sign in sign up
<<
Home , TRIM21, TRIM28, TRIM33, Tripartite motif family

The E3 Ligase Tripartite Motif 33 Is Essential for Cytosolic RNA−Induced NLRP3 Inflammasome Activation

This information is current as Leiyun Weng, Hiroki Mitoma, Coline Tricot, Musheng Bao, of September 23, 2021. Ying Liu, Zhiqiang Zhang and Yong-Jun Liu J Immunol published online 29 August 2014 http://www.jimmunol.org/content/early/2014/08/28/jimmun ol.1401448 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2014/08/28/jimmunol.140144 Material 8.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 23, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/193/10/5351.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published August 29, 2014, doi:10.4049/jimmunol.1401448 The Journal of Immunology

The E3 Ubiquitin Ligase Tripartite Motif 33 Is Essential for Cytosolic RNA–Induced NLRP3 Inflammasome Activation

Leiyun Weng,* Hiroki Mitoma,* Coline Tricot,* Musheng Bao,* Ying Liu,* Zhiqiang Zhang,*,† and Yong-Jun Liu*,‡

NLRP3 is a key component of caspase-activating macromolecular complexes called inflammasomes. It has been found that DHX33 is a cytosolic dsRNA sensor for the NLRP3 inflammasome, which induces caspase-1–dependent production of IL-1b and IL-18 upon activation. However, how the cytosolic dsRNAs induce the interaction between DHX33 and the NLRP3 inflammasome remains unknown. In this study, we report that TRIM33, a member of the tripartite motif (TRIM) family, can bind DHX33 directly and induce DHX33 ubiquitination via the lysine 218 upon dsRNA stimulation. Knocking down of TRIM33 abolished the dsRNA-induced NLRP3 inflammasome activation in both THP-1–derived macrophages and human monocyte-derived macro-

phages. The ubiquitination of DHX33 by TRIM33 is lysine 63 specific and is required for the formation of the DHX33–NLRP3 Downloaded from inflammasome complex. The Journal of Immunology, 2014, 193: 000–000.

ripartite motif (TRIM) family contain RBCC TRIM33, previously known as transcriptional intermediary motifs, which consist of the RING (really interesting new factor 1 g (TIF1-g), has been shown to function in transcriptional T 1) finger domain, B-box motif, and a coiled-coil regulation during hematopoiesis (13). It is also reported to have

domain (1, 2). Most of the TRIM family members are E3 ubiq- tumor suppressor activity in multiple tissues (14, 15). A recent study http://www.jimmunol.org/ uitin (Ub) ligases. These proteins interact with Ub-conjugating reported that TRIM33 functions in DNA repair (16). It is unknown enzymes (E2) via their RING domains and transfer Ub from whether TRIM33 plays a role in the innate immune system. Ub-activating enzymes (E1) to the target molecules (3–5). Many Inflammasomes are caspase-activating multiprotein complexes TRIM members are IFN-stimulated and play important that were identified in 2002 (17). NLRP3 is a member of Nod-like roles in a broad range of immune responses including antimicro- receptors. Upon activation, NLRP3 forms a macromolecular sig- bial infection (6, 7). It has been reported that TRIM25 ubiquitinates naling complex with its adaptor protein ASC and procaspase-1 the caspase recruitment domains of retinoic acid–inducible gene-I called the NLRP3 inflammasome (18, 19). This leads to the (RIG-I), and this ubiquitination activity is essential for the acti- cleavage and activation of caspase-1, which in turn processes the vation of downstream antiviral innate immune responses (8). proforms of IL-1b and IL-18 to generate biologically active cyto- by guest on September 23, 2021 TRIM5a has been intensively studied with its well-known ret- kines (20). Multiple types of stimulatory signals can activate the roviral restriction activity (9). TRIM21 negatively regulates an in- NLRP3 inflammasome, including ATP, crystalline reagents and tracellular dsDNA sensing pathway by ubiquitinating and microbial toxin nigericin (19, 21, 22). It’s believed that these stimuli degrading DDX41 (10). TRIM30a induces TAB2 and TAB3 may activate the NLRP3 inflammasome via different pathways (23– ubiquitination and degradation, and it inhibits TRAF6-induced 26). Our laboratory has recently reported that DHX33, a member NF-kB activation (11). Ubiquitination of stimulator of IFN gene of DExD/H-box helicase family, is a cytosolic dsRNA sensor for (STING) by TRIM56 is essential for STING dimerization and the NLRP3 inflammasome (27). However, the mechanism of how IFN-b promoter activation (12). the cytosolic RNA induces the activation of the DHX33-NLRP3 inflammasome is unclear. In this paper, we report that TRIM33 ubiquitinates DHX33 and is essential for the cytosolic RNA-induced NLRP3 inflammasome activation. When TRIM33 is knocked down *Baylor Institute for Immunology Research, Baylor Research Institute, Baylor Scott and White Health, Dallas, TX 75204; †Immunobiology and Transplant Research, in human macrophages, the dsRNA-induced NLRP3 inflammasome Houston Methodist Hospital and Houston Methodist Research Institute, Texas Med- activation is blocked. TRIM33 binds DHX33 directly and induces ical Center, Houston, TX 77030; and ‡MedImmune, LLC, Gaithersburg, MD 20878 lysine 63 (K63)–specific ubiquitination of DHX33, which is es- Received for publication June 6, 2014. Accepted for publication August 4, 2014. sential for the formation of the DHX33–NLRP3 complex. This work was supported by National Institutes of Health Grant R37 AI091947. Address correspondence and reprint requests to Dr. Zhiqiang Zhang or Dr. Yong-Jun Materials and Methods Liu, Immunobiology and Transplant Research, Houston Methodist Hospital and Plasmids Houston Methodist Research Institute, Texas Medical Center, 6670 Bertner Avenue, Houston, TX 77030 (Z.Z.) or MedImmune LLC, One MedImmune Way, Gaithersburg, For reconstitution of TRIM33, TRIM33 cDNA was subcloned into pCMV MD 20878 (Y.-J.L.). E-mail addresses: [email protected] (Z.Z.) and vectors coding for HA- and Myc-tagged proteins (BD Clontech). Various [email protected] (Y.-J.L.) primers were designed and used for the generation of truncations using HA- The online version of this article contains supplemental material. tagged full-length TRIM33 as template. All of the PCRs were carried out Abbreviations used in this article: BBC, B-box C-terminal; d, domain; HA, hemag- according to a standard procedure. HA-tagged DHX33 lysine-to-arginine glutinin; hPMDM, human primary monocyte–derived macrophage; HMW, high m.w.; mutants were obtained using a site-directed mutagenesis kit (Agilent, K63, lysine 63; LMW, low m.w.; poly dA:dT, poly(deoxyadenylic-deoxythymidylic); Life Technologies), according to the manufacturer’s manual. poly I:C: polyinosinic-polycytidylic acid; RIG-I, retinoic acid–inducible gene-I; RSV, respiratory syncytial ; shRNA, short-hairpin RNA; siRNA, small interfering Cell culture RNA; STING, stimulator of IFN gene; TRIM, tripartite motif; Ub, ubiquitin. HEK293T cells were maintained in DMEM medium with 10% FBS. THP-1 Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 cells, a human acute monocytic leukemia cell line, were maintained in

