Attachment 1 .PLOS ONE
CORRECTION Correction: Exposure of bighorn sheep to domestic goats colonized with Mycoplasma ovipneumoniae induces sub-lethal pneumonia
Thomas E. Besser, E. Frances Cassirer, Kathleen A. Potter, William J. Foreyt
Tnresponse to queries raised after publication, the authors, the authors’institution (Officeof ResearchAssurance,Washington StateUniversity)and a member of PLOSONE’sEditorial Boardhave reviewedthe findings in this article,and as a consequencethe authors provide an update to the Competing Interests statement and clarificationsregarding the results: The competing interests declaration is updated to acknowledgeadditional sourcesof fund ing receivedby the authors. This specificstudy wassupported by funding competitively awarded by the Wild SheepFoundation and by revenuefrom the WSU RockyCrate Endow ment for Wild Sheep DiseaseResearch.Additional research funding for the authors’bighorn sheeppneumonia-related research has been receivedfrom the USDepartment of Agriculture (including the Animal Plant Health Inspection Serviceand the USForest Service),the USGeo logicSurvey,numerous chapters and affiliatesof the Wild Sheep Foundation, and the WSU FowlerEmerging Infectious Diseasesendowment. Regardingthe pneumonia diagnosisreported in the article,the authors re-assessedthe pri mary data and solicitedand receiveda second opinion from a veterinary pathologistat Wash ington Animal DiseaseDiagnosticLab (WADDL)unassociatedwith the original project. Followingthis reassessment,the authors confirmed the descriptions and diagnosesas reported in the article,but they noted that the consulted pathologistadvised,“somepathologistsmight describethe histopathologiclesions seen in the least severelyaffectedanimal as ‘bronchiolitis’ rather than ‘pneumonia’due to the preponderance of that lesion in that animal”.In light of Lt this, the final sentence of the “Necropsyfindings”section (Results)should read, “Inflammation wascharacterizedby peribronchiolar and perivascularlymphoid hyperplasiain allanimals, with secondary suppurative bronchiolitis and alveolaratelectasisin the more severelyaffected animals.” There is inconsistencyin reporting pleural adhesion lesions:the third sentence of the “Nec OPENACCESS ropsy findings”paragraph notes that “severalanimals had strong fibrous adhesionsbetween Citation:BesserTE,CassirerEF,PotterKA,Foreyt these same lung regions and the pericardial or parietal pleura...”. The word “several”is incor WJ (2018)Correction:Exposureof bighornsheep rect here, as this was observed only for two animals aswas correctlyspecifiedin Tables 1 to domesticgoats colonizedwithMycoplasma and 3. ovipneumoniaeinducessub-lethalpneumonia. These corrections do not affectany of the conclusionsof the study. PL0SONE13(1):eOl92006.https:I/dotorg/ 10.1371/journalpone0192006 Reference Published:January24,2018 1. Besser TE, Cassirer EF, Potter KA,Foreyt WJ (2017) Exposure of bighorn sheep to domestic goats col Copyriuht:©2018 Besseret al.Thisisan open onized with Mycoplasma ovipneumoniae induces sub-lethal pneumonia. PLoS ONE 12(6): eOl 78707. access articledistributedunderthe terms ofthe https://doi.org/1 0.1 371/journal.pone.01 78707 PMID:28591169 CreatweCommonsAttrmbutionLicense,which permitsunrestricteduse, distribution,and reproductioninanymedium,providedthe original authorand source are credited.
PLOS ONE https://doi.org/1 0.1371 /journal.pone.O1 92006 1/1 I January 24,2018 Attachment 2 Exhibit I - WADDL#2015-7604 - Page 1
WASHINGTON AMMAL DISEASE DIAGNOSTIC LABORATORY P.O. Box 647034 Pullman, WA 99164-7034 Phone: (509) 335-9696 Fax: (509) 335-7424
Veterinarian: Dr. Tom Besser Owner: Besser Research Clinic: Vet Micro Path Animal: Address: Species: Bighom Sheep Bustad Hall Breed: Pullman, WA 99165 Age: Adult Phone: (509) 335-8680 Sex:
HISTOPATHOLOGY REPORT 06/10/15 WADDL #2015-7604 Report authorized by: Kathleen Potter, Senior Pathologist Received: 06/04/15
Selective tissues from 3 bighom sheep are examined.
#28 Lamb: In sections from primarily right cranial lung lobe there are scattered bronchioles lined by mildly hyperplastic bronchiolar epithelium and cuffed by well-organized lymphoid follicles. In a few foci surrounding alveoli are collapsed (atelectic). No inflammatory exudate is identified within airways. Plant material within bronchi and bronchioles is considered artifactual. In other lung lobes, widely scattered bronchioles are cuffed by small accumulations of lymphocytes.
The trachea has one well-developed tymphoid nodule in the submucosa. Sections of liver, spleen, thymus, kidney and intestines are all normal.
#28: In sections of ventral lung lobes bronchi and bronchioles are cuffed by large, well-developed lymphoid follicles. No intra-alveolar exudate is identified. Atelectasis is minimal. Other lung lobes have widely scattered peribronchiolar lymphoid cuffs.
A section of trachea has diffuse mild infiltrates of lymphocytes and plasma cells within the submucosa. Sections of liver, spleen, lymph node and intestines are within normal limits.
#31: Of six sections examined, 1 section (likely cranial ventral lung lobe) has a single, well-developed peribronchiolar lymphoid cuff. Other sections have rare, small peribronchiolar lymphoid infiltrates.
The trachea has mild diffuse lymphoid infiltrates in the submucosa. Sections of liver, heart and intestines are histologically normal.
Page 1 of2 Thisreport contains i,![ormationthat is confidential and is intendedJör the use of the individual or entity named on page 1. If yoti have received this report in error, please notifi WADDLimmediately. Exhibit 1 - WADDL#2015-7604 - Page 2
HISTOPATHOLOGY REPORT 06/10/15 WADDL #2015-7604
HISTOLOGIC DIAGNOSES:
1. Mild (#31) to moderate (#28 and 28L) lymphoid peribronciolitis with mild bronchiolar epithelial hyperplasia 2. Mild lymphoplasmacytic tracheitis (all sheep)
COMMENTS: Lesions in lungs and tracheas are compatible with experimental infections with Mycoplasma ovioneumoniae. M. ovi has been demonstrated in all animals by PCR
WORK PENDING: None
Dr. Kathleen Potter/KAP/kap/j db 3360
Phone contact: Reviewed slides with Dr. Besser on 6/10/15.
Page2of2 This report contains infbrrnatiouthat is conficlentialand is intendedfor the use oJthe individual or entity named on page 1. If you have received this report in error, please notijj’ WADDLimmediately. Exhibit 1 - WADDL#2015-7604 - Page 3
Yager, Patricia
To: Besser,Tom;WADDLSample Receiving Cc: Potter, Kathleen([email protected]);Nelson, Danielle Subject: RE:WADDLcase requested
Thanks Dr. Besser,
Logged this as case number 2015-7604. Will bring paperwork and stickers down to Kip’s desk next time I head downstairs.
As specimen, I only entered one fixed sample routed to necropsy. We will need a half sheet with a list of samples taken from field necropsy and the tests requested/labs you would like samples to go to, so we can updatevadds.
Thank you!
‘Ihsi Thger Sarnp1’cR.cceiving ‘t2sfiington)lnirnat(ThseasetDiaGnosticLa6 tYL) 509 335-6954
From: Besser, Tom Sent: Thursday, June 04, 2015 8:39 AM To: WADDLSample Receiving Subject: WADDLcase requested
Good morning folks,
We’llbe performing ‘fieldnecropsies’ on three bighorn sheep this morning. Would it be possible to make a WADDLcase and print out extra (3x normal number) of stickers for this case, so Ican use them to label the samples?
Please assign histopathology to KathyPotter. 0 t4. 2 Callme ifyou have any questions — c— cell,5-6075 office. .. .
Thanks! r C- 0 - Tom Besser
C311
1 Attachment 3 Exhibit 2-WADDL#2014-5187- Page 1 Washington Animal Disease Diagnostic Lab P.O. Box 647034 Pullman, WA 99164-7034 Telephone: (509) 335-9696 Fax: (509) 335-7424
Dr. Tom Besser Case#: 2014-5187 Vet Micro Path Report Date: 05/12/14 Bustad Hall
Pullman, WA 99165
Submittal Date: 05/01/14 Species: Bighorn Sheep Age: Owner: Besser Research Sex:
Final Report:
Serology- Reported on 05/12/14 Authorized by James Evermann, Section Head
Please see Serology test interpretation comments at end of report Sample Animal BRSV BVD IBR SRLV P1-3 21 A Serum 3lL2 POS @1:4 Neg Neg Neg POS @1:256 22A Serum 33L POS @1:4 Neg Neg Neg POS @1:128 f NOTE: Serum titers to RSV and P1-3 viruses most likely due to maternal antibody. LT for JFE 5/12/14.
M. ovipneumoniae by ELISA
Specimen Animal % I Result 21 A Blood Serum 31L2 -9.0652 Not detected 22 A Blood Serum 33L 48.938 Indeterminant
Previously reported results:
Bacteriology- Last reported on 05/07/14 Authorized by Dubraska Diaz, Section Head
Aerobic Culture SOP: 303.1.2014.01.09 Animal Specimen Result Isolate 31L2 Spleen Moderate Mixed bacterial growth 31L2 Spleen No Pasteurella isolated. 31L2 Left Lung See comment. Mannheimia haemolytica Result Comment: One colony cultured.
Washington Animal Disease Diagnostic Lab Case#: 2014-5187 Page 1 of 4 This report contains information that is confidential and is intended for the use oft/ic individual or entity named on page 1. If you have received this report in error, please notify WADDLimmediately. Exhibit2 - WADDL#2014-5187 - Page 2 Washington Animal Disease Diagnostic Lab
Aerobic Culture SOP: 303.1.2014.01.09 Animal Specimen Result Isolate 31L2 Right Lung Few Mixed bacterial grotvth 31L2 Right Lung No Pasteurelta isolated. 31L2 eye Swab Very Many Mannheimia haemolytica 3lL2 pharyngeal Swab Very Many Mixed bacterial growth Result Comment: Mixed bacteria includes Mannheimia haemolytica and Bibersteinia trehatosi.
33L Spleen Mixed bacterial growth. 33L Spleen No Pasteurella isolated. 33L Left Lung No growth. 33L Right Lung No growth. 33L eye Swab Moderate Mixed bacterial growth 33L eye Swab Very Many Mannheimia haemolytica 33L pharyngeal Swab Very Many Mixed bacterial growth Result Comment: Mixed bacteria includes Past. sp., Mannheimia sp., and Pasteurella multocida.
Aerobic Culture test comment: Mixed bacterial growth is suggestive of post-mortem bacterial overgrowth. contamination, and or incubation of sample resulting in bacterial proliferation.
Histopathology- Last reported on 05/07/14
Histo-field necropsy (Other) SOP: 06013.2003.09.18 Animal Specimen Result Container of Tissue(s) Reported separately
Molecular Diagnostics- Last reported on 05/09/14 Authorized by Daniel Bradway, Lab Manager
PCR.Mycoplasma ovipneumoniae SOP: 501.4ORT.2013.0531 Animal Specimen Result 31L2 Culture Medium-Nose Not detected 31L2 Culture Medium-Bronchus Detected 31L2 Culture Medium-Eye Not detected 33L Culture Medium-Nose Detected 33L Culture Medium-Bronchus Detected 33L Culture Medium-Eye Not detected Block #1 31L2 Tissue Block Embedded Not detected Block #8 33L Tissue Block Embedded Not detected
PCR-Mycoplasma ovipneumoniae test comment: This assay detects only Mycoplasma ovipneumoniae. Culture is available at WADDL to detect other species of Mycoplasma if desired. Fees for culture are available on our website. Please contact the lab if Mycoplasma culture or other testing is desired.
Washington Animal Disease Diagnostic Lab Case#: 2014-5187 Page 2 of 4
This report contains information that is co,fidential and is intended for the use of the individual or entity ncuned on page 1 If you have received this report in error, please notify WADDLimmediately. Exhibit 2- WADDL#2014-5187 - Page 3 Washington Animal Disease Diagnostic Lab
Serology Test interpretation comments: BRSV (Virus Neutralization) sop: 204.3.2013.02.04
Negative (Neg): No antibody detected @ 1:4. Submit convalescent serum (lO-21d) to detect antibody due to acute infection.
POSITIVE (POS): Antibody present due to exposure, vaccination, or passive transfer. Submit convalescent serum (10-2 Id) to detect changes in antibody consistent with recent exposure. Endpoint titers available upon request for results reported as >512 and will be set up on the next scheduled testing day.
BVD (Virus Neutralization) SOP: 204.3.2013.02.04
Negative (Neg): No antibody detected @ 1:4. Submit convalescent serum (10-21d) to detect antibody responses to acute infection. Animals immunotolerant to BVD are typically negative for convalescent serum antibody. Virus isolation from chilled whole (EDTA) blood or chilled serum is recommended.
Positive (POS): Antibody present due to exposure, vaccination, or passive transfer. Submit convalescent serum (10-21d) to detect changes in antibody consistent with recent exposure.
IBR (BHV-1) (Virus Neutralization) SOP: 204.3.2013.02.04
Negative (Neg): No antibody detected @ 1:4. Submit convalescent serum (10-21d) to detect antibody due to acute infection. Negative antibody does not exclude latent infection.
Positive (POS): Antibody present due to infection, vaccination, or passive transfer. Serum antibody titers to IBR (BHV-1) usually range from 1:4 to 1:64. Submit convalescent serum (l0-21d) to detect changes in antibody consistent with recent infection.
Elevated (ELEV): Positive antibody titers equal to or greater than 1:128 may be indicative of field infection. Contact the laboratory if any questions/comments arise.
SRLV - Small Ruminant Lentivirus (CAE/OPP) (cELISA) SOP: 203.16.1.2012.12.11
Negative (Neg): No antibody to small ruminant lentivirus (SRLV) detected. Submit an additional serum sample drawn in 60 - 90 days in order to detect recent infection.
POSITIVE (POS): Antibody to small ruminant lentivirus (SRLV) detected. A positive result indicates infection or passively acquired antibody via colostrum or serum therapy.
NOTE: SRLV includes caprine arthritis-encephalitis virus (C’AEV,)and ovine progressive pneumonia virus (OPPV)/ Maedi- Visna. Recent motecular epidemiotogy has shown both viruses are variants wit/tin a group best characterized as smatt ruminant tentiviruses. The c-ELISA detects both variants. For more information on CAE, please reference: http://www.vetmed.wsu.edu/depts_waddl/caefaq.aspx
Washington Animal Disease Diagnostic Lab Casef: 2014-5187 Page 3 of 4 This report contains information that is confidential and is intended for the use of the individual or entitynatned on page 1. If you have received this report in error, please notify WADDLimmediately. Exhibit 2- WADDL#2014-5187 - Page 4 Washington Animal Disease Diagnostic Lab
Mycoplasma ovipneumoniae ELISA SOP: 203.20.2.2013.01.16
% I <40%: Antibody not detected.
% I> 50%: Antibody detected at levels consistent with previous exposure or current infection with Mycoplasma ovipneumoniae.
% 140% to 50%: Antibody detection indeterminate to establishment of correlation with Mycoplasma ovipneumoniae infection.
The 50% cutoff represents 3 standard deviations from the mean of bighorn sheep from defined negative populations (99% confidence interval). Using the 50% cutoff the performance of the cELISA with reference standards is as follows: Agreement 95.4%, Diagnostic specificity = 99.3%, and Diagnostic sensitivity = 88%. The 40% cutoff represents 2 standard deviations from the mean of defined negative sheep (95% confidence interval). Using the 40% cutoff the performance of the cELl SA for individual animals with reference standards is as follows: Agreement = 95.8%. Diagnostic specificity = 98.6%, and Diagnostic sensitivity = 90.7%. However, the test is designed for classifying populations, not individuals. Populations not exposed to Al. ovipneumoniae will have 0-10% of animals with detected’ antibody. whereas exposed populations wilt have 30-100% of animals with ‘detected antibody.
P13 (Virus Neutralization) SOP: 204.3.2013.02.04
Negative (Neg): No antibody detected @ 1:4. Submit convalescent serum (10-2 Id) to detect antibody due to acute infection.
POSITIVE (POS): Antibody present due to exposure. vaccination, or passive transfer. Submit convalescent serum (10-2 ld) to detect changes in antibody consistent with recent exposure. Endpoint titers available upon request for results reported as >512 and will be set up on the next scheduled testing day.
Washington Animal Disease Diagnostic Lab Case#: 2014-5 187 Page 4 of 4 This report contains information that is confidential and is intended for the u.se of the individual or entity named on page 1. If you have received this report in error, please notify WADDL immediately. Attachment 4 JCM ]ourna AM org
Pathogens of Bovine Respiratory Disease in North American Feedlots Conferring Multidrug Resistance via Integrative Conjugative Elements
Cassidy L. Klima, Rahat Zaheer, Shaun R. Cook, Calvin W. Booker, Steve Hendrick,b Trevor W. Alexandet, Tim A. McAllister Agriculture and Agri-Food Canada Research Centre, tethbridge, Alberta,Canada; Department of Large AnimalClinicalSciences, Western College of Veterinary Medicine, Universityof Saskatoon,Saskatoon, Saskatchewan, Canada; Feedlot Health Management Services,Okotoks, Alberta, Canada’
In this study, we determined the prevalence of bovine respiratory disease (BRD)-associated viral and bacterial pathogens in cat tle and characterized the genetic profiles, antimicrobial susceptibilities, and nature of antimicrobial resistance determinants in collected bacteria. Nasopharyngeal swab and lung tissue samples from 68 BRD mortalities in Alberta, Canada (n = 42), Texas (n 6), and Nebraska (n = 20) were screened using PCR for bovine viral diarrhea virus (BVDV), bovine respiratory synqrtial virus, bovine herpesvirus 1, parainfluenza type 3 virus, Mycoplasma bovis, Mannheirnia haernoiytica, Pasteureila multocida, and Histophulus somni. Excepting bovine herpesvirus 1, all agents were detected. M. haernoiytica (91%) and BVDV (69%) were the 0 most prevalent, with cooccurrence in 63% of the cattle. Isolates of M. haernolytica (n = 55), P. rntdtocida (n = 8), and H. sonini (n = 10) from lungs were also collected. AmongM. haeniotytica isolates, a clonal subpopulation (n = 8) was obtained from a 0 p3 Nebraskan feedlot. All three bacterial pathogens exhibited a high rate of antimicrobial resistance, with 45% exhibiting resistance 0 CD to three or more antimicrobials. M. haernoiytica (ii = 1$), P. muitocida (n = 3), and H. somni (n = 3) from Texas and Nebraska 0 possessed integrative conjugative elements (ICE) that conferred resistance for up to seven different antimicrobial classes. ICE 0 were shown to be transferred via conjugation from P. muttocida to Escherichia coil and from M. haernotytica and H. somni to P. 3 muttocida. ICE-mediated multidrug-resistant profiles of bacterial BRD pathogens could be a major detriment to many of the therapeutic antimicrobial strategies currently used to control BRD. -a 0 n newly received feeder calves,shipping fever or bovine respira (13) and reduce the efficacyof antimicrobials employed to control 3 Itory disease (BRD) is the leading cause of death and illness, infectious disease in cattle. Co contributing to millions of dollars in losses through treatment Bacteria may be intrinsically 3 resistant or acquire resistance to 0 costs, reduced meat yields, and mortalities (1, 2). Stressors as a antimicrobial agents either by de novo mutation in their genomes CD result of weaning, marketing, and transport predispose calves to or through the via acquisition of additional genes horizontal gene 0 viral infection that in turn can precipitate bacterial pathogenesis transfer through conjugation, transformation, or transduction. in the lower respiratory tract (3). Multiple viral and bacterial Horizontal gene transfer through conjugation requires a multi- C agents are implicated in BRD, including bovine viral diarrhea protein apparatus, typically synthesized by the donor strain that CD C virus (BVDV), bovine respiratory syncytial virus (BRSV), bo physically connects the donor and recipient (14), enabling trans 0) vine herpesvirus 1 (BoHV-1), parainfluenza 3 virus (PI3V), fer of one or multiple genes. Typically, conjugation systems em (2 Mannheinua haernolytica, Mycoptasnia bovis,Pasteurella multo ploy plasmids or plasmid-derived DNA but recently, chromo 0 cida, and Histophilus somni. respiratory disease F’) The term bovine some-borne mobile genetic elements referred to as integrative C can cover a range of pneumonic illnesses, from acute fatal respi conjugative elements (ICE) have been identified (14). These ele -a —1 ratory disease to chronic or prolonged intractable respiratory dis ments commonly harbor clusters of accessory genes, including a ease (4). Although not absolute, acute fibrinous pneumonia or muhidrug resistance cassettes accumulated through recombina acute fatal is CD pneumonia most commonly associated with M. hoe tion. Once generated, multidrug-resistant elements can establish C molyticci,while chronic caseonecrotic pneumonia is typically as CD and persist in bacterial populations as the result of the use of a C,, sociated with M. bovis(5, 6). single antimicrobial that coselects for the entire element. To date, vaccination has shown inconsistent efficacyagainst M. The development of widespread resistance in BRD pathogens haernolytica,P. multocida, and H. somni infection in feedlot cattle would be economically devastating to the cattle industry (15). To (7). As a result, antimicrobials are often the primary management ensure prudent antimicrobial use, surveillance of antimicrobial practice used to reduce the in large incidence of BRD feedlots. In resistance in bacterial agents of BRD is required if therapeutic western Canada, 20 to 50% of newly arrived feedlot placements receive injectable metaphylactic antimicrobials for BRD preven tion (8), while capacities >8,000 75% of U.S. feedlots with of head Received 6 September 2013 Returned for modification 2 October 2013 use injectable antimicrobials at arrival (9). Accepted 4 November 2013 As the largest user of antimicrobials worldwide (10), the agri Published ahead of print 20 November 2013 cultural sector is a potential driving force for evolution, persis Editor: A B Onderdonk tence, and spread of antimicrobial resistance traits (11), both in Address corresoondence bum A,McAllister,rim [email protected] ca, or Trevor targeted pathogens and commensals of livestock (12). The use of W Alexander, trevoralexander@agr gc ca antimicrobials for growth promotion and metaphylaxis raises Copyright © 2014, American Societyfor Microbiology AllRights Reserved concerns over the extent that these practices might contribute to dair’) I12CIJCM3248513 antimicrobial resistance (AIvIR)in zoonotic bacterial pathogens
438 jcm.asm.org Journal of Clinical Microbiology p. 438—448 February 2014 Volume 52 Number 2 BRDPathogens and Multidrug Resi5tance
