DOCSLIB.ORG

Comparative Analysis of Chromosome 8 Copy Number in Paediatric Solid Tumours

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comparative Analysis of Chromosome 8 Copy Number in Paediatric Solid Tumours Comparative analysis of chromosome 8 copy number in paediatric solid tumours Nancy Martin La Rotta A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Molecular Oncology Group, Children’s Cancer Research Unit, Kids Research Institute, The Children’s Hospital at Westmead Discipline of Paediatrics and Child Health, Sydney Medical School 2017 Copyright © All rights reserved Table of contents Statement of originality viii Acknowledgments ix Abstract xi Publications arising from this thesis, by the author xv List of abbreviations xvi List of Tables xix List of Figures xxiii Chapter 1 Literature review 1 1. Introduction 2 1.1 General introduction to childhood cancer 2 1.1.1 Classification of tumours in children 2 1.1.2 Solid tumours of childhood 6 1.1.3 Neuroblastoma 6 1.1.4 Rhabdomyosarcoma 7 1.1.5 Ewing Sarcoma 9 1.1.6 Osteosarcoma 10 1.2 Cytogenetic changes in childhood cancers - relevance to prognosis 11 1.2.1 Introduction to cytogenetic changes in cancer 11 1.2.2. Cytogenetic changes in neuroblastoma 12 i 1.2.3. Cytogenetic changes in rhabdomyosarcomas 15 1.2.4. Cytogenetic changes in Ewing sarcoma 19 1.2.5. Cytogenetic changes in osteosarcoma 22 1.2.6 Cytogenetic changes relevant to cancer therapy 25 1.3 Technical approaches to detect copy number changes in cancer 26 1.3.1 Classical cytogenetics 26 1.3.2 Comparative Genomic Hybridization (CGH) and array CGH 30 1.3.2.1 Comparative Genomic Hybridization (CGH) 30 1.3.2.2 Array Comparative Genomic Hybridization (aCGH) 31 1.3.3 Multiplex Ligation-dependent Probe Amplification (MLPA) and Quantitative Polymerase Chain Reaction (qPCR) 34 1.3.3.1 Multiplex ligation-dependent probe amplification (MLPA) 35 1.3.3.2 MLPA and Cancer 37 1.3.3.3 Quantitative Polymerase Chain Reaction (qPCR) 40 1.4 Chromosome 8q gain in adult cancers 43 1.4.1 Breast cancer 43 1.4.2 Prostate cancer 44 1.4.3 Colorectal cancer 45 1.4.4 Human cancer cell lines 45 ii 1.5 Chromosome 8 gain in childhood cancers 46 1.5.1 Neuroblastoma 46 1.5.2 Rhabdomyosarcoma 49 1.5.3 Ewing Sarcoma 51 1.5.4 Osteosarcoma 53 1.6 Statement of the problem, hypothesis and aims of this research 55 1.6.1 Hypotheses 55 Chapter 2 Materials and Methods 57 2.1 Materials 58 2.2 Breast cell lines 59 2.3 Paediatric solid tumour cohort 59 2.4 Genomic DNA extraction from frozen tissues and cultured cells 62 2.5 Spectrophotometric and electrophoretic analysis of genomic DNA 63 2.6 Multiplex Ligation-dependent Probe Amplification (MLPA) 63 2.6.1 MLPA reactions (day 1) 64 2.6.2 MLPA reactions (day 2) 65 2.6.3 MLPA Fragment separation and peak pattern evaluation 66 2.6.4. Data analysis 67 iii 2.7 Array Comparative Genomic Hybridization (aCGH) 69 2.7.1 Array description 71 2.7.2 Sample preparation 71 2.7.3 Restriction digestion of test and reference DNA samples 71 2.7.4 Labeling of test and reference DNA samples 72 2.7.5 Clean-up of labelled DNA samples 73 2.7.6 Hybridization 73 2.7.7 Post-hybridization washing and scanning 74 2.7.8 Data analysis 74 2.8 Quantitative real-time Polymerase Chain Reaction (qPCR) 76 2.9 Statistical Analyses 77 Chapter 3 Analysis of chromosome 8 copy number in paediatric solid tumours using MLPA 78 3.1 Introduction 79 3.2 Aims for chapter 3 83 3.3 Results 84 3.3.1 Use of known copy number changes in 6 breast cell lines, as positive controls for this paediatric tumour study. 87 iv 3.3.2 Copy number changes on chromosome 8p in the paediatric solid tumour cohort 95 3.3.3 Copy number changes on chromosome 8q and at reference genes in the paediatric tumour cohort. 