Rorα) Als Schlüsselfaktor in Der Osteoklastogenese Und in Der Pathogenese Der Rheumatoiden Arthritis Und Der

Home , Scleraxis

Der Nukleäre Rezeptor „Retinoic Acid Receptor related Orphan Receptor α“ (RORα) als Schlüsselfaktor in der Osteoklastogenese und in der Pathogenese der rheumatoiden Arthritis und der

Osteoporose

Der Naturwissenschaftlichen Fakultät

der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur

Erlangung des Doktorgrades Dr. rer. nat.

vorgelegt von Rosebeth Kagwiria aus Kenia

2017

Als Dissertation genehmigt von der

Naturwissenschaftlichen Fakultät der

Friedrich-Alexander Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 14.08.2017

Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Lars Nitschke Prof. Dr. Georg Schett

Evaluation of the nuclear receptor Retinoic Acid Receptor related Orphan Receptor α (RORα) as a regulator of osteoclastogenesis in rheumatoid arthritis and osteoporosis

The Faculty of Natural Sciences of the

Friedrich-Alexander-University Erlangen-Nuremberg

for the obtainment of the academic degree

doctor rerum naturalium (Dr. rer. nat.)

submitted by Rosebeth Kagwiria from Kenya 2017

Approved by the Faculty of Natural Sciences of the

Friedrich-Alexander University Erlangen-Nürnberg

Date of oral examination: 14.08.2017

Chairman of examination board: Prof. Dr. Georg Kreimer Referees: Prof. Dr. Lars Nitschke Prof. Dr. Georg Schett

SUMMARY ...... 9

Zusammenfassung ...... 11

1. INTRODUCTION ...... 13

1.1 Bone tissue ...... 13

1.1.1 Bone cells ...... 14

1.1.1.1 Osteoblasts ...... 15

1.1.1.2 Osteoclasts...... 16

1.1.2 Osteogenesis ...... 18

1.1.3 Bone remodeling ...... 19

1.1.4 Bone disease ...... 21

1.1.4.1 Rheumatoid arthritis ...... 22

1.1.4.2 Osteoporosis ...... 23

1.2 Activating protein 1 (AP-1) pathway ...... 24

1.2.1 AP-1 pathway in bone metabolism ...... 24

1.3 Nuclear receptor superfamily ...... 26

1.3.1 ROR superfamily ...... 27

1.3.1.1 ROR-alpha (RORα) ...... 30

2. AIMS OF THE STUDY ...... 32

3. MATERIALS AND METHODS ...... 33

3.1 MATERIALS ...... 33

3.1.1 Reagents and instruments ...... 33

3.1.2 Patients ...... 46

3.1.3 Mice ...... 46

3.2 METHODS ...... 50

3.2.1 Bone marrow isolation ...... 50

3.2.2 Mouse primary osteoclast culture and stimulation ...... 50

3.2.3 Adeno-associated viral over-expression in osteoclasts ...... 50

3.2.4 Plasmid isolation ...... 51

Mini Prep ...... 51

Maxi Prep ...... 51

3.2.5 siRNA Knock-down-assay ...... 52

3.2.6 In vitro bone resorption assay ...... 52

3.2.7 Bone marrow transplantation ...... 52

3.2.8 Quantitative real-time PCR ...... 53

3.2.9 Western Blot ...... 53

3.2.10 Immunofluorescence staining ...... 54

3.2.11 Co-Immunoprecipitation-Assay (Co-IP) ...... 54

3.2.12 Chromatin Immunoprecipitation-Assay (ChIP-assay) ...... 54

3.2.13 Reporter-assay ...... 55

3.2.14 Animal models ...... 56

3.2.15 Clinical assessment ...... 57

3.2.16 Microcomputed tomography analysis ...... 57

3.2.17 Immunofluorescent staining ...... 58

3.2.18 Histomorphometric analysis ...... 58

3.2.19 Statistical analysis ...... 60

4. RESULTS ...... 61

4.1 RORα is expressed in osteoclasts and induced during osteoclastogenesis ...... 61

4.2 Alterations in RORα expression affects osteoclastogenesis ...... 65

4.3 Ablation of RORα protects mice from arthritis and osteoporosis ...... 74

4.4 Molecular mechanisms through which RORα regulates osteoclastogenesis ...... 85

...... 88

5. DISCUSSION ...... 98

6. CONCLUSION ...... 103

7. APPENDICES ...... 104

7.1 Abbreviations ...... 104

7.2 List of Tables ...... 106

7.3 List of Figures ...... 107

8. REFERENCES ...... 108

9. ACKNOWLEDGEMENTS ...... 117

10.CURRICULUM VITAE ...... 118

Summary

SUMMARY

Background: ROR-alpha (RORα) is an orphan nuclear receptor implicated in various physiological processes including circadian rhythm, myogenesis and neurogenesis as well as in pathological processes like colon cancer and hepatic steatosis. Naturally occurring RORα mutant mice (staggerer mice) show an impaired inflammatory phenotype induced by altered development of innate lymphocytes and Th-17 cells. Besides, these mice also display an abnormal skeletal phenotype with long, thin bones.

Osteoclastogenesis is a process which is to date incompletely understood. It takes place in a series of steps which can be roughly classified in differentiation and maturation phases. In search for therapies against bone disorders like rheumatoid arthritis and osteoporosis is exploitation of osteoclastogenesis inevitable. Nuclear receptors are common targets for therapeutic intervention. Natural and synthetic inhibitors of RORα have been described. SR3335 is a RORα specific inhibitor, whereas SR1001 inhibits both RORα and ROR- gamma (RORγ).

Objectives: In this study, we aimed to elucidate the role of RORα in osteoclastogenesis and evaluate its contribution to the pathogenesis of rheumatoid arthritis and osteoporosis. Our main goal, however, was to assess the therapeutic effects of small molecule inhibitors of RORα in preclinical models of inflammatory bone loss and osteoporosis.

Methods: The expression of RORα in osteoclasts of human and mouse bone tissue was determined by TRAP-stained knee and ankle joints co-stained with RORα via immunofluorescence. The role of RORα in osteoclastogenesis was analysed by both RORα inhibition (genetically and using small molecules) and RORα overexpression with adenovirus as well as RORα overexpressing plasmids. Expression variations in osteoclast markers were quantified using real-time PCR and western blot. The effect of RORα inhibition on the phenotype of mouse models of arthritis and of osteoporosis (hTNFαtg mice, SIA mice, OVX mice) was determined by micro-computed tomography, TRAP-, trichrome- and haematoxylin staining. The molecular mechanisms underlying the function of RORα in osteoclastogenesis was elucidated using reporter-assays, Co- Immunoprecipitations, Chromatin immunoprecipitations and rescue experiments. An osteoclast-specific RORα knock-out was achieved with the Cre/LoxP system.

Summary

Transplantation of staggerer bone marrow cells into irradiated wildtype C57BL/6J mice was done to mimic a hematopoietic conditional RORα knock-out.

Result: TRAP and RORα co-staining showed a higher RORα expression in osteoclasts of arthritic bone tissue compared to healthy controls. While RORα inhibition resulted in reduced osteoclast counts and decreased expression levels of osteoclast markers like TRAP, OSCAR, NFATC1 and CATHEPSIN K, RORα overexpression showed the opposite effect. RORα is important for the early differentiating stages of osteoclastogenesis, but is dispensable in later stages. In vivo targeting of RORα using small molecules (SR3335 and SR1001) in different arthritis mouse models protected these mice from local and systemic bone loss. RORα inhibition decreased the expression of c-Jun, whereas RORα overexpression elevated c-Jun expression in osteoclasts. In addition, RORα enhanced c-Jun promoter activity. The attempt to rescue c-Jun-siRNA knock-down with an overexpression of RORα showed that RORα cannot compensate c-Jun deficiency, suggesting that the effects of RORα on osteoclastogenesis require c-Jun.

Conclusion: Here, we demonstrate that RORα is a novel and central regulator of osteoclastogenesis, and consequently a key player in the pathogenesis of rheumatoid arthritis and osteoporosis. Our data also provide evidence that RORα induces osteoclastogenesis through the AP-1 (c-Jun) pathway.

Zusammenfassung

Hintergrund: Der „orphan“ nuklear Rezeptor ROR-alpha (RORα) reguliert ein breites Spektrum physiologischer Prozesse, wie beispielsweise den zirkadianen Rhythmus oder die Myo- und Neurogenese, spielt aber auch in pathologischen Prozessen wie Darmkrebs oder hepatische Steatose eine Rolle. Eine natürliche Mutation von RORα in Mäusen („Staggerer“Mäuse, engl. für taumeln) führt neben neurodegenerativen Merkmalen auch zu einem geschwächten Phänotyp der Entzündungsreaktion, verursacht durch mangelhaft entwickelte, angeborene Lymphozyten-ähnliche Zellen und Th-17 Zellen. Des Weiteren zeigen diese Mäuse einen abnormalen Skelett-Phänotyp mit langen, dünnen Knochen.

Osteoklastogenese ist ein Prozess, der bis heute kaum verstanden ist. Er unterteilt sich in mehrere Schritte, welche grob in Differenzierung und Reifung unterteilt werden können. Auf der Suche nach Therapien bei Knochenerkrankungen ist ein Eingreifen in den Prozess der Osteoklastogenese unentbehrlich. Kernrezeptoren eignen sich besonders für therapeutische Interventionen. Natürliche und synthetische RORα Inhibitoren wurden bereits beschrieben. So ist beispielsweise SR3335 ein spezifischer Inhibitor für RORα, während SR1001 sowohl RORα als auch RORγ inhibiert.

Zielsetzung: Arthritis zählt zu den häufigsten Ursachen von körperlicher Beeinträchtigung des Bewegungsapparates weltweit. Daher ist es von grundlegender Bedeutung nach therapeutischen Wegen zu suchen, die Symptome und Beschwerden zu unterbinden oder gar rückgängig zu machen.

Ziel dieser Studie war es, die Rolle von RORα in der Osteoklastogenese zu bestimmen und ferner, diese Rolle in der Pathogenese der rheumatoiden Arthritis und der Osteoporose zu untersuchen. Darüber hinaus sollte der therapeutische Effekt niedermolekularer RORα Inhibitoren in Entzündungs-abhängigem Knochenabbau und Osteoporose unter Zuhilfenahme präklinischer Tiermodelle untersucht werden.

Methodik: Die Expression von RORα wurde in humanem und murinem Knochengewebe bestimmt. Durch TRAP-Färbung von Knie- und Sprunggelenken wurden Osteoklasten identifiziert, RORα wurde mittels Immunfluoreszenz detektiert. Um die Funktionen von RORα in der Osteoklastogenese zu analysieren, wurde RORα genetisch oder pharmakologisch inhibiert oder aber mithilfe von Adenoviren überexprimiert. Eine RORα-

Zusammenfassung abhängige Veränderung der Expression von Osteoklasten-charakteristischen Genen wurde mittels RT-PCR und Western blot bestimmt. RORα-abhängige Phänotypen von murinen Arthritis- und Osteoporose-Modellen (hTNFαtg, SIA, OVX) wurden mit Hilfe von Micro- CT Messungen sowie TRAP-, Trichom- und Hämatoxylin-Färbungen bestimmt. Der molekulare Mechanismus, durch den RORα die Osteoklastogenese steuert, wurde mithilfe von Reporter Versuchen, Ko-Immunpräzipitätion, Chromatin-Immunpräzipitation und Rettungs-Experimenten entschlüsselt.

Ergebnisse: Die gemeinsame Färbung mittels TRAP und von RORα im arthritischen und gesunden Knochengewebe zeigte, dass Osteoklasten in der Arthritis eine vergleichsweise höhere RORα Expression haben. Während die Hemmung von RORα zu einer Reduktion der Osteoklastenzahl sowie einer verminderten Expression von für Osteoklasten charakteristischen Genen (TRAP, OSCAR, NFATC1 und CATHEPSIN K) führte, verursachte eine Überexpression von RORα den gegenteiligen Effekt. Darüber hinaus zeigte eine zeitabhängige Hemmung von RORα, dass RORα besonders für die frühen Differenzierungsphasen wichtig ist.

Die in vivo Inhibition mittels niedermolekularen Inhibitoren (SR3335 und SR1001) in verschiedenen murinen Arthritis-Modellen zeigte einen schützenden Effekt gegenüber lokalem und systemischem Knochenabbau. Die Hemmung von RORα senkte die Expression von c-Jun, wohingegen die Überexpression von RORα diese steigerte. Des Weiteren zeigten c-Jun-Luziferase-Reporter Versuche, dass ROR-alpha die Promotor Aktivität von c-Jun erhöht. In einem Rettungsversuch konnte gezeigt werden, dass mittels siRNA herunterreguliertes c-Jun durch die Überexpression von RORα nicht kompensiert werden kann. Dies deutet darauf hin, dass RORα die Osteoklastogenese c-Jun-abhängig induziert.

Schlussfolgerung: Durch diese Studie konnte die bisher noch nicht bekannte Rolle von RORα als zentraler Regulator der Osteoklastogenese bestimmt werden. Daher übernimmt RORα die Schlüsselrolle in der Pathogenese rheumatoider Arthritis und Osteoporose. Es konnte erstmals gezeigt werden, dass RORα die Osteoklastogenese durch c-Jun induziert.

Introduction

1. INTRODUCTION

1.1 Bone tissue

Bone is a rigid and yet also dynamic tissue composed of organic and inorganic components [1, 2]. The inorganic part mainly consists of hydroxyapatite and is responsible for the compression resistance and hardness of the bone. The organic part on the other side is made of different bone cell types (osteoblasts, osteoclasts, osteocytes) and extracellular matrix and it is responsible for the flexibility and tensile strength of the bone [3]. Bone is a non- homogeneous, porous and anisotropic organ with two distinguishable tissue types: the trabecular and the cortical bone tissue [4-6].

The trabecular bone, also referred to as cancellous bone, is usually found in cuboidal bones, flat bones and at the ends of long bones [7]. The pores are interconnected and filled with bone marrow (a tissue composed of blood vessels, nerves and various types of cells), while the bone matrix has the form of plates and struts called trabeculae, with a thickness of about 200 µm [8].

The cortical or also referred to as compact bone tissue consists of different types of pores. Vascular porosity being the largest (50 µm diameter) is formed by the Haversian canals and Volkmann’s canals with capillaries and nerves. Other porosities are associated with lacunae with space between collagen and hydroxyapatite (very small, around 10 nm). Cortical bone consists of cylindrical structures known as osteons or Haversian systems (Fig.1), with a diameter of about 200 µm formed by cylindrical lamellae surrounding the Haversian canal. The boundary between the osteon and the surrounding bone is known as the cement line [6, 9, 10].

Bone does not only make up the skeletal system, it also serves as mineral reservoir regulating the calcium homeostasis of the body through sorting and releasing calcium and phosphate into circulation. The cavity of bone provides a natural residence for bone marrow and an environment for development of hematopoietic cells. Bone is therefore a multifunctional tissue with mechanical, hematopoietic, and metabolic functions resulting from a well-orchestrated interplay between different cell types [11].

Introduction

Figure 1: Structure of cortical bone. (a) 3D sketch of cortical bone (b) cut of a Haversian system, (c) photomicrograph of a Haversian system. Fridez P., 1996.

1.1.1 Bone cells

The maintenance of bone integrity and a defined microenvironment is monitored by two main processes: bone resorption and bone formation. These processes regulate skeletal growth during puberty, adaptation of bone to physical strain in adulthood and bone loss during aging. Bone resorption and formation take place simultaneously in bone tissue, as a result of a perfect coordinated interplay between osteoblasts (cells responsible for bone formation) and osteoclasts (cells that resorb bone).

Introduction

1.1.1.1 Osteoblasts

Osteoblasts are of mesenchymal origin and chief bone-making cells in the body. Osteoblasts express different transcription factors like Runx2, Dlx5, Osx or ATF4 [12]. Osteoblasts secret condensed type I collagen and several specialized proteins, including osteocalcin and osteopontin, to compose the organic bone extracellular matrix [13, 14]. Several pathways such as TGF-β/ bone morphogenetic proteins (BMPs), Wnt/ β-catenin and Indian Hedgehog (IHH) play an essential role triggering osteoblast differentiation [15-17]. Bone formation is keenly regulated by the steroid and protein hormones. A particularly important bone- targeted hormonal regulator is parathyroid hormone (PTH). Parathyroid hormone is a protein released from the parathyroid gland under the control of serum calcium levels. Osteoblasts can transform into thin and elongated cells called lining cells which line the surface of the bone and regulate calcium in- and outtake. Older osteoblasts become osteocytes and reside within calcified bone from where they communicate extensively with other bone cell populations through their widespread dendrite framework [18-20]. Osteoblasts are polarized cells with the side nearest to the bone having more cytoplasmic processes extending deep into the osteoid than the opposite side [21].

Figure 2: Osteoblastogenesis: Ihh initiates ostoblastogenesis. Runx2-expressing biopotential progenitors can differentiate into either osteoblast or chondrocyte. Then cells differentiate into preosteoblasts, which further differentiate into mature osteoblasts [22].

Introduction

1.1.1.2 Osteoclasts

Osteoclasts are giant multinucleated cells of hematopoietic origin, which are highly specialized in resorbing bone [23]. Mature osteoclasts are characterized by two features: the sealing zone and the ruffled boarder. The sealing zone binds the osteoclast to the extracellular bone matrix, particularly to osteopontin and bone sialoprotein, through αvβ3 integrins. The sealing zone tightens the osteoclasts towards the resorption compartment, generating a secondary lysosome with low pH and proteases [24]. The ruffled border is formed by the fusion of intracellular vesicles containing the enzymes and transmembrane proteins leading to bone resorption. Osteoclasts differentiate through a series of stages from hematopoietic monocytes through osteoclast precursors to mature, multinucleated, gigantic osteoclasts [25]. This process referred to as osteoclastogenesis is initiated and regulated via different cytokines as well as a close proximity to stromal and bone matrix.

RANKL and M-CSF are both indispensable for the osteoclastogenesis process [26].

M-CSF (CSF-1) is a four-alpha-helical-bundle cytokine that is the primary regulator of macrophage survival, proliferation, and differentiation. M-CSF transmits its signal to the cell through the sole receptor c-Fms, a member of the receptor tyrosine kinase superfamily. M-CSF is essential for the survival and proliferation of osteoclast progenitors and macrophages. It has been reported that op/op mice, which fail to express functional M-CSF as a result of the CSF1 gene mutation, display an osteopetrotic phenotype. M-CSF stimulates receptor activator of nuclear factor-κB (RANK) expression in monocyte- macrophage precursors, to which the receptor RANKL binds. Moreover, M-CSF also regulates the PU.1 gene, which encodes an ETS-domain transcription factor and activates gene expression during macrophage and osteoclast development. In addition, M-CSF also activates MITE, which in turn induces B-cell lymphoma 2 (BCL-2), a vital factor to maintain cell survival. The transgenic expression of BCL-2 rescues op/op mice from the osteopetrotic phenotype, indicating the critical role of M-CSF as a survival factor for osteoclast precursor cells.

Receptor activator of nuclear factor kappa-B ligand (RANKL) is a type II transmembrane protein, which belongs to the TNF superfamily and contains a C-terminal receptor-binding domain and a transmembrane domain. RANKL is released from the cell surface as a soluble molecule following proteolytic cleavage by matrix metalloproteinases such as MMP-14. RANKL is an osteoclast-differentiation factor expressed by osteoblasts, T-cells, 16

Introduction macrophages and synovial cells. RANK is a type I membrane protein sharing high homology with CD40. The binding of RANKL to RANK is inhibited by the decoy receptor osteoprotegerin (OPG). RANKL expression can be upregulated by osteoclastogenic factors, such as 1α, 25-dihydroxyvitamin D3, prostaglandin E2, parathyroid hormone, IL-1, IL-6, IL-11, IL-17, and TNF-α. In contrast, cytokines inhibiting osteoclastogenesis, such as IL- 13, IFN-γ, and TGF-β1 suppress RANKL expression and also induce OPG expression. OPG is a secreted TNF receptor superfamily member produced by stromal cells and B lymphocytes and acts as a decoy receptor molecule for RANKL. The RANK/RANKL/OPG axis is an important target for both physiological and pharmaceutical molecules aiming to regulate osteogenesis and bone remodeling.

Figure 3: Osteoclastogenesis: Myeloid progenitors differentiate in the presence of M-CSF to become osteoclast precursors that express RANK and TREM2 receptors. Upon RANK ligand (RANKL) stimulation and ITAM activation, osteoclast precursors further differentiate to mononuclear osteoclasts expressing Nfatc1 and other osteoclast-markers such as TRAP, Cathepsin K and αvβ3. Mononuclear osteoclasts then fuse to multinuclear osteoclasts and function as polarized bone resorbing cells [27]. Macrophage colony-stimulating factor = M-CSF, RANK = Receptor activator of NF-κB, TREM2 = Triggering receptor expressed by myeloid cells-2, ITAM = Immunoreceptor tyrosine-based activation motif, Nfatc1 = Nuclear factor of activated T cells, cytoplasmic 1.