efficacy is to be maintained. Likewise, it is important to monitor An overallprofile of respiratory tract occurrencewas generated with an the development of cross-resistance to antimicrobials from drug animal identified as positive if the agent was detected in the nasopharynx, classes of importance to human medicine. lung, or both. Lung DNA and nasopharyngeal nucleic acid extractions The objective of this study was to examine BRD mortalities were used as the templates for PCR detection of icIannheimia spp., P. from feedlots in North America for the occurrence of viral and ,nultocida, and H. sonnu; nested PCR detection ofBoHV- I; and real-time bacterial agents associated with disease and to characterize their PCR detection employing TaqMan Fast Universal PCR master mix (Life Technologies, Inc., Burlington, RNA antimicrobial resistance profiles. ON) ofM. bovis (17). Lung and nasal nucleic acid extractions were used as the templates for PCR detection of BVDV, BRSV, and PI3V, employing a SuperScript III one-step reverse MATERIALSAND METHODS transcription (RT)-PCR system (LifeTechnologies, Inc., Burlington, ON) Sample collection. Nasopharyngealswab and Icingtissue samples were for reverse transcription, followed by a nested PCR. A HotStar Hifidelity collectedat postmortem necropsy from 68 BRDmortalities presenting polymerase kit (Qiagen Canada, Inc., Toronto, ON) was used for nested acute fibrinous pneumonia in feedlots within Alberta (u = 42), Texas PCR of BVDV reverse transcription products, with generated amplicons (n = 6), and Nebraska (n = 20). Lung tissue samples consisted ofa 4-cm3 sequenced (Eurofins MWG Operon, Huntsville, AL) and analyzed using section excised from the perimeter of a pneumonic lesion, stored, and Geneious R6 version 6.0.5 (Biomatters, Ltd., Auckland, New Zealand). transported in Cary-Blair media (BD Canada, Inc., Mississauga, ON). Alignments generated in BLAST were used for identification of BVDV Nasopharyngeal samples were collected using commercially available subspecies 1 and 2. deep-guarded culture swabs with a Gary-Blair agar reservoir (BD Canada, 0 DNA extracted from the following strains was used for bacterial Inc., Mississauga, ON). Samples were stored at 4°C for a period no longer pos itive controls: Pasteurettci rnuttocida subsp. muttocida strain l7976B than 10 days prior to processing for bacterial isolation. (CCUG), M. 1,aen,otytica BAA-410 (ATCC), Histophitus son,ni 0 Bacterial isolation of M. haemotytica, P. multocida, and H. somni. strain p3 strain 700025 (ATCC), and Mycoplasnta bovisstrain 25523 (ATCC). Pos 0 For each lung tissue sample, approximately 2 cm3 was excised with a CD sterile scalpel and homogenized with 10 ml of sterile brain heart infusion itive controls for viral agents were prepared by cloning specific PCR prod 0. (BHI) broth (BD Canada, Inc., Mississauga, ON) in a stomacher (Stom ucts into plasmids using the first-round PCR primers listed in Table 1. acher 400 Circulator; Seward Laboratory Systems, Inc.) for 30 s. A 500-ui Amplicons generated from nucleic acids extracted from viral strains 3 aliquot of the stomacher suspension was serially diluted 1:10, with 10’ (BVDVI, Singer strain; BVDV2, Ames 125-C strain; BoHV-I, Cobra :,- 102 do-34 strain) or positive nasopharyngeal/lung samples (BRSV and PI3V) and dilutions cultured onto tryptic soyagar (TSA)(BDCanada,Inc., •0 Mississauga,ON) plates containing 5% blood overnight at 37°C. An ali were cloned into a TA vector pCR2. 1 (LifeTechnologies, Inc., Burlington, quot of the lung tissue stomacher suspension was stored in 20% glycerol at ON). Cloned fragments were confirmed by sequencing. 0 — 80°C and later processed for the isolation ofH. son,ui. For this, approx Statistical analysis. Pearson correlation analysis (SAS System for 3 imately 10 p.l of the frozen stocks was used to inoculate 900 cl of BHI Windows, release 9.1.3; SAS Institute, Gary, NC) was used to determine p3 0) broth. A lOU-p.1aliquot of the resulting suspension was plated onto TSA the correlation between ?CR results from nasopharyngeal and lung tissue 3 plates containing 5% blood and incubated for 48 h at 37°C in 5% CO2. samples for all bacterial and viral agents examined in this study, and dif 0 Colonies displaying morphology indicative of M. haenwtytica (i.e., ferences were considered significant at a P value of <0.01. Co white-gray, round, medium-sized, and nonmucoid and exhibiting n-he Serotyping. Ma,i,ilicirnia haemolytica isolates were serotyped using 0 molysis) were confirmed as previously described (16). Identities of colo the rapid plate agglutination procedure with rabbit antisera raised against D nies displaying morphology of?. n,,,ltocida (translucent, grayish in color, reference strains ofM. hacuzolytica as previously described (18). > and mucoid in consistency) and H. son,m (yellowish hue and hemolytic) Pulsed-fietd gel etectrophoresis. Molecular typing was performed on Co were confirmed by PCR using HotstarTaq Plus master mix (Qiagen Can all isolates of M. haeniolytict,, P. ,niiltocida, and II. somni by pulsed-field 0, ada, Inc., Toronto, ON) according to manufacturer’s specifications, with gel electrophoresis (PfGE) according to previous methods (18). Macro- primers and annealing as described (Table 1). Colonies exhib c,z conditions restriction digests were completed using SaIl forM. haeniotyrica, Apal for 0 iting morphologies not indicative of M. l,aeniolytica, P. niuttocida, or H. P. ,nultoc,da, and Sacli for H. son,ni. Electrophoresis conditions for all son,ni were coisolated and the genus/species identified based on DNA three species employed a program of 6 V/cm for 22 hat 12°C with switch 0 sequencing (Euro fins MWG Operon, Huntsville, AL) and BLASTanalysis times from 4 to 40 s. Pulsed-field profile and statistical analyses were —I of 16S rRNA genes. performed using BioNumerics VS. I soffivare (Applied Maths, Inc., Aus C DNAand RNA extractions. Total DNAand RNAwereextractedfrom tin, TX). lungtissuesamplesusingthe QIAampDNAtissuekit and RNeasyMinikit Co Broth microdilution assay. Antimicrobial susceptibility testing was (QiagenCanada, Inc.,Toronto, ON), respectively,accordingto the man CD performed on M. Iiaeniotytica, P. mnttocida,and H. somni isolates by broth 0) ufacturer’sspecificationsand stored at — 80°C until used. Total nucleic microdilution using a commercially available panel (bovine/porcine with acid (DNA extraction without RNase treatment) was extracted from tulathromycin MIC format, Sensititre; Trek Diagnostic Systems, Cleve nasopharyngeal swabs using the following procedures. Nasopharyngeal land, OH), as previously described for iW.haemotytica (19) and according swabs were centrifuged at 13,000 X g for 5 mm and the supernatant was manufacturer’s specifications for P. rnultocida and H. so,nni. MIC was aspirated. The swab was removed from the applicator and left inside the to assigned by the unaided eye as outlined in the Clinical and Laboratory tube containing the pellet, resuspended in 180 p.1of enzymatic lysis buffer, Standards Institute document M3I-A3 (20). Clinical and Laboratory and incubated for 30 mm at 37°C. A 25-p.l aliquot ofproteinase K and 200 Standards Institute (20) breakpoints were not available for clindamycin, p.1of buffer AL (provided with kit) were added to the suspension and incubated at 56°C for 30 mm. A sterile steel ball was added to the tube and ampicillin, penicillin, gentamicin, neomycmn,tiamulin, sulfadimethoxine, samples were processed for I mm at 30 Hz using a tissue lyser (Qiagen trimethoprim-sulfamethoxazole, or tylosin tactrate. Consequently, sus were Canada, Inc., Toronto, ON). A 200-p.l volume of ethanol (96 to 100%) ceptibility designations for these drugs were not assigned. Exceptions was added and the suspension centrifuged at 8,000 X g for 5 mm to pellet made in cases in which ampidillin, penicillin, neomycin, or gentamicin debris. The supernatant was passed through a DNeasy spin column and MIC distributions for the populations were bimodal and isolates exhib nucleic acids were eluted as described in the kit protocol. Samples were ited high MICs and harbored corresponding antimicrobial resistance gene stored at —80°Cuntil used. determinants. In these instances, isolates were classified as resistant. In Viral and bacterial pathogen detection. All viral and bacterial agents addition, the resistance breakpoint for spectinomycin (128 p.gJml) was were detected by PCR using master mixes according to the manufacturer’s greater than that evaluated by the panel (maximum concentration evalu specifications and primers and annealing temperatures listed in Table 1. ated was 64 pg/mI). As a result, isolates were classified as spectinomycin
February 2014 Volume 52 Number 2 jcm.asm.org 439 ‘5 C TABLE 1 PCR primers and annealing conditions used for bacterial species confirmation, virus detection, antimicrobial resistance gene screening, and detection of ICE-associated genes 3 originating from ICEPmnI rD 3 3 Amplicon Annealing Primer 0 PCR target/phenotype’ Primer name (FIR)6 PCR primer sequence (5’ to 3’) size (bp) temp (“C) reference no. ‘0 Bacteria species confirmation PCR Manuheimia spp. MHIkt-int_F/MHlkt-int_R GTCCCTGTGTITFCATFATAAG/CACTCGATAATFATTCTAAATTAG 385 58 44 Histophilns soinni HS453_F/HS860_R GAAGGCGATFACVI]’AAGAG/TTCGGGCACCAAGTRTFCA 400 55 45 Pasteurdlla ,nultocida PM23_f/PM23_R GGCTGGGAAGCCAAATCAAAG/CGAGGGACTACAATFACTGTAA 1432 52 46 Mycoplasnrn basis PMB996-F/PMBIO66-R TCAAGGAACCCCACCAGAT/AGGCAAAGTCK[TTCTAGGTCCAA 71 60 17 Mbovis probe FAM-TGGCAAACTTACCTATCGGTGACCCT-TAMRA t6S rRNA 27F11492R AGAGTrFGATCCTGGTCAGIGGTFACC17GTfACGAC71’ 1,450 58 17
Virus detection BVDV (ssRNA-positive strand) RT_BVDVFIRT_ BVDVR’ AGCGAAGGCCGAAAAGAGGCICAACTCCATGTGCCATGTACAG 312 58 This work PI3VRr PI3V (ssRNA-negative strand) RT_PI3VFIRT_ CATAAGTGATCTAGATGATGATCC1TTCATCTAGAATcTGAATACTCC 460 55 This work N_PI3VFIN_PI3VR” 111 60 48 BRSV (ssRNA negative-strand) RT_BRSVF/RT_ BRSVR’ CAAACTAAATGACACTTTCAACAAG/CA’ITfCATFCCTFAGTACATTGTTG 566 54 This work N_BRSVF/N_BRSVR” CGTAGTACAGGTGACAACATTG/ACCAAAGCAGCAACACATAGCAC 422 63 This work BoHV-1 (dsDNA) BoHV-1FIB0I-IV-1R TCGAGCGGCAAGAGCACAAG/GGAAATCTFCGTGGCCCAGATG 662 62 This work N_BoHV- I F/N_BoHV- I R” TGAGGCCTATGTATGGGCAGVF/GGACACAACAAACAATGCGG 422 60 This work
Antimicrobial resistance phenotype ict(H), teLRICTET’, oxr fet(H)_P/tetfH)_R ATACTGCTGATCACCGT/TCCCAATAAGCGACGCT 1,076 60 18 ICE tctR_F/ICE tctR_R CGGCrTGGGTFAATAATGGCGIATAACGCGAAAAGCITCCGC ‘125 58 This work bIa505 , bICIOXA.,/AMP, PEN’ blat5ot3tFIblnsott R AATAACCCTI’GCCCCAATFCITCGCFFATCAGGTGTGCFFG 685 60 18 b!a0x4 GCAGACGAACGCCAAGCGGA/CCCGCACGATfGCCTCCCTC 625 64 This work ermf 42), insr(E), ntph(E)ITII.’, TUL’ crnt(42)_Flcnn(42)_R GGGTGAAAAGGGCGTrFATF/ACGTTGCAC’fl’GGTFFGACA 1,254 60 49 ntsr(E)_f/ntph(E)_R ACCAGCCACCFTGATCTCAATG/GrFCCATFCGATCCAGTFATAGCG 620 60 This svork niph(E)_Flntplt(E)_R TCTGTAGCGGG’fl7CCAATFGC/AATGG’fl’GCTGCGTATFCCTCG 401 60 This work aadA25/SPEC’ aadA25_F/aadA25_R GCAGTGGATGGCGGCCTGAA/TCGGCGCGAT1TFGCCCGTI’ 503 66 This work aphA- IINEO’ np/tA- 1_FIaphA- 1_R ‘fl’ATGCCTCTTCCGACCATCIGAGAAMCTCACCGAGGCAG 489 54 50 strB/NEOC,GENr strA, strA_F/strA_R AAGGCAAGGCGTfCGCGGTCICCGGCGGCTGATCTGTCTGG 506 64 This work strB_F/strB_R TCGCACCTGCYFGATCGCGG/GCTCGAATATGCCGGGGAGCG 586 64 This work aadB/GENr aadB_FIaadB_R TFACGCAGCAGGGCAGTCGC/GCGGCACGCAAGACCTCAAC 551 66 This work floR/FFNr ICEfloR_F/ICEfloR_R GACGGVFCGCGACG1TFATG/GAAGACGAAGAAGGTGCCCA 320 58 This work sul2/TMP-SMX’ std2_F/stil2_R CCAATACCGCCAGCCCGTCG/TGCCTFGTCGCGTGGTGTGG 489 64 This work
ICE-associated genes from ICEPinuI Hypothetical protein Pmu_02680F/Pmu_02680R ‘fl’ATGAACCCGGTGCGAGTG/TGTGAGAGCAAAGACTCTGGT 226 58 This work Integrase Pmu_02700F/Pmu_02700R ACGGAATCATAGACCFGCCAC/TCTGITGCAGTFGTATGTCGGA 735 58 This work 0 Molticopper oxidase Pmu_03360F/Pmu_03360R CAAGGCAGTGCTGGGACATA/GTfCCTfGCGTfCACCCAC 458 58 This work z Transposase nipA Pmu_035 I 0F/Pmu_035 IOR TGCCGC111CGTC’ITFGTG1TACACGCCGAAG’5TTCCGAA 204 56 This work 0 Single-stranded DNA-binding protein Pmu_03540F/Pmu_03540R GACTTCTCGACG’fl’CTCCGG/ATCGTFGCAAVfl’CCTGTCC 110 58 This work n S “ssRNA, single-stranded RNA; dsDNA, double-stranded DNA. F and R, forward and reverse primers, respectively. P denotes probe. RT, one-step reverse transcription-PCR primers. “N, second-round nested PCR primers. 0 0 ‘CTET’, chlortetracycline resistant; OXYT’, oxytetracycline resistant; AMP’, ampicillin resistant; PEN’, penicillin resistant; TIL’, tilmicosin resistant; NEOr, 0 TUL’, tulathromycin resistant; SPEC’, spectinomycin resistant; neomycin 0 resistant; GEN’, gentamicin resistant; FFN’, florfenicol resistant; TMP-SMX’, trimethoprim-sulfamethoxazole resistant. ‘0 ‘C
isanD Aq L ‘O isn6n uo ,6owswwo[,:dq woi popoiuoa BRDPathogens and Muttidrug Resistance
TABLE 2 PCR and culture-based detection of bovine respiratory disease agents from BRD mortalities originating in Alberta, Nebraska, and Texas” No. (%) of samples from: No. (%) detected tn Total no. (%) Test type and diseaseagent Alberta to = 42) Nebraska (n = 20) Texas to = 6) both sample types (n = 68) PCR data Manuheimia haemolytica 38 (90) 19 (95) 5 (83) 48 (77) 62 (91)
Pasteurellamultocida 6 (14) 1 (5) 2 (33) 3 (33) 9 (13) Histophilussomni 25 (60) 8 (40) 6 (100) 14 (35) 39 (57) Mycaplasniabovis 23 (55) 15 (75) 5 (83) 22 (51) 43 (63)
Parainfluenza3virus 6(14) 2(10) 1 (17) 1 (11) 9(13)
Bovine respiratorysyncytial virus 10 (24) 2 (10) 1 (17) 2 (15) 13 (19) Bovine herpesvirus I
Bovine viral diarrhea virus 29 (69) 17 (85) 1 (17) 33 (70.2) 47 (69) (BVDV)
BVDV-l 17 (41) 17 (85) 1 (17) 35 (51) BVDV-2 11 (27) 11 (16)
BVDV-1/BVDV-2 1 (2) 1 (1) ID 0 Culture data Mannheimiahaemolytica 31 (74) 20 (100) 4 (67) 55 (81) 0 £1) Serotype 1 22 (52) 18 (90) 4 (67) 44 (65) Serotype 2 1 (2) 1 (5) 2 (3) 0CD Serotype6 8(20) 1 (5) 9(13) Pasteurelta,nultocida 6 (14) 1 (5) 1 (16) 8 (12) 0 Histophitussonini 5 (12) 2 (10) 3 (50) 10 (15) 3 Total PCR detection data and data broken down by sample origin are overall respiratory tract profiles,positiveif agent svaspresent in either nasopharyngealswabsampte or lung tissuesample or both. Detection in both sampte types represents the number of positiveanimalswith the PCR-detectedagent in both nasopharyngealssvaband lung tissuesamples. -o Culture data represent isolatesrecovered from lung tissuesamples. 0 3 0) resistant if they exhibited a high MIC and harbored a corresponding an nasopharynx, lung, or both. Manuheirnia spp. were present in (1) timicrobial resistance gene determinant. 91% of cattle, followed by BVDV (69%), with the subspecies 3 Screening for resistance determinants and integrative conjugation BVDV1 accounting for 77% of BVDV positives. BVDV2 was ob b elements. PCR was used to screen for resistance gene determinants and served in 26% of cattle, with all BVDV2 containing samples orig (0 integrative conjugation element (ICE)-associated genes from ICEPnzul in inating from Alberta. One animal screened positive for both 0 isolates of M. ltaemolytica,P. niuttocida,and H. sornni.All PCRs used D BVDV subspecies, with BVDV2 detected in the nasopharynx and heat-lysed colony suspension as the template and primers and annealing > BVDV1 detected in the lung. Mycopiasnta bovis (63%) and H. conditions described in Table 1. Representative PCR products were se CO somni (57%) were detected in more than half of the mortalities, quenced to confirm the accuracy of amplified fragments. 0) Bacterial conjugation assay. Conjugal mating experiments were per followed by BRSV (19%), PI3V (13%), and P. ntuitocida (13%). C,) formed to examine the mobility of ICE among isolates of M. haentotytica, BoHV-1 was not detected in any of the samples. Significant posi 0 P. mtiltocida, and H.sonini.Spontaneous rifampin-resistant tRW) isolates tive correlations were found between PCR results from nasopha F’) for P. mttltocidastrain 17976B and Escherichiacolistrain K-12 were gen ryngeal swab and lung tissue samples in individual animals for 0 erated by selecting and purif’ing colonies on brain heart infusion (BHI) Mannheirnia spp. (r — 0.391,? = 0.0011), P. ntuttocidct (r = 0.531, —.4 or Luria-Bertani (LB) (BD Canada Inc., Mississauga, ON) agar plates, P < 0.0001), M. bovis (r = 0.395, P = 0.0010), and BVDV (r = 0 respectively, containing 25 jig/mI rifampin. The RW P. rntiltocida was CO used as a recipient forM. haemotyticaand H. sonini donor strains while 0.630, P < 0.0001). RWE.coilwasusedasarecipientforP. rntilrocidadonor strains. Overnight Coexistence of multiple pathogens was found in 97% of BRD 0CD cultures of donor and recipient strains were grown at 37°C on TSA plates cases, with Mannheintia spp., BVDV, and M. bovis cooccurrence containing 5% blood and mating assays were performed as previously most frequently identified (16.2%), followed byMaitnheintia spp., described (21). Representative colonies of resulting transconjugants were BVDV, M. bovis, and H. sonini cooccurrence (11.8%) and streak purified twice before the transfers of resistance-conferring elements Mannheintia spp. and BVDV cooccurrence (10.3%) (Fig. 1). were verified by susceptibility testing and PCR screening for resistance Overall, the most prevalent pathogens identified together were determinants and ICE-associated genes from ICEPrntil. To ensure that Mannheimia spp. and BVDV, present in 63% of the cattle studied. transconjugants were not spontaneously resistant donor cells, they were Bacterial species that were identified by their 16S rRNA characterized by PCR using the species-specific primers listed in Table 1. se quences but not part of the BRD complex included Bacillus RESULTS spp., Psychrobacter spp., E. coil, Caruobctcteriurn spp., Enterobacter Bacterial and viral pathogen detection. For the detection of bac spp., Trueperetta pyogenes, Pantoea agglornerans, Cornarnonas spp., terial and viral pathogens implicated in BRD (Table 2) (BVDV, Aeronwnas spp., Alcatigenes spp., Arthrobacter oxydans, Lactoba BRSV, BoHV-1, PI3V, Mannheirnia spp., M. bovis, P. muttocida, cittus scikei,Pasteuretta trehatosi, Proteus rnirabihs, Staphylococcus and H. sonini), nucleic acid extractions from lung tissue and na vitutinus, and Streptococcus uberis (data not shown). sopharyngeal swabswere screened by PCR and used to generate an Isolate recovery and characterization. Single isolates of M. overall profile of respiratory tract occurrence. Samples were iden haentolytica (a = 55), P. ntultocida (a = 8), and H. somni (a = 10) tified as positive if the viral or bacterial agent was detected in the were recovered from lung tissue samples (Table 2). From the 55
February 2014 Volume 52 Number 2 jcm.asm.org 441 ______
Klima et al.
BRSV,BVDV,HS,MB BRSV,BVDV,HS, MB,M app BRSV,BVDV,HS, MB,M spp. PI3V BRSV,BVDV.HS, MB, Mapp., PM BRSV,BVDV,HS, MB,PI3V • Alberta BRSV,BVDV,MB Nebraska BRSV, BVDV,Mapp. BRSV,BVDV,Mspp., PM O Texas C BRSV,HS, MB,Mapp .2 BRSV,HS, MB,PM BVDV,HS,MB BVDV,ItS, MB,Mapp BVDV,HS, MB Mapp., PI3V BVDV,HS,M app. BVOV,HS, Mapp., PM c BVDV,MB,Mspp. \\\\\\\\\\\\ 0 BVDV,MB,Mapp., PI3V BVDV,MB,M app., PI3V,PM BVDV,Mspp 0 HS,MB,Mspp. :3 HS, MB,Mspp., PI3V 0 HS,MB,Mspp., PM II) HS,M app. 0 CD HS, Mspp,PM a HS,PI3V MB,Mapp Mspp. 3 0 2 4 6 8 10 12 0 Animals with pathogen combination (%) C) a, FIG1 Bacterialandviralcoinfectionintherespiratorytractoffeedlotcattlemortalitiesthatsuccumbedtobovinerespiratorydisease, BRSV,bovinerespiratory 3 syncytialvirus;BVDV,bovineviraldiarrheavirus;I-IS,Histophilussomni;MB,Mycophisinabovis;Mspp.,Monuheinno species;PM,Pasteurelto,nultocida;PI3V, 1) parainfiuenza3 virus.OverallrespiratorytractprofilesarepresentedwithanimalsclassifiedasinfectedifpathogenicagentsweredetectedbyPCRin nasopha C,) ryngealswabs,lungtissue,or both, 3 0 Co 0 M. haernoiyticaisolates collected across North America, 80% (is HS25, and HS33) (fig. 3B) and one isolate exhibiting a gene pro 44) were 1,3.6% (is 2) were 2, 16.3% (is file to the serotype = serotype and similar that of multidrug-resistant isolates of M. haerno C 9) were serotype 6. PFGE analysis identified a clonal subpopula iyficctand P. multocida described above (HS33) (Fig. 3B). CO C tion of M. haenwlytica (is 8) in isolates originating in Nebraska Conjugal transfer of ICE/mobile genetic elements. Mating Cl) (Fig. 2) (MHO9, MH11, MH3Y, MH34, MH35, MH42, MH44, assays were used to assess the transfer of mobile genetic elements and MHO8). Antimicrobial resistant isolates ofF. muitocida were conferring multidrug resistance from isolates of M. haenwiytica 0 found in cattle from Texas, Nebraska, and Alberta and shared (is = 25) and H. sonmi (is = 4) to an Rie strain of P. muitocida and 0I’3 >70% genetic relatedness (fig. 3A). Isolates of H. sornisi from from P. muttocida (is 3) to an RW strain of E. coil (Table 3). All Alberta and Texas exhibited nearly identical pulsotypes (Fig. 3B). but eight matings successfully generated transconjugant colonies. 0 Susceptibility testing showed 72% of M. haernolytica and 50% Susceptibility testing and PCR were used to confirm phenotypes CO ofF. niultocida isolates were antimicrobial resistant. Ofthese, 30% and genetic transfer of resistance determinants and ICE-associ C of M. haernolytica (fig. 2) (is = 16) and 12.5% of P. muttocida (fig. ated genes from ICEPnsul to transconjugants. In 21 of 24 success 0CD 3a) (is = 1) were resistant to more than seven antimicrobial ful transformations, all resistance phenotypes and associated re classes, including aminoglycosides, penicillins, fluoroquinolones, sistance genes were transferred, excepting danofloxacin. It is lincosamides, macrolides, pleuromutilins, and tetracyclines. All possible that the danofloxacin resistance determinant was not lo multidrug-resistant isolates originated from samples collected in cated on the ICE or was not functional in transconjugants. In Texas or Nebraska. Antimicrobial-resistant phenotypeswere ob instances where successfullytransformed recipients differed from served in multiple M. haernotytica populations with pulsotypes the profiles of the donors, ttvo transconjugants acquired all genes ranging in similarity from 65 to 100% (fig. 2), indicating that and corresponding resistance phenotype with the exception of the resistance was not spread strictly by clonal dissemination. All an bia001 gene and associated ampicillin and penicillin resistance timicrobial resistance phenotypes observed corresponded with (MH24 and MH5) (Table 3). One transconjugant acquired all PCR-positive results for the ICE-associated genes from ICEPrnul resistance phenotypes with the exception of ceftiofur, which was listed in Table 1,with the exception of two P. multocida isolates for observed in the donor P. muitocida strain (PM22) (Table 3). In the which a determinant for ceftiofur resistance was not identified. eight cases where matings were unsuccessful, one donor isolate Antimicrobial susceptibility testing of H. somni isolates pro (MH8) (Table 3) had the full complement of ICE-associated genes duced inconsistent results and therefore, only genotypic analyses from ICEPnzul, six of the donor isolates (Table 3) (MH2, MH25, were reported (Fig. 3). PCR for resistance determinants revealed MH26, MH27, MH51, and MH57) did not contain the hypothet four isolates harboring multiple resistance genes (H545, 1-1556, ical protein or integrase gene, and one donor isolate (HS25)
442 jcm.asm.org Journal of Clinical Microbiology BRDPathogens and MciItidrug Resistance
Ispbp Ori.’in’ SemI, nc Phenohnc” MIl23 TX I AMP. Pt N’, Cl-N’, Oxyl’, lit’, TUL’, 0410, t’4R0’, SPEC’ ‘.1107 71 I GUN’,OXYI’, ILL’. 0410’, WIRO’, SPEC MI lIt, lx I AMP, PEN’.GtN’.OXYr. IL’.IUL’, 0410’, INRO’, SPEC’
‘.11154 NE I AMP’, PEN’, FIN’, GEl’, NtO’, OX VI’.lIL’, ThE’. DANO’,EIRO’
‘.11141 AB I NECY,OXYT’
SIllS.) AR I ItO’, OXYV
641100. AD I NI 0, OX Vi’
‘.11157 ‘.0 I ItO’. OXYT’, TIC’, JUL. 0,510’ ‘.10101 ‘.13 OXYI’ ‘.1021 AS
‘.11110 All I 110, 0117’
‘.11150 AS I TIL’ M1112 AS Ml 07 AS 6 III 120 45 I NEO’. 0111’ ‘.11113 AS OXYT’
‘.11167 AS I ‘.11125 ix i A’.lV,PF’.GEN’.OXVT’,CEET,ilI’,TUL’,D,\NO’,ENRO’SPEC ‘.11164 AD I ItO’. 0117’
MI-los AS 1 110’. OXYT’ SIIl6 AD I NE0’.OXIE’
M1102 AS C NEC)’.01ST ‘.1)165 AS I 110’, OXST 0 641-123 TX 6
‘.11164 AS I 110’, OX’.’)’ 641161 45 I lEO’. OXYt 0 641151 XL I AMP’. PEN’, GE’S’.011 t, ill.’. 101’. 0.310’, 111(1, SPEC’ 64)118 Nc I PEN, GUN’. lEO’, OXYT’, TIL’,TI 1’. 0,610’, SPEC’ 0 64114] XC I tN,NF0. 011 C. lit’. GANG CD ‘.11 107 NE C UPS’. GUN’. ItO’. OXYT’, IlL’. ILL’. DAIlY, SPEC a
‘.11133 NE C FUN’.GUN’. ITO’. OX’,”r. TIL’,iUL’, 0410’, Sl’EC’
640(13 NE I PIN’, GUN’. tG’. Ox’.]’.ci trilL’. n;c’. 0410’. SPEC’ MIII I Nt. C PIN’, GEN’, NEo’.oxvr,nL’,TUL’. GANG’, SPEC’ 3 641131 NE I EFN.GEN’,NEfY,OXYT.TCILTI;C’,DANO.SI’Ff”
‘.11134 XE C PEN’, GUN’. NE0’. GIll’, nC’. TUC’. 0410’. SPEC’
‘.11135 NE I FE’S’.GUN’. ItO’, OXYT. CTEr.iIL’, JUL’ GANG’. SPEC’ ‘.11142 NE I FI-N’.GLN’.NLO’.OXYI’,TIL’.TUL’.DANO’,SP[C’
‘.11143 NE I PEN’,GIN, lEO’. 0117 . CTEE’, ilL’. JUL. GANG’, SPEC’ ‘.111115 Nt I rrN.mN’,NrIY,oxyl’TII’.IIJI’,oANo’,sprc’ 0 ‘.11137 ‘.13 C 3 ‘.11)56 AS a ‘.111111 XL I GE’.’. ItO’, GIVE’. dEl’. IlL’. JUL’ SI’EC’ 0 MHS2 NE I GEN’,NEO’.OX’.T,CTUT’,TII,’. JUt’, SPEC’
641129 NE C GUN’,OXY’t’, frET’. TtJC’, DANO’, SAC’ 3 641130 40 6 b ‘.11137 AS 6 CD ‘.11155 All SlUM AS 0 0 ‘.11140 AS 6 D ‘.11416 AS I, 641114 AS 6 641110 Ni I GUN’.OXYE’,ClEI’.iCIL’. 13ANCY’.SPLC’ CD MIlls AS I NEO’, GIVE’, 0410’ ‘.11131 NE 2 GIN’, OX’.]’, Cit C. TIt’. 101’, DAMCJ’,SPEC 0 ‘.11130 AS 2 Ce) FIG 2 Pulsotype, serotype, and antimicrobial susceptibility profileofM. Itaemolytica cultured from lung tiSSue of bovine respiratory diseasemortalities in North 0
America. The dendrogram was using unweightedpairgroupmethodwitharithmetic averages (UPGMA) clustering of Dice coefficient values. The similarity F’.) matrix was based on band-matching analysis,with optimization and tolerance settings of 1.0%and 1.5%,respectively.c, TX, Texas;NE, Nebraska; AB,Alberta, 0 1., AMP’, ampicillin resistant; PENr, penicillin resistant; GEN’, gentamicin resistant; OXYT’,oxytetracycline resistant; TILr, tilmicosin resistant; TULr, tulath romycin resistant; DANO’, danofioxacin resistant; ENRO’, enrofioxacin resistant; SPEC, spectinomycin resistant; FFNr,florfenicol resistant; NEO’, neomycin 0 resistant; CTETr,chlortetracycline resistant. CD 0CD (Table 3) did not contain the multicopper oxidase gene. However, The occurrence of BVDV in this study was slightly higher than two isolates with a partial complement of ICE-associated genes expected. Administrations of modified livevaccinesare a potential from ICEPmuI (containing three of the fivescreened genes: mul source of false-positive data if the duration between vaccination ticopper oxidase, transposase tnpA, and single-stranded DNA- and testing is too short and the vaccine virus is still detectible by binding protein) were successfully transferred (MH54 and PCR. Although the majority of the cattle in this study received a MH24) (Table 3). modified livevaccine, more than 90% were sampled at least 7 days after the vaccine was administered upon entry to the feedlot. Per DISCUSSION sistently infected (P1)cattle are also known to be a primary source With the exception of a fewcases (4, 22, 23), epidemiological data of BVDVexposure, leading to seroconversion in over 80% of pre associated with acute BRD mortalities seldom include the com viously virus-free calves postcontact (25). Although not screened plete range of agents that can play a role in the disease. Further, the for in the feedtots sampled, P1animals could have contributed to prevalence of agents is often highly variable within individual the increased occurrence of BVDV seen here. It was also interest cases, likely due to the multiple factors involved in BRD patho ing to note that all cases of BVDV2 were found in Alberta when genesis.Consistently, in all studies, including ours, i’1.hnenwtytica BVDV2 has been detected in 27.9% of U.S. stocker calves with has been the predominant pathogenic agent detected, and is often acute respiratory disease in the past (22), and others have shown identified in mixed infections with M. bovis and BVDV(1, 23, 24). that BVDV2 accounts for a substantial portion of the North
February 2014 Volume 52 Number 2 jcm.asm.org 443 Klima et al.
