DOCSLIB.ORG

Centrosome Linker–Induced Tetraploid Segregation Errors Link

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Centrosome Linker–Induced Tetraploid Segregation Errors Link Published OnlineFirst May 21, 2018; DOI: 10.1158/1541-7786.MCR-18-0062 Oncogenes and Tumor Suppressors Molecular Cancer Research Centrosome Linker–induced Tetraploid Segregation Errors Link Rhabdoid Phenotypes and Lethal Colorectal Cancers Andrea Remo1, Erminia Manfrin2, Pietro Parcesepe2, Alberto Ferrarini3, Hye Seung Han4, Ugnius Mickys5, Carmelo Laudanna6, Michele Simbolo2, Donatella Malanga6, Duarte Mendes Oliveira6, Elisabetta Baritono1, Tommaso Colangelo7, Lina Sabatino8, Jacopo Giuliani1, Enrico Molinari1, Marianna Garonzi9, Luciano Xumerle9, Massimo Delledonne9,10, Guido Giordano11,12, Claudio Ghimenton2, Fortunato Lonardo13, Fulvio D'angelo14, Federica Grillo15, Luca Mastracci15, Giuseppe Viglietto6, Michele Ceccarelli8,14, Vittorio Colantuoni8, Aldo Scarpa2,16, and Massimo Pancione8,17 Abstract Centrosome anomalies contribute to tumorigenesis, but it metastatic model harboring 1p36.13 deletion results in cor- remains unclear how they are generated in lethal cancer rection of centrosome segregation errors and cell death, reveal- phenotypes. Here, it is demonstrated that human microsatel- ing a mechanism of tolerance to mitotic errors and tetraploi- lite instable (MSI) and BRAFV600E-mutant colorectal cancers dization promoted by deleterious 1p36.13 loss. Accordingly, with a lethal rhabdoid phenotype are characterized by inac- cancer cells lacking 1p36.13 display far greater sensitivity to tivation of centrosomal functions. A splice site mutation that centrosome spindle pole stabilizing agents in vitro. These data causes an unbalanced dosage of rootletin (CROCC), a cen- shed light on a previously unknown link between centrosome trosome linker component required for centrosome cohesion cohesion defects and lethal cancer phenotypes providing new and separation at the chromosome 1p36.13 locus, resulted in insight into pathways underlying genome instability. abnormally shaped centrosomes in rhabdoid cells from human colon tissues. Notably, deleterious deletions at Implications: Mis-segregation of chromosomes is a prom- 1p36.13 were recurrent in a subgroup of BRAFV600E-mutant inent feature of chromosome instability and intratumoral and microsatellite stable (MSS) rhabdoid colorectal cancers, heterogeneity recurrent in metastatic tumors for which the but not in classical colorectal cancer or pediatric rhabdoid molecular basis is unknown. This study provides insight tumors. Interfering with CROCC expression in near-diploid into the mechanism by which defects in rootletin, a cen- BRAFV600E-mutant/MSI colon cancer cells disrupts bipolar trosome linker component causes tetraploid segregation mitotic spindle architecture, promotes tetraploid segregation errors and phenotypic transition to a clinically devastating errors, resulting in a highly aggressive rhabdoid-like pheno- form of malignant rhabdoid tumor. Mol Cancer Res; 1–11. type in vitro. Restoring near-wild-type levels of CROCC in a Ó2018 AACR. 1Pathology Unit, "Mater Salutis" Hospital AULSS9, Legnago (Verona), Italy. Research on Cancer, University and Hospital Trust of Verona, Verona, Italy. 2Department of Diagnostics and Public Health, Section of Pathology, University 17Department of Biochemistry and Molecular Biology II, Faculty of Pharmacy, and Hospital Trust of Verona, Verona, Italy. 3Menarini Silicon Biosystems S.p.A, Complutense University, Madrid, Spain. Bologna, Italy. 4Department of Pathology, Konkuk University School of Medicine, Seoul, Korea. 5National Center of Pathology, Affiliate of Vilnius Note: Supplementary data for this article are available at Molecular Cancer University Hospital Santariskiu Clinics, Vilnius, Lithuania. 6Department of Research Online (http://mcr.aacrjournals.org/). Experimental and Clinical Medicine "Gaetano Salvatore", University "Magna Grecia", Catanzaro, Italy. 7Institute for Stem Cell Biology, Regenerative Medicine A. Remo, E. Manfrin, and P. Parcesepe contributed equally to this article. and Innovative Therapies (ISBReMIT), Casa Sollievo della Sofferenza-IRCCS, San Giovanni Rotondo, Italy. 8Department of Sciences and Technologies, University Corresponding Authors: Massimo Pancione, Department of Sciences and of Sannio, Benevento, Italy. 