Introduction

1.1.2 Osteogenesis

Osteogenesis occurs through two distinct pathways: the endochondral ossification and intramembranous ossification. Mesenchymal cells commit to either chondrogenic or osteogenic lineages [12].

Intramembranous ossification takes place in the development of flat bones like the skull, which is by definition the direct conversion of mesenchymal tissue into bone tissue. The osteoblasts derived from condensed mesenchymal cells play an important role in the process of bone maturation (osteoid) through secreting collagen-proteoglycan matrix. As calcification proceeds, the collagen-proteoglycan matrix binds to calcium salt and turns into calcified bone matrix. The trapped osteoblasts in the calcified matrix differentiate into osteocytes. Furthermore, compact mesenchymal cells cover the calcified spicules surface to form the periosteum (a membrane that surrounds the bone) for the next layer of calcified bone matrix [6, 28].

Intramembranous ossification involves bone morphogenetic proteins (BMP) and the activation of a transcription factor called Core-binding factor alpha 1, CBFA1, which is encoded by the RUNX2 gene. Endochondral ossification in the long bones involves maturation of bone matrix, which initiates the process on cartilage tissue formation from aggregated mesenchymal cells and the subsequent replacement by bone tissue. The process of endochondral ossification can be divided into five stages. First, mesenchymal cells are committed to cartilage cells with expression of N-cadherin and SOX9. During the second phase, two transcription factors, Pax1 and Scleraxis, are secreted from paracrine factor stimulated mesodermal cells, which are thought to activate cartilage-specific expression genes such as SOX9 and PGC1α [28]. In the third stage, chondrocytes proliferate rapidly to form a framework for the bone and secrete a cartilage-specific extracellular matrix such as type II collagen. After that, chondrocytes stop proliferating and gain cell volume, thus becoming so-called hypertrophic chondrocytes. The hypertrophic chondrocytes modulate the composition of the extracellular matrix by secreting type X collagen instead of collagen II and thus foster calcification of the bone tissue. At the last stage, blood vessels invade into the cartilage. The chondrocytes surrounding the cartilage model differentiate into osteoblasts, which start secreting bone matrix. The hypertrophic chondrocytes undergo apoptosis and their site is filled with bone marrow [29].

Introduction

Eventually, endochondral ossification can spread outward from the center in both directions to stimulate the mineralization of newly formed bone [30] (Fig. 4).

Figure 4: Schematic diagram of endochondral ossification. (A, B) Mesenchymal cells condense and chondrocytes differentiate. (C) Chondrocytes undergo hypertrophy and apoptosis while they mineralize extracellular matrix and this allows angiogenesis. (D, E) Increased osteoblastogenesis reduces the chondrocyte matrix. (F-H) Bone formation and growth consist of ordered arrays of proliferating, hypertrophic, and mineralizing chondrocytes. Adapted from Horton W A. 1990. The biology of bone growth. Growth Genet.

1.1.3 Bone remodeling

Bone remodeling is a tightly controlled process where mature bone tissue is degraded by osteoclasts and replaced by new bone matrix secreted by osteoblasts. This process takes place continuously through a life span. The dynamic interplay between osteoclasts and osteoblasts is called a basic multicellular unit (BMU) [11]. The BMUs in cortical and trabecular bone differ greatly in their structures and functions. In trabecular bone the BMU is located on the surface and gets covered by a roofing of mesenchymal cells. Osteoclasts resorb part of the bone surface and the resorbed surface is then cleaned up by lining cells and probably macrophages. The BMU in the cortex on the other hand comprises a cutting zone led by osteoclasts that proceed through bone followed by differentiating osteoblasts [11, 31].

Introduction

The remodeling cycle consists of three consecutive phases: resorption, reversal and formation. Resorption is initiated by migration of committed mononuclear osteoclast precursor cells to the bone surface followed immediately by formation of multinucleated osteoclasts. Subsequent to resorption is the reversal phase which is initiated via mononuclear cells which cover the bone surface and secret factors that recruit osteoblasts and trigger their differentiation. In the formation phase, osteoblasts secret bone matrix to fill the areas of resorption until they are completely replaced by new bone [11, 32].

The vibrant and dynamic process of bone remodeling is tightly regulated, both systematically and locally. Hormones play the central role in the systematic regulation of bone remodeling. Parathyroid hormone regulates serum calcium concentrations by elevating degradation of bone matrix. Besides, growth hormones (GH) are known to play an important role in endochondral bone formation and steroids are involved in bone remodeling. Estrogens moreover, decrease the responsiveness of the osteoclast precursor cells to receptor activator of NF-kappa B ligand (RANKL), thereby preventing osteoclast formation.

The OPG/RANKL/RANK pathway plays a key role in the local regulation of bone remodeling. RANKL is expressed on the surface of pre-osteoblasts and stromal cells and binds to RANK receptor on the osteoclast precursor cells. This interaction is necessary to induce osteoclast differentiation. Osteoprotegerin (OPG) is also secreted by osteoblasts and it unfolds its antagonistic effect by binding and blocking RANKL. Furthermore, macrophage colony-stimulating factor (M-CSF) controls the pool of osteoclast precursors by binding to c-Fms on these cells [2, 33-35].

Inflammatory cytokines like TNF-alpha, TGF-β and IL-1 have also been identified as regulators of bone remodeling. These cytokines trigger the expression of M-CSF and RANKL [26, 36].

Bone remodeling is closely regulated by maintaining a balance between bone formation and bone resorption. Alterations of the dynamic balance can lead to a variety of different bone diseases with osteoporosis and rheumatoid arthritis as prominent examples.

Introduction

Figure 5: Trabecular Vs Cortical bone remodeling. Remodeling is initiated under the lining cells of trabecular bone (upper panels) and within cortical bone Haversian canals (lower panels). Sims NA et al; 2014

1.1.4 Bone disease

Bone and cartilage diseases are conditions that result in the impairment of normal bone function and display certain parameters including cartilage degeneration, reduction in bone density, bone destruction and osteophyte formation (bone spur). From the clinical osteoimmunological point of view, these diseases can briefly be classified in two groups: inflammation- and non-inflammation-induced skeletal disorders.

Introduction

1.1.4.1 Rheumatoid arthritis

Rheumatoid arthritis (RA) is a chronic autoimmune disease that is clinically manifested by persistent inflammation, articular cartilage and underlying bone destruction as well as increased morning stiffness [37]. The etiology of RA remains unknown; however, several risk factors have been described.

Genetic features contribute to up to 50% of the risk for RA [38]. More than 30 single nucleotide polymorphisms (SNPs) have been associated with RA [39-41]. Genetic studies have shown differences in ACPA status of patients with rheumatoid arthritis in relation to the number of specific HLA-DRB1 alleles [42]. These HLA alleles share a common motive, the shared epitope. Antigens are shown to be modified by citrullination, which consequently leads to post-translational modification of the amino acid arginine to citrulline. This modification allows antigens to adequately fit in the HLA alleles that host the shared epitope. This results in breakage of tolerance, allowing antibody production against these antigens [37, 43]. The presence of these autoantibodies is considered an additional risk factor for RA. Autoantibodies against citrullinated proteins (ACPA) as well as against the immunoglobulin Fc fragment (rheumatoid factor) are the key hallmarks for RA. Most patients positive for APCA are also positive for rheumatoid factor [37, 44].

Inflammation is a key factor in RA. Inflammatory cytokines such as tumor necrosis factor α (TNFα), interleukin-6 and interleukin-17, which are secreted by T and B lymphocytes, synovial-like fibroblasts and macrophages, are increased in RA. Indeed, inhibition of TNFα and IL6 signaling is already successfully used in the clinics. Moreover, human TNFα transgenic mice (hTNFα) display an increased number of osteoclasts and destructive joints closely resemble RA [35, 45].

Introduction

1.1.4.2 Osteoporosis

Osteoporosis is a progressive bone disease that is characterized by a decrease in bone mass and density, which can lead to a high risk of fracture. Osteoporosis is considered as a major socioeconomic burden and accounts for up to 8.9 million fractures annually worldwide. Among these, hip fractures are responsible for the most serious consequences of osteoporosis. Osteoporotic fractures are not only a major cause of age-related morbidity, but also of increased mortality with hip fractures being associated with 20 - 24% mortality within the first year.

Age is one of the most important factors for osteoporosis. Estrogen deficiency in women after menopause and a decrease of testosterone level in men are correlated with a rapid reduction in bone mineral density. The second type of osteoporosis results from chronic predisposing medical problems or prolonged use of medications such as steroid- or glucocorticoid-induced osteoporosis. Besides, low calcium diets, smoking and a low exercise increase the risk to osteoporosis. The underlying mechanism in osteoporosis is an imbalance between bone resorption and bone formation.

Introduction

1.2 Activating protein 1 (AP-1) pathway

AP-1 proteins are basic leucine zipper proteins which function as dimeric transcription factors. They dimerize through a leucine zipper motif to form homo- and heterodimers. Members of the AP-1 family are JUN- (c-JUN, JUNB, JUND), FOS- (cFOS, FOSB, FRA- 1, FRA-2), MAF- (c-Maf, MafB, MafA, MafG/F/K, Nrl) as well as ATF- (ATF2, LRF1/ATF3, B-ATF, JDP1, JDP2) families. The protein combinations of the dimers determine the transcription genes to be regulated [46, 47].

AP-1 members have been shown to regulate different cellular processes from embryonic development to adulthood. They are involved in the regulation of cellular proliferation, differentiation, transformation and apoptosis [47-49]. These proteins were thought to be all prototypic oncogenes, but recent studies have shown that some members of the AP-1 family like cFOS and JUNB act as tumor suppressors [47].

AP-1 activity is induced by several factors including growth factors, cytokines, neurotransmitters, polypeptide hormones, cell–matrix interactions, bacterial and viral infections, and physical or chemical stress [49].

1.2.1 AP-1 pathway in bone metabolism

The role of many AP-1 proteins in bone metabolism still remains obscure. However, the functions of JUN and FOS subfamilies in bone have been well studied and documented.

FOS family members can only dimerize with other FOS members to form transcriptionally active complexes [48]. The pattern of FOS expression during mouse development suggested a critical role in endochondral ossification. Indeed, when FOS was expressed in various cell types of transgenic mice, specific effects on the skeleton were observed [50]. Wang et al showed that chimeric mice obtained from FOS-overexpressing embryonic stem cells develop chondrogenic tumors, suggesting an important function of FOS in chondrogenesis [51]. Astonishing results from overexpressing FOS studies showed that FOS is a negative regulator of chondrocyte differentiation [52]. Additionally, FOS has been described as a specific differentiation transcription factor in osteoclasts while FRA-1 has been reported to play a dominant role in osteoblasts. FRA-1 transgenic mice display an osteosclerosis bone phenotype with increased bone formation. The increase in bone mass could be traced back

Introduction to elevated osteoblast numbers and function [53, 54]. Studies on FRA-2 revealed that FRA- 2 is critical for the maintenance of bone homeostasis. Bozec et al showed that osteoblast- specific depletion of FRA-2 causes a decrease in bone mineral density despite an increase in body weight [55]. FRA-2 transgenic mice on the other hand displayed signs of pulmonary fibrosis due to increased extracellular matrix deposition and vasculopathy. Furthermore, these mice are ostosclerotic in consequence to enhanced osteoblast differentiation. In vitro data showed increased osteoclast activity in FRA-2 transgenic cells compared to wildtype controls [56].

JUN family members can, unlike the FOS members, dimerize with other AP-1 members and other transcription factors like CREB to form either homodimers or heterodimers, respectively. JUN members have been implicated in the formation of different bone cells including chondrocytes, osteoblasts and osteoclasts [55-58]. c-Jun is one of the most well studied and documented members of the JUN family. The c- Jun signaling pathway has been implicated in major physiological and pathological metabolisms including embryogenesis, inflammation and cancer, among others [59-61]. c- Jun is involved in the downstream signaling of RANKL and TNF-alpha in the bone metabolism [62]. High expression levels of inflammatory cytokines, e.g IL-1 and TNF- alpha, in diseases like rheumatoid arthritis lead to elevated c-Jun expression [49, 63].

Introduction

1.3 Nuclear receptor superfamily

Differential gene expression regulation has become a central subject of study in today’s biomolecular research. Lipophilic molecules are capable of building a direct bridge between stimulant and gene expression by penetrating the cell and the nuclear membrane and their ability to directly bind a specific DNA gene sequence. This unique characteristic makes them ideal candidates to serve as regulators of various processes. These molecules include hormone receptors like steroids, retinoic acid receptors, thyroid hormone receptors, and vitamin D receptors [64, 65]

This is a rapidly growing class of transcription factors which are ligand dependent and are involved in various physiological and pathological processes [66-68]. Nuclear receptors can directly control gene expression in response to environmental, developmental and physiological stimuli [69]. They share a modular structure consisting of a variable amino- terminal domain, a DNA-binding domain (DBD) also known as the hormone response element, hinge and a ligand-binding domain (LBD) [70, 71]. Nuclear receptors can bind to short DNA fragments (hormone response elements) as monomers, homodimers or heterodimers [65, 68].

Nuclear receptors bind to specific DNA binding domains inducing conformational changes, hence activating a series of downstream cascades. Such cascades involve dissociation from heat shock proteins and translocation into the nucleus or recruitment of transcription factors and co-regulatory proteins to promoter gene complexes. These events could either be activating or inhibitory [66, 72, 73].

In the last decades, a huge number of nuclear receptors have been described to which no ligands had been assigned. These receptors were termed as “orphans” due to their lack of any known natural ligand. To number among them are RORs and Rev-Erbs.

Introduction

1.3.1 ROR superfamily

Retinoic acid-related orphan receptor (ROR) is a subgroup of the orphan nuclear receptor superfamily and consists of 3 members: RORα, RORβ and RORγ (NR1F1, NR1F2 and NR1F3 respectively). RORs show sequence similarities to the Retinoid receptors [68, 74, 75]. They share a modular structure similar to nuclear receptors composed of an amino- terminal domain, a DNA-binding domain (DBD), hinge and a ligand-binding domain (LBD). The DNA binding domain is highly conserved among the RORs whereas the ligand- binding domain is only partly conserved [71]. The three members are distinguished through a distinct amino-terminus generated by alternative RNA splicing and differential promoter usage [68].

RORs regulate transcription through binding as monomers to the ROR-response elements (RORE) composed of a single half-site core motif PuGGTCA preceded by a 6-bp AT-rich sequence [68, 70, 71].

Even though RORs were initially named `orphan` because no ligands had been identified yet, intensive research in the last years however, has positively identified a few natural and synthetic ROR-ligands (table 1).

As a result of alternative promoter usage and exon splicing, ROR genes generate different isoforms. ROR-alpha produces four isoforms (RORα1-4) whereas RORβ and RORγ generate only two isoforms each (RORβ1, RORβ2 and RORγ1, RORγ2 respectively) [76]. Most isoforms from the three ROR subtypes display significant sequence similarity and conservation between species. The RORs show distinct patterns of tissue expression and are involved in the regulation of various physiological processes, some of which could be overlapping. REV-Erbs are ligand-dependent transcriptional repressors, which in many cases functionally antagonize the action of the RORs [67, 72].

Introduction

Figure 6: Structural organization of ROR functional domains. (A) Schematic diagram of the domain structure of RORs. Similar to other nuclear receptors, RORs display conserved modular domain structure with an N-terminal ligand-independent activation function 1 (AF-1) domain, a DNA binding domain (DBD), a hinge domain, and a ligand-binding domain with an activation function 2 (AF-2) domain. (B) Sequence alignment of the ligand binding domain of RORα, RORβ, and RORγ performed using ClustalW. Cartoon presentation of the general architecture of RORs is shown under the corresponding sequences. Identical residues are labeled with an asterisk. Partially conserved residues are labeled with a colon. The residue numbering for RORα, RORβ, and RORγ are E305-G556, E222-K470, and E269-K518, respectively. Residues around the ligand are shown as red letters. Residues important for ligand binding were labeled on top of the sequences. Adapted from [77].

Introduction

Table 1: RORα natural and synthetic ligands (Solt LA et al; 2012).

Introduction

1.3.1.1 ROR-alpha (RORα)

RORα was the first of the three members of the ROR-superfamily to be identified in 1994 by Giguère and colleagues based on its similarities to retinoic acid receptor (RAR) and the retinoid X receptor (RXR) receptors [77, 78]. The human RORA gene has been mapped in the 15q21-q22 locus while the mouse Rora gene has been mapped at chromosome 9 [79].

RORα occurs in four splicing isoforms: RORα1–4. They show variations at the N-terminal domains causing different DNA binding site preferences, and diverse as well as distinct expression profiles. In the thalamus for example there is only RORα1 mRNA expressed, RORα4 transcripts are predominant in leukocytes and skin, RORα2 and RORα3 transcripts are solely detected in testis. RORα1 and RORα4 transcripts are detected in an overlapping manner in various other organs [80].

RORα is widely expressed in various tissues including the spleen, skeletal muscle, testis, kidney, adipocytes, thymus, liver, lens, retina, and the Purkinje cells of the cerebellum [68, 72, 81]. Based on this fact, RORα is therefore involved in many different physiological and pathological processes. Studies of these processes are mainly carried out with the help of the naturally occurring RORα mutant mouse, the staggerer mouse (sg/sg) [82, 83].

RORα has been reported to be involved in the development of Purkinje cells especially in the cerebellum [84-86]. The staggerer mice display a severe neural phenotype with immature Purkinje cell-morphology and cerebellar ataxia, meaning that RORα is important for normal differentiation of Purkinje cells [87-89]. Besides, RORα plays a central role in the maintenance of the circadian rhythm where it directly regulates the expression of brain and muscle Arnt-like protein 1 (BMAL1), cryptochrome 1 (Cry1) and circadian locomotor output cycles kaput (CLOCK) [90-92].

Additionally, RORα plays a key role in the regulation of inflammation. Timotheus et al showed that RORα is required for development of innate lymphoid cells and to an extent regulate the development of allergic inflammatory reactions. RORα inhibition using the small molecule SR1001 abolished the development of Th17 cells and mice lacking RORα were resistant against auto-immune diseases [93-95].

Introduction

Furthermore, RORα has been reported to regulate key genes of lipogenesis and fatty acid oxidation. The staggerer mice display an increased susceptibility to hypoalphalipoproteinemia, which is the leading risk factor for coronary artery disease and atherosclerosis. RORα was shown to positively regulate the expression of apolipoprotein AI and apolipoprotein CIII genes and hence hold an important role in triglyceride metabolism. Cholesterol and cholesterol-derivatives have been intensively discussed as potential natural ligands to RORα.

Staggerer mice exhibit prodigious reduction of susceptibility to both diet- and age-induced obesity and insulin resistance. Single nucleotide polymorphisms in RORα have been linked to elevated risk for diabetes. These findings show that RORα also takes a key position in the regulation of glucose metabolism [83, 96].

Moreover, reports have shown the importance of RORα in bone metabolism. Benderdour et al described RORα as a modulator of the metabolic activity of osteoblasts. RORα was shown to stimulate osteoblast marker expression [97].

Aims of the study

2. AIMS OF THE STUDY

Bone disorders including rheumatoid arthritis and osteoporosis contribute to a large extent to the ever growing economic burden and a poor health and living standard of the elderly population. Arthritis and rheumatism are reported to be the leading causes of disability. Individuals over 50 years of age carry a higher risk of developing bone disorders. These patients not only suffer limitations in performing simple daily chaos but also suffer limited work efficacy. In the last decades, the peak of the age population curve has shifted from the ages 20-40 years to the ages 40-60 years. This means that the largest working class group is at risk of bone diseases. This shift has led to a drastic escalation in the global economic costs. The society suffers elevated cost for both pharmacological management of disease symptoms as well as the improvement of the patient’s living standards.

It goes without saying that there is an urgent necessity for improvement in the prevention, treatment and maintenance of these bone diseases.

There are many factors involved in the pathogenesis and progression of bone disorders. Progressive bone destruction is a hallmark of the pathogenesis of arthritis and one of the key factors leading to feeble and weak bones. Osteoclasts are the chief cells involved in bone resorption. Osteoclastogenesis, which is the differentiating process of osteoclasts from their hematopoietic precursors, is to date, not well understood.

In this study, we aim to achieve a closer insight in understanding the molecular mechanisms underlying osteoclastogenesis as well as those involved in the pathogenesis of rheumatoid arthritis and osteoporosis. Furthermore, we strive to analyze the role of Retinoic acid related orphan receptor (RORα) in osteoclastogenesis. Our main goal, moreover, is to study the effect of RORα inhibitors (SR3335 and SR1001) on clinical outcome of both inflammatory as well as non-inflammatory bone disorders in murine models.