% similarity
PFCE Profile Isolate Orluin Phen,)hI)e A I’M21 AR XNL’, AMP. PEN’ PM68 AR f PM39 AR NE0’. OXYT’,TIL’ PM$ NE NEO’, OXYlr, TIL’, DANO’ { ---L PM22 TX XNL’, AMP’, GEN’. NEO’, OX\7’, TIL’. TElL’, DANOr,SPEC’ PM56 AR P5167 AR PMI7 AR
Isolate Orinin Resishinee-nene ProfiIe HS45 NE foR, op/iA-!. feiR, Uflil). sfrA,.slrB, ssI2 B 11556 AR up/iA-]. leiR, M(ll),sO.l.strB, suI2 11513 AR 0 11522 IX HS39 AR IcIR. let(‘II) t1Sl8 Alt leiR, tel/it) 0 ITSIt AR IctR. tel/H) 0 CD 11526 TX MR. tel/il) 0 llS25 TX JIoR, up/cl’!. MR. ret/i), rnsr(L) nah(E),,crr,1,.srr8, soD 0 iI ttS33 NE blur,, .jluR, u,kllJ, up/iA—I,MR. Ut/it). n,sr(E), mph(P. cuuL42S.,,leA sIr!!, sid2 3
FIG 3 Pulsotype and antimicrobial susceptibility phenotype and resistance gene-determinant profiles of (A) Pasteurellantultocidaand (B) Histophitttssomni cultured from lung tissue samples from bovine respiratory diseasemortalities in North America. The dendrogram wascreated using UPGMAclustering of Dice -o coefficient values. The similarity matrix was based on band-matching analysis, with optimization and tolerance settings of 1.0% and 1.5%, respectively.The phenotype data are presented for P.mtiltocidoonly. “,XNL’,ceftiofur resistant; AMP’,ampicillin resistant; PENr,penicillin resistant; NEOr,neomycin resistant; C) oxYT, oxytetracycline resistant; TILr, tilmicosin resistant; DANO’, danofioxacin resistant; GENr,gentamicin resistant; TULr, tulathromycin resistant; SPEC, 3 H. ‘fable I. spectinomycin resistant. The resistance gene profile for sound was generated from PCR detection of resistance determinants listed in Co 3 0 Co American BVDV population (26). It is possible that the failure to as it persists latently in the sensory neurons of the trigeminat gan 0 detect BVDV2 in U.S. BRD mortalities reflects a lower prevalence glia or tonsils (30) and is undetectable in nasal mucus postinfec BVDV2 States in is also (31). sample size also have to rate of in the United than Canada. It tion Our limited may contributed C possible those data are a result of the restricted sample size, a our low level of detection of this pathogen. Co C limitation of the PCR to identify cattle infected with multiple Previously, ribotyping of?. rnuttocidczobtained from nasal and Co strains of BVDV, or the result of the use of BVDV2-based modi tracheal swabs of calves with BRD found that 70% of the isolates (AZ fied live vaccines in Alberta but not U.S. feedlots. obtained from these two locations were genetically identical (32) C Compared to previous investigations (23, 27), the occurrence and Timsit et al. (33) recently found that 77% of M. haenwlytica 0 of?. muttocida was lower than anticipated, but it is acknowledged collected from the nasopharynx and trans-tracheal aspirations that P. muttocidaplays a significant role in dairy calf pneumonia had identical PFGE profiles. Here, we were interested to see if and in subacute/chronic bronchopneumonia (28, 29) and lessof a nasopharyngeal swabs could serve as a reliable and economical CO role in acute fibrinous pneumonia in feedlot calves.Despite selec alternative to lung tissue to detect both viral and bacterial agents C CD tion for fibrinous pneumonia cases, M. bovis and H. somni were implicated in BRD using PCR. Comparisons of PFGE profiles or Cl) isolated at higher rates than expected, comparable to those de DNA sequences from M. haernolytica and BVDV, respectively, tected in chronic and bronchiolar pneumonia casesin Alberta (4). collected from both the nasopharynx and lungs of individual an Likewise, the prevalence of BSRVin the current study was more imals, revealed that in over 80% of casesthe agents were identical similar to that reported in subacute pneumonia (1). In the past 5 (data not shown). Further, high concordance was observed be years, chronic pneumonia has accounted for an increasing pro tween nasopharyngeal swabs and lung tissue for PCR detection of portion of reported BRD cases (6) and it is not uncommon to see Mannheirnia spp. and BVDV, indicating that nasophatyngeal both fibrinous and caseonecrotic pneumonia occurring simulta swabs may provide a representative profile of the involvement of neously within the same individual (5). Additionally, coisolation these agents in acute BRD mortalities. of multiple respiratory pathogens is commonly reported in BRD Between 2000 and 2009, overall decreases in the susceptibility diagnostic investigations (4, 22—24).Thus, the elevated detection of M. haernolytica to danofloxacin, tilmicosin, tulathromycin, en of some pathogens not typically associated with fibrinous pneu rofloxacin, and florfenicol have been observed, with the latter two monia may not be surprising. antimicrobials in particular associated with increased resistance in The only viral pathogen tested for but not detected in this study H. sonmi (34). Overtime, the MICs of tetracycline, tilmicosin, and was BoHV-1. Previously, BoHV-l has been reported in up to 10% tulathromycin have also been increasing for H. somni (34), of BRD cases (4, 23). However, if calves had been infected with whereas bovine-sourced P. multocida has shown reduced suscep BoHV-1 prior to sampling, the virus may not have been detected tibility to florfenicol, spectinomycin, tetracycline, tilmicosin, and
444 jcm.asm.org Journal of Clinical Microbiology BRDPathogens and Multidrug Resistance
TABLE 3 Donor strain gene profile, transfer outcome, and resulting transconjugant genotype and phenotype Donor strain ICE- associated Transconjugant Donor genes from ICEPmu1 matches donor strain Donor strain resistance gene profile profile” (yes or no) MH2 aphA-1, tetR, tet(H), strA,srrB,sul2 Cu-oxi, tupA,ssb No5 MH8 bki0,,,,floR, addB, csphA-],tetR, tet(H), crnz(42),nsr(E), mph(E), aadA.25,strA, strB,ss,t2 Hypo, Int, Cu-oxi, tnpA, ssb No” MH9 blisoxA,floR, addB, aphA-1, tetR, tet(H), er,n(42), msr(E), snph(E),aacL42S,strA,suB, sul2 Hypo, Int, Cu-oxi, tupA, ssb Yes MHID b1a0 ,, nadB, tetR, tet(H), nisr(E), nph(E), nndA25 Hypo, lnt, Cu-oxi, tupA, ssb Yes MI-Ill btaok,,floR, sddB, apM-1, tetR, tet(H), mu(42), nisr(E), niph(E), aadA25, strA,strB, sut2 Hypo, Int, Cu-oxi, tnpA, ssb Yes MH24 bin5051, bIa0,2, nndB, tetR, tet(H), ?usr(E),snph(E),aadA25 Cu-oxi, tnpA,ssb No’ MH25 bin5051, biao,c ,, nndB, tetR, tct(H), usr(E), uiph(f), nnUA25 Cu-oxi, tupA,ssb No” MH26 bln5051, bia055,, nadB, tetR, tet(H), ,usr(E), uiph(f,), nndA25 Cu-oxi, tnpA,ssb No”
MH27 btn0-, 2’ addB, tetR,tet(H,l, ,nsr(E, ntph(E, nndA25 Cu-oxi, tupA,ssb No”
MH2$ bin 2,floR, nddB,nphA-1, tetR, tct(H), erni(42), snsr(E),mph(E), nndA25,strA,strB,sul2 Hypo, Int, Cu-oxi, tupA, ssb Yes MH29 bla0-,, addB, terR,tct(H), iusr(E), iuph(E), andA25 Hypo, mt Cu-oxi, tupA, ssb Yes
MH3O bia0-,, addB, tsphA-1, tetR, tet(H), cnn(42), msr(E), ntph(E), andA25,strA, strB,st,12 Hypo, mt Cu-oxi, tupA, ssb Yes MH3I bia0,,floR, ,sddB,apk4-l, tetR, tet(H), erni(42), ntsr(E), mph(E), nadA25, strA, strB,st,i2 Hypo, tnt, Cu-oxi, tupA,ssb Yes 0 MH32 b1a0,,,, addB, nphA-1, tetR, tct(H), crsu(42), ntsr(E), mph(E), aadA25, strA,strB,sid2 Hypo, tnt, Cu-oxi, tnpA,ssb Yes MH33 btn0,, nddB, tetR, tct(H), ,nsr(E), ntph(E), nadA25 Hypo, tnt, Cu-oxi,tupA,ssb Yes MH34 b1n0.<.,,,floR,adUB,np/tA-I, tetR, tct(H), crnt(42), msr(E,),mph(E), nndA25,strA,strB Hypo, tnt, Cu-oxi, tnpA, ssb Yes 0 MH35 bln().,,,,fioR, addB, np/tA-I, tctR, tet(H), erm(42), ntsr(E,),mph(E), nndA25,strA,strB, ss,t2 Hypo, tnt, Cu-oxi, tupA, ssb Yes 0 CD MH42 bin0,,,ftoR, nddB, np/tA-I, tetR, tct(H), ernz(42),ntsr(E), tuph(E), nndA25,strA,srrB, sui2 Hypo, tnt, Cu-oxi, tupA, ssb Yes a MH43 foR, aphA-I, tetR, tet(H), euu(42), strA,strB,st,l2 Hypo, tnt, Cu-oxi, tupA, ssb Yes 0-t MH44 nddB, aphA-I, tetR, tet(H), cnu(42), :usr(E), niph(E), nad,425,strA, strB,suD Hypo, tnt, Cu-oxi, tupA, ssb Yes 3 MH51 bin50151, bln 2’ nndB, tetR, tet(H), susr(E),ntph(E), aadA25 Cu-oxi, tupA,ssb No” MH52 bin0,2,floR, ncldB,np/tA-I, tetR, tet(H), eriu(42), ntsr(E), tuph(E), andA25,strA, strB,sui2 Hypo, tnt, Cu-oxi, tupA,ssb Yes \iH33 bln0-,2,floR, ,tddB,np/tA-I, tetR, tet(H), criu(42), ,usr(E), tuph(E), nadA25,strA,suB, sui2 I-typo,tnt, Cu-oxi, tupA, ssb Yes •0 MH54 binROB , b1a,,. ,,floR, addB, nphA-i, tctR, tet(H), ernt(42), tusr(E), sup/t(E),nntL425,strA, Cu-oxi, tnpA, ssb No’ 0 strB, sut2 3 MH57 apliA-], tetR, tet(H), strA, strB, sui2 Cu-oxi, tupA,ssb No” ) PM8A nphA-I, tetR, tet(H), eriit(42), strA, strB,sul2 0 Hypo, tnt, Cu-oxi, tupA, ssb Yes 3 PM22A 2’ ddB, np/tA-], tctR, tct(H), mn(42), msr(E), snph(E),nddA2S,strA,strB,st,12 Hypo, tnt, Cu-oxi, utpA, ssb No” PM39A nphA-I, tetR, tet(H), erm(42), strA, strB,st,12 Hypo, tnt, Cu-oxi, tupA, ssb Yes b Co HS25A foR, aphA-I, tetR, tet(H), ntsr(E), ntph(E), strA,strB, 51112 Hypo, tnt, tupA,ssb No” HS33A bin 2,floR, nddB,nphA-I, tetR, tet(H), crin(42), ntsr(E), ntph(E), nndA25,strA,strB, sul2 Hypo, tnt, Cu-oxi, tupA, Yes 0 ov,, ssb D HS45A foR, np/tA-I , tetR, tet(H), strA, strB, st,12 Hypo, tnt, Cu-oxi, tupA, ssb Yes HS56A nphA-1, tetR, tet(H), strA,strB, sul2 Hypo, tnt, Cu-oxi, titpA,ssb Yes CD Hypo,hypotheticalprotein;tnt,integrase;Cu-oxi,multicopperoxidase;tspA,transposase;ssb,single-strandedDNA-bindingprotein. Elementdidnot transfer. 0 Flu505 notdetected. Cz “Ceftiofur-resistantphenotypenotobservedin transconfugant. C CF’) trimethoprim-sulfamethoxazole (27). Consistent with these mosome, ICE retain the machinery required for excision and con 0 trends, the present study revealed a high overall rate of antimicro jugal transfer (14). These elements contribute to the horizontal bial resistance. Seventy-two percent of M. huentotyticaisolated in transfer of accessory genes that can bestow traits of antibiotic and CD this CD study were antimicrobial resistant, about twice the percentage heavy-metal resistance, virulence, bioflim formation, nitrogen C,, detected forM. huentotyticaisolated from the nasopharynx of cat fixation, and metabolic adaptation (14, 39). The modular struc tle displaying BRD (35%) in a previous study from our group (19). ture of ICE with tandem arrays of closely related elements pro Furthermore, evidence for multidrug resistance against more than motes generation of novel ICE through module swapping and three antimicrobials was found in 45% of the isolates collected recombination (14). Certain ICE families employ processes such during this project, results agreeing with reports that multidrug as toxin-antitoxin systems to prevent their loss, ensuring reinte resistance in BRD pathogens is on the increase (35—37). gration back into the donor cell after conjugation has occurred Recently, an isolate ofF. ntultocidctoriginating from a beef calf (40). Integrated conjugative elements have been detected in H. in Nebraska was shown to harbor an ICE (ICEPntul) that carried sontni with accessory genes for heavy metal and toxin resistance 11 resistance determinants (38). The similarity between the anti (21), but prior to this report they have not contained multidrug microbial-resistant phenotypic profile of that ICEPntul isolate resistance cassettes. In M. hcternolyticct,a partial ICE was identified and the profiles of isolates recovered in this study prompted the by Michael et al. (21) in the draft genome sequence of PHL2I3, search for and subsequent detection of ICE in M. ttaernolytica,P. and a putative ICEM/ti was recently detected in M. haentolytica rntittocida, and H. sontni. Integrated conjugative elements are a strain 42548, the latter harboring five resistance genes, aphA-1, diverse group of mobile genetic elements found in both Gram strA,strB,sul2,and tetR-tetH (41), a lessdeveloped complement of positive and Gram-negative bacteria, including Proteobacterict, resistance genes than that identified in the present study. Actinobacteria,and firmict,tes. Although resident in the host chro ICEPmuI from P. multocida has been shown to undergo con-
February 2014 Volume 52 Number 2 jcm.asm.org 445 Klimaet al.
jugal transfer among strains of M. haernolyticaand F. coil(21). In healthy and sick populations of cattle (19), and the high levels of this study, we successfully transferred ICE from M. haernoiytica resistance observed in mortality cases here may not be represent and H. somni into a recipient strain of P. muitocida, but not di those of the general population. rectly into F. coil. Transformation efficiency was not examined To our knowledge, this is the first detection of ICE in M. hoe here and it ispossiblethat ICEtransfer from M. haernoiyticato F. coil moiytica and H. somni from U.S. feedlots, and the very recent or from H. somni toE. coiloccurs, but at low frequency. Integrated identification of ICEPmuI (38) indicates that these elements may conjugative elements from P. nsiiltocidawere readily transferred have recently emerged within the feedlot environment. In the cur into a recipient strain ofE. coil,raising the possibility that P. rnui rent study, isolates of M. haemoiyticawere obtained that exhibited tocida may act as a potential vector for ICE among bacterial spe resistant phenotypes against all antimicrobials commonly em cies. ployed to treat 3RD, except ceftiofur. However, resistance to ceft Further investigations into interspecies transfer of the ICE de iofur was observed in this study in an isolate of P. mziltocidaand tected here, in particular transfer from BRD pathogens into en the potential incorporation of this undefined determinant into teric zoonotic or environmentally persistent species that thrive in existing M. haemoiytica could result in pathogenic isolates resis fecal material and water bodies in feedlot environments, are im tant to the entire suite of therapies commonly used to treat and portant. Transfer of ICE into environmental isolates, such as those prevent respiratory disease in feedlot cattle. C we coisolated with BRD pathogens (Actinobacter spp., Bacillus The identification of ICE elements in this study is new infor 0 spp., Carnobacteriurn spp., and Psychrobacterspp.), could result in mation that may affect our thought processes relative to how an the dissemination of these elements into the broader environ timicrobials are used for BRDcontrol and treatment. One hypoth 0 ment, establishing a reservoir for their persistence. In addition, esis is that the presence or absence of ICE elements relates to 0 many veterinary and zoonotic pathogens are present in the feedlot antimicrobial use; however, in the current study the Alberta feed- CD environment, including Sairnonelia spp., Enterococcusspp., Cam lots followed the same antimicrobial use protocols for BRD con 0 pyiobacter jejuni, E. coil, Yersinia enterocolitica, and Clostridium trol and treatment as those in Nebraska. As such, continued re 0 difficlie.Potentially pathogenic species, including F. coil, Proteus search should be supported to investigate interspecies barriers for 3 mirabiiis, Moraxeiia bovocuil,and Streptococcusuberis were iden ICE transfer and to describe donor versus recipient range to pro tified in this study but not examined for antimicrobial resistance vide more information about how features of these elements con 0 phenotypes. Multidrug resistance development in these organ tribute to proliferation and spread. Further, comparative se C, isms as a result of a single ICE transfer event could potentially have quence analysisof these identified ICE is required to confirm gene 3 undesirable consequences for human health. arrangement, and may give insight into of the evolutionary devel ci) In this study, it was interesting that multidrug-resistant ICE opment of these specificelements. IfICE elements were to become 3 were detected in a high proportion of the U.S. samples (88%) but established in bacterial populations implicated in BRD, it could 0 not in the samples screened from Alberta. In the United States,the compromise the ability of prophylactic use of antimicrobials to CO majority of feedlots contain more than 32,000 animals, with the control this important disease. 0 five largest feeding operations controlling approximately 20% of feeding capacity. The average feedlot in Alberta or Saskatchewan ACKNOWLEDGMENTS contains approximately 8,000 head, with 64% of feedlots in Al We thank Fred Van Herk for support with statistical analyses and Sherry CO berta havingcapacitiesof <20,000 head (42).It ispossiblethat larger, Hannon,TrinaHancock,TraceyGreer,andBreckHunsakerfromfeedlot Ci) higher-density operations require more antimicrobial input to pre HealthManagementServicesand SamIvesfromCactusfeedersforpro vent disease.Likewise,the U.S.calvessampledwere on average250lb vidingnecropsysamples. 0 lighter and on feed 17dayslessthan those in Alberta, indicating that ThisworkwassupportedbyAlbertaLivestockand MeatAssociation 0 theywerelikelyconsidered high riskfordevelopingBRDand targeted and TheAlbertaLivestockGenomeProgram. —1 for metaphylactictreatment upon arrival. 0 It is important to note that BRD mortalities were targeted in REFERENCES CO this study and the cattle examined were likely exposed to more 1. Larson RL. 2005. Effect of cattle disease on carcass trait. J. Anim. Sci. 83:37—47. antimicrobial therapies than the general cattle population. Fur CD 2. Snowder GD, Van Vieck LD, Cundiff LV, Bennett GE, Koohmaraie M, ci) ther, sample sizewas a limitation, and a larger surveillance project Dikeman ME. 2007. Bovine respiratory disease in feedlot cattle: pheno would be required to comment on the prevalence of ICE-harbor typic, environmental, and genetic correlations with growth, carcass, and ing bacteria in North American cattle populations. Future inves longissimus muscle palatability traits. J. Anim. Sci. 85:1885—1892.http: tigations into antimicrobial resistance profiles of P. muitocida, M. //dx.doi.org/ I0,2527/jas.2007-0008. 3. Rice JA, Carrasco-Medina L, Hodgins DC, Shewen PE. 2007. haemoiytica,and H. sonmi from swine and operations and poultry Mounl,eimiahaemotyticaand bovine respiratory disease. Anim. Health at other levels of the beef production system, including cow-calf Rca.Rev.8:117—128.http://dx.doi.org/0.1017/SI 166252307001375. and various points during the marketing chain, would be advis 4. Booker CW, Abutarbush SM, Morety PS, Jim GK, Pittman I], Schu able. Aarestrup et al. (43) estimated that swine and poultry ac nicht OC, Perrett T, Witdman BK, Fenton RK, Guichon PT, Janzen ED. count for about 34% and 33%, respectively,of the global livestock 2008. Microbiological and histopathological findings in cases of fatal bo vine respiratory disease of feedlot cattle in western Canada. Can. Vet. J. antimicrobial market, whereas cattle account for only 26%. The 49:473—481. majority of ICE in this study could be coselected for through the 5. GageaMI, Bateman KG, Shanahan RA, van Dreumel T, McEwen BJ, use of florfenicol, enrofloxacin, tilmicosin, or tetracycline, all Carman S, Archambault M, Caswell JL. 2006. Naturally occurring drugs used to prevent or treat 3RD (27) but also approved for use Mycoplasmtibovis-associated pneumonia and polyarthritis in feedlot beef calves. Vet. Diagn. Invest. 18:29—40.htip:/!clx.doi.org/I0.I 177 in swine and poultry. Examination J. of the prevalence of ICE-har /104063870601800105. boring bacteria in the general feedlot population would be of ben 6. Woolums AR. 2010. Feedlot BRD: is the disease changing? p 16—20.In efit as rates of resistance have been shown to differ between Proceedings of the North American Veterinary Conference, Orlando, FL.
