Epigenetic Alterations Induced by Human Papillomavirus E6 and E7 Oncoproteins

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:40050102

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Epigenetic Alterations Induced by Human Papillomavirus E6 and E7 Oncoproteins

A dissertation presented

Tyshia Kyree Wellman

The Division of Medical Sciences

in partial fulfillment of the requirements

for the degree of

Doctor of Philosophy

in the subject of

Virology

Harvard University

Cambridge, Massachusetts

April 2018

Dissertation Advisor: Professor Karl Munger Tyshia Kyree Wellman

Epigenetic Alterations Induced by Human Papillomavirus E6 and E7 Oncoproteins

Abstract

High-risk human papillomaviruses (HPVs) account for over 99 percent of cervical carcinomas as well as other anogenital tract and oropharyngeal carcinomas. The E6 and E7 oncoproteins are consistently expressed in cervical cancer and are small proteins with no enzymatic or DNA binding activity. Oncogenic transformation results from the modulation of host proteins and pathways by these proteins, most notably the degradation of tumor suppressors p53 and pRB by E6 and E7, respectively. To overcome the oncogenic activities of E7, the expression of the p16INK4A tumor suppressor is induced; thereby inhibiting CDK 4/6 activity leading to growth arrest and cellular senescence. However, E7 subverts this response through the degradation of the downstream effector pRB, resulting in aberrant proliferation. The mechanisms for E7 driven p16INK4A expression are not fully defined, but include epigenetic derepression through removal of repressive H3K27 trimethylation by the demethylase

KDM6B.

Here we show that epigenetic modulation of p16INK4A by E7 also involves removal of repressive

H2AK119 monoubiquitination and deposition of activating H3K4 trimethyl and H3K27 acetyl marks, likely facilitated through the recruitment of the H2AK119 ubiquitin reader ZRF1 and H3K4 methyltransferase MLL1, respectively. Moreover, we report that p16INK4A expression persists despite the presence of repressive PRC2 components EZH2 and SUZ12 and H3K27 trimethylation, suggesting that presence of PRC2 complexes and H3K27 trimethylation are not sufficient to repress p16INK4A expression.

We investigated the necessity of epigenetic factors on the survival of E6/E7 expressing cells. The expression of epigenetic factor KDM6B, and consequently p16INK4A, is necessary for the survival of E7 expressing cells; therefore, performing the first epigenetic RNAi screen in primary human foreskin

iii keratinocytes, we identified and validated four factors, MLL1, ASXL1, BRD4, and ZRF1 that are necessary for the survival of E6/E7 expressing cells.

Finally, we evaluated the necessity of p16INK4A and KDM6B expression in carcinomas that express high levels of p16INK4A. Depletion of p16INK4A in breast carcinoma cells selectively affected survival of p16INK4A-high expressing cells over p16INK4A-deleted cells. Furthermore, treatment of ovarian, lung, Merkel cell, and breast carcinoma cells with a KDM6B inhibitor resulted in decreased survival with the greatest effects in the high p16INK4A expressing cells.

ACKNOWLEDGMENTS

The road to a Ph.D. is not one that you can travel alone. I would firstly like to thank my Creator because truly with Him all things are possible. This journey has been incredibly long and arduous and He has given me strength when I was weak, insight when there was none, and most importantly, hope. He helped me navigate the numerous obstacles with His divine guidance. I would like to thank Him for his generous revelation of the complexities of nature that He designed and He is justly deserving of all honor and glory.

I would like to thank my advisor Karl Munger. Karl has stuck with me through numerous setbacks and his optimism has helped me to persevere. Karl’s patience and understanding, especially when life pulled me away from my work, has been absolutely essential for the completion of this degree.

One of the things that I enjoyed the most about my time in the lab was the experimental freedom as Karl encouraged and supported new ideas and experiments. I admire his desire to foster a community in his lab, of which he was happy to join. He was even a good sport when we “April Fooled” his office with

Easter eggs and confetti! This Ph.D. could literally have not been possible without the help from Karl as he did some of the experiments himself! It was exciting to get to train my mentor on how to do alamar blue assays! Although this dissertation did not end up where either of us hoped it would, I can say that I have learned a great deal from Karl that will serve me well in my future scientific endeavors.

I would also like to thank my dissertation advisory committee. Jim DeCaprio was so valuable with experimental design and his straightforward attitude really helped to cut through the “we could do” experiments to determine the most important ones to perform. I would also like to thank Jim for his time serving as the chair of my defense examination committee. It was a pleasure to have Yang Shi and Karen

Cichowski on my committee and their suggestions and encouragement were greatly appreciated.

The Munger lab has been incredibly helpful during this process. The lab has always been filled with individuals who were willingly to offer advice, design experiments, and have non-scientific discussions. I would like to give a huge thanks to Miranda Grace, who has helped me in so many ways. I

v could not have completed this Ph.D. without all of the work that she did. Molly McLaughlin-Drubin was a great mentor when I first joined the lab and has taught me most of what I know about experimental execution. Finally, I would like to thank Mallory Harden who has been my biggest support in the lab.

She has encouraged me and helped me back up when I would get knocked down. We shared many good memories during our time in the lab that I will look fondly back on for years to come.

I thank all of my family for their support, especially my sister Toyce and her family, who have been so encouraging. My sister has been an excellent role model and I have always admired her strength.

My parents have been such an integral part of my education. They pushed me just the right amount and always took a great interest in my education. They have been great models for doing your best and not giving up even when life gets hard. They have taught me so much and I wouldn’t be where I am without them. I want to thank them for their support through this whole process and especially my Dad, whom I have spent countless hours on the phone with telling me that I could do this. After all, “If it were easy, then anyone could do it”.

I would like to also thank my family for all of their sacrifices to help me complete this degree.

My husband, Jon, has been there from day one and always did a great job of encouraging me when I was ready to quit. You were my rock during this time and were great at putting things into perspective for me when I couldn’t. Thank you for being by my side during this journey and for your incredible patience while we put our lives on hold so I could pursue my dream. Although they can’t understand yet, I want to thank my two beautiful girls for their patience and love during this process. Your smiles, laughs, and hugs would lift me up during the roughest days. You girls have been my motivation to see this through.

As I am writing this now and looking down on your faces as you sweetly dream, I did this all for you girls.

TABLE OF CONTENTS

ABSTRACT...... iii

ACKNOWLEDGEMENTS...... v

CHAPTER ONE: Introduction

1.1 Human Papillomaviruses...... 2

1.1.1 Classification of Papillomaviruses...... 2

1.1.2 HPV genome structure...... 3

1.1.3 High-risk HPV16 lifecycle...... 3

1.1.4 High-risk HPV associated disease and prevention...... 8

1.1.5 Oncogenic activities of E6 and E7 oncoproteins...... 10

1.2 Oncogene-induced senescence and the p16INK4A tumor suppressor...... 15

1.2.1 Tumor suppressor p16INK4A...... 16

1.2.2 The role of HPV16 E7 in the induction of p16INK4A...... 18

1.2.3 Synthetic lethality in cancers...... 19

1.3 Epigenetic regulation of p16INK4A...... 21

1.3.1 Polycomb and trithorax group proteins control a variety of cellular programs....21

1.3.2 Epigenetic regulation of p16INK4A...... 24

1.3.3 HPV16 E7 and PcGs...... 27

1.4 Overexpression of p16INK4A in non-HPV associated carcinomas...... 30

1.4.1 High-grade serous ovarian carcinomas...... 30

1.4.2 Non-small cell lung carcinomas...... 30

1.4.3 Basal-like breast carcinomas...... 30

1.4.4 Merkel cell carcinomas...... 31

SUMMARY AND SIGNIFICANCE...... 32

vii

CHAPTER TWO: Alteration of the epigenetic state of tumor suppressor p16INK4A by the human papillomavirus E7 oncoprotein

Abstract...... 36

Introduction...... 37

Materials and Methods...... 39

Results...... 42

Discussion...... 56

CHAPTER THREE: Epigenetic regulators ASXL1, MLL1, BRD4, and ZRF1 are necessary for survival of HPV16 E6 and E7 expressing cells

Abstract...... 62

Introduction...... 63

Materials and Methods...... 65

Results...... 68

Discussion...... 81

CHAPTER FOUR: A variety of HPV-negative carcinoma cell lines are sensitive to inhibition of histone demethylase KDM6B possibly through a p16INK4A-dependent mechanism

Abstract...... 89

Introduction...... 89

Materials and Methods...... 90

Results...... 93

Discussion...... 101

CHAPTER FIVE: General Discussion

Summary...... 107

General discussion and future directions...... 111

REFERENCES...... 137

APPENDIX 1...... 163

viii

TABLE OF FIGURES

Figure 1.1 HPV16 genome structure and lifecycle...... 4

Figure 1.2 Transformation by HPV16 E6 and E7 oncoproteins...... 11

Figure 1.3 Oncogene-induced senescence and the pRB pathway...... 17

Figure 1.4 Epigenetic regulation of p16INK4A...... 25

Table 1.1 Review of epigenetic regulation of p16INK4A between oncogenic RAS and HPV16 E7

activation...... 29

Figure 2.1 Transcriptional alteration of p16INK4A regulators in HPV16 E7 expressing HFKs...... 43

Figure 2.2 HPV16 E7 modulates expression of some p16INK4A regulators in HFKs...... 44

Figure 2.3 Expression of HPV16 E7 reduces repressive H3K27 trimethylation and H2AK119

monoubiquitination and increases H3K4 trimethylation and H3K27 acetylation on the

p16INK4A promoter...... 46

Figure 2.4 Expression of HPV16 E7 may increase recruitment of MLL1 and ZRF1 to the p16INK4A

promoter...... 48

Figure 2.5 EZH2 is associated with SUZ12 occupancy at the p16INK4A promoter and promotes

increased H3K27 trimethylation in HPV16 E6/E7 HFKs...... 51

Figure 2.6 Expression of negative epigenetic regulators of p16INK4A expression in HPV16 E6/E7

HFKs...... 52

Figure 2.7 Increased EZH2 at the p16INK4A promoter may be phosphorylated and is contained in

PRC2 complexes leading to H3K27 trimethylation, but not silencing of p16INK4A

expression in HPV16 E7 HFKs...... 54

Figure 3.1 Schematic representation of screen execution...... 70

Figure 3.2 Sequencing of HPV16 E6/E7 expressing HFKs screened with epigenetic

library...... 71

Table 3.1 List of top 30 epigenetic factors identified as necessary for survival of E6/E7 expressing

HFKs...... 73

Figure 3.3 ASXL1, BRD4, and MLL1 depletion may affect viability of E6/E7 expressing HFKs...74

Figure 3.4 E6 and E7 oncoproteins contribute to loss of viability of ASXL1, BRD4, MLL1,

KDM3B, and DNMT1 depleted HFKs...... 76

Figure 3.5 ASXL1, BRD4, and MLL1 depletion reduces survival of cervical carcinoma lines...... 78

Figure 3.6 Depletion of epigenetic factors selectively reduces survival of cervical carcinoma

lines...... 79

Figure 3.7 ZRF1 knockdown affects viability of SiHa cervical carcinoma cell line...... 80

Figure 3.8 ZRF1 depletion selectively affects survival of E7 expressing HFKs...... 82

Figure 4.1 Expression of p16INK4A and pRB are inversely correlated in breast carcinoma cell

lines...... 94

Figure 4.2 The p16INK4A high breast carcinoma cell line MDA-MB-468 requires expression of

p16INK4A for survival...... 96

Figure 4.3 GSK-J4 treatment affects survival of cancer cell lines...... 98

Figure 4.4 Levels of p16INK4A or p14ARF do not correlate with levels of KDM6B...... 99

Figure 5.1 Recruitment of S21 phosphorylated EZH2 to the p16INK4A promoter is not sufficient to

repress p16INK4A expression...... 115

Figure 5.2 Expression of HPV16 E7 alters the core histone modifications leading to p16INK4A

activation...... 119

Table 5.1 Updated review of epigenetic regulation of p16INK4A as a consequence of HPV16 E7

expression...... 122

Figure 5.3 Proposed models of HPV16 E6/E7 expressing cells dependence on ASXL1, MLL1,

BRD4, and ZRF1 for survival...... 129

Figure A.1 Expression of screen hits ASXL1 and BRD4 in HPV16 E7 expressing HFKs through RT-

qPCR...... 164

Table A.1 List of genes targeted by the CP0010 lentiviral shRNA epigenetic library (Broad

Institute) used in screen...... 165

Figure A.2 Effects on cell viability of shRNA depletion of additional screen hits and polycomb

proteins in HPV16 E7 expressing HFKs two days post

transduction...... 189

Figure A.3 Treatment of HPV-negative and HPV-positive carcinoma lines with KDM6B/A inhibitor,

GSK-J4, and pan-selective jumonji demethylase inhibitor, JIB-04...... 191

Figure A.4 Impact of various culturing methods on expression of p16INK4A through RT-qPCR and

lifespan in culture...... 193

Figure A.5 Hydroxyurea treatment of HFKs induces p16INK4A and KDM6B expression...... 195

Figure A.6 Inducible expression of HPV16 E7, p16INK4A, and KDM6B in HFKs as determined by

RT-qPCR using the pLIX system for doxycycline-inducible HPV16 E7

expression...... 196

CHAPTER ONE

Introduction

1.1 HUMAN PAPILLOMAVIRUSES

1.1.1 Classification of Papillomaviruses

Papillomaviruses (PVs) are small DNA viruses belonging to the family Papillomaviridae and display high species specificity infecting the mucosal or cutaneous epithelia of a variety of vertebrate hosts including mammals, birds, reptiles, and even fish (Bernard et al., 2010; Lopez-Bueno et al., 2016).

In addition, individual PVs display unique anatomical tropism of the mucosal or cutaneous epithelium.

Genetically speaking, PVs are relatively stable viruses and are classified based on the L1 capsid protein as it is generally well conserved among PVs (Bernard et al., 2010). Genera are determined though greater than 60% sequence similarity of the L1 protein with further classification into species (Bernard et al.,

2010). Types within a species are distinguished by less than 90% L1 sequence similarity (Bernard et al.,

2010). Types that are less than 10% dissimilar are designated subtypes and variants are distinguished by greater than 98% similarity (de Villiers et al., 2004). Most human PVs (HPVs) fall into one of five genera: alpha, beta, gamma, mu, and nu (de Villiers et al., 2004). As of April 2018, 202 HPVs have been identified and classified (Papillomavirus Episteme http://pave.niaid.nih.gov; (Van Doorslaer et al., 2017)).

In addition, over 100 additional HPVs have been identified, but remain to be classified by the

International Human Papillomavirus Reference Center (Papillomavirus Episteme http://pave.niaid.nih.gov; (Van Doorslaer et al., 2017)). Of the over 200 HPVs that have been classified, alpha and beta HPVs continue to be the most studied due to their medical significance. Beta HPVs infect cutaneous epithelium and cause benign warts; however, these warts can progress to squamous cell carcinomas in individuals with the genetic disorder, epidermodysplasia verruciformis (EV) and in chronically immune suppressed patients (Lazarczyk et al., 2009). Alpha HPVs, which are the focus of this dissertation, infect the mucosal epithelium of the anogenital and oropharyngeal tracts and are categorized into low-risk or high-risk based on their propensity to cause malignant neoplasms. High-risk

HPV infections are associated with nearly all cervical carcinomas as well as many anogenital and

2 oropharyngeal cancers (IARC, 2007). Low-risk HPVs, like types 6 and 11, are associated with benign mucosal warts that do not progress to malignant transformation (Moore et al., 1999).

1.1.2 HPV genome structure

HPVs are non-enveloped, double stranded DNA viruses with an iscoshedral structure approximately 60 nm in diameter, containing the approximately 8 kb genome as a single episome (Knipe and Howley, 2013). The genome is divided into three regions: the long control region (LCR), alternatively known as the upstream regulatory region (URR) or non-coding region (NCR), the early (E), and the late (L) region containing eight to nine open reading frames (ORFs) (Zheng and Baker, 2006).

The non-coding LCR region contains the origin of replication as well as elements necessary for transcription of the E and L regions (Figure 1.1) (Mistry et al., 2007; Zheng and Baker, 2006). All HPV

E regions, encompassing over 50% of the genome, encode the non-structural E1, E2, E4, E6, and E7

ORFs and some HPVs also encode the E5 and/or the E8 ORFs (Zheng and Baker, 2006). E1, E2, E6, E7, and E8 are transcribed from the early promoter during the initial phases of infection and the late promoter controls transcription of E1, E2, E4, E5, and the L region encoded ORFs, L1 and L2, which are the major and minor capsid structural proteins, respectively (reviewed in (Doorbar, 2006)). Both the E and L regions are delineated by the presence of early and late polyadenylation sites poly AE and poly AL, respectively (Zheng and Baker, 2006).

1.1.3 High-risk HPV16 lifecycle

Attachment and Entry

Like all HPVs, the high-risk alpha HPV type 16 described in this dissertation, requires the host for replication and transcriptional processes as their limited genome does not encode replication or transcriptional machinery. Therefore, HPVs require the actively proliferating cells of the epithelium to initiate their life cycle. The stratified squamous epithelium is divided into basal, spinous, granular, and cornified layers, where cells of the basal layer are symmetrically or asymmetrically dividing to generate

Figure 1.1. HPV16 genome structure and lifecycle. The HPV16 genome encodes seven early (E) and two late (L) proteins denoted in yellow and purple, respectively. HPVs infect the cells of the basal epithelium through exposure from microabrasions. In these undifferentiated cells, early gene expression (E1, E2, E6, E7, E8) occurs from the early P97 promoter leading to viral genome maintenance. As the basal cells begin to differentiate and move up the epithelium, transcription of genes (E1, E2, E4, E5) from the late promoter P670 occurs for genome amplification. Expression of the L proteins required for virion assembly begins in the upper layers of the epithelium. Virions are released from the continuous shedding of dead cells from the uppermost layers of the epidermis.

4 self-renewing stem cells or the upper layers of the epithelium, respectively (Figure 1.1). HPVs are non- lytic and require the unique biology of the epithelium to release progeny virions through the continuous shedding of upper most layer of terminally differentiated cells; however, as the suprabasal layers of the epithelium are composed of non-cycling differentiated cells, only the basal layer of cells is amenable to

HPV infection. Cells of subcolumnar junctions in the transformation zone of the cervix are particularly susceptible to infection by alpha HPVs (Herfs et al., 2012). Cells of the basal layers are not directly accessible by HPVs as they are shielded by the layers of differentiated epithelial cells above.

Microabrasions mediate exposure to this subset of cells, circumventing this challenge (Figure 1.1)

(reviewed in (Moody and Laimins, 2010)). HPVs target the asymmetrically dividing basal cells to complete productive infection in the upper layers of the epithelium. Wound healing responses triggered by the microabrasions stimulate the self-renewing stem cells of the basal layer to divide thus establishing persistent infection by maintenance of low copies of the genome (reviewed in (Bodily and Laimins,

2011)).

Initial interaction between the virus and the cell occur through association of the L1 major capsid protein with three O and N-sulfated heparan sulfate proteoglycans (HSPGs) on the cell surface (Dasgupta et al., 2011; Giroglou et al., 2001; Johnson et al., 2009; Richards et al., 2013; Selinka et al., 2003).

Laminin 5 has been shown to be an additional attachment receptor for HPV16 (Culp et al., 2006; Richards et al., 2014; Selinka et al., 2007). Engagement of L1 with HSPGs induces conformational changes, specifically exposure of the amino terminus of L2 for cleavage, suspected to be facilitated by cyclophilin

B on the cell surface (Bienkowska-Haba et al., 2009). The cellular serine protease, furin, cleaves L2 at the well conserved cleavage site at the amino terminus (Richards et al., 2006). Cleavage of L2 induces a conformational change, impairing the affinity of the virus for HSPGs (Day et al., 2008). This mediates transfer to an unidentified secondary receptor, with candidates including α-6 integrins, tetraspanins, growth factor receptors, and annexin A2 (Abban et al., 2008; Dziduszko and Ozbun, 2013; Evander et al.,

1997; Scheffer et al., 2013; Spoden et al., 2008; Surviladze et al., 2012; Woodham et al., 2012; Yoon et al., 2001). The mechanisms by which the virus is internalized are unclear. Actin appears to play a role

5 and it has been suggested that the virus moves along actin-rich membrane filopodia, an action termed

“surfing” (Schelhaas et al., 2008; Smith et al., 2008). However, it is clear that HPV does not utilize traditional avenues of endocytosis as internalization is not dependent on clathrin, caveolin, cholesterol, or dynamin and small endocytic vesicles may form through a process similar to micropinocytosis (Schelhaas et al., 2012; Spoden et al., 2008). Endocytosis is relatively slow and asynchronous averaging approximately 12 hours; however, can be as little as 4 hours (Broniarczyk et al., 2015; Christensen et al.,

1995; Schelhaas et al., 2012; Selinka et al., 2007; Selinka et al., 2002) and is dependent on EGFR, PKC,

PAK-1, and PI3K, although the exact mechanisms are unclear (Fothergill and McMillan, 2006; Schelhaas et al., 2012; Surviladze et al., 2013). Trafficking of the genome from the endosome to the nucleus is mediated by L2 and requires the progression of mitosis (Pyeon et al., 2009).

