e 358 Veillonella sp. OK11 987 JN6956SO e 358 Veillonella sp. oral clone ASCGO1 990 AY923.144 e 358 Veillonella sp. oral clone ASCG02 991 AY95.3257 e 358 Veillonella sp. oral clone OH1A 992 AY947495 e 358 Veillonella sp. oral taxon 158 993 ENUO1 OOOOO7 e 358 Kochiria marina O40 Q260086 e 365 Kocuria rhizophila O42 YO3O315 e 365 Kochiria rosea O43 87756 e 365 Kochiria varians O44 FS42O74 e 365 Clostridiaceae bacterium END 2 531 F451053 e 368 Micrococci is antarcticus 242 R O25285 e 371 Micrococcus luteus 243 R O75062 e 371 Micrococcus liviae 244 R 026.200 e 371 Micrococcus sp. 185 245 714334 e 371 Lactobacilius brevis O72 U194349 e 372 Lactobacilius parabrevis 104 R 042456 e 372 Pediococcus acidiactici 436 CXBO1 OOOO26 e 372 Pediococcuspentosaceus 437 R O75052 e 372 Lactobacilius dextrinicus O81 R 036861 e 373 Lactobacilius peroiens 109 R 029360 e 373 Lactobacilius rhamnostis 113 BWJO1OOOO68 e 373 Lactobacilius Saniviri 118 B6O2S69 e 373 Lactobacilius sp. BT6 121 Q616370 e 373 Mycobacterium mageritense 282 R798914 e 374 Mycobacterium neoaurum 286 F268445 e 374 Mycobacterium smegmatis 291 POOO480 e 374 Mycobacterium sp. HE5 304 O12738 e 374 Dysgonomonasgadei 775 DLVO1 OOOOO1 e 377 Dysgonomonas mossi 776 DLWO1OOOO23 e 377 Porphyromonas levi 474 R O25907 e 377 Porphyromonas somerae 476 BS476.67 e 377 Bacteroides barnesiae 267 R 041446 e 378 Bacteroides coprocola 272 BIYO2OOOOSO e 378 Bacteroides coprophilus 273 CBWO1OOOO12 e 378 Bacteroides doei 274 BWZO1 OOOO93 e 378 Bacteroides massiliensis 284 B2OO226 e 378 US 2016/0158294 A1 Jun. 9, 2016 54

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bacteroides plebeius 289 AB20O218 e 378 Bacteroides sp. 3 1 33FAA 309 ACPSO1 OOOO85 e 378 Bacteroides sp. 3 1. 40A 310 ACRTO1 OOO136 e 378 Bacteroides sp. 4 3 47FAA 313 ACDRO2OOOO29 e 378 Bacteroides sp. 9 1 42FAA 314 ACAAO1OOOO96 e 378 Bacteroides sp. NB 8 323 AB11756S e 378 Bacteroides vulgatus 331 CPOOO139 e 378 Bacteroides ovatus 287 ACWHO1 OOOO36 e 38 Bacteroides sp. 1 1 30 294 ADCLO1OOO128 e 38 Bacteroides sp. 2 1 22 297 ACPQ01000117 e 38 Bacteroides sp. 2 2 4 299 ABZZO1 OOO168 e 38 Bacteroides sp. 3 1. 23 308 ACRSO1 OOOO81 e 38 Bacteroides sp. D1 318 ACABO2OOOO3O e 38 Bacteroides sp. D2 321 ACGAO1OOOO77 e 38 Bacteroides sp. D22 320 ADCKO1 OOO151 e 38 Bacteroides xvianisolvens 332 ADKPO1OOOO87 e 38 Treponema lecithinolyticum 1931 NR 026247 e 380 Treponema parvin 1933 AF3O2937 e 380 Treponema sp. oral clone JUO25 1940 AY3494.17 e 380 Treponema sp. oral taxon 270 1954 GQ422733 e 380 Parascardovia denticoiens 1428 ADEBO1OOOO20 e 381 Scardovia inopinata 1688 ABO29087 e 381 Scardovia wiggsiae 1689 AY278626 e 381 Clostridiales bacterium 9400853 533 HM58732O e 384 Mogibacterium diversum 1254 NR 027191 e 384 Mogibacterium neglectin 1255 NR 0272O3 e 384 Mogibacterium pumilum 1256 NR 028.608 e 384 Mogibacterium timidium 1257 Z36296 e 384 Borrelia burgdorferi 389 ABGIO1OOOOO1 e 386 Borrelia garinii 392 ABVO1 OOOOO1 e 386 Borrelia sp. NE49 397 AJ224142 e 386 Caidinonas manganoxidans 457 NR 040787 e 387 Comamonadaceae bacterium oral taxon F47 667 HMO99651 e 387 Lautropia mirabilis 149 AEQPO1000026 e 387 Lautropia sp. oral clone AP009 1SO AYOOSO3O e 387 Peptoniphilus asaccharolyticus 441 D14145 e 389 Peptoniphilus duerdenii 442 EUS2629O e 389 Peptoniphilus harei 443 NR 026358 e 389 Peptoniphilus indolicus 444 AY153431 e 389 Peptoniphilus lacrimalis 446 ADDOO1OOOOSO e 389 Peptoniphilus sp. gpac077 450 AM176527 e 389 Peptoniphilus sp. JC140 447 JF824.803 e 389 Peptoniphilus sp. oral taxon 386 452 ADCSO1 OOOO31 e 389 Peptoniphilus sp. oral taxon 836 453 AEAAO1OOOO90 e 389 Peptostreptococcaceae bacteriumph 1 454 N837.495 e 389 Dialister pneumosinies 765 HM596.297 e 390 Dialister sp. oral taxon 502 767 GQ422739 e 390 Cupriavidus metallidurans 741, GU23O889 e 391 Herbaspirillum seropedicae OO1 CPOO2O39 e 391 Herbaspirillum sp. JC206 OO2 JN657219 e 391 Janthinobacterium sp. SY12 O15 EF455530 e 391 Massilia sp. CCUG 43427A 197 FR773700 e 391 Ralstonia picketti 615 NC 01.0682 e 391 Ralstonia sp. 5. 7 47FAA 616 ACUFO1 OOOO76 e 391 Franciselia novicida 889 ABSSO1 OOOOO2 e 392 Francisella philomiragia 890 AY928.394 e 392 Franciselia initiatensis 891 ABAZO1OOOO82 e 392 ategory-A Ignatzschineria indica O09 HQ823562 e 392 Ignatzschineria sp. NML 95 0260 010 HQ823.559 e 392 Streptococci is mutans 814 APO106SS e 394 Lactobacilitisgasseri O84 ACOZO1OOOO18 e 398 Lactobacilius hominis O90 FR681902 e 398 Lactobacilius iners O91 AEKO1OOOOO2 e 398 Lactobacilius johnsonii O93 AEO171.98 e 398 Lactobacilius senioris 119 AB6O2S70 e 398 Lactobacilius sp. oral clone HT002 135 AY349.382 e 398 Weisseia beninensis 2006 EU439435 e 398 Sphingomonas echinoides 744 NR 0247OO e 399 Sphingomonas sp. oral taxon A09 747 HMO99639 e 399 Sphingomonas sp. oral taxon F71 748 HMO99645 e 399 Zymomonas mobilis 2032 NR 074274 e 399 Arcanobacterium haemolyticum 174 NR 025347 e 400 Arcanobacterium pyogenes 175 GU585578 e 400 Trieperella pyogenes 962 NR 044858 e 400 US 2016/0158294 A1 Jun. 9, 2016 55

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Lactococci is garvieae 1144 AFO 61005 Lactococci is lactis 1145 CPOO236S Brevibacterium mchreineri 424 ADNUO1OOOO76 Brevibacterium paucivorans 425 EUO86796 Brevibacterium sp. JC43 428 JF824.806 Seienomonas artemidis 1692 HMS96274 Selenomonas sp. FOBRC9 1704 HQ616378 Selenomonas sp. oral taxon 137 171S AENVO1 OOOOO7 Desmospora activa 751 AM940019 Desmospora sp. 8437 752 AFHTO1 OOO143 Paenibacilius sp. oral taxon F45 1407 HMO99647 Corynebacterium ammoniagenes 682 ADNSO1OOOO11 Corynebacterium aurimucosum 687 ACLHO1OOOO41 Corynebacterium bovis 688 AFS37590 Corynebacterium canis 689 GQ871934 Corynebacterium casei 690 NR 025101 Corynebacterium durum 694 Z97O69 Corynebacterium efficiens 695 ACLIO1 OOO121 Corynebacterium falsenii 696 Y13024 Corynebacterium flavescens 697 NR 037040 Corynebacterium glutamicum 701 BAOOOO36 Corynebacterium jeikeium 704 ACYWO1 OOOOO1 Corynebacterium kroppenstedtii 705 NR 02638O Corynebacterium lipophiloflavum 706 ACHO1 OOOO75 Corynebacterium matriuchotii 709 ACSHO2OOOOO3 Corynebacterium minutissimum 710 X82O64 Corynebacterium resistens 718 ADGNO1OOOOS8 Corynebacterium simulans 720 AFS37604 Corynebacterium singulare 721 NR 026394 Corynebacterium sp. 1 ex sheep 722 Y13427 Corynebacterium sp. NML 99 0018 726 GU238413 Corynebacterium striatum 727 ACGEO1OOOOO1 Corynebacterium urealyticum 732 X81913 R Corynebacterium variabile 734 NR 025314 Aerococci is sanguinicola 98 AY837833 Aerococci is tirinae 99 CPOO2512 Aerococci is tirinaeequi 100 NR 043443 Aerococcus viridians 101 ADNTO1 OOOO41 Fusobacterium naviforme 898 HQ223106 Moryella indoligenes 1268 AF527773 Selenomonas genomosp. P5 1697 AY341820 4 O Selenomonas sp. oral clone IQ048 1710 AY3494.08 Selenomonas splitigena 1717 ACKPO2OOOO33 Hyphomicrobium sulfonivorans 1007 AY468372 Methylocella silvestris 1228 NR 074237 Legionella pneumophila 1153 NC OO2942 Lactobacilius coryniformis 1077 NR 044705 Arthrobacter agilis 178 NR 026198 Arthrobacter ariaitensis 179 NR 074608 Arthrobacter beigerei 180 NR 025612 Arthrobacter globiformis 181 NR 0261.87 Arthrobacter nicotianae 182 NR 026190 Mycobacterium abscessus 269 AGQUO1000002 Mycobacterium chelonae 273 ABS4861O Bacteroides saianitronis 291 CPOO2530 Paraprevoteia xylaniphila 427 AFBRO1OOOO11 : Barnesieia intestinihominis 336 AB37O2S1 4 2 Barnesieia viscericola 337 NR 041508 Parabacteroides sp. NS31 3 422 JNO29805 t : g Porphyromonadaceae bacterium NML 06.0648 47O EF184292 e 420 Tannerella forsythia 913 CPOO3191 e 420 Tannerella sp. 6 1 58FAA CT1 914 ACWXO1 OOOO68 e 420 Mycoplasma amphoriforme 311 AYS31656 e 421 Mycoplasma genitalium 317 L43967 e 421 Mycoplasma pneumoniae 322 NC 000912 e 421 Mycoplasma penetrans 321 NC 004.432 e 422 Ureaplasma parvum 966 AEOO2127 e 422 Ureaplasma trealytictim 967 AAYNO1OOOOO2 e 422 Treponema genomosp. P1 927 AY34.1822 e 425 Treponema sp. oral taxon 228 943 GU40858O e 425 Treponema sp. oral taxon 230 944 GU408.603 e 425 Treponema sp. oral taxon 231 945 GU408631 e 425 Treponema sp. oral taxon 232 946 GU408.646 e 425 Treponema sp. oral taxon 235 947 GU408673 e 425 US 2016/0158294 A1 Jun. 9, 2016 56

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Treponema sp. ovine footrot 959 AJO10951 e 425 Treponema vincentii 960 ACYHO1OOOO36 e 425 Burkholderiales bacterium 1 1 47 452 ADCQ01000066 e 432 Parasutterelia excrementihominis 429 AFBPO1 OOOO29 e 432 Parasutterelia Secunda 430 AB491209 e 432 Sutterelia morbirenis 898 A.J832129 e 432 Stitterelia sanguinus 900 AJ748647 e 432 Sutterella sp. YIT 12072 901 AB491210 e 432 Sutterelia Stercoricanis 902 NR 025600 e 432 Sutterelia wadsworthensis 903 ADMFO1OOOO48 e 432 Propionibacterium feudenreichii 572 NR 036972 e 433 Propionibacterium sp. oral taxon 192 580 GQ422728 e 433 Tessaracoccus sp. oral taxon FO4 917 HMO99640 e 433 Peptoniphilus ivorii 44S YO7840 e 434 Peptoniphilus sp. gpac007 448 AM176517 e 434 Peptoniphilus sp. gpac018A 449 AM176519 e 434 Peptoniphilus sp. gpac148 451 AM176535 e 434 Flexispira rappini 887 AY1264.79 e 436 Helicobacter biis 993 ACDNO1OOOO23 e 436 Helicobacter cinaedi 995 ABQTO1000054 e 436 Helicobacter sp. None 998 U44756 e 436 Brevundimonas sub vibrioides 429 CPOO2102 e 438 Hyphomonas neptunit in 1008 NR 074092 e 438 Phenyiobacterium zucineum 146S AY628697 e 438 Streptococci is downei 1793 AEKNO1 OOOOO2 e 441 Streptococcus sp. SHV515 1848 YO76O1 e 441 Acinetobacter sp. CIP 53.82 40 JQ638584 e 443 Halomonas elongata 990 NR 074782 e 443 Halomonasjohnsoniae 991 FR775979 e 443 Butyrivibriofibrisolvens 456 U41172 e 444 Roseburia sp. 11 SE37 1640 FM954975 e 444 Roseburia sp. 11 SE38 1641 FM954976 e 444 Shuttleworthia satelies 1728 ACIPO2OOOOO4 e 444 Shuttleworthia sp. MSX8B 1729 HQ616383 e 444 Shuttleworthia sp. oral taxon G69 173O GU432167 e 444 Bdellovibrio sp. MPA 344 AY294215 e 445 Desulfobulbus sp. oral clone CH031 755 AYOO5036 e 445 Desulfovibrio desulfuricans 757 DQ092636 e 445 Desulfovibrio fairfieldensis 758 U42221 e 445 Desulfovibrio piger 759 AF1921.52 e 445 Desulfovibrio sp. 3 1 syn3 760 ADDRO1 OOO239 e 445 Geobacter hemidjiensis 941 CPOO1124 e 445 Brachybacterium alimentarium 401 NR 026269 e 446 Brachybacterium conglomeratum 402 ABS37169 e 446 Brachybacterium tyrofermenians 403 NR 026272 e 446 Dernabacter hominis 749 FJ263375 e 446 Aneurinibacilius thermoaerophilus 171 NR 029303 e 448 Brevibacilius agri 409 NR 040983 e 448 Brevibacilius centrosporus 411 NR 043414 e 448 Brevibacilius choshinensis 412 NR 040980 e 448 Brevibacilius invocatus 413 NR 041836 e 448 Brevibacilius parabrevis 415 NR 040981 e 448 Brevibacilius reuszeri 416 NR 040982 e 448 Brevibacilius sp. phR 417 JN837488 e 448 Brevibacilius thermoruber 418 NR 026514 e 448 Lactobacilius murinus 1100 NR 042231 e 449 Lactobacilius Oeni 1102 NR 043095 e 449 Lactobacilius ruminis 1115 ACGSO2OOOO43 e 449 Lactobacilius vini 1141 NR 042196 e 449 Gemella haemolysans 924 ACDZO2OOOO12 e 450 Gemeia morbilliorum 925 NR 025904 e 450 Gemeia morbilliorum 926 ACRXO1 OOOO10 e 450 Gemeila sanguinis 927 ACRYO1000057 e 450 Gemella sp. oral clone ASCE02 929 AY923.133 e 450 Gemella sp. oral clone ASCF04 930 AY923.139 e 450 Gemella sp. oral clone ASCF12 931 AY923143 e 450 Gemella sp. WAL 1945J 928 EU427463 e 450 Sporolactobacilius nakayamae 1753 NR 042247 e 451 Giuconacetobacter entani 945 NR 028909 e 452 Gluconacetobacter europaeus 946 NR 026513 e 452 Giuconacetobacter hansenii 947 NR 026133 e 452 Giuconacetobacter oboediens 949 NR 041295 e 452 Gluconacetobacter xylinus 950 NR 074338 e 452 Attritibacter ignavus 193 FNSS4542 e 453 US 2016/0158294 A1 Jun. 9, 2016 57