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1401448 2 TRIM33 UBIQUITINATION ON NLRP3 INFLAMMASOME ACTIVATION

RPMI-1640 medium containing 10% FBS, 2 mM L-glutamine, and 50 mM DHX33 (sc-137424; Santa Cruz Biotechnology), monoclonal mouse anti- 2-ME. All of the FBS was heat inactivated before use. NLRP3 (Cryo-2) (ALX-804-881-C100; Enzo Life Sciences), monoclonal rabbit anti–caspase-1 (D7F10) (3866; Cell Signaling Technology) and Differentiation and stimulation of THP-1 macrophages monoclonal mouse anti-GAPDH (G9295; Sigma-Aldrich). As previously described (27), THP-1 cells were differentiated to macrophages Expression and purification of recombinant proteins in with 60 nM PMA (Sigma-Aldrich) for 16 h, and cells were cultured for an additional 48h without PMA. Differentiated cells were stimulated for 8 h in HEK293T cells 96-well plates with one of the following conditions: 5 mg/ml high m.w. (HMW) PCMV-HA plasmid encoding human DHX33 was transfected to HEK293T polyinosinic-polycytidylic acid (poly I:C; InvivoGen) plus Lipofectamine 2000, cells. At 36 h posttransfection, cells were harvested, and the expressed 5 mg/ml low m.w. (LMW) poly I:C or 1 mg/ml poly(deoxyadenylic- HA-tagged human DHX33 protein was purified using anti-HA beads deoxythymidylic) (poly dA:dT; InvivoGen) plus Lipofectamine 2000, (Sigma-Aldrich). After washing, the recombinant protein was eluted from 2.5 mg/ml reoviral genomic RNA plus Lipofectamine 2000, and 2.5 mg/ml the beads using acidic elution buffer (0.1 M glycine-HCl [pH 2.5]) and then bacterial RNA plus Lipofectamine 2000, or 2 mM nigericin (InvivoGen). the pH was adjusted to ∼7.5 using 1 M Tris-HCl (pH 9). Culture supernatants were collected to measure cytokines IL-1b and IL-18 using ELISA and cleavage of caspase-1 using immunoblot. Cells were Coimmunoprecipitation assays using transfected harvested for real-time PCR or immunoblot analysis. HEK293T cells Lentivirus production and infection pCMV vectors encoding Myc-tagged and HA-tagged expression plasmids were cotransfected to HEK293T cells using Lipofectamine 2000. Cells were The short hairpin RNA (shRNA) targeting sequences for human TRIM33, lysed 36 h after transfection in the lysis buffer (50 mM Tris-HCl [pH 7.5], DHX33, NLRP3 and caspase-1 are the following (59 to 39): shTRIM33-1, 150 mM NaCl, 1% Nonidet-P40, 5 mM EDTA, and 1 mM DTT). Cell AACTGGAAAGTAATCAGTCGC; shTRIM33-2, ATTAGGAGTATAAC- lysates were immunoprecipitated by anti-HA beads (Sigma-Aldrich). CAGGAGC; shDHX33-1, CATTTCCTTTAGAACCCAAAT; shDHX33-2, Downloaded from GTTGACACGGGCATGGTTAAA-3; shNLRP3, GCGTTAGAAACACT- Endogenous immunoprecipitation assays using stimulated TCAAGAA; and shcaspase-1, CTACAACTCAATGCAATCTTT. THP-1 macrophages The scrambled or gene-specific targeting shRNAs (Open Biosystems) in PLKO.1 vector were transfected to HEK293T cells together with packaging THP-1 cells were differentiated with 60 nM PMA for 16 h and then treated plasmid psPAX2 and envelope-encoding plasmid pMD2G using Lipofect- with 5 mg/ml HMW poly I:C plus Lipofectamine 2000 for 2 h or 2 mM amine 2000 (Life Technologies) for production of lentiviral particles. The nigericin for 45 min. For overexpression in THP-1 cells, HA-tagged supernatants of transfected HEK293T cells were harvested 24 and 48 h DHX33 wild-type or K218R mutant was transfected to THP-1 cells for posttransfection and then were centrifuged at 1500 rpm for 15 min before 24 h before stimulation. Stimulated cells were washed with 13 PBS once http://www.jimmunol.org/ infection. THP-1 cells were infected with the lentiviral particles containing and then resuspended in 13 lysis buffer (50 mM Tris-HCl [pH 7.5], supernatants in the presence of 8 mg/ml polybrene (Sigma-Aldrich), followed 150 mM NaCl, 0.3% Nonidet-P40, 1 mM EDTA, and 1 mM DTT). Cell lysates by centrifugation at 3500 rpm for 1 h. The medium was changed to fresh were immunoprecipitated with isotype control rabbit IgG, anti-DHX33 Ab complete medium 6 h postinfection. The infected THP-1 cells were cultured (NB100-2581; Novus Biologicals) or anti-TRIM33 (8972S; Cell Signaling for another 48 h before antibiotic selection using 5 mg/ml puromycin Technology) for 4 h, followed by 1 h incubation with protein G–Sepharose (InvivoGen). The knockdown efficiency of each shRNA was examined by (Thermo Scientific). real-time PCR and/or immunoblot analysis after 3 d of puromycin selection. Real-time PCR Isolation of reoviral genomic RNA RNAs from ∼0.2 million cells were isolated using the RNeasy Micro Kit As previously described (27), Vero cells were infected with reovirus se- (Qiagen) and used for synthesis of cDNA with iScript cDNA Synthesis Kit by guest on September 23, 2021 rotype 3 (VR-824; American Type Culture Collection) at a multiplicity of (Bio-Rad). The iTaq SYBR Green Supermix with ROX (Bio-Rad) was infection of 0.1 PFU/cell. The supernatant was collected 48 h post viral used for real-time PCR. The housekeeping gene GAPDH was used infection, centrifuged at 2500 rpm for 30 min, and then passed through as internal control to normalize the amount of cDNA among different 0.45 mm filters. The filtered supernatant was centrifuged at 21,000 rpm for samples. 