Genome replication and viral gene expression

Transcription of the highly conserved E1 and E2 proteins from the P97 early promoter occurs in order to initiate replication. The E2 protein binds the viral genome through recognition of the palindromic motif ACCg(N4)cGGT in the LCR and initiates genome replication from the origin (Dell et al., 2003). The E1 protein is an ATP-dependent helicase that is recruited by E2 to begin replication following the assembly of replication machinery derived from the host into a double hexameric ring structure (Conger et al., 1999; Loo and Melendy, 2004; Masterson et al., 1998). Following replication, the E2 protein facilitates genome segregation into daughter cells during division through tethering of the genome to host chromosomes (Ilves et al., 1999; Oliveira et al., 2006; You et al., 2004). As HPVs are completely dependent on host machinery for replication, genome amplification and maintenance only occur during the division of the basal cells. The viral genome is maintained as a stable episome present in

50-100 copies per basal cell (reviewed in (Doorbar, 2006)). This non-productive phase allows for the persistence of the genome for years or decades. In these undifferentiated keratinocytes, genome replication is kept at low levels due to the E8^E2 fusion protein as it suppresses the P97 early promoter and inhibits the ability of E1 and E2 to replicate the viral origin (Doorbar et al., 1990; Lace et al., 2008).

In addition, it has also been demonstrated that E8^E2 limitation of replication and transcription is not restricted to the early HPV lifecycle in undifferentiated cells (Straub et al., 2014).

The productive phase of the viral lifecycle begins as the basal cells divide and differentiate. In addition to its role in replication, the E2 protein acts as a transcription factor for the P97 early promoter, specifically for the E6 and E7 proteins. Through its interaction with histone interacting proteins including

BRD4, EP400, and SMCX, expression of E2 can repress expression of E6 and E7 (Smith et al., 2014;

Smith et al., 2010).

Unlike other non-enveloped viruses, the unique nature of HPV trophism for basal epithelial cells allows for non-lytic mechanisms of viral egress through the shedding of differentiated cells. However, this presents a challenge for viral production as the basal cells exit cycling and begin to terminally differentiate as they move up the layers of the epidermis (Madison, 2003). Therefore, HPVs require alterations of host pathways to establish a replication competent environment necessary for virus production. This is accomplished through the actions of the E6 and E7 proteins primarily through their ability to affect the p53 and retinoblastoma (pRB) tumor suppressor pathways, respectively. High-risk E6 proteins bind to p53 and the E3 ubiquitin ligase E6 associated protein (E6AP or UBE3A), targeting p53 for proteasomal degradation (Scheffner et al., 1993). High-risk E7 proteins inhibit pRB through binding and proteasomal degradation via the cullin 2 ubiquitin ligase complex (Huh et al., 2007; Munger et al.,

1989), relieving repression of E2F transcription factors that regulate replication. The biological activities of E6 and E7 will be discussed in greater detail in section 1.1.5.

Viral genome amplification occurs in the upper levels of the epithelia through the increased transcription of the E1, E2, E4, and E5 proteins by the activation of the P670 late promoter (reviewed in

(Doorbar, 2006)). The E5 protein is thought to contribute to genome amplification through increased

EGF receptor signaling; thereby sustaining an environment suitable for replication (Crusius et al., 2000).

The E5 protein contributes to this increased signaling through its association with the vacuolar proton

ATPase, hindering the acidification of the endosome resulting in increased presentation of EGFR on the cell surface (Disbrow et al., 2005; Hwang et al., 1995; Straight et al., 1995). The role of E4 in genome

7 amplification is not well defined, but is thought to arrest cells in G2 phase allowing for amplification to occur before the start of mitosis (Davy et al., 2002).

Virion Assembly and Egress

Expression of the L1 and L2 proteins from the late promoter (P670) in the terminally differentiated keratinocytes occurs following genome amplification and is triggered by changes in mRNA processing and codon usage (Doorbar and Gallimore, 1987; Florin et al., 2002; Schwartz, 2000; Zhao et al., 2003;

Zhou et al., 1999). The L2 protein associates with nuclear PML bodies as a result of nuclear localization signals contained in the amino and carboxyl termini and requires the DNA binding activity of the E2 protein (Doorbar, 2006). Following L2 localization in PML bodies, pentameric capsomeres of the L1 protein import into the nucleus and associate with the L2-containing PML bodies (Florin et al., 2002). L2 proteins assemble on the L1 capsomere through the association of the carboxyl terminus with the holes formed by the pentameric L1 structure (Finnen et al., 2003). While not required for the formation of viral particles, presence of the L2 protein greatly enhances packaging and infectivity of produced virions

(Roden et al., 2001; Stauffer et al., 1998). As the keratinocytes in the cornified layer of the epidermis begin to die, they create a reducing environment which causes the accumulation of disulfide bonds between L1 proteins in the capsid, completing viral maturation resulting in the formation of a stable and infectious virus (Buck et al., 2005; Finnen et al., 2003). Infectious viruses are released as the cellular integrity wanes in the differentiated cornified layer and cells are sloughed off. The E4 protein may also mediate release due to its disruption of the keratin network and cornified envelope (Doorbar et al., 1991;

Wang et al., 2004).

1.1.4 High-risk HPV associated disease and prevention

Infections by HPVs are the most common sexually transmitted disease. High-risk HPV infections are associated with 60% of oropharyngeal carcinomas as well as 66% of other anogenitial carcinomas including penile, vulvar, vaginal and anal (Viens et al., 2016). Infections by high-risk HPVs, mostly

HPV16 and HPV18, account for nearly all cervical carcinomas, which has moved from the second to the fourth most common cause of cancer in women worldwide (Bray et al., 2013). In 2012, approximately

528,000 new cases were diagnosed worldwide with 266,000 deaths reported that same year (Ferlay et al.,

2013). Developing countries bear the brunt of these deaths as 87% of cervical cancer associated deaths occur in these regions (Ferlay et al., 2013).

As there are no treatments for HPV associated cervical cancers, except for surgical removal, and early detection and removal of the precancerous lesions remain the best therapeutic approaches. Indeed, early screening reduced the incidence of cervical carcinomas by 80% in developing countries (WHO,

2016). Over the past 40 years the Papanicolaou (Pap) smear has been the standard of practice for the early detection of cervical carcinomas and has had dramatic effects on cervical cancer incidence

(Papanicolaou and Traut, 1997). Failure to have regular Pap tests performed has been estimated to account for four out of five women developing cervical cancer in the United States (Jemal et al., 2013).

These tests analyze cells scraped from the cervix for cytological anomalies including enlarged cells with hyperchromatic nuclei and increased expression of the tumor suppressor p16INK4A induced as a consequence of the E7 protein ((Klaes et al., 2001) and reviewed in (Cubie, 2013)). In addition, molecular approaches have been developed including the Cobas® test, a PCR screen for 14 HPV types including the high-risk types 16 and 18 (Roche).

The best preventative measure has been the introduction of prophylactic vaccination. Indeed, comprehensive studies in Australia have demonstrated prevalence of HPV infection, genital warts, and high-grade cervical lesions have begun to decline since vaccination programs have been introduced, in some cases quite significantly (Ali et al., 2013; Brotherton et al., 2011; Tabrizi et al., 2012). Three vaccines, consisting of self-assembled L1 capsid containing virus-like particles (VLPs), have been developed that offer protection against a broad range of low and high-risk HPV types depending on the vaccine. The Gardasil® vaccine developed by Merck, is a quadravalent vaccine that protects against the most prevalent high-risk (16 and 18) and low-risk (6 and 11) HPV types. Merck released a second- generation vaccine covering an additional five high-risk types (31, 33, 45, 52, and 58) in 2014 called

Gardasil 9®. Cervarix®, a bivalent vaccine against HPV16 and HPV18, has also been introduced by

GlaxoSmithKline. The CDC recommends young boys and girls receive their first dose between ages 11 and 12 and a second dose between 6 and 12 months later. It is important to note that these vaccines protect against new infections and do not offer therapeutic value to current infections; therefore, the full appreciation of HPV vaccination on prevalence and associated disease is decades away.

1.1.5 Oncogenic activities of E6 and E7 oncoproteins

While the vast majority of infections with HPVs are cleared by the immune system, some individuals fail to resolve these infections and maintain persistent infection for years to decades. These persistent infections precede the development of high-grade cervical neoplasias partly through the integration of HPV genomes near fragile sites in the host genome, resulting in non-productive infections as only the E6 and E7 proteins are consistently expressed (Smith et al., 1992). Integration of the viral genome in these lesions typically disrupts the proper expression of the E2 protein which is a transcriptional repressor of expression of E6 and E7, leading to the dysregulation of E6 and E7 expression

(Bernard et al., 1989). Increase in progression of cervical intraepithelial neoplasias (CIN) from CIN1 to

CIN3 is thought to be associated with increased expression of E6 and E7 (Munger et al., 2006). Both E6 and E7 are potent drivers of cell proliferation, and the transforming abilities of E6 and E7 will be discussed in greater detail below. Briefly, inactivation of pRB by high-risk E7 drives cell cycle progression and as a consequence, induces increases in p53 to limit growth and trigger apoptosis (Figure

1.2A) (Demers et al., 1994). The high-risk E6 protein targets p53 for degradation, subverting this response (Scheffner et al., 1993). In addition, E6 increases human telomerase reverse transcriptase

(hTERT) to maintain chromosome end integrity as a result of increased proliferation (reviewed in (Howie et al., 2009)). It is thought that this continuous cell cycle entry as well as the activation of DNA repair mechanisms over decades results in the accumulation of additional mutations and increased genomic instability that eventually lead to the development of cancer (Moody and Laimins, 2010).

Figure 1.2. Transformation by HPV16 E6 and E7 oncoproteins. (A) Degradation of pRB by the high-risk HPV16 E7 oncoprotein, relieves E2F repression sending cells into S phase. Inactivation of pRB by E7 triggers a p53-mediated response that is subverted through the degradation of p53 through the actions of the high-risk HPV16 E6 protein. As integration of these two proteins into the host genome typically includes loss of the E6/E7 attenuation function of the viral E2 protein, the unchecked actions of E6 and E7 drive extended proliferation in cells. Immortalization is achieved through the activation of hTERT by E6. Several years of continuous aberrant proliferation results in genomic instability and the acquisition of secondary mutations that can eventually lead to cancer. (B) The pRB protein controls the G1 to S transition through the repression of E2F transcription factors required for transcription of S phase genes. During cell cycle progression, cyclin dependent kinases (CDK) 4/6 phosphorylate pRB causing its release from E2F factors, resulting in S phase entry. (C) The HPV16 E7 protein drives cell cycle progression through the degradation of pRB through the cullin 2 ubiquitin ligase complex.

High-risk HPV E6 oncoprotein

HPV E6 proteins are small 150 amino acid proteins approximately 18 kDa in size and contain two

CXXC-X29-CXXC zinc-binding motifs that are necessary for the overall stability of the structure

(reviewed in (Vande Pol and Klingelhutz, 2013)). Splice variants of high-risk E6 proteins, denoted as

E6* or E6**, are about a third of the size of full-length E6 and lack the two CXXC-X29-CXXC motifs and are thought by some to bind full-length E6 and antagonize its function (Pim and Banks, 1999).

E6 proteins do not have any enzymatic or DNA binding activities and function through the association and modulation of host proteins and pathways. A consequence of the activities of high-risk

E7 proteins is the activation of the p53 tumor suppressor pathway, which induces G1 arrest and apoptosis through the binding of p53 to target genes (Demers et al., 1994). Circumventing this problem, high-risk

E6 proteins bind the E3 ubiquitin ligase, E6 Associated Protein (E6AP or UBE3A) through a LXXLL motif, recruiting it to target p53 for ubiquitin-mediated proteasomal degradation (Scheffner et al., 1993).

This ability to target p53 for degradation is specific to high-risk HPVs and low-risk HPVs do not demonstrate this function (Vande Pol and Klingelhutz, 2013). Direct binding of E6 to p53 disrupts the ability of p53 to bind DNA, thereby inhibiting p53-mediated transcription (Lechner and Laimins, 1994).

In addition, high-risk E6 proteins may modulate p53 activity by preventing acetylation-facilitated stabilization through their association with histone acetyltransferases p300, CREB-binding protein (CBP), and ADA3 (Kumar et al., 2002; Patel et al., 1999; Zimmermann et al., 1999).

The transforming ability of E6 can also be attributed to the increase in telomerase activity which is necessary for immortalization. The high-risk E6 proteins activate transcription of hTERT through interactions with c-Myc and NFX123, in addition to E6AP modulation of transcriptional activators

(Myc/Max, SP1, and histone acetyltransferases) and repressors (USF1/2 and NFX1-91) of hTERT transcription (reviewed in (Howie et al., 2009)). In addition, high-risk E6 proteins can also directly bind hTERT; however, the impacts on activation are not clear (Liu et al., 2009). The ability to transcriptionally activate hTERT is not shared with low-risk or cutaneous E6 proteins (Vande Pol and

Klingelhutz, 2013).

A B

In addition to its modulation of p53 and hTERT, high-risk E6 proteins interact with PDZ domain containing proteins, such as hDlg and hSrib (homologues of the Drosophila Dlg and Scribbl proteins), which regulate cellular growth and cell to cell contacts (Zeitler et al., 2004). High-risk E6 proteins bind to PDZ proteins through the (S/T)-X-V-I-L motif on the carboxyl terminus of E6 (Vande Pol and

Klingelhutz, 2013). Binding of PDZ proteins by high-risk E6 contributes to transformation and is a feature not found in low-risk E6 or beta E6 proteins that lack the PDZ binding domain (Kiyono et al.,

1997; Vande Pol and Klingelhutz, 2013). The high-risk E6 proteins target a subset of PDZ containing proteins for degradation, typically through an E6AP and proteasome dependent manner (Vande Pol and

Klingelhutz, 2013).

High-risk HPV E7 oncoprotein

HPV E7 proteins are also small proteins about 15 kDa and approximately 100 amino acids in length. The E7 proteins contain two conserved regions (CR1 and CR2) near the amino terminus, which share similarities to adenovirus type 5 E1A and Simian Vacuolating Virus 40 large T antigen (Roman and

Munger, 2013). Contained in CR2 is the LXCXE motif, which is highly conserved among HPV E7 proteins. Like E6 proteins, E7 proteins contain the zinc binding CXXC-X29-30-CXXC motif near the carboxyl terminus. The transforming capabilities of high-risk E7 are primarily attributed to their ability to bind pRB and related p107 and p130 through the LXCXE motif and mediate their degradation through recruitment to a cullin 2 ubiquitin ligase complex in the case of HPV16 (Figure 1.2C) (Boyer et al., 1996;

Huh et al., 2007; Munger et al., 1989). Low-risk E7 proteins bind pRB proteins with low affinity, but do not target them for degradation (Roman and Munger, 2013). The pRB family of proteins regulate the G1 to S transition through modulation of E2F transcription factors (Dyson, 1998). The E2F family of transcription factors can act as transcriptional activators or repressors and are important for a variety of cellular processes including cell cycle, apoptosis, mitosis, and differentiation (DeGregori and Johnson,

2006). The pRB protein acts as a transcriptional repressor of E2F target genes through direct binding or recruitment of chromatin modifiers. During the transition to S phase, pRB is phosphorylated by cyclin

13 dependent kinases (CDKs) promoting its dissociation from activator E2F complexes, which leads to transcription of S phase genes (Figure 1.2B) (Stevaux and Dyson, 2002). The binding and degradation of pRB by high-risk E7 drives transcription of S phase genes by relieving pRB-mediated E2F repression

(Figure 1.2C). In addition, high-risk HPV16 E7 proteins can associate with HDACs and modulate their activities to promote transcription of S phase genes (Brehm et al., 1998; Brehm et al., 1999).

Furthermore, HPV16 E7 can directly interact with E2F members to promote gene transcription, specifically through the binding and sequestering of repressive E2F6 containing polycomb repressive complexes from promoters (McLaughlin-Drubin et al., 2008) and the binding of E2F1 and subsequent activation of E2F1 transcription (Hwang et al., 2002). Moreover, it has been demonstrated that pRB- independent transforming activities of high-risk E7 proteins exist. Interaction between E7 and the ubiquitin ligase p600 (UBR4) contributes to anchorage-independent growth (Huh et al., 2005).

Furthermore, high-risk, but not low-risk or beta, E7 proteins bind and target the non-receptor protein tyrosine phosphatase PTPN14 for degradation through UBR4 contributing to pRB-independent transformation (White et al., 2016).

1.2 ONCOGENE-INDUCED SENESCENCE AND THE p16INK4A TUMOR SUPPRESSOR

Oncogenic and cellular stress stimuli can induce cellular senescence, a particular form of growth arrest characterized by its permanence, increases in senescence-associated β-galactosidase activity, formation of senescence-associated heterochromatic foci, and enlarged and flattened morphology

(reviewed in (Campisi, 2005)). While growth arrest occurs rapidly, the induction of senescence requires prolonged signaling, on the order of several days (Dai and Enders, 2000). Originally identified as a consequence of oncogenic RAS expression, oncogene-induced senescence (OIS) is a cell intrinsic mechanism defending against uncontrolled proliferation as a result of oncogene overexpression and/or activation (Campisi and d'Adda di Fagagna, 2007; Serrano et al., 1997; Tuveson et al., 2004). The precise mechanisms by which oncogenic stimuli are sensed are not completely clear. It has been suggested that cells require two concomitant signals: signals that promote growth, such as ERK activation, and signals resulting from cellular stress, such as radical oxygen species (ROS) generation or telomere malfunctions

(Satyanarayana and Rudolph, 2004). Despite the varied stimuli, the signaling pathways converge on the activation of the p53 and pRB pathways (reviewed in (Bringold and Serrano, 2000)). Overexpression of oncogenic RAS induces the p53 arm of the senescence pathway potentially though the generation of high levels of ROS (Ferbeyre et al., 2000; Lee et al., 1999; Pearson et al., 2000; Serrano et al., 1997). In addition, irreparable DNA damage, including breaks and dysfunctional telomeres, are also activators that can be induced by overexpression of oncogenes (d'Adda di Fagagna et al., 2004; Itahana et al., 2001).

Activation of the p53 pathway leads to the transcription of p53 responsive genes that result in growth arrest and eventual cellular senescence. The exact mechanisms of how overexpression of oncogenes activate the pRB pathway during OIS are unclear; however, activation of the pathway results in the formation of pRB containing repressive complexes that repress E2F targets genes, which are responsible for cell cycle progression (reviewed in (Dimova and Dyson, 2005)). The primary focus of this dissertation is on the pRB branch of the OIS pathway and will be discussed in detail below.

1.2.1 Tumor suppressor p16INK4A

Activation of the pRB mediated OIS response is facilitated by the expression of the tumor suppressor p16INK4A (Serrano et al., 1997). The CDKN2 locus on chromosome 9p21 consists of three important tumor suppressors: p16INK4A, p14ARF, and p15INK4B. Both p15INK4B and p16INK4A bind to

CDK4/6 inducing allosteric changes preventing their association with D-type cyclins (Kim and Sharpless,

2006). The p16INK4A and p14ARF proteins share the first exon and alternative splicing of p14ARF generates a distinctive protein that functions as an activator of the p53 pathway through binding and degradation of the p53 negative regulator, MDM2 (Kim and Sharpless, 2006). Upregulation of p16INK4A in response to oncogenic stimulus, such as the overexpression of oncogenic RAS, results in the activation of the pRB

OIS response through the inhibition of CDK 4/6 phosphorylation of pRB, promoting the dissociation from E2F, thereby relieving pRB-mediated E2F repression (Figure 1.3) (Lukas et al., 1995; Serrano et al.,

1993; Serrano et al., 1997).

As the p16INK4A/pRB pathway represents a major barrier to malignant progression, it is frequently mutated, deleted, or epigenetically silenced in tumors (reviewed in (Enders, 2003; Romagosa et al.,

2011)). However, a subset of carcinomas express high levels of p16INK4A including non-small cell lung, high-grade serous ovarian, Merkel cell, breast, and prostate, which will be discussed further in section 1.4

(Andujar et al., 2010; Bohn et al., 2010; Chiesa-Vottero et al., 2007; Jarrard et al., 2002; Kommoss et al.,

2007; Lassacher et al., 2008; Milde-Langosch et al., 2001). Transformation resulting from viral infections can also perturb the p16INK4A/pRB pathway. The LMP1 protein of Epstein-Barr virus (EBV) prevents transcription of p16INK4A through the export of the transcription factor, ETS2 (Ohtani et al.,

2003), while the EBNA3A and EBNA3C proteins epigenetically silence p16INK4A expression (Skalska et al., 2010). In addition, the kCYC protein, a D-type cyclin, of Kaposi sarcoma associated herpesvirus

(KSHV) complexes with CDK6 and is resistant to p16INK4A inhibition (Swanton et al., 1997). However, direct antagonism of p16INK4A is not always necessary for viral-mediated transformation. High-risk HPV associated carcinomas express high levels of p16INK4A, which is inconsequential as the E7 oncoprotein degrades the downstream effector pRB (Figure 1.3).

Figure 1.3. Oncogene-induced senescence and the pRB pathway. Under normal growing conditions, pRB is phosphorylated in G1/S by cyclin D bound CDK4/6, causing the release of E2F transcription factors that activate S phase genes. Following oncogenic stress, such as oncogenic RAS activation or expression of HPV16 E7, p16INK4A is induced and binds and inhibits CDK4/6 activity. Typically, this leads to growth arrest and senescence; however, as E7 degrades the downstream effector, pRB, this response is subverted, driving aberrant proliferation in these cells.