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Dermacoccus sp. Ellin185 750 EIQ01000090 e 453 Janibacterinosus 1013 R 026362 e 453 Janibacter meionis 1014 FO63716 e 453 Acetobacter aceti 7 R 026121 e 454 Acetobacter fabarum 8 R 042678 e 454 Acetobacteriovaniensis 9 R 040832 e 454 Acetobacter maiorum 10 R 02551.3 e 454 Acetobacter orientais 11 R 028625 e 454 Acetobacter pasteuriants 12 R 026107 e 454 Acetobacter pomorum 13 R 042112 e 454 Acetobacter Syzygii 14 R 040868 e 454 Acetobacter tropicalis 15 R 036881 e 454 Gluconacetobacter azotoCaptains 943 R 028767 e 454 Gluconacetobacter diazotrophicus 944 R 074292 e 454 Gluconacetobacteriohannae 948 R 024959 e 454 Nocardia brasiliensis 1351 HVO1 OOOO38 e 455 Nocardia cyriacigeorgica 1352 Q0094.86 e 455 Nocardia puris 1354 R 028994 e 455 Nocardia sp. 01 Je 025 1355 US 74059 e 455 Rhodococci is equi 1623 DNWO1 OOOOS8 e 455 Oceanobacilius caeni 1358 R 041533 e 456 Oceanobacilius sp. Ndiop 1359 AERO1 OOOO83 e 456 Ornithinibacilius bavariensis 1384 R 044923 e 456 Ornithinibacilius sp. 7 10AIA 1385 N397526 e 456 Virgibacilius proomi 2005 R O253O8 e 456 Corynebacterium amycolatum 683 BZUO1OOOO33 e 457 P Corynebacterium hansenii 702 M946,639 e 457 Corynebacterium xerosis 735 N179330 e 457 Staphylococcaceae bacterium NML 92 0017 756 Y 84 1 3 6 2 e 458 Staphylococcus fieuretti 766 R 041326 e 458 Staphylococcus Sciuri 774 R 02552O e 458 Staphylococciis vitatinus 779 R 024670 e 458 Stenotrophomonas maliophia 782 AAVZO1 OOOOOS e 459 Stenotrophomonas sp. FG 6 783 FO17810 e 459 Mycobacterium africanum 270 F480605 e 46 Mycobacterium alsiensis 271 938169 e 46 Mycobacterium avium 272 POOO479 e 46 Mycobacterium colombiense 274 MO62764 e 46 Mycobacterium gordonae 276 U142930 e 46 Mycobacterium intracellulare 277 Q153276 e 46 Mycobacterium kansasii 278 F480601 e 46 Mycobacterium lacus 279 R O25175 e 46 Mycobacterium leprae 28O M211.192 e 46 Mycobacterium lepromatosis 281 U2O3590 e 46 Mycobacterium mantenii 283 O42897 e 46 Mycobacterium marinum 284 C 01.0612 e 46 Mycobacterium microti 285 R 025234 e 46 Mycobacterium parascrofitiacetim 287 DNVO1OOO3SO e 46 Mycobacterium Seoulense 290 Q536403 e 46 Mycobacterium sp. 1761 292 U703150 e 46 Mycobacterium sp. 1791 295 U703148 e 46 Mycobacterium sp. 1797 296 U703149 e 46 Mycobacterium sp. B10 07.09.0206 298 Q174245 e 46 Mycobacterium sp. NLA001000736 305 M627011 e 46 Mycobacterium sp. W 306 Q437715 e 46 Mycobacterium tuberculosis 307 POO1658 e 46 Category-C Mycobacterium ulcerans 3O8 B548725 e 46 OP Mycobacterium vulneris 309 U834OSS e 46 OP Xanthomonas Campestris 2016 F101975 e 461 Xanthomonas sp. kmd 489 2017 U7231.84 e 461 Dietzia natronoimnaea 769 GQ870426 e 462 Dietzia sp. BBDP51 770 DQ337512 e 462 Dietzia sp. CA149 771 GQ870422 e 462 Dietzia timorensis 772 GQ870424 e 462 Gordonia bronchiais 951 NR O27594 e 463 Gordonia polyisoprenivorans 952 DQ385,609 e 463 Gordonia sp. KTR9 953 DQ068383 e 463 Gordonia Spitti 954 FJS36304 e 463 Gordonia terrae 955 GQ848239 e 463 Leptotrichia goodfellowii 1167 ADAD01OOO110 e 465 Leptotrichia sp. oral clone IK040 1174 AY349387 e 465 Leptotrichia sp. oral clone P2PB 51 P1 1175 AY207053 e 465 Bacteroidales genomosp. P7 oral clone MB3 P19 264 DQ003623 e 466 Butyricimonas virosa 454 AB443949 e 466 US 2016/0158294 A1 Jun. 9, 2016 58

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Odoribacterianeus 1363 AB4908OS clade 466 N N Odoribacter splanchinicus 1364 CPOO2S44 clade 466 N N Capnocytophaga gingivais 478 ACLQ01000011 clade 467 N N Capnocytophaga granulosa 479 X97248 clade 467 N N Capnocytophaga sp. oral clone AHO15 483 AYOOSO74 clade 467 N N Capnocytophaga sp. oral strain S3 487 AYOO5073 clade 467 N N Capnocytophaga sp. oral taxon 338 488 AEXXO1000050 clade 467 N N Capnocytophaga caninorsus 476 CPOO2113 clade 468 N N Capnocytophaga sp. oral clone ID062 485 AY3493.68 clade 468 N N Lactobacilius catenaformis 1075 M23729 clade 469 N N Lactobacilius vitatinus 1142 NR 041305 clade 469 N N Cetobacterium somerae SO1 A4381.SS clade 470 N N Fusobacterium gonidiaformans 896 ACETO1000043 clade 470 N N Fusobacterium mortiferum 897 ACDBO2OOOO34 clade 470 N N Fusobacterium necrogenes 899 XSS408 clade 470 N N Fusobacterium necrophorum 900 AM905356 clade 470 N N Fusobacterium sp. 12 1B 905 AGWJO1OOOO70 clade 470 N N Fusobacterium sp. 3 1 SR 911 ACDDO 1000078 clade 470 N N Fusobacterium sp. D12 918 ACDGO2000O36 clade 470 N N Fusobacterium ulcerans 921 ACDHO1000090 clade 470 N N Fusobacterium varium 922 ACIEO1 OOOOO9 clade 470 N N Mycoplasma arthritidis 312 NC 011025 clade 473 N N Mycoplasma faticium 314 NR 024983 clade 473 N N Mycoplasma hominis 318 AF443616 clade 473 N N Mycoplasma orale 319 AY796060 clade 473 N N Mycoplasma salivarium 324 M24661 clade 473 N N Mitsuokella ialaludinii 247 NR 028840 clade 474 N N Mitsuokeia multacida 248 ABWKO2000005 clade 474 N N Mitsuokella sp. oral taxon 521 249 GU413658 clade 474 N N Mitsuokella sp. oral taxon G68 2SO GU432166 clade 474 N N Selenomonas genomosp. C1 695 AY278627 clade 474 N N Selenomonas genomosp. P8 oral clone MB5 P06 700 DQ003628 clade 474 N N Selenomonas riminantium 703 NR 075026 clade 474 N N Veillonellaceae bacterium oral taxon 131 994 GU402916 clade 474 N N Alioscardovia omnicoiens 139 NR 042583 clade 475 N N Alloscardovia sp. OB7196 140 AB42SO70 clade 475 N N Bifidobacterium urinalis 366 A.J278695 clade 475 N N Prevoteia loescheii SO3 JN867231 clade 48 N. N Prevoteila sp. oral clone ASCG12 530 DQ272511 clade 48 N. N Prevoteila sp. oral clone GUO27 S40 AY349398 clade 48 N. N Prevoteila sp. oral taxon 472 553 ACZSO1OOO106 clade 48 N. N Selenomonas dianae 693 GQ422719 clade 480 N N Selenomonas fitteggei 694 AF2878O3 clade 480 N N Selenomonas genomosp. C2 696 AY278628 clade 480 N N Selenomonas genomosp. P6 oral clone MB3 C41 698 DQ003636 clade 480 N N Selenomonas genomosp. P7 oral clone MB5 C08 699 DQ003627 clade 480 N N Selenomonas infelix 701 AF2878O2 clade 480 N N Selenomonas noxia 702 GU470909 clade 480 N N Selenomonas sp. oral clone FT050 70S AY349403 clade 480 N N Selenomonas sp. oral clone GIO64 706 AY3494.04 clade 480 N N Selenomonas sp. oral clone GTO10 707 AY3494.OS clade 480 N N Selenomonas sp. oral clone HU051 708 AY3494O6 clade 480 N N Selenomonas sp. oral clone IK004 709 AY3494O7 clade 480 N N Selenomonas sp. oral clone JIO21 711 AY3494.09 clade 480 N N Selenomonas sp. oral clone JSO31 712 AY3494.10 clade 480 N N Selenomonas sp. oral clone OH4A 713 AY947498 clade 480 N N Selenomonas sp. oral clone P2PA 80 P4 714 AY207052 clade 480 N N Selenomonas sp. oral taxon 149 716 AEEJO1000007 clade 480 N N Veillonellaceae bacterium oral taxon 155 995 GU470897 clade 480 N N AgrococcuSienensis 117 NR 026275 clade 484 N N Microbacterium gubbeenense 232 NR 025 098 clade 484 N N Pseudoclavibacter sp. Timone 590 FJ375951 clade 484 N N Tropheryma whippiei 961 BX251412 clade 484 N N Zimmermannella bifida 2O31 ABO12592 clade 484 N N Legionelia hackeiae 151 M36O28 clade 486 N OP Legionelia longbeachae 152 M36O29 clade 486 N OP Legionella sp. D3923 154 JN380999 clade 486 N OP Legionella sp. D4088 1SS JN381 012 clade 486 N OP Legionella sp. H63 1S6 JF831047 clade 486 N OP Legionella sp. NML 93L054 157 GUO627O6 clade 486 N OP Legionelia Steelei 158 HQ3982O2 clade 486 N OP Taiiockia micdadei 91S M36032 clade 486 N N Helicobacter pullorum 996 ABQUO1000097 clade 489 N N Acetobacteraceae bacterium AT5844 16 AGEZO100004-0 clade 490 N N US 2016/0158294 A1 Jun. 9, 2016 59

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Roseomonas cervicais 643 ADVLO1 OOO363 e 490 Roseomonas inticosa 644 NR 028857 e 490 Roseomonas sp. NML94 0193 645 AF533357 e 490 Roseomonas sp. NML97 0121 646 AFS33359 e 490 Roseomonas sp. NML98 0009 647 AFS33358 e 490 Roseomonas sp. NML98 O157 648 AFS33360 e 490 Rickettsia akari 627 CPOOO847 e 492 OP Rickettsia Conorii 628 AEOO8647 e 492 OP Rickettsia prowazeki 629 M21789 e 492 Category-B Rickettsia rickettsii 630 NC 010263 e 492 Rickettsia Siovaca 631 L36224 e 492 Rickettsia typhi 632 AEO171.97 e 492 Anaeroglobits geminati is 160 AGCO1 OOOOS4 e 493 Megasphaera genomosp. C1 2O1 AY278622 e 493 Megasphaera micronticifornis 2O3 AECSO1OOOO20 e 493 Clostridiales genomosp. BVAB3 S40 CPOO1850 e 495 Tsukamtirella pattrometabola 963 X80628 e 496 Tsukamurella tyrosinosolvens 964 AB478958 e 496 Abiotrophia para adiacens 2 ABO22027 e 497 Carnobacterium divergens 492 NR 044706 e 497 Carnobacterium maitaromaticum 493 NC 019425 e 497 Enterococci is a vitin 800 AF133S35 e 497 Enterococciis Caccae 8O1 AY94382O e 497 Enterococci is cassellifiavits 8O2 AEWTO1OOOO47 e 497 Enterococci is durans 803 A2763S4 e 497 Enterococci is faecalis 804 AEO1683O e 497 Enterococci is faecium 805 AM157434 e 497 Enterococci is gallinarum 806 AB269767 e 497 Enterococci is gilvis 807 AYO33814 e 497 Enterococci is hawaiiensis 808 AY321377 e 497 Enterococcus hirae 809 AFO 61011 e 497 Enterococci is italicits 81O AEPVO1 OOO109 e 497 Enterococcus mindtii 811 NR 024906 e 497 Enterococci is rafinostis 812 FN600541 e 497 Enterococcus sp. BV2CASA2 813 JN809766 e 497 Enterococcus sp. CCRI 16620 814 GU457263 e 497 Enterococcus sp. F95 815 FJ463817 e 497 Enterococcus sp. RfL6 81.6 A133478 e 497 Enterococcus thailandicus 817 AY321376 e 497 Fusobacterium canifelinum 893 AY162222 e 497 Fusobacterium genomosp. C1 894 AY278616 e 497 Fusobacterium genomosp. C2 895 AY2786.17 e 497 Fusobacterium periodonticum 902 ACTYO1 OOOOO2 e 497 Fusobacterium sp. 1 1. 41FAA 906 ADGGO1OOOOS3 e 497 Fusobacterium sp. 11 3 2 904 ACUOO1OOOOS2 e 497 Fusobacterium sp. 2 1 31 907 ACDCO2OOOO18 e 497 Fusobacterium sp. 3 1. 27 908 ADGFO1OOOO45 e 497 Fusobacterium sp. 3. 1 33 909 ACQE01.000178 e 497 Fusobacterium sp. 3 1 36A2 910 ACPUO1 OOOO44 e 497 Fusobacterium sp. AC18 912 HQ616357 e 497 Fusobacterium sp. ACB2 913 HQ616358 e 497 Fusobacterium sp. AS2 914 HQ616361 e 497 Fusobacterium sp. CM1 915 HQ616371 e 497 Fusobacterium sp. CM21 916 HQ616375 e 497 Fusobacterium sp. CM22 917 HQ616376 e 497 Fusobacterium sp. oral clone ASCF06 919 AY923141 e 497 Fusobacterium sp. oral clone ASCF11 920 AY953.256 e 497 Granticateia adiacens 959 ACKZO1OOOOO2 e 497 Granticatella elegans 960 AB2S2689 e 497 Granticatella paradiacens 961 AY879298 e 497 Granulicatella sp. oral clone ASCO2 963 AY923.126 e 497 Granulicatella sp. oral clone ASCA05 964 DQ341469 e 497 Granulicatella sp. oral clone ASCB09 965 AY95.3251 e 497 Granulicatella sp. oral clone ASCG05 966 AY923.146 e 497 Tetragenococciis halophilus 1918 NR 075020 e 497 Tetragenococci is koreensis 1919 NR 043113 e 497 Vagococcits fiti vialis 1973 NR 026489 e 497 Chryseobacterium anthropi S14 AM982.793 e 498 Chryseobacterium gleum 515 ACKQ02000003 e 498 Chryseobacterium hominis 516 NR 042517 e 498 Treponema refingens 1936 AF426101 e 499 Treponema sp. oral clone JUO31 1941 AY349416 e 499 Treponema sp. oral taxon 239 1948 GU408738 e 499 Treponema sp. oral taxon 271 1955 GU408871 e 499 US 2016/0158294 A1 Jun. 9, 2016 60