180 min. The viral pellet was resuspended in RLT Buffer (RNeasy kit; Qiagen), which was followed by RNA extraction according to the manu- Ubiquitination assay in HEK293T overexpression system facturer’s manual. HEK293T cells were cotransfected with expression plasmids encoding HA Isolation and stimulation of human monocyte-derived empty vector, HA-tagged full-length wild-type or mutant DHX33 together macrophages with Myc-tagged TRIM33, using Lipofectamine 2000. The protease in- hibitor MG132 (10 mM; Sigma-Aldrich) was added 10 h before harvest. At As previously described (27), buffy coats of blood samples from healthy 36 h posttransfection, cells were harvested and lysed for immunoprecipi- donors were used for isolation of peripheral blood monocytes. Monocytes tation with anti-HA beads and then followed by immunoblotting of HA. were isolated using RosetteSep Human Monocyte Enrichment Cocktail (StemCell Technologies) and were differentiated into macrophages in In vitro ubiquitination assay RPMI 1640 medium containing 10% FBS, 2 mM L-glutamine, and 10 ng/ml M-CSF (Life Technologies) for 10 d. Scramble or gene-specific small in- An in vitro ubiquitination assay was performed as described previously (10). terfering RNAs (siRNAs; Dharmacon) were transfected into macrophages Briefly, 2 ng mammalian-derived HA-tagged DHX33 and Myc-tagged using HiPerFect Transfection Reagent (Qiagen). At 48 h posttransfection, TRIM33 proteins were incubated with E1 (100 ng), E2 (500 ng), and cells were stimulated with the indicated dsRNA plus Lipofectamine 2000 Ub (2.5 mg) in 50 ml assay buffer (50 mM Tris-HCl [pH 7.5], 2.5 mM for 8 h before the culture supernatants were harvested for cytokine ex- MgCl2, 0.5 mM DTT, and 2 mM ATP). Reactions were incubated at 30˚C pression analysis. For respiratory syncytial virus (RSV) infection, we first for 2 h. Then, samples were loaded to SDS-PAGE gel and analyzed by incubated the RSV (B strain; from Advanced Biotechnologies) with the immunoblotting. macrophages at a multiplicity of infection of 1 in Opti-MEM reduced- serum medium (Life Technologies) for 2 h as described previously (27), followed by washing and continued culturing with complete culture me- Results dium for 8 h before the supernatants were collected for ELISA. TRIM33 plays a critical role in cytosolic poly I:C–induced NLRP3 inflammasome activation in THP-1–derived ELISA macrophages The concentration of secreted human IL-1b and IL-18 in culture super- Helicase DHX33 is a critical cytosolic dsRNA sensor for the natants was measured by ELISA kits (IL-1b, BD Biosciences; IL-18, MBL International), according to the manufacturers’ instructions. NLRP3 inflammasome (27). To further investigate how DHX33 is regulated in dsRNA-induced the NLRP3 inflammasome, we Immunoblot analysis identified DHX33-interacting proteins by immunoprecipitation Proteins were probed with a primary Ab as follows: polyclonal rabbit anti- with Ab to DHX33 (anti-DHX33) in THP-1 cells, followed by TRIM33 (8972S; Cell Signaling Technology), polyclonal rabbit anti- protein sequencing by liquid chromatography–mass spectrometry. The Journal of Immunology 3

We found that the E3 Ub ligase TRIM33 was in a DHX33- LWM poly I:C–induced IL-1b production decreased dramatically interacting protein complex. We then examined whether TRIM33 in TRIM33-knockdown cells (Fig. 1E). By contrast, knockdown also functions in NLRP3 inflammasome activation. We checked of TRIM33 or DHX33 did not affect poly dA:dT induced IL-1b this function by stable knockdown of TRIM33 using shRNA in production (Fig. 1E). The knockdown efficiency of the shRNAs THP-1–derived macrophages. Two distinct TRIM33-targeting targeting TRIM33, DHX33, caspase-1 and NLRP3 were shown in shRNAs that showed good knockdown efficiency were selected. Fig. 1F. Taken together, these data indicate that TRIM33 is spe- We then stimulated those THP-1–derived macrophages with cifically involved in poly I:C–induced DHX33-dependent NLRP3 HMW poly I:C delivered by Lipofectamine 2000 and measured inflammasome activation but not in nigericin-induced NLRP3 IL-1b and IL-18 in the culture supernatants by ELISA. Consistent inflammasome activation. with published data, knockdown of DHX33 or NLRP3 abrogated the production of IL-1b and IL-18 (Fig. 1A) as well as the TRIM33 plays a critical role for cytosolic dsRNA-induced cleavage of caspase-1 (Fig. 1B) that was induced by intracellular NLRP3 inflammasome activation in human primary monocyte- poly I:C (27–29). Interestingly, knockdown of TRIM33 also re- derived macrophages duced the production of IL-1b and IL-18 and the cleavage of We next determined the role of TRIM33 in human primary caspase-1 by THP-1–derived macrophages in response to intra- monocyte–derived macrophages (hPMDM). We used siRNA to cellular HMW poly I:C (Fig. 1A, 1B). DHX33 is specifically in- knock down TRIM33, DHX33, and NLRP3. As shown in Fig. 2A volved in a cytosolic dsRNA-induced inflammasome activation by real-time PCR, all of the three siRNAs showed .60% knock- pathway but does not respond to other stimuli such as nigericin. down of mRNA levels. Knocking down TRIM33 in hPMDM re-

