DOCSLIB.ORG

Arbutin Increases Caenorhabditis Elegans Longevity and Stress Resistance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Arbutin Increases Caenorhabditis Elegans Longevity and Stress Resistance Arbutin increases Caenorhabditis elegans longevity and stress resistance Lin Zhou, Xueqi Fu, Liyan Jiang, Lu Wang, Shuju Bai, Yan Jiao, Shu Xing, Wannan Li and Junfeng Ma School of Life Sciences, Jilin University, Changchun, Jilin Province, China ABSTRACT Arbutin (p-hydroxyphenyl-β-D-glucopyranoside), a well-known tyrosinase inhibitor, has been widely used as a cosmetic whitening agent. Although its natural role is to scavenge free radicals within cells, it has also exhibited useful activities for the treatment of diuresis, bacterial infections and cancer, as well as anti-inflammatory and anti-tussive activities. Because function of free radical scavenging is also related to antioxidant and the effects of arbutin on longevity and stress resistance in animals have not yet been confirmed, here the effects of arbutin on Caenorhabditis elegans were investigated. The results demonstrated that optimal concentrations of arbutin could extend lifespan and enhance resistance to oxidative stress. The underlying molecular mechanism for these effects involves decreased levels of reactive oxygen species (ROS), improvement of daf- 16 nuclear localization, and up-regulated expression of daf-16 and its downstream targets, including sod-3 and hsp16.2. In this work the roles of arbutin in lifespan and health are studied and the results support that arbutin is an antioxidant for maintaining overall health. Subjects Animal Behavior, Biochemistry, Molecular Biology Keywords Arbutin, C. elegans, daf-16, Stress, Longevity INTRODUCTION Tannins, also known as plant polyphenols, comprise the most common category of Submitted 16 October 2017 secondary metabolites and are present in all vegetative organs of flowering plants (Scalbert Accepted 27 November 2017 Published 20 December 2017 et al., 2005). Studies have shown that plant polyphenols mainly participate in plant chemical Corresponding author defenses by interfering with normal functions of various macromolecules (Spencer et al., Junfeng Ma, [email protected] 2008) and also exhibit antioxidant, anti-inflammatory, antibacterial, antitumor and other Academic editor biological activities (Balandrin et al., 1985). Angelo Piato Arbutin (C12H16O7), a plant polyphenol with a simple molecular structure, is widely Additional Information and distributed in animals, plants and microbes. It exhibits an acicular crystal habit and can Declarations can be found on page 13 be processed into a white or grey powder. Arbutin can dissolve in methyl alcohol, ethyl alcohol, acetonitrile and tetrahydrofuran, but it is insoluble in solvents such as cyclohexane, DOI 10.7717/peerj.4170 diethyl ether, chloroform, petroleum and DMSO. It is unstable and easily hydrolyzed in an Copyright acid environment, but it has been successfully isolated using plant extraction techniques, 2017 Zhou et al. biological transformation, organic synthesis and enzymatic synthesis methods (Seo et al., Distributed under 2012). Arbutin possesses two functional groups, a hydrophilic anhydroglucose group and a Creative Commons CC-BY 4.0 melanin synthase inhibitory phenolic group. The latter group inhibits melanin synthase to OPEN ACCESS lighten hair and it is the reason that arbutin was widely used in the cosmetic hairdressing How to cite this article Zhou et al. (2017), Arbutin increases Caenorhabditis elegans longevity and stress resistance. PeerJ 5:e4170; DOI 10.7717/peerj.4170 industry. Furthermore, recent reports have showed that arbutin exhibited many biological activities, including antioxidant, diuretic, antibacterial, anti-inflammatory, anti-tussive, anticancer and so on (Mustapha et al., 2016). As an animal model for human biomedical research, Caenorhabditis elegans