9Functional Genomics Center, Department of Technologies, University of Sannio, Via Port'Arsa, 1182100 Benevento, Italy. Biotechnology, University of Verona, Verona, Italy. 10Personal Genomics S.r.l., Phone: 3908-2430-5157; Fax: 3908-2430-5147; E-mail: Verona, Italy. 11CRO Aviano National Cancer Center, Aviano, Italy. 12Medical [email protected]; Aldo Scarpa, ARC-NET Research Centre, Oncology Unit, San Filippo Neri Hospital, Rome, Italy. 13Medical Cytogenetics Policlinico GB Rossi, Piazzale L.A. Scuro, Verona, Italy. Phone: 3904-5812- and Molecular Genetics Unit, AORN "Gaetano Rummo," Benevento, Italy. 4043; Fax: 3904-5812-7432; E-mail: [email protected] 14 Bioinformatics Laboratory, BIOGEM scrl, Ariano Irpino, Avellino, Italy. doi: 10.1158/1541-7786.MCR-18-0062 15Department of Surgical and Diagnostic Sciences (DISC), University of Genova and S. Martino Polyclinic Hospital, Genova, Italy. 16ARC-Net Centre for Applied Ó2018 American Association for Cancer Research. www.aacrjournals.org OF1 Downloaded from mcr.aacrjournals.org on September 26, 2021. © 2018 American Association for Cancer Research. Published OnlineFirst May 21, 2018; DOI: 10.1158/1541-7786.MCR-18-0062 Remo et al. Introduction from ATCC. BJ human fibroblasts and G401 cells derived from normal foreskin and pediatric rhabdoid tumor were used as a The century-old hypothesis on the relationship between cen- nonneoplastic control and a pure rhabdoid model, respectively. trosomes and cancer, formulated by the German embryologist Theodor Boveri more than 100 years ago (1, 2), remains unan- Whole-exome sequencing swered. Centrosome abnormalities, consisting usually in increased Whole-exome sequencing with 100-bp paired reads was per- numbers, are common in human tumors (3), and experimentally formed with a HiSEQ1000 (Illumina), using 1.3 mg genomic induced tetraploid cells from extra centrosomes can be critical DNA (based on fluorometric Picogreen dsDNA quantification), for aneuploidy and metastatic progression of malignancy (3, 4). and enrichment for whole exome was done according to TruSeq fi However, insuf cient progress has been made in our knowledge Exome Enrichment Guide (Illumina). on genetic defects underlying centrosome anomalies in tumori- genesis (1–4). In this scenario, the rare and lethal pathologic Functional in vitro assays variant of common colorectal cancers showing rhabdoid pheno- RKO cells were transiently transfected with SureSilencing con- type (5–7), is of particular interest as it features recurrent mitotic trol or CROCC shRNA expression plasmids KH23140P (Qiagen) anomalies of enigmatic origin (8–10). We thus hypothesized that containing the puromycin-resistant cassette. After selection puro- the systematic study of rare rhabdoid colorectal cancers, could mycin (Thermo Fisher Scientific), single colonies were amplified provide insights into biological mechanisms responsible for the and assessed for efficient CROCC silencing by qPCR and Western generation of genome instability and reveal key factors for the blot analysis, respectively. HT29 and T84 cells were transfected development of aggressive disease entities. To test this idea, we with the full-length CROCC coding sequence or a truncated form performed whole-exome sequencing of two rhabdoid colorectal (1–494 aa) cloned with GFP epitope or GFP alone (used as þ cancers and discovered an enrichment of centrosome anomalies control). For long-term experiments, CROCC-GFP cells were and inactivation of Rootletin encoded by ciliary rootlet coiled-coil maintained in 0.6 mg/mL of G418. (CROCC) gene (11, 12), a structural component of the centro- some linker, which assembles and keeps the two centrioles con- Statistical analysis nected. Centrosomal alterations were assessed in an expanded Data are presented as mean, medians, and ranges. P values of series of rare rhabdoid colorectal cancers and related tumors, and <0.05 (two tailed) were considered to be significant. Statistical functionally characterized in colorectal cancer cellular models. analyses were conducted by GeneSpring R/bioconductor v.12.5 and R based package, SPSS v15, and GraphPad Prism 5. Materials and Methods Materials and Methods and any associated references as a Results continuation of the main text are