Similar to the knocking down of DHX33, knocking down of duced the secretion of IL-1b and IL-18 in response to cytosolic Downloaded from TRIM33 in THP-1–derived macrophages did not affect the pro- HMW poly I:C, as measured by ELISA (Fig. 2B). To determine duction of IL-1b and IL-18 (Fig. 1C) or the cleavage of caspase-1 the role of TRIM33 in response to microbial RNA stimulation, we (Fig. 1D) in response to nigericin. Both caspase-1 and NLRP3 isolated bacterial total RNA and reoviral RNA. In cells with are dispensable for the nigericin pathway. We also examined the scramble siRNA, large amounts of IL-1b and IL18 were produced TRIM33 function in THP-1–derived macrophages in response to upon stimulation with cytosolic bacterial and reoviral RNAs

LMW poly I:C and poly dA:dT. Similar to HMW poly I:C, the (Fig. 2C, 2D). These levels of IL-1b and IL-18 were reduced http://www.jimmunol.org/ by guest on September 23, 2021

FIGURE 1. TRIM33 plays a critical role in cytosolic poly I:C–induced NLRP3 inflammasome activation in THP-1–derived macrophages. (A–D) THP-1 macrophages were stimulated with 5 mg/ml cytosolic HMW poly I:C delivered by Lipofectamine 2000 (A and B)or2mM nigericin (C and D) for 8 h. The supernatants (sup) were collected for analysis of secreted IL-1b and IL-18 by ELISA (A and C) and cleaved caspase-1 by IB (B and D). The expression levels of procaspase-1 and GAPDH proteins in stimulated cells (lysate) were also analyzed by IB (B and D). THP-1 macrophages with scramble shRNA (shSCR) and treated with Lipofectamine 2000 alone (A and B) or medium (C and D) were used as mock. (E) ELISA of IL-1b production of THP-1 macrophages stimulated by 5 mg/ml cytosolic LMW poly I:C or poly dA:dT delivered by Lipofectamine 2000. (F) The protein expression levels of TRIM33, DHX33, caspase-1, NLRP3, and GAPDH were analyzed by immunoblotting in THP-1 macrophages with gene-specific shRNA or shSCR. GAPDH was shown for normalization of proteins. 4 TRIM33 UBIQUITINATION ON NLRP3 INFLAMMASOME ACTIVATION Downloaded from

FIGURE 2. TRIM33 plays a critical role in cytosolic dsRNA-induced NLRP3 inflammasome activation in hPMDMs. (A) The mRNA levels of TRIM33, DHX33, and NLRP3 in hPMDM were measured by real-time PCR 48 h post-siRNA transfection. (B–E) ELISA detection of IL-1b and IL-18 secretion by hPMDM cells after stimulation. Cells were stimulated with 5 mg/ml cytosolic HMW poly I:C (B), 2.5 mg/ml bacterial RNA (C), and 2.5 mg/ml Reoviral RNA (D) delivered by Lipofectamine 2000 or RSV for 8 h before the culture supernatants (sup) were collected for ELISA. hPMDM with scramble siRNA

(siSCR) and treated with Lipofectamine 2000 alone were used as mock. http://www.jimmunol.org/ dramatically in DHX33-knockdown cells or in NLRP3-knockdown dsRNA intermediates during the replication (30). The induced cells, which confirmed a previous study showing that DHX33 and IL-1b and IL-18 expression levels in the RSV-infected hPMDM NLRP3 play critical roles in sensing microbial RNA to activate supernatants were measured by ELISA. Both the IL-1b and IL-18 inflammasomes (27). TRIM33 knockdown resulted in about a production decreased dramatically when TRIM33, DHX33, or 60–70% reduction in IL-1b and IL18 secretion in response to NLRP3 is absent as compared with scramble siRNA knockdown. cytosolic bacterial RNA or reoviral RNA (Fig. 2C, 2D). To further These results indicated that TRIM33 play a critical role in cyto- determine the role of TRIM33 in response to viral infection, solic dsRNA–inducted NLRP3 inflammasome activation in siRNA-treated hPMDMs were infected with RSV, which generates hPMDM cells. by guest on September 23, 2021

FIGURE 3. TRIM33 binds to DHX33 directly and induces K63-linked ubiquitination. (A) In vitro pulldown assay using purified proteins. Left panel shows 1-mg pro- teins of DHX33, TRIM33, TRIM25, and RIG-I, followed by staining with Coomassie Brilliant Blue (Bio-Rad). HA- DHX33 (1 mg) was incubated with 0.5, 1, and 2 mg Myc- tagged TRIM33 or TRIM25 for 2 h, followed by Myc- beads pulldown and immunoblotting (IB) with anti-HA Ab (right panel). (B) In vitro ubiquitination assay using puri- fied TRIM33 and DHX33. Taken together with E1, Ub, ATP, and 10 different E2, the proteins were incubated at 30˚C for 2 h before SDS-PAGE and IB analysis with anti- Ub Ab. (C) In vitro ubiquitination assay using K48- or K63-linked Ub as a substrate. Taken together with E1, ATP, and E2 (Ubc H13), TRIM33 and DHX33 were incubated with K48- or K63-linked Ub under the same conditions for 2 h, followed by Ub IB. (D) In vitro ubiquitination assay of RIG-I or DHX33 by TRIM33 or TRIM25. In the presence of E1, Ubc 5c E2, Ub, and ATP, TRIM33 was incubated with RIG-I, whereas TRIM33 with DHX33 and TRIM25 with RIG-I combinations also were tested as controls. IP, immunoprecipitation. The Journal of Immunology 5