presents many advantages, such as easy culture and rapid reproduction with short generation times. Moreover, the organism is visible, due to its translucent body that allows fluorescence labeled organs to be easily visualized. Furthermore, this organism exist numerous recombinant strains which incorporate GFP reporter genes for many important cellular pathways, including aging, oxidative stress tolerance and many diseases (Abbas & Wink, 2010; Henderson & Johnson, 2001; Hsu, Murphy & Kenyon, 2003; Link et al., 2015). Finally, C. elegans is a suitable tool for the study of human health conditions and diseases because its homologues have been identified for 60–80% of human genes (Kaletta & Hengartner, 2006). In this study, we investigated the effects of arbutin on C. elegans longevity and stress resistance and evaluated the signaling pathways involved. MATERIALS AND METHODS Chemicals and reagents Juglone, DCFH-DA and sodium azide were purchased from TransGen Biotech Co., Ltd. (Beijing, China). All other chemicals were of analytical or reagent grade. C. elegans strains and maintenance The following strains in this study were obtained from the Caenorhabditis Genetics Center: wild type N2, CF1038 (daf-16(mu86)I), TJ356 zIs356 (daf-16p::daf-16a/b::GFPCrol- 6(su1006)). Worms were maintained at 20 ◦C on agar plates containing nematode growth medium (NGM, 1.7% agar, 25 mM potassium phosphate, pH 6.0, 50 mM NaCl, 2.5 mg/ml peptone, 5 mg/ml cholesterol, 1 mM MgSO4, 1 mM CaCl2) seeded with Escherichia coli OP50. Arbutin (Wuhan Fude Chemical Co., Ltd., Wuhan City, Hubei Province, China; >98% pure, HPLC grade) dissolved in ultrapure water to a concentration of 50 mM and added directly to E. coli OP50 cultured in LB liquid medium supplement present to final concentrations of 0.5, 2.5, 5, 10 and 20 mM. Lifespan assay The lifespan assay of C. elegans was investigated as previously described (Schlotterer et al., 2009). The pre-fertile period of adulthood was used as time zero (t D 0). The nematodes were maintained on NGM plates containing either various concentrations of arbutin or vehicle (control) from birth and transferred to new plates every day. Worms were recorded as dead if they did not move after repeated stimulus and they were excluded if they crawled away from the plate. The assays were running until all animals died. Experiments were performed in at least triplicate with 120 nematodes each at 20 ◦C. All subsequent assays were conducted using the most effective concentration in inducing lifespan extension relative to wild type controls. Zhou et al. (2017), PeerJ, DOI 10.7717/peerj.4170 2/15 Stress resistance assays Twenty gravid adult nematodes (N2 or CF1038) were placed on NGM plates seeded with E. coli strain OP50 together with no arbutin (control group) or 5 mM arbutin (experimental group). Worms were allowed to lay eggs at 20 ◦C for approximately 2 h to obtain a synchronous population. Then, they were removed and the plates were placed back at 20 ◦C until the progeny reached young adulthood (about 72 h). Worms were transferred to fresh control plates or arbutin plates every day. On the fifth day (at about 120 h), animals were submitted to various kinds of stressors. Experiments were performed in triplicate, with 60 nematodes each at least. In the heat shock stress assay, animals were transferred from 20 ◦C to 35 ◦C incubator and the number of surviving worms were recorded every hour until all worms died. In the juglone stress assay, worms were placed in 96-well plates containing 200 ml S medium (100 mM NaCl, 0.01 mM cholesterol and 50 mM potassium phosphate, pH 6.0) with 200 mM juglone in each well (Waterston & Brenner, 1978). Worms were observed at 20 ◦C every hour until no worms remained alive. In the UV-irradiation stress assay, worms were treated with 254 nm UVC irradiation with a dose of 1,000 J/m2 for 8 min 40 s and immediately transferred to 20 ◦C incubator. Animals