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Alistipes finegoidii 129 NR 043064 Alistipes onderdonki 131 NR 043318 Alistipes puttredinis 132 ABFKO2OOOO17 Alistipes shahi 133 FP929O32 Alistipes sp. HGB5 134 AENZO1 OOOO82 Alistipes sp. JC50 135 JF824.804 Alistipes sp. RMA 9912 136 GQ140629 Mycoplasma agaiaciae 1310 AFO10477 Mycoplasma bovoculi 1313 NR O25987 Mycoplasma fermenians 1315 CPOO2458 Mycoplasmafiocchiare 1316 X62699 Mycoplasma ovipneumoniae 132O NR O25989 Arcobacter buizieri 176 AEPTO1 OOOO71 Arcobacter cryaerophilus 177 NR O25905 Campylobacter curvus 461 NC OO9715 Campylobacter rectus 467 ACFUO1 OOOOSO Campylobacter Showae 468 ACVQ01000030 Campylobacter sp. FOBRC14 469 HQ616379 Campylobacter sp. FOBRC15 470 HQ616380 Campylobacter sp. oral clone BB120 471 AYOOSO38 Campylobacter splitorum 472 NR 044839 Bacteroides tireolyticus 330 GQ167666 Campylobacter gracilis 463 ACYGO1OOOO26 Campylobacter hominis 464 NC OO9714 Dialister invisits 762 ACIMO2OOOOO1 Dialister micraerophilus 763 FBBO1OOOO28 Dialister microaerophilus 764 ENTO1 OOOOO8 Dialister propioniclifaciens 766 R 043231 Dialister succinatiphilus 768 B370249 Megasphaera eisdenii 1200 YO 3 8 9 9 6 Megasphaera genomosp. type 1 12O2 DGPO1OOOO10 Megasphaera sp. BLPYG 07 1204 M990964 Megasphaera sp. UPII 199 6 12OS FIO1OOOO40 Chronobacterium violiaceum 513 C 005085 Laribacter hongkongensis 1148 POO1154 Methylophilus sp. ECd5 1229 Y436794 Finegoidia magna 883 CHMO2OOOOO1 Parvinonas micra 1431 B729O72 Parvimonas sp. oral taxon 110 1432 FIIO1 OOOOO2 Peptostreptococci is microS 1456 M176538 Peptostreptococcus sp. oral clone FJO23 1460 Y3 4 9 3 9 O Peptostreptococcus sp. P4P 31 P3 1458 Y2O7059 Helicobacter pylori 997 POOOO12 P Anaplasma marginale 16S BORO1 OOOO19 Anaplasma phagocytophilum 166 C 007797 Ehrlichia chafeensis 783 AAIFO1 OOOO3S P Neorickettsia risticii 1349 POO1431 Neorickettsia Sennetsu 1350 C 007798 Pseudoramibacter alactolyticus 1606 BO36759 Veillonella montpellierensis 1977 F473836 Veillonella sp. oral clone ASCA08 1988 Veillonella sp. oral clone ASCB03 1989 y g : s : Inquilinus inostis 1012 R 029046 Sphingomonas sp. oral clone FZO16 1746 Y3 4 9 4 1 2 Anaerococci is lactolyticits 145 BYOO1 OOO217 Anaerococcits prevotii 147 POO1708 Anaerococci is sp. gpac104 152 AM176528 Anaerococci is sp. gpac126 153 AM176530 Anaerococci is sp. gpac155 154 AM176536 Anaerococci is sp. gpac199 155 AM176539 Anaerococci is tetradius 157 ACGCO1 OOO107 Bacteroides coaglians 271 ABS47639 Clostridiales bacterium 9403326 534 HMS87324 Clostridiales bacterium ph2 539 N837487 Peptostreptococci is sp. 9Succ1 1457 X90471 Peptostreptococci is sp. oral clone AP24 1459 AB17SO72 Tissierelia praeactita 1924 NR 044860 Helicobacter Canadensis 994 ABQSO1000108 Peptostreptococci is anaerobius 1455 AY32.6462 2 Peptostreptococci is Stomatis 1461 ADGQ01000048 Biophila wadsworthia 367 ADCPO1 OOO166 : Desulfovibrio vulgaris 761 NR 074897 e 521 Actinomyces nasicola 64 AJSO84S5 e 523 Cellulosimicrobium funkei 500 AYSO1364 e 523 US 2016/0158294 A1 Jun. 9, 2016 61

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Lactococci is raffinolactis 1146 NR 044359 e 524 Bacteroidales genomosp. P1 258 AY341819 e 529 Bacteroidales genomosp. P2 oral clone MB1 G13 259 DQ003613 e 529 Bacteroidales genomosp. P3 oral clone MB1 G34 260 DQ003615 e 529 Bacteroidales genomosp. P4 oral clone MB2 G17 261 DQ003617 e 529 Bacteroidales genomosp. P5 oral clone MB2 P04 262 DQ003619 e 529 Bacteroidales genomosp. P6 oral clone MB3 C19 263 DQ003634 e 529 Bacteroidales genomosp. P8 oral clone MB4 G15 265 DQ003626 e 529 Bacteroidetes bacterium oral taxon D27 333 HMO99638 e 530 Bacteroidetes bacterium oral taxon F31 334 HMO99643 e 530 Bacteroidetes bacterium oral taxon F44 335 HMO99649 e 530 Flavobacterium sp. NF2 1 88S F195988 e 530 Myroides odoratimimus 1326 NR 042354 e 530 Myroides sp. MY15 1327 GU253339 e 530 Chlamydiales bacterium NS16 507 JN606O76 e 531 Chlamydophila pecorum SO8 D883.17 e 531 Parachlamydia sp. UWE25 1423 BX908798 e 531 Fusobacterium russi 903 NR 044687 e 532 Streptobacilius moniiformis 1784 NR 027615 e 532 Eubacteriaceae bacterium P4P 50 P4 833 AY2O7O60 e 533 Abiotrophia defectiva 1 ACINO2OOOO16 e 534 Abiotrophia sp. oral clone P4PA 155 P1 3 AY2O7063 e 534 Catonella genomosp. P1 oral clone MB5 P12 496 DQ003629 e 534 Caioneia morbi 497 ACILO2OOOO16 e 534 Catonella sp. oral clone FLO37 498 AY34.9369 e 534 Eremococci is Coleocola 818 AENNO1 OOOOO8 e 534 Fackiania hominis 879 Y10772 e 534 Granulicatella sp. M658 99 3 962 A.271861 e 534 Campylobacter coli 459 AAFLO1OOOOO4 e 535 Campylobacter concisus 460 CPOOO792 e 535 Campylobacter fetus 462 ACLGO1001177 e 535 Campylobacterieitini 46S AL139074 e 535 Category-B Campylobacter upsaliensis 473 AEPUO1 OOOO40 e 535 OP Atopobium minuti in 183 HMOOfS83 e 539 Atopobium parvulum 184 CPOO1721 e 539 Atopobium finae 185 ACFEO1OOOOO7 e 539 Atopobium sp. BS2 186 HQ616367 e 539 Atopobium sp. F0209 187 EUS92966 e 539 Atopobium sp. ICM42b10 188 HQ616393 e 539 Atopobium sp. ICM57 189 HQ616400 e 539 Atopobium vaginae 190 AEDQ01000024 e 539 Coriobacteriaceae bacterium BV3Ac1 677 JN809768 e 539 Actinomyces naeslundi 63 X81062 e 54 Actinomyces Oricola 67 NR 025559 e 54 Actinomyces Oris 69 BABVO1 OOOO70 e 54 Actinomyces sp. 7400942 70 EU484334 e 54 Actinomyces sp. ChDC B197 72 AF543275 e 54 Actinomyces sp. GEJ15 73 GU561313 e 54 Actinomyces sp. M2231. 94 1 79 AJ234063 e 54 Actinomyces sp. oral clone GU067 83 AY349362 e 54 Actinomyces sp. oral clone IO077 85 AY349364 e 54 Actinomyces sp. oral clone IP073 86 AY349365 e 54 Actinomyces sp. oral clone JAO63 88 AY349367 e 54 Actinomyces sp. oral taxon 170 89 AFBLO1OOOO10 e 54 Actinomyces sp. oral taxon 171 90 AECWO1 OOOO34 e 54 Actinomyces tirogenitalis 95 ACFEHO1 OOOO38 e 54 Actinomyces viscosits 96 ACREO1 OOOO96 e 54 Orientia tsutsugamishi 383 APOO8981 e 541 Megamonas finifornis 198 AB300988 e 542 Megamonas hypermegale 199 A42O107 e 542 Aeronicrobium marinum 102 NR 025681 e 544 Aeromicrobium sp. JC14 103 JF824798 e 544 Latteococci is sanguinis 190 NR 025507 e 544 Propionibacteriaceae bacterium NML 02 0265 568 EF59.9122 e 544 Rhodococcus corynebacterioides 622 X80615 e 546 Rhodococcus erythropolis 624 ACNOO1OOOO3O e 546 Rhodococci is fascians 625 NR 037021 e 546 Segniipartis rotundits 690 CPOO1958 e 546 Segniipartis rugostis 691 ACZIO1 OOOO2S e 546 Exigliobacterium acetylictim 878 FJ970O34 e 547 Macrococci is caseolyticits 194 NR 074941 e 547 Streptomyces sp. 1 AIP 2009 890 FJ176782 e 548 Streptomyces sp. SD 524 892 EUS44234 e 548 Streptomyces sp. SD 528 893 EUS44233 e 548 US 2016/0158294 A1 Jun. 9, 2016 62

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Streptomyces thermo violacetis 1895 NR 027616 e 548 N Borrelia afzelii 388 ABCUO1 OOOOO1 e 549 OP Borreia crocidurae 390 DQ057990 e 549 OP Borreia dutionii 391 NC 011229 e 549 OP Borreia herinsii 393 AY597657 e 549 OP Borrelia hispanica 394 DQ057988 e 549 OP Borrelia persica 39S HM161645 e 549 OP Borreia recurrentis 396 AF107367 e 549 OP Borrelia spielmanii 398 ABKBO1 OOOOO2 e 549 OP Borreia iuricatae 399 NC 008710 e 549 OP Borreia vaiaisiana 400 ABCYO1 OOOOO2 e 549 OP Providencia alcalifaciens 1586 ABXWO1 OOOO71 e 55 Providencia retigeri 1587 AMO40492 e 55 Providencia rustigiani 1588 AMO40489 e 55 Providencia Stuarii 1589 AFOO8581 e 55 Treponema pallidiin 1932 CPOO1752 e 550 P Treponema phagedenis 1934 AEFEHO1 OOO172 e 550 Treponema sp. clone DDKL 4 1939 YO8894 e 550 Acholeplasma laidlawii 17 NR 074448 e 551 Mycoplasma pittrefaciens 1323 U26055 e 551 Mycoplasmataceae genomosp. P1 oral clone MB1 G23 1325 DQ003614 e 551 Spiroplasma insolitain 1750 NR 025.705 e 551 Coinseila intestinais 660 ABXHO2OOOO37 e 553 Coinseiia Stercoris 661 ABXO1 OOO150 e 553 Coinseila tanakaei 662 AB490807 e 553 Caminicella sporogenes 458 NR 025.485 e 554 Acidaminococci is fermenians 21 CPOO1859 e 556 Acidaminococcits intestini 22 CPOO3058 e 556 Acidaminococcus sp. D21 23 ACGBO1 OOOO71 e 556 Phascolarctobacterium faecium 1462 NR 026111 e 556 Phascolarctobacterium sp. YIT 12068 1463 AB490812 e 556 Phascoiarctobacterium succinatuiens 1464 AB490811 e 556 Acidithiobacilius ferrivorans 25 NR 07466O e 557 Xanthomonadaceae bacterium NML 03 0222 2015 EU313791 e 557 Catabacter hongkongensis 494 AB671763 e 558 Christenseneia minuta S12 AB490809 e 558 Clostridiales bacterium oral clone P4PA 66 P1 536 AY2O7065 e 558 Clostridiales bacterium oral taxon 093 537 GQ422712 e 558 Heliobacterium modesticaidium 1000 NR 074517 e 560 Alistipes indistinctus 130 AB490804 e 561 Bacteroidales bacteriumph 8 257 N837494 e 561 Candidates Suicia matelieri 475 CPOO21 63 e 561 Cytophaga xylanolytica 742 FR733683 e 561 Flavobacteriaceae genomosp. C1 884 AY278614 e 561 Gramella forsetii 958 NR 074707 e 561 Sphingobacterium faecium 1740 NR 025537 e 562 Sphingobacterium mizutai 1741 JF708889 e 562 Sphingobacterium multivorum 1742 NR 040953 e 562 Sphingobacterium spiritivorum 1743 ACHAO2OOOO13 e 562 Jonquetelia anthropi 1017 ACOOO2OOOOO4 e 563 Pyramidobacter piscolens 1614 AY2O70S6 e 563 Synergistes genomosp. C1 1904 AY278615 e 563 Synergistes sp. RMA 14551 1905 DQ412722 e 563 Synergistetes bacterium ADV897 1906 GQ258968 e 563 Candidates Arthromitus sp. 474 NR 074,460 e 564 SFB mouse Yit Graciibacter thermotoierans 957 NR 043559 e 564 Brachyspira aalborgi 404 FM178386 e 565 Brachyspira sp. HIS3 406 FM178387 e 565 Brachyspira sp. HIS4 407 FM178388 e 565 Brachyspira sp. HIS5 408 FM178389 e 565 Adlercreutzia equoifaciens 97 AB306661 e 566 Coriobacteriaceae bacterium JC110 678 CAEMO1(OOOO62 e 566 Coriobacteriaceae bacterium phI 679 JN837493 e 566 Cryptobacterium curtum 740 GQ422741 e 566 Eggerihelia Sinensis 779 AY321958 e 566 Eggerthelia sp. 1 3 56FAA 780 ACWNO1 OOOO99 e 566 Eggerthelia sp. HGA1 781. AEXRO1OOOO21 e 566 Eggerthella sp. YY7918 782 APO12211 e 566 Gordonibacter pameiaeae 680 AM886059 e 566 Gordonibacter pameiaeae 956 FP929047 e 566 Slackia equoifaciens 1732 EU377663 e 566 Slackia exiglia 1733 ACUXO1OOOO29 e 566 Slackia faecicanis 1734 NR 042220 e 566 US 2016/0158294 A1 Jun. 9, 2016 63