1.2.2 The role of HPV16 E7 in the induction of p16INK4A

Infections by high-risk HPVs lead to the development of pre-cancerous cervical intraepithelial neoplasias (CIN), graded from 1 to 3 based on severity. These lesions can further develop into carcinomas after several years partly due to the integration of portions of the HPV genome resulting in aberrant oncogene expression (Smith et al., 1992). CINs and cervical carcinomas display strong immunostaining for p16INK4A in the proliferating basal cells (Klaes et al., 2001; Sano et al., 1998; von

Knebel Doeberitz, 2002). The correlation between p16INK4A overexpression and high-risk HPV infection has been well documented (Bose et al., 2005; Klaes et al., 2001; Sano et al., 1998). However, p16INK4A expression is not completely indicative of HPV infection as some high-risk HPV infected cells display hallmarks of HPV replication, but do not stain for p16INK4A (von Knebel Doeberitz, 2002). In addition, lesions resulting from infection with low-risk HPVs, like types 6 and 11, display weak p16INK4A staining

(Munger et al., 2001; Sano et al., 1998; von Knebel Doeberitz, 2002). Degree of p16INK4A expression correlates with disease progression as high-grade lesions have higher p16INK4A than low-grade lesions

(Murphy et al., 2005; Wang et al., 2005). Since the early 2000s, p16INK4A staining has been used as a biomarker to identify malignant lesions (Sano et al., 1998; von Knebel Doeberitz, 2002). Investigations into the mechanism of aberrant E6 and E7 expression and the induction of p16INK4A in high-risk HPV infections, revealed that the expression of p16INK4A is a consequence of the expression of the E7 oncoprotein (Klaes et al., 2001; Sano et al., 1998). Overexpression of p16INK4A observed in viral associated carcinomas is typically a result of inactivation of pRB (Guenova et al., 1999); however, the ability of E7 to induce p16INK4A expression is not dependent on the E7-mediated degradation of pRB

(McLaughlin-Drubin et al., 2011). The mechanism by which E7 induces p16INK4A is not fully understood, but involves epigenetic regulation discussed in section 1.3.3 and is a major component of this dissertation.

However, the precursor actions that induce these epigenetic alterations by E7 are unknown. As OIS can be triggered by DNA damage, ROS generation (Campisi, 2005; Rayess et al., 2012), and alterations in expression of epigenetic modulators (Bandyopadhyay and Medrano, 2003; Narita and Lowe, 2004;

Neumeister et al., 2002), it is plausible that E7 expression can induce OIS/p16INK4A through these mechanisms.

Interestingly, although OIS is induced, but subverted through the degradation of pRB, E7 expressing cells require expression of p16INK4A for survival (McLaughlin-Drubin et al., 2013).

McLaughlin-Drubin et al. demonstrated that depletion of p16INK4A in cervical carcinoma cells resulted in cell death and this was a direct consequence of expression of E7 as viability of E6 expressing cells were not affected following p16INK4A depletion. They further showed that cell death following p16INK4A depletion in E7 expressing cells was dependent on the activities of CDK4/6 and viability could be reinstated with the impairment of CDK4/6 activity through siRNA depletion or expression of kinase-dead mutants. They propose a model where CDK4/6 activity must be suppressed in cells that have lost pRB function in order to remain viable, identifying a synthetic lethal interaction in these cells. The identification of synthetic lethal interactions has developed as a way to provide targeted therapies for cancer and will be discussed in the following section.

1.2.3 Synthetic lethality in cancers

The requirement of p16INK4A expression in HPV16 E7 expressing cells, but not control cells, illustrates the concept of synthetic lethality. Synthetic lethal interactions describe the relationship between two gene products where loss of either gene does not overtly affect survival of cells, but loss of both is incompatible with viability. In the early 2000s, the exploitation of synthetic lethal interactions with mutations found in cancers was evaluated as a targeted method for cancer treatment (Kaelin, 2005;

Moody et al., 2010). Initial success in this field arose with the development of poly(ADP-ribose) polymerase (PARP) inhibitors for the treatment of breast cancers harboring mutations in the BRCA gene.

These cancers acquire mutations as a result of the inability to perform higher fidelity homologous DNA repair, forcing the use of more error-prone DNA repair mechanisms (Lord et al., 2015). PARP proteins sense single-stranded DNA breaks and inhibition results in the accumulation of these breaks leading to replication fork collapse during cell division, creating double-stranded breaks that cannot be repaired by

BRCA deficient cells (Lord et al., 2015). The initial efficacy of these treatments in breast cancer cells have been quite remarkable with up to a 1000 times greater sensitivity of BRCA mutant cells compared to wild-type cells (Bryant et al., 2005; Farmer et al., 2005). Indeed, early phase clinical trials show promise for the treatment of breast and ovarian cancers, with several ongoing phase III clinical trials as of April

2018 (reviewed in (Lord et al., 2015)).

Synthetic lethal relationships have been indentified in epigenetic regulators primarily in components of the SWItch/Sucrose Non-Fermentable (SWI/SNF) complex (reviewed in (Morel et al.,

2017)). Mutations in SMARCB1, SMARCA4, ARID1A, and PBRM1 are sensitive to PRC2 inhibition typically through the targeting of EZH2 (reviewed in (Morel et al., 2017)). Phase I clinical trials of the

EZH2 inhibitor, tazemetostat, illustrated partial responses and effects on disease stability in patients with

SMARCA4 or SMARCB1 deficient tumors (Italiano et al., 2015). Epigenetic synthetic lethal interactions are becoming appreciated and several clinical trials are ongoing that explore these relationships (reviewed in (Morel et al., 2017)). Synthetic lethal interactions with epigenetic factors in HPV16 E6/E7 expressing cells will be explored in Chapter 3 of this dissertation.

1.3 EPIGENETIC REGULATION OF p16INK4A

1.3.1 Polycomb and trithorax group proteins control a variety of cellular programs

Transcriptional silencing of p16INK4A in normal cells is accomplished through epigenetic alterations of the promoter by polycomb repressive complexes (PRCs) 1 and 2. Polycomb group proteins

(PcGs) and the contrasting trithorax group proteins (TrxG) are evolutionary conserved groups that control expression of genes involved in differentiation, stemness, and developmental processes through the chemical modulation of histones. PcGs were originally identified in Drosophila as mutations in these proteins resulted in defects in body patterning during the early stages of embryogenesis due to the erroneous expression of homeobox (HOX) genes (Lewis, 1978; Lewis, 1947). Soon after, TrxGs genes were identified that phenotypically antagonized PcGs as activators of HOX genes (Ingham, 1983, 1985;

Kennison and Tamkun, 1988; Struhl and Akam, 1985). Both PcGs and TrxGs are necessary for the maintenance of HOX gene expression during differentiation and development; however, several studies have shown connection of these proteins to a variety of other cellular processes including cell cycle control and carcinogenesis (reviewed in (Schwartz and Pirrotta, 2007)). Cellular memory, specifically maintenance of repressed or activated transcriptional states during cell division, require the expression of

PcG and TrxG proteins (Hansen et al., 2008; Petruk et al., 2012).

PcG proteins are categorized into two complexes, PRC1 and PRC2. In mammals, components of

PRCs are diverse and generate a variety of PRCs that are species, cell, and gene specific. Canonical

PRC1 complexes contain the E3 ubiquitin ligase RING1 (RING1A or RING1B) that mediates monoubiquitination of lysine 119 (K119) on histone H2A (H2AK119). In addition, a chromobox protein

(CBX2, 4, 6-8) responsible for binding of trimethyl marks on lysine 27 of histone 3 (H3K27), and scaffolding proteins Polyhomeotic (PHC1-3) and Polycomb group ring-finger domain protein (PCGF1-6) complete the PRC1 complex (reviewed in (Schuettengruber et al., 2017)). The core components of the

PRC2 complex consist of H3K27 methyltransferase enhancer of zeste (EZH1 or 2), embryonic ectoderm development (EED), suppressor of zeste (SUZ12), and RBBP4 or RBBP7 (CAF1 histone

21 binding proteins). Gene target diversity is achieved through the association of the core complex with a variety of accessory proteins (Ciferri et al., 2012; Li et al., 2010a; Pasini et al., 2010; Shen et al., 2009).

Furthermore, identification of non-canonical PRC1 complexes as well as additional PcG complexes has added to the diversity and complexity of gene regulation by these complexes (Schuettengruber et al.,

2017).

The TrxG complexes are diverse and counteract the repressive functions of PcG complexes.

TrxG can be divided into two general categories: chromatin remodeler SWI/SNF complexes and complexes that govern histone acetylation and methylation. SWI/SNF complexes regulate chromatin structure in response to several cellular stimuli and form the BAF and PBAF complexes containing a variety of evolutionary conserved subunits (Schuettengruber et al., 2017). The histone modifying complexes comprise the COMPASS family of complexes which include the core components WDR5,

ASH2L, RBBP5, and DPy30 along with either SET1, MLL1/2, or MLL3/4, which coordinate H3K4 trimethylation (Schuettengruber et al., 2017). In addition, the ASH1L containing complex mediates

H3K36 trimethylation and H3K27 acetylation (Schuettengruber et al., 2017). Intriguingly, studies in embryonic stem cells revealed that the transcription start sites of a subset of genes, specifically those governing developmental processes like HOX developmental transcription factor gene expression, contained both repressive H3K27 trimethylation and activating H3K4 trimethylation, deposited by PcGs and TrxGs, respectively (Bernstein et al., 2006). While these bivalent promoters are commonly seen in embryonic stem cells, they have been described in other cell types where they are thought to facilitate rapid changes in gene expression in response to developmental or environmental stimuli (reviewed in

(Voigt et al., 2013)).

PcGs and TrxGs dysregulation and cancer

As they control several key cellular processes, it is unsurprising that PcGs and TrxGs are found to be mutated or dysregulated in cancers. Overexpression of PRC2 component and H3K27 methyltransferase EZH2 is one of the most common events in solid tumors (reviewed in (Simon and

Lange, 2008)). Increased expression of EZH2 has been observed in bladder, prostate, breast, colorectal and oral squamous carcinomas in some cases contributing to their aggressiveness (Bachmann et al., 2006;

Collett et al., 2006; Kidani et al., 2009; Mimori et al., 2005; Weikert et al., 2005). The overexpression of

SUZ12 has been linked to hematological and other malignancies (Simon and Lange, 2008). Furthermore, overexpression of BMI1 of PRC1 have been described in squamous cell, neuroblastomas, non-small cell lung cancers, and bladder carcinomas (He et al., 2009; Nowak et al., 2006; Shafaroudi et al., 2008;

Vonlanthen et al., 2001). In addition, BMI1 has been attributed to the development of B cell lymphomas

(van Lohuizen et al., 1991). Mutations in PHD proteins have been associated with promotion of myeloid leukemia, esophageal squamous cell carcinoma, head and neck squamous cell carcinoma, and melanoma

(reviewed in (Chi et al., 2010)). The rearrangement of TrxG protein MLL1 drives the development of several leukemias (Krivtsov and Armstrong, 2007). In addition, alterations in histone demethylases that antagonize PcGs have been reported in solid tumors although it is unclear how their dysregulation drives carcinogenesis (Chi et al., 2010). As PcGs have roles in stem-cell renewal, recent studies have attributed formation of cancer stem cells to PcGs (reviewed in (Richly et al., 2011)).

Significant crosstalk between PcG containing complexes further complicates the role of dysregulation of PcG proteins in carcinogenesis as a single PcG protein can affect a multitude of target genes. Ubiquitination of H2BK34 and H2BK120 promotes the binding of the ASH2L subunit of the

MLL1 complex activating its H3K4 methyltransferase activity (Wu et al., 2013). Conversely, H2AK119 ubiquitination has been shown to inhibit MLL1 methyltransferase activity (Endoh et al., 2012; Nakagawa et al., 2008) and H3K36 methyltransferase activity (Yuan et al., 2013). Recruitment of the SAGA acetyltransferase complex to H3K9 is mediated through the binding of the SGF29 component to H3K4 trimethyl marks (Bian et al., 2011). In addition, PRC1 is recruited to PRC2 repressed genes through binding of H3K27 trimethyl marks by the CBX proteins (Dietrich et al., 2007; Yap et al., 2010).

1.3.2 Epigenetic regulation of p16INK4A

The PRC2 complex that has been shown to target p16INK4A consists of the nucleosome-associating proteins, SUZ12, EED, and RBBP7, and the methyltransferase EZH2 (Figure 1.4A) (Margueron et al.,

2009; Yuan et al., 2012). PRC2 targets H3K27 in the p16INK4A promoter for repressive trimethylation via

EZH2. Trimethylation of H3K27 is recognized by the CBX7 (Yap et al., 2010) or CBX8 (Dietrich et al.,

2007) component of PRC1, which further represses p16INK4A through the monoubiquitination of

H2AK119 by the E3 ligase RING1B, which is activated by the PRC1 component BMI1 (Bracken et al.,

2007; Kotake et al., 2007). These complexes are recruited by the long non-coding RNA ANRIL which is transcribed from the CDKN2 locus between p15INK4B and p14ARF (Kotake et al., 2011; Yap et al., 2010).

Further epigenetic silencing has been shown to occur through the trimethylation of H3K9 by the methyltransferase SUV39H2 with H3K27 trimethyl binding by CBX7 of PRC1 playing a role (Li et al.,

2010b). Sequestration of the transcription factor ETS2 through the binding of ID1 may further repress p16INK4A(Ohtani et al., 2001). The transcription factor YB1 has also been shown to repress p16INK4A expression as YB1 silencing results in increased p16INK4A transcription (Kotake et al., 2013).

Following an oncogenic stimulus, such as aberrant expression of RAS, the transcriptional repression by PRC is removed (Figure 1.4B). While the particular order of events for derepression and activation have not been determined, the H3K27 demethylase KDM6B is recruited to the p16INK4A promoter and removes the repressive H3K27 trimethyl mark (Agger et al., 2009; Barradas et al., 2009).

The removal of H3K27 trimethylation weakens the affinity of PRC1 (Bracken et al., 2007) for the p16INK4A promoter and it is displaced by the H2AK119 monoubiquityl reader, ZRF1 (Ribeiro et al., 2013).

The H2AK119 monoubiquityl mark is removed, but it is unclear if there is a specific deubiquitinase for this mark on the p16INK4A promoter; however, USP21 and BAP1 have been shown to be important for regulation of other polycomb repressed genes (LaFave et al., 2015; Nakagawa et al., 2008; Ribeiro et al.,

2013; Sahtoe et al., 2016; Scheuermann et al., 2010). Additionally, the repressive H3K9 trimethylation must be removed; however, the mechanism has not been investigated for p16INK4A. Expression of ANRIL is reduced in oncogenic RAS expressing cells, suggesting that its reduction may play a role in activation

Figure 1.4. Epigenetic regulation of p16INK4A. (A) Silencing of p16INK4A begins with the recruitment of PRC2 to the p16INK4A promoter by the long non-coding RNA (lncRNA) ANRIL (1). PRC2 mediates repressive trimethylation of H3K27 (yellow). ANRIL also recruits PRC1 and the H3K27 trimethyl mark is recognized by PRC1 (2) which monoubiquitinates H2AK119 (green). Further silencing by the addition of H3K9 trimethylation (purple) by SUV39H2 is facilitated by PRC1 (3). In addition, sequestration of the transcription factors ETS2/1 through the binding of ID1, prevents association with the p16INK4A promoter (4). (B) Following oncogenic RAS expression, H3K27 trimethylation is removed by KDM6B (1). This weakens PRC1 affinity for the p16INK4A promoter and it is displaced by H2AK119 monoubiquitin reader, ZRF1 (2). Deubiquitinases, USP21 and/or BAP1 may remove the H2AK119 monoubiquityl mark (3). Trimethylation of H3K9 is also removed although the demethylase that mediates this action in unknown (4). Finally, activating H3K4 trimethylation (blue) is added by the MLL1 complex (5) and transcription factors ETS2/1 are recruited (6). Following expression of HPV16 E7, EZH2 recruitment is increased at the p16INK4A promoter; however, H3K27 trimethylation is reduced by KDM6B (1). It is unknown if H2AK119 monoubiquitination or H3K9 trimethylation is removed from the promoter (2) during expression of HPV16 E7 as symbolized by the ?. It is also unclear what factors are involved in this process. Activating H3K4 trimethylation is added by the MLL1 complex (3); however, it is not known whether expression of HPV16 E7 alters recruitment of ETS2/1 to the promoter (4).

Figure 1.4. (Continued).

26 of p16INK4A by decreasing recruitment of PRC1 and 2 complexes (Kotake et al., 2016). Activating H3K4 trimethylation is added by the MLL1 complex, consisting of structural proteins RBBP5, ASH2L, andWRD5, which are required for the processivity and proper positioning of histone tails for trimethylation by MLL1 (Dou et al., 2006; Kotake et al., 2009; Wysocka et al., 2005). The CUL4-DDB1

E3 ubiquitin ligase complex has been shown to bind to RBBP5, WDR5 and the p16INK4A promoter to activate p16INK4A transcription following oncogenic RAS expression; however, the mechanism remains to be elucidated (Kotake et al., 2009). Finally, it has been reported that the transcription factors ETS2 and

ETS1 are important for p16INK4A activation as the levels of the ETS2 inhibitor, ID1, are reduced and ETS1 increased (Ohtani et al., 2001).

1.3.3 HPV16 E7 and PcGs

High-risk HPV16 E7 has been shown to associate with a variety of PcGs. HPV16 E7 has been reported to interact with E2F6 containing PRCs, causing the reduction of these complexes in cells

(McLaughlin-Drubin et al., 2008). E2F6 is a non-canonical member of the E2F family of transcription factors as its transcriptional activity is not regulated by pRB and acts as a transcriptional repressor of target genes during S-phase. Although low-risk HPV E7 proteins as well as Simian Vacuolating Virus 40 large T antigen and adenovirus type 5 E1A proteins have been shown to target E2F6, it is unclear whether they also interact with E2F6 containing PRCs (McLaughlin-Drubin and Munger, 2013). In addition, proteomic studies of HPV16 E7 revealed associations with other PcGs including CBX4, MEL-18, BMI1,

RING1, MGA, L3MBTL2 (McLaughlin-Drubin et al., 2008). Furthermore, increases in expression and recruitment of EZH2, but not SUZ12 or EED have been reported as a consequence of E7 expression

(Hyland et al., 2011; McLaughlin-Drubin et al., 2011). Moreover, expression of BMI1 is reduced in

HPV16 E6/E7 expressing cells (Hyland et al., 2011). Finally, HPV16 E7 expression upregulates transcription of H3K27 demethylases KDM6A and KDM6B resulting in dramatic and global decreases in

H3K27 trimethylation (McLaughlin-Drubin et al., 2011). Interestingly, HPV16 E7 expressing cells require expression of KDM6A/B for survival as depletion or small molecule inhibition results in

27 reduction of viability (McLaughlin-Drubin et al., 2013). Decreased survival for KDM6B inhibited cells is p16INK4A dependent (McLaughlin-Drubin et al., 2013), whereas p21CIP1 likely mediates effects on viability in KDM6A depleted cells (Soto et al., 2017). Table 1.1 outlines the current knowledge of p16INK4A epigenetic regulation and differences between activation through oncogenic RAS and HPV16 E7 expression.

Table 1.1. Review of epigenetic regulation of p16INK4A between oncogenic RAS and HPV16 E7 activation. Modulation of the core epigenetic marks associated with p16INK4A expression are shown with the cell type used in the study indicated in parentheses. Expression and recruitment of the associated complexes and proteins are also shown. Question marks (?) denote areas to be explored.

1.4 OVEREXPRESSION OF p16INK4A IN NON-HPV ASSOCIATED CARCINOMAS

1.4.1 High-grade serous ovarian carcinomas

High-grade serous ovarian carcinomas are the most common and malignant form of ovarian cancer that respond well to initial chemotherapy treatments; however, these carcinomas have high relapse rates and poor prognosis. Globally, the five year survival rate is 30% with an average of length of survival of 29-44 months (reviewed in (Hoppenot et al., 2018)). High expression of p16INK4A in these tumors (Chiesa-Vottero et al., 2007; Kommoss et al., 2007) inversely correlates with pRB expression, which is frequently observed in many carcinomas as pRB negatively regulates p16INK4A expression

(Kommoss et al., 2007; Li et al., 1994). In addition, high or low p16INK4A expression has been linked to poor survival in patients with advanced stage ovarian cancer post treatment with chemotherapy and surgical resection (Kommoss et al., 2007).

1.4.2 Non-small cell lung carcinomas

Lung cancer continues to be the leading cause of cancer-related death worldwide and development is largely dependent on prolonged exposure to tobacco smoke (Hecht, 1999; Herbst et al.,

2008). While promoter hypermethylation and deletion of p16INK4A is common in non-small cell carcinomas (66.7% in one study of 75 patients), a small subset display high p16INK4A expression (Andujar et al., 2010). Analysis of non-small cell carcinomas through the cBioPortal for Cancer Genomics, revealed that KDM6A/B mutations are rare; however, in a subset of p16INK4A highly expressing samples, pRB was found to be deleted (Cerami et al., 2012; Gao et al., 2013).

1.4.3 Basal-like breast carcinomas

Breast cancer is the second most common cause of cancer related mortality in women in the

United States and approximately 12.4% will be diagnosed with breast cancer in their lifetime (Howlader et al., 2017). The p16INK4A protein is highly expressed in some subsets of breast cancers and is linked

30 with their development as a result of increased mammary cell proliferation (Pare et al., 2016). In addition, patients with p16INK4A overexpressing tumors have been shown to have shorter metastatic-free survival rates; however, these patients responded more favorably to neoadjuvant chemotherapy treatments

(Meseure et al., 2016). Highly aggressive basal-like breast carcinomas, characterized by the triple- negative phenotype (estrogen receptor, progesterone receptor, and human epidermal growth factor receptor (HER)-2 negative), express high levels of p16INK4A associated with poor prognosis and have reduced relapse-free survivals (Bohn et al., 2010; Fan et al., 2006; Sorlie et al., 2001; Sorlie et al., 2003).