were counted every 12 h until they died. Measurement of general ROS levels Five-day-old worms with or without 5 mM arbutin treatment from birth were transferred into 100 ml M9 buffer (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4) with 200 mM DCFH-DA. After incubation with DCFH-DA for 2 h, animals were washed with M9 buffer to remove residual DCFH-DA. And then they were transferred to 96-well plates containing 200 ml M9 buffer per well. ROS-associated fluorescence levels were measured using a fluorescence microplate reader (Infinite F200 PRO, Tecan, Switzerland) at 485 nm excitation and 535 nm emission settings. Arbutin-treated group relative fluorescence unit (RFU) was compared with control group of which mean value RFU was set as 1 to reflect relative ROS levels. Ten worms were added to each well and at least twenty parallel wells were performed for each group (control or 5 mM arbutin treatment). Fluorescence quantification of DAF-16::GFP Transgenic strains TJ356 worms harboring the DAF-16::GFP reporter gene were subjected to arbutin treatments from birth to 5 days of age. Then, they were treated with 35 ◦C heat shock for 30 min. Later, animals were narcotized with 10 mM sodium azide and fixed to glass slides containing 5% agar for observation under a fluorescence microscope. DAF-16 expression corresponded with green fluorescence intensity. Experiments were performed in at least triplicate, with 10 nematodes each. Quantitative real-time PCR After birth followed by 5 days of incubation either with or without 5 mM arbutin, worms were collected and washed with M9 buffer to remove residual E. coli OP50 on their skin. Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used for total RNA extraction. The primers used in RT-PCR were as follows: daf-16, Zhou et al. (2017), PeerJ, DOI 10.7717/peerj.4170 3/15 50-TTTCCGTCCCCGAACTCAA-30 and 50-ATTCGCCAACCCATGATGG-30; sod-3, 50-AGCATCATGCCACCTACGTGA-30 and 50-CACCACCATTGAATTTCAGCG-30; hsp-16.2, 50- CTGCAGAATCTCTCCATCTGAGTC -30 and 50-AGATTCGAAGCAACTG CACC -30; ama-1, 50-CTGACCCAAAGAACACGGTGA-30 and 50-TCCAATTCGATCCGA AGAAGC-30. The gene ama-1 was used as an internal reference gene and the AB 7500 RT- PCR (Applied Biosystems, Foster City, CA, USA) detection system was used to visualize RT-PCR products. RT-PCR data were analyzed using the comparative 2−44Ct method (Livak & Schmittgen, 2001). Experiments were performed in at least triplicate, with 200 nematodes per group for total RNA extraction.
Load more

Recommended publications
  • Boards' Fodder
    boards’ fodder Cosmeceuticals Contributed by Elisabeth Hurliman, MD, PhD; Jennifer Hayes, MD; Hilary Reich MD; and Sarah Schram, MD. INGREDIENT FUNCTION MECHANISM ASSOCIATIONS/SIDE EFFECTS Vitamin A/ Antioxidant (reduces free Affects gene transcription Comedolysis epidermal thickening, dermal Derivatives (retinal, radicals, lowers concentration differentiation and growth of regeneration, pigment lightening retinol, retinoic of matrix metalloproteinases cells in the skin acid, provitamin reduces collagen degradation) Side effects: Irritation, erythema, desquamation A, asthaxanthin, Normalizes follicular Elisabeth Hurliman, lutein) epithelial differentiation and keratinization MD, PhD, is a PGY-4 dermatology resident Vitamin C (L Secondary endogenous Ascorbic acid: necessary L-ascorbic acid + alpha-tocopherol (vitamin E)= ascorbic acid, antioxidant in skin cofactor for prolylhydroxylase UVA and UVB protection at University of tetrahexyldecyl and lysyl hydroxylase Minnesota department ascorbate) Lightens pigment Zinc, resveratrol, L-ergothioneine and tyrosine add of dermatology. (affects melanogenesis) L-ascorbic acid: scavenges to vitamin C bioavailability free oxygen radicals, Protects Vitamin E from oxidation stimulates collagen synthesis Improves skin texture and hydration May interrupt melanogenesis by interacting with copper ions Vitamin E/ Primary endogenous antioxidant Prevents lipid peroxidation; Alpha tocopherol is the most physiologically Tocopherols, in skin scavenges free oxygen active isomer Jennifer Hayes, MD, Tocotrienols