described more in detail within Discovery of CROCC mutations and centrosome anomalies the Supplementary Material. Two previously reported primary BRAFV600E-mutant rhabdoid colorectal cancers (RC1 and RC2; refs. 9, 10), harboring MSI due Patient and tissue cohort to defective DNA mismatch repair (MMR) machinery caused by This study was conducted in accordance with Declaration of promoter methylation of the MLH1 gene, were subjected to Helsinki ethical guidelines. It was approved by an institutional whole-exome sequencing (WES) using DNA from FFPE-matched review board, approval no. 997CESC from the Ethics Commit- tumor/normal samples (Supplementary Table S1). We detected tee (Comitato Etico di Verona e Rovigo dell'Azienda Ospeda- an exceptionally large number of somatic point mutations, 1,056 liera Universitaria Integrata) on September 7, 2016, documen- and 1,078 per 106 bases for RC1 and RC2, respectively, which is ted by the CESC prot. 42160 on 9 September 2016, and consistent with the presence of MMR defects (13–15; Fig. 1A). formalized by the General Manager with deliberation no. About twenty percent
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Use of the Polo-Like Kinase 4 (PLK4) Inhibitor Centrinone to Investigate Intracellular Signaling Networks Using SILAC-Based Phos
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Use of the Polo-like kinase 4 (PLK4) inhibitor centrinone to 2 investigate intracellular signaling networks using SILAC-based 3 phosphoproteomics 4 Dominic P Byrne1#, Christopher J Clarke1,2#, Philip J Brownridge2, Anton Kalyuzhnyy1, 5 3, Simon Perkins1, 3, Amy Campbell1,2, David Mason4, Andrew R Jones1, 3, Patrick A 6 Eyers1* and Claire E Eyers1,2* 7 1 Department of Biochemistry and Systems Biology, Institute of Systems, Molecular & 8 Integrative Biology, University of Liverpool, L69 7ZB, UK. 9 2 Centre for Proteome Research, Department of Biochemistry and Systems Biology, 10 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 11 UK. 12 13 3 Computational Biology Facility, Department of Biochemistry and Systems Biology, 14 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 15 UK. 16 17 4 Centre for Cell Imaging, Department of Biochemistry and Systems Biology, Institute 18 of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, UK. 19 20 # Equal contribution 21 *Correspondence to CEE ([email protected]) and PAE 22 ([email protected]) 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations
    The American Journal of Pathology, Vol. 180, No. 6, June 2012 Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajpath.2012.01.044 Tumorigenesis and Neoplastic Progression Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations John M. Krill-Burger,* Maureen A. Lyons,*† The annual incidence of renal cell carcinoma (RCC) has Lori A. Kelly,*† Christin M. Sciulli,*† increased steadily in the United States for the past three Patricia Petrosko,*† Uma R. Chandran,†‡ decades, with approximately 58,000 new cases diag- 1,2 Michael D. Kubal,§ Sheldon I. Bastacky,*† nosed in 2010, representing 3% of all malignancies. Anil V. Parwani,*†‡ Rajiv Dhir,*†‡ and Treatment of RCC is complicated by the fact that it is not a single disease but composes multiple tumor types with William A. LaFramboise*†‡ different morphological characteristics, clinical courses, From the Departments of Pathology* and Biomedical and outcomes (ie, clear-cell carcinoma, 82% of RCC ‡ Informatics, University of Pittsburgh, Pittsburgh, Pennsylvania; cases; type 1 or 2 papillary tumors, 11% of RCC cases; † the University of Pittsburgh Cancer Institute, Pittsburgh, chromophobe tumors, 5% of RCC cases; and collecting § Pennsylvania; and Life Technologies, Carlsbad, California duct carcinoma, approximately 1% of RCC cases).2,3 Benign renal neoplasms are subdivided into papillary adenoma, renal oncocytoma, and metanephric ade- Copy number variant (CNV) analysis was performed on noma.2,3 Treatment of RCC often involves surgical resec- renal cell carcinoma (RCC) specimens (chromophobe, tion of a large renal tissue component or removal of the clear cell, oncocytoma, papillary type 1, and papillary entire affected kidney because of the relatively large size of type 2) using high-resolution arrays (1.85 million renal tumors on discovery and the availability of a life-sus- probes).