TRIM33 binds to DHX33 directly and induces K63-linked ubiquitination Because we found that TRIM33 is in a DHX33-interacting protein complex and TRIM33 is an E3 Ub ligase, we next investigated whether DHX33 is the ubiquitination target of TRIM33. HA- tagged DHX33 or Myc-tagged TRIM33 was expressed and puri- fied from 293T cells and were shown by Coomassie Brilliant Blue staining together with commercially obtained TRIM25 and RIG-I (Fig. 3A, left panel). In vitro pulldown assay experiments show that TRIM33 binds DHX33 in a dose-dependent manner (Fig. 3A, right panel). By contrast, TRIM25, an E3 ligase regulating the sensing of RNA by RIG-I, does not bind DHX33. To de- termine whether TRIM33 modified DHX33 directly, we per- formed an in vitro ubiquitination assay with TRIM33 and DHX33. In the presence of E1, E3 ligase TRIM33, Ub substrate, and ATP, DHX33 is ubiquitinated strongly by a specific E2 enzyme (Ubc H13). Two other E2 enzymes, Ubc H5c and H6, also can mar- ginally ubiquitinate DHX33 by TRIM33 (Fig. 3B). Using K48- specific or K63-specific Ub substrates, we observed that the FIGURE 4. TRIM33 binds to the HA2 domain of DHX33 via its Downloaded from ubiquitination of DHX33 was mediated by TRIM33 via K63 C-terminal BBC domain. Schematic structures of full-length (FL) and three A linkage but not K48 linkage (Fig. 3C). To determine whether truncations of DHX33 ( , top panel) and FL and seven truncations of B RIG-I is the ubiquitination target of TRIM33, we performed the TRIM33 ( , top panel) were shown. Numbers represent amino acid resi- dues. Domain mapping of DHX33 and TRIM33 interactions was shown in ubiquitination assay with RIG-I, TRIM33, or TRIM25. As shown the bottom panels (A and B). HA-tagged FL and truncation constructs were in Fig. 3D, RIG-I is ubiquitinated strongly by TRIM25 but not coexpressed with Myc-tagged TRIM33 (A) or DHX33 (B), followed by http://www.jimmunol.org/ by TRIM33. These results demonstrated that TRIM33 binds to immunoprecipitation (IP) with Myc-beads and then immunoblotting (IB) DHX33 and induces the ubiquitination of DHX33 specifically by of HA to detect the interacting molecules (middle panel). Five percent K63 linkage. input of HA-tagged truncations, and FL construct is shown in bottom panels (IP Myc and IB HA), whereas input of Myc-tagged FL protein is TRIM33 binds the HA2–DUF region of DHX33 via its B-box C shown as input. BB1, B-box motif 1; BB2, B-box motif 2; Brom, bro- terminal domain modomain; DEXDc, DEAD-like helicases superfamily domain; DUF, We next determined the interaction domains between TRIM33 and domain of unknown function; HA2, helicase-associated domain; HELICc, DHX33. We generated three truncations of HA-tagged DHX33 helicase C-terminal domain; PHD, plant homeo domain; RING, really with a deletion of the C-terminal DUF domain (dDUF), the HA2 interesting new gene. domain (dHA2) or the N-terminal DEXDc and HELICc domains by guest on September 23, 2021 (dHELICc) (Fig. 4A, top panel). We coexpressed the full-length target sites (Supplemental Table I). We therefore replaced each of DHX33 or the C terminus of DHX33 consisting of both HA2 the eleven lysine residues in DHX33 individually with arginine. domain and DUF domain with Myc-tagged TRIM33 and coim- We coexpressed the HA-tagged wild-type or mutations of DHX33 munoprecipitated using anti-Myc beads. We found that either together with Myc-TRIM33 in HEK293T cells and stimulated version of DHX33 could bind TRIM33 (Fig. 4A, bottom panel), the cells with HMW poly I:C for 2 h. Using the approach of an indicating that DHX33 binds TRIM33 via the C-terminal HA2– immunoprecipitation assay with anti-HA beads and followed by DUF region. Likewise, we generated and expressed truncated Ub immunoblotting, we were able to demonstrate that the K218R forms of HA-TRIM33 in 293T cells along with Myc-DHX33. substitution blocked ubiquitination of DHX33 (Fig. 5B). These Coimmunoprecipitated experiments showed that the truncated data indicated that TRIM33 is the main E3 ligase to induce the version of TRIM33 that lacked the B-box C-terminal (BBC) do- ubiquitination of DHX33, and this occurred on lysine 218. main was no longer pulled down by DHX33 (Fig. 4B), indicating TRIM33 is essential for DHX33-NLRP3 inflammasome that the BBC domain of TRIM33 binds DHX33. formation upon dsRNA stimulation TRIM33 ubiquitinates DHX33 at lysine 218 Because DHX33 forms a complex with NLRP3 in response to To determine whether TRIM33 is the main E3 ligase for the cytosolic dsRNA (27), we next examined whether TRIM33 plays ubiquitination of DHX33, we performed an in vivo Ub assay a role in the DHX33-NLRP3 complex formation. THP-1–derived on THP-1–derived macrophages. Upon stimulation with HMW macrophages with scramble and TRIM33-specific (shTRIM33) poly I:C for 2 h, we detected the polyubiquitinated DHX33 (Ub- stable knockdown were stimulated with HMW poly I:C or nigericin DHX33) in scramble knockdown cells, whereas nigericin stimu- for 2 h before harvesting and cell lysis. Immunoprecipitation lation did not generate detectable ubiquitinated DHX33 (Fig. 5A). was performed using anti-DHX33 followed by immunoblotting When we knock down DHX33 in THP-1 macrophages using for DHX33, TRIM33, and NLRP3. As shown in Fig. 6A, both TRIM33-specific shRNA, the Ub-DHX33 is not detectable any TRIM33 and NLRP3 were present with DHX33 only when more after HMW poly I:C stimulation (Fig. 5A). This result stimulated with HMW poly I:C in scramble knockdown mac- indicates that poly I:C–induced DHX33 ubiquitination in THP-1- rophages but not in nigericin-stimulated cells. Furthermore, derived macrophages is dependent on TRIM33. when TRIM33 is absent by stable knockdown using shTRIM33, To determine the residue on DHX33 that is ubiquitinated the interaction of NLRP3 with DHX33 is no longer detectable by TRIM33, we predicted the lysine sites of DHX33 that might after HMW poly I:C stimulation; neither was it detectable after be ubiquitinated using BDM-PUB online tool (http://bdmpub. nigericin stimulation, which indicates that TRIM33 is essential biocuckoo.org/results.php). When the ubiquitination threshold and specific for poly I:C–induced DHX33-NLRP3 complex was adjusted to 1.35, the tool predicted 11 putative ubiquitination formation. 6 TRIM33 UBIQUITINATION ON NLRP3 INFLAMMASOME ACTIVATION