446 jcm.ssm.org Journal of Clinical Microbiology RRDPathogens and Multidrug Resistance
7. Larson RL, Step DL. 2012. Evidence-based effectiveness of Vaccination with bronchopneumonia. I. Vet. Diagn. Invest. 24:277—282.http:I/dx.doi against Mannheimia haemoiytica,Pasteureila multocida, and Histophitus .orgIlO.l 177/1040638711428149. somni in feedlot cattle for mitigating the incidence and effect of bovine 25. Fulton RW, Briggs RE, Ridpath IF, Salild IT, Confer AW, Payton ME, respiratory disease complex. Vet. Clin. North Am. Food Anim. Pract. Duff GC, Step DL, Walker DA. 2005. Transmission of bovine viral 28:97—106.http://dx.doi.org/ 0.I016/j.cvfa.2011.12.005. diarrhea Viruslb to susceptible and vaccinated calvesby exposure to per 8. Checkley SI. Campbell JR, Chirino-Trejo M, Janzen ED, Waldner CL. sistently infected calves.Can.]. Vet. Rca.69:161—169. 2010. Associations between antimicrobial use and the prevalence of anti 26. Ridpath Jf, Neill ID, Frey M, Landgraf 1G.2000. Phylogenetic,antigenic microbial resistance in fecalEschcridtia coilfrom feedlot cattle in western and clinicalcharacterizationof type 2 BVDVfrom North America.Vet. Mi Canada. Can. Vet.]. 51:853—861. crobial. 77:145—155.http:IIdx.doi.orstflo.1016/50378-1135(00)00271-6. 9. United States Department of Agriculture (USDA) Economic Research 27. Welsh RD, Dye LB, Payton ME, Confer AW. 2004. Isolation and anti Service. 2012. Statistics & information: U.S. cattle and beef industry, microbial susceptibilities of bacterial pathogens from bovine pneumonia: 2002—2011.U.S.Department of Agriculture Economic Research Service, 1994—2002.1.Vet. Diagn. Invest. 16:426—431.http://dx.doi.org/10.ll77 ‘Alashington,DC. llttp://wwsv.ers.usda.gov/topics/animal-productskat[le / 104063870-101601)510. -heef/statistics-informstion.aspxcdJdcdGWT22BOT. 28. Panciera RI, Confer AW. 2010. Pathogenesis and pathology of bovine 10. Silbergeld EK, Graham I, Price LB. 200$. Industrial food animal pro pneumonia. Vet. Clin. North Am. Food Anim. Pract. 26:191—214.http: duction, antimicrobial resistance, and human health. Annu. Rev. Public IIdx.doi.orI 10.1016/j.cuLc2O10(14.001. 29. Health 29:151—169. http://dx.doi.org/I0. I I46/annurev.publhealth.29 Dabo SM, Taylor JO, ConferAW. 2007.Pasteuretta muttocidaand bovine .020907.090904. respiratory disease. Anim. Health Res. Rev. 8:129—150.http:/Idx.doi.org II. CallDR, Davis MA, SawantAA.2008.Antimicrobial resistancein beefand /10.1017/81466252307001399. C dairycattleproduction. Anim. Health Rca.Rev.9:159—167.http://dx.doi.org 30. Ellis IA. 2009. Update on viral pathogenesis in BRD.Anim. Health Res. 0 Il0.1017/S146625230800I515. Rev. 10:149—153.http://dx.doi.org/10.1017/8t46625230999020X. 12. Catry B, Laevens H, Devriese LA, Opsomer G, De Kruif A. 2003. 31. Pastoret PP, Thiry E. 1985.Diagnosisand prophylaxisof infectiousbovine 0 role virus latency. Antimicrobial resistance in livestock. I. Vet. Pharmacol. Ther. 26:81—93. rhinotracheitis:the of Comp. Irnmunol. Microbiol.Infect. Dis.8:35—42.http://dx.doi.orgIlO.I0I6/0I47-9571(85)90052-9. 0 http://dx.doi.org! 10.l0-lt/j. 1365-2885.2003.00463.x. CD 13. McEwen SA,Fedorka-Cray PJ. 2002. Antimicrobial use and resistance in 32. DeRosa DC, Mechor GD, Staats J], Chengappa MM, Shryock TR. 2000. 0 animals. Clin. Infect. Dis. 4:S93—S106.http://dx.doi.org/I0.I086/3402.l6. Comparison of Pasteureita spp. simultaneously isolated from nasal and 14. Wozniak RAF, Waldor MK. 2010. Integrative and conjugative elements: transtracheal swabs from cattle with clinical signs of bovine respiratory 0 mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat. disease. I. Clin. Microbiol. 38:327—332. 3 Rev. Microbiol. 8:552—563.http://dx.doi.org/t0.I038/nrmicro2382. 33. Timsit E, Christensen H, Bareille N, Seegers H, Bisgaard M, Assié S. 2013. Transmission dynamics of Man,tlteimia hacmotytica in newly- 15. Watts IL, Sweeney MT. 2010. Antimicrobial resistance in bovine respi received bulls at Vet. ratory disease pathogens: measures, trends, and impact on efficacy.Vet. beef fattening operations. Microbiol. 161:295—304. http://drc.doi.org/I0.10I6/j.vetmic.20l 2.07.041. Clin. North Am. Food Anim. Pract. 26:79—88.http://dx.doi.orgJlO.I016 CD 34. E, C, L, 2012. A /j.cvii.2009. 10.009. Portis Lindeman Johansen Stottman G. ten-year (2000— 3 2009) study of antimicrobial susceptibility of bacteria that cause bovine 16. Alexander TW, Cook SR, Yanke LI, Booker CW, Morley PS, Read RR, respiratory disease complex—Mannhcintia hacntotytica,Pastenrettn mut (.0 Gow 5?, McAllister TA. 2008. A multiplex polymerase chain reaction tocida, and Histophitus aomni—in the United States and Canada. 1. Vet. 3 assayfor the identification of Mannitcinua hacmoiytica,ttiannheinna gin— Diagn. Invest. 24:932—944.http://dx.doi.org/10.1177/1010638712457559. 0 cosidaand Man,thcimia mutinous. Vet. Microbiol. 130:165—175.http:IIclx 35. Lubbers By, Hanzlicek GA. 2013. Antimicrobial multi-drug resistance Co ,doi.orgl 10.1016/I.vetrnk.200$.0 I.0t)I. and coresistance patterns of Mannheimia haenzotyticaisolated from bo 17. Sachse K, Salam HS, DiIler R, Schubert E, Hoffmann B, Hotzel H. 2010. 0 vine respiratory disease cases—a three-year (2009—2011)retrospective Use ofa novel real-time PCR technique to monitor and quantitate Myco analysis. I. Vet. Diagn. Invest. 25:413—417. http://dx.doi.org/I0. 1177 plasma bovisinfection in cattle herds with mastitis and respiratory disease. /10.106387I3185227. C Vet. 186:299—303.http://dx.doi.org/10.I0I6/j.tviI.2009.10.008. Co 1. 36. Esald H, Asai T, Kojima A, Ishihara K, Morioka A, Tamura Y, Taka C 18. Klima CL, Alexander TW, Read RR, Gow SP, Booker CW, Hannon 5, hashi T. 2005. Antimicrobial susceptibility of Mannhcimia haemotytica (.0 Sheedy C, McAllister TA, Selinger LB. 2011. Genetic characterization isolates from cattle in lapan from 200110 2002. Vet. Med. Sci.67:75—77. CoZ and antimicrobial susceptibility of Manuheintia hoemotyticaisolated from 1. http://dx.doi.org) 10.1292/jvms.67.75. 0 the nasopharynx of feedlot cattle. Vet. Microbiol. 149:390—39$.http://dx 37. Tang X, Zhao Z, Hu J, Wu B, Cai X, He Q, Chen H. 2009. Isolation, N) .doi.org/ 10.1016/j.vetrnic.20l0. 11.01$. antimicrobial resistance, and virulence genes of Pasteumeflamuirocida 0 19. Klima CK, Alexander TW, Hendrick 5, McAllister TA. 2013. Charac strains from swine in China. J. Clin. Microbial. 47:951—958.http://dx.doi terization of Ivlannheintia hoemotytica —1 isolated from feedlot cattle that .orgl 10.1128/JCM.02029-08. were healthy or treated Res.,in for bovine respiratory disease. Can. I. Vet. 38. Michael GB, Kadlec K, Sweeney MT, Brzuszldewicz E, Liesegang H, press. Daniel R, Murray RW, Watts IL, Schwarz S. 2012. ICEPmuI, an inte Co 20. Clinical and Laboratory Standards Institute. 200$. Performance stan C grative conjugative element (ICE) of Pasteumeilamuttocida:analysisof the CD dards for antimicrobial disk and dilution susceptibility tests for bacteria Co regions that comprise 12 antimicrobial resistance genes. I. Antimicrob. collected from animals; approved standard—3rd ed. CLSI document Chemother. 67:84—90.http://dx.doi.org/10.I093/jsc/clkr406. M31-A3. Clinical and Laboratory Standards Institute, Wayne, PA. 39. Bi D, Xu Z, Harrison EM,Tai C, Wei Y,HeX, Jia 5, Deng Z, Rajakumsr 21. Michael GB, Kadlec K, Sweeney MT, Brzuszkiewicz E, Liesegang H, K, Ou HY. 2012. ICEberg: a web-based resource for integrative and con Daniel R, Murray RW, Watts JL, Schwarz 5. 2012. ICEPmuI, an inte jugative elements found in bacteria. Nucleic Acids Rca.40:D621—D626. grative conjugative element (ICE) of Pasteurella multocida:structure and htt p/Id’..doi.org/ 10.11(93Inar/gkrS.t6. transfer.]. Antimicrob. Chemother. 67:91—100.http://dx.doi.org! 10.1093 40. Wozniak RA,Waldor MK. 2009. A toxin-antitoxin system promotes the /jsc/dkr.l 11. maintenance of an integrative conjugative element. PLoS Genet. 22. Fulton RW, Purdy CW, Confer AW, Salild IT, Loan RW, Briggs RE, 5:e1000439.http:l/dx.doi,orgl 10.137t/Journal.pgen. 1000439. Burge LI. 2000. Bovineviral diarrhea viral infections in feeder calveswith 41. Eidam C, Poehlein A, Brenner Michael G, Kadlec K, Liesegang H, respiratory disease: interactions avithPasteurelia spp., parinfluenza-3 Vi Brzuszldewicz E, Daniel R, Sweeney MT, Murray RW, Watts IL, rus, and bovine respiratory syncytial virus. Can. I. Vet. Res.64:151—159. Schwarz S. 2013. Complete genome sequence of Mannheimia haentolyrica 23. Fulton RW, Blood KS, Panciera RI, Payton ME, Ridpath IF, Confer strain 42548 from a case of bovine respiratory disease. Genome Announc.
AW, Salild IT, Burge LT, Welsh RD, Johnson B], Reck A. 2009. Lung 30:e00318—13.http://dx.doi.org/ 10.1I28/genomeA.O0318—13. pathology and infectious agents in fatal feedlot pneumonias and relation 42. Galyean ML, Ponce C, Schutz J. 2011. The future of beef production in
ship with mortality, disease onset, and treatments. I. Vet. Diagn. Invest. North America. Anim. front. 1:29—36.hIIp://dx.doi.org/I0.2527/sI2(II I
21:464—477.http://dx.doi.or9/ tO.I l77/I04063870902100407. -0013. 24. Lamm CG, Love BC, Krehbiel CR, Johnson N], Step DL. 2012. Com 43. Aarestrup FM, Oliver Duran C, Butch DG. 2008. Antimicrobial resis parison of antemortem antimicrobial treatment regimens to antimicro tance in swine production. Anim. Health Rca. Rev. 9:135—148.http://dx bial susceptibility patterns of postmortem lung isolatesfrom feedlot cattle .doi.org/ 10.10171St466252308001503.
February 2014 Volume 52 Number 2 jcm.asm.org 447 Klimaet al.
44. Angen 0, Thomsen J, Larsen LE, Larsen J,Kokotovic B, Heegaard PM, lytica and enterococci isolated from beef cattle. Front. Microbiol. 4:133. Enemark JM. 2009. Respiratory disease in calves: microbiological inves http://dx.dei.org/l t).3389Ifrnich.2013.00133. tigations on trans-tracheally aspirated bronchoalveolar fluid and acute 48. Horwood PF, Mahony TJ. 2011. Multiplex real-time RT-PCR detection of phase protein response. Vet. Microbiol. 137:165—171.http://dx.doi.org/10 three virusesassociatedwith the bovine respiratory diseasecomplex. J.Virol. .1016/j.vetmic.2008. 2.024. Methods 171:360—363.http://dx.doi.orgIlO.1016!j.jviromet.20l0.l 1.020. 45. Angen 0, Ahrens P, Tegtmeier C. 1998. Development of a PCR test for 49. Kadlec K, Brenner Michael G, Sweeney MT, Brzuszkiewicz E, Liesegang identification of Haemophilus somnus in pure and mixed cultures. Vet. H, Daniel R, Watts JL, Schwarz 5. 2011. Molecular basis of macrolide, Microbiol. 63:39—48.http://dx.doi.org/l0.10l6/S0378- 1135(96)00222-3. triamilide, and lincosamide resistance in Pasteurella inuttocida from bo 46. Miflin JK, Blackall PJ. 2001. Development of a 23S rRNA-based PCR vine respiratory disease. Antimicrob. Agents Chemother. 55:2475—2477. assay for the identification of Pasteurellanztiltocida.Lett. AppI. Microbiol. tutpI/dx.cloi.orgl It).II 2$/AAC.00092—II. 33:216—221.htt://dx.doiorg/l0.l046/j.l472-765x.200I.00985.x. 50. Poppe C, Ziebell K, Martin L, Allen K. 2002. Diversity in antimicrobial 47. Zaheer R, Cook SR, Klima CL, Stanford K, Alexander T Topp E, Read resistance and other characteristics among Salmonella Typhimurium RR, McAllister TA. 2013. Effect of subtherapeutic vs. therapeutic admin DT1O4 isolates. Microb. Drug Resist. 8:107—122.http://dx.doi.org/l0 istration ofmacrolides on antimicrobial resistance in Mannhei,nia hae,no .t089/l07662902760l90633.
ID 0 D 0 0 0CD 0 3
-o 0 3 0) 3 0 (0 0
CD 0 CCo) 0 0
CD 0CD
448 jcm.asm.org Journal of Clinical Microbiology Attachment 5 PubMed
1 I
Format: Abstract v Full text links iii&4LI;4i Vet Clin North Am Food Anim Pract. 2010 JuI;26(2):381-94. dol: 10.1016/j.cvfa.2010.04.004. Bacterial pathogens of the bovine respiratory disease complex.
Griffin D1, Chengppa MM, Kuszak J, McVey. Author information Abstract Pneumonia caused by the bacterial pathogens discussed in this article is the most significant cause of morbidity and mortality of the BRDC. Most of these infectious bacteria are not capable of inducing significant disease without the presence of other predisposing environmental factors, physiologic stressors, or concurrent infections. Mannheimia haemolytica is the most common and serious of these bacterial agents and is therefore also the most highly characterized. There are other important bacterial pathogens of BRD, such as Pasteurella multocida, Histophulus somni, and Mycoplasma bovis. Mixed infections with these organisms do occur. These pathogens have unique and common virulence factors but the resulting pneumonic lesions may be similar. Although the amount and quality of research associated with BRD has increased, vaccination and therapeutic practices are not fully successful. A greater understanding of the virulence mechanisms of the infecting bacteria and pathogenesis of pneumonia, as well as the characteristics of the organisms that allow tissue persistence, may lead to improved management, therapeutics, and vaccines.
PMID: 20619191 DOl: 10.101 6/j.cvfa.201 0.04.004
[Indexed for MEDLINE]
Publication type, MeSH terms
LinkOut - more resources +
PubMed Commons PubMed Commons home
Q 0 comments Howto join PubMed Commons Attachment 6 This is the html version of the file http://mail.acvp.org/meeting/2O13/appFiles/212_Paulsen.docx. Google automatically generates html versions of documents as we crawl the web.
Respiratory Diseases of Cattle
Daniel B. Paulsen, DVM, PhD, DACVP, Professor, Department of Pathobiological Sciences, Louisiana State University, and Director, Louisiana Animal Disease Diagnostic Laboratory, Baton Rouge, Louisiana.
Bovine respiratory disease (BRD) continues to plague the cattle feeding industry and dairy calf industry despite more than 5 decades of intensive research efforts.1’2 It has a complex etiology including various physical stressors, environmental factors, host factors, and infectious diseases, both viral and bacterial. Pathologists nearly always see these animals postmortem, and death is typically caused by a bacterial infection. It is important to realize that this bacterial infection may be primary or secondary. The critical factor in pathogenesis of the bacterial infection is compromise of the pulmonary defenses to allow bacterial colonization of the bronchoalveolar junction, the most vulnerable site. This colonization is by bacteria that are mostly normal inhabitants of the upper respiratory tract and are usually rapidly cleared from the lower respiratory tract. The ensuing inflammatory response is responsible for the majority of the pulmonary damage.3
The most important bacterial pathogens involved in the 3RD complex are Mannheimia haemolytica, Paste ttrella multocida, Histophilus sornntts, Mycop/asma bovis, and Bibersteinia trehalosi. The important viral diseases in BRD are Infectious Bovine Rhinotracheitis (IBR), Bovine Respiratory Syncytial Virus (BRSV), Parainfluenza-3 (P1-3), Bovine Viral Diarrhea (BVD), and Bovine Respiratory Coronavirus (BRC).3 The viral-bacterial synergism in BRD is well-known and oft-discussed. However, many cases or outbreaks of 3RD have no evidence of viral infection. Viral infections are efficient inhibitors of the pulmonary defenses, which allow bacterial colonization of the lungs, but this role is equally effectively performed by various physical and/or environmental stressors.4
Unfortunately for the pathologist, there is considerable overlap in the lesions caused by the various agents of 3RD. Some lesions are characteristic (the lesions of Mycoplasma bovis or BRSV, for example) but there are nearly always exceptions. Therefore, close cooperation among the pathologist, bacteriologist, virologist, and referring veterinarian are required for accurate diagnosis and effective management of the syndrome in the affected herds. As more sensitive and broader spectrum molecular techniques become available and are put into use, it will again fall on the pathologist and clinical veterinarian to determine the significance of positive results, which, for example, may detect veiy few copies of a genome in the sample.5
Bacterial Diseases of BRD
Mannhein,ia haemotytjca is generally considered to be the most significant pathogen in acute 3RD in feedlot cattle.6 The major virulence factor for this organism is its ruminant-specific leukotoxin. It is an RTX type of bacterial exotoxin. Its receptor is the CD18 portion of the b-integrins and unique sequences in the ruminant CD18 molecules account for its specificity. In high concentrations, leukotoxin causes rapid lysis of ruminant WBC and platelets by forming pores in the cell membrane. In lower concentrations, it promotes apoptosis of the WBC. It is also antigenic and is being employed in many of the current vaccines. Additional virulence factors include lipopolysaccharide, capsular polysaccharide, and iron binding proteins.4’7
The classical lesion associated with M haernolytica is a fibrinous pleuropneumonia. This lesion can also be called lobar pneumonia or bronchopneumonia with fibrinous pleuritis. At necropsy the lungs have severe consolidation of from 30 to 90% of the cranioventral portions. The pleural surface, roughly corresponding to the consolidated areas but sometimes diffusely, is covered by white to tan to yellow, friable fibrin. The opposing parietal pleural is usually similarly affected and fibrinous adhesion are common. The cut surface reveals the classical lesion of li haemolytica, the black-cherry red to pale, irregular foci that are surrounded by a distinct, narrow white zone of suppuration. These foci may be confined to a portion of a single lobule or cross several lobules. They have the classical appearance of an infarct, but proof of infarction as the cause of these lesions has proved elusive. With chronicity these foci can form sequestra, which are ideal nidi for secondary bacterial infections. Additionally, there is thickening of the pleura and expansion of the interlobular septa. The septal expansion can be clear (edema) to white (fibrin clots and/or WBC infiltrates). Fibrinous to suppurative exudates can be expressed from the bronchi.3 However, the mottled appearance with bronchocentric, white infiltrates is not commonly seen. These lesions are highly suggestive of li haernolytica as being the etiology, but other bacterial pathogens can cause indistinguishable lesions.
With chronicity affected lungs have variable cranioventral scarring. Sequestra may be evident and these will eventually resolve with scarring or abscessation. Bronchiectasis is sometimes seen. Fibrous pleural adhesions are common. Heat stress will often cause an acute death due to severe emphysema. Emphysema can also be seen with reinfection (reinfection syndrome) and can mimic the classical lesions of BRSV. This residual pulmonary damage adversely affects performance in the feedlot and is a major cause of economic loss due to BRD.8
The histological lesions correspond well with the gross lesions. The infarct-like lesions have widespread alveolar wall necrosis in the centers. The alveoli are flooded with serum, fibrin, and variable hemorrhage. These are demarcated from adjacent viable tissues by a zone of intense neutrophil infiltration. These neutrophils have been affected by leukotoxin and exhibit the classical streaming oat cell (a.k.a. streaming mononuclear cell) appearance that is highly suggestive of mannheimiosis.3
Pasteurella mtdtocida is the most important bacterial pathogen in enzootic pneumonia of dairy calves, the summer pneumonia of beef calves, and is an important contributor to BRD of feeder cattle.9 Encapsulation is required for virulence but otherwise, virulence factors are poorly understood.
The lesions most commonly seen with F multocida are those of a typical bronchopneumonia. Cranioventral consolidation of the lungs is consistently present. The cut surface has a mottled appearance with red to gray parenchyma and white zones (cellular infiltration) surrounding bronchi and bronchioles, i.e. a bronchocentric distribution. Thick, white pus/mucopus can be expressed from the bronchi and bronchioles. Pleuritis in not usually present nor is there profound expansion of the pleura and interlobular septa. This pattern is fairly consistent in enzootic pneumonia.3 In feeder cattle, F multocia is the only organism isolated somewhat commonly from lungs that have lesions indistinguishable from li haemolytica.4
Histological lesions are again consistent with the gross lesions. An intense, bronchocentric, suppurative inflammatory infiltrate is present. Bronchioles and bronchi are filled with suppurative exudates. The lesions tend to be limited by interlobular septa. Suppurative infiltrates in the alveoli tend to decrease with intensity with distance from the bronchioles.3
Histophitas somni is an important component of BRD of feeder cattle. In some areas of the USA, for example the Northwest, it may be the most important bacterial pathogen. Several virulence factors have been described. Some allow antigenic variation and immune escape, such as phosphocholine modification and phase variation of its lipooligosaccharide. It expresses the Fc-binding protein, IbpA, and a transferrmn binding protein. The truncated lipopolysaccharide of H somni can induce apoptosis in endothelial cells and induce platelet aggregation. It also has the ability to survive in macrophages by as yet unknown mechanisms.3’4
Histophihts somni has the ability to produce a variety of disease manifestations including thromboembolic meningoencephalitis, fibrinous pericarditis and myocarditis, polyarthritis, and abortion. The respiratory form is thought by some to precede the other manifestations. The respiratory form causes a bronchopneumonia with a fibrinous pleuritis. This can be extremely difficult to distinguish from the pleuropneumonia of li haemotyitica.3
Biberstei,,ia trehtilosi may be increasing in significance as a pathogen of 3RD. The pathogenic factors are poorly understood. Some strains produce a leukotoxin very similar to that of li haemolytica, whereas other strains do not. It is not currently know whether or not LKT is required for pathogenicity. Other outer membrane proteins and fibrin-binding proteins have been identified, but their significance for pathogenicity is unknown.3
Lesions of 3. trehalosi are indistinguishable fiom M haemolytica.3
My.cj2p1asmabovis is increasing in significance as a pathogen in chronic BRD of feeder calves. In dairy calves it has more significance as an agent of otitis media, but pneumonia and arthritis may accompany it. M. bovis has a large family of immunodominant variable surface lipoproteins, which undergo high fteqtiency phase and size variation resulting in antigenic variability, immune evasion, and persistent infection. Persistent infection along with a high degree of antibiotic resistance makes the disease particularly devastating. The organisms also produce phospholipases and reactive oxygen species and can form biofilrns, which may contribute to virulence. Co-infection with the other bacterial pathogens of 3RD is very common. Its importance as a primary or secondary pathogen has been debated, but the evidence suggests that both occur.’°’
The lesions of li bovis are characteristic. The typical pneumonia has a cranoventral distribution of numerous, often densely packed, caseous to inspissated abscesses, which vary from a few millimeters to several centimeters in diameter. Interlobular septa can have linear necrotic lesions. These are usually accompanied by extensive fibrosis. Histologically, the caseonecrotic foci develop in airways, in alveoli, or in interlobular septa. Macrophages and fewer neutrophils, viable and degenerate, are present at the periphery, and there is often a capsule of fibrous tissue containing lymphocytes and macrophages.3’1’
Viral Diseases of BRD
Infectious bovine rhinotracheitis (IflR bovine herpesvirus 1) is arguably the most important viral component of the BRD complex in feeder cattle. Acute infection causes mucoid to mucopurrulent oculonasal discharge, anorexia, and fever. Lesions associated with the acute disease include numerous small clusters of gray ulcers, mostly on the nasal septum. Keratoconjunctivitis is usually also present. This can progress to a severe mucopurrulent to fibrinopurrulent rhinitis and fibrinous tracheitis. The virus readily establishes latency in the trigeminal ganglion in respiratory infections, and reactivates during times of stress, translocates to the respiratory and conjuncitival tissues, and is shed. This likely accounts for the high rates of infection that can be seen shortly after arrival of cattle in the feedlots.12
In general, the disease typically remains mild unless there is secondary bacterial infection. Viral-bacterial synergism between IBR and the various bacterial pathogens described above is well-known. IBR has immunosuppressive properties that play a role in this synergism. These properties include CD$ and CD4 lymphocyte suppression, interferon signaling, and inhibition of MI-ICclass 1 antigen presentation. Additionally, airway epithelial necrosis and alterations in mucus composition and viscosity likely impair mucociliary clearance.12 Bovine respiratory syncytial virus (BRSV) has more potential than the other respiratory viruses for causing primary lethal disease. This tvas especially true in the initial epidemic seen in the mid-80s, but it is still occasionally seen in isolated, naïve herds. As the disease has become more endemic, its importance has shifted towards viral-bacterial synergism in 3RD. Bronchial epithelial cell necrosis and inhibition of pulmonary alveolar macrophage function are the major factors promoting this synergy.13
The uncomplicated lesions of BRSV in susceptible cattle consist of moderate cranioventral. red consolidation of the lungs with a lobular pattern. The affected lobules are usually confluent but occasionally are scattered. In fatal cases there is usually emphysema of the caudodorsal lungs fields. The emphysematous lesions are associated with high pulmonary levels of BRSV-specific IgE, leading to the theory that this is a hypersensitivity reaction. Histologically, the pulmonary lesions are of bronchial epithelial necrosis with variable formation of syncytial cells. Bronchointerstitial pneumonia is also present with increased alveolar macrophages, with multinucleate cell formation. Alveolar septal damage may be manifested by hyaline membranes and later type 2 pneumocyte proliferation.13
Bovine Parainfluenza-3 (P1-3) has been dubbed in a recent review as “a forgotten virus” of the 3RD complex. This is most likely because of its high rate of seroprevalence in feeder cattle coupled with its rarity of isolation from disease outbreaks. How important a contributor to the BRD complex that P1-3 is at the current time is uncertain.14
The gross lesions of P1-3 include a possible rhinitis with mucopurulent exudate in nasal passage. The gross pneumonic lesions produced by experimental inoculation of P1-3 consist of atelectasis and consolidation in the cranioventral aspects of the lungs. These appear initially as swollen and later depressed, red-purple, firm areas that may exude mucopurulent exudate from airways on cut surface. There may be interlobular edema. These lesions are similar to those of BRSV, but emphysema is typically absent. Histologically, experimental infection causes bronchial/bronchioloar epithelial cell necrosis with inflammatory cellular exudation into the lumens. Early in the infection, eosinophilic intracytoplasmic inclusion bodies are present. Syncytial cells may be present, but this is strain-dependent. The repair phase has bronchial, bronchiolar, and alveolar epithelial cell hyperplasia. Bronchiolitis obliterans may occur.14 Reports in the literature of the lesions of pure P1-3 infections from field cases is lacking. From the pathology of experimental infections, one can infer that P1-3may promote bacterial infection of the lower respiratoly tract through epithelial necrosis and interference with the mucociliaiy apparatus. The effects on immunity or alveolar macrophage function are subjects deserving of additional study.