1.4.4 Merkel cell carcinomas

Merkel cell carcinoma (MCC) is a rare, but highly aggressive form of skin cancer usually found on sun-exposed areas of skin on the head and neck (Kaae et al., 2010) in the elderly and immunocompromised, such as individuals infected with HIV (Agelli and Clegg, 2003; Engels et al.,

2002). Advanced stages of MCC are linked with poor prognosis with five year survival rates as low as

25% (Agelli and Clegg, 2003). Close to 80% of MCCs contain clonal integrations of Merkel cell polyomavirus (MCPyV) (Feng et al., 2008). The large T antigen of MCPyV binds and inactivates pRB and like HPV associated carcinomas, analysis of MCC tumor samples revealed that over 95% of the MCC tumors were associated with expression of p16INK4A (Lassacher et al., 2008).

SUMMARY AND SIGNIFICANCE

High-risk HPVs are the etiologic agents of cervical carcinomas and are associated with anogenital tract and oropharyngeal carcinomas. Given that E6 and E7 are the only two oncoproteins consistently expressed in these tumors, investigation into the oncogenic activities of these two proteins provide a well defined system to study cancer initiation and progression. The E6 and E7 oncoproteins of high-risk HPVs are frequently integrated into the host genome and expression is sufficient to immortalize cells and necessary for the maintenance of the transformed state as depletion of E6 or E7 expression results in senescence and eventual cell death. Expression of high-risk HPV16 E7 triggers activation of the OIS pathway leading to induction of p16INK4A through the removal of repressive H3K27 trimethylation; however, removal of a single repressive mark is likely not sufficient for activation. The additional epigenetic alterations required for p16INK4A activation as a consequence of HPV16 E7 expression have not been investigated. We demonstrate that removal of repressive H2AK119 monoubiquitination and deposition of activating H3K27 acetylation and H3K4 trimethylation lead to p16INK4A expression as a consequence of HPV16 E7 expression. We further show that HPV16 E7 expression increases the recruitment of the H3K4 methyltransferase MLL1 and H2AK119 monoubiquitin reader ZRF1 to the p16INK4A promoter. Interestingly, presence of repressive H3K27 trimethylation may not be sufficient to silence p16INK4A expression as components of the repressive PRC2 complex are found at the promoter during E7 expression. We identified a separate oncogenic pathway triggered by HPV16 E7 expression as we and others have shown that p16INK4A induction as a result of oncogenic RAS expression is similar, but mechanistically different from induction by HPV16 E7. Despite the presence of a vaccine, continued investigation into therapeutics is required as cervical carcinomas typically arise years after initial infection. Therefore, it will be years or decades for vaccination to have an appreciable effect on prevalence of HPV associated cancers. The therapeutic value in the epigenetic reprogramming of cells induced by HPV16 E7 has only begun to be exploited as it has been shown that expression of the H3K27 demethylases KDM6B and KDM6A are required for survival of HPV16 E7 expressing cells. Using an unprecedented approach to perform an RNAi screen in primary cells for epigenetic factors that are

32 necessary for survival of HPV16 E6/E7 expressing cells, we identified four factors, ASXL1, MLL1,

BRD4, and ZRF1 that are necessary for survival of HPV16 E6/E7 expressing cells. Depletion of these factors results in decreased viability of cervical cancer cells implicating these factors as potential therapeutic targets for cervical carcinomas following further evaluation of the effects of depletion in normal cells. The p16INK4A protein is a valuable biomarker for the identification of HPV infected cells and curiously several other carcinomas also have high p16INK4A expression including ovarian, lung, prostate, and breast carcinomas. Therefore, our study into the epigenetic factors necessary for survival for cervical carcinomas may be extended to these cancers. Indeed, we also report here that KDM6B activity is necessary for the survival of p16INK4A expressing carcinoma cell lines and that p16INK4A expression is required for a highly p16INK4A expressing breast carcinoma cell line as depletion results in decreases in cell viability in these cells, but not in p16INK4A deleted line. Collectively, this dissertation demonstrates that HPV16 E7 induces p16INK4A through removal of H3K27 trimethylation and H2AK119 monoubiquitination and addition of H3K4 trimethylation and H3K27 acetylation and that MLL1, ASXL1,

BRD4, and ZRF1 are necessary for survival of cervical carcinoma cell lines, which may be extended to other p16INK4A positive carcinomas, providing many therapeutic avenues to explore.

CHAPTER TWO

Alteration of the epigenetic state of tumor suppressor p16INK4A by the human papillomavirus E7

oncoprotein

Alteration of the epigenetic state of tumor suppressor p16INK4A by the human papillomavirus E7

oncoprotein

Tyshia K. Wellman1, Miranda Grace2, and Karl Munger2

1 Committee on Virology, Harvard Medical School, Boston, Massachusetts, 02115 2 Tufts University

School of Medicine, Boston, Massachusetts, 02111

Contributions: I wrote this manuscript and performed all of the experiments described in it with the exception of the western blot of HPV16 E6/E7 expressing HFKs, which was performed by Miranda

Grace. Karl Munger helped design the research and edited the manuscript.

Abstract

Changes in the epigenetic landscape are becoming critical to the understanding of cancer initiation and progression. Unlike genetic alterations, epigenetic modifications are reversible and an increase in our knowledge of these changes is crucial for the development of new, epigenetics-based therapies. Tumor suppressor, p16INK4A, is a cyclin dependent kinase (CDK) 4/6 inhibitor and is a key component of the retinoblastoma (pRB) tumor suppressor pathway that is activated in response to an oncogenic insult leading to a type of cellular senescence referred to as oncogene-induced senescence. As p16INK4A represents a critical barrier to cancer progression, it is frequently mutated or epigenetically silenced in human tumors. Interestingly, some human cancers, including high-risk human papillomavirus

(HPV) associated carcinomas express high levels of p16INK4A. In unperturbed normal human cells, p16INK4A is epigenetically silenced by polycomb repressive complexes, but expression is induced in response to potentially oncogenic stress signals. Previous reports from our group, have revealed that following expression of the high-risk HPV type 16 E7 oncoprotein, the histone 3 lysine 27 (H3K27) trimethyl mark is removed on some polycomb repressed genes including p16INK4A. However, removal of this single repressive mark, is likely not sufficient to switch p16INK4A into a transcriptionally active state and expression of E7 may alter additional histone marks on the p16INK4A promoter to render it active.

Using chromatin immunoprecipitations, we have investigated the role of E7 expression on the epigenetic state of p16INK4A. We report that epigenetic factor expression and recruitment are altered in response to

E7 expression. The activating H3K4 trimethyl and H3K27 acetyl marks are increased, whereas the repressive H2AK119 monoubiquityl mark is decreased, leading to the activation of p16INK4A.

Interestingly, we report an increase in repressive H3K27 trimethylation and PRC2 occupancy concomitant with an increase in p16INK4A transcription in some cell populations, suggesting that H3K27 trimethylation and PRC2 presence is not sufficient for transcriptional repression. These results illustrate the epigenetic complexities of this important tumor suppressor that may have implications for not only high-risk HPV carcinomas, but also other p16INK4A expressing cancers.

Introduction

Activation of oncogenes or inactivation of tumor suppressors, resulting in altered signal transduction and gene expression leading to aberrant growth, is a crucial step in the initiation of cancer.

In order to restrict cancer progression, several cellular defensive responses exist to eliminate these cells.

Oncogene-induced senescence (OIS) is a tumor suppressive mechanism that was initially identified as a consequence of HRAS expression (Serrano et al., 1997). OIS has been observed in a variety of malignancies including early stage prostate cancer, melanoma, and mouse models of lung adenomas

(Chen et al., 2005b; Collado et al., 2005; Michaloglou et al., 2005). Activation of OIS leads to permanent growth arrest characterized by activation of β-galactosidase, formation of heterochromatic foci, and increased size (reviewed in (Campisi, 2005)). OIS triggers the transcriptional activation of the tumor suppressor p16INK4A, which is a cyclin dependent kinase (CDK) 4 and CDK6 inhibitor (Serrano et al.,

1993). Under normal cellular conditions, the p16INK4A gene is kept epigenetically repressed through the actions of polycomb repressive complexes (PRCs), specifically the EZH2 methyltransferase of PRC2 and the RING1B E3 ligase of PRC1, which deposit histone 3 lysine 27 (H3K27) trimethylation and histone

2A lysine 119 (H2AK119) monoubiquitination, respectively (reviewed in (Margueron and Reinberg,

2011)). Following an oncogenic insult, these histone modifications are removed and activating histone 3 lysine 4 (H3K4) trimethylation is deposited by the MLL1 complex, resulting in the transcriptional activation of p16INK4A (Kotake et al., 2009). Expression of the p16INK4A protein results in the accumulation of the hypophosphorylated form of the retinoblastoma tumor suppressor protein (pRB), which leads to G1 arrest and senescence (Lukas et al., 1995). As OIS represents an obstacle to carcinogenesis, additional events are necessary to overcome this barrier; therefore it follows that p16INK4A is frequently mutated, deleted, or epigenetically silenced by DNA methylation in tumors (reviewed in

(Enders, 2003; Romagosa et al., 2011)).

Curiously, high levels of p16INK4A have been observed in several cancer types including high- grade serous ovarian, breast, prostate, and lung cancers (Chiesa-Vottero et al., 2007; Lam et al., 2008;

Milde-Langosch et al., 2001); however, subversion of the OIS response is typically a result of pRB

37 mutations in these cancers (Herschkowitz et al., 2008; Kommoss et al., 2007). High-risk human papillomavirus (HPV) associated cancers also express high levels of p16INK4A as a consequence of the expression of the E7 oncoprotein; however high-risk HPVs subvert the OIS response through the E7- targeted degradation of pRB (Boyer et al., 1996). However, the induction of p16INK4A by E7 is not dependent on pRB inactivation, and our group has demonstrated that induction is mediated in part by polycomb derepression of H3K27 trimethylation by the demethylase KDM6B (McLaughlin-Drubin et al.,

2011). Previous studies from our lab and others have investigated the role of E7 in the expression and presence of PRC factors in the activation of p16INK4A. Our lab has shown increased EZH2 expression and recruitment to the p16INK4A promoter in HPV16 E7 expressing cells (McLaughlin-Drubin et al., 2011).

Studies by Hyland et al. have also demonstrated an increase in EZH2 expression and recruitment in E6/E7 expressing cells and no changes in the levels of other PRC2 components SUZ12 and EED (Hyland et al.,

2011). Furthermore, expression of PRC1 component, BMI1, has been reported to be decreased in E6/E7 expressing cells (Hyland et al., 2011) and recruitment to the p16INK4A promoter reduced in E7 expressing cells (Kotake et al., 2009). Finally, increases in H3K4 trimethylation and MLL1 occupancy at the p16INK4A promoter in E7 expressing cells have been observed (Kotake et al., 2009).

Given that E7 expressing cells require the expression of p16INK4A for survival (McLaughlin-

Drubin et al., 2013), we were interested in further characterizing the epigenetic regulation of p16INK4A leading to its activation in order to identify potential epigenetic therapeutic targets. Indeed, our lab has shown that p16INK4A necessity is mediated, in part, by the activity of KDM6B (McLaughlin-Drubin et al.,

2013). We hypothesize that E7 driven p16INK4A expression would involve the same epigenetic alterations as RAS-induced p16INK4A expression; therefore, we investigated the modulation of the core histone marks associated with RAS-induced p16INK4A expression. Here we report that H3K4 trimethylation, H2AK119 monoubiquitination, and H3K27 trimethylation are altered as a consequence of HPV16 E7 expression. In addition, recruitment and expression of the histone modifying factors that are associated with these marks are altered in E7 expressing cells. Finally, we observed an intriguing increase in repressive H3K27 trimethylation despite an increase in p16INK4A transcription, suggesting that H3K27 trimethylation is not

38 rate-limiting to silence p16INK4A transcription. Our results provide further insight into the complex mechanisms governing the epigenetic regulation of p16INK4A during E7-induced OIS and have revealed that cellular responses to oncogenic stimuli can differ as E7 expression does not induce the same responses as RAS. It will be of interest to determine if our findings have relevance in other cancers with high level p16INK4A expression.

Materials and Methods

Cells. Primary human foreskin keratinocytes (HFKs) were isolated from a pool of five to eight newborn foreskins, cultured, and transduced with LXSN recombinant retroviruses encoding control, HPV16 E7, or

HPV16 E6/E7 vectors as previously described (Halbert et al., 1991). Following transduction, cells were cultured in F media as described (Meyers, 1996) and supplemented with 5% fetal bovine serum, 50 U/mL penicillin, 50 µg/mL streptomycin, 20 µg/mL gentamycin, and 1 µg/mL amphotericin B

(Gibco/ThermoFisher), 10 µM of Rho kinase inhibitor (Y-27632) (Enzo Lifesciences) and with mitomyocin treated 3T3-J2 feeder cells as previously described (Chapman et al., 2010). Experiments were performed with donor and passage matched HFK populations.

RT-qPCR. Total RNA was isolated using Quick-RNA kit (Zymo Research) as per manufacturer’s instructions. Isolated RNA (100 ng) was reverse transcribed using TaqMan Reverse Transcription

Reagents (Applied Biosystems/ThermoFisher). Amplification of the cDNA (15 ng) was performed with

SYBR Green (Applied Biosystems) and 0.7 µM final concentration of previously established primer pairs for p16INK4A (Agger et al., 2009), KDM6B (Agger et al., 2009), EZH2 (Bracken et al., 2007), SUZ12

(Bracken et al., 2007), WRD5 (Mungamuri et al., 2015), MLL1 (Ansari et al., 2012), and ZRF1 (Ribeiro et al., 2012). GAPDH was used as an internal control. Assays were performed in triplicate on the

StepOnePlus Real-Time PCR System (Applied Biosystems). Primer pairs are as follows: p16INK4A Forward: 5’GAAGGTCCCTCAGACATCCCC3’ p16INK4A Reverse: 5’CCCTGTAGGACCTTCGGTGAC3’

EZH2 Forward: 5’GGGACAGTAAAAATGTGTCCTGC3’

EZH2 Reverse: 5’TGCCAGCAATAGATGCTTTTTG3’

SUZ12 Forward: 5’TGGGAGACTATTCTTGATGGGAAG3’

SUZ12 Reverse: 5’GGAGCCGTAGATTTATCATTGGTC3’

MLL1 Forward: 5’GAGGACCCCGGATTAAACAT3’

MLL1 Reverse: 5’GGAGCAAGAGGTTCAGCATC3’

WRD5 Forward: 5’CACAAGCTGGGAATATCCGATG3’

WRD5 Reverse: 5’GGGGATTGAAGTTGCAGCAAAA3’

KDM6B Forward: 5’GGAGGCCACACGCGTCTAC3’

KDM6B Reverse: 5’GCCAGTATGAAAGTTCCAGAGCTG3’

ZRF1 Forward: 5’CGCTCTGACCTCTGCCTCTA3’

ZRF1 Reverse: 5’CAGAAGCATTTCTGTTTCTCCT3’

GAPDH Forward: 5’GATTCCACCCATGGCAAATTC3’

GAPDH Reverse: 5’TGGGATTTCCATTGATGACAAG3’

Western blotting and antibodies. Cell lysates were prepared by incubation in RIPA buffer (10 mM

Tris-Cl [pH 8.0], 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1%

SDS, 140 mM NaCl) supplemented with one cOmplete EDTA-free Protease Inhibitor Cocktail tab

(Roche) per 50 ml lysis buffer. Cells were incubated on ice for 30 min. and then cleared by centrifugation at 16,000 x g for 20 min. at 4°C. Bradford assay (BioRad) was used to determine protein concentration.

Samples were incubated at 95°C for 10 min. in NuPAGE LDS Sample Buffer (4X) (Invitrogen), loaded onto NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm (Invitrogen), and transferred onto polyvinylidene difluoride (PVDF) membranes (Immobilon-P; Millipore) at 20V for 16 hours. Membranes were blocked for 2 hours in 5% nonfat dry milk in TBST buffer (137 mM NaCl, 2.7 mM KCl, 25 mM Tris [pH 7.4],

0.1% Tween 20). Blots were incubated overnight at 4°C with agitation. Primary antibodies used were as follows: pRB (Oncogene Research AB-5, 1:100), SUZ12 (Abcam 12073, 1:1000), HPV16 E7 (mix of

Zymed/Invitrogen 8C9, 1:150 and Santa Cruz Biotechnology ED17, 1:200), phospho(S21) EZH2(Abcam

84989, 1:500), EZH2 (Cell Signaling 5246, 1:1000), ZRF1 (Abcam 134572, 1:5000), p53 (Calbiochem

OP43, 1:1000), H3K27 trimethyl (Millipore 07-449, 1:750), p16INK4A (SantaCruz 56330, 1:200), and β- actin (Millipore MAB1501, 1:1000). Following three washes with TBST, blots were incubated for 2 hours with agitation with secondary anti-mouse IgG and anti-rabbit IgG horseradish peroxidase- conjugated antibodies (Amersham) at 1:10,000 dilutions. Proteins were visualized by enhanced chemiluminescence (Luminata™ Crescendo Western HRP Substrate; Millipore) and exposed on film or electronically acquired with a Syngene G: BOX image station (Syngene) equipped with GeneSys software, v1.5.6.0.

ChIP. Passage 6 or younger HFKs expressing control, HPV16 E7, or HPV16 E6/E7 vectors were analyzed by ChIP using the SimpleChIP Plus Enzymatic Chromatin IP Kit Magnetic Beads (Cell

Signaling) as per manufacturer’s instructions. Immunoprecipitation of 10 µg of chromatin with the following antibodies was performed: H3K27 trimethyl (Millipore 07-449, 5 µg), H3K4 trimethyl

(Millipore CS200580, 1:70), H2AK119 ubiquityl (Cell Signaling 8240, 1:50), H3K27 acetyl (Abcam

4729, 8 µg), RNA polymerase II (Millipore 05-623, 1 µg), EZH2 (Cell Signaling 5246, 1:100), SUZ12

(Abcam 12073, 2 µg), phospho(S21) EZH2(Abcam 84989, 1:100), MLL1 (Bethyl Labs A300-374A, 2

µg), ZRF1 (Abcam 134572, 5 µg), Normal Mouse IgG (Millipore 12-371, 1 µL), and Normal Rabbit IgG

(Millipore CS200581, 2µg). Purified immunoprecipitated DNA (1 µL) was amplified by real-time qPCR using SYBR Green (Applied Biosystems) and 0.5 µM of previously established primers for the p16INK4A promoter 85 base pairs downstream of the transcription start site (Agger et al., 2009):

Forward: 5’CCCCTTGCCTGGAAAGATAC3’

Reverse: 5’AGCCCCTCCTCTTTCTTCCT3’

Cycling parameters were 20 sec. at 95 °C followed by 40 cycles for 3 sec. at 95 °C and 30 sec. at 60 °C.

Assays were performed in triplicate on the StepOnePlus Real-Time PCR System (Applied Biosystems).

Percent of input was calculated as 2% x 2(C[T] 2%Input Sample - C[T] IP Sample).

Statistics. Statistical significance was determined using unpaired two-tailed Students t test.

Results

Expression of p16INK4A regulators is altered in HPV16 E7 expressing HFKs. As expression of the

H3K27 demethylases KDM6A and KDM6B has been shown to be induced following expression of

HPV16 E7 (McLaughlin-Drubin et al., 2011), we were interested in whether HPV16 E7 also modulates the expression of other epigenetic regulators of p16INK4A. We performed RT-qPCR and western blotting analysis of either HPV16 E7 or control vector transduced primary human foreskin keratinocytes (HFKs) populations generated from independent pools of newborn foreskin tissue. As previously demonstrated,

E7 expression induces expression of p16INK4A and the repressive E2F transcriptional target and PRC2 component, EZH2, as illustrated by both RT-qPCR and western blotting (Figure 2.1A and B and Figure

2.2A and B) (Hyland et al., 2011; McLaughlin-Drubin et al., 2011). In addition, phosphorylation of

EZH2 at serine 21 (S21) has been reported to inhibit its repressive activity (Cha et al., 2005; Xu et al.,

2012). Following expression of E7, levels of phospho(S21) EZH2 were increased (Figure 2.2B).

Interestingly, the expression of the PRC2 component, SUZ12, was also induced following expression of

E7 (Figure 2.1C and Figure 2.2A). Although levels were previously reported to remain unchanged following expression of E6 and E7 in primary HFKs (Hyland et al., 2011), SUZ12 is an E2F target gene and its transcriptional activation is likely mediated by the release of E2F from pRB through the degradation of pRB by E7 (Bieda et al., 2006; Bracken et al., 2003; Weinmann et al., 2001). Transcript levels of MLL1, which deposits activating H3K4 trimethylation on the p16INK4A promoter (Kotake et al.,

2009), were not affected by E7 expression as determined by RT-qPCR (Figure 2.1D). In addition, transcript levels of WRD5, a component of the MLL1 complex (Wysocka et al., 2005), were not increased following expression of E7 (Figure 2.1E). Although, increases in KDM6B expression have been reported in HPV16 E7 expressing HFKs (McLaughlin-Drubin et al., 2011), induction was not observed in the populations tested (Figure 2.1F). Finally, levels of the H2AK119 monoubiquitin reader

A B C

D E F

Figure 2.1. Transcriptional alteration of p16INK4A regulators in HPV16 E7 expressing HFKs. RT-qPCR analysis of (A) p16INK4A, (B) EZH2, (C) SUZ12, (D) MLL1, (E) WRD5, (F) KDM6B, and (G) ZRF1 expression in three independent control and HPV16 E7 expressing HFK populations. Error bars represent SEMs from three RT-qPCR reactions. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 2.2. HPV16 E7 modulates expression of some p16INK4A regulators in HFKs. Western blotting analysis of (A) SUZ12 and (B) phospho(S21) EZH2, EZH2 and ZRF1 was performed in three independent populations of HFKs expressing HPV16 E7 or control vectors. Blots of E7 and pRB are included to verify functional expression of E7. A blot of p16INK4A is included to verify induction and actin as a loading control. *Note that the CTL and E7 lanes are reversed.