    [Show full text]
  • PRODUCT INFORMATION Arbutin Item No
    PRODUCT INFORMATION Arbutin Item No. 26407 CAS Registry No.: 497-76-7 Formal Name: 4-hydroxyphenyl β-D-glucopyranoside OH Synonyms: β-Arbutin, NSC 4036 MF: C H O OH 12 16 7 HO FW: 272.3 O Purity: ≥98% UV/Vis.: λmax: 221, 283 nm OH O Supplied as: A crystalline solid Storage: -20°C OH Stability: ≥2 years Information represents the product specifications. Batch specific analytical results are provided on each certificate of analysis. Laboratory Procedures Arbutin is supplied as a crystalline solid. A stock solution may be made by dissolving the arbutin in the solvent of choice. Arbutin is soluble in organic solvents such as ethanol, DMSO, and dimethyl formamide, which should be purged with an inert gas. The solubility of arbutin in these solvents is approximately 1, 10, and 20 mg/ml, respectively. Further dilutions of the stock solution into aqueous buffers or isotonic saline should be made prior to performing biological experiments. Ensure that the residual amount of organic solvent is insignificant, since organic solvents may have physiological effects at low concentrations. Organic solvent-free aqueous solutions of arbutin can be prepared by directly dissolving the crystalline solid in aqueous buffers. The solubility of arbutin in PBS, pH 7.2, is approximately 3 mg/ml. We do not recommend storing the aqueous solution for more than one day. Description Arbutin is a glycosylated hydroquinone that has been found in Arctostaphylos plants and has diverse biological activities, including tyrosinase inhibitory, antioxidant, and anti-inflammatory properties.1,2 It inhibits human tyrosinase activity in crude tyrosinase solution isolated from human melanocytes (IC50s = 5.7 and 18.9 mM using L-tyrosine and L-DOPA as substrates, respectively) as well as in intact 3 melanocytes (IC50 = 0.5 mM).
    [Show full text]
  • 4Nbutylresorcinol, a Highly Effective Tyrosinase Inhibitor for the Topical
    DOI: 10.1111/jdv.12051 JEADV ORIGINAL ARTICLE 4-n-butylresorcinol, a highly effective tyrosinase inhibitor for the topical treatment of hyperpigmentation L. Kolbe,* T. Mann, W. Gerwat, J. Batzer, S. Ahlheit, C. Scherner, H. Wenck, F. Sta¨ b Research and Development, Beiersdorf AG, Hamburg, Germany *Correspondence: L. Kolbe, E-mail: [email protected] Abstract Background Hyperpigmentary disorders like melasma, actinic and senile lentigines are a major cosmetic concern. Therefore, many topical products are available, containing various active ingredients aiming to reduce melanin production and distribution. The most prominent target for inhibitors of hyperpigmentation is tyrosinase, the key regulator of melanin production. Many inhibitors of tyrosinase are described in the literature; however, most of them lack clinical efficacy. Methods We were interested in evaluating the inhibition of skin pigmentation by well-known compounds with skin- whitening activity like hydroquinone, arbutin, kojic acid and 4-n-butylresorcinol. We compared the inhibition of human tyrosinase activity in a biochemical assay as well as inhibition of melanin production in MelanoDermÔ skin model culture. For some compounds, the in vivo efficacy was tested in clinical studies. Results Arbutin and hydroquinone only weakly inhibit human tyrosinase with a half maximal inhibitory concentration (IC50) in the millimolar range. Kojic acid is 10 times more potent with an IC50 of approximately 500 lmol ⁄ L. However, by far the most potent inhibitor of human tyrosinase is 4-n-butylresorcinol with an IC50 of 21 lmol ⁄ L. In artificial skin models, arbutin was least active with an IC50 for inhibition of melanin production > 5000 lmol ⁄ L. Kojic acid inhibited with an IC50 > 400 lmol ⁄ L.