    [Show full text]
  • PLK4, Active (SRP5315)
    PLK4, active, GST-tagged, human Ò PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5315 Storage Temperature –70 °C Synonyms: SAK, STK18 Figure 1. SDS-PAGE Gel of Typical Lot: Product Description ³70% (SDS-PAGE, densitometry) PLK4 or polo-like kinase 4 is a member of the polo family of serine/threonine protein kinases, which localizes to centrioles, the complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. The overexpression of PLK4 triggered the simultaneous formation of multiple procentrioles around each preexisting centriole, which results in centriole amplification and thus, PLK4-induced centriole biogenesis in human cells.1 The reduced PLK4 gene dosage increases the probability of mitotic errors and cancer development.2 Figure 2. Specific Activity of Typical Lot: Recombinant human PLK4 (1-836) was expressed by 4.5–6.7 nmole/min/mg baculovirus in Sf9 insect cells using an N-terminal GST-tag. The PLK4 gene accession number is NM_014264. It is supplied in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~140 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data Sheet for information regarding hazards Procedure and safe handling practices. Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7. 2, 12.5 mM Storage/Stability glycerol 2-phosphate, 25 mM MgC12, 5 mM EGTA, and The product ships on dry ice and storage at –70 °C is 2 mM EDTA.
    [Show full text]
  • Synthesis, Biological Evaluation and in Silico Studies of Certain Oxindole–Indole Conjugates As Anticancer CDK Inhibitors
    molecules Article Synthesis, Biological Evaluation and In Silico Studies of Certain Oxindole–Indole Conjugates as Anticancer CDK Inhibitors Tarfah Al-Warhi 1, Ahmed M. El Kerdawy 2,3 , Nada Aljaeed 1, Omnia E. Ismael 4, Rezk R. Ayyad 5, Wagdy M. Eldehna 6,* , Hatem A. Abdel-Aziz 7 and Ghada H. Al-Ansary 8,9,* 1 Department of Chemistry, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 12271, Saudi Arabia; [email protected] (T.A.-W.); [email protected] (N.A.) 2 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Kasr El-Aini Street, Cairo 11562, Egypt; [email protected] 3 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, New Giza University, Newgiza, km 22 Cairo–Alexandria Desert Road, Cairo 12577, Egypt 4 Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Badr City, Cairo 11829, Egypt; [email protected] 5 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Al-Azhar University, Cairo 11651, Egypt; [email protected] 6 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Kafrelsheikh University, Kafrelsheikh 33516, Egypt 7 Department of Applied Organic Chemistry, National Research Center, Dokki, Giza 12622, Egypt; [email protected] 8 Department of Pharmaceutical Chemistry, Pharmacy Program, Batterejee Medical College, Jeddah 6231, Saudi Arabia 9 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Ain Shams University, Abbassia, Cairo 11566, Egypt * Correspondence: [email protected] (W.M.E.); [email protected] (G.H.A.) Academic Editor: Sandra Gemma Received: 3 April 2020; Accepted: 23 April 2020; Published: 27 April 2020 Abstract: On account of their overexpression in a wide range of human malignancies, cyclin-dependent kinases (CDKs) are among the most validated cancer targets, and their inhibition has been featured as a valuable strategy for anticancer drug discovery.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • An Extensive Program of Periodic Alternative Splicing Linked to Cell