44 protein ZRF1 were not appreciably affected by E7 expression although one population did exhibit an increase in transcription and translation (Figure 2.1G); however, previous HFK populations have consistently illustrated no effect on ZRF1 levels as a consequence of E7 expression.

Induction of p16INK4A by HPV16 E7 is mediated by the removal of H2AK119 monoubiquitination and deposition of H3K4 trimethylation and H3K27 acetylation. To investigate how HPV16 E7 alters the epigenetic state of the p16INK4A promoter leading to its activation, we performed chromatin immunoprecipitations (ChIP) experiments for the core epigenetic marks that have been demonstrated as necessary for p16INK4A activation during RAS-induced OIS in four independent HFK populations expressing HPV16 E7 or control vectors. Consistent with our group’s previous report in U2OS cells

(McLaughlin-Drubin et al., 2011), the repressive H3K27 trimethyl mark was decreased 23.0 ± 7.3 fold (P

< 0.0001) in E7 expressing cells across all populations on the p16INK4A promoter (Figure 2.3A). Given that loss of H3K27 trimethylation is typically accompanied by accumulation of H3K27 acetylation and gene activation (Tie et al., 2009), we assessed the presence of this mark on the p16INK4A promoter.

Acetylation was increased 2.9 ± 0.7 fold (P=0.0765) in E7 expressing HFK populations over control

(Figure 2.3B), concomitant with an increase in RNA polymerase II occupancy on the p16INK4A promoter, indicative of gene expression (Figure 2.3E).

The p16INK4A gene is kept epigenetically repressed by both H3K27 trimethylation and H2AK119 monoubiquitination. Induction of p16INK4A during OIS is mediated by the removal of these marks in addition to deposition of activating H3K4 trimethylation. Therefore, we were interested if these core marks are altered following expression of E7. We found that H2AK119 monoubiquitination was decreased approximately 4.9 ± 1.7 fold (P=0.0496) among the four E7 expressing HFK populations

(Figure 2.3C). Expression of E7 resulted in an increase of the H3K4 trimethyl mark by 2.3 ± 0.4 fold

(P=0.0351) in the four HFK populations evaluated (Figure 2.3D). Taken together, these results illustrate that E7 triggers the OIS pathway resulting in activation of p16INK4A through removal of repressive H3K27

A B

C D

Figure 2.3. Expression of HPV16 E7 reduces repressive H3K27 trimethylation and H2AK119 monoubiquitination and increases H3K4 trimethylation and H3K27 acetylation on the p16INK4A promoter. Four (or three) independent populations of HFKs expressing HPV16 E7 or control vectors were used for ChIP analysis using antibodies specific to (A) H3K27 trimethylation, (B) H3K27 acetylation, (C) H2AK119 monoubiquitination, (D) H3K4 trimethylation, and (E) RNA polymerase II as an indicator of gene expression. Quantification of the immunoprecpitated DNA was determined through RT-qPCR using primer pairs 85 bp downstream of the p16INK4A start site. Data is plotted as percent of input and averages and SEMs for four independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, ****P < 0.0001.

46 trimethylation and H2AK119 monoubiquitination, and deposition of activating H3K27 acetylation and

H3K4 trimethylation.

Expression of HPV16 E7 may cause increased recruitment of H3K4 methyltransferase MLL1 and

H2AK119 monoubiquitin reader ZRF1 to the p16INK4A promoter. To further investigate how expression of E7 epigenetically triggers p16INK4A activation, we examined the recruitment of the H3K4 methyltransferase MLL1 as it has been shown to regulate H3K4 trimethylation on the p16INK4A promoter following oncogenic RAS expression (Kotake et al., 2009). In three independent populations of HFKs expressing E7 or control vectors, MLL1 recruitment was increased 3.8 ± 0.5 fold (P=0.1362) following

E7 expression (Figure 2.4A); however, as MLL1 signal over background IgG was low, we cannot conclusively state a difference and these results will need to be further validated. Interestingly, levels of

H3K4 trimethylation remained unchanged in population A even with an increase in MLL1 recruitment

(Figure 2.4B).

We also analyzed recruitment of H2AK119 monoubiquitin reader ZRF1 to the p16INK4A promoter during E7 expression as it has been reported to be recruited to displace repressive PRC1 complexes following oncogenic RAS expression (Ribeiro et al., 2012). A 1.6 ± 0.3 fold (P=0.2256) increase in recruitment to the p16INK4A promoter was seen in the two populations of HFKs evaluated (Figure 2.4C); however, as ZRF1 signal was weak, these results require further validation. In addition, levels of the

H2AK119 monoubiquitin mark remained unchanged in population B following expression of E7 (Figure

2.4D). Of note, population A displayed an increase in ZRF1 expression in E7 HFKs (Figures 2.1G and

2.2B), but recruitment to the p16INK4A promoter was only slightly increased in these cells. These results suggest that recruitment does not necessarily correlate with alterations in histone marks indicating complex regulation of p16INK4A during expression of E7 in primary cells.

A B

POP POP A

B POP POP

C POP POP

ERGE M

Figure 2.4. Expression of HPV16 E7 may increase recruitment of MLL1 and ZRF1 to the p16INK4A promoter. Three (or two) independent populations of HFKs expressing HPV16 E7 or control vectors were used for ChIP analysis using antibodies specific to (A) MLL1, (B) H3K4 trimethylation, (C) ZRF1, or (D) H2AK119 monoubiquitination. Quantification of the immunoprecpitated DNA was determined through RT-qPCR using primer pairs 85 bp downstream of the p16INK4A start site. Data is plotted as percent of input and averages and SEMs for two or three independent experiments are shown in MERGE. Statistically significant changes are indicated: ns not significant.

C D

POP POP A

B POP POP

MERGE

Figure 2.4. (Continued).

Recruitment of S21 phosphorylated EZH2 to the p16INK4A promoter is not sufficient to repress p16INK4A expression. Although reduction of the H3K27 trimethyl mark on the p16INK4A promoter has been observed following HPV16 E7 and oncogenic RAS expression (Kotake et al., 2009; McLaughlin-

Drubin et al., 2011), expression and recruitment of the H3K27 methyltransferase, EZH2, to the p16INK4A promoter is increased (Hyland et al., 2011; McLaughlin-Drubin et al., 2011). However, this is only observed in E7 expressing cells as oncogenic RAS expression has been shown to cause a decrease in

EZH2 expression and recruitment to the p16INK4A promoter (Agger et al., 2009; Barradas et al., 2009). It has been suggested that increases in EZH2 expression enhances PRC4 formation, which mediates H1K26 trimethylation (McLaughlin-Drubin et al., 2011); while other studies have suggested that EZH2 repressor function is context dependent and can act as an activator depending on its phosphorylation state (Cha et al., 2005; Xu et al., 2012). Furthermore, phosphorylation at serine 21 by AKT inhibits the methyltransferase activity of EZH2, but not its ability to associate with PRC2 components (Cha et al.,

2005). To distinguish between these two models, we analyzed recruitment of EZH2 and SUZ12 to the p16INK4A promoter in three populations of HFKs expressing E6/E7 or control vectors to determine whether EZH2 is associated with repressive PRC2 complexes. Consistent with previous reports (Hyland et al., 2011; McLaughlin-Drubin et al., 2011), we observed an increase in EZH2 occupancy (2.7 ± 0.4 fold, P=0.0292) at the p16INK4A promoter in E6/E7 expressing HFKs (Figure 2.5A). Moreover, SUZ12 recruitment was slightly increased (2.0 ± 0.7 fold, P=0.2199) in the E6/E7 expressing HFKs, suggesting that the bound EZH2 may be contained in the repressive PRC2 complex (Figure 2.5B). Unexpectedly, our analyses revealed marked increases in the H3K27 trimethyl mark (9.4 ± 1.1 fold, P=0.0337) in each of the three E6/E7 expressing HFK populations (Figure 2.5C). This result was quite surprising as our previous experiments in HPV16 E7 expressing HFKs (Figure 2.3A) and other groups have consistently shown a decrease in H3K27 trimethylation following the expression of E7 (Hyland et al., 2011;

McLaughlin-Drubin et al., 2011). Therefore, one might predict that p16INK4A expression may be reduced in these E6/E7 expressing cells. However, p16INK4A was expressed at high levels in HPV16 E6/E7 expressing HFKs (Figure 2.6A). In addition, expression of EZH2 was also induced in HPV16 E6/E7

A B

Figure 2.5. EZH2 is associated with SUZ12 occupancy at the p16INK4A promoter and promotes increased H3K27 trimethylation in HPV16 E6/E7 HFKs. Three independent populations of HFKs expressing E6/E7 or control vectors were used for ChIP analysis using antibodies specific to (A) EZH2, (B) SUZ12, or (C) H3K27 trimethylation. Quantification of the immunoprecpitated DNA was determined through RT-qPCR using primer pairs 85 bp downstream of the p16INK4A start site. Data is plotted as percent of input and averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05.

A B

Figure 2.6. Expression of negative epigenetic regulators of p16INK4A expression in HPV16 E6/E7 HFKs. Western blotting analysis of (A) phospho(S21) EZH2, EZH2, p16INK4A, and H3K27 trimethyl or (B) SUZ12 was performed in three independent populations of HFKs expressing HPV16 E6/E7 or control vectors. Blots of E7, pRB, and p53 are included to verify functional expression of E6 and E7. Actin is used as a loading control.

52 expressing cells and levels of phospho(S21) EZH2 were also increased, suggesting that the increase in

EZH2 expression is a result of increased phosphorylation. Furthermore, expression of SUZ12 was also increased, which conflicts with previous reports of unchanged levels in E6/E7 expressing cells (Figure

2.6B) (Hyland et al., 2011). Expression of HPV16 E7 induces global reduction of the H3K27 trimethyl mark and we have observed an increase in H3K27 trimethylation at the p16INK4A promoter following

HPV16 E6/E7 expression (Figure 2.5C); therefore, we analyzed global levels of H3K27 trimethylation in these cells and determined that HPV16 E6/E7 expression in these HFKs increases H3K27 trimethylation on a global level (Figure 2.6A). Collectively, these results suggest that the EZH2 recruited to the p16INK4A promoter during expression of HPV16 E6/E7 is phosphorylated and associates with PRC2 components; however, its activity is not inhibited as H3K27 trimethylation is increased. Moreover, the

H3K27 trimethyl mark is not sufficient to inhibit p16INK4A expression in these cells.

As the role of HPV16 E6 expression on the epigenetic regulation of p16INK4A has not been fully explored and may account for the surprising results observed above, we performed ChIP experiments in three populations of HFKs expressing E7 alone or control vectors. We observed a 1.8 ± 0.4 fold

(P=0.3562) increase in EZH2 recruitment to the p16INK4A promoter; however, recruitment in population A remained unchanged (Figure 2.7A). Levels of p16INK4A were increased following expression of E7 in these populations (Figure 2.1A and Figure 2.2B) and the levels of phospho(S21) EZH2 in two of the three populations were also increased (Figure 2.2B). We analyzed phospho(S21) EZH2 recruitment to the p16INK4A promoter and observed a 2.6 ± 0.3 fold (P=0.2405) increase in E7 expressing cells (Figure 2.7B); however, as both EZH2 and phospho(S21) EZH2 signals were weak compared to background IgG, these results will need further validation to make definitive conclusions on phosphoEZH2/EZH2 occupancy on the p16INK4A promoter.

Similar to our observations in E6/E7 expressing HFKs above, SUZ12 recruitment and H3K27 trimethylation were slightly increased following expression of E7; however, p16INK4A expression was not repressed, implicating the necessity of other histone modifications for the repression of p16INK4A (Figures

2.7C and D).

A B

POP POP A

B POP POP

C POP POP

MERGE

Figure 2.7. Increased EZH2 at the p16INK4A promoter may be phosphorylated and is contained in PRC2 complexes leading to H3K27 trimethylation, but not silencing of p16INK4A expression in HPV16 E7 HFKs. Three independent populations of HFKs expressing HPV16 E7 or control vectors were used for ChIP analysis using antibodies specific to (A) EZH2, (B) phospho(S21) EZH2, (C) SUZ12, or (D) H3K27 trimethylation. Quantification of the immunoprecpitated DNA was determined through RT-qPCR using primer pairs 85 bp downstream of the p16INK4A start site. Data is plotted as percent of input and averages and SEMs for two or three independent experiments are shown in MERGE. Statistically significant changes are indicated: ns not significant.

C D

POP POP A

B POP POP

C POP POP

MERGE

Figure 2.7. (Continued).

Discussion

OIS is an important barrier that must be overcome for the progression of malignant transformation. The p16INK4A gene is an important and well studied tumor suppressor that is kept epigenetically repressed by polycomb repressive complexes and is a valuable biomarker for HPV associated cancers (Sano et al., 1998). The high-risk HPV16 E7 protein triggers OIS and p16INK4A expression, but subverts senescence by targeting the downstream effector, pRB, for degradation leading to aberrant proliferation. Our group has previously shown that induction of p16INK4A by HPV16 E7 is mediated through removal of repressive H3K27 trimethyl marks by the demethylase KDM6B

(McLaughlin-Drubin et al., 2011); however removal of this single mark is likely insufficient to render the gene completely active. We sought to determine if HPV16 E7 expression alters the core histone marks associated with p16INK4A transcription and if expression of E7 modulates expression or recruitment of the epigenetic factors associated with these marks.

Here we report that expression of HPV16 E7 reduces the H3K27 trimethyl mark at the p16INK4A promoter in primary HFKs (Figure 2.3A) consistent with previous reports in U2OS and WI38 cells

(Kotake et al., 2009; McLaughlin-Drubin et al., 2011). The loss of the H3K27 trimethyl mark is not accompanied by an increase in KDM6B expression (Figure 2.1F) as has been previously observed

(McLaughlin-Drubin et al., 2011); however, this is consistent with other reports (Hyland et al., 2011). In addition, we demonstrate that activation of p16INK4A in response to E7 is also mediated by the loss of

H2AK119 monoubiquitination (Figure 2.3C and 2.4D) perhaps mediated through the occupancy of the ubiquitin reader ZRF1 (Figure 2.4C). ZRF1 displaces PRC1 and it has been suggested to aid in the recruitment of deubiquitinases (Ribeiro et al., 2012); however, further investigation is required to draw definitive conclusions on ZRF1 occupancy during E7 expression. While ZRF1 is induced as a consequence of RAS expression, E7 expression did not appear to have the same effect as expression of

ZRF1 did not appreciably change, except for one population of HFKs (Figure 2.1G and 2.2B); however, we have consistently observed that expression of ZRF1 is not typically altered in E7 expressing HFKs

(data not shown).

Acquisition of H3K27 acetylation and H3K4 trimethylation were also observed on the p16INK4A promoter during expression of E7 (Figure 2.3). The increase in H3K4 trimethylation may result from the increase in occupancy of MLL1 at the p16INK4A promoter as the expression of MLL1 and WRD5, a structural protein of the MLL1 methyltransferase complex (Dou et al., 2006), did not appear to change as a consequence of E7 expression (Figure 2.1D and E), consistent with reports of expression alterations following oncogenic RAS expression (Kotake et al., 2009). While increases in H3K4 trimethylation and

MLL1 recruitment to the p16INK4A promoter following expression of E7 have previously been reported in

WI38 cells (Kotake et al., 2009), this is the first study to validate this observation in primary HFKs, a more biologically relevant cell type as these cells serve as a natural host for HPV infections.

Interestingly, presence of MLL1 or ZRF1 did not always correlate with a gain of H3K4 trimethylation or H2AK119 monoubiquitination, respectively. In one population of HFKs analyzed, the increase in MLL1 at the p16INK4A promoter in E7 expressing HFKs did not result in an increase in H3K4 trimethylation (Figure 2.4). A similar oddity was also seen with an increase in ZRF1 occupancy, but not a decrease in H2AK119 monoubiquitination (Figure 2.4). While these data sets are not entirely compelling due to the weak signal to background ratio, they suggest that these epigenetic changes are dynamic and that alterations in a single mark may require the presence or absence of other factors, further demonstrating the complexity of the regulation of p16INK4A. Indeed, crosstalk between complexes and histone marks have been illustrated for the activation and repression of genes (reviewed in (Suganuma and Workman, 2011)).

Our observed increases in expression and recruitment of EZH2 are consistent with previous reports (Hyland et al., 2011; McLaughlin-Drubin et al., 2011). As these previous groups suggested, increases in EZH2 expression and recruitment conflict with the observed decreases in H3K27 trimethylation. To resolve these contrasting pieces of data, it has been suggested that EZH2 upregulation does not increase PRC2 activity as the phosphorylation state of EZH2 can affect its ability to repress or activate genes (Cha et al., 2005; Xu et al., 2012). The first model for gene expression in the presence of

EZH2 occupancy proposed by Xu et al. in castration-resistant prostate cancer cells, suggests that

57 phosphorylation of EZH2 at S21 switches EZH2 from a repressor to a transcriptional activator through the association with androgen receptor containing transcription factor complexes and activation of target genes (Xu et al., 2012). According to this model, the methyltransferase activity of EZH2 is required for activation of target genes; however, association with PRC2 complexes or H3K27 trimethylation is not observed. While we observed increased phosphorylation of EZH2 and transcriptional activation of p16INK4A (Figures 2.1A, 2.2B, and 2.6A), H3K27 trimethyl levels and PRC2 occupancy as determined by presence of SUZ12 were increased at the p16INK4A promoter (Figures 2.5B and C, and 2.7C and D), thereby invalidating this model in our system. The second model proposed by Hyland et al., suggests that phosphorylation of EZH2 inhibits its affinity for H3, but does not prevent its association with the PRC2 complex. They suggest that induction of AKT by HPV16 E7 facilitates phosphorylation as AKT has been shown to phosphorylate EZH2 at S21 (Cha et al., 2005; Menges et al., 2006). Indeed, Hyland et al. demonstrated that levels of phospho(S21) EZH2 are increased in E6/E7 human foreskin fibroblasts supporting the model that phosphorylation of EZH2 inhibits its methyltransferase activity, thereby resulting in a decrease in H3K27 trimethylation in spite of EZH2 occupancy at the p16INK4A promoter. In agreement with Hyland et al., we also observed an increase in phospho(S21) EZH2 in HFKs that express only E7 (Figure 2.1A) and E6/E7 (Figure 2.6A). In further support of this model, we demonstrated that phospho(S21) EZH2 is present at the p16INK4A promoter following E7 expression, suggesting that EZH2 found at the p16INK4A promoter is in the phosphorylated form. Consistent with this model, we detected occupancy of the PRC2 component SUZ12 on the p16INK4A promoter following expression of E7 (Figures

2.5B and 2.7C). Based on this model, levels of H3K27 trimethylation should be reduced due to inactive

EZH2; however, we observed a gain in H3K27 trimethylation in a total of six independent HFK populations expressing either E7 or E6/E7 (Figures 2.5C and 2.7D). Intriguingly, this increase in H3K27 trimethylation did not repress expression of p16INK4A (Figures 2.1A, 2.2B, and 2.6A). While H3K27 trimethylation is typically a mark associated with gene repression, there has been evidence that transcriptional activation requires loss of PRC1, but H3K27 demethylation is not as necessary (Prickaerts et al., 2016). While not shown directly, it is attractive to assume that the decreases in H2AK119

58 monoubiquitination we observed in these cells would indirectly suggest PRC1 loss from the p16INK4A promoter (Figure 2.4D), thereby leading to its transcription in spite of the presence of H3K27 trimethylation. Investigation into the occupancy of PRC1 components in cells where p16INK4A expression persists in the presence of H3K27 trimethylation would be particularly interesting. We can conclude from these data that the epigenetic regulation of p16INK4A is more complex than anticipated.

In this study we have demonstrated that HPV16 E7 triggers OIS through the canonical mechanism of p16INK4A activation through the removal of H3K27 trimethylation and H2AK119 monoubiquitination and the acquisition of H3K4 trimethylation; however, E7 expression does not trigger the same alterations in the epigenetic factors that regulate these changes as seen in RAS-induced OIS, suggesting that the method for OIS induction is dependent on the type of oncogenic stimulus. It will be interesting to determine the biological significance of these differences. In addition, our data also suggests that H3K27 trimethylation is not sufficient to transcriptionally repress p16INK4A, indicating that the mechanisms governing the activation of p16INK4A during OIS are very complex and further investigations into these epigenetic changes are warranted.