FIGURE 5. TRIM33 ubiquitinates DHX33 at lysine 218. (A) Immunoblot of DHX33 in THP-1–derived macrophages after stimulation with HMW poly I:C or nigericin in scramble or TRIM33-specific shRNA knockdown cells. After 2 h of HMW poly I:C or 45 min of nigericin treatment, THP-1 macrophages were collected, and cytoplasmic components were extracted for SDS-PAGE and DHX33 immunoblotting (IB) (top panel). TRIM33 protein was determined using anti-TRIM33 Ab, and GAPDH was a loading control (bottom panel). (B) Immunoblotting of Ub after HA IP from HEK293T cells cotransfected with Myc-TRIM33 and HA-DHX33 wild-type and 10 mutants. Empty HA vector was used as a control (top panel). Cells were harvested 36 h posttransfection, and cell lysates were loaded for detection of input DHX33 amount by HA IB (middle panel). GAPDH was used as loading control. Downloaded from To further determine the ubiquitination effect on DHX33-NLRP3 As important intracellular antimicrobial machinery (32), the complex formation, we overexpressed HA-tagged DHX33 wild- inflammasome needs precise regulation of its activation. Our type and the lysine 218 mutant (K218R) in THP-1 macrophages. results showed that TRIM33-induced DHX33 ubiquitination is The macrophages were stimulated with HMW poly I:C or niger- essential for the DHX33–NLRP3 inflammasome formation and icin, followed by HA immunoprecipitation. As shown in Fig. 6B, function, as shown by ELISA detection of IL-1b and IL-18 pro-