Materials and methods

3. MATERIALS AND METHODS

3.1 MATERIALS

3.1.1 Reagents and instruments

Chemicals

Chemical Source

2-Propanol Roth, Germany

3,3’-Diaminobenzidine-tetrahydrochloride dihydrate Sigma Aldrich, USA (DAB)

30% Polyacrylamide Sigma, Germany

4-(2-hydroxyethyl)-1-piperazineethanesulfonic Life technologies, Germany acid (HEPES)

4',6-diamidino-2-phenylindole (DAPI) Santa Cruz, Germany

4-(Dimethylamino)benzaldehyde Fluka, Germany

Acetic acid Merck, Germany

Acetone AppliChem, Germany

Acid chloride Merck, Germany

Amido black 10B Serva, Germany

Ammonium peroxide sulfate (APS) Sigma, Germany

Ascorbic acid Sigma, Germany

BCIP®/NBT tablets Sigma, Germany

Bovine serum albumin (BSA) Roth, Germany

Materials and methods

Citric acid monohydrate Roth, Germany

Collagenase Sigma, Germany

Dispase Sigma, Germany

Deoxyribonucleosidetriphosphates Roche Diagnostics, Germany

(dNTPs)

Dimethyl sulfoxide (DMSO) Roth, Germany di-Sodium hydrogen phosphate dehydrate Merck, Germany

DMEM/F12 (1:1) Gibco® Life technologies, Germany

Ethanol Roth, Germany

Eosin Roth, Germany

Ethylenediaminetetraacetic acid (EDTA) Roth, Germany

Fetal bovine serum (FBS, FCS) Gibco® Life technologies, Germany

Gibco® Phosphate buffered saline (PBS) Life technologies, Germany

Glacial acetic acid EMPROVE®bio, Merck, Germany

Haematoxylin Merck, Germany

Hydrogen peroxide 30 % Roth, Germany

HEPES Sigma, Germany

Horse serum Life technologies, Germany

Histofix 4% Roti® (PFA) Roth, Germany

Histokitt Roti® Roth, Germany

Hydrochloric acid Roth, Germany

Materials and methods

L-glutamine Life technologies, Germany

Magnesium chloride Applied Biosystems, Germany

Magnesium chloride 25mM Applied Biosystems, Germany

Methoxymethylacetate Merck, Darmstadt, Germany

Methanol Roth, Germany

Methoxyethanol Sigma, Germany

Milk powder, blotting grade Roth, Germany

Methylmetacrylate Technovit, Wehrheim, Germany

Microscopy aquatex Merck, Germany

N’,N’,N’,N’-Tetraethylmethylenediamine (TEMED) Sigma, Germany polyethylenglycol 300 (PEG 300) Roth, Germany

1-methyl-2 pyrolidone Sigma, Germany

Penicillin Life technologies, Germany

Potassium chloride Merck, Germany

Potassium sulfate dodecahydrate Roth, Germany

Random Hexamers Applied Biosystems, Germany

Sodium acetate Roth, Germany

Sodium chloride Roth, Germany

Sodium chloride 0.9 % Uniklinikum Erlangen, Germany

Sodium citrate dihydrate Roth, Germany

Sodium dihydrogen phosphate dihydrate Merck, Germany

Sodium dodecyl sulfate (SDS) Sigma, Germany

Materials and methods

Streptomycin Life technologies, Germany

Tris-(hydroxymethyl)-aminomethane (Tris) Roth, Germany

Tri-Sodium citrate dihydrate Merck, Germany

Triton X-100 Sigma, Germany

Trypan blue solution 0.4% Sigma, Germany

Trypsin/EDTA Gibco® Life technologies, Germany

Tween 20 Roth, Germany

Weigert’s Iron-Hematoxylin-Set Sigma, Germany

Xylene Roth, Germany

β-Mercaptoethanol Sigma, Germany

Table 2:Chemicals

Auxiliary materials

Material Source

6-well plate Nalge Nunc International, Denmark

70 µm nylon meshes BD Biosciences, Germany

96-well filter plate Millipore GmbH, Germany

96-well plate Nalge Nunc International, Denmark

Amersham Hyperfilm ECL Amersham Biosciences, UK

Dentine discs (bone resorption) Immunodiagnostic Systems Ltd, Germany

Cell strainer 70 μm Nylon BD falcon, Germany

Materials and methods

Cellstar® polystyrene conical tubes BD falcon, Germany

(15 ml, 50 ml)

Cellstar® serological pipette (2 ml, 5 ml, Greiner, Germany

10 ml, 25 ml)

Cellstar® tissue culture flask (T25, T75, T175) Greiner, Germany

Chamber slides, 8 well Nalge Nunc International, Denmark

Cover glass 24x500 mm Menzel-Gläser, Germany

Cryo tube vials Nalge Nunc International, Denmark

Dako Faramount Aqueous Mounting medium Dako, USA

Dako Faramount Fluorescent mounting Dako, USA

Medium

Developer and fixer for X-ray films Tetenal Photowerk, Germany

Dipsosable Sterile filter (0.22 μm pore size) Schleicher & Schüll, Germany

Discardit™II syringe BD falcon, Germany

Dual Gel Caster (SE 245) Hoefer, USA

Eppendorf reaction tubes Eppendorf AG, Germany

(0.2 ml, 1.5 ml, 2 ml)

Eppendorf research pipettes Eppendorf AG, Germany

(2.5 μl, 10 μl, 100 μl, 1000 μl)

Eppendorf tips Eppendorf AG, Germany

Feather disposable scalpel (No11, No21) pfm medical AG, Germany

Filter CA-membrane 0.45 μm; 0.20 μm BD falcon, Germany

Materials and methods

Freeze box for cryo vials Nalge Nunc International, Denmark

Gel blotting paper Schleicher & Schüll, Germany

Inject®-F, single use syringe B.Braun Melsungen AG, Germany

Microlance™ 3 needle BD falcon, Germany

(0.4 mmx19 mm, 0.9 mmx40 mm)

Neubauer counting chamber Paul Marienfeld GmbH & Co KG, Germany

Optical 8 cap strip, MicroAmp® Applied Biosystems, Germany

Optical 96-well reaction plate, Micro-Amp® Applied Biosystems, Germany

PCR reaction tubes, single cap Biozym Scientific GmbH, Germany

Petri dish Greiner bio-one GmbH, Germany

pH indicator paper Carl Roth, Germany

PVDF membrane Hybond™-P Amersham Biosciences, UK

RNase Zap Applied Biosystems, Germany

Safe Seal-Tips professional Biozym, Germany

Steritop®and Stericup® Millipore GmbH, Germany

X-Ray cassettes Amersham Biosciences, UK

Table 3| Auxiliary materials

Materials and methods

Instruments

Instrument Source

Mx3005P Sequence Detection System Agilent Technologies, USA

Biofuge fresco Heraeus, Germany

Biological safety cabinet Class II ESCO, UK

Camera DXC-390P Sony, Germany

Centrifuge 5417R Eppendorf , Germany

Centrifuge function line Heraeus, Germany

Digital block heater HX-2 Peqlab, Germany

Eppendorf centrifuge 5417R Eppendorf, Germany

Heraeus Megafuge 1G Thermo Scientific, Germany

Hettich Rotixal P Andreas Hettich GmbH & Co KG, Germany

ImageJ V. 142q software National Institutes of Health, USA

Incubator Heraeus, Germany

Total body irradiation with Cs 137 Buchler GmbH, Germany

Microscope Axiovert 25 Zeiss, Germany

Microscope Eclipse 80i Nikon, Germany

Microscope Primo Vert Zeiss, Germany

MP-3AP power supply Talron Biotech. L.T.D., Israel

pH-Meter pH340 WTW, Germany

Pipetboy Integra Biosciences, USA

Materials and methods

Serva Blue Power Serva, Germany

SpectraMax 190 GMI, inc, USA

Thermocycler T personal Biometra GmbH, Germany

TKA Micropure water purification system Thermo Scientific, Germany

Table 4| Instruments

Commercially available systems (kits)

System Source Application

Avidin/Biotin Blocking Kit Linaris GmbH, Germany IHC

ECL Plus™ Qiagen GmbH, Germany WB

MESA FAST Real-time PCR Eurogentec Deutschland RT-PCR MasterMix Plus for SYBR® No GmbH, Germany ROX

Acid Phosphatase, Leukocyte Sigma, Germany Osteoclast staining (TRAP) Kit

NucleoSpin® RNA II Macherey-Nagel GmbH & RNA isolation

Co. KG, Germany

Table 5| Commercially available systems (kits)

Materials and methods

Antibodies

Antibody Source Dilution/ Application

Alexa Fluor 488 goat anti-mouse IgG Invitrogen™, Germany 1:200/ IF

Alexa Fluor 594 goat anti-rabbit IgG Invitrogen™, Germany 1:200/ IF

Polyclonal rabbit anti-ROR-alpha Santa Cruz 1:50/IF

Monoclonal mouse anti-β actin Sigma, Germany 1:10000/ WB

Polyclonal rabbit anti-ROR-alpha Thermoscientific 1:5000/ WB

Polyclonal rabbit anti-ROR-alpha Abcam 1:50/Co-IP,ChIP

Polyclonal mouse anti-c-Jun Santa-cruz 1:200/ WB

Polyclonal rabbit anti-fra-2 Santa-cruz 1:200/ WB

Polyclonal rabbit anti-cFos Santa-cruz 1:200/ WB

Polyclonal goat anti-pNfatc1 Santa-cruz 1:200/ WB

Polyclonal goat anti-Nfatc1 Santa Cruz, Germany 1:200/ WB

Polyclonal rabbit anti-Cathepsin k Abcam, Germany 1:200/ WB

Monoclonal mouse anti-p300 Thermoscientific 1:500/WB

Monoclonal rabbit anti-Sp1 Thermoscientific 1:1000/WB

Table 6| Antibodies used for Immunoprecipitation, immunofluorescence and western blot. ChIP = Chromatin immunoprecipitation; Co-IP = Immunoprecipitation IF= immunofluorescence; WB = Western Blot; AF = Alexa Fluor

Materials and methods

Cytokines and inhibitors

Cytokines Source Application

M-CSF R and D systems, Osteoclast formation Germany

RANKL R and D systems, Osteoclast formation Germany

Inhibitors Source Application

SR3335 Prof. Thomas Burris ROR-alpha inhibition

SR1001 Prof. Thomas Burris ROR-alpha inhibition

Table 7| Cytokines and inhibitors

Primers and siRNAs

Primer Sequence

human β-ACTIN forward 5’–AGAAAATCTGGCACCACACC–3’

human β-ACTIN reverse 5’–TAGCACAGCCTGGATAGCAA–3’

murine β-actin forward 5’–TCTTTGATGTCACGCACGAT-3’

murine β-actin reverse 5’–ACAGCTTCACCACCACA–3’

human CATHEPSIN K forward 5’-TAGTTTTTACTGCCAGACCG-3’

human CATHEPSIN K reverse 5’-TTGCTGTTATACTGCTTCTG-3’

human NFATC1 forward 5’-GAGGCTCCGAACTCGCC-3’

human NFATC1 reverse 5’-CCTGCTGCTGGGATCTGG-3’

human OSCAR forward 5’-TGGCTTAGGGTGGTATGAAGC-3’

Materials and methods human OSCAR reverse 5’-ACACAGACATCACTCCGTCTG-3’ murine Cathepsin k forward 5’-GGAAGAAGACTCACCAGAAGC-3’ murine Cathepsin k reverse 5’-GTCATATAGCCGCCTCCACAG-3’ murine Trap forward 5’-CGACCATTGTTAGCCACATACG-3’ murine Trap reverse 5’-TCGTCCTGAAGATACTGCAGGTT-3’ murine Nfatc1 forward 5’-CAACAAGCGCAAGTACAGTCTC-3’ murine Nfatc1 reverse 5’-CAGGTATCTTCGGTCACACTGA-3’ murine Oscar forward 5’-TCGCTGATACTCCAGCTGTC-3’ murine Oscar reverse 5’-TCGCTGATACTCCAGCTGTC-3’ murine Ror-alpha forward 5’-TCGCTGATACTCCAGCTGTC-3’ murine Ror-alpha reverse 5’-TCGCTGATACTCCAGCTGTC-3’ murine Jun forward 5’-CGCCTGATCATCCAGTCC-3’ murine c-Jun reverse 5’-GGGGTCGGTGTAGTGGTG-3’ murine Junb forward 5’-CACAGGCGCATCTCTGAA-3’ murine Junb reverse 5’-CGATCAAGCGCTCCAGTT -3’ murine cFos forward 5’-TCCTGTCAACACACAGGACTTT -3’ murine cFos reverse 5’-TGGCACTAGAGACGGACAGAT -3’ murine Jund forward 5’- ACTACCCCGACCAGTACGC-3’ murine Jund reverse 5’-TCGCTAGCTGCCACCTTC -3’ murine fra-2 forward 5’-GACCTGCAGTGGATGGTACA-3’ murine fra-2 reverse 5’-GGATTGGACATGGAGGTGAT-3’ murine p300 forward 5’-AGCTGTGAGTTCCCGAGAATTCGC-3’

Materials and methods murine p300 reverse 5’-CTGATCCCACGAGCACGTCCG-3’ murine Sp1 forward 5’-TCCGAGTCAGTCAGGGGGCAC-3’ murine Sp1 reverse 5’-GTTGTGCGGCTGTGAGGTCCAGT-3’ murine Cry forward 5’-GCTGCCCACTCCGGG -3’

Murine Cry reverse 5’-GCTGACGCGGCCTCC -3’ murine Arntl forward 5’-GAAATGTCCATTCTCTGGTC-3’ murine Arntl reverse 5’-GCTGACGCGGCCTCC -3’ murine Il-6 forward 5’-GTTGTCTGGGAAATCGTG-3’ murine Il-6 reverse 5’-GAATTGCCATTGCACAAC -3’ human ROR-alpha 1 forward 5’-GCCCCGGTGCGCAGACA -3’ human ROR-alpha 1 reverse 5’- GTGCTGGAGATACCTCTG-3’ human ROR-alpha 2 forward 5’- GGGGCCCCAGGAGACAGTGA-3’ human ROR-alpha 2 reverse 5’-GACCACGGGACTCTTGCCTCA -3’ human ROR-alpha 3 forward 5’- GCAAAGCACAGCCCCAGT-3’ human ROR-alpha 3 reverse 5’-GCCTTTTCCTGGTTACCCATCTGCC -3’ human ROR-alpha 4 forward 5’-AGCGCCACACACTGGACA -3’ human ROR-alpha 4 reverse 5’- CCCTCCTTTGCCTAACCC-3’

Materials and methods

ChIP-primers

Murine Jun forward 5’AGAAGGGCCCAACTGTAGGA-3’

Murine Jun reverse 5’- ATGTCACCCCGAGGCTTT-3’

siRNA Sequence murine Jun siRNA 5’AGUCAUGAACCACGUUAACdTdT-3’

Murine Fra-2 siRNA 5’GAAGUUCCGGGUAGAUAUGdTdT-3’

Murine P300 siRNA 5’- GGCUUGACUUCUCCAAACAtt-3’

Murine Sp1siRNA 5’- GCAGAAUUGAGUCACCAAtt-3’

Murine Control siRNA # AM4642 Ambion

Table 8| Primers and siRNA: All primers were obtained from Metabion (Martinsried, Germany); siRNA was purchased from Eurogentec (Cologne, Germany).

Materials and methods

3.1.2 Patients

Human sample collection was approved by the local ethics boards and authorities in Erlangen, Germany. All patients gave written informed consent according to the regulations of the local ethics committees.

Gender age diagnosis tissue location f 74 RA knee joint f 64 RA knee joint f 71 RA knee joint f 78 RA knee joint m 78 RA knee joint f 58 RA knee joint f 64 RA knee joint f 80 RA knee joint

Table 9| human samples

3.1.3 Mice

All mice were kept in wire-top cages with wooden bedding (Abedd, Vienna, Austria) in a 12 hour light-dark cycle. Pellet food (Ssniff, Soest, Germany) and water were given ad libitum. All mouse experiments were approved by the local ethical committee.

For pharmacological inhibition of RORα, buffers and solutions as well as serum for induction of arthritis were delivered via intraperitoneal (i.p.) injection.

Materials and methods

Cell culture Osteoclast culture medium Alpha Minimum Essential Media (MEM) 500 ml 10% fetal calf serum (FCS) Antibiotics: penicillin and streptomycin Antimycotics: fungal amylase

Red blood cell lysis buffer 4.15 g Ammonium Chloride 50 ml 0.1 M Tris HCl Make up to 500 ml ddH2O Adjust pH to 7.5

Western Blot 1x Phosphate buffered saline (PBS) / Tween 1.5 M NaCl 60 mM Na2HPO4 · 2 H2O 20.5 mM NaH2PO4 · 2 H2O 0.1% Tween-20

RIPA buffer 50 mM Tris-HCl (pH 7.5) 150 mM NaCl 0.1% (w/v) SDS 0.5% (w/v) Sodium deoxycholate 1% (v/v) Nonidet P-40

Laemmli sample buffer (5X) 0.3 M Tris-HCl (pH 6.8) 50% glycerol 25% β-mercaptoethanol 10% (w/v) SDS 0.05% bromphenol blue

Running buffer (10x) 250 mM Tris-HCl pH 8.6 – 8.8 2 M Glycerol 1% (w/v) SDS Dilute 1:10 with ddH2O

Transfer buffer (10x) 0.5 M Tris-HCl (pH 8.0) 1.05 M Glycerol 1% (w/v) SDS 20% (v/v) methanol in 1x working solution

Materials and methods

Immunohistochemistry 1x PBS 1.5 M NaCl 60 mM Na2HPO4 · 2 H2O 20.5 mM NaH2PO4 · 2 H2O

Citrate buffer pH 6.0 10 mM Trisodium citrate dihydrate

DAB stock solution 1% (w/v) in ddH2O 3-5 drops of 10 M HCl

DAB working solution 5% (v/v) DAB stock solution 5% (v/v) of 0.3 % H2O2 In 1x PBS

Histology Hematoxylin 0.1% (w/v) Hematoxylin 0.02% (w/v) NaJO3 105 mM KAl(SO4)2 300 mM Chloral hydrate 0.1% (w/v) citric acid

Eosin 0.3% (w/v) Eosin 0.01% (v/v) acetic acid

Toluidine Blue Working Solution 10% Toluidine blue stock solution in 1% NaCl pH 2.3 1g Toluidine blue in 100ml 70% ethanol

TRAP staining Fixation solution: 25% Citrate solution 8% PFA (4%) 67% acetone

Materials and methods

TRAP solution: Pre mixture A 1.8 ml ddH2O 20 µl Naphtol 80 µl Acetate 40 µl Tartrate Pre mixture B 20 µl sodium Nitrite 20 µl Fast green Preserve solution: Glycerin/ PBS (1:1)

Goldner's Trichrome staining Solution A: 20 g Orange G 40 g Phosphomolybdic acid 1L distilled water Solution B: 10 mL Acetic acid, glacial 1L distilled water Solution C: 2g light green SF 2mL acetic acid, glacial 1L distilled water

Materials and methods

3.2 METHODS

3.2.1 Bone marrow isolation

Six to eight week-old mice were sacrificed, whole femora and tibiae were dissected from hip joints and the skin and muscles were stripped out. Both ends of the long bones were cut off and the bone marrow was flushed out with serum-free medium through 70 µm nylon meshes to disaggregate cells. The cells were centrifuged at 1200 rpm for five minutes. The pellet was thereafter re-suspended in five ml RBC lysis buffer to lyse the erythrocytes and subsequently neutralized in five times volume of PBS. The suspension was centrifuged anew and the pellet re-suspended in complete medium.

3.2.2 Mouse primary osteoclast culture and stimulation

Subsequently, bone marrow cells were incubated for 18-20 hours after which non-adherent cells were collected, centrifuged afresh and diluted in 10 ml complete medium prior to counting. Cells were seeded at a density of 1x106 cells/ml in desired well plates, and simultaneously stimulated with 20 ng/ml murine M-CSF and 30 ng/ml murine RANKL before they were incubated. Medium and cytokines were changed after 72 hours. Osteoclast differentiation was evaluated by staining cells for tartrate-resistant acid phosphatase (TRAP) using a Leukocyte Acid Phosphatase Kit (Sigma-Aldrich, St. Louis, MO, USA). Samples for RNA were collected in 350µl RNA-lysis buffer following the manufacturer’s instructions and protein samples were collected in protein-lysis buffer.

3.2.3 Adeno-associated viral over-expression in osteoclasts

Simultaneous to stimulation with M-CSF and RANKL, bone marrow cells were additionally infected with AdV-ROR-alpha, AdV-Cre or AdV-LacZ at a multiplicity of infection (MOI) of 200 IFU/1x106cells. The cells were then cultured as described in 3.2.2 mouse primary osteoclast culture and stimulation. The AdV-ROR-alpha virus (mRORA Adenovirus NM- 013646 #198145A) uses a CMV promoter and encodes for murine RORα. This vector was used to over-express RORα in murine osteoclast precursor cells. The AdCre virus was likewise an Adenovirus and was used to express the cre-recombinase that could ligase the LoxP sites and generate gene specific knock-out cells in-vitro. AdLacZ was used for controls.