98 3.3.4 Additional MLPA results 99 3.4 Discussion 114 3.4.1 Previous research examining chromosome 8 copy number using MLPA 115 3.4.2 Six Breast cell lines: included in this study as known positive controls 116 3.4.3 Chromosome 8p copy number in paediatric solid tumours 116 3.4.4 Chromosome 8q copy number in paediatric solid tumours 119 3.4.5 Technical considerations 121 Chapter 4 Analysis of copy number in paediatric solid tumours using array Comparative Genomic Hybridization 123 4.1 Introduction 124 4.2 Aims for aCGH 130 4.3 Results 131 4.3.1 Chromosome 8 copy number changes in breast cell lines 132 4.3.2 Compound plots indicating common copy number changes in paediatric solid tumours 137 v 4.3.3 Copy number changes in genes examined by MLPA on chromosome 8 in 31 solid tumours 145 4.3.4 Statistical Analysis for loci examined by MLPA 145 4.4 Discussion 155 4.4.1 Chromosome 8 copy number changes in breast cell lines 155 4.4.2 Common regions of copy number change in paediatric solid tumours 156 4.4.3 Copy number changes in chromosome 8 genes examined by MLPA in the solid tumour cohort 158 4.4.4 Limitations 160 4.4.5 Summary and conclusions 160 Chapter 5 Comparison of 3 techniques for the assessment of DNA copy number as applied to solid paediatric tumour samples and breast cell lines 162 5.1 Introduction 163 5.2 Aims 165 5.3 Results 166 5.3.1 Comparison of copy number results obtained using MLPA or aCGH across all measured chromosome 8 loci in 6 breast cell lines 167 5.3.2 Comparison of MLPA and aCGH copy number results obtained for the paediatric solid tumour cohort, according to tumour type 172 vi 5.3.3 Selection of genes for qPCR 183 5.3.4 Overview of qPCR 186 5.3.5 qPCR results 190 5.4 Discussion 192 5.5 Summary and conclusions 195 Chapter 6 General Discussion 196 6.1 Introduction 197 6.2 MLPA as a stand-alone technique for measuring copy number changes 197 6.3 aCGH results of other genes genome-wide 200 6.4 Summary of aCGH chromosome 8 results obtained for 6 breast cell lines and the solid tumour cohort for genes examined by MLPA 202 Final conclusions 206 References 207 Appendices 238 Appendix 1. Statistical analysis 239 Appendix 2. Copy number changes in cell lines 240 Appendix 3. Copy number changes in solid tumours 243 Appendix 4. Copy number status using aCGH 259 Appendix 5. Copy number categories in cell lines 263 Appendix 6. Copy number categories in solid tumours 264 vii Statement of originality The work described in this thesis was performed by Nancy Martin La Rotta, except where due acknowledgement has been made. I declare that no part of this work has been submitted previously for the purpose of obtaining any other degree at the University of Sydney or at any other institution. Nancy Martin La Rotta December 2016 viii Acknowledgments I would like to thank God who gave me the opportunity to accomplish one of my deepest yearnings of my heart, to pursue my PhD, and who provided me with the best supervisors that I ever imagine, A. Prof Jennifer Byrne and associate supervisor Dr. Greg Peters. I owe my more sincere gratitude and respect to my primary supervisor Jennifer Byrne, a great scientist and wise person in any possible way. She with their dedication and guidance always helped me to resolve my fears and uncertainties, to see problems from different angles and thus took me to solve them in absolutely impressive ways. I greatly appreciate the support of the staff from Kids Research Institute (KRI), present and past members, particularly all members of Cancer Research Unit. Dr. Yuyan Chen who always gave me her wise advise, and also to admin members, Vanita De’Souza and Janette Clarkson, thank you very much. I would like to express my immense gratitude to my associate supervisor Dr. Greg Peters for the support, his critical feedback and words of wisdom. Likewise, I would like to thank the availability and generosity from the scientists in the Cytogenetics and FISH Laboratories at The Children's Hospital at Westmead, especially Ms. Dorothy Hung, Mr. Artur Darmanian and Mr. Luke St. Heaps. ix Last but not less I would like to thank my lovely and supportive husband that was at my side from beginning to end, without his support I would not have been able to achieve what I accomplished. Finally, I want to thank my Mum who travelled from overseas few times to provide me with endless support and encouragement. Finally, I want to dedicate this work to my three kids for whom I wanted to set an example of persistence and achievement of goals in life, in the hope that they will go far beyond. This work was supported by the NHMRC scholarship and The Kids Cancer project x Abstract Chromosomal imbalances are of major significance in cancer initiation and progression. Gains of chromosome 8 in human cancer have been described by a number of authors and are amongst the most common cytogenetic events that occur. However in childhood solid tumours, few studies have examined copy number changes of specific genes on chromosome 8. Somatic genomic events have been for many years an important component of diagnosis, prognosis and therapy selection in paediatric oncology. Different techniques have been designed to identify gene dosage or copy number changes in a quantitative fashion. In this project we used Multiplex Ligation-dependent Probe Amplification (MLPA), array Comparative Genomic Hybridization (aCGH) and quantitative PCR (qPCR).