    [Show full text]
  • Overview of Skin Whitening Agents: Drugs and Cosmetic Products
    cosmetics Review Overview of Skin Whitening Agents: Drugs and Cosmetic Products Céline Couteau and Laurence Coiffard * Faculty of Pharmacy, Université de Nantes, Nantes Atlantique Universités, LPiC, MMS, EA2160, 9 rue Bias, Nantes F-44000, France; [email protected] * Correspondence: [email protected]; Tel.: +33-253484317 Academic Editor: Enzo Berardesca Received: 30 March 2016; Accepted: 13 July 2016; Published: 25 July 2016 Abstract: Depigmentation and skin lightening products, which have been in use for ages in Asian countries where skin whiteness is a major esthetic criterion, are now also highly valued by Western populations, who expose themselves excessively to the sun and develop skin spots as a consequence. After discussing the various possible mechanisms of depigmentation, the different molecules that can be used as well as the status of the products containing them will now be presented. Hydroquinone and derivatives thereof, retinoids, alpha- and beta-hydroxy acids, ascorbic acid, divalent ion chelators, kojic acid, azelaic acid, as well as diverse herbal extracts are described in terms of their efficacy and safety. Since a genuine effect (without toxic effects) is difficult to obtain, prevention by using sunscreen products is always preferable. Keywords: depigmenting agents; safety; efficacy 1. Introduction The allure of a pale complexion is nothing new and many doctors have been looking into this subject for some time, proposing diverse and varied recipes for eliminating all unsightly marks (freckles and liver spots were clearly targeted). Pliny the Elder (Naturalis Historia), Dioscoride (De Universa medicina), Castore Durante (Herbario nuove), and other authors from other time periods have addressed this issue.
    [Show full text]
  • Skin-Lightening Agents: an Overview of Prescription, Office-Dispensed, and Over-The-Counter Products Chesahna Kindred, MD, MBA; Uchenna Okereke, MD; Valerie D
    Review Skin-Lightening Agents: An Overview of Prescription, Office-Dispensed, and Over-the-counter Products Chesahna Kindred, MD, MBA; Uchenna Okereke, MD; Valerie D. Callender, MD Not so long ago, there was a limited number of skin-lightening agents, with hydroquinone (HQ) being the most efficacious. Currently, there are a plethora of agents, some as effective as HQ; some are avail- able over-the-counter (OTC) and others are physician dispensed. The purpose of this article is to provide physicians with an overview of available skin brighteners, including HQ, mequinol, topical retinoids, azelaic acid, arbutin and deoxyarbutin, kojic acid, licorice extract, ascorbic acid, soy, aleosin, niacinamide, and N-acetylglucosamine.COS DERM igmentation disorders can be an issue for hospital-based dermatology faculty practice revealed that all individuals, especially those with skin of dyschromia was among the 5 most common diagnoses Docolor.1,2 Although theNot natural pigmentation observed, Copy3 providing evidence that hyperpigmentation is in patients with skin of color provides many a major concern for darker-skinned racial ethnic groups. advantages such as sun protection and slowed Dermatologists and patients have a number of options Psigns of aging, it also increases susceptibility to hyper- when treating hyperpigmentation. Although some pigmentation, which can have a negative psychological patients may use prescription medications from derma- impact. A study assessing the most common diagnoses in tologists, others seek assistance from over-the-counter patients of various racial and ethnic groups treated at a (OTC) agents manufactured in the Unites States or abroad. Dermatologists face the following challenges: (1) how does one become familiar with the many OTC Dr.
    [Show full text]
  • Phytochemical Investigation of Arctostaphylos Columbiana Piper and Arctostaphylos Patula Greene
    AN ABSTRACT OF THE THESIS OF George Harmon Constantine, Jr. for the Ph.D. in Pharmacognosy (Name) (Degree) (Major) Date thesis is presented May 5, 1966 Title PHYTOCHEMICAL INVESTIGATION OF ARCTOSTAPHYLOS COLUMBIANA PIPER AND ARCTOSTAPHYLOS PATULA GREENE Abstract approved Redacted for privacy (Major professor) There are numerous references in the literature concerning the use of various Arctostaphylos species as medicinal plants. One of the species, A. uva-ursi, was listed in the United States official compendia from 18 20 until 1946 as a urinary antiseptic. Many species indigenous to the Pacific Northwest were employed by the Indians for a variety of uses, ranging from consuming the ripe fruits as a food to utilizing the leaves in urinary tract and other infections. Early settlers in the West consequently used the plants for the same purposes. Phytochemical investigations of the genus Arctostaphylos have not been extensive although several members of the family, Ericaceae, yield compounds restricted only to the family. A thorough review of the literature revealed that there has been little phytochemical investigation of species other than Arctostaphylos uva-ursi. Therefore, the purpose of this study was to thoroughly investigate two other Arctostaphylos species, viz. , A. Columbiana and A. patula, for organic components. The devel opment of newer methods of extraction, isolation and identifica tion, as well as, a screening of both plants for possible biological activity was also pursued. A new extraction solvent mixture was utilized in order to extract all of the components of interest in one extraction proce dure. The residue from the extraction was then separated into two fractions; one containing sterol and trite rpenoid compounds; and the other, phenolic components.