Materials and methods

3.2.4 Plasmid isolation

Mini Prep

Plasmid Mini Prep for all used plasmids followed the manufacturer’s protocol (PureYield™ Plasmid Mini prep System, Promega, USA). 600μl of bacterial culture were transferred to 1.5ml tubes with 100μl lysis buffer and inverted several times. 350μl of cold neutralization solution was added immediately and mixed. After centrifugation (15,000×g, 3 min, 4 °C), the supernatant (~900μl) was pipetted onto a mini-column, placed in a collection tube and centrifuged again (15,000×g, 30 s, 4 °C). Several washing steps with endotoxin removal washing solution and column wash solution were conducted before the DNA was eluted from the column using 30μl of nuclease-free water. The DNA yield was determined using the Nano drop device and plasmid DNA was stored at -20 °C.

Maxi Prep

Plasmid Maxi Prep followed the manufacturer’s protocol (QIAGEN Plasmid Maxi Kit, Qiagen, Düsseldorf). Single colonies were picked from selection plates and inoculated in a starter culture of 3 ml LB medium containing ampicillin antibiotics. LB medium was incubated for ~8 h at 37 °C with vigorous shaking at 300 rpm. The starting culture was then added into 300 ml selective LB medium and kept under growth conditions for 18 h at 37 °C and 125 rpm. Bacteria were harvested by centrifugation (6,000×g, 30 min, 4 °C) and the pellet was re-suspended in 10 ml Buffer P1 containing RNase A. Cells were lysed using 10 ml Buffer P2, mixed gently but thoroughly by inverting 4-6 times and incubated at RT for 5 min. 10 ml of chilled Buffer P3 was added to the cells, mixed immediately but gently by inverting 4-6 times, and incubated on ice for 20 min. The lysate was applied to the equilibrated column (QIAGEN-tip 500). After washing twice with 30 ml Buffer QC, the plasmid DNA was eluted using 15 ml Buffer QF. The DNA was precipitated by adding 10.5 ml isopropanol and subsequent centrifugation (15,000×g, 30 min, 4 °C). The supernatant was carefully discarded and the pellet was re-suspended in 5 ml of RT 70 % ethanol and centrifuged again (15,000×g, 10 min, RT). Ethanol was removed carefully and the pellet was dried at RT for 5-10 min and finally DNA was dissolved in 0.1 ml nuclease-free water. The DNA yield was determined using a Nano drop device.

Materials and methods

3.2.5 siRNA Knock-down-assay

A day before transfection, cells were seeded at a density of 1x106 cell per ml in a 24-well plate and 1.25x105 in a 96-well plate. Cells should be 80% confluent on the day of transfection. On the day of transfection, the FUGENE reagent is left to attain room temperature. 25nM (Jun, Fra2, p300, Sp1) siRNA and 8µl FUGENE reagent were mixed in 100µl Opti-MEM serum-free media and incubated for 15 minutes. The above amounts are enough for twenty 96-well plates (5µl/well) or four 24-well plates (25µl/plate). The appropriate volumes were then added to the cells and incubated for 24 hours before medium was changed and the cells were stimulated with either M-CSF or the combination of M-CSF and RANKL.

3.2.6 In vitro bone resorption assay

BMCs were plated on bone slices (IDS, London, Great Britain) at a density of 5 × 104 cells/slice in 96-well culture plates with 200 µl culture medium per well. The culture medium was exchanged every third day. After 14 d, bone pits were stained with 1% toluidine blue (Sigma-Aldrich). Analysis was done using a light microscope.

3.2.7 Bone marrow transplantation

Male C57Bl/6J wildtype mice (4-week-old) were irradiated at 10.5 Gy (340s), using orthovoltage irradiation. 24 hours later, these mice received donor bone marrow cells from either RORsg/sg or wildtype mice injected intravenously at a concentration of 5 x 106 cells in 200 µl PBS. Mice were thereafter challenged with KBxN mouse serum to induce an arthritic phenotype. Mice were clinically evaluated every second day and sacrificed after 14 days for histochemical- as well as microcomputed tomographical analysis.

Materials and methods

3.2.8 Quantitative real-time PCR

Total RNA was isolated with the NucleoSpin RNA II extraction system (Macherey-Nagel, Düren, Germany) according to the instructions of the manufacturer. Reverse transcription into cDNA was performed as described using random hexamers. Gene expression was quantified by SYBR Green real-time PCR using the Mx3005P Sequence Detection System (Agilent Technologies, Santa Clara, CA, USA). Samples without enzyme in the reverse transcription reaction (Non-RT-controls) were used as negative controls to exclude genomic contamination. β-actin was used to normalize for the amounts of loaded cDNA. Differences were calculated with the threshold cycle (Ct) and the comparative Ct method for relative quantification.

3.2.9 Western Blot

The protein concentration of cell lysates was determined by amido black assays. Proteins were separated by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 2 % BSA at RT for 1h. Afterwards, the membrane was incubated with primary antibodies against RORα (PA5-23267), Nfatc1 (PA1- 41041), pNfatc1 (#sc-32979), Cathepsin-K, c-Jun (#sc-1694), Fra2, p300 (#MA1-16608), SP1 (#9389) at 4 °C overnight. After washing the membrane with 1x PBST for 3 times, 10 min each, the membrane was incubated with HRP-conjugated secondary antibodies (1:5,000 in 2 % BSA; Dako, Hamburg, Germany) at RT for 1 h. Lastly, the membrane was washed with 1x PBST for 3 times, 10 min each and blots were visualized by ECL. Determination of β-actin was used to exclude differences in loading. Western Blots were quantified using the ImageJ Software (version 1.41; National Institutes of Health).

Materials and methods

3.2.10 Immunofluorescence staining

Paraffin-embedded tissue sections were de-paraffinized and rehydrated, incubated 10 minutes in EDTA/ citric-acid to retrieve antigens and then blocked with 5 % bovine serum albumin before incubating with RORα primary antibodies. Fluorescence-labeled polyclonal antibodies were used as secondary antibodies. Quantification was performed by either manually counting the positive cells or via quantifying the intensity of immunofluorescence with ImageJ software. Exposure times as well as light intensity were the same throughout all samples within an experiment.

3.2.11 Co-Immunoprecipitation-Assay (Co-IP)

Whole cell lysates were collected in low salt protein lysis buffer (400 mM NaCl, 20mM HEPES (pH 7.9) and 1 mM EDTA). 2µg of specific antibodies (RORα (Abcam), p300 (Thermo- scientific), SP1 (Thermo-scientific)) or normal IgG antibodies (Santa Cruz Technologies) were mixed with 20µl of agarose beads and added to 100µg of protein lysates and the volume filled to 200µl with lysis buffer. The mixture was then left over night to shake in a thermomixer at 4°C. The samples were then centrifuged and the pellet was washed in low salt lysis buffer. The pellet was lysed in Laemmli buffer and evaluated via Western blot. The proteins of interest were detected using specific antibodies.

3.2.12 Chromatin Immunoprecipitation-Assay (ChIP-assay)

ChIP-assay was carried out following the protocol in the ChIP-IT Express kit from Active Motif. Briefly, cells were fixed in 5ml of 37% PFA and washed in ice-cold PBS. Fixation was then stopped in glycine stop solution. Cell lysates were then collected in 5ml scraping buffer and centrifuged. The pellet was suspended in ice-cold lysis buffer and the chromatin was sheared using a homogenizer and directly afterwards sonicated. The sheared chromatin was then centrifuged for 10 minutes. The supernatant containing chromatin was collected in a 1.5 ml tube. The chromatin concentration and the shearing efficacy were determined by using a Nano-drop device and loading onto an agarose gel, respectively.

Materials and methods

Chromatin was used to precipitate the RORα using anti- RORα specific antibody (Abcam # ab60134) or anti-Sp1 specific antibody (Cell signaling #9389) as follows:

Reagent One reaction

Protein G magnetic Beads 25µl ChIP Buffer 1 20µl Sheared chromatin (7-25µg) 100µl

Protease inhibitor Cocktail (PIC) 2µl dH20 53µl Antibody (Added last) 2µg

Total Volume 200µl

Table 10| ChIP-assay immunoprecipitation components

ChIP and input DNA was measured by quantitative real-time PCR and normalized by 10 % input.

3.2.13 Reporter-assay

Reporter plasmid transfection:

Transfecting RAW cells using Lipofectamin: 500ng reporter plasmid (Bmal1 and Jun) and 500 ng β-Gal reporter plasmids were mixed in 50µl serum-free medium. Subsequently, 5µl Lipofectamine (Thermo Fischer Scientific) were added to 50 µl serum-free medium. The solutions were then incubated for 5 minutes at RT. The two solutions were thereafter mixed and the complex mixture was incubated for 20 minutes at RT. 100µl of the complex were then added to each well containing 10x106 cells and incubated for 12 hours in a cell culture incubator at 37°C with 5 % CO2 and 90% relative humidity. After 12 hours, medium was changed, stimulated with M-CSF and RANKL and treated with inhibitors, respectively.

Materials and methods

Transfecting primary osteoclasts precursor cells using FUGENE: A day before transfection, cells were seeded at a density of 1x106 cell per ml in a 24-well plate and 1.25x105 in a 96-well plate. Cells should be 80% confluent on the day of transfection. On the day of transfection, the FUGENE reagent is left to attain room temperature. 2µg (Jun, Bmla1) DNA and 8µl FUGENE reagent were mixed in 100µl Opti-MEM serum-free media and incubated for 15 minutes. The above amounts are enough for twenty 96-well plates (5µl/well) or four 24-well plates (25µl/plate). The appropriate volumes were then added to the cells and incubated for 24 hours before medium was changed and the cells were stimulated with either M-CSF or M-CSF and RANKL.

Sample collection and measuring:

Samples were collected in 60µl passive lysis buffer. The β-galactosidase activity was measured at the ELISA reader with OPNG diluted in β-galactosidase buffer. The luciferase activity was measured at the luminometer device using 0.3mg/ml D-Luciferin substrate diluted in luciferase buffer.

3.2.14 Animal models

Model of inflammation induced arthritis hTNFα-tg mice spontaneously develop arthritis with a rheumatoid arthritis-like pattern with paw swelling and loss of grip strength at four weeks of age. RORα inhibitor treatment was started at four weeks of age before onset of disease. Treatment was done every twelve hours for four weeks after which mice were sacrificed and the outcome was analyzed by microcomputed tomography (µ-CT), histomorphometry, TRAP and Toluidine blue staining as described in more detail below.

K/BxN serum was injected into C57BL/6J WT mice to induce a phenotype that mimics human arthritis. 150µl of K/BxN serum was delivered via intraperitoneal injection. RORα inhibitor treatment was started one day after serum injection for 14 days. Clinical assessment for the weight, paw swelling and grip strength was done every other day. On day 15, mice were sacrificed and the outcome was analyzed by microcomputed tomography (µ-CT), histomorphometry, TRAP and toluidine blue stainings.

Materials and methods

Model of non-inflammation induced arthritis Experimental osteoporosis was induced in 8-week old female C57BL/6J mice (Janvier, France) by surgical ovariectomy. The control sham mice underwent the surgery, but no ovaries were removed. After five weeks, mice were sacrificed and the outcome was analysed by microcomputed tomography (µ-CT), histomorphometry and TRAP staining.

RORα inhibitor delivery The RORα inhibitors were injected intraperitoneally at a dose of 15mg/kg and 25mg/kg of SR3335 and SR1001, respectively. Negative control groups were injected with the vehicle 10% tween and 10% DMSO in PBS. Application was done every 12 hours.

3.2.15 Clinical assessment

Clinical evaluation was performed weekly and in a blinded manner as described. Briefly, paw swelling was examined in all 4 paws, and a clinical score of 0–3 was assigned as follows: 0 = no swelling, 1 = mild swelling, 2 = moderate swelling and 3 = severe swelling of the toes and ankle. In addition, grip strength was examined in each paw using a 3-mm diameter wire, and was scored on a scale from 0 to −4 as follows: 0 = normal grip strength, −1 = mildly reduced, −2 = moderately reduced, −3 = severely reduced, and −4 = no grip strength. Mice were weighed weekly.

3.2.16 Microcomputed tomography analysis

Hind paws and tibial bones were analyzed by microcomputed tomography (μCT) (μCT35; SCANCO Medical AG, Brüttisellen, Switzerland). The following acquisition parameters were used: voltage: 40 kV; x-ray current: 250 μA; exposure time: 5000 ms/projection, 720 projections; matrix: 1024 × 1024; and voxel size in reconstructed image: 9 μm. Bone mineral density could be determined by getting the ratio of bone volume to total volume. Additionally, differences between trabecular and cortical bone densities were analyzed. Trabecular thickness, trabecular thickness as well as trabecular spacing were also determined.

Materials and methods

3.2.17 Immunofluorescent staining

Formalin-fixed, paraffin-embedded bone sections or 4 % PFA-fixed, 0.5 % Triton X100- permebealized cells were stained with anti-RORα primary antibody (Santa Cruz (H-65) #sc- 28612) at a 1:50 dilution. Alexa Fluor antibody (Darmstadt, Germany) was used as secondary antibody. In addition, cell nuclei were stained using DAPI (Santa Cruz Biotechnology, Heidelberg, Germany). Stained cells were visualized using a Nikon Eclipse 80i microscope (Nikon, Badhoevedorp, Netherlands).

3.2.18 Histomorphometric analysis

Decalcified, paraffin-embedded hind paws were cut in 5 μm sections and stained with toluidine blue, haematoxylin (Merck, Darmstadt, Germany) or tartrate-resistant acid phosphatase (TRAP), using a leukocyte acid phosphatase staining kit (Sigma-Aldrich). Bone erosion, osteoclast number, and cartilage destruction were quantified with a Zeiss Axioskop 2 microscope (Carl Zeiss AG, Oberkochen, Germany) equipped with a digital camera and image analysis system (OsteoMeasure; Osteometrics, Decatur, GA).

Hematoxylin-Eosin staining The paraffin-embedded sections were deparaffinized in xylene and rehydrated in a series of descending isopropanol dilutions. After rinsing in ddH2O, sections were stained in filtered hematoxylin solution. Sections were then again shortly rinsed in running tap water and differentiated in acid alcohol. Finally, the sections were stained in eosin solution and dehydrated in a series of ascending isopropanol dilutions and xylene. Slides were mounted with non-aqueous mounting medium (Histokitt Roti) under the laboratory hood.

TRAP-staining in tissues The paraffin-embedded sections were deparaffinized in xylene and rehydrated in a series of descending ethanol dilutions. Afterwards, the slides were incubated in the “pre mixture A” solution (Naphthol AS-BI phosphoric acid, acetate solution and tartrate solution) at 37°C for one hour. Finally, “pre mixture B” solution (Fast green and sodium nitrite solution) was added for 2 to 5 minutes to develop the staining in osteoclasts. Slides were mounted with aqueous mounting medium.

Materials and methods

TRAP-Cells Osteoclasts were stained for TRAP as described in the protocol of the TRAP-staining kit (Sigma-Aldrich, #3871). Briefly, cells were washed twice in PBS to remove loosely adherent cells. 150µl fixation solution per well were added and incubated for three minutes at RT. Cells were thereafter washed twice again before 150µl TRAP-staining solution was added and incubated for 5-15 minutes at RT. The cells were observed constantly under a light microscope for a violet/purple color to avoid overstaining. The cells were then washed in PBS and stored in 250µl Glycine: PBS (1:1) solution per well to preserve the cell morphology before evaluation was carried out under the light microscope. The above volumes were used for 96 well plates. For TRAP-immunofluorescence co-staining, cells were blocked and permeabilized with 2%BSA/0.5% Triton-X solution. The immunofluorescence protocol was followed as documented in the material and methods section 3.2.16: immunofluorescent staining.

Goldner Trichrome Sections of non-decalcified bone embedded in methylmetacrylate (Technovit, Wehrheim, Germany) were deplastinated in methoxymethylacetate (Merck, Darmstadt, Germany). The sections were then placed in solution A (Orange G and Phosphomolybdic acid) and rinsed with solution B (acetic acid). The sections were then put into solution C (light green SF and acetic acid) and afterwards rapidly dehydrated with absolute ethanol and xylene, and finally mounted with a resinous medium.

Toluidine blue staining After deparaffinization and rehydration in xylene and a series of descending ethanol dilutions, the sections were shortly rinsed in ddH2O and then stained in toluidine blue working solution (5 ml toluidine blue stock solution + 45ml 1% Sodium chloride pH 2.3). The sections were dehydrated quickly through 95%, two times of 100% alcohol, and xylene. . Slides were mounted with non-aqueous mounting medium (Histokitt Roti) under the laboratory hood.

Materials and methods

3.2.19 Statistical analysis

Data is expressed as mean ± standard deviation. The Wilcoxon signed rank tests for related samples and the Mann-Whitney-U-test for non-related samples were used for statistical analyses. A p-value of less than 0.05 was considered statistically significant; p-values are expressed as follows: 0.05 > p ≥ 0.01 as *; 0.01 > p ≥ 0.001 as **; p < 0.001 as ***.

4. RESULTS

4.1 RORα is expressed in osteoclasts and induced during osteoclastogenesis

RORα is expressed in various organs including the skeletal muscles, kidneys, testis and the brain. RORα has indeed been reported to be implicated in different physiological and pathological metabolisms including glucose and lipid metabolisms, circadian rhythm and also in the immune system. Furthermore, RORα has been shown to modulate osteoblast activity and chondrocyte hypertrophy and hence to play an important role in osteogenesis [82, 96]. However, the expression and the role of RORα in osteoclasts remain unexplored. In the first part of our study, we determined the expression of RORα in osteoclasts both in vivo and in vitro.

RORα is highly expressed in arthritic murine and human osteoclasts The osteoclast is the main and key cell type in the body specialized in bone resorption. A shift of the bone homeostasis due to an increase in bone resorption compared to bone formation leads to fragile and weaker bones, which are prone to fracture. To address the question whether RORα plays any role in osteoclasts, we first determined the expression of RORα in both human and murine osteoclasts. Knee tissue from rheumatoid arthritis patients were stained using TRAP and immunofluorescence and compared to those from healthy individuals. Furthermore, murine ankle tissue from both serum-induced arthritis mice (SIA) as well as human Tumor necrosis factor alpha transgenic mice (hTNFαtg) were likewise stained by TRAP and immunofluorescence and compared to tissue from healthy C57BL/6J wildtype mice. Tartrate-resistant acid phosphatase (TRAP) staining was used to visualize osteoclasts. TRAP is a metalloproteinase resistant to tartrate which is highly expressed in osteoclasts. The TRAP-immunofluorescence co-staining illustrated a co- localization of TRAP and RORα. Besides, it was noted that not all TRAP+ cells stained positive for RORα (Figure 7a+b+c). To compare the number of TRAP and RORα double-positive cells between healthy and arthritic bone, the number of osteoclasts in knee- and ankle joints from healthy individuals and arthritic patients as well as from healthy mice and arthritis-induced mice were counted and presented as number of osteoclasts per joint.

The quantification for all TRAP+ and RORα+ cells in both healthy and arthritic tissue revealed that arthritic tissue stained more double-positive cells than healthy tissue. This was the case inboth human (Figure 7d) and murine bone tissue (Figure 7e+f).

Figure 7 : RORα expression in human and murine osteoclasts. Representative images of osteoclasts in bone tissue from (a) patients with RA vs. healthy individuals, (b) SIA vs. wildtype, (c) hTNFtg vs. wildtype double- stained for TRAP and RORα are shown at 1000x magnification. TRAP staining (purple) is shown in the upper panels and immunofluorescence staining for RORα in the second panel.. n = 6 for humans, n=10 for mice per group. (d-f) Quantification of a-c respectively. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

RORα expression is elevated during osteoclastogenesis

Osteoclastogenesis is a process in which hematopoietic mononuclear precursors differentiate and mature into multinuclear, bone resorbing osteoclasts. We addressed the potential function of RORα during this process by evaluating the expression of RORα throughout the whole differentiating process. Mononuclear, CD11b+ bone-marrow cells differentiate in vitro in the presence of M-CSF and RANKL into mature, functional osteoclasts.

Differentiating CD11b+ bone-marrow cells treated with both M-CSF and RANKL were stained for TRAP to visualize osteoclasts and co-stained for RORα via immunofluorescence at different time points after RANKL stimulation. We defined an osteoclast as TRAP-positive cell with at least three nuclei. The TRAP staining increased continuously over time. Cells displayed barely any TRAP 12 hours after RANKL stimulation and the highest TRAP expression 72 hours after RANKL stimulation. Additionally, the TRAP/ RORα co-staining showed cells in close proximity to each other 48 hours post RANKL stimulation and cells fused together 60 hours after RANKL stimulation (Figure 8a).

The immunofluorescence staining revealed a time-dependent increase in Rorα expression in osteoclasts. Whereas TRAP staining augmented continuously over time up to 72 hours, Rorα expression peaked 60 hours after RANKL stimulation and dropped thereafter (Figure 8a). Consistent to the TRAP staining, osteoclast markers (Trap, Oscar, Nfatc1, and Cathepsin k) likewise increased in a time-dependent manner and peaked 72 hours after RANKL stimulation (Figure 8b).