both NLRP3 and TRIM33 were pulled down by wild-type DHX33. duction as well as our endogenous immunoprecipitation experi- http://www.jimmunol.org/ However, the DHX33 K218R mutant, which abolished the ments. In contrast to cytosolic dsRNA, TRIM33-DHX33 is not DHX33 ubiquitination by TRIM33, only pulled down TRIM33 involved in the NLRP3 activation that is induced by nigericin, but not NLRP3. Neither the wild-type nor the K218R mutant which is believed to use a different activation pathway (33). DHX33 can pull down TRIM33 or NLRP3 after nigericin stim- IthasbeenreportedthatTRIM33isinvolvedinerythroid ulation (Fig. 6B). These data indicate that the ubiquitination of differentiation, tumor suppression, and the autoimmune disease DHX33 at lysine 218 by TRIM33 is required to form the DHX33– NLRP3 complex and thus is also required for NLRP3 inflam- masome activation. by guest on September 23, 2021 Discussion In this study, we have presented data showing that the E3 Ub ligase TRIM33 plays a critical role in the cytosolic dsRNA–induced NLRP3 inflammasome activation by targeting the dsRNA sensor DHX33. Knockdown of TRIM33 in THP-1–derived or hPMDMs results in reduced NLRP3 inflammasome activation in response to cytosolic dsRNA. TRIM33 binds DHX33 in macrophages and induces the K63-linked polyubiquitination of DHX33 upon cyto- solic dsRNA stimulation. TRIM33 ubiquitinates DHX33 at lysine 218. DHX33 interacts with TRIM33 via the HA2-DUF region and the BBC domain. This interaction is essential for the activation and formation of the DHX33–NLRP3 inflammasome complex upon dsRNA stimulation. Various stimuli have been shown to activate the NLRP3 inflammasome, including the bacterial toxin nigericin, LPS plus ATP treatment, and cytosolic nucleic acids (26). DHX33 has been identified as the cytosolic dsRNA sensor that induces NLRP3 inflammasome activation.TRIM33 is the main E3 ligase of DHX33, specifically regulating the formation of the cytosolic dsRNA–induced NLRP3 inflammasome. FIGURE 6. TRIM33 is essential for DHX33–NLRP3 inflammasome Most of the TRIM family members are E3 Ub ligases, and they formation upon dsRNA stimulation. (A) Endogenous immunoprecipitation have been reported to mediate both K48- and K63-linked ubiq- (IP) of DHX33 in THP-1–derived macrophages treated with scramble uitination. Two well-studied examples of TRIM protein ubiq- (shSCR) or TRIM33-specific shRNA (shTRIM33) and stimulated with uitination of helicase family members are the reports that TRIM25 HMW poly I:C or nigericin. Isotype Ab (IgG) was also used for immu- ubiquitinates RIG-I by K63-specific linkage and TRIM21 ubiq- noprecipitation (IP) as a control. The IP samples were blotted with Abs anti-NLRP3 and anti-DHX33 (IP section). Five percent of the lysate was uitinates DDX41 by K48-specific linkage (8, 10). Some other loaded as input and blotted with anti-TRIM33, anti-DHX33, and anti- TRIM members that are important in regulating the innate im- NLRP3 Abs (input section). GAPDH was used as a loading control. (B)IP mune response also have been reported. TRIM56 was reported to of DHX33 in THP-1–derived macrophages transfected with HA-tagged ubiquitinate and activate the STING molecule, which is a key DHX33 wild-type and K218R mutant plasmids using HA beads. Five adaptor for DNA sensors (12). TRIM38 was reported to target percent of each cell lysate was loaded as input. The IP samples and inputs TRAF6 for degradation via K48-linked ubiquitination (31). were blotted with Abs anti-HA, anti-NLRP3, and anti-TRIM33. The Journal of Immunology 7 dermatomyositis (34–37). Our study found another important dependent DNA damage response through interaction with amplified in liver cancer 1 (ALC1) protein. J. Biol. Chem. 288: 32357–32369. function of TRIM33 in regulating NLRP3 activation in response to 17. Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular bacterial and viral infection. This finding will further shed light on platform triggering activation of inflammatory caspases and processing of proIL- the clinical application of TRIM33 for various diseases including b. Mol. Cell 10: 417–426. 18. Agostini, L., F. Martinon, K. Burns, M. F. McDermott, P. N. Hawkins, and microbial infections. J. Tschopp. 2004. NALP3 forms an IL-1b‑processing inflammasome with in- creased activity in Muckle-Wells autoinflammatory disorder. Immunity 20: 319– 325. Acknowledgments 19. Schroder, K., and J. Tschopp. 2010. The inflammasomes. Cell 140: 821–832. We thank Dr. Carson Harrod at Baylor Institute for Immunology Research 20. Cerretti, D. P., C. J. Kozlosky, B. Mosley, N. Nelson, K. Van Ness, for critical reading of the manuscript. We also thank all of the colleagues T. A. Greenstreet, C. J. March, S. R. Kronheim, T. Druck, L. A. Cannizzaro, et al. 1992. Molecular cloning of the interleukin-1b converting enzyme. Science in our laboratory for helpful discussions. 256: 97–100. 21. Wen, H., E. A. Miao, and J. P. Ting. 2013. Mechanisms of NOD-like receptor- associated inflammasome activation. Immunity 39: 432–441. Disclosures 22. Wu, J., T. Fernandes-Alnemri, and E. S. Alnemri. 2010. Involvement of the The authors have no financial conflicts of interest. AIM2, NLRC4, and NLRP3 inflammasomes in caspase-1 activation by Listeria monocytogenes. J. Clin. Immunol. 30: 693–702. 23. Zhou, R., A. Tardivel, B. Thorens, I. Choi, and J. Tschopp. 2010. Thioredoxin- interacting protein links oxidative stress to inflammasome activation. Nat. References Immunol. 11: 136–140. 1. Meroni, G., and G. Diez-Roux. 2005. TRIM/RBCC, a novel class of ‘single 24. Zhou, R., A. S. Yazdi, P. Menu, and J. Tschopp. 2011. A role for mitochondria in protein RING finger’ E3 ubiquitin ligases. BioEssays 27: 1147‑1157. NLRP3 inflammasome activation. Nature 469: 221–225. 2. Reymond, A., G. Meroni, A. Fantozzi, G. Merla, S. Cairo, L. Luzi, D. Riganelli, 25. Shimada, K., T. R. Crother, J. Karlin, J. Dagvadorj, N. Chiba, S. Chen, E. Zanaria, S. Messali, S. Cainarca, et al. 2001. The V. K. Ramanujan, A. J. Wolf, L. Vergnes, D. M. Ojcius, et al. 2012. Oxidized Downloaded from identifies cell compartments. EMBO J. 20: 2140–2151. mitochondrial DNA activates the NLRP3 inflammasome during . Im- 3. Joazeiro, C. A., and A. M. Weissman. 2000. RING finger proteins: mediators of munity 36: 401–414. ubiquitin ligase activity. Cell 102: 549–552. 26. Mariathasan, S., K. Newton, D. M. Monack, D. Vucic, D. M. French, W. P. Lee, 4. Rajsbaum, R., A. Garcı´a-Sastre, and G. A. Versteeg. 2014. TRIMmunity: the M. Roose-Girma, S. Erickson, and V. M. Dixit. 2004. Differential activation of roles of the TRIM E3-ubiquitin ligase family in innate antiviral immunity. J. the inflammasome by caspase-1 adaptors ASC and Ipaf. Nature 430: 213–218. Mol. Biol. 426: 1265–1284. 27. Mitoma, H., S. Hanabuchi, T. Kim, M. Bao, Z. Zhang, N. Sugimoto, and 5. Liu, Y. C. 2004. Ubiquitin ligases and the immune response. Annu. Rev. Y. J. Liu. 2013. The DHX33 RNA helicase senses cytosolic RNA and activates