    [Show full text]
  • Beta-Arbutin
    SCCS/1550/15 Version S Scientific Committee on Consumer Safety SCCS OPINION ON β-arbutin The SCCS adopted this Opinion at its 9th plenary meeting on 25 March 2015 SCCS/1550/15 Opinion on β-arbutin ________________________________________________________________________________________ About the Scientific Committees Three independent non-food Scientific Committees provide the Commission with the scientific advice it needs when preparing policy and proposals relating to consumer safety, public health and the environment. The Committees also draw the Commission's attention to the new or emerging problems which may pose an actual or potential threat. They are: the Scientific Committee on Consumer Safety (SCCS), the Scientific Committee on Health and Environmental Risks (SCHER) and the Scientific Committee on Emerging and Newly Identified Health Risks (SCENIHR) and are made up of external experts. In addition, the Commission relies upon the work of the European Food Safety Authority (EFSA), the European Medicines Agency (EMA), the European Centre for Disease prevention and Control (ECDC) and the European Chemicals Agency (ECHA). SCCS The Committee shall provide opinions on questions concerning all types of health and safety risks (notably chemical, biological, mechanical and other physical risks) of non-food consumer products (for example: cosmetic products and their ingredients, toys, textiles, clothing, personal care and household products such as detergents, etc.) and services (for example: tattooing, artificial sun tanning, etc.). Scientific
    [Show full text]
  • Biologically Active Compounds in Stizolophus Balsamita Inflorescences
    International Journal of Molecular Sciences Article Biologically Active Compounds in Stizolophus balsamita Inflorescences: Isolation, Phytochemical Characterization and Effects on the Skin Biophysical Parameters Joanna Nawrot 1 , Jaromir Budzianowski 2 , Gerard Nowak 1, Iwona Micek 1, Anna Budzianowska 2 and Justyna Gornowicz-Porowska 1,* 1 Department and Division of Practical Cosmetology and Skin Diseases Prophylaxis, Poznan University of Medicinal Sciences, Mazowiecka 33, 60-623 Poznan, Poland; [email protected] (J.N.); [email protected] (G.N.); [email protected] (I.M.) 2 Department of Pharmaceutical Botany and Plant Biotechnology, Poznan University of Medical Sciences, SwMariiMagdaleny Str., 60-356 Poznan, Poland; [email protected] (J.B.); [email protected] (A.B.) * Correspondence: [email protected] Abstract: Three germacranolides, as well as five flavonoids, natural steroid and simple phenolic compounds, were isolated from the inflorescence of Stizolophus balsamita growing in Iran. The paper presents active compounds found for the first time in the inflorescence of this species. The flavonoids, simple phenolic compounds and natural steroids have been isolated for the first time in the genus Citation: Nawrot, J.; Budzianowski, Stizolophus. The MTT assay was employed to study in vitro cytotoxic effects of the taxifolin against J.; Nowak, G.; Micek, I.; human fibroblasts. We also evaluate the possible biological properties/cosmetic effects of Stizolophus Budzianowska, A.; Gornowicz-Porowska, J. Biologically balsamita extract and taxifolin on the human skin. Sixty healthy Caucasian adult females with no Active Compounds in Stizolophus dermatological diseases were investigated. We evaluate the effects of S. balsamita extract and taxifolin balsamita Inflorescences: Isolation, on skin hydration and transepidermal water loss (TEWL).