CHAPTER THREE

Epigenetic regulators ASXL1, MLL1, BRD4, and ZRF1 are necessary for survival of HPV16 E6

and E7 expressing cells

Epigenetic regulators ASXL1, MLL1, BRD4, and ZRF1 are necessary for survival of HPV16 E6

and E7 expressing cells

Tyshia K. Wellman1, Miranda Grace2, Glenn Cowley3, Federica Piccioni3, and Karl Munger2

1 Committee on Virology, Harvard Medical School, Boston, Massachusetts, 02115 2 Tufts University

School of Medicine, Boston, Massachusetts, 02111 3 Broad Institute, Cambridge, Massachusetts, 02142

Contributions: I wrote this manuscript and performed all of the experiments described in it with the exceptions of shRNA knockdown experiments in cervical carcinoma cell lines and primary human foreskin keratinocytes, which I designed, but was performed by Miranda Grace and Karl Munger.

Miranda Grace also performed half of the first screen and the entire second screen with my instruction.

Glenn Cowley assisted in screen design and optimization protocols and Federica Piccioni performed the deep sequencing, deconvolution, and fold change calculations. Karl Munger helped design the research and edited the manuscript.

Abstract

Alterations in the epigenetic makeup of cells contribute to cancer initiation and progression as such changes can globally impact gene expression and cellular activities. The high-risk human papillomavirus type 16 (HPV16) E6 and E7 oncoproteins have been shown to induce changes in epigenetic programs on a global level in epithelial cells. Specifically, expression of the E7 oncoprotein results in global decreases in repressive histone 3 lysine 27 (H3K27) trimethylation, increased expression of polycomb group proteins (PcGs) KDM6A, KDM6B, and EZH2, and aberrant expression of KDM6A/B responsive genes, including homeobox (HOX) genes and tumor suppressor p16INK4A. Surprisingly, this epigenetic reprogramming creates specific cellular vulnerabilities as KDM6A/B expression is required for the survival of HPV16 E7 expressing cells, including many cervical carcinoma lines. Given that the E7 oncoprotein interacts with epigenetic factors and modulates gene expression, we were interested in determining if other epigenetic factors may be important for survival of E7 expressing cells. To this end, we performed an RNAi screen to identify epigenetic factors that are necessary for survival of E6/E7 expressing cells, but are dispensable for survival of normal cells. ASXL1, MLL1, BRD4, and ZRF1 depletion resulted in significantly decreased viability of HPV16 E6/E7 expressing cervical carcinoma cells, illustrating the importance of these factors in these epigenetically reprogrammed cells, thus these factors become attractive candidates for therapy in cervical carcinomas.

Introduction

Epigenetic regulation of gene expression involves a complex balance among readers, writers, and erasers of histone modifications. Dysregulation of these factors through deletion, mutation, or misexpression is an important factor in cancer initiation and progression. For example, enhancer of zeste

2 (EZH2) is frequently overexpressed in a variety of solid tumors (Simon and Lange, 2008). Mutations in

DNA methyltransferases result in the silencing of tumor suppressor genes (Jones and Baylin, 2007). Loss of heterozygosity of inhibitor of growth 1 (ING1), a component of the p53 tumor suppressor pathway, has been observed in ovarian, colorectal, and pancreatic cancers (Chen et al., 2005a; Shen et al., 2005; Yu et al., 2004). Rearrangement of mixed lineage leukemia 1 (MLL1) is the most common mutation observed in leukemias (Krivtsov and Armstrong, 2007). Changes in gene regulation as a result of alterations in these factors, expose vulnerabilities in gene expression that have the potential to be selectively targeted for therapy. Indeed, this concept of synthetic lethality is a common approach to the treatment of cancers.

For example, small molecule inhibition of EZH2 has been explored for the treatment of AIRD1A mutated ovarian tumors in mice (Bitler et al., 2015).

Human papillomaviruses (HPVs) are small, non-enveloped, DNA viruses that infect cutaneous and mucosal epithelia and replicate exclusively in differentiating epithelial cells (reviewed in

(McLaughlin-Drubin et al., 2012)). High-risk HPVs are associated with over 99% of cervical cancers, as well as other anogenital tract and oral carcinomas (Chung and Gillison, 2009; Giuliano et al., 2008;

Walboomers et al., 1999). The E6 and E7 proteins are potent oncogenes that are necessary for cervical carcinoma development and persistence, and are the only two proteins that are consistently expressed in cervical cancer cells (reviewed in (McLaughlin-Drubin and Munger, 2009)). Lacking intrinsic enzymatic activities, E6 and E7 proteins alter host gene expression and signal transduction through their association with cellular proteins. The transforming activities of E6 and E7 have been linked, at least in part to their ability to target the p53 and retinoblastoma tumor suppressor (pRB) respectively for proteasomal degradation (Boyer et al., 1996; Huh et al., 2007; Huibregtse et al., 1991; Jones et al., 1997; Scheffner et al., 1993).

The high-risk HPV type 16 (HPV16) E7 oncoprotein induces epigenetic reprogramming in epithelial cells. E7 directly binds repressive E2F6 containing polycomb repressive complexes (PRCs) and these complexes are reduced in E7 expressing cells (McLaughlin-Drubin et al., 2008). In addition,

E7 expression results in the increase of expression of the PRC2 histone 3 lysine 27 (H3K27) methyltransferase EZH2, and surprisingly a global reduction of H3K27 trimethylation is observed

(McLaughlin-Drubin et al., 2011). Cervical carcinomas display aberrant homeobox (HOX) gene expression and expression of the H3K27 specific demethylases KDM6A/B are increased in E7 expressing cells coinciding with an increase in expression of KDM6A/B responsive HOX genes (McLaughlin-

Drubin et al., 2011). Expression of PRC1 component, BMI1, has been reported to be decreased in E6/E7 expressing cells (Hyland et al., 2011), and E6 and E7 have been shown to associate with factors important for modulation of histone acetylation (Avvakumov et al., 2003; Brehm et al., 1999; Longworth and

Laimins, 2004).

Interestingly, the altered epigenetic state induced by E7 creates a dependence on the expression of

KDM6B and KDM6A, where depletion or small molecule inhibition of KDM6A/B selectively inhibits survival of E7 expressing cells, but not control cells (McLaughlin-Drubin et al., 2011; McLaughlin-

Drubin et al., 2013). This dependence is mediated, in part, by the activity of the downstream KDM6B target tumor suppressor p16INK4A, and KDM6A target p21CIP1 (McLaughlin-Drubin et al., 2013; Soto et al.,

2017). The p16INK4A protein is a cyclin dependent kinase (CDK) 4/6 inhibitor and depletion of p16INK4A or inhibition of CDK4/6 results in decreased viability of E7 expressing cells (McLaughlin-Drubin et al.,

2013). It is clear that HPV16 E6 and E7 greatly alter the epigenetic landscape of epithelial cells, thereby creating synthetic lethal vulnerabilities; therefore, we hypothesized that additional epigenetic regulators may also generate synthetic lethal interactions in HPV16 E6/E7 expressing cells. To this end, we utilized

RNAi to screen for epigenetic factors important for the survival of E6/E7 expressing primary human foreskin keratinocytes (HFKs), while not similarly affecting survival of donor and passage matched control vector transduced HFKs. Our study identified factors that are necessary for the survival of E6/E7 expressing cells, four of which – ASXL1, MLL1, BRD4, and ZRF1 – also significantly inhibit the

64 viability of HPV-positive cervical cancers cells. To our knowledge, this is the first epigenetic RNAi screen to be performed in human keratinocytes, and as small molecule inhibitors of some of these factors exist, this study has promising therapeutic implications.

Materials and Methods

Cells. Primary HFKs were isolated from a pool of five to eight newborn foreskins, cultured, and transduced with LXSN recombinant retroviruses encoding control, HPV16 E6, E7, or E6/E7 vectors as previously described (Halbert et al., 1991). Following transduction, cells were either cultured in

Keratinocyte Serum Free Media (KSFM) supplemented with human recombinant epidermal growth factor

1-53, bovine pituitary extract, 50 U/mL penicillin, 50 µg/mL streptomycin, 20 µg/mL gentamycin, and 1

µg/mL amphotericin B (Gibco/ThermoFisher) or F media as described (Meyers, 1996) and supplemented with 5% fetal bovine serum (FBS), 50 U/mL penicillin, 50 µg/mL streptomycin, 20 µg/mL gentamycin, and 1 µg/mL amphotericin B (Gibco/ThermoFisher), 10 µM of Rho kinase inhibitor (Y-27632) (Enzo

Lifesciences) and with mitomyocin treated 3T3-J2 feeder cells as previously described (Chapman et al.,

2010). Experiments were performed with donor and passage matched HFK populations. CaSki, SiHa, and HeLa cells (ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10%

FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin. Experiments were performed with donor and passage matched HFK populations.

shRNA epigenetic library screening and sequencing. Two independent populations of HFKs expressing control or HPV16 E6/E7 vectors were generated and cultured as described above. HPV16 E6 and E7 expression was confirmed through western blotting and the two populations were pooled. Passage

6 HFKs were infected with the CP0010 shRNA pooled epigenetic library (Broad Institute, Cambridge,

MA) (Table A.1) following the “Large Scale Infection for Pooled Screens of shRNA libraries” protocol from the Broad Institute. Briefly, HFKs were trypsinized to remove J2 feeder cells and HFKs were collected and counted. Next, 3 x 106 HFKs were infected with 1.65 x 106 virus particles of the CP0010

(6.6 x 106 vp/mL) shRNA RNA library in the presence of 4 µg/mL polybrene and four replicates plated onto 12 well plates for a total of 1.8 x 107 infected HFKs per replicate. Plates were centrifuged at 800 x g in a benchtop centrifuge for 2 hours at 37°C, virus containing media removed and replaced, and incubated overnight. The following day, HFKs were collected and plated onto one 15 cm plate per replicate with 3

µg/mL puromycin. After four days, selection was removed and HFKs were cultured in F media as described above. HFKs were passaged (6 x 106 cells plated at each passage) for 32 days (4 passages).

After each passage, unpassaged cells were collected and genomic DNA was isolated using the QIAamp

Blood Midi kit (Qiagen). Deep sequencing and deconvolution was performed by the Broad Institute using 10 µg of isolated DNA. Read counts were log2 transformed and log fold changes were determined for each perturbation.

Data analysis. The STARS algorithm (Doench et al., 2016) was used to determine ranking of gene targets and statistical significance. STARS scores were calculated for genes with at least two perturbations ranking in the top 10% of perturbations. Hits were analyzed using the Gene Ontology

Consortium and STRING database (Ashburner et al., 2000; Mi et al., 2013; Szklarczyk et al., 2017; The

Gene Ontology, 2017).

RNAi. For siRNA transfections, 1 x 105 (cervical cancer) or 7.5 x 104 (passage 5 HFKs in KSFM) cells were plated onto 24 well dishes one day prior to transfection with 5 pmol of ASXL1 (L-012856-00),

BRD4 (L-004937-00), MLL1 (L-009914-00), KDM6B (L-023013-01), KDM3B (L-020378-01), DNMT1

(L-004605-00), and non-targeting (D-001810-10) ON-TARGET plus siRNA SMARTpools (Dharmacon) using the Lipofectamine RNAiMax reagent (Invitrogen), in triplicate. Three days post transfection, a 10X resazurin solution (Sigma-Aldrich) was added to the wells and plates were incubated for 2-4 hours at

37°C. Fluorescence was measured at 590 nm on a microtiter well plate reader (Biotek).

For shRNA transductions, 5 x 103 (passage 5 HFKs in KSFM) or 4.5 x 103 (cervical cancer) cells were plated onto 96 well dishes one day prior to infection with 2.18 x 108 vp of KDM6B, ASXL1,

MLL1, and BRD4 shRNAs (Broad Institute, Cambridge, MA, listed below) in triplicate in the presence of

4 µg/mL polybrene. Plates were centrifuged at 1000 x g for 2 hours at 37°C and then incubated overnight. Media was changed the following day to contain 3 µg/mL puromycin. Six days (cervical cancer) or two days (HFKs) post infection, a 10X resazurin solution (Sigma-Aldrich) was added to the wells and plates were incubated for 2-4 hours at 37°C. Fluorescence was measured at 590 nm on a microtiter well plate reader (Biotek).

shRNA viruses used for cervical cancer cell lines:

CTL: TRCN0000231782

MLL1: TRCN0000234742, TRCN0000257388, TRCN0000234741, TRCN0000005956,

TRCN0000005954, TRCN0000234743

BRD4: TRCN0000196576, TRCN0000318773, TRCN0000382028, TRCN0000021427,

TRCN0000021426, TRCN0000021425

ASXL1: TRCN0000275379, TRCN0000285357, TRCN0000135296, TRCN0000134690,

TRCN0000379665, TRCN0000275380

KDM6B: TRCN0000367906, TRCN0000236677, TRCN0000359976, TRCN0000360034,

TRCN0000359975

ZRF1: TRCN0000254057, TRCN0000254056, TRCN0000254058

shRNA viruses used for HFKs:

CTL: TRCN0000231782

MLL1 #1: TRCN0000257388

MLL1 #2: TRCN0000234741

BRD4 #1: TRCN0000318773

BRD4 #2: TRCN0000021426

ASXL1 #1: TRCN0000379665

ASXL1 #2: TRCN0000275379

KDM6B #1: TRCN0000367906

KDM6B #2: TRCN0000236677

ZRF1: TRCN0000254057, TRCN0000254056, TRCN0000254058

RT-qPCR. Total RNA was isolated using Quick-RNA kit (Zymo Research) as per manufacturer’s instructions. Isolated RNA (100 ng) was reverse transcribed using TaqMan Reverse Transcription

Reagents (Applied Biosystems/ThermoFisher). Amplification of the cDNA (15 ng) was performed with

SYBR Green (Applied Biosystems) and 0.7 µM final concentration of previously established primer pairs for p16INK4A (Agger et al., 2009) and ZRF1 (Ribeiro et al., 2012) and GAPDH for internal control. Primer pairs are as follows: p16INK4A Forward: 5’GAAGGTCCCTCAGACATCCCC3’ p16INK4A Reverse: 5’CCCTGTAGGACCTTCGGTGAC3’

ZRF1 Forward: 5’CGCTCTGACCTCTGCCTCTA3’

ZRF1 Reverse: 5’CAGAAGCATTTCTGTTTCTCCT3’

GAPDH Forward: 5’GATTCCACCCATGGCAAATTC3’

GAPDH Reverse: 5’TGGGATTTCCATTGATGACAAG3’

Assays were performed in triplicate on the StepOnePlus Real-Time PCR System (Applied Biosystems).

Statistics. Statistical significance was determined using unpaired two-tailed Students t test.

Results

Several epigenetic regulators are important for survival of HPV16 E6/E7 expressing HFKs. Studies performed in our lab have revealed that HPV16 E7 induces epigenetic reprogramming as evidenced by aberrant HOX gene expression (McLaughlin-Drubin et al., 2011). Moreover, E7 expressing cells become

“addicted” to p16INK4A and KDM6B expression as RNAi depletion or a small molecule KDM6A/B

68 inhibitor causes decreased viability in E7 expressing cells while not affecting proliferation of parental cells (McLaughlin-Drubin et al., 2011; McLaughlin-Drubin et al., 2013). Therefore, we hypothesized that other positive regulators of p16INK4A expression were also necessary for survival of HPV16 E7 expressing cells. To identify not only regulators of p16INK4A, but also other epigenetic factors that are important in these reprogrammed cells, we employed an unbiased approach using a loss-of-function viability-based

RNAi screen with a pooled lentiviral shRNA library that targets epigenetic factors in HFKs expressing

HPV16 E6/E7 as cervical cancer lesions express both viral oncoproteins. Utilizing the Broad Institute’s

(Cambridge, MA) epigenetic shRNA library that targets 553 readers, writers, and erasers of histone modifications, we screened two independently derived populations of HFKs, each in quadruplicate, transduced with either control or an HPV16 E6/E7 expression vector. A schematic representation of the screen design is show in Figure 3.1. As infection rates (CTL: 15%, E6/E7: 4.2%) and shRNA representation (CTL: 3.23 x 106, E6/E7: 1.91 x 106) of the second HFK population screened were considered successful as determined by the Broad’s parameters for infection rate and shRNA representation (Infection rate < 65%; shRNA representation >1.05 x 106 for this library), we sent the isolated barcoded genomic DNA from this screen to the Broad Institute for deep sequencing. Our initial approach in designing and executing this screen was to identify factors that selectively affect viability of

E6/E7 HFKs, but not CTL HFKs. However, due to technical challenges resulting from reduced growth of our CTL HFKs unrelated to screening perturbations, we were unable to sequence these cells. Therefore, read counts from the four replicates of E6/E7 HFKs were averaged and fold changes were calculated between E6/E7 HFKs from post infection to the end of the screen (Figure 3.2). Underrepresented shRNA plasmid sequences in these data sets identify epigenetic factors that, when lost, resulted in growth disadvantages (slow growth, senescence, cell death) corresponding to negative fold change values.

Figure 3.1. Schematic representation of screen execution. CTL or HPV16 E6/E7 vector transduced HFKs were infected with the CP0010 pooled epigenetic lentiviral shRNA library (Broad Institute, Cambridge, MA). One day post infection, cells were seeded onto four plates representing four replicates and selection with puromycin began. HFKs were passaged for 32 days (4 total passages) and then genomic DNA was isolated and sent to the Broad Institute for deep sequencing.

Figure 3.2. Sequencing of HPV16 E6/E7 expressing HFKs screened with epigenetic library. Volcano plot of log2 transformed average fold changes of E6/E7 HFKs. Horizontal red lines indicate p-value cutoffs and vertical red lines indicate fold change cutoffs for hits identified through the STARS algorithm. Targets that result in growth disadvantages (senescence, cell death, slow growth) are represented by negative fold changes and are located in the top left defined quadrant. Initial hits selected for validation and positive control KDM6B are indicated.

The STARS algorithm (Doench et al., 2016), which calculates scores (STAR scores) for each perturbation above a defined threshold using the probability mass function of a binomial distribution, was used for gene ranking and p-values were calculated for genes with at least two perturbations in the top

10% of perturbations. The top 30 scoring genes are listed in Table 3.1. STRING and GeneOntology analyses revealed multiple components of the SWItch/Sucrose Non-Fermentable (SWI/SNF) complex and regulators of DNA damage responses were represented in the data set in addition to several components of PRCs. As p16INK4A is a polycomb repressed gene, we were most interested in these targets, specifically additional sex combs like 1 (ASXL1) and KMT2A (known as mixed-lineage leukemia 1 [MLL1]).

ASXL1 binds to and activates BRCA1 associated protein 1 (BAP1) to deubiquitinate histone 2A lysine

119 (H2AK119) (Sahtoe et al., 2016; Scheuermann et al., 2010) and acts as a corepressor through binding and recruitment of lysine specific demethylase 1A (LSD1) (Lee et al., 2010). MLL1 is the histone 3 lysine 4 (H3K4) methyltransferase that activates p16INK4A expression (Kotake et al., 2009). In addition, we also focused on bromodomain-containing protein 4 (BRD4) as it binds to super-enhancer regions facilitating transcription of HPV16 integrated viral oncogenes (Dooley et al., 2016).

ASXL1, MLL1, and BRD4 may be important for survival of HPV16 E6/E7 expressing HFKs. To validate the results from the initial screen, three additional HFK populations were transduced with the two top scoring lentiviral shRNAs for ASXL1, BRD4, MLL1, and KDM6B as a positive control. An alamar blue based cell viability assay was performed following transduction (Figure 3.3A-D). KDM6B was used as a positive control as our group has reported effects on cell viability following KDM6B knockdown

(McLaughlin-Drubin et al., 2011). Great variability in cell viability following MLL1 depletion between

HPV16 E6/E7 expressing and control HFKs was observed among the three populations tested; however, population A was the most sensitive to target depletion. A 10-15% decrease in viability for both shRNAs tested was seen in E6/E7 expressing population A HFKs, while no appreciable effects were seen in populations B or C. BRD4 depletion resulted in greater effects on E6/E7 cell viability, around 30%, in

Table 3.1. List of top 30 epigenetic factors identified as necessary for survival of E6/E7 expressing HFKs. STARS scores were calculated for genes with at least two scoring perturbations in the top 10% of total perturbations. The top 30 factors for E6/E7 expressing HFKs are listed.

STARS Scores of hits in E6/E7 HFKs Gene STARS score DNMT1 5.427748321 SUDS3 5.15888046

KMT2A (MLL1) 2.991755036 SMARCB1 2.913900554 DPF2 2.871684244 PRMT1 2.812742741 SS18 2.695227236

SMC1A 2.66603014

METTL7B 2.548321539 SMN1 2.495875333 MORF4L1 2.393862123 JMJD7 2.278090823 SIN3A 2.220986069

JMJD8 2.096797949

EPC2 2.010014321 SMARCE1 2.000638769 SP140L 1.998523583 UBE2A 1.942898687

TAF3 1.899831412

RSF1 1.85601305 AS3MT 1.855980943 BRD4 1.831212056 RERE 1.806099822 PRDM9 1.769061408

PHC1 1.748371763

KDM4C 1.739538475 NSD1 1.725318935 KAT5 1.690943647 CHD7 1.677639253 ASXL1 1.651748858

Figure 3.3. ASXL1, BRD4, and MLL1 depletion may affect viability of E6/E7 expressing HFKs. ASXL1 (A), BRD4 (B), MLL1 (C), and KDM6B (D) were depleted by two shRNA constructs in three independent populations of HFKs expressing HPV16 E6/E7 or control vectors. Two days post infection cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01.

74 population A, but no effects in populations B and C. In all three populations, ASXL1 depletion affected

E6/E7 viability ranging between 5 and 45%. Reduction of KDM6B in all populations affected

E6/E7expressing cells more than control with decreases in viability between 15-35%. We tested additional hits, PRMT1 and NSD1; however, depletion did not selectively affect viability of E6/E7 expressing cells although NSD1 knockdown in population A resulted in a 30% decrease in viability of

E6/E7 HFKs (Figure A.2). While not highly scoring in our screen, we performed shRNA knockdowns of the polycomb proteins CBX1 and EZH2 and observed no consistent effect on the viability of HPV16

E6/E7 expressing cells (Figure A.2).