Western blot results showed elevated Rorα protein expression after RANKL stimulation in a time-dependent manner during osteoclastogenesis with the highest expression 72 hours after RANKL stimulation. Cells that were not stimulated with RANKL expressed minimal amounts of Rorα (Figure 8c). Protein expression determined by Western blot however, did not decrease 60 hours after RANKL stimulation like observed in immunofluorescence and the real-time PCR results. Rorα mRNA levels increased in a time-dependent manner, similar to the osteoclast markers and peaked 60 hours after RANKL stimulation. Consistent with the immunofluorescence staining results, the Rorα mRNA levels rose up to 60 hours after RANKL stimulation and subsequently decreased 72 hours post RANKL stimulation (Figure 8d).

Hours after RANKL stimulation a)

** * 8 * ** 12hrs * 8 * 6 24hrs 12hrs 48hrs b) c) 6 24hrs 72hrs 4 48hrs 72hrs 15 * 4 * 4 2 *

mRNA * 2 3

10 0

mRNA

x-fold change in TRAP mRNA x-foldTRAP in change Nfatc1

0 2 Rorα x-fold change in TRAP mRNA x-foldTRAP in change 5 ß-actin

1 x fold x change in

Cathepsin k 24 hours 48 hours 72 hours

0 0 x fold x change in d) 8 ** 10 ** 20 * * *

** 6 mRNA

mRNA 8 15

Trap mRNA 6 Oscar 4 10

4 Rora 2 5 fold changex in 2 0

0 0

x-fold change in x fold changex in Figure 8: RORα is upregulated during osteoclastogenesis. (a) Representative images of TRAP and immunofluorescence staining for Rorα in differentiating CD11b+ osteoclast precursors are shown at 1000x magnification. TRAP staining (purple) is shown in the upper panels, immunofluorescence staining for Rorα in the second panels and Dapi in the third panels. (b) Bar graphs of quantified mRNA expression of osteoclast markers (Trap, Oscar, Nfatc1, Cathepsin k) by real-time PCR at different time points during osteoclastogenesis. (c) Western blot data of samples with and without RANKL stimulation at different time points during osteoclastogenesis. (d) Bar graph of quantified Rora mRNA expression via real-time PCR at different time points during osteoclastogenesis. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

4.2 Alterations in RORα expression affects osteoclastogenesis

Our previous data showed increased RORα expression in arthritic tissue from both human and mouse as well as elevated RORα expression during osteoclastogenesis. We therefore hypothesized that RORα might play a role in osteoclastogenesis. To test this hypothesis, small molecule inhibitors of ROR were used: SR3335 which is a RORα specific inhibitor and SR1001 which inhibits both RORα and RORγ. Moreover, Cre/LoxP-driven recombination was applied to knockout RORα in osteoclast precursors. Furthermore, an adenovirus- overexpressing system was designed to overexpress RORα in osteoclast precursor cells.

RORα inhibitors suppress osteoclastogenesis in a dose dependent manner When bound to RORα, SR3335 triggers a conformational change in the ligand binding domain (LBD) of RORα and thereby lowering its ability to activate transcription (IC50=480nM). SR1001 binds to the LBD of both RORα and RORγ inducing a conformational change, which results in decreased co-activator and increased co-repressor affinity (IC50=117nM).

Differentiating CD11b+ cells were treated with different concentrations of ROR inhibitors. Three and five µM of SR3335 and five and ten µM of SR1001 were used. After the TRAP positive osteoclasts (≥3 nuclei) were counted, a dose-dependent decrease in the number of osteoclasts was attained. The highest efficacy in inhibiting osteoclast differentiation was achieved by 5µM SR3335 and 10µM SR1001 with both concentrations yielding less than ten osteoclasts per well (Figure 9a+b). Analysis of the mRNA levels of the osteoclast markers Trap, Nfatc1, Oscar and Cathepsin k showed decreased levels of all the markers when cells were treated with ROR inhibitors (Figure 9c). The protein expression levels of osteoclast markers Nfatc1 and Cathepsin k were similarly diminished when cells were treated with ROR inhibitors (Figure 9d).

a) Murine Bone-marrow cells b)

w/oRANKL R+3µMSR3335 R+5µMSR1001 *** 40 *** *** w /oRANKL 30 +RANKL R+3µM SR3335 20 R+5µM SR3335 R+5µM SR1001 10 R+10µM SR1001

+RANKL R+5µMSR3335 R+10µMSR1001cells positive TRAP 0 *** 40 *** *** w /oRANKL 30 +RANKL R+3µM SR3335 ** 20 R+5µM SR3335 5 ** * -RANKL R+5µM SR1001 ** 4 5 ** * +RANKL 10 R+10µM SR1001 -RANKL 3 RANKL+SR3335

4 cells positive TRAP c) +RANKL RANKL+SR1001 d) 3 RANKL+SR33352 0 RANKL+SR1001 20 * 2 ** *** xfoldin change 1 25 cathepsin-K mRNA cathepsin-K ** ** 0

xfoldin change 1 cathepsin-K mRNA cathepsin-K 15 20 0 15

10 mRNA mRNA 10

Trap Rorα

Nfatc1 x fold x change in x foldx change in 5 Nfatc1 0 0 Cathepsin k * * 25 ** * 5 ** ** ß-actin 20 4

15 mRNA 3 mRNA

10 2

Oscar x fold changex in

5 fold x change in 1 Cathepsin k 0 0

Figure 9: RORα inhibitors suppress osteoclastogenesis in a dose-dependent manner. (a) Representative images of TRAP-stained osteoclasts after treatment with different concentrations of RORα inhibitors at a magnification of 200x. Osteoclast precursors were stimulated with M-CSF (20ng/ml) and RANKL (30ng/ml). (b) Bar graphs showing the number of osteoclasts counted in a. (c) Real-time PCR analysis of osteoclast markers: Cathepsin k, Trap, Oscar, and Nfatc1. (d) Western-blot results showing the protein expression in osteoclasts after treatment with RORα inhibitors. n=5 independent experiments. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα inhibitors suppress the bone resorbing efficacy of osteoclasts

After osteoclast numbers decreased upon RORα inhibition, we then aimed to address the question whether osteoclast function was also altered when osteoclast precursor cells were treated with ROR inhibitors. In vitro bone resorption-assay was performed to evaluate calcified bone eroding efficacy of osteoclasts with and without ROR inhibition. Violet/blue areas represent eroded zones. Bone slides without RANKL showed minimal purple patches compared to the bone slides with cells stimulated with RANKL. Bone slides treated with ROR inhibitors in addition to RANKL and M-CSF on the other side, displayed resolved zones similar to the wells without RANKL (Figure 10a). The quantification is presented in a bar graph after resorbed areas per well were counted under the light microscope (Figure 10b).

Resorption-Assay a)

** 8080 *** ** *** ***40 *** * b) * *** w-RANKL /oRANKL 6060 30 +RANKL R+3µMRANKL+SR3335 SR3335 4040 20 R+5µMRANKL+SR1001 SR3335 R+5µM SR1001 R+10µM SR1001

2020 10 TRAP positive cells positive TRAP 0 0

Resorption areas perw Resorption ell 0 Resorption areas perw Resorption ell

Figure 10: RORα inhibitors suppress osteoclasts bone resorbing efficacy (a) Representative images of toluidine-blue-stained artificial bone slices cultured in osteoclasts which were treated with and without RANKL and in addition with RORα inhibitors. Purple/blue areas represent resorbed zones. Magnification 200x (b) Bar graph of quantified resorbed areas per well in a. n=3 independent experiments. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data are presented as the mean ± SEM.

Genetic knock-out of RORα suppresses osteoclast differentiation and function

Small molecule inhibitors can cause off-target effects. Despite the proven specificity of the RORα inhibitors used in our study, we aimed to confirm the results obtained with small molecules by genetic approaches. To achieve specific ablation of RORα in osteoclast precursor cells, we used the Cre/lox system to knock out RORα in CD11b+ hematopoietic monocytes from RORAfl/fl mice. The cells were treated with a Cre-recombinase expressing adenovirus to flox-out Rora, which was flanked by LoxP sequences, and a LacZ expressing adenovirus as control. LacZ is a lacoperon that encodes the ß-galactosidase in the presence of lactose. In the absence of the inducer however, the lacZ promoter remains inactive. LacZ was used to exclude any general adenovirus effects which could falsify the results.

As expected, CD11b+ cells treated with M-CSF and LacZ adenovirus did not yield any osteoclasts. Cells treated with M-CSF and RANKL in addition to LacZ differentiated into normal osteoclasts of normal size and counts. However, the cells treated with the Cre virus in addition to M-CSF and RANKL did not yield as many mature osteoclasts as the ones treated with LacZ. These cells were smaller in size and the number of osteoclasts with more than 3 nuclei were significantly reduced (Figure 11a).

Protein analysis of RORα using Western blot showed increased RORα expression when osteoclasts were treated with LacZ, M-CSF and RANKL. This increase in RORα however was abrogated when cells were treated with the Cre-recombinase virus instead of LacZ leading to an 85% Rora knock-out efficacy. To evaluate the effect of RORα knock-out on osteoclastogenesis, we analyzed both protein and mRNA levels of osteoclasts markers (Cathepsin k, Nfatc1, Oscar and Trap). Similar to the RORα protein expression, all the analyzed osteoclasts markers (Cathepsin-k, Nfatc1) were suppressed by the Cre-recombinase virus (Figure 11b). The Real-time PCR results showed attenuated mRNA levels of all these markers upon infection with Cre-recombinase virus (Figure 11c).

a) b)

fl/fl fl/fl Rora Rora w/oRANKL+LacZ RANKL+LacZ

Rorα

fl/fl fl/fl Cathepsin k Rora Rora w/oRANKL+Cre RANKL+Cre Nfatc1

ß-actin

c) 20 * * * * Lacz Adv. 15 Cre Adv.

mRNA levels mRNA 5 x fold x change in

Mcsf Mcsf Mcsf Mcsf

Rankl Rankl Rankl Rankl Cathepsin k Nfatc1 Oscar Trap

Figure 11: Genetic ablation of RORα suppresses osteoclast differentiation and function (a) Microphotographs of TRAP-stained osteoclasts after RORα knock-out at a magnification of 200x. (b) Western- blot results showing protein expressions of Rorα and the osteoclast marker Cathepsin k. (c) Real-time PCR results of mRNA levels of osteoclast markers; Cathepsin k, Nfatc1, Oscar and Trap. n=3 per each group. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα overexpression induces osteoclastogenesis

Alteration of RORα functionality through both inhibitions by small chemical molecules as well as through genetic knock-out caused a significant decrease in both osteoclast number as well as in osteoclast function. We next aimed to determine the effect of RORα overexpression in osteoclastogenesis. We hypothesized that RORα overexpression might show the opposite effect and enhance osteoclastogenesis.

CD11b+ cells were cultured in the presence of M-CSF and RANKL and treated with either Rora- or LacZ adenovirus. The Rora adenoviral overexpression efficacy was confirmed by Western blot and Real-time PCR where we obtained a 75% and 80% efficacy, respectively. Cells treated with M-CSF, RANKL and LacZ adenovirus and the TRAP staining results showed a normal number of osteoclasts with an average of ten nuclei per cell. Cells treated with M-CSF, RANKL and RORA adenovirus on the other side differentiated into huge osteoclasts with an average of 16 nuclei per cell (Figure 12a).

Western blot analysis showed elevated protein levels of the osteoclast markers Cathepsin-K and Nfatc1 (Figure 12b). The mRNA levels of the osteoclast markers TRAP, Nfatc1, Oscar and Cathepsin-k were likewise increased after RORα overexpression, even without RANKL stimulation. Additive effects were observed when cells were treated with both Rora adenovirus and RANKL where a more pronounced rise in all osteoclast markers was evident both at the mRNA as well as the protein level (Figure 12c).

a) b)

W/o RANKL +RANKL

Adv.

LacZ Rorα

Cathepsin k

Nfatc1

Adv. ß-actin Rora

c) LacZAdv. RoraAdv. R+LacZ Adv. R+RoraAdv.

25 * * ** * * ** * ** 20

5 x fold changex in mRNA 0 Cathepsin k Nfatc1 Oscar Trap

Figure 12: RORα overexpression enhances Osteoclastogenesis. (a) Representative images of TRAP- stained osteoclasts after RORα over-expression at a magnification of 200x. (b) Western-blot data and (c) Real-time PCR analysis of osteoclast markers (Cathepsin k, Nfatc1, Oscar and Trap) after RORα adeno- associated viral-over-expression. n=3 per group. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα inhibitors affect the early stages of osteoclastogenesis

Osteoclastogenesis is a complex mechanism, which is to date not fully understood. During osteoclastogenesis, hematopoietic mononuclear cells undergo differentiation in a series of steps to become mature bone resorbing giant cells. The first steps can be roughly classified as the differentiating stages whereas the later steps on the other hand can be considered as maturing stages. Both stages have distinct molecular regulating mechanisms. Here, we aimed to determine which stage of osteoclastogenesis is regulated by RORα.

Osteoclast precursor cells were treated with RORα inhibitors at two different time points. The first time point was right after cells were seeded, parallel to the first M-CSF and RANKL stimulation and the second time point was parallel to the second stimulation which was 60 hours post the first RANKL stimulation. RORα was stained via immunofluorescence and the nuclei counter-stained with DAPI. The immunofluorescence results exhibit increased RORα expression after RANKL stimulation conforming to our previous results (Figure 13a). The RORα expression remained unaffected by RORα inhibitors, both at day 1 and day 3. TRAP staining results showed declined number of osteoclasts, when cells were treated with RORα inhibitors at day 1, while the number of osteoclasts remained unaffected when RORα inhibitors were added at day 3 (Figure 13a).

Protein analysis of Rorα and the osteoclast marker Nfatc1 and pNfatc1 before and after treatment with RORα inhibitors at these two different time points was carried out using western blot. Western blot analyses evinced increased RORα expression when cells were treated with RANKL. No differences were detected in cells treated with RORα inhibitors at day 3. In contrast, significant decrease in the expression of osteoclast markers Nfatc1 and pNfatc1 was displayed when cells were treated with RORα inhibitors at day 1 (Figure 13b).

b) Figure 13: RORα inhibitors affect early stages of osteoclastogenesis. (a) Representative images of TRAP stained osteoclasts co-stained for Rorα and Dapi at a magnification of 100x. (b) Western blot analysis of Rorα, and osteoclast markers (pNfatc1, Nfatc1) after treatment Rorα with RORα inhibitors at two different time points: before Nfatc1 differentiation and after differentiation. n=3 per group.

Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, pNfatc1 ***p≤0.001 Data is presented as the mean ± SEM. ß-actin

4.3 Ablation of RORα protects mice from arthritis and osteoporosis

Bone destruction is a key component of bone disorders like rheumatoid arthritis and osteoporosis. Despite the differences in etiology and symptom-manifestations, these two diseases share bone destruction as a common phenotype.

Our results so far have pointed out that RORα might play an important role in the early stages of osteoclastogenesis. Inhibition of RORα in vitro showed a significant decrease in osteoclast number and function.

Next, we aimed to transfer the same principle in vivo to evaluate the therapeutic potential of RORα inhibitors in different murine models mimicking different human bone diseases.

RORα inhibitors protect mice from ovariectomy-induced osteoporosis

The ovariectomy model was used to mimic non-inflammatory bone loss as observed in human post-menopausal osteoporosis.

Analysis of the distal tibia by micro-computed tomography showed reduced bone mineral density in mice of the OVX group compared to the ones from the sham-operated group. This was evident by decreased trabecular volume (Figure 14a). Trabecular number and thickness as well as trabecular and total bone volume to total volume ratio (BV/TV) were significantly decreased (Figure 14b).

The OVX+SR3335 group showed higher bone-mineral density compared to the OVX group. Trabecular number and thickness showed protection from bone loss in the OVX+SR3335 group (Figure 14a+b).

In order to investigate whether the protective effect of RORα inhibitors was osteoclast- dependent, TRAP staining on proximal tibiae of these mice was carried out. The OVX + vehicle group displayed increased numbers of osteoclasts as compared to the sham operated, vehicle-treated group. The number of osteoclasts was considerably reduced in OVX-mice treated with SR3335 as compared to those treated with vehicle (Figure 14c).

- Micro

0.8 * * Sham+Vehicle 0.6 OVX + Vehicle OVX + SR3335 0.4 b)

Total BV/TV Total 0.2

0.0

200x

TRAP

1000x

Figure 14: RORα inhibitors protect mice from ovariectomy-induced osteoporosis. (a) Representative images of µ-CT analysis of the trabecular bone of the distal tibia. (b) Quantification of the µ-CT parameters, (total and trabecular BV/TV, Trabecular number, trabecular thickness). (c) Representative images of TRAP stained proximal tibia sections. n=6 mice per group. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα inhibitors ameliorate serum-induced arthritis

In addition to non-inflammatory bone loss, we aimed to also assess the effects of targeting RORα in models of inflammatory bone loss. One of these models is the serum transfer model. The transfer of serum from K/BxN mice induces arthritis in wildtype mice of various backgrounds. Arthritis induced by K/BxN serum occurs rapidly within 2 days after serum injection. The symptoms are transient and regress after 15-30 days [98].

Clinical parameters (weight, joint swelling and grip strength) were collected every other day. Swollen ankle joints were observed in mice that received the K/BxN serum from day 3 after serum injection. The severity of the swelling increased over time to the clinical grade 2 at day 15. The grip strength was similarly deteriorated over time up to a clinical score of -2.3 at day 15. The swelling and the loss of grip strength were both improved in mice that additionally received RORα inhibitors. No major differences were observed between mice treated with either SR3335 or SR1001 (Figure 15a).

Besides clinical grading, histomorphometric analyses were done to determine bone erosion and inflammatory infiltration. TRAP staining results displayed an elevated number of osteoclasts in K/BxN serum treated groups. The number of osteoclasts declined almost to the levels of controls in mice treated with RORα inhibitors (Figure 15b, upper panel). Hematoxylin-Eosin staining showed a reduced area of inflammatory infiltrates in mice treated with RORα inhibitors as compared to vehicle-treated controls (Figure 15b middle panel). To determine the amount of mineralized bone of these mice, trichrome staining was carried out. Mice treated with K/BxN serum displayed less mineralized bone. Bone from mice challenged with K/BxN serum and treated with RORα inhibitors, showed more mineralized bone than K/BxN serum challenged mice treated with vehicle. The mineralized bone levels were comparable to that of non-arthritic control mice (Figure 15b lower panel and 15c).

200x b)

Figure 15: RORα inhibitors ameliorate serum induced arthritis. (a) Clinical analysis of the weight, joint swelling and the grip strength. (b) Histomorphometric analysis with TRAP, HE and trichrome staining. (c) Dot- blot presenting bone erosion parameters; osteoclasts counts, eroded area and the inflamed area. . n=8 mice per group. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

2 * 6 * +Vehicle

2 * + serum 6 * 4 +Vehicle serum + SR3335 + serum serum + SR1001 b) 4 serum + SR3335 2 serum + SR1001

0 Area of inflammation in mm in Areaof inflammation

Figure 16: RORα inhibitors ameliorate serum-induced arthritis. (a) Micro-photographs showing µ- CT images of trabecular bone of the proximal tibia in 3D and 2D. (b) Dot-blots representing µ-CT parameters of bone loss (trabecular thickness, bone mineral density, trabecular spacing, trabecular number). n=8 mice per group. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα inhibitors ameliorate human TNF-alpha induced arthritis

Another murine model of inflammatory bone loss is the hTNFα-transgenic model. Contrary to the serum-induced model, the hTNFtg murine model is not a systemic induced model but rather a genetically engineered model. These mice develop arthritis with swollen joints and decreased grip strength starting at an age of 4 weeks and are also smaller in size and weigh less than their wildtype littermates.

Clinical parameters (body weight, joint swelling and grip strength) were assessed weekly. The swelling of the ankle joint was progressive over the whole experimental period. The grip strength of the paws also decreased over time. However, hTNFtg mice treated with RORα inhibitors showed reduced joint swelling and improved grip strength compared to hTNFtg mice treated with vehicle. Although mice treated with RORα inhibitors showed a tendency towards higher body weight than vehicle-treated hTNFtg mice, these differences did not reach statistical significance (Figure 17a). The number of osteoclasts in the hTNFtg mice treated with vehicle was significantly increased compared to the wildtype mice treated with vehicle. Osteoclast counts in hTNFtg mice treated with RORα inhibitors were lower than in vehicle-treated hTNFtg mice (Figure 17b upper panel).