    RESEARCH ARTICLE An extensive program of periodic alternative splicing linked to cell cycle progression Daniel Dominguez1,2, Yi-Hsuan Tsai1,3, Robert Weatheritt4, Yang Wang1,2, Benjamin J Blencowe4*, Zefeng Wang1,5* 1Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 2Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, United States; 3Program in Bioinformatics and Computational Biology, University of North Carolina at Chapel Hill, Chapel Hill, United States; 4Donnelly Centre and Department of Molecular Genetics, University of Toronto, Toronto, Canada; 5Key Lab of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Chinese Academy of Science, Shanghai, China Abstract Progression through the mitotic cell cycle requires periodic regulation of gene function at the levels of transcription, translation, protein-protein interactions, post-translational modification and degradation. However, the role of alternative splicing (AS) in the temporal control of cell cycle is not well understood. By sequencing the human transcriptome through two continuous cell cycles, we identify ~ 1300 genes with cell cycle-dependent AS changes. These genes are significantly enriched in functions linked to cell cycle control, yet they do not significantly overlap genes subject to periodic changes in steady-state transcript levels. Many of the periodically spliced genes are controlled by the SR protein kinase CLK1, whose level undergoes cell cycle- dependent fluctuations via an auto-inhibitory circuit. Disruption of CLK1 causes pleiotropic cell cycle defects and loss of proliferation, whereas CLK1 over-expression is associated with various *For correspondence: cancers. These results thus reveal a large program of CLK1-regulated periodic AS intimately [email protected] (BJB); associated with cell cycle control.
    [Show full text]
  • Molecular Genetics of Microcephaly Primary Hereditary: an Overview
    brain sciences Review Molecular Genetics of Microcephaly Primary Hereditary: An Overview Nikistratos Siskos † , Electra Stylianopoulou †, Georgios Skavdis and Maria E. Grigoriou * Department of Molecular Biology & Genetics, Democritus University of Thrace, 68100 Alexandroupolis, Greece; [email protected] (N.S.); [email protected] (E.S.); [email protected] (G.S.) * Correspondence: [email protected] † Equal contribution. Abstract: MicroCephaly Primary Hereditary (MCPH) is a rare congenital neurodevelopmental disorder characterized by a significant reduction of the occipitofrontal head circumference and mild to moderate mental disability. Patients have small brains, though with overall normal architecture; therefore, studying MCPH can reveal not only the pathological mechanisms leading to this condition, but also the mechanisms operating during normal development. MCPH is genetically heterogeneous, with 27 genes listed so far in the Online Mendelian Inheritance in Man (OMIM) database. In this review, we discuss the role of MCPH proteins and delineate the molecular mechanisms and common pathways in which they participate. Keywords: microcephaly; MCPH; MCPH1–MCPH27; molecular genetics; cell cycle 1. Introduction Citation: Siskos, N.; Stylianopoulou, Microcephaly, from the Greek word µικρoκεϕαλi´α (mikrokephalia), meaning small E.; Skavdis, G.; Grigoriou, M.E. head, is a term used to describe a cranium with reduction of the occipitofrontal head circum- Molecular Genetics of Microcephaly ference equal, or more that teo standard deviations
    [Show full text]
  • Centrosome Impairment Causes DNA Replication Stress Through MLK3
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Centrosome impairment causes DNA replication stress through MLK3/MK2 signaling and R-loop formation Zainab Tayeh 1, Kim Stegmann 1, Antonia Kleeberg 1, Mascha Friedrich 1, Josephine Ann Mun Yee Choo 1, Bernd Wollnik 2, and Matthias Dobbelstein 1* 1) Institute of Molecular Oncology, Göttingen Center of Molecular Biosciences (GZMB), University Medical Center Göttingen, Göttingen, Germany 2) Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany *Lead Contact. Correspondence and requests for materials should be addressed to M. D. (e-mail: [email protected]; ORCID 0000-0001-5052-3967) Running title: Centrosome integrity supports DNA replication Key words: Centrosome, CEP152, CCP110, SASS6, CEP152, Polo-like kinase 4 (PLK4), DNA replication, DNA fiber assays, R-loops, MLK3, MK2 alias MAPKAPK2, Seckel syndrome, microcephaly. Highlights: • Centrosome defects cause replication stress independent of mitosis. • MLK3, p38 and MK2 (alias MAPKAPK2) are signalling between centrosome defects and DNA replication stress through R-loop formation. • Patient-derived cells with defective centrosomes display replication stress, whereas inhibition of MK2 restores their DNA replication fork progression and proliferation. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Plk4 Is Required for Cytokinesis and Maintenance of Chromosomal Stability