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Siackia heiotrinireducens 735 NR 074,439 clade 566 N N Slackia isoflavoniconvertens 736 ABS 66418 clade 566 N N Slackia piriformis 737 AB490806 clade 566 N N Slackia sp. NATTS 738 AB505075 clade 566 N N Chlamydiales bacterium NS13 SO6 JN606O75 clade 567 N N Victivallaceae bacterium NML 08.0035 2003 FJ394.915 clade 567 N N Victivais vadensis 2004 ABDEO2OOOO10 clade 567 N N Streptomyces grisetts 889 NR 074787 clade 573 N N Streptomyces sp. SD 511 891 EUS44231 clade 573 N N Streptomyces sp. SD 534 894 EUS44232 clade 573 N N Cloacibacilius eviyensis 530 GQ258966 clade 575 N N Deferribacteres sp. oral clone JV001 743 AY349370 clade 575 N N Deferribacteres sp. oral clone JVO23 745 AY3493.72 clade 575 N N Synergistetes bacterium. LBVCM1157 907 GQ258969 clade 575 N N Synergistetes bacterium oral taxon 362 909 GU410752 clade 575 N N Synergistetes bacterium oral taxon D48 910 GU430992 clade 575 N N Peptococcus sp. oral clone JM048 439 AY34938.9 clade 576 N N Helicobacter winghamensis 999 ACDOO1OOOO13 clade 577 N N Wolinella succinogenes 2014 BXS71657 clade 577 N N Olseneila genomosp. C1 368 AY278623 clade 578 N N Olseneia profitsa 369 FN178466 clade 578 N N Olseneila sp. F0004 370 EUS92964 clade 578 N N Olseneila sp. oral taxon 809 371 ACVEO1OOOOO2 clade 578 N N Olseneia iiii 372 CPOO2106 clade 578 N N Nocardiopsis dassonvillei 356 CPOO2O41 clade 579 N N Peptococci is niger 438 NR 029221 clade 580 N N Peptococcus sp. oral taxon 167 440 GQ422727 clade 580 N N Akkermansia muciniphila 118 CPOO1071 clade 583 N N Opittituts terrae 373 NR 074978 clade 583 N N Clostridiales bacterium oral taxon F32 S38 HMO99644 clade 584 N N Leptospira borg.petersenii 161 NC 008508 clade 585 N OP Leptospira broomi 162 NR 043200 clade 585 N OP Leptospira interrogans 163 NC OO5823 clade 585 N OP Methanobrevibactergottschalkii 213 NR 044789 clade 587 N N Meihanobrevibacter milierrae 214 NR 042785 clade 587 N N Meihanobrevibacter oralis 216 HE654OO3 clade 587 N N Meihanobrevibacter thanieri 219 NR 044787 clade 587 N N Meihanobrevibacter Smithii 218 ABYVO2OOOOO2 clade 588 N N Deinococcus radiodurans 746 AEOOOS13 clade 589 N N Deinococcus sp. R 43890 747 FR682.752 clade 589 N N Thermits aquaticits 923 NR 025900 clade 589 N N Actinomyces sp. c109 81 AB167239 clade 590 N N Syntrophomonadaceae genomosp. P1 912 AY34.1821 clade 590 N N Anaerobaculum hydrogeniformans 141 ACJXO2OOOOO9 clade 591 N N Microcystis aeruginosa 246 NC 010296 clade 592 N N Prochiorococcus marinus 567 CPOOO551 clade 592 N N Meihanobrevibacter acididatrans 208 NR 028779 clade 593 N N Methanobrevibacter arboriphilus 209 NR 042783 clade 593 N N Meihanobrevibacter curvatus 210 NR 044796 clade 593 N N Meihanobrevibacter culticularis 211 NR 044776 clade 593 N N Methanobrevibacter filiformis 212 NR 044801 clade 593 N N Meihanobrevibacter woesei 220 NR 044788 clade 593 N N Roseiflexus castenholzii 642 CPOOO804 clade 594 N N Methanobrevibacter oileyae 215 NR 043024 clade 595 N N Meihanobrevibacter ruminantium 217 NR 042784 clade 595 N N Meihanobrevibacter woiinii 221 NR 044790 clade 595 N N Meihanosphaera Stadtmanae 222 AY196684 clade 595 N N Chloroflexigenomosp. P1 S11 AY331414 clade 596 N N Haiorubrum lipolyticum 992 AB477978 clade 597 N N Methanobacterium formicicum 207 NR 025O28 clade 597 N N Acidiiobus saccharov.orans 24 AY3SOS86 clade 598 N N Hyperthermus butyllicus O06 CPOOO493 clade 598 N N Ignicocci is islandict is O11 X99562 clade 598 N N Metaliosphaera seditia 2O6 D26491 clade 598 N N Thermofilum pendens 922 X14835 clade 598 N N Prevoteila melaninogenica SO6 CPOO2122 clade 6 N N Prevoteila sp. ICM1 520 HQ616385 clade 6 N N Prevoteila sp. oral clone FU048 535 AY349393 clade 6 N N Prevoteila sp. oral clone GIO30 537 AY349395 clade 6 N N Prevoteila sp. SEQ116 526 JN867246 clade 6 N N Streptococci is anginostis 787 AECTO1000011 clade 60 N N Streptococcus milieri 812 X81023 clade 60 N N Streptococcus sp. 16362 829 JNS90019 clade 60 N N Streptococcus sp. 69130 832 X7882S clade 60 N N US 2016/0158294 A1 Jun. 9, 2016 64

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Streptococcus sp. AC15 1833 HQ616356 clade 60 N N Streptococcus sp. CM7 1839 HQ616373 clade 60 N N Streptococcus sp. OBRC6 1847 HQ616352 clade 60 N N Burkholderia ambifaria 442 AAUZO1000009 clade 61 N OP Burkholderia cenocepacia 443 AAHIO1000060 clade 61 N OP Burkholderia cepacia 444 NR 041719 clade 61 N OP Burkhoideria maiei 445 CPOOOS47 clade 61 N Category-B Burkhoideria multivorans 446 NC 010086 clade 61 N OP Burkhoideria Okiahomensis 447 DQ108388 clade 61 N OP Burkholderia pseudomaiei 448 CPOO1408 clade 61 N Category-B Burkhoideria rhizoxinica 449 HQ005410 clade 61 N OP Burkholderia sp. 383 450 CPOOO151 clade 61 N OP Burkhoideria xenovorans 451 U86373 clade 61 N OP Prevoteia buccae 1488 ACRBO1OOOOO1 clade 62 N N Prevoteila genomosp. P8 oral clone MB3 P13 1498 DQ003622 clade 62 N N Prevotella sp. oral clone FW035 1536 AY349394 clade 62 N N Prevoteia bivia 1486 ADFOO1000096 clade 63 N N Prevoteia disiens 1494 AEDOO1000026 clade 64 N N Bacteroides faecis 276 GQ496624 clade 65 N N Bacteroides fragilis 279 APOO6841 clade 65 N N Bacteroides nordi 285 NR 043017 clade 65 N N Bacteroides Salversiae 292 EU136690 clade 65 N N Bacteroides sp. 1 1 14 293 ACRPO1OOO155 clade 65 N N Bacteroides sp. 1, 1 6 295 ACICO1OOO215 clade 65 N N Bacteroides sp. 2 1 56FAA 298 ACWIO1000065 clade 65 N N Bacteroides sp. AR29 316 AF13952S clade 65 N N Bacteroides sp. B2 317 EU722733 clade 65 N N Bacteroides theiaioiaomicron 328 NR 074277 clade 65 N N Actinobacilius minor 45 ACFTO1OOOO2S clade 69 N N Haemophilias parastis 978 GU226366 clade 69 N N Vibrio choierae 996 AAURO1000095 clade 71 N Category-B Vibrio fluvialis 997 X76335 clade 71 N Category-B Vibrio furnissi 998 CPOO2377 clade 71 N Category-B Vibrio mimicus 999 ADAFO1000001 clade 71 N Category-B Vibrio parahaemolyticus 2000 AAWQ01000116 clade 71 N Category-B Vibrio sp. RC341 2001 ACZTO1000024 clade 71 N Category-B Vibrio vulnificus 2002 AEO16796 clade 71 N Category-B Lactobacilius acidophilus O67 CPOOOO33 clade 72 N N Lactobacilius amylolyticuts O69 ADNYO1000006 clade 72 N N Lactobacilius amylovortis O70 CPOO2338 clade 72 N N Lactobacilius crispatus O78 ACOGO1000151 clade 72 N N Lactobacilius deilbruecki O80 CPOO2341 clade 72 N N Lactobacilius helveticus 088 ACLMO1000202 clade 72 N N Lactobacilius kaixensis O94 NR 029083 clade 72 N N Lactobacilius kefiranofaciens O95 NR 042440 clade 72 N N Lactobacilius leichmannii O98 X986966 clade 72 N N Lactobacilius sp. 66c 120 FR681900 clade 72 N N Lactobacilius sp. KLDS 1.0701 122 EU600905 clade 72 N N Lactobacilius sp. KLDS 1.0712 130 EU6OO916 clade 72 N N Lactobacilius sp. oral clone HTO70 136 AY349383 clade 72 N N Lactobacilius tiltinensis 139 ACGUO1000081 clade 72 N N Prevoteia intermedia SO2 AF414829 clade 81 N N Prevotella nigrescens 511 AFPXO1000069 clade 81 N N Prevoteila pallens 515 AFPYO1000135 clade 81 N N Prevoteila sp. oral taxon 310 551 GQ422737 clade 81 N N Prevoteila genomosp. C1 495 AY278624 clade 82 N N Prevotella sp. CM38 519 HQ610181 clade 82 N N Prevoteila sp. oral taxon 317 552 ACQHO1000158 clade 82 N N Prevoteila sp. SG12 S27 GUS 61343 clade 82 N N Prevoteia denticoia 493 CPOO2S89 clade 83 N N Prevoteila genomosp. P7 oral clone MB2 P31 497 DQ003620 clade 83 N N Prevoteia histicoia 5O1 JN867315 clade 83 N N Prevoteila multiformis 508 AEWXO1000054 clade 83 N N Prevotella sp. JCM 6330 S22 ABS47699 clade 83 N N Prevoteila sp. oral clone GIO59 539 AY349397 clade 83 N N Prevoteila sp. oral taxon 782 555 GQ422745 clade 83 N N Prevoteila sp. oral taxon G71 S59 GU43218O clade 83 N N Prevotella sp. SEQ065 524 JN867234 clade 83 N N Prevoteia verora is 565 ACVAO1000027 clade 83 N N Bacteroides acidifaciens 266 NR 0286O7 clade 85 N N Bacteroides cellulosilyticus 269 ACCHO1000108 clade 85 N N Bacteroides clarus 270 AFBMO1000011 clade 85 N N Bacteroides eggerthi 275 ACWGO1OOOO65 clade 85 N N Bacteroides Oleicipientis 286 ABS47644 clade 85 N N US 2016/0158294 A1 Jun. 9, 2016 65

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bacteroides pyogenes 290 NR 041280 e 85 Bacteroides sp. 315 5 300 FJ848S47 e 85 Bacteroides sp. 31SF15 301 AJS83248 e 85 Bacteroides sp. 31SF18 3O2 AJS83249 e 85 Bacteroides sp. 35AE31 3O3 AJS83244 e 85 Bacteroides sp. 35AE37 3O4 AJS83245 e 85 Bacteroides sp. 35BE34 3OS AJS83246 e 85 Bacteroides sp. 35BE35 306 AJS83247 e 85 Bacteroides sp. WH2 324 AY89518O e 85 Bacteroides sp. XB12B 325 AM230648 e 85 Bacteroides stercoris 327 ABFZO2OOOO22 e 85 Actinobacilius pietiropneumoniae 46 NR 074857 e 88 Actinobacilius tireae 48 AEVGO1OOO167 e 88 Haemophilus aegyptius 969 AFBCO1OOOOS3 e 88 Haemophilus ducreyi 97O AEO17143 e 88 P Haemophilus haemolyticus 973 JN175335 e 88 Haemophilus influenzae 974 AADPO1OOOOO1 e 88 P Haemophilus parahaemolyticus 975 US 61425 e 88 Haemophilus parain fittenzae 976 EWUO1OOOO24 e 88 Haemophilus paraphrophaemolyticuts 977 75076 e 88 Haemophilus Somnus 979 C 008309 e 88 Haemophilus sp. 70334 98O Q680854 e 88 Haemophilus sp. HK445 981 685624 e 88 Haemophilus sp. oral clone ASCAO7 982 AY923117 e 88 Haemophilus sp. oral clone ASCGO6 983 AY923.147 e 88 Haemophilus sp. oral clone BJO21 984 AYOOSO34 e 88 Haemophilus sp. oral clone BJO95 985 AYOO5033 e 88 Haemophilus sp. oral taxon 851 987 AGRKO1OOOOO4 e 88 Haemophilus spittortin 988 AFNKO1OOOOOS e 88 Histophilus somni OO3 AFS49387 e 88 Mannheimia haemolytica 195 ACZXO1OOO102 e 88 Pasteurella bettyae 433 LO6088 e 88 Moellereia wisconsensis 2S3 JN175344 e 89 Morganella morgani 26S AJ3O1681 e 89 Morganella sp. JB T16 266 AJ781OOS e 89 Proteus mirabilis S82 ACLEO1 OOOO13 e 89 Proteus penneri 583 ABVPO1 OOOO20 e 89 Proteus sp. HS7514 584 DQ512963 e 89 Proteus vulgaris 585 A233.425 e 89 Oribacterium sinus 374. ACKX1000142 e 90 Oribacterium sp. ACB1 375 HM120210 e 90 Oribacterium sp. ACB7 376 HM120211 e 90 Oribacterium sp. CM12 377 HQ616374 e 90 Oribacterium sp. ICM51 378 HQ616397 e 90 Oribacterium sp. OBRC12 379 HQ616355 e 90 Oribacterium sp. oral taxon 108 382 AFIHO1 OOOOO1 e 90 Actinobacilius actinomycetemcomitans 44 AY362885 e 92 Actinobacilius Sticcinogenes 47 CPOOO746 e 92 Aggregatibacter actinomycetemcomitans 112 CPOO1733 e 92 Aggregatibacter aphrophilus 113 CPOO16O7 e 92 Aggregatibacter Segnis 114 AEPSO1OOOO17 e 92 Averveila dailhousiensis 194 DQ481464 e 92 Bisgaard Taxon 368 AY683487 e 92 Bisgaard Taxon 369 AY6834.89 e 92 Bisgaard Taxon 370 AY683491 e 92 Bisgaard Taxon 371 AY683492 e 92 Buchnera aphidicola 440 NR 074609 e 92 Cedecea davisae 499 AF493976 e 92 Citrobacter amationaicus S17 FR870441 e 92 Citrobacter braaki 518 NR 028687 e 92 Citrobacter farmeni 519 AFO253.71 e 92 Citrobacter fieundi 520 NR 028894 e 92 Citrobacter gillenii S21 AFO2S367 e 92 Citrobacter koseri 522 NC O09792 e 92 Citrobacter muriniae S23 AFO2S369 e 92 Citrobacter rodentium 524 NR 074903 e 92 Citrobactersediaki S25 AFO2S364 e 92 Citrobacter sp. 30 2 526 ACDJO1 OOOOS3 e 92 Citrobacter sp. KMSI 3 527 GQ468398 e 92 Citrobacter werkmani 528 AFO25373 e 92 Citrobacter votingae 529 ABWLO2OOOO11 e 92 Cronobacter maionaticus 737 GU122174 e 92 Cronobacter Sakazaki 738 NC 009.778 e 92 Cronobacteriuricensis 739 FN543093 e 92 US 2016/0158294 A1 Jun. 9, 2016 66