E6 and E7 contribute to synthetic lethal phenotype. To determine the primary oncoprotein driving the reduced viability phenotype in E6/E7 expressing HFKs, three populations of HFKs expressing either control, E6, E7, or E6/E7 vectors were transfected with ON-TARGET plus siRNA SMARTpools

(Dharmacon) for each target. Three days post transfection, cell viability was measured through alamar blue (Figure 3.4). Positive control KDM6B knockdown in two of the three populations tested did not affect viability of E7 expressing cells; therefore, only population A was analyzed for all targets. E6 was the primary oncoprotein responsible for the decreases in viability in E6/E7 expressing HFKs following

MLL1 knockdown, whereas E7 may potentially be important for the phenotype in BRD4 depleted E6/E7

HFKs; however, significant decreases in viability were observed in control HFKs with only moderate effects in the E6/E7 HFKs therefore these conclusions require further validation. ASXL1 depletion did not appear to selectively affect E6/E7 expressing HFKs as depletion in control HFKs also resulted in decreased viability. Additional hits, DNMT1 and KDM3B, were also tested and revealed that E6 and E7 both contribute to the effects observed following depletion in E6/E7 expressing HFKs.

ASXL1, MLL1, and BRD4 are necessary for survival of HPV16-positive SiHa and CaSki cervical cancer cell lines. We next sought to determine the effects on survival of ASXL1, MLL1 and BRD4

Figure 3.4. E6 and E7 oncoproteins contribute to loss of viability of ASXL1, BRD4, MLL1, KDM3B, and DNMT1 depleted HFKs. ASXL1, BRD4, MLL1, DNMT1, KDM3B and KDM6B were depleted by transfection with ON-TARGET plus siRNA SMARTpools in one population of HFKs expressing HPV16 E6, E7, E6/E7 or control vectors. Three days post transfection, cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for four independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001.

76 depletion in cervical carcinoma cell lines due to their biological significance. CaSki and SiHa cervical carcinoma lines contain integrated copies of the HPV16 genome and consistently express both E6 and E7.

Using several shRNAs per target, we depleted cells of MLL1, ASXL1, BRD4, and positive control

KDM6B and analyzed cell viability through alamar blue (Figure 3.5). Consistent with previous reports,

KDM6B depletion caused significant loss of cell viability in both CaSki and SiHa cells (McLaughlin-

Drubin et al., 2011; McLaughlin-Drubin et al., 2013). BRD4, ASXL1, and MLL1 knockdown affected the viability of both CaSki and SiHa cells with the greatest effects seen in the CaSki cell line resulting in up to 65% decreases in viability.

Weaker effects were seen in these cells following pooled siRNA transfection (Figure 3.6).

ASXL1 depletion had minimal effects on viability of both cell lines and MLL1 depletion only significantly affected viability of SiHa cells (25 ±3% P=0.0134). BRD4 knockdown consistently affected viability in CaSki and SiHa cells, with decreases of 9±1.6% (P=0.0218) and 17±2% (P=0.0350), respectively. Knockdown of hits DNMT1 and KDM3B only affected survival of CaSki cells with decreases in viability of 16.5±2% (P=0.0052) and 16±0.7% (P=0.0015), respectively. Similar to CaSki and SiHa cell lines, siRNA transfections in the HPV18 positive cervical carcinoma line HeLa resulted in a

14±0.4% (P=0.0442) and a 20±3% (P=0.0251) decrease in viability in BRD4 and DNMT1 depleted cells, respectively. While the sensitivities of cervical carcinoma lines differ, collectively MLL1, BRD4,

DNMT1, and KDM3B depletion significantly impact survival of these lines and may offer some avenues for therapeutics.

ZRF1 is necessary for the survival of E7 expressing cells. The H2AK119 monoubiquitin reader,

ZRF1, positively regulates p16INK4A expression by displacing the repressive PRC1 complex (Ribeiro et al., 2012). Therefore, we hypothesized that ZRF1 expression would be necessary for survival of E7 expressing cells that express high levels of p16INK4A. We transduced SiHa cervical carcinoma cells with three different ZRF1 shRNA constructs and measured cell viability through alamar blue. ZRF1 depletion resulted in significant decreases in viability in two of the three shRNAs investigated (sh56: 9±0.4%

Figure 3.5. ASXL1, BRD4, and MLL1 depletion reduces survival of cervical carcinoma lines. ASXL1, BRD4, MLL1 and KDM6B were depleted by 5-6 shRNA constructs in the HPV16 positive cervical carcinoma cell lines, CaSki and SiHa. Six days post infection cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Figure 3.6. Depletion of epigenetic factors selectively reduces survival of cervical carcinoma lines. ASXL1, BRD4, MLL1, DNMT1, KDM3B and KDM6B were depleted by transfection with ON-TARGET plus siRNA SMARTpools in the HPV16+ cervical carcinoma cell lines, CaSki and SiHa and HPV18+ line HeLa. Three days post transfection cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 3.7. ZRF1 knockdown affects viability of SiHa cervical carcinoma cell line. (A) ZRF1 was depleted by three shRNA constructs in the HPV16 positive cervical carcinoma cell line, SiHa. Three days post infection cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for two independent experiments are shown. (B) Three days post infection, cells were harvested for RNA and RT- qPCR was performed to analyze levels of ZRF1 and p16INK4A. Averages and SEMs for two independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001.

P=0.3947; sh57: 46±1.5% P=0.0333; sh58: 41±0.5% P=0.0414) (Figure 3.7A). Levels of p16INK4A were also significantly reduced following ZRF1 depletion and correlated with the strength of the viability phenotype observed, illustrating the importance for ZRF1 expression for p16INK4A induction (Figure

3.7B). To understand the contribution of E7 to the observed phenotype, we transduced three independent populations of HFKs expressing either HPV16 E7 or control vector with the three shRNA constructs and measured cell viability. Collectively, ZRF1 knockdown significantly impacted cell survival of E7 expressing HFKs over control HFKs in all three populations with up to 50% decreases in viability observed (Figure 3.8).

Discussion

The high-risk HPV E6 and E7 proteins interact with a multitude of cellular proteins, drastically altering host pathways. While beneficial to the virus life cycle and cancer initiation, an unintentional consequence of this reprogramming is the development of vulnerabilities that do not exist in untransformed cells, a concept termed synthetic lethality. We sought to uncover these synthetic lethal interactions using RNAi to identify epigenetic factors that are necessary for the survival of primary cells that express E6 and E7. To our knowledge, a screen of this type has not been performed in primary cells.

We identified several epigenetic factors that are important for the survival of E6/E7 expressing cells that may lend themselves to the development of therapeutics to treat cervical cancer.

The aim of this study was to identify epigenetic regulators that when depleted impact the survival of E6/E7 expressing HFKs, but have little effects on control HFKs. Despite improved culturing conditions, the control HFKs proliferated more slowly with increasing passage number. This growth arrest was unrelated to the screen perturbations and was a result of the limited lifespan characteristic of primary human epithelial cells in culture. As a result, sequencing of the control HFKs at the end of the screen was unreliable and some of the replicates failed to amplify due to low amounts of genomic DNA.

Hence, we could not identify hits that only selectively affected viability of E6/E7 HFKs; however, we were able to identify factors that are necessary for survival of E6/E7 expressing cells in general (Table

Figure 3.8. ZRF1 depletion selectively affects survival of E7 expressing HFKs. ZRF1 was depleted by three shRNA constructs in three independent populations of HFKs expressing HPV16 E7 or control vectors. Three days post infection cell viability was measured through alamar blue. Data is represented as percent decrease in viability and averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

3.1). Analysis of these factors through the cBioPortal for Cancer Genomics, revealed that they are commonly mutated or amplified in cancers, including cervical carcinomas (Cerami et al., 2012; Gao et al.,

2013). Furthermore, low and high-risk E6 proteins have been shown to interact with KAT5, and modulate the activity of PRMT1,while high-risk E7 binds to the DNA methyltransferase DNMT1

(reviewed in (Roman and Munger, 2013; Vande Pol and Klingelhutz, 2013)). STRING and

GeneOntology analysis of the hits revealed that these factors are highly interconnected and several factors grouped into pathways including DNA damage responses (SMARCB1, MORF4L1, SMC1A, BRD4,

KAT5, UBE2A, PRMT1, and EPC2: P-value=7.24 x 10-6) and transcriptional silencing (components of

SIN3 complex SIN3A, SUDS3, MORF4L1) (Ashburner et al., 2000; Mi et al., 2013; Szklarczyk et al.,

2017; The Gene Ontology, 2017). Components of HDAC (MORF4L1, SIN3A, and SUDS3) and BAF-

SWI/SNF complexes (SMARCB1, SMARCE1, and SS18) were also represented in the hit list

(Szklarczyk et al., 2017). As E6/E7 expressing cells have compromised p53 and pRB activities, it was of interest that JMJD8 mutations and METTL7B are mutually exclusive with p53 and pRB mutations, respectively (Cerami et al., 2012; Gao et al., 2013).

HPV16 E7 has been shown to associate with polycomb group proteins (PcGs). E7 can bind to and reduce E2F6 containing polycomb repressive complexes and expression of E7 causes global reductions in repressive H3K27 trimethylation (McLaughlin-Drubin et al., 2011; McLaughlin-Drubin et al., 2008). Expression of E7 triggers upregulation of PRC2 component EZH2 and PcGs, KDM6A and

KDM6B (Hyland et al., 2011; McLaughlin-Drubin et al., 2011). Therefore, we were most interested in targets that were related to polycomb gene activation, and focused on ASXL1 and MLL1 as they are important for H2AK119 deubiquitination and H3K4 trimethylation, respectively (Kotake et al., 2009;

Sahtoe et al., 2016; Scheuermann et al., 2010). While not associated with polycomb repressed genes, we were interested in BRD4 as it is important for the transcription of integrated E6 and E7 oncoproteins, which are necessary for survival of these cells (Dooley et al., 2016). MLL1 rearrangement is the most common alteration in leukemias accounting for greater than 70% of infant and 10% of adult leukemias

(Krivtsov and Armstrong, 2007). BRD4 and ASXL1 are commonly mutated or amplified in cancers.

Specifically in cervical cancers, MLL1 and BRD4 are commonly found to contain missense mutations, and deletions in BRD4 in squamous cell cervical carcinoma have been observed (Cerami et al., 2012; Gao et al., 2013). ASXL1 is found to be amplified in mucosal, squamous cell and endocervical carcinoma with gain of function mutations seen in squamous cell carcinomas (Cerami et al., 2012; Gao et al., 2013).

Results obtained from our initial validation of the hits in primary HFKs were conflicting. While depletion of MLL1, BRD4, and ASXL1 inhibited cell viability selectively in E6/E7 expressing HFKs in one population, the other two populations used illustrated opposing effects, and one population did not respond to the depletion of positive control KDM6B, resulting in difficulty of data interpretation (Figure

3.3). Moreover, effects on viability could not be definitively attributed to either E6 or E7. While the data suggest that E7 and E6 may drive the viability loss in BRD4 and MLL1 depleted HFKs respectively, E7 expressing HFKs were not significantly affected by KDM6B knockdown (Figure 3.4) as previously reported (McLaughlin-Drubin et al., 2013). In addition, E6 and E7 may both contribute to lethality seen in DNMT1 and KDM3B depleted HFKs; however, these effects were only consistently observed in one population of HFKs (Figure 3.4). While variability is inherent in working with primary cells, it is likely that these differences arose through the technical difficulty of the assay. In addition, the validation assays were performed on a shorter timeframe than the original screen and an increase in length of the assay may reduce inconsistencies and reveal more definitive phenotypes.

Although our studies in HFKs are inconsistent, depletion of ASXL1, BRD4, and MLL1 in cervical cancer cell lines yielded strong phenotypes, comparable to decreases in viability in response to

KDM6B depletion (Figure 3.5). As CaSki and SiHa cervical cancer cell lines express both HPV16 E6 and E7, we are confident that these factors are important for survival of E6/E7 expressing cells and are not experimental artifacts. As these cells are clinically relevant, we are most interested in factors that affect the survival of these cells for therapeutic purposes; however, it remains to be elucidated if these factors are indeed synthetically lethal and only impact E6/E7 expressing cells.

We also investigated the H2AK119 monoubiquitin reader, ZRF1, as it is important for p16INK4A transcription following RAS- induced senescence (Ribeiro et al., 2012). Depletion of ZRF1 in SiHa cells

84 had a significant effect on cell viability, up to a 50% reduction (Figure 3.7). As expected, p16INK4A levels were decreased following ZRF1 depletion, implicating the importance of ZRF1 in p16INK4A activation in

E6/E7 expressing cells (Figure 3.7). Expression of E7 contributes to the decrease in viability in ZRF1 depleted cells, as illustrated by our experiments in HFKs expressing E7 or control vectors; however, contributions of E6 cannot be discounted and have yet to be tested (Figure 3.8). Given the significant effects ZRF1 depletion has on viability of E7 and E6/E7 expressing cells, it was surprising that it did not appreciably score in our screen. However, this contradiction illustrates the complexities in epigenetic regulation in various cell types. It is not surprising that the gene expression profiles of cervical cancer cells would differ from primary cells. Furthermore, early passage primary cells would likely have altered gene expression compared to late passage cells; therefore, it is understandable that epigenetic regulation of gene expression would be different in various cell types and that certain factors may be more important in other cell types.

Both MLL1 and ZRF1 are important for expression of p16INK4A following oncogenic insult by

RAS (Kotake et al., 2009; Ribeiro et al., 2012) and their synthetic lethality may be attributed to the loss of p16INK4A expression in E6/E7 expressing cells; however, as it is unclear if depletion of these factors affect normal cells. Given the importance of MLL1 in gene activation, it is plausible that these effects on viability may be p16INK4A-independent and attributed to a general reliance on transcriptional activation.

ASXL1 binds to the deubiquitinase BAP1, which removes repressive H2AK119 monoubiquitination on polycomb repressed genes, creating weak affinity for PRC2 thereby reducing levels of H3K27 trimethylation (Scheuermann et al., 2010). Indeed, we have observed global decreases in H3K27 trimethylation following expression of E7 (McLaughlin-Drubin et al., 2011), and this may suggest that

ASXL1 is important for the epigenetic modulation of these genes and thus survival of these cells. While the role of ASXL1 in p16INK4A activation has not been investigated, it is plausible that the decreases in viability due to ASXL1 loss may be a direct consequence of lack of p16INK4A expression as ASXL1 positively regulates other polycomb repressed genes; however, this will need to be further elucidated.

BRD4 is a reader of acetylated histones and is important for transcription initiation and epigenetic

85 memory; therefore loss of BRD4 expression may be generally lethal. However, BRD4 has been shown to bind super-enhancer elements at integration sites of HPV16 promoting the transcription of E6 and E7

(Dooley et al., 2016). As E6 and E7 depletion impacts survival of cervical cancer cells (Francis et al.,

2000; Goodwin and DiMaio, 2000), it is plausible that lack of BRD4 affects the levels of E6 and E7 needed to maintain the transformed state in these cells.

While not the focus of this study, other targets are of great interest as they have been shown to be important in senescence and polycomb regulation. For example, MORF4L1 is a transcription factor important in cellular senescence and binds methylated H3K36 (Pena and Pereira-Smith, 2007; Zhang et al., 2006) and DNMT1 has been shown to colocalize with PcG BMI1 (Hernandez-Munoz et al., 2005) and is responsible for silencing p16INK4A in KRAS-positive colorectal cancers (Serra et al., 2014).

In conclusion, our study was the first, to our knowledge, to perform an epigenetic screen in primary human keratinocytes. Despite technical problems, we were able to identify and validate four epigenetic factors, ASXL1, BRD4, MLL1, and ZRF1 that are important for the survival of E6/E7 expressing cells; however, further evaluation is necessary to determine if these factors are selectively lethal in E6/E7 expressing cells and whether E6 and/or E7 contribute to the loss of viability phenotype.

In addition, it will be interesting to elucidate the downstream targets of these epigenetic factors to understand the mechanisms for necessity in E6/E7 expressing cells.

CHAPTER FOUR

A variety of HPV-negative carcinoma cell lines are sensitive to inhibition of histone demethylase

KDM6B possibly through a p16INK4A-dependent mechanism

A variety of HPV-negative carcinoma cell lines are sensitive to inhibition of histone demethylase

KDM6B possibly through a p16INK4A-dependent mechanism

Tyshia K. Wellman1 and Karl Munger2

1 Committee on Virology, Harvard Medical School, Boston, Massachusetts, 02115 2 Tufts University

School of Medicine, Boston, Massachusetts, 02111

Contributions: I wrote this manuscript and performed all of the experiments described in it. Karl Munger helped design the research and edited the manuscript.

Abstract

The p16INK4A tumor suppressor is an important block to cancer progression as it activates the retinoblastoma (pRB) tumor suppressor pathway through its inhibition of cyclin dependent kinases

(CDK) 4 and 6, causing cellular senescence. However, several cancers including high-grade serous ovarian, breast, and lung carcinomas proliferate despite high levels of p16INK4A, frequently through a loss or inactivation of pRB. Similarly, high-risk human papillomavirus (HPV) associated cancers have been shown to express high levels of p16INK4A. Interestingly, the p16INK4A protein is necessary for survival of

HPV containing cervical carcinomas. In addition, KDM6B, the H3K27 demethylase important for p16INK4A transcriptional activation, is also required for survival. Therefore, we were interested in determining if these high p16INK4A expressing carcinomas also required KDM6B and/or p16INK4A expression for survival. Depletion of p16INK4A in a p16INK4A highly expressing breast cancer cell line negatively impacted survival. Furthermore, the expression of KDM6B, or related demethylase KDM6A, did not strictly determine the levels of p16INK4A expression in a variety of ovarian, lung, and breast carcinoma cell lines. However, small molecule KDM6B inhibition through the treatment with KDM6B/A inhibitor, GSK-J4, reduced the viability of high-grade serous ovarian and lung carcinoma cell lines to varying degrees, suggesting prognostic value of KDM6B/A inhibition in these carcinomas.

Introduction

The p16INK4A protein is a cyclin dependent kinase (CDK) 4 and 6 inhibitor and activator of the retinoblastoma tumor suppressor (pRB) pathway. Curiously, it is highly expressed in a variety of tumor types and typically a predictor of poor prognosis and treatment response. Basal-like breast cancers are highly metastatic and account for 15% of invasive breast carcinomas (Bryan et al., 2006).

Overexpression of p16INK4A is generally associated with these carcinomas and is linked to poor prognosis and reduced relapse-free survivals (Bohn et al., 2010; Fan et al., 2006; Milde-Langosch et al., 2001;

Sorlie et al., 2001; Sorlie et al., 2003). High p16INK4A expression has been reported in high-grade serous ovarian carcinomas, the most common form of ovarian cancer, and is linked to poor survival (Chiesa-

Vottero et al., 2007; Kommoss et al., 2007). In addition, high p16INK4A expression has been reported in some subsets of lung carcinomas and Merkel cell carcinomas (MCCs) (Andujar et al., 2010; Lassacher et al., 2008). These p16INK4A highly expressing tumors typically have inactive pRB pathways (Herschkowitz et al., 2008). Loss of pRB can induce p16INK4A expression through a negative feedback mechanism through recruitment of polycomb repressive complexes to epigenetically silence p16INK4A (Kotake et al.,

2007).

High-risk human papillomavirus (HPV) associated cancers also express high levels of p16INK4A as a consequence of the E7 oncoprotein (Khleif et al., 1996; Klaes et al., 2001; Sano et al., 1998). In fact,

E7 expressing cells require expression of p16INK4A for survival (McLaughlin-Drubin et al., 2013). The histone 3 lysine 27 (H3K27) demethylase KDM6B positively regulates p16INK4A expression, and our group has demonstrated that E7 expressing cells also require KDM6B expression for survival

(McLaughlin-Drubin et al., 2013). Therefore, we hypothesized that high p16INK4A expressing carcinoma cell lines, including breast, lung, and ovarian, may also be sensitive to p16INK4A/KDM6B depletion. We report that the p16INK4A expressing breast cancer cell line, MDA-MB-468 requires expression of p16INK4A for survival. In addition, we investigated the effects of KDM6B suppression in high-grade serous ovarian and MCC cell lines and observed that KDM6B sensitivity may not necessarily be associated with p16INK4A expression. Finally, as high-risk HPV16 E7 and oncogenic RAS expression trigger epigenetic derepression of p16INK4A through the transcriptional upregulation of KDM6B (Agger et al., 2009;

Barradas et al., 2009; McLaughlin-Drubin et al., 2011), we investigated if levels of KDM6B and p16INK4A correlate in these carcinomas. These experiments revealed that p16INK4A and KDM6B levels do not generally correlate. Nonetheless, this study may suggest that KDM6B inhibition may be efficacious in p16INK4A high carcinomas.