Bovine viral diarrhea virus (BVD) infection is generally included in the list of important 3RD pathogens, even though the primary effects of viral infection on the respiratory tract are usually minimal. Its true impact on 3RD is not known, despite it being an intensely studied pathogen. Marked strain variability and syndrome variability complicate our abilities to make generalities about the virus. There is no doubt that 3VD infection is immunosuppressive and through this mechanism likely enhances severity and/or susceptibility to other BRD pathogens. Calves infected in utero with non-cytopathic strains from 40-125 days of gestation become persistently infected and may shed large numbers of viruses over long periods of time and serve as sources of infection in cattle grouped together in feedlots. Persistently infected animals are much more likely to develop fatal BRD than their uninfected counterparts. 3VD infection inhibits lymphocytic functions and cause necrosis/apoptosis of lymphocytes, inhibits phagocytic and chemotactic functions of leukocytes, and inhibits interferon and cytokine responses. Studies have also shown definite synergy of BVD infection with nearly all the significant viral and bacterial pathogens of BRD.15’16
Experimental infection with certain strains causes mild lower respiratory epithelial damage and decreased BALI. Otherwise, there are no specific gross or histological lesions in the lungs associated with BVD infection.15’16 Bovine respiratory coronavirus (BRCV) infection has been associated with several severe BRU outbreaks. Evan’s postulates have been fulfilled for the viral disease, but Koch’s postulates have not.17 As a result, no suitable model for study of the disease has been developed and no lesions can be ascribed to the virus. We have shown that the virus is shed in a biphasic manner from the upper and lower respiratory tract of experimentally infected calves, but no significant respiratory signs or lesions were produced.
OTHER RESPIRATORY DISEASES OF FEEDER CATTLE
&tXpical interstitial pneumonia (AIi) tends to occur in late summer to early fall in heavy feeder cattle. The lesions are identical to acute bovine pulmonary edema and emphysema (formerly also called atypical interstitial pneumonia) caused by the ingestion of high tiyptophan, which is metabolized to the toxic 3-methyl indole, 4-ipomeanol from moldy sweet potatoes, and perilla ketones. There is a sex predisposition for heifers and incidence is increased in those being fed melengestrol acetate to inhibit estrus, but feeding it is not required for development of the syndrome. Some studies have given evidence supporting 3-methyl indole or BRSV involvement in the syndrome, but other studies have shown development of the syndrome in the absence of either, so the cause is currently undetermined.18
The gross lesions of AlP are severe pulmonary emphysema with severe gas-distension of interlobular septa with formation of bullae. The emphysema usually extends into the mediastinum and subpleural tissues. It frequently extends to the subcutis over the withers and back. Despite the hyperinflated and emphysematous appearance of the lungs, they are extraordinarily heavy. This is due to the extensive pulmonary edema, which can be appreciated by the wet appearance of the lobules and extensive foam in the airways. The histological lesions consist of extensive alveolar edema with hyaline membrane formation and striking type 2 epithelial cell hyperplasia. Interlobular lymphatics are distended with air with frequent escape of air into surrounding tissues. 18
Honkers is an acute upper respiratory syndrome of heavy feeder cattle. The lesion is severe tracheal edema, which partially occludes the tracheal lumen and creates the high pitched respiratory sounds that are responsible for its name. The etiology is unkown.
References:
1. Woolums, A. R., G. H. Loneragan, L. L. Hawkins, and S. M. Williams. Baseline management practices and animal health data reported by US feedlots responding to a survey regarding acute interstitial pneumonia. Bovine Pract. 2005 ;39:116—124. 2. Taylor, JD, RW Fulton, TW Lehenbauer, DL Step, AW Confer. The epidemiology of bovine respiratory disease: What is the evidence for preventive measures? Can Vet J 2010;51:1351-1359. 3. Panciera, RJ and AW Confer. Pathogenesis and pathology of bovine pneumonia. Vet Clin Food Anim 2010;26:191-214. 4. Griffin, D, MM Chengappa, J Kuszak, and DS McVey. Bacterial pathogens of the bovine respiratory disease complex. Vet Clin Food Anim 2010;26:381-394. 5. Fulton, RW and AW Confer. Laboratory test descriptions for bovine respiratory disease diagnosis and their strengths and weaknesses: Gold standards for diagnosis, do they exist? Can Vet J 2012;53:754— 761. 6. Booker CW, Abutarbush SM, Morley PS, Jim GK, Pittman TJ, Schunicht OC, Perrett T, Wildman BK, Fenton RK, Guichon PT, Janzen ED. Microbiological and histopathological findings in cases of fatal bovine respiratory disease of feedlot cattle in Western Canada. Can Vet J. 200$;49:473-$1. 7. Singh, K, JW Ritchey, and AW Confer. Mannheimia haemolytica: Bacterial—HostInteractions in Bovine Pneumonia. Vet Pathol 2011;48:338-34$. 8. Fulton RW, Cook BJ, Step DL, Confer AW, Saliki JT, Payton ME, Burge U, Welsh RD,Blood KS. Evaluation of health status of calves and the impact on feedlot performance: assessment of a retained ownership program for postweaning calves. Can J Vet Res. 2002;66(3):173-$O. 9. Griffin, D. Bovine pasteurellosis and other bacterial infections of the respiratory tract. Vet Clin food Anim 2010;26:57—71. 10. Maunsell, fP. AR Woolums. D Francoz. RF Rosenbusch, DL Step, DI Wilson, and ED Janzen. Mycoptasma bovis Infections in Cattle. J Vet Intern Med 2011;25:772—7$3. 11. Caswell. IL, KG Bateman, HY Cai, F Castillo-Alcala. Mycoplasma bovis in Respiratory Disease of Feedlot Cattle. Vet Clin Food Anim 2010;26:365—379. 12. Jones, C and S Chowdhuiy. Bovine Herpesvirus Type 1 (BHV-1) is an Important Cofactor in the Bovine Respiratory disease Complex. Vet Clin food Anim 2010;26:303—321. 13. Brodersen, BW. Bovine respiratory syncytial virus. Vet Clin food Anim 2010;26:323—333. 14. Ellis, JA. Bovine parainfluenza-3 virus. Vet Clin Food Anim 2010;26: 575—593. 15. Ridpath, J. The Contribution of Infections with Bovine Viral Diarrhea Viruses to Bovine Respiratory Disease. Vet Clin Food Anim 2010;26: 335—348. 16. Campbell, JR. Effect of bovine viral diarrhea virus in the feedlot. Vet Clin Food Anim 2004;20: 39-50. 17. Storz J, Lin X, Purdy CW, Ct al. Coronavirus and Pasteurella infections in bovine shipping fever pneumonia and Evans’ criteria for causation. J Clin Microbiol 2000;38:3291—3292. 1$. Doster, AR. Bovine atypical interstitial pneumonia. Vet Clin Food Anim 2010;26:395-407. Attachment 7 Mycoplasma Disease in Cattle
In recent years, more than 20 species of Mycoplasma, Ureaplasma and Acho!eplasma have been Locations isolated from cattle with different diseases. Allof the 20 aforementioned species have been referred to ADDL-West Lafayette: as the Mycoplasmas. It is generally believed that Mycoplasmas play a secondary role in infections, 406 S. University most often exacerbating pre-existing disease; but it has been shown that Mycoplasma bovis (M. bovis) West Lafayette, IN47907 play primary M. is of can a role. bovis considered one the more pathogenic species and is the most Phone: 765-494-7440 frequent Mycoplasma pathogen of pneumonia, mastitis, and arthritis in cattle. Meningitis, otitis media, Fax: 765-494-9181 kerato-conjunctivitis, decubital abscesses, vaginitis and/or abortion are other conditions which may be caused by M. bovis. In general, treatment of Mycoplasma diseases is difficultsince Mycoplasma spp. ADDL-SIPAC lack a cell wall, which differentiates them from bacteria and are thus resistant to some commonly used 11367 E. Purdue Farm antibiotics. Methods used for definitive diagnosis of Mycoplasma infection within an individual animal or Road Duboix, IN herd include culture, fluorescent antibody test (FA-test), and/or serology. In addition, polymerase chain 47527 Phone: (812) 678-3401 reaction (PCR) is a sensitive method which can be used. Selective media such as Friis or Hayflick’sT Fax: (812) 678-3412 mycoplasma media are necessary for Mycoplasma culture and cultures must be kept at 10% CO2. To detect acute infection, paired serum samples are recommended, since rises in antibody titers occur 10- 14 days after acute infection with certain Mycoplasma spp. PCR is an extremely sensitive method which can be used to confirm Mycoplasma infection.
Pneumonia: Two types of pneumonia are associated with Mycoplasma infections: contagious bovine pleuropneumonia and enzootic pneumonia of calves. Contagious bovine pleuropneumonia is caused by infection with Mycoplasma mycoides subsp. mycoides and is classified as a foreign animal disease. In “calf pneumonia”, fenzootic pneumonia), Mycoplasma spp. are seldom the only pathogens isolated. Most commonly, there is primary and/or concurrent vital and/or bacterial infection. Common involved respiratory viruses are Parainfluenza 3 virus (P13), Infectious bovine rhinotracheitis virus (IBR) and/or Bovine respiratory syncytial virus (BRSV). Common involved bacteria are Histophilus somni (H. somni), Pasteurella multocida, (P multocida), and/or Mannhemia haemolytica (M. haemolytica). Most commonly, respiratory viruses are primary pathogens. However, M. dispa, M. bovis and Ureaplasma may also act as primary pathogens. Several species of Mycoplasma may be isolated from calves with pneumonia, but only a few of these species are considered pathogenic. Respiratory pathogenic Mycoplasma spp. include M. dispa, M. bovis, M. bovirhinus, M. bovigenitalium, Ureaplasma diversum. With the exception of M. bovis, these mycoplasmas can be found as normal flora of the upper respiratory tract. Pneumonia develops after their introduction into the lower respiratory tract, which is commonly preceded by impairment of mucociliary clearance and/or immune defense. Mycoplasmas can be introduced in a herd by subclinical Mycoplasma carriers. These cattle shed the organism through nasal discharge for months to years without showing clinical signs. Clinical signs observed in cattle with pure Mycoplasma pneumonia are coughing, induced by stress or movement, slight tachypnea, low grade fever and mild depression. Affected cattle usually retain a good appetite, which distinguishes this type of pneumonia from other viral and/or bacterial pneumonias. At necropsy, cranioventral areas of lungs are red-blue, firm and ooze purulent material on cut section. Histologically, there is chronic bronchointerstitial pneumonia charac-terized by peribronchiolar and perivascular lymphocytic cuffings, purulent bronchiolitis, accumulation of neutrophils and macrophages within alveolar lumens, epithelialization of alveolar septae and atelectasis. Due to prominent lymphocytic cuffings, this type of pneumonia is also called “cuffingpneumonia”. Definitive diagnosis can be obtained through culture of a tracheal lavage fluid and/or tissue samples of lungs. In addition, fluorescent antibody tests for detection of antigen of distinct Mycoplasma spp. can be performed. Intramuscular application of oxytetra-cycline, erythromycin, or tylosin is recommended. In mixed infections with Mycoplasma spp. and bacteria, antibacterial therapy must be also effective against involved bacteria. Since “enzootic pneumonia” is a multifactorial disease associated with impaired pulmonary defense, proper management is also very important (i.e., adequate ventilation, prevention of overcrowding.
Mastitis. Although several Mycoplasma spp. (M. canadense, M. bovigenitalium, M. californicum) may cause mastitis, Mycoplasma bovis is the most prevalent. The disease spreads rapidly within a herd, thus the usual history in a farm with Mycoplasma mastitis is that several cows within a short period of time have acute mastitis in one or more quarters. Allquarters are usually affected in lactating animals. In addition, the same farm may also have problems with lameness, reproductive problems, calf pneumonia, and adult cow respiratory disease. Cows affected with acute Mycoplasma mastitis have a dramatic drop in milk production. Affected quarters willbe warm, swollen and light brown. On palpation, the parenchyma may be firm and often fine nodular. Drawn milk appears normal initially,but separates rapidly in a floccular deposit and a clear supernatant. Acute mastitis may be followed by chronic mastitis, intermittent acute flare-ups, or subclinical infection. Cows with subclinical infection can return to normal milk production, but they may continue to shed Mycoplasma spp. within milk. Mycoplasma spp. and, thus, Mycoplasma mastitis can be transmitted mechanically via handling, milking machines, and common udder wash solutions. Microscopically, acute infection causes neutrophilic mastitis characterized by neutrophilic infiltrationof lobular interstitium, degeneration, and necrosis of alveolar epithelium and neutrophilic accumulation within alveoli, which is often followed by abscess formation. In subacute stages, macrophages predominate as inflammatory cells. Chronic Myco-plasma mastitis is characterized by hyperplasia of alveolar and ductular epithelium, aggregation of lymphocytes within interstitium and around ducts, interstitial fibrosis and lobular atrophy. For definitive diagnosis of Mycoplasma mastitis, culture of milkand/or udder parenchyma may be pursued. Immunoblot performed on milksamples is another method which can be used for diagnosis. As with other Mycoplasma diseases, Mycoplasma mastitis is difficultto treat. Thus, prevention by teat dipping, dry/lactating cow therapy, and proper maintenance of milking machine equipment is recommended. Once Mycoplasma mastitis is detected within a herd, identification of infected cattle and their strict separation or culling may be necessary, since the disease is highly contagious and often therapy resistant.
Arthritis: The incidence of Mycoplasma arthritis is increased in cattle herds with enzootic Mycoplasma mastitis and/or pneumonia, since Mycoplasma arthritis occurs commonly secondary to bovine affected with Mycoplasma pneumonia or mastitis due to hematogenous spread. Oral infection of calves from dams with Mycoplasma mastitis may also occur. Lameness caused by M. bovis is typically a result of polyarthritis and/or tendosynovitis. One clinical sign of Mycoplasma arthritis is marked lameness. Animals have pain during movement and/or at palpation of affected joints. Capsules of affected joints are warm, distended and fluctuant on palpation. Gross examination of the affected joints willshow fibrinosuppurative synovitis and tenosynovitis with cartilage erosions. Affected joint capsules are distended by opaque, cream colored exudates, which often contains fibrin flakes. Eroded cartilage may be replaced by polypoid granulation tissue. The synovium is often reddened and edematous. Microscopically, there may be ulceration of synovial membranes and infiltrationof synovia and joint capsule with neutrophils, macrophages, plasma cells and/or lymphocytes. Neutrophils may accumulate within the joint space and there may be hyperplasia of synovial cells and villi. Synovial vessels are often congested and occasionally thrombosed. Mycoplasma culture of tissue samples and/or synovial fluid may be pursued for definitive diagnosis. Treatment follows the protocol of any septic arthritis. Recommended is lavage of affected joints with a through-and-through flushing method, most likelyon a daily basis over the next 1-2 weeks. Local antibiotic therapy may be used. Systemic antibiotic therapy is recommended, since there is commonly concurrent Mycop!asma mastitis and/or pneumonia. It must be considered that Mycoplasma spp. have a poor response to antibiotic therapy. Antibiotics effective in Mycoplasma-induced lameness include danofloxacin, enrofloxacin, and tylosin. Aspirin can be given for pain management.
-by Suzanne Brishard, Class of 2003
-edited by Dr. Sandra Schoeniger, ADDLGraduate Student References:
1. Ellis JA: 2001. The immunology of the bovine respiratory disease complex. Vet Clin North Amer-Food Anim Prac 17,3: 535-550.
2. Enzootic Pneumonia of Calves. lnf Dis of Cattle: 1993. Veterinary Learning Systems Co., Inc. pp7l.
3. HendersonJP, Ball, H]: 1999. Polyarthritis due to Mycoplasma bovis infection in adult dairy cattle in Northern Ireland. Vet Record 145,13: 374-376.
4. Nicholas R, Baker, R, Rayling, R et al: 2000. Mycoplasma infections in growing cattle. Cattle Practice 8,2: 115-118.
5. Rebhun W: 1995. Diseases of Dairy Cattle. Media, PA, Lippincott Williams and Wilkins, pp 80, 283-284, 386.
6. Smith B: 1996. Large Animal Internal Medicine, 2 ed.
7. Stokka GL, Lechtenberg K, Edwards T et al: 2001. Lameness in Feedlot Cattle. Vet Clin North Amer-Food Animal Practice 17, 1: 196-202.
Home Users Guide Fee Schedule Online Case Reports fl Intranet Attachment 8 Journal Tenericutes, tilmicosin, florfenicol, tetracyclines, animals, Author Organism Author(s): Broad Geographic Record Nations, Identifier: Descriptor(s): U Surrey, tilmicosin, ISSN: can/s This antimycoplasma fittps://www.cabd Language of commonly sole Stipkovits, respiratory
Mycoplasma Exported RL: M. pathogen report https://www.ca can canis 0969-1 terms: UK. Number: Affiliation: article: eukaryotes, Developed cause United florfenicol, of from descriptor(s): L.; in bacterium, used Nicholas, confirms disease Bacteria, Location: 251 vitro, fluoroquinolone Text: Cattle infections Bos, antibiotics, and severe Cattle pneumonic antibiotics activity. Kingdom 20002213576 irect.org/cabd mortality, with Bovidae, English in Veterinary
Countries, Abstract bdi Practice, the Mycoplasma, R.; prokaryotes, spectinomycin; cattle Britain, Practice pneumonia UK rect.org/cabdi Baker, high surveys In in cattle, calves, reveals the growing ruminants, more calves. mortality. pneumonia, 2000, death antibiotics European S.; Laboratories 2000 last I Mycoplasma rect/abstract/2000221 of danofloxacin, Ayling, often Mycoplasmataceae, British that in five Further others rate, Vol. 8 cattle. only calves rect/abstract/2000221 2 An Artiodactyla, years present
with record(s) 11 R.; 8, Union disease respiratory Isles, danofloxacin in that 5-1 experimental Stipkovits, No. Agency in vitro other bovis there 1 the 8 Mycoplasma Western disease Countries, 2, isolates study surveillance, absence Nicholas, pp. bacterial has (Weybridge), mammals, diseases, 3576 L. 11 Mycoplasmatales, surveys, of been showed are Europe, 5-1 evidence the OECD of boy/s 3576 resistant pathogens 18 R.; a other sensitivities isolates, serology, large Baker, vertebrates, any experimental Countries Europe, New plays is pathogens. significant increase presented to Haw, S.; an but, lung tetracyclines, spectinomycin, Ayling, Commonwealth Mollicutes, important of Addlestone, frequently diseases, Chordata, M. in infections, bovis here the R.; isolation role that to as in M. of © Copyright 2018 CABInternational. CAB!is a registered EUtrademark. Attachment 9 ACVIM Consensus Statement J Vet Intern Med 2011;25:772—783
Consensus Statements of the American College of Veterinary Internal Medicine (ACVIM) provide the veterinary community with up—to—dateimiformation on the pathophysiologv, diagnosis, ctncltreatment of clinically inlportcmt aninial diseases. The ACVIM Board of Regents oversees selection of relevant topics, idemitfication of pctnelmnentherswith the expertise to drqft the statements, and other aspects of assuring the integrity of the process. The statements are derivedfrom ei’idence-baseclmedicine wheneverpossible and the panel offers interpretive comments when such evidence is inadequate or contradictory. A draft is prepared by the panel, followed by solicitation of input by the ACVIM membership which may be incorporated into the statement. It is then submitted to the Journal of Veierinctri Internal Medllc’ine,n’hereit is etliteciprior to publication. The authors are solely responsiblefor the content of the statements.
Mycoptasma bovis Infections in Cattle F.P. Matinsell, AR. Woolurns. D. Francoz. R.f. Rosenbusch. D.L. Step, D.J. Wilson, and ED. Janzen
lv!vcoplasmc,baits is a pathogen causing respiratory disease, otitis media, arthritis, mastitis, anda variety of other diseases in cattle worldwide. It is increasingly recognized by the veterinary and livestock communities as having an important impact on the health, welfare, and productivity of dairy and beef cattle. ALhovisdiseases can be difficult to diagnose and control because of inconsistent disease expression and response to treatments and vaccines, and large gaps in our understanding of the epidemiology and patho physiology of thesc diseases. There are limited data on which to base evidence-based decisions for treatment and control, and the literature contains differing clinical biases and opinions. This document is intended for veterinarians dealing with cattle and is focused on the cattle production systems of North America. The goal of the consensus statement panel was to encourage an ev idence-based approach to H. boris problems. The scientific literature was critically reviewed, including peer-reviewed journal articles and reviews obtained by database searches using the terms “Mvcoplasma boris” or “mycoplasma + cattle.” Where other data were lacking. conference proceedings were reviewed as a source of expert opinion. Key words: Arthritis; Mastitis: Otitis media; Pneumonia.