Additionally, we performed HE staining of the paws to quantify the inflamed area. We observed an increase in the inflammatory infiltrates in the hTNFtg mice treated with vehicle. Inflammatory infiltration was strongly suppressed by treatment with RORα inhibitors (Figure 17b middle panel). To analyze the amount of mineralized tissue in the bone of these mice, we performed trichrome staining. Bone tissue from hTNFtg mice displayed reduced amount of mineralized tissue compared to the wildtype controls. Bones from hTNFtg mice treated with RORα inhibitors however showed more mineralized bone tissue compared to the mice without treatment (Figure 17b lower panel). TRAP-stained osteoclasts were counted under the light microscope and presented as osteoclasts per bone. The number of eroded area was also counted under the light microscope and is presented as eroded areas per bone tissue. Areas of inflammatory infiltrates of the HE staining were quantified using the osteomeasure and presented as inflamed area in mm2 per bone. The bone erosion parameters number of osteoclasts, eroded area and inflamed area were quantified and presented in dot-blots (Figure 17c).

200x

00x 4

a) 30 2.5 030 WT+vehicle 2.0 WT+vehicle WT+vehicle * 25 hTNFtg+vehicle 25 hTNFtg+vehicle -1 hTNFtg+vehicle 1.5 hTNFtg+SR3335 20 * hTNFtg+SR3335 1.0 hTNFtg+SR3335 * ** hTNFtg+SR1001 20 -2 ** hTNFtg+SR1001

0.5 hTNFtg+SR1001 wgrams in eight 15 * Grip strength Grip Joint sw Joint elling 0.0 0 4 7 14 21 28 wgrams in eight -3 15 Days after treatment 0 4 7 0 4 7 0 4 7 14 21 28 14 21 28 14 21 28 Days after treatment Days after treatment Days after treatment

w t + vehicle hTNFtg + vehicle w t + vehicle hTNFtg + SR3335 hTNFtg + vehicle hTNFtg + SR1001 c) hTNFtg + SR3335 80 * hTNFtg + SR1001 ** 60 80 * ** 40 60

40 Osteoclastscounts 0 20

Figure 17: RORα inhibitors ameliorate arthritis in hTNFtg mice. (a) Clinical analysis of the weight, Osteoclastscounts 0 joint swelling and the grip strength. (b) Histomorphometric analysis with TRAP, HE and trichrome staining. (c) Dot-blot presenting bone erosion parameters: osteoclast counts, eroded area and the inflamed area. The arrow shows the inflammatory infiltrates. n=8 mice per group. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM

w t + vehicle

hTNFtg + vehicle w t + vehicle hTNFtg + SR3335 hTNFtg + vehicle hTNFtg + SR1001 hTNFtg + SR3335 b) 80 * hTNFtg + SR1001 **

60 80 * ** 60 40

40 20 Osteoclastscounts

20 0 Osteoclastscounts 0 Figure 18: RORα inhibitors ameliorate hTNF-induced arthritis. (a) Micro-photographs showing µ-CT images of trabecular bone of the proximal tibia in 3D and 2D. (b) Dot-blots representing µ-CT parameters of bone loss (trabecular thickness, bone mineral density, trabecular spacing, trabecular number. n=8 mice per

group. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM

Mice transplanted with bone marrow cells deficient in RORα are protected from serum- induced arthritis

To provide further evidence that the effect of RORα inhibitors in experimental arthritis is mediated by effects on osteoclasts and not on other cells, we induced arthritis in mice carrying either the staggerer bone marrow or the wildtype bone marrow. Since staggerer mice die shortly after birth, we transplanted staggerer bone marrow into wildtype mice that had their bone marrow irradiated. The control mice were also irradiated and received bone marrow from wildtype mice instead.

Mice transplanted with bone marrow cells from wildtype mice showed normal arthritis symptoms with swollen paws and loss of grip strength, whereas mice transplanted with bone marrow cells from staggerer mice showed reduced severity of these arthritic symptoms. In addition to less inflammatory infiltrates (Figure 19b upper panel), mice transplanted with bone marrow cells from staggerer mice also displayed lower numbers of osteoclasts (Figure 19b lower panel).

µ-CT analysis demonstrated that wildtype mice that received wildtype bone marrow cells, but no K/BxN serum, showed a normal bone mineral content, with intact cortical as well as trabecular bone. Wildtype mice that received wildtype bone marrow and K/BxN serum presented with reduced bone mineral content. Bones from these mice showed large eroded areas in both trabecular and cortical bone. The group of wildtype mice that received bone marrow cells from staggerer mice and K/BxN serum showed increased bone mineral content compared to the group that received wildtype bone marrow cells (Figure 20b).

Figure 19: RORα-deficient bone marrow cells protect mice from serum-induced arthritis. (b) HE- stained paw joint from mice treated either with wildtype bone marrow (left) or staggerer (sg/sg) bone marrow (right). TRAP stained paw joints from mice treated either with wildtype bone marrow (left) or staggerer (sg) bone marrow (right) after arthritis induction using K/BxN serum. n=5 mice in the group treated with wildtype bone marrow, and n=4 in the group treated with sg/sg bone marrow. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

1mm

WT-BMT SIA-BMT SIA-Rorasg/sg-BMT

0.050 5 *** * 0.08 *

0.045 4 0.06 0.040 3 0.04

0.035 2

Total Bv/Tv Th. Number

Tb-thickness 0.02 0.030 1

0.025 0 0.00

Figure 20: RORα-deficient bone marrow cells protect mice from serum-induced arthritis. (a) µ- CT results of proximal tibiae from mice treated with either wildtype bone marrow without serum injection (left), wildtype bone marrow with serum induction or staggerer (sg/sg) bone marrow (right) with serum injection. (b) Clinical analysis of arthritic parameters: paw swelling and grip strength. n=5 mice in the group treated with wildtype bone marrow, and n=4 in the group treated with sg/sg bone

marrow. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

4.4 Molecular mechanisms through which RORα regulates osteoclastogenesis

Over the last decades, intensive studies on osteoclastogenesis have shown a wide range of RANKL-driven pathways including NF-κB, MAPK, AP-1, SRC and PLC that keenly regulate osteoclast differentiation [99-102]. RANKL-mediated activation of MAPKs and the phosphorylation of JNK have been shown to induce c-Jun translocation. JUN members form heterodimers with the FOS family members to induce the transcription of osteoclastogenesis regulating genes, for example NFATc1. RORα is known to regulate glucose and lipid metabolisms via AKT/AMPK pathways [82]. Furthermore, RORα was shown to induce the expression of osteoblast markers by blocking NFκB activation [97]. RORα has been shown to activate genes in a cell dependent manner.

RORα inhibitors suppress the expression AP-1 members; c-Jun and Fra-2

The AP-1 family is composed of JUN and FOS members. RANKL has been reported to induce the AP-1 pathway by induction of JNK phosphorylation. To find out whether RORα regulates osteoclastogenesis through the AP-1 pathway, we evaluated the expression of AP-1 members during osteoclastogenesis with and without RORα inhibition. Mono-nuclear osteoclast precursor cells were stimulated with M-CSF and RANKL and treated with RORα inhibitors. Protein and mRNA levels of AP-1 members were then analyzed.

As anticipated, RANKL enhanced the expression of AP-1 members (Jun, Junb, Jund, Fos, Fosb, and Fra2) in osteoclast precursor cells. After treatment with the RORα inhibitors

SR3335 and SR1001, Jun and Fra-2 mRNA levels declined sharply (Figure 21a-f). Likewise, the protein expression level of c-Jun and Fra-2 were induced by RANKL, but the induction diminished when cells were treated with RORα inhibitors (Figure 21g). Other AP-1 members (Jund, Junb, Fra-1, cFos, Fosb) remained unaffected by RORα inhibitors (Figure 21a-g). The Jun luciferase-assay showed that RANKL induced Jun promoter activity. Osteoclasts precursor cells treated with RORα inhibitors however displayed reduced Jun promoter activity (Figure 21h).

In addition to RORα inhibition, we opted to genetically knockout RORα in osteoclast precursor cells aiming to see if it will give the same outcome on the expression of AP-1 members. We used the LoxP/Cre system to knockout RORα in osteoclast precursors. Control cells were infected with LacZ virus to control for potential infection related changes.

The mRNA levels of Jun and Fra-2 were induced by RANKL. This induction was obviated in RORα knockout cells (Figure 22a-b). Consistent with the mRNA data, the protein expression levels of c-Jun and Fra-2 were similarly decreased after RORα knockout (Figure 22e).

Fra2

Fra2 10 a) b) ** * w /oRANKLc) 10 8 + RANKL ** * w /oRANKL RANKL + SR3335 8 6 + RANKL RANKL + SR1001 RANKL + SR3335 4 2.0 6 * RANKL4 + SR1001* 5 ** * * mRNA Fra-2 4 xfoldin change 2 4 1.5 mRNA Fra-2 0 3

xfoldin change 2

mRNA

mRNA 1.0 2

Jun Jund

0.5 Junb 1 x fold x change in x fold x change in

x fold x change in 1

0.0 0 0

d) e) f)

10 * 8 * 5 * ** * 8 6 4

6 3

mRNA mRNA 4 mRNA 4

cFos Fosb

Fra-2 2

x foldx change in x fold x change in

2 foldx change in 1

0 0 0

g) h)

4 * * * RANKL+empty

3 RANKL+Jun Rorα RANKL+Jun+SR3335

promoter activity 2 RANKL+Jun+SR1001

cFos Jun 1 c-Jun

Fra-2 0

ß-actin x fold x change

Figure 21: RORα inhibitors suppress c-Jun and Fra-2 expression levels. (a-f) mRNA expression levels of AP-1 members (Jun, Fra-2, Junb, Fosb, cFos, Jund) after RANKL stimulation and RORα inhibition. (g) Protein expression levels of AP-1 members after RANKL stimulation and RORα inhibition. (h) Luciferase reporter assay of the Jun promoter in presence and absence of RORα inhibitors. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM

6 * LacZ Adv.

mRNA Cre Adv.

a)4 b) fra-2 15 * 6 *

2 mRNA

mRNA 10 4

fra-2 Jun

0 x-fold change in

5 2

Mcsf Rankl

0 0 x-fold change in

c) x-fold change in

Mcsf

Mcsf Rankl Rankl d)

3 1.5

mRNA mRNA

2 1.0

Jund cfos

1 0.5

0 x fold change in 0.0

x fold x change in

Mcsf

Rankl Rankl

Rorα

c-Jun

Fra-2

cFos

ß-actin

LacZAdv. CreAdv.

Figure 22: RORα knock-out suppresses c-Jun and Fra-2 expression. (a-d) mRNA expression levels of AP-1 members (Jun, Fra-2, Junb, Fosb, cFos, Jund) after RANKL stimulation and RORα knock-out. (e) Protein expression levels of RORα and AP-1 members (cJun, Fra-2, cFos, Jund) after RANKL stimulation and RORα knockout. Asterisk symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα over-expression enhances c-Jun and Fra-2 expression levels

Next, we aimed to confirm the importance of RORα to the AP-1 signaling during osteoclastogenesis. Therefore, we over-expressed RORα in osteoclast precursor cells using a RORα overexpressing adenovirus.

CD11b+ cells were infected with RORα overexpressing adenovirus or a LacZ adenovirus as control, before they were treated with MCSF and RANKL and cultured for 48 hours.

Real-time PCR analysis of AP-1 members illustrated a RORα-dependent induction of both c- Jun and Fra-2. Cells treated with both RANKL and RORα showed a synergistic effect with a 6-fold and 10-fold increase in c-Jun and Fra-2, respectively. Western blot results demonstrated that RORα could not induce the expression of AP-1 members when cells were only treated with M-CSF. When cells were treated with M-CSF and RANKL on the other hand, c-Jun and cFos expression levels were both elevated. This increased expression of c- Jun and Fra-2 was tremendously increased when cells were treated with both RANKL and RORα. The other AP-1 members however remained unaffected in cells over-expressing RORα (Figure 23a-f). Resembling the PCR results, western blot results showed increased expression of c-Jun and Fra-2 when treated with M-CSF and RANKL. The elevation was enhanced in cells over-expressing RORα (Figure 23g). The luciferase reporter assay showed that RORα could activate the Jun promoter (Figure 23h).

cJun

8 * cJun M-CSF + lacz 6 M-CSF + RORadv 8 * M-CSF + lacz RANKL + lacz 4 6 M-CSF + RORadv RANKL + RORadv a) mRNA cjun RANKL + lacz b) 2 c) 4 xfoldin change RANKL + RORadv 8 * 3 4 0

cjun mRNA cjun 2

mRNA

xfoldin change mRNA 6 mRNA 3

0 2

Jun

Jund junb 4 2 1 2 1

0 0

x fold changex in 0 x fold x change in d) fold x change in e) f)

15 ** 2.5 2.5

mRNA mRNA mRNA 2.0 2.0

Fosb Fra-2 cFos 1.5 1.5

1.0 1.0 5 0.5 0.5

0.0

0 x-fold change in 0.0

x fold x change in x fold changex in g) h) LacZ Adv. Rora Adv. 5 *

4 Rorα

promoter activity 3 cFos Jun 2 c-Jun 1 Fra-2 0

ß-actin x fold x change in

Figure 23: RORα over-expression enhances c-Jun and Fra-2 expression levels. (a-f) mRNA expression levels of AP-1 members after RANKL stimulation and RORα knock-out. (g) Protein expression levels of AP-1 members (c-Jun, Fra-2, cFos, Jund) after RANKL stimulation and RORα knockout. (h) Luciferase reporter assay of the Jun promoter in Rora overexpressing osteoclasts precursor cells. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001 Data is presented as the mean ± SEM.

RORα overexpression failed to compensate for c-Jun deficiency during osteoclastogenesis

To further illustrate the RORα dependency of the AP-1 signaling in osteoclastogenesis, we determined the outcome of c-Jun knock-down in RORα overexpressing osteoclast precursor cells. Parallel to the siRNA-mediated knock-down of c-Jun, the cells were transfected with either empty plasmid or a RORα expression plasmid. The siRNA knock-down and the RORα over-expression efficacy were determined by western blot and real-time PCR. At the protein level, an efficacy of 95% for c-Jun knock-down and of 80% for RORα overexpression was achieved (Figure 24 b).

Reduced numbers of osteoclasts were counted in the cells deficient of c-Jun. The osteoclast differentiation process remained altered even in cells over-expressing RORα (Figure 24a).

Levels of the osteoclast markers Trap, Cathepsin k and Nfatc1 after c-Jun knock-down and RORα over-expression were assessed using the real-time PCR. The mRNA levels of these markers were decreased in cells deficient of c-Jun. RORα over-expression in osteoclast precursor cells could not rescue the expression of any of the osteoclast markers (Figure 24c).

a) R+Jun siRNA R+Jun siRNA R+Jun siRNA R+n.t siRNA + empty plasmid + empty plasmid + RORA plasmid

n.t siRNA Jun siRNA b) c) Jun siRNA+empty.plasmid Jun siRNA+RORA plasmid 100 **

mRNA 100 1.5 ** * **

mRNA Rora

mRNA 80

60 1.0 Rora Jun c-Jun 60 40 Rorα 4 0.5 40 2 4

x-fold change in 0 ß-actin 2

0.0 x-fold change in 0 x-fold change in d)

2.0 ** 1.5 * 2.0 * * **

** * mRNA

mRNA ** 1.5 ** 1.5

mRNA 1.0 Trap Nfatc1 1.0 1.0 0.5

0.5 0.5

x fold x change in Cathepsin k

0.0 0.0 0.0

x-fold change in x-fold change in

Figure 23: RORα over-expression cannot compensate c-Jun knock-down (a) microphotographs of TRAP- stained cells after transfecting with Jun siRNA and over-expressing Rorα with an adenovirus at a magnification of 200x. (b) Western blot results of the samples described in a. (c) Real-time PCR analysis of Jun and Rora. (d) Real-time PCR results of osteoclast markers Nfatc1, Cathepsin k and Trap of Rorα overexpressing osteoclast precursor cells deficient of c.Jun. n=3 individual experiments. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

RORα binds to p300 and SP1 to regulate the transcription of c-Jun

EP300 (p300) and SP1 are known to regulate the promoter activity of target genes by binding to their enhancer regions. EP300 and SP1 promote recruitment of the basal transcription machinery to the promoter of target genes. A ROR response element (RORE) carrying the putative sequence AGGTCA could be detected in the Jun promoter. In silico Jun promoter binding site predictions showed that the binding sites of RORα, p300 and SP1 lie within 100bp (151-216) of the Jun promoter (Figure 25). This suggested that RORα, p300 and SP1 might undergo protein-protein interactions to bind to the Jun promoter.

Jun promoter

Figure 24: In silico predictions for RORα, p300 and SP1 binding sites to the Jun promoter. In silico prediction showed a RORa binding sites (TGAGGTCTCC 151-160), two SP1 binding sites (ACCCCGCGGA 162-171, and ACCGTCGCTC 171-180) and one p300 binding site (ACTTCGGAGTGTTCT post 202-216) within 100bp range. Predictions were carried out using http://jaspar.genereg.net/ and http://consite.genereg.net/ data bases.

We therefore hypothesized that p300 and SP1 might bind to RORα to form a c-Jun promoter activating complex. To test this hypothesis, first a co-immunoprecipitation assay was performed to show any protein-protein interaction between RORα, SP1 and p300.

Bands at 300kD for p300 and at 90kD for SP1 were observed indicating an interaction between these two proteins and RORα. The samples precipitated with IgG were free from any bands excluding unspecific signals (Figure 26a).

To further demonstrate the binding of RORα and SP1 to the Jun promoter in the presence and absence of RANKL, ChIP-assays were performed. ChIP-assays showed increased binding of Rorα and Sp1 to the Jun promoter upon stimulation of osteoclast precursors with M-CSF and RANKL as compared to cells incubated with M-CSF only (Figure 26b+c).

To confirm the activation of the Jun promoter through p300, Sp1 and Rorα, c-Jun reporter- assay was carried out. Non-transcribing siRNA was used as the control. Osteoclast precursor cells were treated with either p300 siRNA or Sp1 siRNA or both. The luciferase activity was measured at the luminometer and it equaled the Jun promoter activity. A reduction of the Jun promoter activity was detected with both p300 and Sp1 siRNAs. The decrease in Jun promoter activity was even further enhanced when cells were treated with both p300 and Sp1 siRNA (Figure 26d).

p300 Rorα

Sp1

ß-actin Rorα

IP:Rorα IP:IgG Input 8 * w/oRANKL 6 +RANKL b) c) 8 * 15 * 4 6 2 10

c-Jun mRNA 4 x fold x change in

0 mRNA mRNA 5 IP: ROR

Jun 2

Jun

x fold x change in x fold changex in 0 0 IP: Rora IP: Sp1

** 1.5 *** *** d) *** Empty RANKL+n.t siRNA 1.0

R+p300 siRNA promorer activity

R+Sp1 siRNA Jun 0.5 R+p300+Sp1 siRNA

0.0 x-fold change in Figure 25: Rorα binds to p300 and SP1 to build a cJun transcription regulating complex (a) Co-IP results showing a protein-protein interaction between RORα, p300 and SP1. (b+c) ChIP- assay results showing increased binding efficacy of Sp1 and Rorα to Jun promoter after RANKL stimulation. (d) Jun promoter activity of osteoclasts precursor cells after p300, Sp1 and (p300+Sp1) siRNA knock-down n=3 individual experiments. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

Ep300 and Sp1 siRNA knock-down inhibit osteoclastogenesis even in the presence of RORα

Having established that p300 and Sp1 both bind to Rorα to form a Jun-promoter regulating complex, we next wanted to know if osteoclast precursor cells deficient of p300 or SP1 would show altered osteoclast differentiation even in RORα over-expressing cells. Specific siRNA sequences were used to knock-down p300 and Sp1 in osteoclast precursor cells. TRAP staining was carried out to visualize osteoclasts. Additionally, real-time PCR and western blot analysis were done to determine levels of osteoclast markers at both mRNA and protein levels respectively. A knock-down efficacy of 90% and 85% for p300 and Sp1 respectively was achieved.

TRAP-staining of cells treated with control siRNA showed normal osteoclast differentiation with normal osteoclast counts per well and of normal size (average of 15 nuclei per cell). On the contrary, cells deficient of either p300 or SP1 showed a decreased number of osteoclasts. The few osteoclasts were smaller in size with an average of four nuclei per cell (Figure 27b).

Sp1 knock-down was not sufficient to suppress the expression of Nfatc1, whereas p300 knock-down inhibited Nfatc1 expression almost to the baseline. Combined knockdown of p300 and SP1 completely abrogated the expression of Nfatc1. Unlike Nfatc1, the expression of Cathepsin-k was diminished in cells deficient of either p300 or Sp1 whereas the inhibition was prevented in cells deficient of both p300 and Sp1 (Figure 27c).