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Enterobacter aerogenes 786 A251468 e 92 Enterobacter as buriae 787 NR 024640 e 92 Enterobacter cancerogenits 788 Z96O78 e 92 Enterobacter cloacae 789 FP929O40 e 92 Enterobacter cowanii 790 NR 025566 e 92 Enterobacter hormaechei 791 AFHRO1 OOOO79 e 92 Enterobacter sp. 247BMC 792 HQ122932 e 92 Enterobacter sp. 638 793 NR 074777 e 92 Enterobacter sp. JC163 794 JN657217 e 92 Enterobacter sp. SCSS 795 HMOOf811 e 92 Enterobacter sp. TSE38 796 HM1561.34 e 92 Enterobacteriaceae bacterium 9 2 54FAA 797 ADCUO1 OOOO33 e 92 Enterobacteriaceae bacterium CFO1Ent 1 798 A489826 e 92 Enterobacteriaceae bacterium Smarlab 3302238 799 AYS38694 e 92 Escherichia albertii 824 ABKXO1 OOOO12 e 92 Escherichia coi 825 NC OO8563 e 92 ategory-B Escherichiafergusonii 826 CU9281.58 e 92 Escherichia hermannii 827 HQ407266 e 92 Escherichia sp. 1 1. 43 828 ACIDO1 OOOO33 e 92 Escherichia sp. 4 1 40B 829 ACDMO2OOOOS6 e 92 Escherichia sp. B4 830 EU722735 e 92 Escherichia vulneris 831 NR 041927 e 92 Ewingelia americana 877 JN175329 e 92 Haemophilus genomosp. P2 oral clone MB3 C24 971 DQ003621 e 92 Haemophilus genomosp. P3 oral clone MB3 C38 972 DQ003635 e 92 Haemophilus sp. oral clone JM053 986 AY349380 e 92 Hafnia alvei 989 DQ412565 e 92 Klebsiella Oxytoca O24 AY29.2871 e 92 Klebsiella pneumoniae O2S CPOOO647 e 92 Klebsiella sp. AS10 026 HQ616362 e 92 Klebsiella sp. Co9935 027 DQ068764 e 92 Klebsiella sp. enrichment culture clone SRC DSD25 O36 HM195210 e 92 Klebsiella sp. OBRC7 028 HQ616353 e 92 Klebsiella sp. SP BA O29 FJ999767 e 92 Klebsiella sp. SRC DSD1 O33 GUT 97254 e 92 Klebsiella sp. SRC DSD11 O3O GUT 97.263 e 92 Klebsiella sp. SRC DSD12 O31 GU797264 e 92 Klebsiella sp. SRC DSD15 O32 GUT97267 e 92 Klebsiella sp. SRC DSD2 O34 GUT 97253 e 92 Klebsiella sp. SRC DSD6 O35 GUT 97258 e 92 Kiebsiella varicola O37 CPOO1891 e 92 Kluyvera as Corbata O38 NR 028677 e 92 Kluyvera cryocrescens O39 NR 028803 e 92 Leminorella grimontii 159 AJ233421 e 92 Leminorelia richardi 160 HFSS8368 e 92 Pantoea agglomerans 409 AY335552 e 92 Pantoea ananatis 410 CPOO1875 e 92 Pantoea brenneri 411 EU21673S e 92 Panioea citrea 412 EF6880O8 e 92 Pantoea conspictia 413 EU216737 e 92 Pantoea septica 414 EU216734 e 92 Pastetirella dagmatis 434 ACZRO1 OOOOO3 e 92 Pasteureia mitocida 435 NC 002663 e 92 Plesiomonas Shigelioides 469 X60418 e 92 Raouitella ornithinolytica 617 AB364958 e 92 Raouitella planticola 618 AF129443 e 92 Raouitella terrigena 619 NR 037085 e 92 Salmonella bongori 683 NR 041699 e 92 Category-B Saimoneia enterica 672 NC 01.1149 e 92 Category-B Saimoneia enterica 673 NC 011205 e 92 Category-B Saimoneia enterica 674 DQ344532 e 92 Category-B Saimoneia enterica 675 ABEHO2OOOOO4 e 92 Category-B Saimoneia enterica 676 ABAKO2OOOOO1 e 92 Category-B Saimoneia enterica 677 NC 01108O e 92 Category-B Saimoneia enterica 678 EU 118094 e 92 Category-B Saimoneia enterica 679 NC 011094 e 92 Category-B Saimoneia enterica 680 AEO14613 e 92 Category-B Saimoneia enterica 682 ABFHO2OOOOO1 e 92 Category-B Saimoneia enterica 684 ABEMO1(OOOOO1 e 92 Category-B Saimoneia enterica 685 ABAMO2OOOOO1 e 92 Category-B Salmonella typhimurium 681 DQ344533 e 92 Category-B Salmonella typhimurium 686 AF1701.76 e 92 Category-B Serratia fonticola 718 NR 025339 e 92 N Serraia liquefaciens 719 NR 042062 e 92 N US 2016/0158294 A1 Jun. 9, 2016 67

TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Serraia marcescens 172O GU826157 e 92 N Serratia odorifera 1721 ADBYO1 OOOOO1 e 92 N Serraia proteanachtians 1722 AAUNO1 OOOO15 e 92 N Shigella boydii 1724 AAKAO1OOOOO7 e 92 Category-B Shigella dysenteriae 1725 NC 007 606 e 92 Category-B Shigella flexneri 1726 AEOOS674 e 92 Category-B Shigella sonnei 1727 NC 007384 e 92 Category-B Tattimelia ptyseos 1916 NR 025342 e 92 N Trabilisiella gliamensis 1925 AYST3830 e 92 N Yersinia aidovae 2019 AJ871363 e 92 OP Yersinia aleksiciae 2020 A627597 e 92 OP Yersinia bercovieri 2021 AF366377 e 92 OP Yersinia enterocolitica 2022 FR729477 e 92 Category-B Yersinia fiederiksenii 2023 AF366379 e 92 OP Yersinia intermedia 2O24 AF3.6638O e 92 OP Yersinia kristensenii 2O2S ACCAO1 OOOO78 e 92 OP Yersinia moiareii 2026 NR 027546 e 92 OP Yersinia pestis 2O27 AEO13632 e 92 Category-A Yersinia pseudotuberculosis 2028 NC OO9708 e 92 OP Yersinia rohdei 2O29 ACCDO1 OOOO71 e 92 OP Yokenelia regensburgei 2O3O AB273739 e 92 Conchiformibius kuhniae 669 NR 041821 e 94 Morococcus cerebrosus 267 JN175352 e 94 Neisseria baciliiformis 328 AFAYO1OOOOS8 e 94 Neisseria cinerea 329 ACDYO1 OOOO37 e 94 Neisseria flavescens 331 ACQVO1000025 e 94 Neisseria gonorrhoeae 333 CPOO2440 e 94 P Neisseria iacianica 334 ACEQ01000095 e 94 Neisseria macacae 335 AFOE01000146 e 94 Neisseria meningitidis 336 NC 003112 e 94 P Neisseria inticosa 337 ACDXO1OOO110 e 94 Neisseria pharyngis 338 A239281 e 94 Neisseria polysaccharea 339 ADBEO1OOO137 e 94 Neisseria Sicca 340 ACKOO2OOOO16 e 94 Neisseria sp. KEM232 341 GQ203291 e 94 Neisseria sp. oral clone AP132 344 AYOOSO27 e 94 Neisseria sp. oral strain B33KA 346 AYOOSO28 e 94 Neisseria sp. oral taxon 014 347 ADEAO1 OOOO39 e 94 Neisseria sp. TM10 1 343 DQ279352 e 94 Neisseria subflava 348 ACEOO1OOOO67 e 94 Okadaella gastrococci is 365 HQ6994.65 e 98 Streptococci is agaiactiae 785 AAJOO1OOO130 e 98 Streptococci is alactolyticits 786 NR 041781 e 98 Streptococcusatistralis 788 AEQRO1000024 e 98 Streptococcus bovis 789 AEELO1OOOO3O e 98 Streptococci is Canis 790 A4132O3 e 98 Streptococci is constellatus 791 AY277942 e 98 Streptococci is cristatus 792 AEWCO1OOOO28 e 98 Streptococci is dysgalaciae 794 APO10935 e 98 Streptococci is equi 795 CPOO1129 e 98 Streptococci is equinus 796 AEVBO1OOOO43 e 98 Streptococci is gallolyticits 797 FR824O43 e 98 Streptococci is genomosp. C1 798 AY278629 e 98 Streptococci is genomosp. C2 799 AY278630 e 98 Streptococci is genomosp. C3 800 AY278631 e 98 Streptococci is genomosp. C4 8O1 AY278632 e 98 Streptococci is genomosp. C5 8O2 AY278633 e 98 Streptococci is genomosp. C6 803 AY278634 e 98 Streptococci is genomosp. C7 804 AY278635 e 98 Streptococci is genomosp. C8 80S AY278609 e 98 Streptococci isgordonii 806 NC OO9785 e 98 Streptococci is infantarius 807 ABJKO2OOOO17 e 98 Streptococci is infantis 808 AFNNO1OOOO24 e 98 Streptococci is intermedius 809 NR 028736 e 98 Streptococci is lutetiensis 810 NR 037.096 e 98 Streptococci is massiliensis 811 AY769997 e 98 Streptococci is mitis 813 AM15742O e 98 Streptococci is oligofermenians 815 AYO9909S e 98 Streptococci is oralis 816 ADMVO1 OOOOO1 e 98 Streptococci is parasanguinis 817 AEKMO1 OOOO12 e 98 Streptococci is pasteuriants 818 APO12O54 e 98 Streptococci is peroris 819 AEVFO1 OOOO16 e 98 Streptococci is pneumoniae 82O AEOO8537 e 98 Streptococci is porcinus 821 EF121439 e 98 US 2016/0158294 A1 Jun. 9, 2016 68

TABLE 1-continued

SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status

Streptococci is pseudopneumoniae 822 FJ827123 e 98 Streptococci is pseudoporcinus 823 AENSO1 OOOOO3 e 98 Streptococci is pyogenes 824 AEOO6496 e 98 P Streptococci is ratti 825 XS8304 e 98 Streptococci is sanguinis 827 NR 074974 e 98 Streptococci is Sinensis 828 AF43.2857 e 98 Streptococci is sp. 2. 1 36FAA 831 ACOIO1 OOOO28 e 98 Streptococcus sp. 2285 97 830 AJ131.96S e 98 Streptococcus sp. ACS2 834 HQ616360 e 98 Streptococcus sp. AS20 835 HQ616366 e 98 Streptococcuss 836 HQ616369 e 98 Streptococcuss C150 837 ACRIO1OOOO45 e 98 Streptococcuss CM6 838 HQ616372 e 98 Streptococcuss ICM10 840 HQ616389 e 98 Streptococcuss ICM12 841 HQ616390 e 98 Streptococcuss ICM2 842 HQ616386 e 98 Streptococcuss ICM4 844 HQ616387 e 98 Streptococcuss ICM45 843 HQ616394 e 98 Streptococcuss M143 845 ACRKO1 OOOO2S e 98 Streptococcuss M334 846 ACRLO1 OOOOS2 e 98 Streptococcuss one ASBO2 849 AY923121 e 98 Streptococci is sp. ora one ASCAO3 850 DQ272504 e 98 Streptococci is sp. ora one ASCA04 851 AY923116 e 98 Streptococci is sp. ora one ASCAO9 852 AY923119 e 98 Streptococci is sp. ora one ASCBO4 853 AY923.123 e 98 Streptococcuss O One ASCBO6 854 AY923,124 e 98 Streptococcuss O8. one ASCCO)4 855 AY923127 e 98 Streptococci is sp. ora one ASCCOS 856 AY923128 e 98 Streptococci is sp. ora one ASCC12 857 DQ272507 e 98 Streptococci is sp. ora one ASCDO1 858 AY923129 e 98 Streptococci is sp. ora one ASCD09 859 AY923.130 e 98 Streptococci is sp. ora one ASCD10 860 DQ272509 e 98 Streptococci is sp. ora one ASCEO3 861 AY923.134 e 98 Streptococci is sp. ora one ASCEO)4 862 AY95.3253 e 98 Streptococci is sp. ora one ASCEOS 863 DQ272510 e 98 Streptococci is sp. ora one ASCEO6 864 AY923135 e 98 Streptococci is sp. ora one ASCEO9 865 AY923136 e 98 Streptococci is sp. ora one ASCE10 866 AY923.137 e 98 Streptococci is sp. ora one ASCE12 867 AY923138 e 98 Streptococci is sp. ora one ASCFOS 868 AY923140 e 98 Streptococci is sp. ora one ASCFO7 869 AY95.3255 e 98 Streptococci is sp. ora one ASCFO9 870 AY923.142 e 98 Streptococci is sp. ora one ASCG04 871 AY923.145 e 98 Streptococci is sp. ora one BWOO9 872 AYOOSO42 e 98 Streptococci is sp. ora one CHO16 873 AYOOSO44 e 98 Streptococci is sp. ora one GKOS1 874 AY3494.13 e 98 Streptococci is sp. ora one GMOO6 875 AY349414 e 98 Streptococci is sp. ora One P2PA 41 P2 876 AY2O7051 e 98 Streptococci is sp. ora One P4PA 30 P4 877 AY2O7064 e 98 Streptococcuss oral taxon 071 878 AEEPO1 OOOO19 e 98 Streptococcus sp. oral taxon G59 879 GU432132 e 98 Streptococci is sp. oral taxon G62 880 GU432.146 e 98 Streptococci is sp. oral taxon G63 881 GU4321SO e 98 Streptococci is stiis 882 FM2S2O32 e 98 Streptococcus thermophilus 883 CPOOO419 e 98 Streptococci is salivarius 826 AGBVO1OOOOO1 e 98 Streptococci is liberis 884 HQ391900 e 98 Streptococci is tirina is 885 DQ303194 e 98 Streptococcus vestibularis 886 AEKOO1 OOOOO8 e 98 Streptococcus viridans 887 AFO76036 e 98 Synergistetes bacterium oral clone 035 D05 908 GU227.192 e 98 US 2016/0158294 A1 Jun. 9, 2016 69

TABLE 2 TABLE 3-continued Species isolated from ethanol treated spore preparation preparation Representative diseases, disorders and conditions potentially before (left) and after (right) CSCI gradient step associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. ethanol treated, ethanol treated gradient purified Adult respiratory distress syndrome Isolates spore preparation spore preparation Adult T-cell lymphoma Adult varicella zoster virus infection Bacilius coaglians 7 2 Advanced solid tumor Biatitia initi 1 Agammaglobulinemia Bialitia sp 14 13 Age related macular degeneration Bialitia welerae 3 Aggression Ruminococcus obeum 4 2 Aggressive fibromatosis Clostridiales sp 1 2 Aging Cliostridium aerotoierans 1 2 Agitation Clostridium disporicum O AL amyloidosis Clostridium sp 1 Albuminuria Clostridium symbiosum O Alcoholism (and effects) Dorea longicatena 8 6 Alkaptonuria Eubacterium ceilutioSolvens 1 O Allergic conjunctivitis Eubacterium ventriosum 2 2 Allergic rhinitis Gemmiger formicilis O Allergy Robinsoniella peoriensis O Alopecia Roseburia hominis 3 6 Alopecia areata Roseburia intestina is 9 7 Alpha mannosidosis Raiminococci is sp 5 2 Alpha-1 antitrypsin deficiency S. ALS wntrophococcits sticromtitans 1 Alzheimers disease Turicibacter sanguinis 3 4 Amenorrhea Clostridiales sp 7 9 Amnesia Cliostridium bartietti 8 1 Amoeba infection Clostridium irregulare O Amoebic liver abscess Cliostridium sordei 4 6 Amphetamine dependence Lachnospiraceae sp 1 O Amyloidosis Anal cancer Anal fissure Anal fistula TABLE 3 Anal tumor Anaplastic astrocytoma Representative diseases, disorders and conditions potentially Anaplastic large cell lymphoma associated with a dysbiosis, which are suitable for treatment Anemia with the compositions and methods of the invention. AnesthesiaAngina Abdominal abscess Angioedema Abdominal cavity inflammation Angiomyolipoma Abscess Angiosarcoma Absidia infection Angle closure glaucoma Achromatopsia Ankylosing spondylitis Acidemia Anorexia nervosa Acinetobacter baumanii infection Anovulation Acinetobacter infection Antibiotic treatment Acinetobacter twofii infection Antiphospholipid syndrome Acne Antitbiotic associated diarrhea Acne Vulgaris Anus pain Acoustic neuroma Anxiety disorder Acromegaly Aortic aneurysm Actinomyces israeli infection Aortic stenosis Acute bronchitis Aplastic anemia Acute chest syndrome Apnea Acute coronary syndrome Appendicitis Acute decompensated heart failure Appetite loss Acute external otitis Arterial occlusive disease Acute lung injury Arterial thrombosis Acute lymphoblastic leukemia Arteriosclerosis Acute myelogenous leukemia Arteriovenous malformation Acute promyelocytic leukemia Artery disease Acute sinusitis Arthralgia Addison's disease Arthritis Adenocarcinoma Ascites Adenoid hypertrophy Asperger syndrome Adenoma Aspergillus finigatus infection Adenomyosis Aspergillus infection Adenosine deaminase deficiency Asthma Adenovirus infection Astrocytoma Adhesive capsulitis Ataxiatelangiectasia Adrenal cortical carcinoma Atherosclerosis Adrenal gland hypofunction Atopic dermatitis Adrenomyeloneuropathy Atopy Allergic Sensitivity US 2016/0158294 A1 Jun. 9, 2016 70