How Important Is Mj’coplasnia bovis as a Bovine Pathogen? Abbreviations: he ability of M. bovis to cause mastitis,t respiratory BAL bronchoalveolar lavage BRD T disease,2 and arthritis3 is demonstrated in experi bovine respiratory disease mental infection studies, although variation in disease CPPS chronic pneumonia and polyarthritis syndrome IHC immunohistochemistry severity is common. In natural infections, M. boris can be IKC infectious keratoconjunctivitis isolated in pure culture from the mammary gland of cows MIC minimum inhibitory concentration with mastitis4 and from the joints, tendon sheaths, or PCR polymerase chain reaction periarticular tissues of cattle with arthritis, tenosynovitis, URT upper respiratory tract or chronic pneumonia and polyarthritis syndrome
From the Deportment of Infectious Diseases and Pathology, Col lege of Veterinciry Medicine, University of Florida, Gainesi’ll/c, FL (Mounsell); the Department of Large Animal Medicine, College of (CPPS).3’5 M. bovisis the predominant pathogen isolated Veterinary Medicine, University of Georgici,Athens, GA ( Woolu,ns); from the middle ear of calves with otitis media.9 [0 How the Department of C/inlet,!Sciences, Fczcultvof Veterinary Medicine, ever, the role M. bos’is Université de Montréal, Saint—Hycicintlie,Quebec, Canada (Fran— of in the multifactodal bovine coz); the Department of Veterinary Microbiology and Preventive respiratory disease (BRD) complex is not as easily Medicine, College of Veterinary Medicine, lost, State University, defined. At the group level, seroconversion to Al. boris is Ames, IA (Rosenbtmsch); the Department of Iterinarv Clinical associated with increased risk of being treated for BRD.’1 Sciences, College of Veterinary Medicine, Oklahoma State Univer M. bovis is often isolated from the lungs of cattle sity, Stillwc,ter, OK (Step); the Departmmientof Ani,nal, Dair,’ and with pneumonia,5”2 and identified within lesions using Veterinary Sciences. College of Agriculture. Utah State University, immunohistochemistry (IHC).8 However, M. boris UT (Wilson); and the Deptirtnient of Production AnimnalHealth, can Faculty of Veterinary Medicine, University of Calgary, Calgary, Al also be isolated from the lungs of some cattle without clin berta, Canadct (Janzen). ical disease or lesions, and so variable disease expression Corresponding author: F. telaunsell, Department of Infectious Dis— appears to be a key feature of both natural and experimen eases and Pathology, College of Veterinctri’Atedicine, University of tal infections. M. boris is often present in the upper Florida, P.O. Box 110880, Gainesville, FL 32611; e-mail: maw, respiratory tract (URT) of cattle without clinical disease. sellfid ttfl.eclu. Therefore, although Al. bos’isalone can cause natural and S,th,nittecl April 28, 2011; Rerised Mar 10, 2011; Accepted May 11,2011. experimentally induced clinicaldisease, the presence of M. Copyright 2011 hr the America,, College of Veterinary Internal boris does not always result in disease, and clinicaldisease Medicine does not appear necessary for the maintenance and dis 10.1111 f.l 939-1676.2011.0 75t).x semination of .11.bovisin the cattle population. Mycoplc,smc,boris 773
What Is the Preeatence/Inchtence of M. bovis colonization in cattle after URT exposure.2 After intra hfection and Disease? mammary exposure the mammary gland appears to be the major site of colonization.’ Regardless of the route of In a 2002 survey of 871 dairies in the United States, exposure, M. boris can be isolated from multiple body 6.8% were M. boris positive on a bulk tank milk cul sites during early infection, particularly the URT, mam ture.13 In other studies, mycoplasma was identified in mary gland, conjunctiva and urogenital tract,1726 and bulk tank milk samples in 7—20%of dairies sampled.11”5 bacteremia during Al. boils infection has been docu Because mycoplasmas are shed intermittently and masti mented.’2’27The URT mucosa and the mammary gland tic milk is withheld from the bulk tank, these values likely appear to be the most important sites of persistence underestimate true prevalence. Individual cow preva and shedding of Al. boils.”7 Although many cattle shed lence and the incidence of clinical mycoplasma mastitis Al. boris for a few months or less,’7’8 some cattle can vary widely between herds and For dairy shed Al. boris intermittently for many months or calves, there are limited data on the prevalence of M. years.’7”8’28The factors responsible for intermittent bo,’is. In a study published over 30 years ago, the nasal shedding have not been determined. Cattle with clinical prevalence of Al. boris in Californian dairy calves up to 8 disease usually excrete especially large numbers of months of age was 34% in herds with Al. boils-associated Al. boris.’8Stressful events such as transportation, comin disease and 6% in nondiseased herds,’8 More recent lon gling, entry into a feedlot, and cold stress are associated gitudinal studies indicate that almost all calves in with increased rates of nasal shedding of Al. boris.22’29 diseased herds become infected with Al. Chronic asymptomatic infection with intermittent shed In beef cattle, the prevalence of Al. bo,’isin nonstressed ding of Al. boris appear critical to the epidemiology of calves is generally low (0—7%)in lungs,’2 nasal swabs,2° infection, especially the maintenance of Al. boils within a or by serology.2’ Conversely, prevalence is often high herd and exposure of naive populations. even in the absence of clinical disease for comingled calves, transported calves, or calves at a feedlot.22Based on necropsy studies, it appears that Al. ho,’is can con How is’M. bovis Transmittett and What Is Knoi’n about tribute substantially to morbidity and mortality in Risk factors for tnfrction and Disease? feedlot cattle.8’23’24In I recent study. 28% of cattle ne The introduction of asymptomatically infected ani cropsied in 3 Canadian feedlots had CPPS, a disease mals is thought to be the prinmry means by which attributed largely to Al. boris.24 Al. boris-free herds become infected.4 Transmission is delayed until, and if, shedding occurs; this delay can What Are the Economic aiictOther (‘on.sequence.s’of’ make it difficult to identify the source of infection and M. bovisbt/ictions? mycoplasma disease outbreaks occur in seemingly closed herds.3° Although Al. boris is an important contributor to mas Once in a Al. be titis and BRD, both major cattle diseases, there are few present herd, boris can readily trans mitted from infected to uninfected cattle. In dairy cattle, available estimates of the costs of Al. boris infection. One Al. boris has been as a contagious report estimated costs to the US beef industry of US$32 traditionally regarded mastitis pathogen, with udder-to-udder spread being the million per year as a result of loss of weight gain and car major means transmission.4’31’32 URT cass value, and US$108 million per year to the US dairy of Whether trans mission with internal dissemination to the mammary industry as a result of M. boris rnastitis.2 However, gland is in given the limitations of prevalence data, these numbers important the epidemiology of Al. bovis mas titis should be interpreted with caution. has not been determined, but Al. boris can be Costs of mycoplasma disease include reduced produc isolated from nasal secretions of cows with tion, drugs and labor for treatment, death and culling For young calves, ingestion of infected milk is an impor tant means Al. fed infected losses, implementation of diagnostic and control mea of boris transmission. Calves milk have much higher rates of nasal colonization than sures, and a portion of the cost of non-pathogen-specific those fed uninfected milk,’8 and feeding of contaminated preventive measures. Because Al. boris-associated dis milk or nursing of with Al. mastitis has been ease tends to be chronic, costs per case are typically cows boris associated with disease in However, high relative to other pathogens.’6’23In addition to eco calves.7”8 other nomic costs, there are important animal welfare means of transmission must also be important, as the disease can occur in calves that are fed milk replacer consequences of M. bovis infections, given that the asso or pasteurized milk. Once established in a multiage facility, ciated disease is often chronic and poorly responsive to treatment. Al. boris is very difficult to eradicate, suggesting ongoing transmission from older to incoming calves; calves could also become infected from adults in the calving What Do We Know about the Epidemiology of area. Congenital Al. boris infections appear to occur AL bovis Infections? infrequently.26 Colonization, Persistence, and Shedding Transmission of Al. boris in respiratory secretions is considered important in the epidemiology of infection, Al. boils is well adapted to colonization of mucosal although there is little experimental data to support this surfaces, where it can persist without causing clinical dis contention. Al.boris might be transmitted in respiratory ease. The URT mucosa is the primary site of Al. boris secretions via aerosols, nose-to-nose contact, or mdi- 774 Maunselletat rectly via feed, water, housing, or other fomites. The im host cells.M. boris can also form biofllmsin vitro that im portance of aerosols in calf-to-calf transmission of part increasedresistanceto desiccationand heat stress.43 M. boris is unknown, but Al. boris has been isolated from air in barns containing diseased calves,32and calves What Role Do Immune Responses Play in the can be experimentally infected by inhalation of M. boris.2 Progression of M. boris Infections? It therefore seems prudent to assume that infection can occur via this route. Fomite-mediated transmission of Passi1’ehumanity M. boris in respiratory secretions is likely given that There is a strong association between failure of trans fomites can be important in the transmission of mycoplas fer of passive immunity and increased risk and severity of ma mastitis.33132 susceptible Mycoplasmas are to BRD in calves. However, the role of maternal immunity desiccation and sunlight, but Al. boris can survive for long in protection against Al. boris-associated disease is un periods in protected environments with greatest survival known. In 1 study, there tvas no association between in cool, humid conditions.33 boris has been shown to ill, postcolostral serum antibody titers against Al. boris and persist for months in recycled sand bedding.34 and has pneumonia in 325 dairy calves.44 been found in cooling ponds and dirt lots on dairies.3 Further studies are needed to determine the role of envi Host Immune Re.sponses ronmental reservoirs in M. boris epidemiology. Innate immune responses are critical in the early phase What Is the Rote of C’obfection is’ithOther Pathogeits? of mycoplasma infections. Alveolar macrophages in particular are important in the early clearance of myco In some studies,36 but not others,23 an association plasmas from the lung. However, inappropriate between bovine viral diarrhea virus infection and activation of alveolar macrophages by mycoplasmas can Al. boris has been observed. Bacterial coinfections in promote an excessiveinflammatory response. Detrimen Al. boris-associated pneumonia52337 and otitis media9 tal inflammatory responses in Al. boris infections have are extremely common; for example, Al. boris was iso been partly attributed to excessiveTNF- production by lated from the lungs of 82% of feedlot calves with alveolar macrophages.4 Activation of macrophages fibrinosuppurative pneumonia from which Afanitheinila results in the recruitment of neutrophils to sites of haeinolytica was isolated.8 In other surveys of feedlot inflammation, and neutrophils are a prominent cell pneumonia Al. boris was commonly identified in combi type in the lungs, middle ear, and joints of Al. boris in nation with Histophilus somni.23 and coinfection with fected calves.89 Excessive neutrophil recruitment with Pasteurella ,mdtociclais common in younger calves.37 the subsequent release of large amounts of inflammatory mediators can occur, and the extent of neutrophil What Microbial Characteristics Are Important in recruitment is directly correlated with the severity of M. bovis Pathogenesis? mycoplasma disease. Although bovine neutrophils are able to kill opsonized M. bovis,unopsonized M. boris can Al. boris has characteristics that enable it to colonize adhere to neutrophilsand inhibitrespiratoryburst activity.46 and persist on mucosal surfaces, to invade tissues, and to Despite a substantial body of work examining adap persist at sites of disease despite an aggressive immune tive immune responses to mycoplasma infections, the response. Molecules involved in adherence, antigenic optimal responses for protection and the types of re variation, invasion, immunomodulation, bioflim forma sponses contributing to disease remain poorly defined. tion, and production of toxic metabolites are likely to be Adaptive responses that are in place at the time of expo important in pathogenesis, but exactly how M. boris sure can help control new infections. For example, prior interacts with the host is poorly understood. Al. boris mastitis seems to protect cows from developing Mycoplasmas lack a cell wall, and exposed membrane the severe mastitis that is typically observed on primary proteins form the primary interface with the host. These infection; most reinfections result in subclinical or mild membrane proteins facilitate adherence to mucosal sur disease.47However, adaptive responses are often ineffec faces, although M. bovis adhesions are not yet well tive at eliminating established mycoptasma infections, characterized. M. bovis has a large family of immuno and ongoing, ineffective responses result in chronic dominant variable surface lipoproteins (Vsps). which inflammation. Exactly how mycoplasmas manage undergo high frequency phase and size variation in vitro to avoid clearance by the host is not welt understood. and in vivo,35 and exhibit extensive strain variation in However, mycoplasmas can induce a broad range of their coding sequences.35Particular Vsp variants can be immunomodulatory events that might induce ineffective selected by exposure to antibodies.4’ These characteris immune responses, and variation of surface antigens tics impart a vast capacity for antigenic variation in could help mycoplasmas to avoid clearance mediated by Al. boris populations that likely contributes to immune adaptive responses. evasion and persistence and provides a challenge for vac Experimental respiratory infection of calves with cine development. M. boris usually elicits a strong humoral response char Al. boris has severalother properties that enhance patho acterized by high levels very little of serum IgG i and genesis. After adherence, many mycoplasmas, including IgG2.48and local mucosal IgG and IgA responses.49Sim Al. boris,42generate products such as phospholipases, hy ilarly, Al. boris inoculation of the mammary gland drogen peroxide. and superoxide radicals which damage results in serum IgG and local mucosal IgG and IgA tvlycopltisnia boils 775 responses.47’5°Humoral responses of naturally infected specific and include fever, tachypnea, dyspnea. and de cattle are more variable.5’ Together with innate creased appetite, with or without nasal discharge and responses, humoral immune responses appear to be coughing.26’37’53Poor tveight gain is observed in chroni important in protection from Al. boils. Systemic anti cally affected animals.37Mycoplasma pneumonia can be body is particularly important in preventing dis accompanied by cases of otitis media, arthritis, or both, seminated infections, and serum IgG Al. boils titers are in the same animal or in other animals in the herd. CPPS, correlated with protection from arthritis.2 On mucosal where animals develop polyarthritis in association with surfaces, however, local antibody is likely to be more chronic pneumonia. occurs in beef cattle several weeks important. For example, anti-Al. boils antibody concen after feedlot entry. trations in milk, but not in serum, are correlated with resistance to reinfection in cows following Al. boris Otitis Media mastitis.47IgG concentrations in bronchoatveolar lavage (BAL) fluid have been correlated with resistance to Al. boris-associated otitis media occurs in dairy or beef Al. boris-associated respiratory disease.49 calves as enzootic disease or as outbreaks, and also It is widely accepted that mycoplasma respiratory in occurs sporadically in feedlot cattle. In early or mild fections have substantial immunopathological cases calves remain alert with a good appetite, but as dis components, characterized by large accumulations ease progress they become febrile and anorectic. Clinical of lymphocytes in affected tissues, the production of signs are because of ear pain and cranial nerve VII defi proinflammatory cytokines, and lung inflammation. cits, especially ear droop and ptosis.9’° Ear pain is Mycoplasmas, including Al. boris. can also modulate evidenced by head shaking and scratching or rubbing some inflammatory responses.47However, little is known ears. Epiphora and exposure keratitis can develop sec about the cytokine environment in the lungs of calves ondary to eyelid paresis. Clinical signs can be unilateral or bilateral, with Al. boris infections. In I study,48 peripheral blood and purulent aural discharge can be present mononuclear cells from Al. boris-infected calves secreted if the tympanic membrane has ruptured. Concurrent IFN-y and IT_4in response to Al. boils antigen. and there cases of pneumonia, arthritis, or both are common. Oti was a strong systemic IgG, response with little IgG2 pro tis interna and vestibulocochlear nerve deficits can occur duced. These findings indicate that Al. boris induces a as sequelae; head tilt is the most common clinical sign. mixed Thl-Th2 cytokine response, although the lack of but severely affected animals can exhibit nystagmus, cir IgG2 production was more consistent with a Th2-biased cling, falling, or drifting toward the side of the lesion and response. vestibular ataxia.9”° In advanced otitis media-interna, meningitis can develop.9’6 Spontaneous regurgitation, What Clinical Signs Are Associated with loss of pharyngeal tone, and dysphagia have also been reported, indicative of glossopharyngeal nerve dysfunc Mycoplasma Infections? tion with or without vagal nerve dysfunction.54 Mastitis Arthriti.s’,Synovitis, The herd presentation of mycoplasma mastitis varies anti Periarticular Infrctions from endemic subclinical disease to severe clinical masti Cattle of any age can be affected by Al. boris arthritis. tis outbreaks.3’ Many infections are subclinical, and a Cases tend to be sporadic and are often concurrent with subset of subclinically infected cows do not have a cases of pneumonia or mastitis, although outbreaks of marked increase in somatic cell count or reduced milk M. bovis arthritis as the predominant clinical manifesta production. Cows of any age or stage of lactation are tion have been reported in calves6’7and dairy cows.3° affected, including prepubertal heifers27and dry cows.52 CPPS is described in feedlot cattle.8 Clinical signs are When the disease is clinical, signs are nonspecific; classi typical of septic arthritis, including acute nonweight cally more than one quarter is affected, there is a drastic bearing lameness with joint swelling, pain, and heat on decrease in milk production and signs of systemic illness palpation. The animal might be febrile and anorectic. are relatively mild. The mammary gland might be swol Involvement of tendon sheaths and periarticular soft tis len but is not usually painful; secretions vary from mildly sues is common.5’3°Large rotator joints (hip, stifle, hock, abnormal to gritty or purulent, and are sometimes shoulder, elbow, and carpal) are commonly affected, al brownish in color.3’ A history of mastitis that is resistant though other joints such as the fetlock or even the to treatment with antimicrobials is common, and clinical atlantooccipital joint can be involved. Poor response to disease can persist for several weeks. Return to produc treatment is a common feature.5’3° tion is possible but slow.3’ Arthritis, synovitis, joint effusion or combinations, or respiratory disease in masti Other Diseases tic or nonmastitic cows can accompany Al. boris mastitis 26,30,31 Keratoconjunctivitis. Al. boris can be isolated from the conjunctiva of healthy and diseased cattle.27’55 Its Pneunwnia involvement in infectious keratoconjunctivitis (IKC) is seldom reported. and it is mainly considered a predispos Al. boris-associated pneumonia occurs in any age cat ing or coinfecting agent. However, it was the only tle. including dairy and beef calves, beef cattle after pathogen isolated in 1 outbreak of IKC in calves, where arrival at a feedlot. and adults. Clinical signs are non- IKC was followed by cases of pneumonia and arthritis.5 776 Maunsell et al
Meningitis. Meningitis can occur as a complication of can be enhanced by repeated sampling, optimal sample mycoplasma otitis media-interna. M. boWshas also been handling, and the use of various laboratory tech isolated from the cerebral ventricles of young calves with niques.20’63Mycoplasmas isolated in culture should be clinical signs of meningitis in conjunction with severe speciated by antibody-based tests (immunofluorescence arthritis, suggesting disseminated septic disease.6 or immunoperoxidase tests) or, preferably, polymerase Decitbital Abscesses. In I report, 50 calves developed chain reaction (PCR). Al.boils-infected decubital abscesses over the brisket and Al. boils can be detected directly in clinical specimens joints: some calves had concurrent Al. boris-associated by PCR.64ODPCR can be especially useful for stored pneumonia.6 samples; PCR had a similar sensitivity to culture for Cardiac Disease. Al. boris was identified concurrently detection of Al. boris in fresh milk but was much more with H. somni in the hearts of 4 of 92 feeder calves dying sensitive than culture in milk frozen for 2 years.66Real from mvocarditis.57 In another report. a heifer with clin time PCR systems with high sensitivity and specificity ical signs of cardiac insufficiency was found to have have been described for the detection of Al. boris in clin mural and valvular endocarditis with Al. boWs isolated ical samples.6’60 Other techniques, including denaturing endocarditis.a from the chronic active fibrinopurulent gradient gel electrophoresis PCR and melting-curve anal Genital Disorders. In isolated and predominantly ysis of PCR products, appear promising for the experimental cases, Al. boWs has been associated with simultaneous detection and differentiation of multiple genital infections and abortion in cows26 and seminal mycoplasma species.6869A monoclonal antibody-based vesiculitis in bulls.56However, there is little evidence to sandwich ELISA (sELISA) kit for the detection of Al. support an important role for Al. boris in naturally boris in clinical material is available in Europe;b sensitiv occurring bovine reproductive disease. ity and assay time are better than conventional culture when samples are preincubated in broth.7° Al. boris can How Are M. bovis Infections Diagnosed? be detected in situ by IHC on formalin fixed, paraffin- embedded tissues.0 An indirect fluorescent antibody test Rapid and accurate diagnosis of Al. boWsinfections is for detection of Al. boris in fresh, frozen lung tissue has compromised by the low sensitivity and, in some cases, also been described.7’ specificityof the available tests, and subclinical infections For the diagnosis of Al. boWs pneumonia in the live and intermittent shedding complicate diagnosis. animal, transtracheal wash or BAL is preferable to URT samples,72although isolation of M. boris is not well cor Detection of Antibodies against M. boils related with respiratory disease in the individual animal. M. boris-specific serum antibodies can be detected by Aspirates of affected joints or tendon sheaths can be sub indirect ELISA,59 usually by 6—JOdays after experimen mitted for M. boris detection. In live calves with otitis tal infection. However, in natural infections, individual media, the sensitivity or specificity of URT Al. boris cul animal titers are poorly correlated with infection or dis ture has not been reported, and samples are not typically ease; not all diseased animals develop high titers, titers collected from the middle ear of live calves. Imaging (ra can remain increased for months,21 and maternal anti diography, computed tomography) has been used as an body results in high titers in calves.5’ On a group level, aid in the diagnosis of otitis media/interna in calves.’0’54 however, seroconversion or high titers are predictive of active Al. hovis infection.’’ Serology is therefore best applied in surveillance or as part of a biosecurity pro How Should Samples Be collected and Handled? gram.21’60Antibody titers in milk have been used to identify M. boris-infected mammary glands.6’ Optimal sample handling is vital to ensure mycoplas ma survival. Because mycoplasmas are cell-surface associated, it is to swab vigorously when Detection of M. bovisin C’lbiica! Material important sam pling. Wooden-shaft cotton swabs should be avoided as Mycoplasma culture requires complex media, special they can inhibit mycoplasma growth. Swabs should be ized equipment, and technical skill. Growth is often placed immediately into aerobic bacterial (Ames without apparent by 48 hours, but 7—10days incubation is rec charcoal, Stuart’s, or Eaton’s) or mycoplasma transport ommended before samples are called negative. The media. Tissue samples should be formalin fixed for histo sensitivity of culture for the detection of Al. boris in clin pathology and IHC or placed in plastic bags on ice for ical material is quite low. Intermittent and low-level culture. When tissue cannot be processed rapidly after shedding, uneven distribution of Al. boris throughout necropsy, postmortem BAL samples or swabs of lesions diseased tissue, suboptimal sample handling or culture might be preferable; mycoplasmas remain viable in BAL conditions, and the presence of mycoplasma inhibitors in fluid for a few days at 4CC,whereas isolation from lung samples likely contribute to low sensitivity. Sensitivity of tissue decreases markedly over a few hours because of the milk culture for diagnosis of mycoplasma intramammary release of mycoplasma inhibitors from disrupted tissue.72 infection has been reported as approximately 50% for Samples should be refrigerated, or frozen if time to pro bulk tank samples and <30% in individual cows without cessing will exceed 2 days. Significant reductions in clinical mastitis.28’3162although it is higher in cows with mycoplasma recovery rates occur with increased time to clinical mastitis. The sensitivity of A’!.boris culture for processing, regardless of whether samples are refriger other clinical material has not been reported. Sensitivity ated or frozen, and best recovery rates are achieved tkfycoplasnia boris 777 when samples are processed fresh within a few hours of clinical mastitis or become culture negative often remain collection.73 intermittent, subclinical shedders, and should be regarded as permanently infected. What Are the Typical Necropsy finttings in M. bovis-Associatecl Disease? What Do We KnoB’ about Antimicrobial Resistance With the exception of mastitis, M. boris-associated of M. bovis? disease is best diagnosed by necropsy; a definitive diag nosis is based on demonstration of M. boris in affected Because mycoplasmas lack a cell wall, the -lactam an tissues by IHC or by culture, PCR, or sELISA. Although timicrobials are not effective against these pathogens. some M. boris lesions are characteristic, many are grossly Similarly, mycoplasmas do not synthesize folic acid and indistinguishable from other pathogens. Additionally, are therefore intrinsicallyresistant to sulfonamides. Myco M. boris pneumonia can resemble contagious bovine plasmas as a class are generally susceptible to drugs that pleuropneumonia, a foreign animal disease. Therefore, interfere with protein (tetracyclines, macrolides, linosam tissues should be submitted to a diagnostic laboratory for ides, and florfenicol)or DNA (fluoroquinolones) synthesis. verification of field necropsy findings. However, M. boris is resistant to erythromycin.7475 Pnetunonia. The presence of M. boris in pneumonic Li Antimicrobial Susceptibility Testing Use/id to Guide lungs must be interpreted together with histopathology Treatment of M. bovishfection.c? Antimicrobial suscep and other findings, given that M. boris can be isolated tibility testing of large M. boris populations can be useful from lungs of cattle without lesions. Macroscopically, to make generalizations about resistance. However, the affected lung often contains multiple necrotic foci filled value of antimicrobial susceptibility testing in making with dry yellow to white caseous material.53 These evidence-based herd-, or individual-level treatment deci raised nodular lesions can be a few millimeters to several sions for M. bovis-associated disease has not been centimeters in diameter. Interlobular septae can contain determined. Susceptibility testing for mycoplasmas in linear necrotic lesions. Extensive fibrosis is common, and animals is not currently standardized and should be necrotic sequestra can be present. Acute fibrinous to interpreted with caution. chronic fibrosing pleuritis occurs in some cases. Histo Which Lcolates Should Be Collected for Antimicrobial logically, naturally occurring M. boris pneumonia is Susceptibility Testing? Isolates obtained from the site of characterized as subaccite to chronic bronchopneumonia infection from representative early, untreated cases that can be suppurative and is usually necrotizing.8’53 should be used. Samples collected at necropsy are ideal. IHC staining reveals large amounts of M. boris antigen, If live cattle with respiratory disease are sampled, BAL especially at the periphery of lesions.8 Mixed infections samples should be used; antimicrobial susceptibility data often complicate the characterization of lesions, and IHC of paired M. boris isolates obtained from nasal swabs can be useful in determining M. boris involvement in and BALs were found to differ considerably.72 these cases. What Methods Are Appropriate for Antimicrobial Susceptibility Testing of M. bovis?Microbroth dilution, Other hfections. A diagnosis of mycoplasma mastitis Etestc is usually made clinically rather than at necropsy, but agar dilution, and the can be used to determine lesions are characterized as mild to severe fibrinosuppu minimum inhibitory concentrations (MICs) for M. bovis. rative to caseonecrotic mastitis.1 In mycoplasma otitis There are currently no MIC testing control standards for media, the affected tympanic bullae contain suppurative veterinary mycoplasmas, although the Clinical Labora to caseous exudate and have often undergone extensive tory Standards Institute is in the process of developing osteolysis.954During field necropsy the ventral aspect of these. Breakpoints have not yet been determined and so the bulla can be opened and swabbed or aspirated for MIC results cannot be defined as susceptible, intermedi culture. Joints with M. boris arthritis contain nonodor ate, or resistant. What Data Are There on the Antimicrobial Susceptibility ous fibrinous to caseous exudate accompanied by of M. bovis Isolates? Selected data on the antimicrobial fibrosis.5’8Periarticular involvement is common and can susceptibility profiles of M. boris isolates are presented in involve tendons, synovial sheaths, muscle, and connec Table 1;most isolates originated from the respiratory tract tive tissue.5’8Affected periarticular tissues contain foci of of diseased cattle.74 The MICs of tilmicosin and spec caseous necrosis, linear necrotic lesions, and extensive fi tinomycin tend to have a bimodal distribution, and many brosis. IHC reveals M. boris antigen at the edges of isolates have high MICs for tetracyclines, findings that are necrotic lesions and within exudates.5’8 suggestiveof acquired resistance. Resistance to the fluoro quinolones and florfenicol appears uncommon, although What Treatment Is Appropriate for enrofloxacin resistance has been identified in a subpopula M. bovis-Associated Disease? tion of Israeli M. boris isolates.76MICs of tulathromycin have been reported for 63 M. boris isolates Should Mycoplasma Mastitis be Treated? European with the M1C50being 4 ig/mL, M1C90> 64tg/mL, and MIC As early as the I970s researchers reported that myco range 0.125 to > 64.tg/mL.78 However, tulathromycin plasma mastitis responded poorly to intramammary or was efficacious in the treatment of calves infected with systemic antimicrobial treatment, and this remains the a strain of M. boils that had an MIC of >64 j.tL/mL,so case today. Treatment of cows with mycoplasma mastitis the clinical relevance of tulathromycin MIC values is is not recommended. Cows that spontaneously resolve unknown.79 778 Maunsell et at
Table 1. Selected minimum inhibitory concentration (MIC) values for Mycoplasnia bovisa
Rosenbusch8 Gerchman Ayline” Francoze Enrofloxacin M1C50 0.25 0.16 — 0.19 M1C90 0.5 0.63 — 0.25 MIC ranse 0.03—4 0.08—2.5 — 0.047—0.5 florfenicol M1C40 I — 4 — M1C90 4 — 16 — MIC range 0.06—8 — 1—64 — Oxvtetracvcline tetracycline1 MIC0 2 4 32 4 M1C90 16 8 64 8 MIC range 0.125 to > 32 0.5—16 1—128 0.094 to > 256 Spectinomycin M1C55 2 2 4 2 M1C90 4 > 1,024 > 128 > 1,021
MIC range I to > 16 0.5 to > 1,024 1 to > 128 0.38 to > 1,021 Tilmicosin MIC5 64 128 > 128 — M1C90 > 128 > 128 > 128 — MIC range 0.5 to> 128 0.5 to> 128 4to > 128 —
GAllvalues are reported as tg;mL. tRosenbusch et al.75223 Us isolates, microbroth dilution method. Gerchman etal.76 17 Israeli isolates. microbroth dilution method except for spectinomycin, where the E-test svas used. 4Aylinget al” 62 UK isolates, microbroth dilution method. Francoz et al.7455 Canadian isolates. E-test. Data from the Francoz study are for tetracycline, other data are for oxytetracycline.