R+n.tR+n.t siRNA+ siRNA+LaczLaczAdv.Adv. R+Sp1R+Sp1 siRNA+ siRNA+LaczLacz Adv. Adv. a) R+n.tR+n.t siRNA+ siRNA+RoraRora Adv. Adv. R+Sp1R+Sp1 siRNA+ siRNA+RoraRora Adv. Adv. R+p300R+p300 siRNA+ siRNA+LaczLaczAdv.Adv. R+p300R+p300 siRNA+ siRNA+LaczLacz Adv. Adv. R+p300R+p300 siRNA+Rora siRNA+Rora Adv. Adv. R+p300R+p300 siRNA+ siRNA+RoraRora Adv. Adv. 8 8 15 8 8 6 6 10

6 6 mRNA

mRNA 4 4

mRNA mRNA

Sp1 5 mRNA

4 4 Rora p300 2 fold x change in

2 fold changex in

x fold changex in Sp1 2 Sp1

x fold changex in 2 0 fold changex in 0 0 LacZ Rora b) 0 0 Adv. Adv. c)

+p300 siRNA +p300 siRNA

p300

Sp1

+RANKL +Sp1 siRNA +Sp1 siRNA Rorα

Nfatc1

Cathepsin k

c-Jun

+p300 siRNA +p300 siRNA β-actin +Sp1 siRNA +Sp1 siRNA +RANKL

Figure 26: SP1 and p300 knock-down inhibits osteoclastogenesis even in the presence of Rorα. (a) Real-time PCR results of SP1- and p300-deficient osteoclasts infected with a Rorα over-expressing virus or LacZ adenovirus as control. (b) TRAP-staining microphotographs of SP1- and p300-deficient osteoclasts at a magnification of 200x. (c) Western-blot results of SP1- and p300-deficient osteoclasts over-expressing Rorα. Asterisks symbol p-value represents: *p≤0.05, **p≤0.01, ***p≤0.001. Data is presented as the mean ± SEM.

Discussion

5. DISCUSSION

Bone remodeling is a dynamic process of cellular components to maintain the integrity and the microarchitecture of the bone. Osteoclasts and osteoblasts are the major cells responsible for bone formation and resorption respectively. Osteoclasts and osteoblasts work sequentially on the same bone remodeling unit to attain a balance between bone formation and resorption. Whereas osteoblasts are of mesenchymal origin, osteoclasts differentiate from hematopoietic mononuclear cells into gigantic multi-nuclear bone resorbing cells in an opaque series of poorly understood steps. Bone disorders like rheumatoid arthritis and osteoporosis manifest a phenotype of feeble and weaker bones which are prone to fracture. This phenotype reflects an imbalance in bone turnover with bone resorption transcending bone formation [102, 103].

Intensive research over the last decades on immunopathogenesis of rheumatoid arthritis has provided a deeper insight into the immunological properties of the disease. The osteopathogenesis of rheumatoid arthritis, however, remains poorly understood. Studies on the new research field of osteoimmunology have described a close link between immune cells and the bone. Immune cells produce cytokines like TNFα, RANKL, IL-1, which in turn regulate bone remodeling cells. Targeting TNFα and IL-1 has remained the best therapeutic approach to alleviate rheumatoid arthritis symptoms [104].

RORα has been implicated in a number of physiological and pathological processes. Besides regulating glucose and lipid metabolisms, RORα also plays an important role in the circadian rhythm and inflammation. Accumulating evidence shows that RORα is involved in the differentiation of Th17 and ILC-2 cells [105]. A naturally occurring RORα mutant mouse displays an osteopenia bone phenotype manifested through long, thin bones. Benderdour et al identified RORα1 as a metabolic activity modulator of osteoblasts [96, 106]. Since little is known about the expression and role of RORα in osteoclasts, we initiated this study to investigate the importance of RORα in osteoclastogenesis and to further analyze the effects of RORα inhibition on the bone phenotype of rheumatoid arthritis and osteoporosis murine models.

Discussion

RORα is upregulated in osteoclasts of rheumatoid arthritis and osteoporosis bones as well as during osteoclastogenesis

RORα is widely expressed in various tissues including the skeletal muscle, testis, kidney, adipocytes, thymus, lens, retina, and the Purkinje cells of the cerebellum [78, 81, 107, 108]. The increment of RORα expression levels detected in osteoclasts of arthritic and osteoporotic bone could not only be due to increased RORα expression in the osteoclasts of these mice, but also due to increased osteoclast counts. Nevertheless, co-expression of RORα and TRAP in osteoclasts insinuates a functionality of RORα in these cells.

Elevated expression levels of RORα during the early stages of osteoclast differentiation suggests that RORα might play a role in the early but not the late stages of osteoclastogenesis, which is evidenced by a diminished expression level of RORα in mature osteoclasts. We further demonstrate a RANKL-dependent RORα upregulation in CD11b+ cells. RANKL is one of the essential and major cytokines that drive osteoclastogenesis [109, 110]. The regulation of RORα expression by RANKL and the peaked expression levels of RORα 60 hours after RANKL stimulation imply a role of RORα in the differentiation process of osteoclast precursor cells.

In this study, we used two small chemical molecules to suppress ROR activity in osteoclast precursor cells: SR3335, which is a RORα specific inhibitor and SR1001, which inhibits both RORα and RORγ, [65, 93, 111]. The advantage of targeting RORα via small molecule reverse agonists was their specificity and the tolerability both in vitro and in vivo. Despite a low promiscuity degree of these compounds, they show high efficacy even at low concentrations.

CD11b+ hematopoietic cells treated with RORα inhibitors yield less osteoclasts compared to untreated cells. The numbers of TRAP+ cells as well as the mRNA and protein levels of the osteoclast markers Oscar, Nfatc1, Cathepsin-k and Trap were distinctly reduced in cells treated with ROR inhibitors. ROR inhibitors could suppress osteoclastogenesis in a dose- dependent manner, which confirms a treatment-dependent effect. Similarly, genetic ablation of RORα in CD11b+ hematopoietic cells abrogated osteoclastogenesis resulting in immature non-functional osteoclasts. This functional deficit of osteoclast precursor cells can therefore be directly linked to RORα deficiency.

Discussion

Osteoclastogenesis is a complex and sophisticated process composed of the differentiation and the maturation steps. Inhibition of RORα post differentiation stages does not affect their maturation and fusion processes. Conversely, inhibition of RORα prior to cell differentiation attenuated osteoclastogenesis. This implies that RORα is involved in the differentiation rather than the maturation processes of osteoclastogenesis. It is worth noting that both SR3335 and SR1001 do not interfere with ROR expression, but rather interrupt their function. Moreover, both inhibitors display similar results, excluding any compensation of RORα through RORγ when only RORα was inhibited by SR3335.

RORα inhibition ameliorates arthritis and osteoporosis in different mouse models

Suppression of osteoclast differentiation and activity is an important approach in the treatment of bone loss. Serum-induced arthritis and hTNFα transgenic mice display a phenotype which mimics rheumatoid arthritis in humans. The phenotype consists of inflammatory and bone loss parameters. Ovariectomy of female C57BL/6J mice induces bone loss similar to the human post-menopausal osteoporosis. Therefore we used these three mouse models to analyze the clinical outcome of targeting RORα in vivo.

K/BxN serum contains auto-antibodies against glucose-6-phosphate isomerase (GPI). These antibodies form complexes, which are then deposited at the synovial tissue, promoting recruitment of inflammatory cells and leading to inflammation and bone loss. C57BL/6J wildtype mice treated with K/BxN serum showed decreased bone mineral density (BMD), trabecular thickness and trabecular numbers compared to mice treated with control serum. Mice treated with RORα inhibitors parallel to K/BxN serum however, showed resistance to bone loss. Additionally, K/BxN serum-treated mice displayed ankle joint swellings due to increased synovial tissue hyperplasia. The swelling of the paws lead to decreased grip strength. RORα inhibition protects mice from both swelling and loss of grip strength. There were less osteoclasts as well as inflammatory infiltrates in the bone of RORα inhibitor-treated mice compared to non-treated mice. These results reveal a protective role of RORα inhibitors against antibody-complex induced inflammation and bone loss. The protective effect of RORα inhibitors against bone loss can be traced back to the inhibition of osteoclastogenesis, since bones from these mice also showed a reduced number of osteoclasts. Besides antibody- complex dispositions at the joints, there are several other causes of joint inflammation and bone loss. These results however, cannot exclude the involvement of inflammatory factors in the protective effect of RORα inhibitors on bone loss. Similar to reduced bone loss, these

100

Discussion mice also showed reduced inflammatory infiltration. It is widely known that inflammatory factors like TNFα and IL-1 can induce bone loss. Furthermore, these cytokines are known to increase RANKL activity.

Human-TNF-alpha transgenic mice that overexpress hTNFα, are used as a model not only for inflammation but also for bone loss, the two major parameters of rheumatoid arthritis. hTNFα transgenic mice start displaying a rheumatoid arthritis mimicking phenotype at 4 weeks of age. Bone loss and inflammation were found to be improved when these mice were treated with RORα inhibitors. Indeed, there was a significant improvement of clinical parameters (joint swelling and grip strength) when mice were treated with RORα inhibitors. The improved phenotype correlates with reduced osteoclasts and decreased inflammatory infiltrates.

In both mouse models, RORα inhibition protects mice from both inflammation and bone loss. These two mouse models represent an inflammation-driven disease course. To determine whether RORα inhibition is inflammation dependent, we performed in vivo analyses using a non-inflammatory bone loss mouse model, the ovariectomy (OVX) model, which mimics the post-menopausal osteoporosis in humans. Osteoporosis is characterized by decreased bone mass and impairment of bone architecture leading to fragile and weaker bone prone to fractures. The removal of ovaries from C57BL/6J wildtype mice decreases estrogen production causing hormonal-induced bone loss. Similar to the inflammation-driven models, the osteoclast number was declined in the bones from mice treated with RORα inhibitors. Despite the absence of inflammatory factors, OVX mice were protected from bone loss after treatment with RORα inhibitors. This data exclude a mere inflammation-dependent activity of RORα inhibitors; rather, it demonstrates that the presence and absence of inflammatory cytokines have no effects on the protective measures of RORα inhibitors against bone loss.

The disadvantage of RORα inhibition by intraperitoneal injection of the small molecule repressors SR3335 and SR1001 is, that they induce a systemic effect. It is therefore intricate to trace the effector cells of RORα inhibitors responsible for the bone loss protection. On this account, we generated a Rora fl/fl/ Lysm-Cre mouse where RORα was specifically deleted in osteoclasts.

101

Discussion

RORα regulates osteoclastogenesis through c-Jun

Osteoclastogenesis can be regulated through a number of RANKL-dependent pathways. RANKL is a member of the TNFα superfamily and is produced by stromal cells and osteoblasts. RANKL exhibits its function by binding to the membrane bond receptor RANK on osteoclast precursor cells where it induces osteoclastogenesis through NFkB, MAPK and AP-1 pathways.

Inhibition of RORα, both chemically using SR3335 and SR1001 as well as genetically, resulted in suppressed AP-1 expression. Supporting results were observed when RORα is overexpressed by adenovirus. However, not all AP-1 members were suppressed by RORα inhibitors or enhanced by the Rorα adenovirus, but the effect was restricted to c-Jun and Fra- 2. RORα regulates the expression of c-Jun by binding to the Ror response element (RORE) and activating its promoter. RORα overexpression in c-Jun-deficient osteoclast precursor cells did not rescue the abrogated osteoclastogenesis. This suggests that RORα solely is not sufficient to enhance osteoclastogenesis. The enhanced osteoclastogenesis by RORα is c-Jun- dependent. Co-immunoprecipitation results showed that RORα forms a transcription regulating complex with SP1 and p300 which then binds to the c-Jun promoter and enhances c-Jun expression. It has been reported that c-Jun regulates the expression of Nfatc1, which is the major transcription factor in osteoclastogenesis [103]. Nfatc1 was not down regulated by Sp1 knock down, but to a certain extent enhanced. This might be because Nfatc1 is also regulated through other c-Jun independent pathways (Wnt, NFκB) which could compensate the Sp1 deficiency [104, 105]. c-Jun autoregulates itself and other AP-1 family members by binding on the AP-1 DNA binding site. This explains the observed elevated Fra-2 expression upon overexpression of RORα and the decrease in FRA2 levels upon inhibition of RORα. The Fra-2 promoter does not have a RORα binding element (RORE) and therefore no direct regulation through RORα was expected [106].

102

Conclusion

6. CONCLUSION

Bone is in a constant state of remodeling to maintain a balance between bone formation and bone erosion. Constitutive activation of RANKL signaling leads to enhanced osteoclastogenesis and hence increased bone resorption. Bone loss is a hallmark of arthritis and osteoporosis. Accumulating evidence has stated a crosslink between bone and the inflammatory system. Numerous publications have linked pathways like RANKL/OPG, canonical Wnt and TNFα to the regulation of inflammation and bone homeostasis.

Our findings convey a new role of RORα in regulating early stages of osteoclastogenesis. Besides, we show that the expression of RORα in osteoclast precursors is RANKL dependent and the regulation of osteoclastogenesis by RORα is c-Jun dependent. Our in vitro data show that RORα inhibitors can suppress osteoclastogenesis. RORα is highly expressed in osteoclasts of arthritic and osteoporotic bone in comparison to normal bone. With the help of different mouse models, we show that inhibition of RORα protects mice from both inflammatory as well as non-inflammatory bone loss. In addition to improving bone quality, RORα-inhibitors also decrease inflammation in arthritic mice.

Our data opens a novel area of focus in search for effective therapies against bone loss. Targeting RORα as a downstream molecule of RANKL might prove to be more effective and with fewer side effects than the therapies available in the market today. RORα inhibitors are already in clinical trials and are well tolerated in humans too. Further analyses to attain a cell- specific delivery will be needed to optimize the efficacy of the inhibitors.

103

Appendices

7. APPENDICES

7.1 Abbreviations

ALP: Alkaline phosphatase

AP-1: activating protein-1

BMT: bone marrow transplantation

BMU: basic multicellular unit

BSA: bovine serum albumin

µ-CT: microcomputed tomography

ChIP: Chromatin immunoprecipitation

CoIP: Co-immunoprecipitation

DAPI: 4’-6-Diamindino-2-phenylindole

DMEM: dulbecco's modified eagle's medium

DMSO: dimethylsulfoxid

DNA: deoxyribonucleic acid dNTPs: desoxyribonukleosidtriphosphate

ECL: enhanced chemiluminescence

ECM: extracellular matrix

EDTA: ethylenediaminetetraacetic acid

EtOH: ethanol

GH: growth hormone hTNF tg: human tumor necrosis factor alpha transgenic

MeOH: methanol

104

Appendices

MSCs: mesenchymal stem cells

Nfatc1: Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1

NFkB: nuclear factor kappa-light-chain-enhancer of activated B cells

OA: osteoarthritis

OCN: osteocalcin

OPG: Osteoprotegerin

OPN: osteopontin

OSCAR: Osteoclast-associated immunoglobulin-like receptor

OSX: osterix

OVX: ovariectomy

P300 [EP300]: Protein 300

PBMC: peripheral blood mononuclear cell

PBS: phosphate buffered saline

PCR: polymerase chain reaction

PVDF: polyvinylidenfluorid

PTH: parathyroid hormone

PTHrP: Parathryroid hormone-related protein

RA: rheumatoid arthritis

RANKL: receptor activator of NF-κB ligand

RNA: ribonucleic acid

ROR: Retinoid receptor related orphan receptor

Runx2: Runt-related transcription factor 2

SDS: sodium dodecyl sulfate

105

Appendices

SP1: specificity protein 1

TEMED: N,N,N',N'-Tetramethylethylendiamin

TNF: tumour-necrosis factor

Tris: tris(hydroxymethyl)aminomethane

TGFβ: Transforming growth factor beta

TRAP: tartrate resistant acid phosphatase

TRAF6: TNF receptor associated

7.2 List of Tables

Table 1: RORα natural and synthetic ligands...... 29 Table 2:Chemicals ...... 36 Table 3: Auxiliary materials ...... 39 Table 4: Instruments ...... 39 Table5: Commercially available systems (kits) ...... 41 Table 6: Antibodies ...... 41-42 Table 7: Commercially available cytokines and inhibitors...... 42 Table 8: Primers and siRNA ...... 43-46 Table 9: Human samples ...... 46

106

Appendices

7.3 List of Figures

Figure 1: Structure of cortical bone ...... 14 Figure 2: Osteoblastogenesis: Ihh initiates ostoblastogenesis...... 15 Figure 3: Osteoclastogenesis...... 17 Figure 4: Schematic diagram of endochondral ossification ...... 19 Figure 5: Trabecular Vs Cortical bone remodeling ...... 21 Figure 6: Structural organization of ROR functional domains...... 28 Figure 7 : RORα expression in human and murine osteoclasts...... 62 Figure 8: RORα is upregulated during osteoclastogenesis...... 64 Figure 9: RORα inhibitors suppress osteoclastogenesis in a dose-dependent manner ...... 66 Figure 10: RORα inhibitors suppress osteoclasts bone resorbing efficacy...... 67 Figure 11: Genetic ablation of RORα suppresses osteoclast differentiation and function...... 69 Figure 12: RORα overexpression enhances Osteoclastogenesis...... 71 Figure 13: RORα inhibitors affect early stages of osteoclastogenesis ...... 73 Figure 14: RORα inhibitors protect mice from ovariectomy-induced osteoporosis ...... 75 Figure 15: RORα inhibitors ameliorate serum induced arthritis...... 77 Figure 16: RORα inhibitors ameliorate serum-induced arthritis...... 78 Figure 17: RORα inhibitors ameliorate arthritis in hTNFtg mice...... 80 Figure 18: RORα inhibitors ameliorate hTNF-induced arthritis...... 81 Figure 19: RORα-deficient bone marrow cells protect mice from serum-induced arthritis...... 83 Figure 20: RORα-deficient bone marrow cells protect mice from serum-induced arthritis...... 84 Figure 21: RORα inhibitors suppress c-Jun and Fra-2 expression levels ...... 87 Figure 22: RORα knock-out suppresses c-Jun and Fra-2 expression...... 88 Figure 23: RORα over-expression cannot compensate c-Jun knock-down...... 92 Figure 24: In silico predictions for RORα, p300 and SP1 binding sites to the Jun promoter...... 93 Figure 25: Rorα binds to p300 and SP1 to build a cJun transcription regulating complex...... 95 Figure 26: SP1 and p300 knock-down inhibits osteoclastogenesis even in the presence of Rorα ...... 97

107

References

8. REFERENCES

1. Boyle, W.J., W.S. Simonet, and D.L. Lacey, Osteoclast differentiation and activation. Nature, 2003. 423(6937): p. 337-342.

2. Simonet, W.S., et al., Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell, 1997. 89(2): p. 309-19.

3. Niedzwiedzki, T. and J. Filipowska, Bone remodeling in the context of cellular and systemic regulation: the role of osteocytes and the nervous system. J Mol Endocrinol, 2015. 55(2): p. R23-36.

4. Martinez-Reina, J., J. Ojeda, and J. Mayo, On the Use of Bone Remodelling Models to Estimate the Density Distribution of Bones. Uniqueness of the Solution. PLoS One, 2016. 11(2): p. e0148603.

5. Robinson, R.A., Bone tissue: composition and function. Johns Hopkins Med J, 1979. 145(1): p. 10-24.

6. Doblare, M. and J.M. Garcia, On the modelling bone tissue fracture and healing of the bone tissue. Acta Cient Venez, 2003. 54(1): p. 58-75.

7. Hauge, E.M., et al., Cancellous bone remodeling occurs in specialized compartments lined by cells expressing osteoblastic markers. J Bone Miner Res, 2001. 16(9): p. 1575-82.

8. Parfitt, A.M., Osteonal and hemi-osteonal remodeling: the spatial and temporal framework for signal traffic in adult human bone. J Cell Biochem, 1994. 55(3): p. 273-86.

9. Reznikov, N., R. Shahar, and S. Weiner, Three-dimensional structure of human lamellar bone: the presence of two different materials and new insights into the hierarchical organization. Bone, 2014. 59: p. 93-104.

10. Martin, R.B., Porosity and specific surface of bone. Crit Rev Biomed Eng, 1984. 10(3): p. 179-222.

11. Sims, N.A. and T.J. Martin, Coupling the activities of bone formation and resorption: a multitude of signals within the basic multicellular unit. Bonekey Rep, 2014. 3: p. 481.

108

References

12. Ducy, P., et al., Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell, 1997. 89(5): p. 747-54.

13. Towler, D.A., C.D. Bennett, and G.A. Rodan, Activity of the rat osteocalcin basal promoter in osteoblastic cells is dependent upon homeodomain and CP1 binding motifs. Mol Endocrinol, 1994. 8(5): p. 614-24.

14. Ducy, P. and G. Karsenty, Two distinct osteoblast-specific cis-acting elements control expression of a mouse osteocalcin gene. Mol Cell Biol, 1995. 15(4): p. 1858-69.

15. Nakashima, K., et al., The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell, 2002. 108(1): p. 17-29.

16. Miyama, K., et al., A BMP-inducible gene, dlx5, regulates osteoblast differentiation and mesoderm induction. Dev Biol, 1999. 208(1): p. 123-33.

17. Lee, K.S., et al., Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol, 2000. 20(23): p. 8783-92.

18. Blair, H.C., et al., The developmental basis of skeletal cell differentiation and the molecular basis of major skeletal defects. Biol Rev Camb Philos Soc, 2008. 83(4): p. 401-15.