    [Show full text]
  • Enzymes for Wine Fermentation: Current and Perspective Applications
    fermentation Review Enzymes for Wine Fermentation: Current and Perspective Applications Harald Claus 1,* and Kiro Mojsov 2 1 Institute of Molecular Physiology, Microbiology and Wine Research, Johannes Gutenberg-University, 55099 Mainz, Germany 2 Faculty of Technology, University “Goce Delˇcev”Štip, Krste Misirkov No. 10-A, P.O. Box 201, 2000 Štip, Macedonia; [email protected] * Correspondence: [email protected] Received: 16 May 2018; Accepted: 5 July 2018; Published: 9 July 2018 Abstract: Enzymes are used in modern wine technology for various biotransformation reactions from prefermentation through fermentation, post-fermentation and wine aging. Industrial enzymes offer quantitative benefits (increased juice yields), qualitative benefits (improved color extraction and flavor enhancement) and processing advantages (shorter maceration, settling and filtration time). This study gives an overview about key enzymes used in winemaking and the effects of commercial enzyme preparations on process engineering and the quality of the final product. In addition, we highlight on the presence and perspectives of beneficial enzymes in wine-related yeasts and lactic acid bacteria. Keywords: wine clarification; extraction; pectinase; glycosidase; protease; phenoloxidase; color; aroma; non-Saccharomyces yeasts 1. Introduction Over the last decades, commercial enzyme preparations have gained increasing popularity in the wine industry [1–5]. They offer many advantages such as accelerated settling and clarification processes, increased juice yield, and improved
    [Show full text]
  • Www .Alfa.Com
    Bio 2013-14 Alfa Aesar North America Alfa Aesar Korea Uni-Onward (International Sales Headquarters) 101-3701, Lotte Castle President 3F-2 93 Wenhau 1st Rd, Sec 1, 26 Parkridge Road O-Dong Linkou Shiang 244, Taipei County Ward Hill, MA 01835 USA 467, Gongduk-Dong, Mapo-Gu Taiwan Tel: 1-800-343-0660 or 1-978-521-6300 Seoul, 121-805, Korea Tel: 886-2-2600-0611 Fax: 1-978-521-6350 Tel: +82-2-3140-6000 Fax: 886-2-2600-0654 Email: [email protected] Fax: +82-2-3140-6002 Email: [email protected] Email: [email protected] Alfa Aesar United Kingdom Echo Chemical Co. Ltd Shore Road Alfa Aesar India 16, Gongyeh Rd, Lu-Chu Li Port of Heysham Industrial Park (Johnson Matthey Chemicals India Toufen, 351, Miaoli Heysham LA3 2XY Pvt. Ltd.) Taiwan England Kandlakoya Village Tel: 866-37-629988 Bio Chemicals for Life Tel: 0800-801812 or +44 (0)1524 850506 Medchal Mandal Email: [email protected] www.alfa.com Fax: +44 (0)1524 850608 R R District Email: [email protected] Hyderabad - 501401 Andhra Pradesh, India Including: Alfa Aesar Germany Tel: +91 40 6730 1234 Postbox 11 07 65 Fax: +91 40 6730 1230 Amino Acids and Derivatives 76057 Karlsruhe Email: [email protected] Buffers Germany Tel: 800 4566 4566 or Distributed By: Click Chemistry Reagents +49 (0)721 84007 280 Electrophoresis Reagents Fax: +49 (0)721 84007 300 Hydrus Chemical Inc. Email: [email protected] Uchikanda 3-Chome, Chiyoda-Ku Signal Transduction Reagents Tokyo 101-0047 Western Blot and ELISA Reagents Alfa Aesar France Japan 2 allée d’Oslo Tel: 03(3258)5031 ...and much more 67300 Schiltigheim Fax: 03(3258)6535 France Email: [email protected] Tel: 0800 03 51 47 or +33 (0)3 8862 2690 Fax: 0800 10 20 67 or OOO “REAKOR” +33 (0)3 8862 6864 Nagorny Proezd, 7 Email: [email protected] 117 105 Moscow Russia Alfa Aesar China Tel: +7 495 640 3427 Room 1509 Fax: +7 495 640 3427 ext 6 CBD International Building Email: [email protected] No.