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Atrial fibrillation Brain disease Atrial flutter Brain hemorrhage Atrophic vaginitis Brain infarction Atrophy Brain injury Attention deficit hyperactivity disorder Brain ischemia Autism Brain tumor Autoimmune disease Breast cancer Autoimmune hemolytic anemia Breast disease Autosomal dominant polycystic kidney disease Breast tumor B-cell acute lymphoblastic leukemia Bronchiectasis B-cell lymphoma Bronchiolitis Bacilius anthracis infection Bronchitis Bacilius infection Bronchospasm Back pain Bruceiia infection Bacteremia Budd Chiari syndrome Bacterial endocarditis Bulimia nervosa Bacterial eye infection Burkhoideria infection Bacterial infection Burkitts lymphoma Bacterial meningitis Bursitis Bacterial pneumonia Cachexia Bacterial respiratory tract infection Campylobacter fetus infection Bacterial skin infection Campylobacter infection Bacterial susceptibility Campylobacterieitini infection Bacterial urinary tract infection Cancer Bacterial vaginosis Cancer pain Bacteroides caccae infection Candida albicans infection Bacteroides fragilis infection Candida infection Bacteroides infection Candida krusei infection Bacteroides theiaioiaomicron infection Capillary leak syndrome Bacteroides uniformis infection Carbamoyl phosphate synthase I deficiency Bacteroides vulgatus infection Carcinoid syndrome Balanitis Carcinoid tumor Bariatric Surgery Carcinoma Bartholinitis Cardiac edema Bartonella baciliiformis infection Cardiac failure Bartoneia infection Cardiac hypertrophy Basal cell carcinoma Cardiac reperfusion injury Becker muscular dystrophy Cardiotoxicity drug-induced Behcets disease Cardiovascular disease Beta thalassemia Carnitine palmitoyltransferase deficiency Bifidobacterium infection Cartilage disease Biliary cancer Castlemans disease Biliary cirrhosis Cataplexy Biliary tract disease Cataract Biliary tract infection Celiac Disease Biliary tumor Cellulitis Binge eating disorder Central nervous system disease Bipolar disorder Central nervous system injury Bipolar I disorder Central nervous system tumor Birth complication Cerebral edema BK virus infection Cerebral hemorrhage Bladder cancer Cerebral hypoxia Bladder tumor Cerebral infarction Biastomyces infection Cerebral palsy Bleeding Cerebrotendinous xanthomatosis Blepharitis Cerebrovascular disease Blepharospasm Cerebrovascular ischemia Blood clotting disorder Cervical dysplasia Blood clotting factor deficiency Cervical dystonia Blood transfusion Cerviciitis Bone and joint infection Cervix disease Bone disease Cervix infection Bone infection Cervix injury Bone injury Chemotherapy induced nausea and vomiting Bone marrow disease Chemotherapy-induced diarrhea Bone marrow failure Chemotherapy-induced emesis Bone marrow transplantation Chlamydia infection Bone metastases Chlamydia pneumoniae infection Bone resorption Chlamydia trachomatis infection Bone tumor Chlamydiae infection Bordeteila pertissis infection Cholangiocarcinoma Borrelia burgdorferi infection Cholangitis Borreia recurrentis infection Cholecystitis US 2016/0158294 A1 Jun. 9, 2016 71

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Cholelithiasis Corynebacterium infection Cholesteryl ester storage disease Cough Chondrosarcoma Coxieia infection Chorioretinitis CRE infection Choroidal neovascularization Crohns disease Choroiditis Cryopyrin associated periodic syndrome Chromoblastomycosis Cryptococci is infection Chronic bronchitis Cryptococci is neoformans infection Chronic fatigue syndrome Cryptococci is neoformans meningitis Chronic granulomatous disease Cryptosporidium infection Chronic infection Cushings disease Chronic inflammatory demyelinating polyneuropathy Cutaneous lupus erythematosus Chronic lymphocytic leukemia Cutaneous T-cell lymphoma Chronic myelocytic leukemia Cystic fibrosis Chronic obstructive airway disease Cystic hygroma Chronic obstructive pulmonary disease Cystinosis Chronic Polio Shedders Cystinuria Chronic thromboembolic pulmonary hypertension Cystitis Churg-Strauss syndrome Cytomegalovirus infection CINCA syndrome Dacryocystitis Circadian rhythm sleep disorder Deafness Cirrhosis Decubitus ulcer Citrobacter infection Deep vein thrombosis Citrullinuria Degenerative disc disease Cladophiaiophora infection Dementia Clostridiaceae infection Dengue virus infection Cliostridium bointinum infection Depression Clostridium difficile infection Dermatitis Cliostridium infection Dermatofibrosarcoma Cliostridium tetani infection Dermatological disease Cluster headache Dermatomycosis CMV retinitis Dermatomyositis Coats disease Dermatophytosis Cocaine addiction Diabetes insipidus Coccidioides infection Diabetes mellitus Cognitive disorder Diabetic complication Cold agglutinin disease Diabetic foot ulcer Colitis Diabetic ketoacidosis Colon cancer Diabetic macular edema Colon polyps Diabetic nephropathy Colon tumor Diabetic neuropathy Colorectal cancer Diabetic retinopathy Colorectal tumor Diarrhea Common cold Diarrhea predominant irritable bowel syndrome Compensated liver cirrhosis Diastolic heart failure Complement diseases Diffuse large B-cell lymphoma Complex partial seizure Digoxin overdose Complex regional pain syndrome Discoid lupus erythematosus Complicated skin and skin structure infection Disseminated intravascular coagulation Complicated urinary tract infection Diverticulitis Compulsive gambling Diverticulosis Condyloma DNA virus infection Congenital adrenal hyperplasia Drug withdrawal syndrome Congenital heart defect Dry age related macular degeneration Congenital hemophilia Duchenne dystrophy Congestive heart failure Dumping syndrome Conjunctiva disease Duodenal ulcer Conjunctival neoplasm Dupuytren contracture Conjunctivitis Dysgeusia Connective tissue disease Dysmenorrhea Constipation Dyspareunia Constipation predominant irritable bowel syndrome Dyspepsia Contact dermatitis Dystonia Contraception Dysuria Copper metabolism disorder Ebola virus infection Corneal disease Eczema Corneal injury Edema Corneal transplant rejection Eisenmenger syndrome Corneal transplantation Embolism Corneal ulcer Emesis Coronary artery disease Emotional lability Coronary thrombosis Emphysema Corynebacterium diphtheriae infection Empyema US 2016/0158294 A1 Jun. 9, 2016 72

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. End stage renal disease Flavivirus infection Endocarditis Folic acid deficiency Endocrine disease Follicle center lymphoma Endocrine tumor Folliculitis Endometrioid carcinoma Food Allergy Endometriosis Food poisoning Endophthalmitis Fragile X syndrome Entamoeba histolytica infection Franciseia initiatensis infection Enteritis Friedreich ataxia Enterobacter aerogenes infection Frontotemporal dementia Enterobacter cloacae infection Functional bowel disorder Enterobacter infection Fungal infection Enterobacteriaceae infection Fungal meningitis Enterococci is faecalis infection Fungal respiratory tract infection Enterococci is faecium infection Fungal urinary tract infection Enterococcus infection Fusarium infection Enterocolitis Fusobacterium infection Enterotoxigenic Escherichia coli (ETEC) Galactorrhea Enterovirus 71 infection Gallbladder tumor Enuresis GALT Eosinophilic esophagitis Gastric injury Ependymoma Gastric motility disorder Epidermolysis bullosa Gastric ulcers Epidermophyton infection Gastritis Epididymitis Gastroesophageal reflux Epididymo-orchitis Gastrointestinal disease Epilepsy Gastrointestinal infection Epstein Barr virus infection Gastrointestinal pain Erectile dysfunction Gastrointestinal stromal tumor Erysipelas Gastrointestinal tumor Erythema Gastrointestinal ulcer Erythema multiforme Gastroparesis Erythema nodosum leprae Gaucher disease Erythropoietic protoporphyria Gauchers disease type I ESBL (Extended Spectrum Beta Lactamase) Producing Bacterial Infection Gauchers disease type III Escherichia Coi infection General anesthesia Esophageal cancer Generalized anxiety disorder Esophageal varices Genetic disorder Esophagitis Genital herpes Esophagus tumor Genital system disease Essential hypertension Genital tract infection Estrogen deficiency Genital ulcer Ewing sarcoma Genitourinary disease Exocrine pancreatic insufficiency Genitourinary tract tumor Exophiaia infection Germ cell and embryonic cancer Extrinsicallergic alveolitis Gestational diabetes Fabry disease Giant bone cell tumor Factor I deficiency Giardia iambia infection Factor II deficiency Gigantism Factor IX deficiency Gingivitis Factor VII deficiency Glaucoma Factor VIII deficiency Glaucoma Surgical procedure Factor XIII deficiency Glioblastoma Fallopian tube cancer Glioma Fallopian tube tumor Gliosarcoma Familial adenomatous polyposis Glomerulonephritis Familial amyloid neuropathy Glossitis Familial cold autoinflammatory syndrome Glucose intolerance Familial hypercholesterolemia Goiter Familial mediterranean fever Gout Fascioia hepatica infection Graft versus host disease Fatigue Gram negative bacterium infection Febrile neutropenia Gram positive bacterium infection Fecal incontinence Granulomatosis Female contraception Growth disorder Female genital tract infection Growth hormone deficiency Female genital tract tumor Guillain Barre syndrome Female infertility Gynecological disorder Female sexual dysfunction Gynecomastia Fewer Haemophilus aegypius infection Fibromyalgia Haemophilus ducreyi infection Fibrosis Haemophilus infection Fistula Haemophilus influenzae infection US 2016/0158294 A1 Jun. 9, 2016 73

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Haemophilus parain fittenzae infection Hyperkalemia Hairy cell leukemia Hyperlipidemia Hallervorden-Spatz syndrome Hyperlipoproteinemia type I Hantavirus infection Hypernatremia Head and neck tumor Hyperoxaluria Headache Hyperparathyroidism Hearing loss Hyperphosphatemia Heart arrhythmia Hyperpigmentation Heart disease Hyperprolactinemia Heart transplant rejection Hypersensitivity Helicobacter pylori infection Hypersomnia Helminth infection Hypertension Hemangioma Hyperthyroidism Hematological disease Hypertriglyceridemia Hematological neoplasm Hypertrophic cardiomyopathy Henatona Hyperuricemia Hematopoietic stem cell transplantation Hypoalbuminemia Hemiplegia Hypocalcemia Hemochromatosis Hypogammaglobulinemia Hemoglobinopathy Hypoglycemia Hemolytic anemia Hypogonadism Hemolytic uremic syndrome Hyponatremia Hemophilia Hypoparathyroidism Hemorrhagic shock Hypophosphatasia Hemorrhoids Hypophosphatemia Heparin induced thrombocytopenia Hypotension Hepatic edema Hypothyroidism Hepatic encephalopathy Hypovolemia Hepatic porphyria chthyosis Vulgaris Hepatitis diopathic pulmonary fibrosis Hepatitis A virus infection gA nephropathy Hepatitis B virus infection (US Hepatitis C virus infection mmediate type hypersensitivity Hepatitis D virus infection mmune complex disease Hepatitis E virus infection mmune deficiency Hepatitis virus infection mmune disorder Hepatobiliary disease mmune thrombocytopenic purpura Hepatobiliary system tumor mmunocompromised Hepatocellular carcinoma mmunoglobulin G deficiency Hepatorenal syndrome mpetigo Hereditary angioedema nappropriate ADH syndrome Herpes simplex virus infection nborn error of metabolism Herpesvirus infection inclusion body myositis Herpetic keratitis indigestion Hidradenitis infantile spasms Hidradenitis Suppurativa infectious arthritis Hippel Lindau syndrome infectious disease Histoplasma infection infectious endocarditis HIV infection infertility HIV-1 infection inflammatory bowel disease HIV-2 infection inflammatory disease HIV-associated lipodystrophy influenza virus A infection Hodgkins disease influenza virus B infection Homocystinuria influenza virus infection Hormone deficiency njury Hormone dependent prostate cancer nsomnia Hormone refractory prostate cancer insulin dependent diabetes Hot flashes intermittent claudication HSV-1 infection interstitial cystitis HSV-2 infection interstitial lung disease Human T cell leukemia virus 1 infection intervertebral disc disease Hunter syndrome intestine disease Huntingtons chorea intestine infection Hydrocephalus intoxication Hyperactivity ritis Hyperammonemia ron deficiency anemia Hyperandrogenism ron metabolism disorder Hyperbilirubinemia ron overload Hypercalcemia rritable bowel syndrome Hypercholesterolemia Schemia Hypereosinophilic syndrome Schemic heart disease Hyperglycemia Schemic stroke Hyperhidrosis slet cell transplant rejection US 2016/0158294 A1 Jun. 9, 2016 74

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. apanese encephalitis virus infection Lupus erythematosus panniculitis aundice Lupus nephritis aw disease Lyme disease oint disease Lymphadenitis oint infection Lymphadenopathy uvenile myoclonic epilepsy Lymphangioleiomyomatosis uvenile rheumatoid arthritis Lymphangitis Kaposis sarcoma Lymphatic system disease Kawasaki disease Lymphedema Keratitis Lymphoblastic leukemia Keratoconjunctivitis Lymphoid leukemia Keratosis Lymphoma Kidney dialysis Lysosomal acid lipase deficiency Kidney transplant rejection Macroglobulinemia Klebsiella granulomatis infection Macular disease Kiebsiella infection Macular edema Klebsiella pneumoniae infection Macular telangiectasia 2 Labor complication Major depressive disorder Lacrimal gland disease Male contraception Lactation disorder Male hypogonadism Lambert-Eaton syndrome Male infertility Large intestine tumor Male osteoporosis Laron syndrome Male sexual dysfunction Laryngitis Mania Laryngopharyngitis Mantle cell lymphoma Lebers hereditary optic atrophy Marburg virus infection Left heart disease pulmonary hypertension Marginal Zone B-cell lymphoma Leg ulcer Maroteaux-Lamy syndrome Legionelia infection Mastalgia Legionella pneumophila infection Mastitis Leigh disease Mastocytosis Leishmania braziensis infection Mastoiditis Leishmania donovani infection Measles virus infection Leishmania infection Meconium aspiration syndrome Leishmania tropica infection Medullary thyroid cancer Lennox Gastaut syndrome Medulloblastoma Leprosy Melanoma Leptospiraceae infection Membranoproliferative glomerulonephritis Lesch Nyhan syndrome Membranous glomerulonephritis Leukemia MEN1 Leukopenia MEN2 Leukopenia drug induced Meningioma Leukoplakia Meningitis Lewy body dementia Menopause Lichen Menorrhagia Lipid metabolism disorder Menstruation disorder Lipodystrophy Mental deficiency Lipoma Merkel cell carcinoma Lipoprotein lipase deficiency Mesothelioma Liposarcoma Metabolic bone disease Listeria monocytogenes infection Metabolic disorder Listerosis Metabolic Syndrome Liver abscess Metabolic syndrome X Liver cancer Metal intoxication Liver cirrhosis Metastasis Liver disease Metastatic brain cancer Liver fibrosis Metastatic breast cancer Liver injury Metastatic colon cancer Liver transplant rejection Metastatic colorectal cancer Liver tumor Metastatic esophageal cancer Lower back pain Metastatic gastrointestinal cancer Lower limb fracture Metastatic head and neck cancer Lower respiratory tract infection Metastatic liver cancer Lung abscess Metastatic lung cancer Lung cancer Metastatic non Small cell lung cancer Lung disease Metastatic ovary cancer Lung disease pulmonary hypertension Metastatic pancreas cancer Lung embolism Metastatic prostate cancer Lung infection Metastatic renal cancer Lung inflammation Metastatic stomach cancer Lung malformation Methylmalonic acidemia Lung transplant rejection Metrorrhagia Lung tumor Micrococcaceae infection US 2016/0158294 A1 Jun. 9, 2016 75