What Other Jnfisrniation can Be Used in Sekcting in the lungs of calves experimentally infected with Al. Treatmentfrr C’attk ,rith M. bovis-Associated Disease? haemolvtica plus Al. boris.80 Calves treated for 10 days with oral valnemulin or oral enrofloxacin beginning 10 There is little information on how pharmacokinetic days after experimental infection with Al. boris had im and pharmacodynamic data, where available, should be proved clinical scores and fewer Al. boris recovered from applied in the treatment of Al. boris infections. their lungs compared with untreated calves.8’ Two antimicrobials are currently approved in the There is little information on the treatment of natu United States for treatment of BRD associated with rally occurring M. boris-associated disease in cattle, M. boris; these are tulathromycin” and florfenicol.e An despite a huge volume of literature on the treatment of other macrolide, gamithromycin,’ is approved for undifferentiated 3RD. Oxytetracycline and tilmicosin treatment of M. boris-associated BRD in Canada. Oxy resulted in clinical improvement in calves with pneumo tetracycline, tilmicosin, and tylosin have a theoretical nia that included a mycoplasma component.82 In an basis for efficacy against M. boris and are approved in industry-sponsored study, tulathromycin and florfenicol the United States for treatment of BRD. Spectinomycin were effective treatments for BRD that included an M. is no longer available for treatment of BRD in the United boris component.83 For the treatment of M. boris-asso States. Enrofioxacin is only approved for treatment of ciated diseases other than 3RD, there are few data BRD associated with Al. haeinolytica, P. n,ultocidcz, and available. Cattle with Al. boris-associated arthritis have H. sonmi, and extralabel use is prohibited in the United an especially poor response to treatment.5’6 Aggressive States. However, in countries where fluoroquinolones early treatment before the development of extensive tis and spectinomycin do carry appropriate labels, these sue necrosis seems most likely to be successful. drugs could be considered for treatment of Al. boris Fluoroquinolones, tetracyclines, and macrolides tend to infections. have good distribution into joints. Myringotomy with Some controlled trials have evaluated the efficacy of irrigation of the middle ear has been recommended for antimicrobials for the treatment of experimentally the treatment of otitis media in calves. However, to our induced M. boris-associated disease. In an industry- knowledge the clinical efficacy or risks of this procedure sponsored study, calves that developed respiratory dis have not been critically evaluated. There is I report of ease after experimental Al. boris infection were treated successful surgical treatment of a calf tvith Al. boris- with tulathromycin.79 Treated calves had lower temper associated otitis media-interna in which a bilateral atures, lower rate of removal from the trial for welfare tympanic bulta osteotomy was performed.53 reasons, and lower lung lesion scores than control calves. Because improved efficacy is observed when treatment In another study. tilmicosin given at the onset of clinical is initiated early in the course of experimental disease, disease was associated with reduced numbers of Al. boris early recognition and treatment of cases are likely to be Ilvfycoplasnict bovis 779 very important in successful therapy. To our knowledge some instances, protect cattle from experimentally induced there are no published studies that have critically evalu li. bouis-associateddisease.2’49In a number of instances ated the duration of therapy for M. boris-associated M. boris vaccines have appeared promising in challenge disease. However, given that M. boris disease often studies but have been ineffective or resulted in increased becomes chronic, continuing antimicrobial treatment un severityof diseasewhen applied in fieldtrials. For example, til clinical resolution could be important and would an M. boris bacterin prevented respiratory diseasein calves involve extending treatment beyond most label recom that were challenged 3 weeks after vaccination.2 However, mendations. Research is needed to evaluate the effect of when the same vaccine was used in a field trial, an in treatment duration on cost and outcome. creased rate and severity of respiratory disease was observed in the vaccinated group.85 In another blinded, controlled field trial, a commercial M. boris bacterin was When Might Metaphylactic Antimicrobials be no different to a placebo in preventing M. boris-associated Indicated for M. bovis-Associated Disease? disease in high-risk dairy calves.’9In both these studies a In experimental M. boris infections, response to treat substantial proportion of calves were identifiedas infected ment when antimicrobials are given early in the course of with M. boris before vaccination. Increased disease sever disease is often better than response rates reported for ity has also been observed in vaccinated, experimentally natural disease.79’8°Metaphylaxis might therefore be infected calves. For example, vaccination with M. boris more successful than treatment after clinical M. boris- membrane proteins was associated with enhanced severity associated disease develops. There is little doubt that of respiratory disease following aerosol challenge, com strategic treatment of cattle at high risk of developing pared with control calves.86Increased severity of clinical undifferentiated BRD is beneficial in reducing the inci mastitis was reported in cows vaccinated with an M. boris dence and severity of disease, and some data support bacterin compared with controls after intramammary in treatment of calves at high risk of M. boils-associated oculation of M. boris.87 disease. For example, in a blinded, randomized study, veal It is therefore apparent that vaccination against calves in a facility in which M. boris was the predominant M. boris-associated disease is sometimes possible in a respiratory pathogen were treated with florfenicol or oral controlled setting, but the vaccines critically evaluated to tilmicosin during a BRD outbreak.84 Metaphylactic for date are not protective in the field.The early age at which fenicolresulted in higher weight gain, better clinicalstatus, calves often become infected also presents a challenge to and reduced rates of 3RD compared with tilmicosin or the development of a successful M. boris vaccine. Ongo untreated controls. Tulathromycin is the only drug cur ing research should lead to improved understanding of rently approved for metaphylactic use in the control of M. boris antigens and might result in the development 3RD associated with M. boris in the United States. In an of more targeted vaccine approaches. industry-sponsored, blinded, randomized field trial in high-risk cattle, significantly fewer cattle developed 3RD after tulathromycin metaphylaxis than after no treatment Tools or treatment with tilmicosin; M. boris was isolated from What Management Can Be Used affected cattle along with other 3RD pathogens.83Given in the Control and Prevention of the limited data available, metaphylactic use of antimicro M. bovis-Associated Disease? bials is probably justified when high levels of morbidity BiosectlrityJi)rM. bovis and mortality because of M. boris-associated disease are being sustained or can be expected in high-risk cattle, The best way to prevent M. boris infections is probably although M. boris-specific efficacy data and economic to maintain a closed herd or, if that is not possible, to analyses are needed. screen and quarantine purchased animals.4 Mycoplasma biosecurity practices targeted to the individual operation should be developed. For dairy herds, it is recommended Can Vaccination Help Control that the bulk tank culture history of the herd of origin be M. bovis-Associated Disease? examined when purchasing heifers or adults. If this his tory is unavailable, the bulk tank can be sampled at least In general, attempts to vaccinate cattle against 3 times spaced 3—4days apart.62 Where possible, calf M. boris-associated disease have been unrewarding. health records should be examined to determine if However, several M. bovis bacterins are licensed for mar M. boils-associated diseases such as otitis media have keting in the United States for the control of M. boris- been observed. When purchasing lactating cows, milk associated respiratory disease or, in one case, mastitis. In samples should be submitted for mycoplasma detection addition, a number of US companies produce auto (culture, PCR, or sELISA), keeping in mind the low sensi genous M. boris bacterins. However, there is virtually tivity of a single sample for detection of subclinical no data demonstrating field efficacy of the available M. boris mastitis.62Testing for M. boris antibodies in milk M. boris vaccines. To our knowledge, no M. boris vac might be useful to identify infected cows.6’ Testing pur cines are commercially available in Europe. chased dry cows, purchased heifers, and heifers raised off- As discussedearlier, adaptive immune responsesthat are site at calving and isolating them until results are obtained in place at the time of mycoplasma exposure can help con- has been recommended.62Serology has been used to help trol infection,so it is not surprising that vaccination can, in identifyuninfectedgroups of cattle before purchase.° 780 Maunsell et at
Managing Mycoplasma Mastitis Al. boils exposure via infected milk can be eliminated by pasteurization or by feeding milk replacer. Batch pas Monitoring programs to detect M. bovis should be in teurization of milk7 at 65CCfor 10 minute or 70CCfor 3 place in herds that are attempting to remain mycoplas minute or high-temperature (72C) short-time (flash) ma-free, as well as in herds managing a mycoplasma pasteurization59 wilt inactivate Al. boris. Other potential problem. Herd leveldetection of Ii. bovismastitis is usu routes of exposure of calves to A’!.boris include cob ally achieved by testing of bulk tank milk by culture, strtLm and respiratory secretions of infected animals. PCR. or sELISA.31”262Bulk tank testing should be per Exposure to infected colostrum could be reduced by pas formed at least monthly, with more frequent sampling teurization, by not pooling colostrum, and by not feeding indicated for large herds, herds undergoing expansion, or colostrum from cows known to be infected with Al. boris. when managing a mycoplasma problem. Sampling of Exposure to airborne Al. boils could be reduced by good clinical mastitis cases, high somatic cell count cows, and ventilation and low-stocking density. Calves with clinical cows and heifers (especially new purchases) at calving is mycoplasma disease shed very large numbers of organ also important. Whole herd sampling is sometimes used isms,15’26and moving sick calves to a separate hospital ‘whenattempting to eliminate Al. bovis, bttt low-test sen area might reduce transmission in calf facilities. All-in, sitivitv means that repeated sampling is required. all-out practices or segregation of age groups might also Mastitis records, including response to treatment, should limit transmission of Al. boris in multiage facilities. be monitored. Removing fence-line contact with other cattle and limit The approach to management of Al. boils mastitis ing the time the calf spends in the maternity area willalso needs to be tailored to each operation and can range reduce the potential for exposure. Proper sanitization of from culling of all Al. boils-infected cows to only culling buckets, housing. and other equipment between uses. cows with chronic clinical mastitis. Al. boils mastitis wearing gloves, and handling sick calves last could can be eliminated from dairy herds through aggressive reduce fomite-mediated transmission. Although Al. boris surveillance and culling of infected cows.3t’55and where a survives surprisingly well in the environment, it is closed herd can be maintained and a small proportion of highly susceptible to heat and to most commonly used cows are infected this could be feasible. Conversely, for chlorine-. chlorhexidine-, acid-, or iodine-based dis expansion herds or dairies where a large proportion of infectants. Addressing nonspecific factors related to the lactating herd is infected, eradication of Al. boWs respiratory health such as air quality, colostrum man might not be appropriate or economical. However, it agement, and nutrition could also help limit the impact should be emphasized that the worst outbreaks of clinical of Al. boris-related disease. Appropriate vaccination and mycoplasma disease observed by some of the authors control programs should be in place for respiratory vi have occurred after mycoplasma mastitis was detected ruses, as controlling other pathogens could decrease the and not eliminated. Attempted elimination of all adult risk of Al. boris coinfections. cows with intramammary mycoplasma infections remains the strongly recommended course of action. Economic analyses of the various approaches for man Managing M. bovisDi.sea,seiii Stocker am!feeder Cattle large aging mycoplasma mastitis in today’s dairy herds Recommendations for the control and prevention of are critically needed to help guide veterinarians in rec Al. boris-associated disease in stocker and feeder cattle ommending the most appropriate strategy. focus on maximizing respiratory system health and im In herds where the ultimate goal is eradication of mune function rather than Al. boris-specific measures. M. bovis but not all infected cows can be immediately Strategic antibiotic treatment of high-risk animals on ar culled, strict segregation infected cows has been used of rival or during an outbreak of 3RD might be useful in effectively As to limit new infections.3’ transmission reducing the incidenceof mycoplasma disease.Segregating might occur via routes other than the udder, cows should affected cattle and keeping the hospital pen separate from be segregated at all times, not in the milking just parlor. new arrivals could reduce exposure of high-risk animals to Strict milking parlor hygiene is recommended to reduce Al. boris.Using appropriate hygienemeasures for handling udder-to-udder M. bovis.3152Cows with transmission of sick cattle (use separate equipment or personnel or clean clinical mycoplasma mastitis should be culled. As dis equipment among animals, feed last, etc) could reduce the cussed earlier, M. boels can survive well in some bedding chances of fomite-mediated Al. boris transmission. substrates. Ideally, bedding found to be mycoplasma positive, usually recycled bedding processed on the farm, should not be used to bed dairy animals of any age. Priority Areas for M. boris Research High-priority areas of basic Al. boris research that need to be addressed include identification of virulence Managing M. bovisDiseasc’in Calves factors, the nature of protective and harmful immune Surveillancefor Al. bovis in calf facilitiesshould include responses in Al. boris infections, the importance of coin monitoring of health records and the submission of appro fection with other pathogens in the progression of priate samples from suspect cases for diagnostic testing. mycoplasma disease, and the potential of new vaccine For the control of Al. boils infections in calves,general in technologies to protect from Al. boris-associated disease. fectious disease control principles based on reducing In applied research, a critical need is the development exposure and maximizing host defensescan be used. of cost-effective. sensitive, and specificdiagnostic tests to Mycopicismoboris 781
allow accurate identification of M. boils-infected ani 10. Francoz D, Fecteau G, Desrochers A, Fortin M. Otitis me mals. Prevalence data are needed so that the true impacts dia in dairy calves: A retrospective study of IS cases (1987 to 2002). of M. bovis infections can be determined and so that Can Vet J 2004;45:66l—666. diagnostic-testing recommendations can be made. Epi 11. Martin SW, Bateman KG, Shewen PE, et al. A group level analysis of the associations between to seven putative demiological research is required to clarify risk factors antibodies for infection and disease, particularly those factors asso pathogens and respiratory disease and weight gain in Ontario feed- lot calves. Can J Vet Res 1990;54:337—342. ciated with severe outbreaks of clinical disease. L.ong 12. Thomas A. Ball H. Dizicr I, et al. Isolation of mycoplasma term studies would be helpful to determine the effect of species from the lower respiratory tract of healthy cattle and cattle calfhood Al. boris infection on disease and productivity with respiratory disease in Belgium. Vet Rec 2002:151:472476. later in life. Perhaps the most critical needs are evidence- 13. USDA. Mvcoplasma in bulk tank milk on US. dairies. based strategies to limit the clinical, welfare, and eco USDA:APHTS:VS: CEAH. National Animal Health Monitoring nomic impacts of Al. boris infection. Identifying these System, Fort Collins. CO. 2003, N395.0503 strategies will require well-designed field studies to 14. Fox LK. Hancock DD, Mickelson A, Britten A. Bulk tank critically evaluate vaccines, antimicrobials for treatment, milk analysis: Factors associated with appearance of A!rcopla.ona or metaphylaxis or both, and management strategies for sp. in milk. 3 Vet Med B Infect Dis Vet Public Health 2003;50: 235—240. the control of A4’.boris infections. 15. Wilson DJ. Goodell G. Justice-Allen A, Smith ST. Herd- level prevalence of A!i’coplasnta spp. mastitis and characteristics of infected dairy herds in Utah as determined by a statewide survey. Footnotes J Am Vet Med Assoc 2009:235:749—754. 16. Wilson DJ, Gonzalez RN. Das HH. Bovine mastitis patho gens in New York and Pennsylvania: Prevalence and effects Helie P. Labrecque 0, Babkine NI. Francoz D. Micoplasnisi boris on somatic cell count and J Sci 1997;80: mural and valvular endocarditis in a heifer. In: Proceedings of the milk production. Dairy 58th Annual Meeting of the American College of Veterinary Pa 2592—2598. 17. Punrapornwithaya V. Fox LK. et al. tholosists. Savannah. GA. November 10—14.2007 (abstract 45) Hancock DD. Asso b Bio-X Diagnostics, Jemelle, Belgium ciation between an outbreak strain causing Mi’coplasma boris cAB BIODISK. Solna. Sweden mastitis and its asymptomatic carriage in the herd: A ease study d Draxxin. Pfizer Animal Health. New York. NY from Idaho. USA. Prey Vet Med 20l0;93:66—70. Nufior Gold, Intervet/Schering-Plough Animal Health, Summit, 18. Bennett RH, Jasper DL. Nasal prevalence of Micoplicciiitiboris NJ and IHA titers in young dairy animals. Comell Vet 1977:67:361—373. rZactran Injectable Solution, Merial Canada. Baie d’Urfe, Quebec, 19. Maunsell FP, Donovan GA, Risco C, Brown MB. Field Canada evaluation of a Mrcoplusuia boris bacterin in young dairy calves. Vaccine 2009;27:2781—2788. 20. Wiggins MC, Woolums AR. Sanchez 5, et al. Prevalence of Mycoplasnia boris in backgrounding and stocker cattle opera tions. JAm Vet Med Assoc 2007;230:l514—l518. References 21. Le Grand D, Calavas D, Brank M. et al. Serological prev alence of Mrcopltisma boris infection in suckling beef cattle in 1. Bennett RH, Jasper DE. Bovine mycoplasma mastitis from France. Vet Rec 2002;150:268—273. intra-mammary inoculation of small numbers of Mrcoplasma boils. 22. Boothby JT, Jasper DI, Zinkl JG, et al. Prevalence of 1. Microbiology and pathology. Vet Microbiol 1977;2:341—355. mycoplasmas and immune responses to Mrcoplasniu htn’isin feedlot 2. Nicholas RA, Ayling RD, Stipkovits LP. An experimental calves. Am J Vet Res 19$3;44:83l—$38. vaccine for calf pneumonia caused by Ii!s’coplasma boris: Clinical, 23. Fulton RW, Blood KS, Panciera RJ, et al. Lung pathology cultural, serological and pathological findings. Vaccine 2002;20: and infectious agents in fatal feedlot pneumonias and relationship 3569—3575. with mortality, disease onset, and treatments. J Vet Diagn Invest 3. Stalheim OH, Page LA. Naturally occurring and experi 2009;21:464477. mentally induced mycoplasmal arthritis of cattle, J Clin Microbiol 24. Campbell J. Economics of Ikfycoplasma boils. In: Proceed 1975;2:165—168. ings of the International Conference on Bovine Mvcoplasmosis, 4. Gonzalez RN, Sears PM, Merrill RA, Hayes GL. Mastitis Saskatoon, Canada, July 7—9,2009. Available at: http://www. due to mycoplasma in the state of New York during the period bovinemycoplasma.ca/. Accessed February 2, 2011. 1972—1990.Cornell Vet I992;$2:29—40. 25. Rosengarten R, Citti C. The role of ruminant mycoplasmas 5. Adegboye DS, Halbur PG. Nutsch RG, et al. Mrcoplas,na in systemic infection. In: Stipkovits L, Rosengarten R, Frey 3, eds. boris-associated pneumonia and arthritis complicated with pyogra Mycoplasmas of Ruminants: Pathogenicity, Diagnostics, nulomatous tenosynovitis in calves. J Am Vet Med Assoc 1996; Epidemiology and Molecular Genetics. Brussels: European Com 209:647—649. mission; 1999:14—17. 6. Stipkovits L, Rady M, Glavits R. Mvcoplasmal arthritis 26. Pfutzner H, Sachse K. Mycoplasnia boris as an agent of and meningitis in calves. Acta Vet Hung 1993;41:73—$8. mastitis, pneumonia, arthritis and genital disorders in cattle. Rev 7. Butler JA, Sickles SA, Johanns CJ, Rosenbusch RF. Pas Sci Tech l996;15:1477—l494. teurization of discard mycoplasma mastitic milk used to feed 27. Fox LK, Muller FJ, Wedam ML. et al. Clinical Mrcopla.r calves: Thermal effects on various mycoplasma. J Dairy Sci 2000;83: nia boris mastitis in prepubertal heifers on 2 dairy herds. Can Vet J 2285—2288. 2008:49:1110-1112. 8. Gagea MI. Bateman KG, Shanahan RA. et al, Naturally 2$. Biddle MK. Fox LK. Hancock DD. Patterns of mycoplas occurring Mvcoplosmciboris-associated pneumonia and polyarthri ma shedding in the milk of dairy cows with intramammary tis in feedlot beef calves.] Vet Diagn Invest 2006;18:29—40. mycoplasma infection. JAm Vet Med Assoc 2003;223:I 163—1166. 9. Lamm CO. Munson L. Thurmond MC, et al. Mycoplasma 29. Woldehiwet Z, Mamache B. Rowan TG. Effects of age, en otitis in California calves. J Vet Diagn Invest 2004:16:397402. vironmental temperature and relative humidity on the colonization 782 Maunsell et al
of the nose and trachea of calves by Aircoplasma spp. Br Vet J 50. Bennett RH, Jasper DE. Bovine mycoplasmal mastitis from 1990;l46:4l9—424. intramammary inoculations of small numbers of Mycoplasmtt 30. Wilson DJ, Skirpstunas RT, Trujillo JD, et al. Unusual boris: Local and systemic antibody response. Am J Vet Res I980;4l: history and initial clinical signs of Mycoplasina boils mastitis 889—892. and arthritis in first-lactation cows in a closed commercial dairy 51. Virtala AM, Grohn YT, Mechor GD, et at. Association of herd. JAm Vet Med Assoc 2007;230:t 519—1523. seroconversion with isolation of agents in transtracheal wash 31. Gonzalez RN, Wilson DJ. Mycoplasmal mastitis in dairy fluids collected from pneumonic calves tess than three months of herds. Vet Clin North Am Food Anim Pract 2003;19:l99—22l. age. Bovine Practitioner 2000;34:77—80. 32. Jasper DE, Alaubaid JM, Fabrican J. Epidemiologic obser 52. Bicknell SR, Jackson G, Boughton E, Wilson CD. Meco vations on mycoplasma mastitis. Cornell Vet l974;64:407—4l5. plasma boris mastitis in the dry cow. Vet Rec l978;102:389. 33. Pfutzner H. The tenacity of Mecoplasma boris. Zentralbl 53. Caswell JL, Archambault M. Mvcoplosnio boris pneumonia Bakteriol Mikrobiol Hyg A l984;258:38—4l. in cattle. Anim Health Res Rev 2007;8:l6l—l86. 34. Justice-Allen A, Trujillo J, Corbett R, et al. Survival 54. Van Biervliet J, Perkins GA, Woodie B, et at. Clinical signs, and replication of Mrcoplas,na species in recycled bedding sand computed tomographic imaging. and management of chronic otitis and association with mastitis on dairy farms in Utah. J Dairy Sci media/interna in dairy calves. J Vet Intern Med 2004;ls:907—9l0. 2010;93:192—202. 55. Alberti A, Addis MF, Chessa B, et al. Molecular and anti- 35. Bray DR, Shearer JK, Donovan GA. Approaches to genie characterization of a A.fycoplosma hos’is strain causing an achieving and maintaining a herd free of mycoplasma mastitis. In: outbreak of infectious keratoconjunctivitis. J Vet Diagn Invest Proceedings of the 36th Annual Meeting of the National Mastitis 2006;l8:4l—5l. Council; Albuquerque, NM, February 16—19,1997, 132—137. 56. Kinde H, Daft BM, Walker RL, et at. Mycopla.vma boris 36. Shahriar FM, Clark EG, Janzen E, et al. Coinfection with associated with decubitat abscesses in Holstein calves. J Vet Diagn bovine virus diarrhea virus and Itfycoplas,nc, boris in feedlot cattle Invest l993;5:l94—l97. with chronic pneumonia. Can Vet J 2002;43:863—868. 57. flames DM, Motine KM, Sargent RA, et at. Immunohisto 37. Stipkovits L, Ripley P, Varga J, Palfi V. Clinical study of chemical study of Hemophihis somnus, Mycoplcisma boris, the disease of calves associated with Micoplcismci boris infection. Ivlannheimic,hemolytica, and bovine viral diarrhea virus in death Acta Vet Hung 2000;48:387—395. losses due to myocarditis in feedlot cattle. Can Vet J 2004;45:231—234. 38. Beier T, Hotzel H, Lysnyansky I, et al. Intraspecies poly 58. LaFaunce NA, McEntee K. Experimental Mycoplasma morphism of vsp genes and expression profiles of variable surface boris seminal vesicutitis in the bull. Cornell Vet t982;72:l50—167. protein antigens (Vsps) in field isolates of Mvcoplasma bos’ls. Vet 59. Uhaa IJ, Riemann HP, Thumiond MC, Franti CE. The use Microbiol 1998;63:l89—203. of the enzyme-linked immunosorbent assay (ELISA) in serological 39. Lysnyansky I, Sachse K, Rosenbusch R, et al. The vsp locus diagnosis of Alycoplasma boris in dairy cattle. Vet Res Commun of Mycoplasoia boris: Gene organization and structural features. l990;l4:279—285. J Bacteriol l999;l8l:5734—574l. 60. O’Farretl K, Dillon P, Mee J, et al. Strategy for restocking 40. Buchenau I, Poumarat F, Grand DL. et al. Expression of of Moorepark after depopulation following bovine spongiform en Mycopla,mio boris variable surface membrane proteins in the respi cephatopathy. Jr Vet J 200l;54:70—75. ratory tract of calves after experimental infection with a clonal 61. Byrne WJ, Ball HJ, Brice N, et al. Application of an indirect variant of Avlicoplasma boris type strain PG45. Res Vet Sci ELISA to milk samples to identify cows with Mycoplasma boris 20l0;89:223—229. mastitis. Vet Rec 2000;l46:368—369. 41. Le Grand D, Solsona M, Rosengarten R, Poumarat F. 62. Gonzalez RN, Wilson DJ. Realistic milk culture programs Adaptive surface antigen variation in Mycoplusmciboris to the host for herd expansion. In: Proceedings of the 41st Annual Meeting of immune response. FEMS Microbiol Lett 1996;l44:267—275. the National Mastitis Council; Orlando, FL, February 3—6,2002, 42. Khan LA, Miles RJ, Nicholas RA. Hydrogen peroxide pro 118—124. duction by ?vlvcoplasniaboris and Mrcoplasma agalactitic’and effect 63. Punyapomwithaya V, Fox LK, Gay GM. et at. Short commu of in vitro passage on a Mycoplasma boris strain producing high lev nication: The effect of centdfugation and resuspension on the recovery els of H202. Vet Res Commun 2005;29:18l—188. of Mj’coplcisniaspeciesfrom milk. J Dairy Sci 2009;92:4441 4447. 43. McAuliffe L, Ellis RJ, Miles K, et al. Biofilm formation by 64. Cremonesi P, Vimercati C, Pisoni G, et al. Development of mycoplasma species and its role in environmental persistence and DNA extraction and PCR amplification protocols for detection of survival. Microbiology 2006;l52:913—922. lilycoplasma boris directly from milk samples. Vet Res Commun 44. Van Donkersgoed J, Ribble CS, Boyer LG, Townsend HG. 2007;3t(Suppt l):225—227. Epidemiological study of enZootic pneumonia in dairy calves in 65. Hotzel H, Helter M, Sachse K. Enhancement of Mrcoplos Saskatchewan. Can J Vet Res l993;57:247—254. ma boris detection in milk samples by antigen capture prior to PCR. 45. Jungi 1W, Krampe M, Sileghem M, et al. Differential and Mol Cell Probes l999;t3:t75—l78. strain-specific triggering of bovine alveolar macrophage effector 66. Pinnow CC, Butler JA, Sachse K, et at. Detection of Myco functions by mycoplasmas. Microb Pathog l996;2l:487—498. plasma boris in preservative-treated field milk samples. J Dairy Sci 46. Thomas CB, Van Ess P, Wolfgram U, et at. Adherence to 200184:1640—1645. bovine neutrophils and suppression of neutrophil chemiluminescence 67. Sachse K, Satam HS, Ditter R, et at. Use of a novel real-time by Ivlvcoplasuittboris. Vet Immunol Immunopathol 199l;27:365—38l. PCR technique to monitor and quantitate Mycoplasma boris infec 47. Bennett RH, Jasper DE. Systemic and local immune re tion in cattle herds with mastitis and respiratory disease. Vet J sponses associated with bovine mammary infections due to 20I0;1 86:299—303. Mycoplasma boris: Resistance and susceptibility in previously in 68. Cai HY, Bell-Rogers P, Parker L, Prescott JF. Develop fected cows. Am J Vet Res l978;39:417—423. ment of a real-time PCR for detection of Mycoplasma boris 48. Vanden Bush TJ, Rosenbusch RF. Characterization of the in bovine milk and lung samples. J Vet Diagn Invest 2005;l7: immune response to Mrcopltisnia boils lung infection. Vet Immunol 537—545. Immunopathol 2003;94:23—33. 69. McAuliffe L, Ellis RJ, Lawes JR, et at. t6S rDNA PCR and 49. Howard CJ, Gourlay RN, Taylor G. Immunity to Myco denaturing gradient gel electrophoresis; a single generic test for de plasma boris infections of the respiratory tract of calves. Res Vet Sci tecting and differentiating Mrcoplasmo species. J Med Microbiot l980;28:242—249. 2005;54:731—739. Mycoplasnia boris 783
70. Heller M, Berthold E, Pfutzner H, et al. Antigen capture induced in calves by Mrcoplosina boris and Posteurella hoemolytica. ELISA using a monoclonal antibody for the detection of Mycoplcts Res Vet Sci l989;47:84—$9. ma boris in milk. Vet Microbiol l993;37:l27—l33. 81. Stipkovits L, Ripley PH, Tenk M, et al. The efficacy of vat 71. Knudtson WU, Reed DE, Daniels G. Identification of nemutin (Eeonor) in the control of disease caused by experimental Mycoplasmatales in pneumonic calf lungs. Vet Microbiol 1986; infection of calves with Mjcoplasma boris. Res Vet Sci 2005;78: 11:79—91. 207—215. 72. Thomas A, Dizier I, Trolin A, et at. Comparison of sam $2. Musser J, Mechor GD, Grohn YT, et at. Comparison of ti pling procedures for isolating pulmonary mycoplasmas in cattle. Imicosin with long-acting oxytetraeycline for treatment of Vet Res Commun 2002;26:333—339. respiratory tract disease in calves. J Am Vet Med Assoc l996;208: 73. Biddle MK, Fox LK, Hancock DD, et al. Effects of storage 102—106. time and thawing methods on the recovery of Mrcoplosma species in 83. Godinho KS, Wolf RM, Sherington J, et al. Efficacy of milk samples from cows with intramammary infections. J Dairy Sci tutathromycin in the treatment and prevention of natural outbreaks 2004;87:933—936. of bovine respiratory disease in European cattle. Vet Ther 2005; 74. Francoz D, Fortin M, Fecteau G, Messier SE. Detemiina 6:122—135. tion of ?vlycoplasma boris susceptibilities against six antimicrobial 84. Catry B, Duchateau L, Van d V, et at. Efficacy of metaphy agents using theE test method. Vet Microbiol 2005;l05:57—64. lactic fiorfenicol therapy during natural outbreaks of bovine 75. Rosenbusch RF, Kinyon JM, Apley M, et al. In vitro anti respiratory disease. J Vet Pharmacol Ther 2008;31:479-487. microbial inhibition profiles of Mrcoplctsmctboris isolates recovered $5. Nicholas RAJ, Ayling RD, Woodger N, et al. Mycoplas from various regions of the United States from 2002 to 2003. J Vet mas in adult cattle: Bugs worth bothering about? Ir Vet J 2006; Diagn Invest 2005;17:436—441. 59:568—572. 76. Gerchman I, Levisohn 5, Mikula I, Lysnyansky I. In vitro 86. Bryson DG, Ball HJ, Brice N, et al. Pathology of induced antimicrobial susceptibility of Mycopicisma boris isolated in Israel Mycoplctsinctboris calf pneumonia in experimentally vaccinated an from local and imported cattle. Vet Microbiol 2009;l37:268—275. imals. In: Stipkovits L, Rosengarten R, Frey J, eds. Mycoplasmas of 77. Ayling RD, Baker SE, Peek ML, et al. Comparison of in Ruminants: Pathogenicity, Diagnostics, Epidemiology and Molec vitro activity of danofioxacin, fiorfenicol, oxytetracycline, spec ular Genetics. Brussels: European Commission; 1999:128—132. tinomycin and tilmicosin against recent field isolates of 87. Boothby JT, Jasper DE, Thomas CB. Experimental intra Mrcoplasnia boris. Vet Rec 2000;146:745—747. mammary inoculation with Mycoplo.mza boris in vaccinated and 78. Godinho KS. Susceptibility testing of tulathromycin: Inter unvaccinated cows: Effect on the mycoptasmal infection and cellu pretative breakpoints and susceptibility of field isolates. Vet lar inflammatory response. Cornell Vet l986;76:188-l97. Microbiot 2008;129:426—432. $8. Byrne Wi, Ball HJ, McCormack K, Brice N. Elimination of 79. Godinho KS, Rae A, Windsor GD, et al. Efficacy of Mycoplasma boris mastitis from an Irish dairy herd. Vet Rec 1998; tulathromycin in the treatment of bovine respiratory disease associ 142:516—517. ated with induced Mycoplasma boris infections in young dairy 89. Stabel JR, Hurd 5, Calvente L, Rosenbusch RF. Destruc calves. Vet Ther 2005;6:96—l12. tion of Mycohctctrritan pctratuberculosis, Sahnonellct spp. and 80. Gourlay RN, Thomas LH, Wyld SG, Smith CJ. Effect of a Mycoplasma spp. in raw milk by a commercial on-farm high-tem new macrolide antibiotic (tilmicosin) on pneumonia experimentally perature, short-time pasteurizer. J Dairy Sci 2004;87:2t77—2l83. Attachment 10 Pub Med
Format: Abstract’ Fulltext links
J Comp Patho!. 2003 Aug-Oct;129(2-3):100-10. Mycoplasma bovis-associated suppurative otitis media and pneumonia in bull calves.