Load more

Recommended publications
  • Cellular and Synaptic Network Defects in Autism
    Cellular and synaptic network defects in autism The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Peca, Joao, and Guoping Feng. “Cellular and Synaptic Network Defects in Autism.” Current Opinion in Neurobiology 22, no. 5 (October 2012): 866–872. As Published http://dx.doi.org/10.1016/j.conb.2012.02.015 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/102179 Terms of Use Creative Commons Attribution-Noncommercial-NoDerivatives Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ NIH Public Access Author Manuscript Curr Opin Neurobiol. Author manuscript; available in PMC 2013 October 01. Published in final edited form as: Curr Opin Neurobiol. 2012 October ; 22(5): 866–872. doi:10.1016/j.conb.2012.02.015. Cellular and synaptic network defects in autism João Peça1 and Guoping Feng1,2 $watermark-text1McGovern $watermark-text Institute $watermark-text for Brain Research, Department of Brain and Cognitive Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139, USA 2Stanley Center for Psychiatric Research, Broad Institute, Cambridge, MA 02142, USA Abstract Many candidate genes are now thought to confer susceptibility to autism spectrum disorder (ASD). Here we review four interrelated complexes, each composed of multiple families of genes that functionally coalesce on common cellular pathways. We illustrate a common thread in the organization of glutamatergic synapses and suggest a link between genes involved in Tuberous Sclerosis Complex, Fragile X syndrome, Angelman syndrome and several synaptic ASD candidate genes. When viewed in this context, progress in deciphering the molecular architecture of cellular protein-protein interactions together with the unraveling of synaptic dysfunction in neural networks may prove pivotal to advancing our understanding of ASDs.
    [Show full text]
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Atlas Antibodies in Breast Cancer Research Table of Contents
    ATLAS ANTIBODIES IN BREAST CANCER RESEARCH TABLE OF CONTENTS The Human Protein Atlas, Triple A Polyclonals and PrecisA Monoclonals (4-5) Clinical markers (6) Antibodies used in breast cancer research (7-13) Antibodies against MammaPrint and other gene expression test proteins (14-16) Antibodies identified in the Human Protein Atlas (17-14) Finding cancer biomarkers, as exemplified by RBM3, granulin and anillin (19-22) Co-Development program (23) Contact (24) Page 2 (24) Page 3 (24) The Human Protein Atlas: a map of the Human Proteome The Human Protein Atlas (HPA) is a The Human Protein Atlas consortium cell types. All the IHC images for Swedish-based program initiated in is mainly funded by the Knut and Alice the normal tissue have undergone 2003 with the aim to map all the human Wallenberg Foundation. pathology-based annotation of proteins in cells, tissues and organs expression levels. using integration of various omics The Human Protein Atlas consists of technologies, including antibody- six separate parts, each focusing on References based imaging, mass spectrometry- a particular aspect of the genome- 1. Sjöstedt E, et al. (2020) An atlas of the based proteomics, transcriptomics wide analysis of the human proteins: protein-coding genes in the human, pig, and and systems biology. mouse brain. Science 367(6482) 2. Thul PJ, et al. (2017) A subcellular map of • The Tissue Atlas shows the the human proteome. Science. 356(6340): All the data in the knowledge resource distribution of proteins across all eaal3321 is open access to allow scientists both major tissues and organs in the 3.