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Micrococcus infection Nephrotic syndrome Microsporidial infection Nerve injury Microsporum infection Nerve tumor Migraine Neuroblastoma Mild cognitive impairment Neurodegenerative disease Mitochondrial disease Neuroendocrine tumor Molluscum contagiosum infection Neurofibromatosis Monkeypox virus infection Neurofibromatosis type I Moraxeiia caiarrhais infection Neurological disease Moraxeia infection Neuromuscular blockade Morganella infection Neuromuscular disease Morganella morganii infection Neuromyelitis optica Morning sickness Neuropathic pain Morquio syndrome Neuropathy Motion sickness Neutropenia Motor neurone disease Nicotine dependence Mouth tumor Niemann Pick disease type C Mouth ulcer Nocturia Movement disorder Non alcoholic fatty liver disease MRSA infection Non segmental vitiligo Muckle Wells syndrome Non Small cell lung cancer Mucopolysaccharidosis type I Non-alcoholic steatohepatitis Mucor infection Non-Hodgkin lymphoma Mucositis Non-insulin dependent diabetes Multidrug resistant infection Non-Small-cell lung cancer Multiple myeloma Obesity Multiple sclerosis Obsessive compulsive disorder Mumps virus infection Obstructive sleep apnea Muscle hypertonia Occlusive coronary artery disease Muscle injury Ocular cystinosis Muscle spasm Ocular disease Muscle weakness Ocular hypertension Muscular dystrophy Ocular infection Musculoskeletal disease Ocular inflammation Musculoskeletal pain Ocular melanoma Musculoskeletal system inflammation Ocular pain Myalgia Ocular Surgical procedure Myasthenia gravis Onychomycosis Mycobacterium infection Open angle glaucoma Mycobacterium leprae infection Opiate dependence Mycobacterium tuberculosis infection Optic neuritis Mycoplasma infection Oral mucositis Mycoplasma pneumoniae infection Orbital inflammatory disease Mycosis fungoides Organ transplant rejection Mydriasis Organ transplantation Myelitis Ornithine transcarbamylase deficiency Myelodysplastic syndrome Orthostatic hypotension Myelofibrosis Ostealgia Myeloid leukemia Osteoarthritis Myeloproliferative disorder Osteogenesis imperfecta Myocardial disease Osteolysis Myocardial infarction Osteomalacia N-acetylglutamate synthase deficiency Osteomyelitis Nail disease Osteonecrosis Narcolepsy Osteopenia Nasal polyps Osteopetrosis Nasopharyngeal carcinoma Osteoporosis Nausea Osteosarcoma Nausea drug-induced Otitis Necrotizing enterocolitis Otitis externa Necrotizing Pancreatitis Otitis media Neisseria gonorrhoeae infection Otorhinolaryngological disease Neisseria infection Otorhinolaryngological infection Neisseria meningitidis infection Ovarian hyperstimulation syndrome Neisseria meningitidis meningitis Ovary cancer Nelson syndrome Ovary tumor Nematode infection Overactive bladder Neonatal respiratory distress syndrome Overgrowth syndrome Neoplasm Pagets bone disease Neoplastic meningitis Pain Nephritis Pancreas disease Nephroblastoma Pancreas transplant rejection Nephropathic cystinosis Pancreas tumor US 2016/0158294 A1 Jun. 9, 2016 76

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Pancreatic ductal adenocarcinoma Post-Surgical bacterial leakage Pancreatic endocrine tumor Postherpetic neuralgia Pancreatic ulcers Postmenopausal osteoporosis Pancreatitis Postnatal depression Panic disorder Pouchitis Panophthalmitis Pre-eclampsia Papillary thyroid tumor Precocious puberty Papillomavirus infection Premature ejaculation Papular skin disease Premature labor Papulosis Premature ovarian failure Paracetamol overdose Premenstrual syndrome Paralysis Prevoteia infection Paraproteinemia Priapism Parasitic infection Primary biliary cirrhosis Parkinsons disease Primary Sclerosing cholangitis Paroxysmall nocturnal hemoglobinuria Proctitis Partial seizure Progestogen deficiency Parturition Progressive Supranuclear palsy Patent ductus arteriosus Proliferative diabetic retinopathy Pediatric varicella zoster virus infection Prolymphocytic leukemia Pediculosis capitis infestation Prophylaxis Pelvic inflammatory disease Propionibacterium acnes infection Pemphigoid Propionibacterium infection Pemphigus Prostate cancer Penile induration Prostate hyperplasia Penis tumor Prostate tumor Peptic ulcer Prostatitis Peptostreptococci is infection Protein C deficiency Perennial allergic rhinitis Proteinuria Perianal fistula Proteus infection Periarthritis Proteus mirabilis infection Pericoronitis Protozoal infection Periodontal disease Providencia infection Periodontitis Prurigo Peripheral arterial occlusive disease Pruritus Peripheral neuropathy Pseudomembranous colitis Peripheral T-cell lymphoma Pseudomonas aeruginosa infection Peripheral vascular disease Pseudomonas infection Peritoneal tumor Psoriasis Peritonitis Psoriatic arthritis Peritonsilitis Psychiatric disorder Pervasive child developmental disorder Psychotic disorder Pharyngitis Pterygium Phenylketonuria Pulmonary artery hypertension Phlebothrombosis Pulmonary fibrosis Pink eye infection Pulmonary heart disease Pituitary tumor Pulmonary hypertension Pityriasis Purpura Planned abortion Pyelonephritis Plasmodium falciparum infection Pyoderma gangrenosum Piasmodium infection Rabies virus infection Piasmodium maiariae infection Radiation sickness Piasmodium vivax infection Radiotherapy induced emesis Pleural disease Raynauds disease Pneumocystis carinii infection Rectal cancer Pneumonia Rectal tumor POEMS syndrome Rectosigmoiditis Poison intoxication Renal cell carcinoma Poliovirus infection Renal disease Polyarteritis nodosa Renal failure Polychondritis Renal injury Polycystic kidney disease Renal osteodystrophy Polycystic ovary syndrome Renal tubule disease Polycythemia Renal tumor Polycythemia vera Renovascular hypertension Polymorphus light eruption Reperfusion injury Polymyalgia rheumatica Reproductive disorder Polymyositis Respiratory congestion Polyomavirus infection Respiratory disease Pompes disease Respiratory disorder Port wine stain Respiratory distress syndrome Portal hypertension Respiratory insufficiency Post traumatic stress disorder Respiratory syncytial virus infection US 2016/0158294 A1 Jun. 9, 2016 77

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Respiratory tract infection Skin cancer Respiratory tract inflammation Skin infection Restenosis Skin Inflammatory disease Restless legs syndrome Skin lymphoma Retinal dystrophy Skin tumor Retinal venous occlusion Skin ulcer Retinitis pigmentosa Sleep apnea Retinoblastoma Sleep disorder Retinopathy Small-cell lung cancer Retinopathy of prematurity Social phobia Rett syndrome Soft tissue sarcoma Rheumatoid arthritis Solid tumor Rhinitis Spinal cord disease Rhinopharyngitis Spinal cord injury Rhizontcor infection Spinal cord tumor Rhizopus infection Spinal muscular atrophy Rickets Spinal Stenosis Rickettsia infection Spinocerebellar ataxia Rocky mountain spotted fever Spinocerebellar degenerations Rosacea Splenomegaly Ross River virus infection Spondylarthritis Rotavirus infection SpondyloSyndesis Rotavirus Vaccine Adjunct Spontaneous abortion Rubella virus infection Squamous cell carcinoma Saimoneia infection Stage III melanoma Salmonella typhi infection Stage IV melanoma Salpingitis Staphylococcusatiretts infection Sandhoff disease Staphylococci is epidermidis infection Sarcoidosis Staphylococci is infection Sarcoma Staphylococcus saprophyticus infection Sarcopenia Stem cell transplantation SARS coronavirus infection Stenotrophomonas maliophilia infection Scabies infection Stevens Johnson syndrome Scar tissue Stomach cancer Scedosporium infection Stomach disease Schistosomiasis Stomach infection Schizoaffective disorder Stomach tumor Schizophrenia Stomach ulcer Scleritis Stomatitis Scleroderma Strabismus Seasonal affective disorder Streptococci is agaiaciae infection Seasonal allergic rhinitis Streptococci is constellatus infection Sebaceous gland disease Streptococci is infection Seborrheic dermatitis Streptococci is intermedius infection Secondary hyperparathyroidism Streptococci is mitis infection Seizure disorder Streptococci is oralis infection Seminoma Streptococci is pneumoniae infection Sepsis Streptococci is pyogenes infection Septic shock Stressurinary incontinence Serratia infection Stroke Serratia marcescens infection Stutter Serum sickness Subcortical vascular dementia Severe combined immunodeficiency syndrome Sucrase isomaltase deficiency Sexual deviation Sunburn Sexual dysfunction Surgery Sezary syndrome Surgical procedure Shigella boydii infection Synovitis Shigella dysenteriae infection Systemic lupus erythematosus Shigella flexneri infection Systemic mastocytosis Shigella infection Systolic heart failure Shigella sonnei infection T-cell acute lymphoblastic leukemia Shock T-cell lymphoma Short bowel syndrome Tachycardia Sialadenitis Tardive dyskinesia Sialorrhea Tay Sachs disease Sickle beta. Othalassemia Temporal arteritis Sickle cell anemia Tendon injury Sickle cell crisis Tenosynovitis Sinusitis Testis tumor Sitosterolemia Testosterone deficiency Soegrens syndrome Thalassemia major Skin allergy Thrombasthenia Skin burns Thromboangiitis obliterans US 2016/0158294 A1 Jun. 9, 2016 78

TABLE 3-continued TABLE 3-continued Representative diseases, disorders and conditions potentially Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment associated with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention. with the compositions and methods of the invention. Thrombocyte disorder Variant angina pectoris Thrombocythemia Varicella Zoster virus infection Thrombocytopenia Varices Thrombocytopenic purpura Varicosis ulcer Thrombocytosis Variola virus infection Thromboembolism Vascular dementia Thrombosis Vascular disease Thymoma Vascular neoplasm Thyroid associated ophthalmopathy Vascular occlusive disease Thyroid tumor Vasculitis Tinea Venous occlusive disease Tinea capitis Ventricular arrhythmia Tinea corporis Ventricular fibrillation Tinea cruris Ventricular tachycardia Tinea pedis Verruca Vulgaris Tinnitus Vertigo Tonic clonic epilepsy Vibrio choierae infection Tonsilitis Viral encephalitis Tooth disease Viral eye infection Topical anesthesia Viral hemorrhagic fever Torticollis Viral infection Tourette syndrome Viral respiratory tract infection Toxic epidermal necrolysis Viral susceptibility Toxicity Viridans group Streptococci is infection Transitional cell carcinoma Vitamin B12 deficiency Transplant rejection Vitamin D deficiency Transplantation Vitamin E deficiency Traumatic brain injury Vitamin K deficiency Traveler's diarrhea Vitiligo Trench mouth Vitreous hemorrhage Treponema infection Von Willebrands disease Treponema pallidum infection Vancomycin-Resistant Enterococcus Infection Trichomonas infection Vulva disease Trichophyton infection Vulvovaginitis Trigeminal neuralgia Wasting disease Trypanosoma bricei infection Wasting Syndrome Trypanosoma Cruzi infection Wegener granulomatosis Trypanosomiasis Weight loss Tuberous sclerosis West Nile virus infection Tumor lysis syndrome Wet age related macular degeneration Turners syndrome Whipple's disease Type 1 Diabetes Wilson disease Type 2 Diabetes Wound healing Type I tyrosinemia X linked dominant hypophosphatemic rickets Olcer Xenobiotic metabolism Olcerative colitis Xerophthalmia Ulcerative proctitis Xerostomia Umbilical cord stem cell transplantation Yellow fever virus infection Onidentified indication Unstable angina Yersinia pestis infection Upper respiratory tract infection Zollinger-Ellison syndrome Ureaplasma trealytictim infection Flatulence Uremia Gastrointestinal Disorder Orethritis General Inflammation Urinary dysfunction Urinary incontinence Urinary retention Urinary tract disease TABLE 4 Urinary tract infection Urinary tract tumor Representative diseases, disorders and conditions potentially associated Urogenital tract infection with a dysbiosis, which are suitable for treatment with the compositions Orolithiasis and methods of the invention Urticaria Oterine cervix tumor Abdominal cavity inflammation Oterine fibroids Absidia infection Oterus infection Acinetobacter baumanii infection Uterus tumor Acinetobacter infection Uveal melanoma Acinetobacter woffii infection Oveitis Acne Vaccination Actinomyces israelii infection Vaccinia virus infection Adenovirus infection Vaginal infection Adult varicella zoster virus infection Vaginitis Aging US 2016/0158294 A1 Jun. 9, 2016 79

TABLE 4-continued TABLE 4-continued Representative diseases, disorders and conditions potentially associated Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment with the compositions with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention and methods of the invention Alcoholism (and effects) polyneuropathy Allergic conjunctivitis Chronic Polio Shedders Allergic rhinitis Circadian rhythm sleep disorder Allergy Cirrhosis ALS Citrobacter infection Alzheimers disease Cladophialophora infection Amoeba infection Clostridiaceae infection Anal cancer Clostridium botulinum infection Antibiotic treatment Clostridium difficile infection Antitbiotic associated diarrhea Clostridium infection Arteriosclerosis Clostridium tetani infection Arthritis Coccidioides infection Aspergillus fumigatus infection Colitis Aspergillus infection Colon cancer Asthma Colorectal cancer Atherosclerosis Common cold Atopic dermatitis Compensated liver cirrhosis Atopy Allergic Sensitivity Complicated skin and skin structure infection Autism Complicated urinary tract infection Autoimmune disease Constipation Bacillus anthracis infection Constipation predominant irritable bowel Bacillus infection syndrome Bacterial endocarditis Corynebacterium diphtheriae infection Bacterial eye infection Corynebacterium infection Bacterial infection Coxiella infection Bacterial meningitis CRE infection Bacterial pneumonia Crohns disease Bacterial respiratory tract infection Cryptococcus infection Bacterial skin infection Cryptococcus neoformans infection Bacterial susceptibility Cryptosporidium infection Bacterial urinary tract infection Cutaneous lupus erythematosus Bacterial vaginosis Cystic fibrosis Bacteroides caccae infection Cystitis Bacteroides fragilis infection Cytomegalovirus infection Bacteroides infection Dementia Bacteroides thetaiotaomicron infection Dengue virus infection Bacteroides uniformis infection Depression Bacteroides vulgatus infection Dermatitis Bartonella bacilliformis infection Diabetes mellitus Bartonella infection Diabetic complication Bifidobacterium infection Diabetic foot ulcer Biliary cancer Diarrhea Biliary cirrhosis Diarrhea predominant irritable bowel Biliary tract disease syndrome Biliary tract infection Discoid lupus erythematosus Biliary tumor Diverticulitis BK virus infection DNA virus infection Blastomyces infection Duodenal ulcer Bone and joint infection Ebola virus infection Bone infection Entamoeba histolytica infection Bordetella pertussis infection Enterobacter aerogenes infection Borrelia burgdorferi infection Enterobacter cloacae infection Borrelia recurrentis infection Enterobacter infection Brucella infection Enterobacteriaceae infection Burkholderia infection Enterococcus faecalis infection Cachexia Enterococcus faecium infection Campylobacter fetus infection Enterococcus infection Campylobacter infection Enterocolitis Campylobacter jejuni infection Enterovirus 71 infection Cancer Epidermophyton infection Candida albicans infection Epstein Barr virus infection Candida infection ESBL (Extended Spectrum Beta Lactamase) Candida krusei infection Producing Bacterial Infection Celiac Disease Escherichia coli infection Cervix infection Esophageal cancer Chemotherapy-induced diarrhea Exophiala infection Chlamydia infection Familial cold autoinflammatory syndrome Chlamydia pneumoniae infection Fasciola hepatica infection Chlamydia trachomatis infection Female genital tract infection Chlamydiae infection Female genital tract tumor Chronic fatigue syndrome Female infertility Chronic infection Fibrosis Chronic inflammatory demyelinating Flavivirus infection US 2016/0158294 A1 Jun. 9, 2016 80