Maeda T1, Shibahara T, Kimura K, Wada Y, Sato K, Imada Y, Ishikawa Y, Kadota K. Author information Abstract Outbreaks of Mycoplasma bovis-associated otitis media and pneumonia occurred on four beef cattle farms in Hokkaido, Japan between 2000 and 2001. The morbidity and mortality were estimated at 8-40 and 30-100%, respectively. Eight calves with bilateral ear droop and exudative otitis media were examined bacteriologically and histopathologically. M. bovis was isolated post mortem from nasal swabs and from the ears, lungs, lymph nodes (cranial and pulmonary), brain and heart of all calves. At necropsy, suppurative exudates were observed in the tympanic bullae of all cases. Numerous abscesses were also found in the petrous portion of the temporal bone and lungs in seven cases. Histopathologically, the exudates within the tympanic bullae consisted of a mixture of neutrophils, necrotic cell debris and fibrin, and the tympanic mucosa was thickened with neutrophil and macrophage infiltration and proliferation of fibrous connective tissue. Pulmonary lesions included extensive foci of coagulative necrosis surrounded by numerous neutrophils. Hepatocytes or renal tubular epithelial cells were enlarged with hyaline cytoplasmic inclusions in four calves. Immunohistochemical labelling confirmed the presence of M. bovis antigen in the cytoplasm of the inflammatory cells in the middle ear, temporal bone and lungs, and was also demonstrated within the cytoplasmic inclusions of the hepatocytes and renal tubular epithelial cells. Ultrastructurally, mycoplasma-like organisms, 200-500 microm in diameter, were found within not only hepatocytes and renal tubular epithelia but also within axons of the facial nerves. The present results show that M. bovis spreads to multiple organs and is capable of invading various kinds of host cell. The intracellular localization may be favourable for evading host immune responses.
PMID: 12921715
[Indexed for MEDLINE]
MeSH terms, Substance LinkOut - more resources +
PubMed Commons PubMed Commons home
0 comments How to join PubMed Commons Attachment 11 October 2, 2017
HiCarl/All,
Since this is a time sensitive matter, I have taken the liberty to copy you all on this message.
I have read through the RADT,SDEIS,and other supplemental documents to better familiarize myself with the specific details. Asyou know well, the complications of disease prevention and control of polymicrobial pneumonia and respiratory disease transmission between BigHorn sheep (BHS)and domestic sheep (DS)/domestic goats (DG)has been an ongoing management challenge for over 30 years. The advancement of science has expanded our knowledge and understanding of the various infectious agents, transmission between animals, disease susceptibility, and inflammatory responses. Despite concerted efforts by federal and state wildlife/land management agencies, federal and state agricultural/livestock agencies, NGOs,and the industry to mitigate disease risk in BHSand D5/DG populations, there is limited resolution to date.
Below and attached are my responses to your posed questions with some additional information for your consideration. Please let me know if you have any questions or need additional information.
Respectfully submitted, Patty
• Is the overall description of disease transmission process between domestic sheep and goats and bighorn sheep adequate and accurate?
Yes.The key topics listed below were covered comprehensively and accurately in the SEISbased on known and available scientific information. o Relative importance of Pasteurella vs. M. Dvi o Mechanisms for disease transmission o Prevalence of pathogens in domestic goats & pack goats (Highland study & others) o Conclusions from co-mingling study regarding transmission potential & disease severity o Evidence for disease transmission from domestic goats in the field o Feasibility of testing & certification program for pack goats o Conclusions regarding risk of contact and potential for disease transmission from pack goats to bighorn sheep
In my responses below, I have provided some additional information for your consideration.
• Is the treatment of data provided by Dr. Highland sufficient? (The NAPgAcomments and raw data from Dr Highland’s lab have been provided to Patty and Brian already).
I appreciate Dr. Highland’s collegiality to provide us with an excerpt of raw data summarizing 83 premises and 575 pack goats tested in 13 states. It is my understanding that the samples collected were tested by several different laboratories and it is not clear if a standardized testing protocol was used. The numbers of premises per state vary from 1 to 25, and the number of animals pet premises tested varies from 2 to 136 raising some questions as to statistical power to determine percent prevalence in such small sample sizes with a stated assumption of low to no prevalence of disease in these domestic goats. Therefore, since a complete analysis of this data in the context of the full study has not yet been peer-reviewed or published, there should be reservation on drawing any conclusions or interpretation of the data until all information becomes available. In comparison, the USDAAPHISVeterinary Services’ 2011 NAHMSSheep Industry study and 2009 NAHMSGoat Study evaluated management practices and disease prevalence on 453 sheep and goat premises in 13 states. The 2011 Sheep Industry study reported that
“...Respiratory disease in sheep and lambs is an important cause of economic losses on U.S. sheep operations. In 2009, 4.8 percent of non-predator death losses in sheep and 12.6 percent of non-predator death losses in lambs were attributed to respiratory diseases such as pneumonia or shipping fever.”
This was the first study to estimate the national prevalence of M. ovipneumonia (M.ovi) in U.S. domestic sheep. Nasal swabs were collected from up to 10 adult ewes per flock on 453 operations in the 13 participating States. Overall, 401 operations (88.5 ¾) were positive by PCR,and there was a ‘within flock’ seroprevalence of 34.6% ELISA-positiveflocks. This high percentage of PCR-and ELISA positive flocks indicates M.ovi is a ubiquitous organism in U.S.sheep flocks. Further, all herded- range flocks were positive for M.ovi carriage. (2011 NAHMSSheep Study).
It is recognized that M.ovi is one of the common respiratory pathogens affecting domestic sheep and goats in the United States found in the respiratory tracts (especially nasal cavities) of healthy and symptomatic domestic sheep. Aerosol transmission and close contact with infected animals allows easy spread to young domestic lambs, often causing mild respiratory disease. Subclinical infected domestic sheep can develop acute pneumonia (‘shipping fever’) when placed under stress due to shipping, crowding, weather, poor nutrition, or other factors.
M.ovi infection predisposes to other respiratory infections by interfering with normal ciliary activity in the respiratory tract and by suppressing lymphocytes. Concurrent M.ovi and Pasteruello (Mannheimia) hemolytica infections are frequently found in lambs with chronic pneumonia and poor growth.
Certain domestic sheep management practices can reduce the likelihood of disease from M. ovi and other respiratory pathogens to include improving indoor ventilation, minimizing overcrowding, and isolating newly acquired sheep and lambs. Vaccination also can reduce prevalence or severity of infectious diseases. According to the 2011 Sheep Industry study, clostridial C and D (enterotoxemia) and tetanus vaccines were used most commonly across all age groups (average 72% and 66% operations, respectively). Approximately 11.0% of operations vaccinated for sore mouth (contagious ecthyma). However, less than 3% of operations vaccinated against common respiratory diseases (IBR/Pl-3;Pneumonia —Pasteurella/Mannheimia) across all age groups.
It would be helpful to understand why the sheep industry has not incorporated respiratory disease vaccines in their vaccine protocols. Vaccination of domestic sheep (and goats) would be more feasible than vaccination of wild sheep.
Goats
The USDAAPHISVSNAHMS’2009 Goat Industry Study and more recent report on “Goat and Kid Predator and Non-predator Death Lossin the United States, 2015” described national management practices and prevalent diseases impacting the goat industry. The 2009 Goat study was the first national study of the U.S.goat industry and was conducted in 21 states representing 75.5% of U.S. goat operations and 82.2% of U.S.goats. Highlightsfrom both of these reports are provided below. In 2015, about 10% of the U.S.adult goat and 19% of the kid inventory were lost to predator and non-predator causes. Non-predator causes accounted for about 75% of all adult goat and kid mortality. Of the non-predator known causes of mortality, internal parasites were the primary cause of loss (23%),weather (11%), kidding problems (7%);and (unspecified) respiratory diseases (approximately 5%).
Interestingly, respiratory disease percentages varied across the U.S.ranging from 1-3% in the Eastern USand West Central; 6% Central; and approximately 13% Pacific. Respiratory diseases were reported to cause a higher percentage of deaths on larger goat operations (>100 goats/kids) than on small operations (<10 animals), but the mortality rate was conversely higher on small operations than larger operations.
Of the goat internal parasites, the gastrointestinal parasite Haemonchus contortus (barber’s pole worm), likelycauses the most significant economic impact to goat producers. This intestinal worm sucks blood from the host resulting in anemia and possibly death. This same intestinal parasite can infect sheep with similar consequences.
Caseous lymphadenitis (CIA)was reported by 12-20% of goat producers as suspected or confirmed on their operations in recent years. CIAis caused by the bacteria, Corynebacterium pseudotuberculosis, often introduced through wounds. The infection results in abscesses at the wound site, regional lymph nodes, and in deeper body tissues. Drainage from abscesses can contaminate the environment and cause disease spread to other animals. Infected animals should be isolated (ifbeing treated) or culled. There have been reports of CLAinfection in captive Rocky Mountain elk on pasture in Utah (Kelly,et al 2012). CIAis a zoonotic disease so precautions taken and proper protective clothing (PPE)worn when working with infected goats, sheep, and other animals.
Sore mouth was reported in about 15% of goat operations as suspected or confirmed on the operation in the recent years. Sore mouth (orf, contagious ecthyma) is caused by a Pox virus which produces vesicles followed by thick scabs on the mouth, lips, nose, teats, udders, and feet of infected animals. Affected young animals refuse to eat and adults may refuse to nurse. Sore mouth has been reported in wild white tailed deer and other wild ruminants are likelysusceptible. It also is a zoonotic disease which may infect people.
In 2015, 7.7% of goat operations stopped raising goats and kids with a higher percentage of small operations (<10 goats) quitting. The combination of diseases (unspecified) and parasites accounted for 11% of the reasons stated.
Summary: although the focus has been on respiratory diseases — M.ovi and Pasteurella-related bacteria as etiologies — we should be cognizant of a number of other goat diseases that may be easily transmitted via direct contact or environmental contamination, and pose a potential significant health concern to BHS.
• Are the rationale for risk ratings and the ratings themselves clearly articulate and consistent with the presentation of best available science? In 2012, the Wild Sheep Working Group of the Western Association of Fish and Wildlife Agencies
(WAFWA)developed “Recommendations for Domestic Sheep and Goat Management in Wild Sheep Habitat”. Below is a summary excerpt:
“The use of domestic sheep or goats as pack animals by persons that travel in identified wild sheep habitat should be prohibited by the appropriate management agency (e.g., USDAForest Service 2011). Where legislation or regulations are not already in place, on outreach program to inform potential users of the risks associated with that activity should be implemented to discourage use of domestic sheep or goats as pack animals.
Further responsible agencies must require that domestic sheep or goats are in good health before being turned out. For example, Alberta and British Columbia have developed health certification protocols (Pybus et al.1994) that must be complied with before domestic sheep are turned out for vegetation management in conifer regeneration efforts. We emphasize that the higher the risk of association between domestic sheep or goats with wildsheep, the higher the certainty of domestic animal health should be.
Further, it must be recognized that even clinicallyhealthy domestic sheep or goats can still carry pathogens that are transmissible to wild sheep, and thus, pose a significant risk to wild sheep. In areas of high risk of association between wild sheep and domestic sheep or goats, agencies and permittees should ensure enhanced monitoring of grazing and trailing patterns using global positioning system (GPS)collars or other technology that provide detailed data on movements and grazing patterns. While enhanced monitoring willnat reduce risk of association, it is vitalfor development of meaningful risk assessments and to ensure appropriate management recommendations are taken to achieve effective separation.”
The 2 key points to be revisited are:
1. Development of standardized testing protocols for health certification of domestic sheep and goats to determine disease prevalence within domestic herds. However, organisms like M.ovi and Pasteurella (Mannheimia, etc) are intermittently shed by reservoir hosts. Stress may elicit active shedding by individuals that may not be documented from on-farm herd testing.
2. There are other potentially significant (non-respiratory) diseases of domestic sheep/goats to which BHSmay be exposed directly or via environmental contamination. These should be considered in relative risk assessments. See aforementioned examples.
• Is the treatment of the potential efficacy and ability to implement the mitigation measures in Alternative 3 sufficient?
Alternative 3: Domestic sheep and domestic goat grazing would be allowed on the current allotment allocated for sheep and goats. Pack goat use would be prohibited from core native bighorn sheep ranges and approved through a permit process once a scientifically proven and viable mitigation is developed and approved.
In 2009, the USAHA(U.S.Animal Health Association) issued “Recommendations on best management practices for domestic sheep grazing on public land ranges shared with bighorn sheep” that was developed by the USAHA’sJoint Working Group: Committee on Wildlife Diseases and Committee on Sheep and Goats. The Working Group comprised of staff or members of state and federal animal health agencies, wildlife and public land management agencies, the American Sheep Industry, and Wild Sheep Foundation. The recommendations that were developed focus on practices intended to minimize opportunities for interspecies contact on shared range that could lead to transmission of respiratory pathogens. The original USAHAresolution that led to this working group directed federal agencies to fund research on epidemiology and pathogenesis of bighorn/domestic sheep disease interactions.
The full report of USAHAJoint Working Group Committee of Wildlife Diseases and Committee on Sheep and Goats is on pages 695-702 of the 2009 USAHAproceedings available at: http://www.usaha.org/upload/Proceedings/2009 USAHAProceedings.pdf
The following is an excerpt of the full Work Group report containing summary recommendations.
Recommended best management practices for grazing domestic sheep (and goats) on public lands where contact with bighorn sheep may occur:
Domestic sheep husbandry
1. Select only highly gregarious breeds of sheep (e.g., Merino, Rambouillet, Western/white-faced ewes”, fine wools and crosses thereof) for grazing on shared ranges.
2. Use pregnant domestic ewes or ewe-lamb pairs (i.e., ewes with lambs) for grazing near occupied bighorn sheep habitats; avoid grazing open ewes, yearling replacement ewes and ewes that have lost their lambs because ewes in estrus attract bighorn rams.
3. Maintain a band size of less than 900 ewes with single lambs (1,800 total) or 700-800 ewes with twin lambs (2,100 to 2,400 total), or of less than 1,500 dry ewes or yearlings.
4. Require instruction/training and supervision for ranch (i.e. camp tenders and sheepherders) and agency staff members and frequent instructions to the sheepherders concerning locations where forage and water is available for domestic sheep and monitor that the grazing standards and guidelines are being followed.
S. Require instruction/training and supervision for ranch (i.e. camp tenders and sheepherders) and agency staff members and frequent instructions to the sheepherders concerning recognizing bighorn sheep and allowable methods for preventing contact between bighorn sheep and domestic bands.
6. Place more experienced, informed, and responsible sheepherders on allotments located nearest to bighorn sheep habitats.
7. Place mature and effective guard dogs and herding dogs with domestic sheep (at least 2 of each per band). Female dogs in heat should not be placed on allotments.
8. Conduct full counts of all individual ewes when moving onto and off of each allotment. 9. Maintain an appropriate ratio of marker sheep within bands; depending on local needs and conditions, ratios should be no fewer than 1 marker for every 100 adult sheep. More markers may be required when dictated by local conditions.
10. Count marker sheep on a regular basis, immediately any time sheep scatter and more frequently (e.g., once or twice per day) if required under local grazing agreements. It is customary to count marker sheep when they are bedded and this should be encouraged. After sheep scatter, complete a full count as soon as reasonably possible.
11. Place bells on at least 1 in every 100 mature ewes to serve as warning, and for identification and location of sheep relative to other sheep.
12. Select camp locations and bedding grounds that are acceptable to sheep and encourage sheep to remain within the bedding grounds.
13. Select herder’s camp, nighttime bedding ground, and midday (siesta) bedding ground locations that maintain communication between guard dogs and herding dogs by smell, sound (barking) and sight, and to take advantage of differences in the sleep cycles of guard dog and herding dog. If grazing federal lands, comply with established “bed ground” standards. Construct temporary electric or boundary fences in congregation areas (e.g., bed grounds) where feasible.
14. Truck in water (if needed) to prevent straying.
15. In situations where sheep are difficult to observe because of dense vegetation or difficult terrain, always count marker sheep after emerging from such conditions.
16. Increase sheepherder vigilance on bright moonlit nights because sheep may rise to graze under these conditions.
17. Truck domestic sheep through “driveway” areas that include occupied bighorn sheep habitat where interspecies contact is considered likely by the land management agency staff in consultation with the state wildlife management agency staff. It is not always possible to truck sheep into certain rugged areas; in these cases other arrangements may need to be made.
18. Do not trail more than 5 miles per day and stop trailing when sheep or lambs show signs of fatigue. Provide for a “babysitter” or removal of lagging sheep when trailing. Follow additional agency guidelines (where applicable) on federal lands.
19. Remove sick or physically disabled domestic sheep from the band.
20. Require that sheepherders use communication equipment such as cellular or satellite phones or two-way radios (when service is adequate) and location equipment such as global positioning system (GPS)receiver to report and record grazing movements and encounters with bighorn sheep. Seek cost-sharing partnerships for providing electronic and other equipment when an operator changes grazing management practices for the sole purpose of minimizing domestic sheep contact with bighorn sheep; these partnerships could include wildlife management agencies and private organizations. 21. Have sheepherders use a log book or other record keeping aids to record GPSlocations, counts, losses, and other information as needed or required.
Domestic goat husbandry
Because domestic goats are less gregarious than domestic sheep and have a greater tendency to stray or disperse, the work group recommends that domestic goats are not grazed in occupied bighorn sheep habitat.
When goats are grazed near bighorn sheep for weed control or other purposes, electric fencing can be used to keep the two species apart.
Pack goats used in bighorn sheep habitats should be tethered when not being trailed.
Strays and commingling responses 1. Develop a commingling detection and response protocol that includes the following: a. reporting bighorn sheep (including a count and GPSlocation) that are attempting to associate with domestic sheep bands; b. reporting stray or missing domestic sheep to the land management agency; c. immediate, two-way notification (between permittee and land management agency) of actual commingling sightings; d. a post turn-off stray domestic sheep removal protocol; e. a protocol for removing individual commingling bighorn sheep; f. where feasible, collect standardized diagnostic samples on stray domestic sheep and commingling bighorn sheep; g. instructions for domestic sheep herders to not leave sick domestic sheep behind when trailing or moving from or between allotments.
2. Develop and follow a plan for locating and reacquiring (dead or alive) stray sheep. Ifa domestic sheep is determined to be missing, the permittee will immediately initiate a comprehensive search and notify the land manager.
3. Allow/encourage the permittee or producer and appropriate agency representatives to remove any stray domestic sheep in areas where interspecies contact could occur.
4. Allow/encourage the permittee or producer and appropriate agency representatives to haze bighorn sheep that appear intent on commingling.
5. Allow/encourage the permittee or producer and/or appropriate agency representatives to remove commingling bighorn sheep.
6. Where not already established, develop or clarify legal authorities for removing stray domestic sheep from public lands by lethal means. 7. Encourage voluntary allotment monitoring by permittees or independent observers in conjunction with federal and state agencies; where used, independent observers should receive prior training from permittees or agency personnel. 8. Develop pilot incentive/recognition programs to foster and recognize compliance, cooperation, and cost-sharing in efforts to prevent commingling of bighorn sheep and domestic sheep on shared ranges.
Allotment boundary and habitat manipulations
1. Review domestic sheep allotment boundaries and/or use and reconfigure where appropriate and feasible to avoid or minimize overlap with critical bighorn sheep habitat. Where feasible, use strategies and techniques including: a. geographic/topographic barriers that enhance species separation; b. seasonal or spatial separation through domestic sheep grazing management.
2. Undertake habitat enhancements that improve bighorn sheep habitats (both summer and winter range) outside allotment boundaries and/or attract bighorn sheep away from domestic sheep allotments.
3. Undertake water developments to enhance bighorn sheep distribution or to move domestic livestock away from preferred bighorn sheep foraging areas by augmenting available natural water sources.
4. Where appropriate and feasible, determine the number of domestic sheep animal unit months (AUM5)that overlap bighorn sheep habitat and negotiate among cooperators (state, federal, industry, private) to locate potentially available replacement AUMsor allotments if necessary.
Other bighorn sheep management practices
1. Manage for bighorn sheep population densities and distribution that reduce potential for interspecies contact.
2. Use hunting and/or other means to discourage bighorn sheep from using domestic sheep allotments where alternative suitable habitats are available.
3. Use hunting and/or other means to discourage bighorn sheep from staying in proximity to or approaching domestic sheep bands.
4. Remove all sick or dead bighorn sheep encountered
Further research is needed to better understand and estimate the magnitude of potential risk to bighorn sheep arising from interactions with domestic sheep and other wild ruminant species, as well as the risks of endemic disease and potential influences of seasonal and environmental factors on these risks. The original USAHAresolution that led to this working group directed federal agencies to fund research on epidemiology and pathogenesis of bighorn/domestic sheep disease interactions.
Summary: It would be timely to reconvene another USAHAJoint Working Group with appropriate representation to re-evaluate the 2009 recommendations given scientific advancements in diagnostic technology and our understanding of potential transmission of diseases between domestic sheep/goats and BHSpopulations. References:
Committee on Wildlife Diseases and Committee on Sheep and Goats. Research and Management of Bighorn Sheep/Domestic Sheep Disease: USAHAResolutions 19 and 43 combined. USAHA;30th Annual Meeting, San Diego, CA.2009
E.Jane Kelly,KARood, RSkirpstunas. Abscesses in Captive ElkAssociated with Corynebacterium pseudotuberculosis, Utah, USA.Journal of Wildlife Diseases, 48(3), 2012, pp. 803—805
Joint Working Group on Wildlife Diseases and Sheep and Goats. Report: Recommendations on Best Management Practices for Domestic Sheep Grazing on Public Land Ranges Shared with Bighorn 130th Sheep. Proceedings of the USAHA Annual Meeting, San Diego CA.2009.
National Animal Health and Monitoring System (NAHMS):Goat Industry Study, USDAAPHIS Veterinary Services, 2009.
National Animal Health and Monitoring System fNAHMS):Sheep Industry Study, USDAAPHIS Veterinary Services, 2011.
NAHMSGoat and KidPredator and Non-predator Death Loss in the United States, USDAAPHIS, Veterinary Services, 2015