    [Show full text]
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • The Role of Methionine Sulfoxide Reductases in Oxidative Stress Tolerance and Virulence of Staphylococcus Aureus and Other Bacteria
    antioxidants Review The Role of Methionine Sulfoxide Reductases in Oxidative Stress Tolerance and Virulence of Staphylococcus aureus and Other Bacteria Vineet K. Singh 1,* , Kuldeep Singh 2 and Kyle Baum 1 1 Department of Microbiology and Immunology, A.T. Still University of Health Sciences, Kirksville, MO 63501, USA; [email protected] 2 Mayo Clinic, Rochester, MN 53905, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-660-626-2474; Fax: +1-660-626-2523 Received: 31 August 2018; Accepted: 26 September 2018; Published: 28 September 2018 Abstract: Methionine sulfoxide reductases (MSRA1 and MSRB) are proteins overproduced in Staphylococcus aureus during exposure with cell wall-active antibiotics. Later studies identified the presence of two additional MSRA proteins (MSRA2 and MSRA3) in S. aureus. These MSR proteins have been characterized in many other bacteria as well. This review provides the current knowledge about the conditions and regulatory network that mimic the expression of these MSR encoding genes and their role in defense from oxidative stress and virulence. Keywords: MSRA; MSRB; oxidative stress; virulence 1. Methionine Sulfoxide Reductases The presence of reactive oxygen species (ROS) is potentially damaging to all cellular macromolecules. Oxidizing agents, such as hydrogen peroxide (H2O2), superoxides, and hydroxyl radicals, oxidize the sulfur atom of methionine residues, resulting in methionine sulfoxide (MetO) that typically leads to loss of protein function [1,2]. In 1981, an enzyme capable of reducing protein-bound methionine sulfoxide was identified [3,4]. These oxidized MetO residues are reduced back to methionine by methionine sulfoxide reductase (MSR) enzymes that restore normal protein functions [5,6].
    [Show full text]
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • Distribution of Methionine Sulfoxide Reductases in Fungi and Conservation of the Free- 2 Methionine-R-Sulfoxide Reductase in Multicellular Eukaryotes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.26.433065; this version posted February 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Distribution of methionine sulfoxide reductases in fungi and conservation of the free- 2 methionine-R-sulfoxide reductase in multicellular eukaryotes 3 4 Hayat Hage1, Marie-Noëlle Rosso1, Lionel Tarrago1,* 5 6 From: 1Biodiversité et Biotechnologie Fongiques, UMR1163, INRAE, Aix Marseille Université, 7 Marseille, France. 8 *Correspondence: Lionel Tarrago ([email protected]) 9 10 Running title: Methionine sulfoxide reductases in fungi 11 12 Keywords: fungi, genome, horizontal gene transfer, methionine sulfoxide, methionine sulfoxide 13 reductase, protein oxidation, thiol oxidoreductase. 14 15 Highlights: 16 • Free and protein-bound methionine can be oxidized into methionine sulfoxide (MetO). 17 • Methionine sulfoxide reductases (Msr) reduce MetO in most organisms. 18 • Sequence characterization and phylogenomics revealed strong conservation of Msr in fungi. 19 • fRMsr is widely conserved in unicellular and multicellular fungi. 20 • Some msr genes were acquired from bacteria via horizontal gene transfers. 21 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.26.433065; this version posted February 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name E2F-associated phosphoprotein Gene Symbol EAPP Organism Human Gene Summary This gene encodes a phosphoprotein that interacts with several members of the E2F family of proteins. The protein localizes to the nucleus and is present throughout the cell cycle except during mitosis. It functions to modulate E2F-regulated transcription and stimulate proliferation. Gene Aliases BM036, C14orf11, FLJ20578, MGC4957 RefSeq Accession No. NC_000014.8, NT_026437.12 UniGene ID Hs.433269 Ensembl Gene ID ENSG00000129518 Entrez Gene ID 55837 Assay Information Unique Assay ID qHsaCID0008053 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000250454, ENST00000554792 Amplicon Context Sequence CAACCCAGGCCTGATCTCTGTTATCTTTTTCAGGATCATACAGTAATTCGTCATTT GTTGGAATCTTGTGTTGTTTCTTCTTTTTTTTCTTGGTCACCTGTACTGCTCTGTCT TCATCCTCGGAATCAGAATCAAAATATATATCATCGTAG Amplicon Length (bp) 122 Chromosome Location 14:34998580-35002699 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 104 R2 0.9989 cDNA Cq 19.93 cDNA Tm (Celsius) 79.5 gDNA Cq 34.63 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report EAPP, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Functional Characterization of the New 8Q21 Asthma Risk Locus