TABLE 4-continued TABLE 4-continued Representative diseases, disorders and conditions potentially associated Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment with the compositions with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention and methods of the invention Food Allergy Listerosis Francisella tularensis infection Liver cirrhosis Functional bowel disorder Liver fibrosis Fungal infection Lower respiratory tract infection Fungal respiratory tract infection Lung infection Fungal urinary tract infection Lung inflammation Fusarium infection Lupus erythematosus panniculitis Fusobacterium infection Lupus nephritis Gastric ulcers Lyme disease Gastrointestinal infection Male infertility Gastrointestinal pain Marburg virus infection Gastrointestinal ulcer Measles virus infection Genital tract infection Metabolic disorder Genitourinary disease Metabolic Syndrome Genitourinary tract tumor Metastatic colon cancer Gestational diabetes Metastatic colorectal cancer Giardia lamblia infection Metastatic esophageal cancer Gingivitis Metastatic gastrointestinal cancer Gram negative bacterium infection Metastatic stomach cancer Gram positive bacterium infection Micrococcaceae infection aemophilus aegyptus infection Micrococcus infection aemophilus ducreyi infection Microsporidial infection aemophilus infection Microsporum infection aemophilus influenzae infection Molluscum contagiosum infection aemophilus parainfluenzae infection Monkeypox virus infection antavirus infection Moraxella catarrhalis infection elicobacter pylori infection Moraxella infection elminth infection Morganella infection epatitis A virus infection Morganella morganii infection epatitis B virus infection MRSA infection epatitis C virus infection Mucor infection epatitis D virus infection Multidrug resistant infection epatitis E virus infection Multiple sclerosis epatitis virus infection Mumps virus infection erpes simplex virus infection Musculoskeletal system inflammation erpesvirus infection Mycobacterium infection istoplasma infection Mycobacterium leprae infection IV infection Mycobacterium tuberculosis infection IV-1 infection Mycoplasma infection IV-2 infection Mycoplasma pneumoniae infection SV-1 infection Necrotizing enterocolitis SV-2 infection Necrotizing Pancreatitis uman T cell leukemia virus 1 infection Neisseria gonorrhoeae infection ypercholesterolemia Neisseria infection yperoxaluria Neisseria meningitidis infection ypertension Nematode infection ectious arthritis Non alcoholic fatty liver disease ectious disease Non-alcoholic steatohepatitis ectious endocarditis Non-insulin dependent diabetes ertility Obesity flammatory bowel disease Ocular infection flammatory disease Ocular inflammation fluenza virus A infection Orbital inflammatory disease fluenza virus B infection Osteoarthritis fluenza virus infection Otorhinolaryngological infection Somnia Pain Sulin dependent diabetes Papillomavirus infection estine infection Parasitic infection (rritable bowel syndrome Parkinsons disease apanese encephalitis virus infection Pediatric varicella Zoster virus infection oint infection Pelvic inflammatory disease uvenile rheumatoid arthritis Peptostreptococcus infection Klebsiella granulomatis infection Perennial allergic rhinitis ebsiella infection Periarthritis K ebsiella pneumoniae infection Pink eye infection Legionella infection Plasmodium falciparum infection Legionella pneumophila infection Plasmodium infection Leishmania braziliensis infection Plasmodium malariae infection Leishmania donovani infection Plasmodium vivax infection Leishmania infection Pneumocystis carinii infection Leishmania tropica infection Poliovirus infection Leptospiraceae infection Polyomavirus infection Listeria monocytogenes infection Post-Surgical bacterial leakage US 2016/0158294 A1 Jun. 9, 2016 81

TABLE 4-continued TABLE 4-continued Representative diseases, disorders and conditions potentially associated Representative diseases, disorders and conditions potentially associated with a dysbiosis, which are suitable for treatment with the compositions with a dysbiosis, which are suitable for treatment with the compositions and methods of the invention and methods of the invention Pouchitis Trichophyton infection Prevotella infection Trypanosoma brucel infection Primary biliary cirrhosis Trypanosoma cruzi infection Primary Sclerosing cholangitis Type 1 Diabetes Propionibacterium acnes infection Type 2 Diabetes Propionibacterium infection Ulcerative colitis Prostate cancer Upper respiratory tract infection Proteus infection Ureaplasma urealyticum infection Proteus mirabilis infection Urinary tract disease Protozoal infection Urinary tract infection Providencia infection Urinary tract tumor Pseudomonas aeruginosa infection Urogenital tract infection Pseudomonas infection Uterus infection Psoriasis Vaccinia virus infection Psoriatic arthritis Vaginal infection Pulmonary fibrosis Varicella zoster virus infection Rabies virus infection Variola virus infection Rectal cancer Vibrio cholerae infection Respiratory syncytial virus infection Viral eye infection Respiratory tract infection Viral infection Respiratory tract inflammation Viral respiratory tract infection Rheumatoid arthritis Viridans group Streptococcus infection Rhinitis Vancomycin-Resistant Enterococcus Rhizomucor infection Infection Rhizopus infection Wasting Syndrome Rickettsia infection Weight loss Ross River virus infection West Nile virus infection Rotavirus infection Whipple's disease Rubella virus infection Xenobiotic metabolism Salmonella infection Yellow fever virus infection Salmonella typhi infection Yersinia pestis infection Sarcopenia Flatulence SARS coronavirus infection Gastrointestinal Disorder Scabies infection Scedosporium infection General Inflammation Scleroderma Seasonal allergic rhinitis Serratia infection Serratia marcescens infection TABLE 5 Shigella boydii infection higella dysenteriae infection Mortality and weight change in mice challenged with C. difficile with higella flexneri infection or without ethanol treated, spore preparation treatment. higella infection higella sonnel infection % weight change hort bowel syndrome Testarticle mortality (n = 10) on Day 3 kin allergy kin cancer vehicle (negative control) 20% -10.5% kin infection Donor feces (positive O -0.1% kin Inflammatory disease control) eep disorder EtOH-treated spore O 2.3% pondylarthritis preparation 1X aphylococcus aureus infection EtOH-treated spore O 2.4% aphylococcus epidermidis infection preparation 0.1X aphylococcus infection EtOH-treated spore O -3% aphylococcus saprophyticus infection preparation 0.01X enotrophomonas maltophilia infection heat-treated spore O O.1% omach cancer preparation omach infection omach ulcer treptococcus agalactiae infection treptococcus constellatus infection TABLE 6 treptococcus infection treptococcus intermedius infection Microbial compositions administered via Oral gavage on Day -1 treptococcus mitis infection treptococcus oralis infection OTU Clade treptococcus pneumoniae infection treptococcus pyogenes infection Microbial Clostridium butyricum clade 252 Systemic lupus erythematosus Composition 1 Clostridium disporicum clade 253 Traveler's diarrhea Clostridium hylemonae clade 260 Trench mouth Clostridium orbiscindens clade 494 Treponema infection Clostridium symbiosum clade 408 Treponema pallidum infection Collinsella aerofaciens clade 553 Trichomonas infection Coprococcus comes clade 262 US 2016/0158294 A1 Jun. 9, 2016

TABLE 6-continued TABLE 6-continued Microbial compositions administered via oral gavage on Day -1 Microbial compositions administered via oral gavage on Day -1

OTU Clade OTU Clade Microbial Clostridium disporicum clade 253 Lachnospiraceae bacterium 5 1 57FAA clade 260 Composition 2 Clostridium orbiscindens clade 494 Ruminococcus bromii clade 537 Clostridium symbiosum clade 408 Blautia producta clade 309 Collinsella aerofaciens clade 553 Clostridium bolteae clade 408 Eubacterium rectale clade 444 Lachnospiraceae bacterium 5 1 57FAA clade 260 Clostridium innocuum clade 351 Blautia producta clade 309 Clostridium mayombei clade 354 Clostridium innocuum clade 351 Clostridium tertium clade 252 Clostridium mayombei clade 354 Ruminococcus gnavus clade 360

TABLE 7 Population of OTUs on Days 2,3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 108 per OTU 1 x 107 per OTU Microbial comp1 1 2 3 4 1 2 3 4 -1 2 3 4

Cl butyricum O 106 51 32 O 10 O 34 195 O O O Cl disporicum 10 1746 1190 887 O 1746 769 1011 201 11175 1531 1152 Cl hylemonae O 258 258 84 O 2O3 164 77 O 26S 214 90 Corbiscindens O 188 1.92 471 O 188 138 276 O 221 174 341 Cl Symbiosum O 485 482 486 O 444 379 447 O 562 427 775 Co aerofaciens O O O O O O O O O O O O C comes O O O O O O O O O O O O L bacterium 5157 0 341 336 354 O 351 182 356 O 256 240 300 FAA R bromii O O O O O O O O O O O O B producta O O O O O O O O O O O O Cl bolteae O O O O O O O O O O O O Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O Cltertium O O O O O O O O O O O O R gnavus O O O O O O O O O O O O

Microbial comp 2 -1 2 3 4 -1 2 3 4 -1 2 3 4

Cl disporicum 29 11810 10948. 14672 O 11349 13978 3942 O 1 1995 700S 6268 Corbiscindens O S10 408 764 O 332 S4S 544 O 31 O 319 432 Cl Symbiosum O 559 508 375 O 66S 494 450 O 396 639 650 Co aerofaciens O O O O O O 1172 O O O 247 O Erectale O O O O O O O 12 O O O 261 L bacterium 5157 0 972 801 S96 O 86O 962 844 O 636 1901 1269 FAA B producta O O O O O O O O O O O O Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O

TABLE 8 Population of Clades on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 10 per OTU 1 x 10" per OTU Microbial comp1 -1 2 3 4 -1 2 3 4 -1 2 3 4 clade 252 O 444 252 87 O 198 122 125 209 394 231 88 clade 253 10 1746 1190 887 O 1746 769 1011 201 11175 1531 1152 clade 260 O 599 594 438 O 554 346 433 O 521 454 390 clade 262 O 14 151 S1 O O O O O. 12 21 57 clade 309 O 11093 9750 4023 O 99.91 5208 5145, 19 9311 6369 4951 clade 351 O 9064 10647 7751 O 6528 7259 8213 O 8903 1.0049 8701 clade 354 O O O O O O O 31 173 O O O clade 360 0 143OO 10220 11036 O 12553 12989 6889 O 93O8 13483 9292 clade 408 13 8892 12985 12101 23 3952 7260 10652 43 4079 8581. 14929 clade 494 O 226 227 565 0 188 184 411 O 221 200 351 US 2016/0158294 A1 Jun. 9, 2016 83

TABLE 8-continued Population of Clades on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 108 per OTU 1 x 107 per OTU clade 537 O O 68 225 O O O O O O O 55 clade 553 O O O O O O O O O O O O

Microbial comp 2 -1 2 3 4 -1 2 3 4 -1 2 3 4 clade 253 29 11810 10948. 14672 O 11349 13978 3942 0 1 1995 7005 6268 clade 260 O 112S 1312 854 O 1049 1295 12SO O 792 2121 1637 clade 309 54 12513 13731 7849 O 11610 12004 12672 0 7407 14111 10858 clade 351 O 7651 9939 S936 O 849S 9724 92O7 O 600S 9833 76SS clade 354 149 O 127 429 O O O 39 12 O O O clade 408 18 2242 4989 10480 12 1688 5580 3789 O 1068 1561 6281 clade 444 41 O 49 202 O 18 O 12 O 14 82 1578 clade 494 O S10 46S 1054 O 332 S6S 596 O 31 O 319 476 clade 553 O O O O O O 1172 O O O 247 O

TABLE 9 TABLE 12 Bacterial OTUs associated with engraftment and ecological augmentation Mortality by experimental group in mice challenged with 10' C. difficile and establishment of a more diverse microbial ecology in patients treated with an ethanol treated spore preparation. OTUs that comprise spores on Day O an augmented ecology are not present in the patient prior to treatment and/or exist at extremely low frequencies such that they do not comprise a significant fraction of the total microbial carriage and are not detectable Group Dose (CFU per OTU) Deaths (%0. mortality) by genomic and/or microbiological assay methods. OTUS that are members of the engrafting and augmented ecologies were identified by Vehicle control NA 10 (100%) characterizing the OTUS that increase in their relative abundance post 9 treatment and that respectively are: (i) present in the ethanol treated Microbial composition 1 10 1 (10%) spore preparation and absent in the patient pretreatment, or (ii) absent 108 1 (10%) in the ethanol treated spore preparation, but increase in their relative abundance through time post treatment with the preparation due to the 107 0 (0%) formation of favorable growth conditions by the treatment. Notably, the Microbial composition 2 109 0 (0%) latter OTUs can grow from low frequency reservoirs in the patient, or be introduced from exogenous sources such as diet. OTUS that comprise 108 1 (10%) a “core augmented or engrafted ecology can be defined by the 107 1 (10%) percentage of total patients in which they are observed to engraft and/or augment; the greater this percentage the more likely they are to be part of a core ecology responsible for catalyzing a shift away from a dysbiotic ecology. The dominant OTUS in an ecology can be identified using several methods including but not limited to defining TABLE 10 the OTUs that have the greatest relative abundance in either the augmented or engrafted ecologies and defining a total relative abundance threshold. As example, the dominant OTUS in the augmented Spore quantitation for ethanol treated spore preparations using spore CFU ecology of Patient-1 were identified by defining the OTUs with the (SCFU) assay and DPA assay greatest relative abundance, which together comprise 60% of the microbial carriage in this patient's augmented ecology. SCFU3O DPASEq/30 Ratio SCFU Dominant Preparation capsules capsules DPA Phylogenetic Ring Rted OTU Clade OTU Ecology Preparation 1 4.0 x 10 6.8 x 10' 5.9 x 10 Bacteroides sp. 2. 1 22 clade38 N Y Preparation 2 2.1 x 10' 9.2 x 10 O.O23 Streptococci is anginostis clade60 N Preparation 3 6.9 x 109 9.6 x 109 0.72 Prevoteia intermedia clade:81 N Prevotella nigrescens clade:81 N Oribacterium sp. ACB7 clade.90 N Prevoteiia Saivae clade104 N Bacteroides intestinais clade171 N Y TABLE 11 Bifidobacterium dentium clade172 N - - - - Alcaligenes faecalis clade183 N - DPA doses in Table AC when normalized to 4 x 10' SCFU per dose Rothic denocariosa claide194 N Peptoniphilus lacrimalis clade291 N SCFU3O DPASEq/30 PreparationFraction of 1 Anaerococci is sp. gpac155 clade294 N Preparation capsules capsules Dose Sutterella SiepcopicariiS clade3O2 N Y Bacteroides sp. 3 1. 19 clade335 N Y Preparation 1 4.0 x 10 6.8 x 107 1.O Parabacteroides goldsteinii clade335 N Preparation 2 4.0 x 10 1.8 x 10' O.26 Bacteroides doei clade378 N Y Preparation 3 4.0 x 10 5.6 x 10 O.OO82 Bacteroides massiliensis clade378 N Lactobacilius iners clade398 N