19. Divieti Pajevic, P., Recent progress in osteocyte research. Endocrinol Metab (Seoul), 2013. 28(4): p. 255-61.

20. Bonewald, L.F., The amazing osteocyte. J Bone Miner Res, 2011. 26(2): p. 229-38.

21. Yang, X., et al., ATF4 is a substrate of RSK2 and an essential regulator of osteoblast biology; implication for Coffin-Lowry Syndrome. Cell, 2004. 117(3): p. 387-98.

22. Zhang, C., Transcriptional regulation of bone formation by the osteoblast-specific transcription factor Osx. J Orthop Surg Res, 2010. 5: p. 37.

23. Drissi, H. and A. Sanjay, The Multifaceted Osteoclast; Far and Beyond Bone Resorption. J Cell Biochem, 2016.

24. Gruber, R., Molecular and cellular basis of bone resorption. Wien Med Wochenschr, 2015. 165(3-4): p. 48-53.

109

References

25. Fischman, D.A. and E.D. Hay, Origin of osteoclasts from mononuclear leucocytes in regenerating newt limbs. Anat Rec, 1962. 143: p. 329-37.

26. Xiong, J., et al., Matrix-embedded cells control osteoclast formation. Nat Med, 2011. 17(10): p. 1235-41.

27. Zhao, B. and L.B. Ivashkiv, Negative regulation of osteoclastogenesis and bone resorption by cytokines and transcriptional repressors. Arthritis Res Ther, 2011. 13(4): p. 234.

28. Cserjesi, P., et al., Scleraxis: a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development, 1995. 121(4): p. 1099-110.

29. Maes, C., Signaling Pathways Effecting Crosstalk Between Cartilage and Adjacent Tissues: SEMINARS IN CELL AND DEVELOPMENTAL BIOLOGY: THE BIOLOGY AND PATHOLOGY OF CARTILAGE. Semin Cell Dev Biol, 2016.

30. Horton, W.A., et al., Tissue and cell studies of the growth plate in the chondrodysplasias. Am J Med Genet, 1989. 34(1): p. 91-5.

31. Everts, V., et al., The bone lining cell: its role in cleaning Howship's lacunae and initiating bone formation. J Bone Miner Res, 2002. 17(1): p. 77-90.

32. Petrtyl, M., J. Hert, and P. Fiala, Spatial organization of the haversian bone in man. J Biomech, 1996. 29(2): p. 161-9.

33. Srivastava, S., et al., Estrogen decreases osteoclast formation by down-regulating receptor activator of NF-kappa B ligand (RANKL)-induced JNK activation. J Biol Chem, 2001. 276(12): p. 8836-40.

34. Wang, J., et al., Evidence supporting dual, IGF-I-independent and IGF-I-dependent, roles for GH in promoting longitudinal bone growth. J Endocrinol, 2004. 180(2): p. 247-55.

35. Kobayashi, K., et al., Tumor necrosis factor alpha stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J Exp Med, 2000. 191(2): p. 275-86.

36. Saeed, J., et al., IL-37 inhibits lipopolysaccharide-induced osteoclast formation and bone resorption in vivo. Immunol Lett, 2016. 175: p. 8-15.

110

References

37. Scott, D.L., F. Wolfe, and T.W. Huizinga, Rheumatoid arthritis. Lancet, 2010. 376(9746): p. 1094-108.

38. van der Woude, D., et al., Quantitative heritability of anti-citrullinated protein antibody-positive and anti-citrullinated protein antibody-negative rheumatoid arthritis. Arthritis Rheum, 2009. 60(4): p. 916-23.

39. Barton, A. and J. Worthington, Genetic susceptibility to rheumatoid arthritis: an emerging picture. Arthritis Rheum, 2009. 61(10): p. 1441-6.

40. Orozco, G., et al., Association of CD40 with rheumatoid arthritis confirmed in a large UK case-control study. Ann Rheum Dis, 2010. 69(5): p. 813-6.

41. Stahl, E.A., et al., Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci. Nat Genet, 2010. 42(6): p. 508-14.

42. Huizinga, T.W., et al., Refining the complex rheumatoid arthritis phenotype based on specificity of the HLA-DRB1 shared epitope for antibodies to citrullinated proteins. Arthritis Rheum, 2005. 52(11): p. 3433-8.

43. Hill, J.A., et al., Cutting edge: the conversion of arginine to citrulline allows for a high-affinity peptide interaction with the rheumatoid arthritis-associated HLA-DRB1*0401 MHC class II molecule. J Immunol, 2003. 171(2): p. 538-41.

44. van der Linden, M.P., et al., Value of anti-modified citrullinated vimentin and third- generation anti-cyclic citrullinated peptide compared with second-generation anti-cyclic citrullinated peptide and rheumatoid factor in predicting disease outcome in undifferentiated arthritis and rheumatoid arthritis. Arthritis Rheum, 2009. 60(8): p. 2232-41.

45. Gravallese, E.M., et al., Identification of cell types responsible for bone resorption in rheumatoid arthritis and juvenile rheumatoid arthritis. Am J Pathol, 1998. 152(4): p. 943-51.

46. Wagner, E.F., AP-1--Introductory remarks. Oncogene, 2001. 20(19): p. 2334-5.

47. Eferl, R. and E.F. Wagner, AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer, 2003. 3(11): p. 859-68.

48. Wagner, E.F., Bone development and inflammatory disease is regulated by AP-1 (Fos/Jun). Ann Rheum Dis, 2010. 69 Suppl 1: p. i86-88.

111

References

49. Shaulian, E. and M. Karin, AP-1 as a regulator of cell life and death. Nat Cell Biol, 2002. 4(5): p. E131-6.

50. Ruther, U., et al., Deregulated c-fos expression interferes with normal bone development in transgenic mice. Nature, 1987. 325(6103): p. 412-6.

51. Wang, Z.Q., et al., A novel target cell for c-fos-induced oncogenesis: development of chondrogenic tumours in embryonic stem cell chimeras. Embo j, 1991. 10(9): p. 2437-50.

52. Thomas, D.P., et al., Inhibition of chondrocyte differentiation in vitro by constitutive and inducible overexpression of the c-fos proto-oncogene. J Cell Sci, 2000. 113 ( Pt 3): p. 439-50.

53. Wagner, E.F. and R. Eferl, Fos/AP-1 proteins in bone and the immune system. Immunol Rev, 2005. 208: p. 126-40.

54. Jochum, W., et al., Increased bone formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nat Med, 2000. 6(9): p. 980-4.

55. Bozec, A., et al., Osteoblast-specific expression of Fra-2/AP-1 controls adiponectin and osteocalcin expression and affects metabolism. J Cell Sci, 2013. 126(Pt 23): p. 5432-40.

56. Bozec, A., et al., Fra-2/AP-1 controls bone formation by regulating osteoblast differentiation and collagen production. J Cell Biol, 2010. 190(6): p. 1093-106.

57. Behrens, A., et al., intervertebral disc formation in the absence of Jun. Development, 2003. 130(1): p. 103-109.

58. Hai, T., et al., ATF3 and stress responses. Gene Expr, 1999. 7(4-6): p. 321-35.

59. Ramo, K., et al., Suppression of ischemia in arterial occlusive disease by JNK- promoted native collateral artery development. Elife, 2016. 5.

60. Jiang, Z., et al., Transcription factor c-jun regulates beta3Gn-T8 expression in gastric cancer cell line SGC-7901. Oncol Rep, 2016. 36(3): p. 1353-60.

61. Kumar, R., N.K. Singh, and G.N. Rao, Proline-rich tyrosine kinase 2 via enhancing signal transducer and activator of transcription 3-dependent cJun expression mediates retinal neovascularization. Sci Rep, 2016. 6: p. 26480.

112

References

62. Zhang, Y.H., et al., Tumor necrosis factor-alpha (TNF) stimulates RANKL-induced osteoclastogenesis via coupling of TNF type 1 receptor and RANK signaling pathways. J Biol Chem, 2001. 276(1): p. 563-8.

63. Karin, M., et al., Various modes of gene regulation by nuclear receptors for steroid and thyroid hormones. Eur J Clin Pharmacol, 1993. 45 Suppl 1: p. S9-15; discussion S43-4.

64. Sever, R. and C.K. Glass, Signaling by nuclear receptors. Cold Spring Harb Perspect Biol, 2013. 5(3): p. a016709.

65. Glass, C.K., Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev, 1994. 15(3): p. 391-407.

66. Mangelsdorf, D.J., et al., The nuclear receptor superfamily: the second decade. Cell, 1995. 83(6): p. 835-9.

67. Solt, L.A. and T.P. Burris, Action of RORs and their ligands in (patho)physiology. Trends Endocrinol Metab, 2012. 23(12): p. 619-27.

68. Giguere, V., et al., Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR alpha, a novel family of orphan hormone nuclear receptors. Genes Dev, 1994. 8(5): p. 538-53.

69. Tuong, Z.K., et al., RORalpha and 25-Hydroxycholesterol Crosstalk Regulates Lipid Droplet Homeostasis in Macrophages. PLoS One, 2016. 11(1): p. e0147179.

70. Medvedev, A., et al., Cloning of a cDNA encoding the murine orphan receptor RZR/ROR gamma and characterization of its response element. Gene, 1996. 181(1-2): p. 199- 206.

71. Jetten, A.M., S. Kurebayashi, and E. Ueda, The ROR nuclear orphan receptor subfamily: critical regulators of multiple biological processes. Prog Nucleic Acid Res Mol Biol, 2001. 69: p. 205-47.

72. Kojetin, D.J. and T.P. Burris, REV-ERB and ROR nuclear receptors as drug targets. Nat Rev Drug Discov, 2014. 13(3): p. 197-216.

73. McKenna, N.J., R.B. Lanz, and B.W. O'Malley, Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev, 1999. 20(3): p. 321-44.

113

References

74. Becker-Andre, M., E. Andre, and J.F. DeLamarter, Identification of nuclear receptor mRNAs by RT-PCR amplification of conserved zinc-finger motif sequences. Biochem Biophys Res Commun, 1993. 194(3): p. 1371-9.

75. Carlberg, C., et al., RZRs, a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Mol Endocrinol, 1994. 8(6): p. 757-70.

76. He, Y.W., Orphan nuclear receptors in T lymphocyte development. J Leukoc Biol, 2002. 72(3): p. 440-6.

77. Zhang, Y., et al., ROR nuclear receptors: structures, related diseases, and drug discovery. Acta Pharmacol Sin, 2015. 36(1): p. 71-87.

78. Steinmayr, M., et al., staggerer phenotype in retinoid-related orphan receptor alpha- deficient mice. Proc Natl Acad Sci U S A, 1998. 95(7): p. 3960-5.

79. Giguere, V., et al., The orphan nuclear receptor ROR alpha (RORA) maps to a conserved region of homology on human chromosome 15q21-q22 and mouse chromosome 9. Genomics, 1995. 28(3): p. 596-8.

80. Matsui, T., et al., An orphan nuclear receptor, mROR alpha, and its spatial expression in adult mouse brain. Brain Res Mol Brain Res, 1995. 33(2): p. 217-26.

81. Matysiak-Scholze, U. and M. Nehls, The structural integrity of ROR alpha isoforms is mutated in staggerer mice: cerebellar coexpression of ROR alpha1 and ROR alpha4. Genomics, 1997. 43(1): p. 78-84.

82. Raichur, S., et al., Identification and validation of the pathways and functions regulated by the orphan nuclear receptor, ROR alpha1, in skeletal muscle. Nucleic Acids Res, 2010. 38(13): p. 4296-312.

83. Takeda, Y. and A.M. Jetten, Prospero-related homeobox 1 (Prox1) functions as a novel modulator of retinoic acid-related orphan receptors alpha- and gamma-mediated transactivation. Nucleic Acids Res, 2013. 41(14): p. 6992-7008.

84. Mamontova, A., et al., Severe atherosclerosis and hypoalphalipoproteinemia in the staggerer mouse, a mutant of the nuclear receptor RORalpha. Circulation, 1998. 98(24): p. 2738-43.

114

References

85. Jarvis, C.I., et al., Age-related phenotypes in the staggerer mouse expand the RORalpha nuclear receptor's role beyond the cerebellum. Mol Cell Endocrinol, 2002. 186(1): p. 1-5.

86. Meyer, T., et al., In vitro and in vivo evidence for orphan nuclear receptor RORalpha function in bone metabolism. Proc Natl Acad Sci U S A, 2000. 97(16): p. 9197-202.

87. Sotelo, C. and J.P. Changeux, Transsynaptic degeneration 'en cascade' in the cerebellar cortex of staggerer mutant mice. Brain Res, 1974. 67(3): p. 519-26.

88. Crepel, F., et al., Multiple innervation of cerebellar Purkinje cells by climbing fibres in staggerer mutant mouse. Nature, 1980. 283(5746): p. 483-4.

89. Mariani, J. and J.P. Changeux, Multiple innervation of Purkinje cells by climbing fibers in the cerebellum of the adult staggerer mutant mouse. J Neurobiol, 1980. 11(1): p. 41- 50.

90. Grechez-Cassiau, A., et al., The hepatic circadian clock regulates the choline kinase alpha gene through the BMAL1-REV-ERBalpha axis. Chronobiol Int, 2015. 32(6): p. 774-84.

91. Guillaumond, F., et al., Differential control of Bmal1 circadian transcription by REV- ERB and ROR nuclear receptors. J Biol Rhythms, 2005. 20(5): p. 391-403.

92. Cook, D.N., H.S. Kang, and A.M. Jetten, Retinoic Acid-Related Orphan Receptors (RORs): Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism. Nucl Receptor Res, 2015. 2.

93. Halim, T.Y., et al., Retinoic-acid-receptor-related orphan nuclear receptor alpha is required for natural helper cell development and allergic inflammation. Immunity, 2012. 37(3): p. 463-74.

94. Solt, L.A., et al., Suppression of TH17 differentiation and autoimmunity by a synthetic ROR ligand. Nature, 2011. 472(7344): p. 491-4.

95. Yang, X.O., et al., T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity, 2008. 28(1): p. 29-39.

96. Lau, P., et al., The orphan nuclear receptor, RORalpha, regulates gene expression that controls lipid metabolism: staggerer (SG/SG) mice are resistant to diet-induced obesity. J Biol Chem, 2008. 283(26): p. 18411-21. 115

References

97. Benderdour, M., et al., Nuclear receptor retinoid-related orphan receptor alpha1 modulates the metabolic activity of human osteoblasts. J Cell Biochem, 2011. 112(8): p. 2160-9.

98. Christensen, A.D., et al., K/BxN Serum-Transfer Arthritis as a Model for Human Inflammatory Arthritis. Frontiers in Immunology, 2016. 7(213).

99. Grigoriadis, A.E., et al., c-Fos: a key regulator of osteoclast-macrophage lineage determination and bone remodeling. Science, 1994. 266(5184): p. 443-8.

100. Matsumoto, M., et al., Involvement of p38 mitogen-activated protein kinase signaling pathway in osteoclastogenesis mediated by receptor activator of NF-kappa B ligand (RANKL). J Biol Chem, 2000. 275(40): p. 31155-61.

101. Miyazaki, T., et al., Src kinase activity is essential for osteoclast function. J Biol Chem, 2004. 279(17): p. 17660-6.

102. Komarova, S.V., et al., RANK ligand-induced elevation of cytosolic Ca2+ accelerates nuclear translocation of nuclear factor kappa B in osteoclasts. J Biol Chem, 2003. 278(10): p. 8286-93.

103. Shinohara, M. and H. Takayanagi, Analysis of NFATc1-centered transcription factor regulatory networks in osteoclast formation. Methods Mol Biol, 2014. 1164: p. 171-6.

104. Kobayashi, Y., et al., The regulation of osteoclast differentiation by Wnt signals. Bonekey Rep, 2015. 4: p. 713.

105. Mediero, A., M. Perez-Aso, and B.N. Cronstein, Activation of EPAC1/2 is essential for osteoclast formation by modulating NFkappaB nuclear translocation and actin cytoskeleton rearrangements. Faseb j, 2014. 28(11): p. 4901-13.

106. Fernandes, K.A., et al., JUN regulates early transcriptional responses to axonal injury in retinal ganglion cells. Exp Eye Res, 2013. 112: p. 106-17.

116

Acknowledgements

9. ACKNOWLEDGEMENTS

First of all, I would like to express my gratitude and appreciation to my advisor Professor Dr. Jörg Distler for his competent supervision, his unfailing support, time and his ever open door, for listening and applying my suggestions and ideas. His faith in me has helped me grow as a researcher and as a person. Similarly, I would like to express my heart felt gratitude to the head of Department of Medicine III, Professor Dr. Georg Schett, for the great opportunity to pursue my PhD in the department of rheumatology. I thank him for his invariable encouragement and support and for being my second referee for this thesis.

Special thanks go to Prof. Dr. Andreas Feigenspan for his willingness to supervise on behave of the Faculty of Natural Sciences, to serve as first referee and take chair for the oral exam and also to Prof. Dr. Lars Nitschke for accepting to be my first referee and examiner.

I would like to thank my cooperation partners; Prof. Dr. Thomas Burris for providing us with RORα inhibitors and plasmids, Prof. Dr. Dieter Engelkamp for generating Rora-flox mouse and Dr. Stefan Wirtz for providing the staggerer bone marrow cells. Furthermore, I thank the DFG-Immunobone and the CRC-1181 for the funding, collaborations and the support during meetings.

I thank my supervisors Neng and Katrin for their shared skills and intellect, for their patience and productive criticism. A special appreciation goes to my lab partner and friend Ruifang for all her work, time and effort in making this project a success. I specially thank Clara, Debbie and Simon for their splendid work in correcting this thesis. I thank our brilliant technicians, Rossella, Regina, Katja and Rita for their help and assistance and all members of the Distler and Ramming group for their daily support and established friendships.

Last but not least, I would like to share the credit with my family; my parents for sacrificing everything in order to send me to Germany and always expecting the best from me, my brothers Albert, Zachary and Zephania for their unconditional love and support, my Partner Tobi and his family for being my rock and my home far away from home and my precious daughter Vicky for her love, her understanding, her support and her kind heart.

117

Curriculum vitae

10. CURRICULUM VITAE

Personal information:

Name: Rosebeth Kagwiria Date of birth: 24/03/1982 Nationality: Kenyan Current address: Fleischmann Straße 1 91083, Baiersdorf Germany

Telephone: +49 15780559168 Email: [email protected]

Education:

2013-till now PhD Thesis: University Clinic Erlangen-Nuremberg (Med3)

2011-2012 Masters in molecular medicine: Friedrich-Alexander University Erlangen-Nuremberg

Bachelors in Molecular Medicine: Friedrich-Alexander 2007-2010 University Erlangen-Nuremberg

Human Medicine: Charité-Medicine Berlin 2003-2006

2002 Studien – Kolleg: Free University Berlin

2001 German language course: University of Rostock

2000 German Language course: Goethe Institute Nairobi- Kenya

1996-1999 High school: Precious blood Sec. School –Kilungu- Kenya

1988-1995 Primary School Education: St.John´s Boarding School- Kenya

118

Curriculum vitae

Research Projects:

2008 F1- Project: Pharmacological department (AG-König)

2009 F1-Project: Virology institute (AG-Stamminger)

2010 Bachelor Thesis: Department of Immunology (AG-David)

T cell costimulation molecules CD80/86 inhibit osteoclast differentiation by inducing the IDO/tryptophan pathway.

2011 F2-Project: Department of Bio-Informatics (AG-Sticht)

Master Thesis: Department of Rheumatology and Immunology 2012 (AG-Distler)

Evaluation of (RORα) as a novel regulator of osteoclastogenesis in rheumatoid arthritis and osteoporosis

2013-Todate PhD-Thesis: Department of Rheumatology and Immunology (AG- Distler)

1. Evaluation of (RORα) as a novel regulator of osteoclastogenesis in rheumatoid arthritis and osteoporosis 2. ROR-alpha as a key checkpoint for controlling inflammation and tissue repair

119

Curriculum vitae

Publications:

1. T cell costimulation molecules CD80/86 inhibit osteoclast differentiation by inducing the IDO/tryptophan pathway. Bozec A, Zaiss MM, Kagwiria R, Voll R, Rauh M, Chen Z, Mueller-Schmucker S, Kroczek RA, Heinzerling L, Moser M, Mellor AL, David JP, Schett G. Sci Transl Med. 2014 May 7;6(235):235ra60. doi: 10.1126/scitranslmed.3007764.PMID:24807557.

2. Inactivation of autophagy ameliorates glucocorticoid-induced and ovariectomy- induced bone loss. Lin NY, Chen CW, Kagwiria R, Liang R, Beyer C, Distler A, Luther J, Engelke K, Schett G, Distler JH. Ann Rheum Dis. 2016 Jun; 75(6):1203-10. doi: 10.1136/annrheumdis-2015-207240. Epub 2015 Jun 25. PMID: 26113650.

Language skills:

English Native speaker

German Fluent in writing and speech

Spanish Basic level

Kiswahili Mother Tongue

120

Curriculum vitae

121