    Functional characterization of the new 8q21 Asthma risk locus Cristina M T Vicente B.Sc, M.Sc A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017 Faculty of Medicine Abstract Genome wide association studies (GWAS) provide a powerful tool to identify genetic variants associated with asthma risk. However, the target genes for many allergy risk variants discovered to date are unknown. In a recent GWAS, Ferreira et al. identified a new association between asthma risk and common variants located on chromosome 8q21. The overarching aim of this thesis was to elucidate the biological mechanisms underlying this association. Specifically, the goals of this study were to identify the gene(s) underlying the observed association and to study their contribution to asthma pathophysiology. Using genetic data from the 1000 Genomes Project, we first identified 118 variants in linkage disequilibrium (LD; r2>0.6) with the sentinel allergy risk SNP (rs7009110) on chromosome 8q21. Of these, 35 were found to overlap one of four Putative Regulatory Elements (PREs) identified in this region in a lymphoblastoid cell line (LCL), based on epigenetic marks measured by the ENCODE project. Results from analysis of gene expression data generated for LCLs (n=373) by the Geuvadis consortium indicated that rs7009110 is associated with the expression of only one nearby gene: PAG1 - located 732 kb away. PAG1 encodes a transmembrane adaptor protein localized to lipid rafts, which is highly expressed in immune cells. Results from chromosome conformation capture (3C) experiments showed that PREs in the region of association physically interacted with the promoter of PAG1.
    [Show full text]
  • Involvement of DPP9 in Gene Fusions in Serous Ovarian Carcinoma
    Smebye et al. BMC Cancer (2017) 17:642 DOI 10.1186/s12885-017-3625-6 RESEARCH ARTICLE Open Access Involvement of DPP9 in gene fusions in serous ovarian carcinoma Marianne Lislerud Smebye1,2, Antonio Agostini1,2, Bjarne Johannessen2,3, Jim Thorsen1,2, Ben Davidson4,5, Claes Göran Tropé6, Sverre Heim1,2,5, Rolf Inge Skotheim2,3 and Francesca Micci1,2* Abstract Background: A fusion gene is a hybrid gene consisting of parts from two previously independent genes. Chromosomal rearrangements leading to gene breakage are frequent in high-grade serous ovarian carcinomas and have been reported as a common mechanism for inactivating tumor suppressor genes. However, no fusion genes have been repeatedly reported to be recurrent driver events in ovarian carcinogenesis. We combined genomic and transcriptomic information to identify novel fusion gene candidates and aberrantly expressed genes in ovarian carcinomas. Methods: Examined were 19 previously karyotyped ovarian carcinomas (18 of the serous histotype and one undifferentiated). First, karyotypic aberrations were compared to fusion gene candidates identified by RNA sequencing (RNA-seq). In addition, we used exon-level gene expression microarrays as a screening tool to identify aberrantly expressed genes possibly involved in gene fusion events, and compared the findings to the RNA-seq data. Results: We found a DPP9-PPP6R3 fusion transcript in one tumor showing a matching genomic 11;19-translocation. Another tumor had a rearrangement of DPP9 with PLIN3. Both rearrangements were associated with diminished expression of the 3′ end of DPP9 corresponding to the breakpoints identified by RNA-seq. For the exon-level expression analysis, candidate fusion partner genes were ranked according to deviating expression compared to the median of the sample set.
    [Show full text]