    Plk4 is required for cytokinesis and maintenance of chromosomal stability Carla O. Rosarioa,b, Michael A. Koa,c,d,1, Yosr Z. Haffania,1, Rebecca A. Gladdya,c,d, Jana Paderovae, Aaron Pollettb, Jeremy A. Squiree, James W. Dennisa,b,f, and Carol J. Swallowa,b,c,d,2 aSamuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, ON M5G 1X5, Canada; bDepartment of Laboratory Medicine and Pathobiology, cDepartment of Surgery, dInstitute of Medical Science, and fDepartment of Molecular Genetics, University of Toronto, Toronto, ON M5S 1A1, Canada; and eDepartment of Pathology and Molecular Medicine, Queen’s University, Kingston, ON K7L 3N6, Canada Edited by David Pellman, Dana-Farber Cancer Institute, Boston, MA, and accepted by the Editorial Board February 16, 2010 (received for review September 25, 2009) Aneuploidy is a characteristic feature of established cancers and dumbbell-shaped cells with anaphase bridges, indicating that can promote tumor development. Aneuploidy may arise directly, Plk4 is also required in late mitosis, possibly at telophase (8). − through unequal distribution of chromosomes into daughter cells, Plk4+/ embryos develop normally, but adult mice display a 16- or indirectly, through a tetraploid intermediate. The polo family fold increase in the incidence of spontaneous hepatomas com- kinase Plk4/Sak is required for late mitotic progression and is pared with Plk4+/+ littermates. The wild-type Plk4 allele was haploinsufficient for tumor suppression in mice. Here we show retained in the liver tumors, indicating that Plk4 is a hap- that loss of heterozygosity (LOH) occurs at the Plk4 locus in 50% of loinsufficient tumor suppressor (9). Cell cycle progression was − human hepatocellular carcinomas (HCC) and is present even in impaired in regenerating Plk4+/ liver with a ≈6-h delay in M preneoplastic cirrhotic liver nodules.
    [Show full text]
  • Kinetochores Accelerate Centrosome Separation to Ensure Faithful Chromosome Segregation
    906 Research Article Kinetochores accelerate centrosome separation to ensure faithful chromosome segregation Nunu Mchedlishvili1,*, Samuel Wieser1,2,*, Rene´ Holtackers1, Julien Mouysset1, Mukta Belwal1, Ana C. Amaro1 and Patrick Meraldi1,` 1Institute of Biochemistry, ETH Zurich, Schafmattstrasse 18, 8093 Zu¨rich, Switzerland 2Wellcome Trust/Cancer Research Gurdon Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QN, UK *These authors contributed equally to this work `Author for correspondence ([email protected]) Accepted 28 August 2011 Journal of Cell Science 125, 906–918 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.091967 Summary At the onset of mitosis, cells need to break down their nuclear envelope, form a bipolar spindle and attach the chromosomes to microtubules via kinetochores. Previous studies have shown that spindle bipolarization can occur either before or after nuclear envelope breakdown. In the latter case, early kinetochore–microtubule attachments generate pushing forces that accelerate centrosome separation. However, until now, the physiological relevance of this prometaphase kinetochore pushing force was unknown. We investigated the depletion phenotype of the kinetochore protein CENP-L, which we find to be essential for the stability of kinetochore microtubules, for a homogenous poleward microtubule flux rate and for the kinetochore pushing force. Loss of this force in prometaphase not only delays centrosome separation by 5–6 minutes, it also causes massive chromosome alignment and segregation defects due to the formation of syntelic and merotelic kinetochore–microtubule attachments. By contrast, CENP-L depletion has no impact on mitotic progression in cells that have already separated their centrosomes at nuclear envelope breakdown.
    [Show full text]