Immunol. 22: 81–127. the NLRP3 inflammasome. Immunity 39: 123–135. http://www.jimmunol.org/ 6. McNab, F. W., R. Rajsbaum, J. P. Stoye, and A. O’Garra. 2011. Tripartite-motif 28. Kanneganti, T. D., M. Body-Malapel, A. Amer, J. H. Park, J. Whitfield, proteins and innate immune regulation. Curr. Opin. Immunol. 23: 46–56. L. Franchi, Z. F. Taraporewala, D. Miller, J. T. Patton, N. Inohara, and G. Nu´n˜ez. 7. Carthagena, L., A. Bergamaschi, J. M. Luna, A. David, P. D. Uchil, F. Margottin- 2006. Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to Goguet, W. Mothes, U. Hazan, C. Transy, G. Pancino, and S. Nisole. 2009. viral infection and double-stranded RNA. J. Biol. Chem. 281: 36560–36568. Human TRIM in response to interferons. PLoS ONE 4: e4894. 29. Rajan, J. V., S. E. Warren, E. A. Miao, and A. Aderem. 2010. Activation of the 8. Gack, M. U., Y. C. Shin, C. H. Joo, T. Urano, C. Liang, L. Sun, O. Takeuchi, NLRP3 inflammasome by intracellular poly I:C. FEBS Lett. 584: 4627–4632. S. Akira, Z. Chen, S. Inoue, and J. U. Jung. 2007. TRIM25 RING-finger E3 30. Martı´nez, I., and J. A. Melero. 2002. A model for the generation of multiple A to ubiquitin ligase is essential for RIG-I‑mediated antiviral activity. Nature 446: G transitions in the human respiratory syncytial virus genome: predicted RNA 916–920. secondary structures as substrates for adenosine deaminases that act on RNA. J. 9. Stremlau, M., C. M. Owens, M. J. Perron, M. Kiessling, P. Autissier, and Gen. Virol. 83: 1445–1455. J. Sodroski. 2004. The cytoplasmic body component TRIM5alpha restricts HIV- 31. Zhao, W., L. Wang, M. Zhang, C. Yuan, and C. Gao. 2012. E3 ubiquitin ligase

1 infection in Old World monkeys. Nature 427: 848–853. tripartite motif 38 negatively regulates TLR-mediated immune responses by by guest on September 23, 2021 10. Zhang, Z., M. Bao, N. Lu, L. Weng, B. Yuan, and Y. J. Liu. 2013. The E3 proteasomal degradation of TNF receptor-associated factor 6 in macrophages. J. ubiquitin ligase TRIM21 negatively regulates the innate immune response to Immunol. 188: 2567–2574. intracellular double-stranded DNA. Nat. Immunol. 14: 172–178. 32. Davis, B. K., H. Wen, and J. P. Ting. 2011. The inflammasome NLRs in im- 11. Shi, M., W. Deng, E. Bi, K. Mao, Y. Ji, G. Lin, X. Wu, Z. Tao, Z. Li, X. Cai, et al. munity, inflammation, and associated diseases. Annu. Rev. Immunol. 29: 707– 2008. TRIM30a negatively regulates TLR-mediated NF-kB activation by tar- 735. geting TAB2 and TAB3 for degradation. Nat. Immunol. 9: 369–377. 33. Perregaux, D., and C. A. Gabel. 1994. Interleukin-1 beta maturation and release 12. Tsuchida, T., J. Zou, T. Saitoh, H. Kumar, T. Abe, Y. Matsuura, T. Kawai, and in response to ATP and nigericin: evidence that potassium depletion mediated by S. Akira. 2010. The ubiquitin ligase TRIM56 regulates innate immune responses these agents is a necessary and common feature of their activity. J. Biol. Chem. to intracellular double-stranded DNA. Immunity 33: 765–776. 269: 15195–15203. 13. He, W., D. C. Dorn, H. Erdjument-Bromage, P. Tempst, M. A. Moore, and 34. Venturini, L., J. You, M. Stadler, R. Galien, V. Lallemand, M. H. Koken, J. Massague´. 2006. Hematopoiesis controlled by distinct TIF1g and Smad4 M. G. Mattei, A. Ganser, P. Chambon, R. Losson, and H. de The´. 1999. TIF1g, branches of the TGFb pathway. Cell 125: 929–941. a novel member of the transcriptional intermediary factor 1 family. 14. Herquel, B., K. Ouararhni, K. Khetchoumian, M. Ignat, M. Teletin, M. Mark, 18: 1209–1217. G. Be´chade, A. Van Dorsselaer, S. Sanglier-Cianfe´rani, A. Hamiche, et al. 2011. 35. Bai, X., J. Kim, Z. Yang, M. J. Jurynec, T. E. Akie, J. Lee, J. LeBlanc, A. Sessa, cofactors TRIM24, TRIM28, and TRIM33 associate to form H. Jiang, A. DiBiase, et al. 2010. TIF1g controls erythroid cell fate by regulating regulatory complexes that suppress murine hepatocellular carcinoma. Proc. Natl. transcription elongation. Cell 142: 133–143. Acad. Sci. USA 108: 8212–8217. 36. Vincent, D. F., K. P. Yan, I. Treilleux, F. Gay, V. Arfi, B. Kaniewski, J. C. Marie, 15. Aucagne, R., N. Droin, J. Paggetti, B. Lagrange, A. Largeot, A. Hammann, F. Lepinasse, S. Martel, S. Goddard-Leon, et al. 2009. Inactivation of TIF1g A. Bataille, L. Martin, K. P. Yan, P. Fenaux, et al. 2011. Transcription inter- cooperates with Kras to induce cystic tumors of the pancreas. PLoS Genet. 5: mediary factor 1g is a tumor suppressor in mouse and human chronic myelo- e1000575. monocytic leukemia. J. Clin. Invest. 121: 2361–2370. 37. Labrador-Horrillo, M., M. A. Martı´nez, A. Selva-O’Callaghan, E. Trallero- 16. Kulkarni, A., J. Oza, M. Yao, H. Sohail, V. Ginjala, A. Tomas-Loba, Z. Horejsi, Aragua´s, E. Balada, M. Vilardell-Tarre´s, and C. Juarez. 2012. Anti-TIF1g A. R. Tan, S. J. Boulton, and S. Ganesan. 2013. Tripartite motif-containing 33 antibodies (anti-p155) in adult patients with dermatomyositis: comparison of (TRIM33) protein functions in the poly(ADP-ribose) polymerase (PARP)- different diagnostic assays. Ann. Rheum. Dis. 71: 993–996. The Journal of Immunology

Corrections

Weng, L., H. Mitoma, C. Tricot, M. Bao, Y. Liu, Z. Zhang, and Y.-J. Liu. 2014. The E3 ubiquitin ligase tripartite motif 33 is essential for cytosolic RNA–induced NLRP3 inflammasome activation. J. Immunol. 193: 3676–3682.

The third author’s last name was published incorrectly. The correct name is Coline Trichot. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1490042

Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00