    [Show full text]
  • Challenges for Cysteamine Stabilization, Quantification, and Biological Effects Improvement Carla Atallah, Catherine Charcosset, Hélène Greige-Gerges
    Challenges for cysteamine stabilization, quantification, and biological effects improvement Carla Atallah, Catherine Charcosset, Hélène Greige-Gerges To cite this version: Carla Atallah, Catherine Charcosset, Hélène Greige-Gerges. Challenges for cysteamine stabilization, quantification, and biological effects improvement. Journal of Pharmaceutical Analysis, Elsevier B.V. on behalf of Xi’an Jiaotong University, In press, 10.1016/j.jpha.2020.03.007. hal-03028849 HAL Id: hal-03028849 https://hal.archives-ouvertes.fr/hal-03028849 Submitted on 27 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Pharmaceutical Analysis xxx (xxxx) xxx Contents lists available at ScienceDirect Journal of Pharmaceutical Analysis journal homepage: www.elsevier.com/locate/jpa Review paper Challenges for cysteamine stabilization, quantification, and biological effects improvement * Carla Atallah a, b, Catherine Charcosset b,Hel ene Greige-Gerges a, a Bioactive Molecules Research Laboratory, Doctoral School of Sciences and Technologies, Faculty of Sciences, Lebanese University, Lebanon b Laboratory of Automatic Control, Chemical and Pharmaceutical Engineering, University Claude Bernard Lyon 1, France article info abstract Article history: The aminothiol cysteamine, derived from coenzyme A degradation in mammalian cells, presents several Received 22 October 2019 biological applications.
    [Show full text]
  • Molecular Docking Studies of Arbutin Derivatives As Tyrosinase Inhibitors
    International Journal of Bioscience, Biochemistry and Bioinformatics Molecular Docking Studies of Arbutin Derivatives as Tyrosinase Inhibitors Ayu Masyita1, Yusnita Rifai2* 1 Postgraduate Student, Faculty of Pharmacy, Hasanuddin University, Makassar, Indonesia. 2 Pharmaceutical Chemistry Laboratory, Faculty of Pharmacy, Hasanuddin University, Makassar, Indonesia. * Corresponding author. Tel.: +62 821-9656-2691; email: [email protected] Manuscript submitted Decemeber 1, 2018; accepted April 9, 2019. doi: 10.17706/ijbbb.2019.9.3.188-193 Abstract: Arbutin is a natural skin-whitening agent as a tyrosinase inhibitor. Arbutin could effectively inhibit the activity of tyrosinase in skin cells and block the formation of melanin without affecting cell proliferation. In the development of drugs, such as arbutin derivatives, a simulation of interactions between tyrosinase enzymes as the target proteins with ligands (arbutin derivatives) is required, by using molecular docking simulation method. Preparation of ligands and proteins was performed using AutoDock 4.2. The results show that α-arbutin derivatives (α-arbutin-undecylinate ester and deoxy-α-arbutin) is able to inhibit a tyrosinase. Key words: Arbutin, molecular docking, tyrosinase inhibitor, hyperpigmentation. 1. Introduction Hyperpigmentation on the epidermis is caused by excessive synthesis of melanin [1], [2]. Biosynthesis of melanin depends on the activity of tyrosinase and ultraviolet radiation (UV) [3]. Tyrosinase is an enzyme that plays an important role in the formation of melanin. The tyrosinase will become L-DOPA, which then, the oxidation of L-DOPA will form dopaquinone (DQ) and DQ undergoes a further transformation, forming melanin [1]. Melanin is responsible for the absorption and protection of skin from harmful UV radiation. The presence of UV radiation will stimulate excessive synthesis of melanin and cause discoloration and the formation of dark spots on the skin [2].
    [Show full text]