Materials and Methods

Cells. A-549 cells were maintained in F-K12 medium with 10% fetal bovine serum (FBS), 50 U/mL penicillin, and 50 mg/mL streptomycin. DMS 79 cells were maintained in RPMI-1640 medium with 10%

90 heat inactivated FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin. OV-90 cells were maintained in

1:1 mixture of MCDB 105 medium containing a final concentration of 1.5 g/L sodium bicarbonate and

Medium 199 containing a final concentration of 2.2 g/L sodium bicarbonate with 15% FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin. ES-2, SK-OV-3, and SK-BR-3 cells were maintained in Mccoy's

5A (Modified) medium with 10% FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin. MKL-1, UISO,

WaGa, MDA-MB-468, MDA-MB-231, OVCA420, OVCA429, NCI-H82, NCI-H526, and OVCAR-3 were maintained in RPMI 1640 medium with 10% FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin. CaSki (ATCC), OVCAR-5, TOV21G, and Caov-3 were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS, 50 U/mL penicillin, and 50 mg/mL streptomycin.

HOEpiC cells were maintained in OEpiCM medium (SciencCell) with 50 U/mL penicillin and 50 mg/mL streptomycin. Ovarian, lung and breast carcinoma cell lines were generous gifts from James Rocco,

Massachusetts General Hospital, Boston, MA. Merkel cell carcinoma lines were generous gifts from

James DeCaprio, Dana-Farber Cancer Institute, Boston, MA.

RT-qPCR. Total RNA was isolated using RNeasy Midi kit (Qiagen) as per manufacturer’s instructions.

Isolated RNA (100 ng) was reverse transcribed using TaqMan Reverse Transcription Reagents (Applied

Biosystems/ThermoFisher). Amplification of the cDNA (15 ng) was performed with SYBR Green

(Applied Biosystems) and 0.7 µM final concentration of previously established primer pairs for p16INK4A, p14ARF, KDM6A, and KDM6B (Agger et al., 2009). GAPDH was used as an internal control. Assays were performed in triplicate on the StepOnePlus Real-Time PCR System (Applied Biosystems). Primer pairs are as follows: p16INK4A Forward: 5’GAAGGTCCCTCAGACATCCCC3’ p16INK4A Reverse: 5’CCCTGTAGGACCTTCGGTGAC3’ p14ARF Forward: 5’CCCTCGTGCTGATGCTACTG3’ p14ARF Reverse: 5’ACCTGGTCTTCTAGGAAGCGG3’

KDM6A Forward: 5’TTTGTCAATTAGGTCACTTCAACCTC3’

KDM6A Reverse: 5’AAAAAGGCAGCATTCTTCCAGTAGTC3’

KDM6B Forward: 5’GGAGGCCACACGCGTCTAC3’

KDM6B Reverse: 5’GCCAGTATGAAAGTTCCAGAGCTG3’

GAPDH Forward: 5’GATTCCACCCATGGCAAATTC3’

GAPDH Reverse: 5’TGGGATTTCCATTGATGACAAG3’

Western blotting and antibodies. Cell lysates were prepared by incubation in ML buffer (300 mM

NaCl, 0.5% Nonidet P-40 [NP-40], 20 mM Tris-HCl [pH 8.0], 1 mM EDTA) supplemented with one cOmplete EDTA-free Protease Inhibitor Cocktail tab (Roche) per 50 ml lysis buffer. Cells were incubated on ice for 30 min. and then cleared by centrifugation at 16,000 x g for 20 min. at 4°C. Bradford assay (Bio-Rad) was used to determine protein concentration. Samples were incubated at 95°C for 10 min. in sodium dodecyl sulfate (SDS)-containing sample buffer, separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto polyvinylidene difluoride membranes (PVDF)

(Immobilon-P; Millipore) at 25V for 16 hours. Membranes were blocked for 2 hours in 5% nonfat dry milk in TBST buffer (137 mM NaCl, 2.7 mM KCl, 25 mM Tris [pH 7.4], 0.1% Tween 20). Blots were incubated overnight at 4°C with agitation. Primary antibodies used were as follows: pRB (Oncogene

Research AB-5, 1:100), KDM6B (Abgent Ap1022a, 1:200), EZH2 (Sigma Ac22, 1:1000), p15INK4B

(Abcam 53037, 1:1000), p16INK4A (SantaCruz 56330, 1:200), and β-actin (Millipore MAB1501, 1:1000).

Following three washes with TBST, blots were incubated for 2 hours with agitation with secondary anti- mouse IgG and anti-rabbit IgG horseradish peroxidase-conjugated antibodies (Amersham) at 1:10,000 dilutions. Proteins were visualized by enhanced chemiluminescence (Luminata™ Crescendo Western

HRP Substrate; Millipore) and exposed on film.

RNAi. MDA-MB-468 and MDA-MB-231 cells (1 x 104 cells in 96 well dishes) were transfected with

100 ng of the following shRNA constructs for depletion of p16INK4A: pbabe shp16INK4AAB, pbabe shp16INK4ACD, pbabe shp16INK4AEF, or pbabeU6 as a control (Gifts from James Rocco, Massachusetts

General Hospital, Boston, MA) using Fugene 6 (Promega). MDA-MB-468 and MDA-MB-231 cells (1 x

104 cells in 96 well dishes) were transfected with 40 nM of the following ONTARGETplus SMARTpools

(Dharmacon): p14ARF (L-011007-00), p15INK4B (L-003245-00), or ON-TARGETplus NonTargeting Pool

(D-001810-10) using Fugene 6 (Promega). Three days post transduction/transfection, a 10X resazurin solution (Sigma-Aldrich) was added to the wells and plates were incubated for 2-4 hours at 37°C.

Absorbance was measured at 570 and 600 nm on a microtiter well plate reader (Biotek).

GSK-J4 treatment. OVCAR-8, TOV21G, and A-549 (6.4 x 104 cells in 6 well dishes), OVCAR-5 (1 x

106 cells in 6 well dishes), and MKL-1 (1.6 x 105 cells in T25 flasks) were plated and treated with various concentrations of 10 mM stock GSK-J4 (Xcess Biosciences) in DMSO. After three days, a 10X resazurin solution (Sigma-Aldrich) was added to the wells and plates were incubated for 2-4 hours at 37°C.

Absorbance was measured at 570 and 600 nm on a microtiter well plate reader (Biotek).

Statistics. Statistical significance was determined using unpaired two-tailed Students t test.

Results

Expression of p16INK4A is necessary for survival of a p16INK4A expressing breast carcinoma cell line.

Basal-like breast carcinomas express high levels of p16INK4A and low levels of pRB contributing to their aggressive nature (Bohn et al., 2010; Gauthier et al., 2007). We examined two metastatic basal breast adenocarcinoma cell lines, MDA-MB-468 and MDA-MB-231 (Neve et al., 2006) for expression of pRB, p16INK4A, and the related CDK inhibitor p15INK4B. Consistent with the model that carcinomas that express high levels of p16INK4A generally have inactive pRB pathways, we did not detect expression of pRB in the p16INK4A high line MDA-MB-468 (Figure 4.1). High levels of p15INK4B were also detected in this line.

While lacking both p16INK4A and p15INK4B expression as a result of deletion of the CDKN2 locus (Cerami et al., 2012; Gao et al., 2013; Reinhold et al., 2012), the expression of pRB was detected in the MDA-

Figure 4.1. Expression of p16INK4A and pRB are inversely correlated in breast carcinoma cell lines. Western blot analysis of p16INK4A high MDA-MB-468 and p16INK4A deleted MDA-MB-231. Lysates were separated by SDS-PAGE and probed for KDM6B, pRB, EZH2, p15INK4B and p16INK4A. Actin serves as a loading control.

MB-231 line (Figure 4.1). We also examined levels of the polycomb group proteins KDM6B and EZH2 that activate or repress p16INK4A transcription, respectively. MDA-MB-231 cells exhibited higher levels of KDM6B and EZH2 as compared to the p16INK4A high MDA-MB-468 (Figure 4.1).

Cervical cancer cell lines, which express high levels of p16INK4A as a consequence of the expression of the HPV16 E7 oncoprotein, require p16INK4A expression for survival; therefore, we were interested if p16INK4A high expressing MDA-MB-468 cells were sensitive to p16INK4A depletion. We depleted MDA-MB-468p16INK4A Hi and MDA-MB-231p16INK4A Del cells of p16INK4A using three different shRNA constructs. We observed significant decreases in cell viability in MDA-MB-468p16INK4A Hi following p16INK4A knockdown (sh AB: 29.9 ± 1.8%, P<0.0001; sh CD: 34.3 ± 3.6%, P<0.0001; sh EF:

30.4 ± 2.2%, P<0.0001). As expected, p16INK4A depletion had no effect on the survival of MDA-MB-

231p16INK4A Del cells (sh AB: -13.6 ± 2%, P=0.0031; sh CD: -18 ± 3.4%, P=0.0017; sh EF: -18.6 ± 3.4%,

P=0.0012) (Figure 4.2A). Viability was not reduced in either cell line following depletion of the related

CDK inhibitor p15INK4B or tumor suppressor p14ARF, which are transcribed from the same locus (Figure

4.2B).

Expression of p16INK4A in cancer cell lines may predict sensitivity to KDM6B/A inhibition. High levels of p16INK4A expression have been reported for a variety of other cancer types including: non-small cell lung, high-grade serous ovarian, and MCCs (Andujar et al., 2010; Chiesa-Vottero et al., 2007;

Kommoss et al., 2007; Lassacher et al., 2008). Typically, these cancers have dysfunctional pRB pathways (reviewed in (Malumbres and Barbacid, 2001)). The H3K27 demethylase KDM6B derepresses p16INK4A following expression of the HPV16 E7 oncoprotein and is required for the survival of these cells

(McLaughlin-Drubin et al., 2013). Therefore, we were interested if these p16INK4A high expressing cancer cell lines were also sensitive to KDM6B inhibition. We compared the effects on cell viability in p16INK4A high and low/deleted high-grade serous ovarian carcinoma cell lines following KDM6B/A inhibition with the GSK-J4 inhibitor. Levels of p16INK4A expression did not seem to determine sensitivity to GSK-J4 in

Figure 4.2. The p16INK4A high breast carcinoma cell line MDA-MB-468 requires expression of p16INK4A for survival. (A) The p16INK4A high (MDA-MB-468) and p16INK4A deleted (MDA-MB-231) breast carcinoma cell lines were transduced with three shRNA constructs (AB, CD, EF) targeting p16INK4A. Three days post transduction, cell viability was measured through alamar blue assay. (B) MDA-MB-468 and MDA-MB-231 were transfected with siRNAs targeting p14ARF and p15INK4B. Three days post transfection, cell viability was measured through alamar blue. Averages and SEMs for nine independent experiments are shown as percent decrease in viability. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

96 high-grade serous ovarian carcinoma lines as only significant effects were seen between 40 and 60 µM

GSK-J4 between the p16INK4A high expressing OVCAR-8 (40 µM: 67.2 ± 0.5% viable; 60 µM: 33.7 ±

0.3% viable) and the p16INK4A deleted OVCAR-5 (40 µM: 76.3 ± 0.7% viable; 60 µM: 62.9 ± 0.5% viable) (Cerami et al., 2012; Gao et al., 2013; Reinhold et al., 2012) (Figure 4.3A). Degree of p16INK4A expression did not appear to have an impact on GSK-J4 sensitivity as the p16INK4A low expressing

TOV21G cell line closely mirrored effects seen in the p16INK4A high expressing line, OVCAR-8.

Merkel cell carcinoma (MCC) is a rare, but aggressive form of skin cancer frequently associated with clonal integration of the Merkel cell polyomavirus (MCPyV). Like the high-risk HPV E7 protein, the large T antigen of MCPyV binds and inactivates pRB and expression of p16INK4A is commonly observed in MCC tumors (Lassacher et al., 2008). Analysis of p16INK4A and pRB levels in three MCC lines illustrated an inverse correlation of p16INK4A and pRB expression (Figure 4.3B). Treatment of the p16INK4A low expressing Merkel cell polyomavirus (MCPyV) positive MKL-1 cell line with GSK-J4 resulted in a 50% reduction in viability (Figure 4.3C). The viability of the p16INK4A deleted non-small cell

A-549 lung carcinoma line (Cerami et al., 2012; Gao et al., 2013; Reinhold et al., 2012) was impacted following treatment of GSK-J4 with the greatest effects at 100 µM (61.4 ± 1.8% viable, P=0.0033)

(Figure 4.3D).

Levels of p16INK4A are not correlated to KDM6B or KDM6A levels in carcinoma cell lines. Given that p16INK4A induction in cervical cancer cell lines is a result of upregulation of KDM6B (McLaughlin-

Drubin et al., 2011), we were interested if high p16INK4A expression correlates with high KDM6B expression. To this end, we performed RT-qPCR analyses on several ovarian, lung, and breast carcinoma cell lines for levels of p16INK4A and KDM6B as well as the related demethylase KDM6A and tumor suppressor p14ARF. Of the 11 ovarian, 3 lung, and 3 breast carcinoma cell lines analyzed, it was evident that levels of p16INK4A expression did not correlate with levels of KDM6B expression (Figure 4.4A).

Levels of p14ARF displayed similar results as high levels of p14ARF did not correlate with high KDM6B levels (Figure 4.4B). Conversely, levels of p16INK4A and p14ARF did positively correlate in the samples

A B

C D

Figure 4.3. GSK-J4 treatment affects survival of cancer cell lines. p16INK4A high expressing and low/deleted (A) ovarian, (C) Merkel cell, and (D) lung carcinoma cells were treated for 72 hours with the indicated concentration of GSK-J4 and cell viability was measured through alamar blue assay. Averages and SEMs for three independent experiments are shown. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. (B) Western blot analysis of MCPyV containing MCC lines, MKL-1 and WaGa, and MCPyV negative MCC line, UISO. The HPV16 positive cervical carcinoma line, CaSki is shown as positive control. Lysates were separated by SDS-PAGE and probed for pRB and p16INK4A. Actin serves as a loading control.

Figure 4.4. Levels of p16INK4A or p14ARF do not correlate with levels of KDM6B. Various cancer cell lines, including ovarian (blue/purple), breast (pink), and lung (green), were assayed by RT-qPCR for expression of p16INK4A, p14ARF, and KDM6B. The levels of p16INK4A were compared to (A) KDM6B and (C) p14ARF, (B) p14ARF to KDM6B, and (D) KDM6B to KDM6A. The HPV16 positive cervical cancer cell line, CaSki (blue), is shown for reference. Data is plotted as delta Ct to GAPDH and error bars represent the SEM from two independent RNA samples from each cell line.

Figure 4.4. (Continued).

100 analyzed (Figure 4.4C). As deletions of the CDKN2 locus, which contain both p14ARF and p16INK4A, are frequent events in many cancers (reviewed in (Kim and Sharpless, 2006)), this result was unsurprising.

Finally, we analyzed levels of KDM6B and the related demethylase KDM6A in these cell lines and observed similar levels of expression of both demethylases in the cell lines evaluated (Figure 4.4D), which is not surprising as although these two proteins have redundant catalytic functions, they have non- overlapping target gene sets. These data imply that p16INK4A highly expressing cells do not require high levels of KDM6B to activate p16INK4A transcription, possibly suggesting that expression alone is not sufficient, and perhaps KDM6B recruitment or KDM6B-independent mechanisms of p16INK4A induction are more important in these carcinomas. Analysis of p16INK4A expression in KDM6B deleted cell lines would be particularly interesting.

Discussion

The p16INK4A gene is an important tumor suppressor that is frequently mutated or silenced in cancers; however, some cancers continue to proliferate despite high levels of p16INK4A (Chiesa-Vottero et al., 2007; Jarrard et al., 2002; Kommoss et al., 2007) and (reviewed in (Romagosa et al., 2011)). As expression of p16INK4A is induced via the oncogene-induced senescence pathway (Serrano et al., 1993), of which pRB is a downstream effector, these cells typically have dysregulated pRB functions to circumvent senescence (reviewed in (Malumbres and Barbacid, 2001)). Analysis of breast carcinomas through the cBioPortal for Cancer Genomics revealed that breast carcinomas generally fit the canonical deviations observed in the pRB pathway, meaning EZH2 is amplified, p16INK4A is deleted, pRB is deleted or mutated, and CDK4/6 are amplified, resulting in the subversion of senescence by this pathway (Cerami et al., 2012; Gao et al., 2013). Basal-like are a subtype of breast carcinomas that are highly metastatic and have been shown to express high levels of p16INK4A linked to poor prognosis (Bohn et al., 2010). These carcinomas have also been shown to contain loss of heterozygosity of pRB (Herschkowitz et al., 2008).

The MDA-MB-468 and MDA-MB-231 are metastatic breast adenocarcinoma cell lines that are highly tumorigenic (Neve et al., 2006). MDA-MB-468 express high levels of p16INK4A, whereas p16INK4A is not

101 expressed in MDA-MB-231 as a result of a deletion of the CDKN2 locus (Figure 4.1) (Cerami et al.,

2012; Gao et al., 2013; Reinhold et al., 2012). Moreover, expression of p15INK4B, upstream of p16INK4A on the CDKN2 locus, was not detected in MDA-MB-231 cells (Figure 4.1). As anticipated, MDA-MB-468 cells lacked pRB expression, while the p16INK4A deleted MDA-MB-231 line expressed pRB (Figure 4.1), as reported by Robinson et al. (Robinson et al., 2013). The loss of pRB can trigger p16INK4A expression through a feedback loop involving the inability of pRB facilitated recruitment of PRCs to silence p16INK4A

(Kotake et al., 2007); however, the induction of p16INK4A in HPV16 E7 expressing cells is not dependent on the loss of pRB; therefore it would be interesting to determine if p16INK4A induction in MDA-MB-468 cells is independent of pRB loss as well. Intriguingly, the expression of the H3K27 demethylase,

KDM6B, was higher in the p16INK4A deleted line MDA-MB-231 than MDA-MB-468 (Figure 4.1).

Similarly, expression of HPV16 E7 triggers upregulation of KDM6B leading to p16INK4A derepression

(McLaughlin-Drubin et al., 2011), and investigations into whether p16INK4A regulation in these cells is similar to HPV16 E7 expressing cells would be insightful.

Depletion of p16INK4A in the p16INK4A expressing MDA-MB-468 cell line reduced viability, and as predicted, did not have an effect on the p16INK4A-deleted MDA-MB-231 line (Figure 4.2A). Treatment of

HPV16 E7 expressing cells with moieties that reduced CDK4/6 activities (siRNAs, kinase-dead mutants) reverse the effects on cell survival of p16INK4A depleted cells (McLaughlin-Drubin et al., 2013); revealing that in cells that have lost pRB function, through deletion or inhibition, CDK4/6 activity must be suppressed for viability of these cells. It would be interesting to determine if depletion of CDK4/6 in

MDA-MB-468 cells would rescue the effects on viability observed. The CDKN2 locus also encodes the related CDK inhibitor, p15INK4B and tumor suppressor, p14ARF that also trigger cellular senescence in response to oncogenic insults (Kim and Sharpless, 2006). While the p14ARF protein is important for p53- mediated responses to oncogenic stress, p15INK4B is a homologous protein sharing 85% amino acid sequence identity (Kim and Sharpless, 2006). Surprisingly, depletion of p15INK4B in the p16INK4A high expressing MDA-MB-468 cells did not have an effect on cell viability (Figure 4.2B); however, p15INK4B has greater importance as a tumor suppressor when p16INK4A is absent (Krimpenfort et al., 2007). These

102 cells have a loss of function mutation in p53 (Joerger et al., 2005; Nigro et al., 1989), so it is intriguing that p14ARF depletion did not affect cell survival (Figure 4.2B), suggesting that the downstream effectors of p53 do not need to be suppressed for the viability of these cells like is seen for p16INK4A depletion with pRB inactivation. As the entire CDKN2 locus is deleted from MDA-MB-231 cells (Cerami et al., 2012;

Gao et al., 2013; Reinhold et al., 2012), it was unsurprising that depletion of p16INK4A, p14ARF, or p15INK4B did not affect cell viability (Figure 4.2B) as it is obvious that these cells have evolved mechanisms to prevent this dependence. Indeed, it has been shown that p53 harbors a gain of function mutation in these cells, thereby removing the requirement of p14ARF (Cerami et al., 2012; Gao et al., 2013; Neve et al.,

2006).

Preliminary studies with KDM6B/A inhibition through treatment with small molecule inhibitor

GSK-J4, were suggestive of selective inhibition of viability in the p16INK4A expressing MDA-MB-468 line

(Figure A.3). The high levels of p16INK4A in this line likely confer the observed sensitivity to GSK-J4 and may suggest that like E7 expressing cells, KDM6B is necessary for induction of p16INK4A in this cell line.

In addition, GSK-J4 treatment appeared to effect the survival of the p16INK4A-deleted line MDA-MB-231 to an extent. The survival is not dependent on p16INK4A expression, implying that the effect on viability may be mediated through KDM6A targets or other targets of KDM6B. Indeed, KDM6B is more highly expressed in these cells than the p16INK4A high MDA-MB-468 cells (Figure 4.1).

Sensitivity to GSK-J4 treatment in high-grade serous ovarian carcinoma lines did not appear to strongly depend on p16INK4A expression as the p16INK4A-deleted OVCAR-5 line was as sensitive as the p16INK4A expressing lines OVCAR-8 and TOV21G, suggesting that the sensitivity may result from other

KDM6B/A targets (Figure 4.3A). Interestingly, KDM6B/A inhibition in the MCPyV positive MCC line,

MKL-1 did affect survival of these cells; however, p16INK4A expression was not detected in MKL-1 cells

(Figure 4.3B and C). Preliminary studies in the p16INK4A expressing MCC line UISO (MCPyV negative) did not appear to reveal sensitivity to GSK-J4 treatment; however, effects on viability following GSK-J4 treatment in the p16INK4A expressing WaGa line (MCPyV positive) were similar to MKL-1 (Figure A.3).

It is interesting to note that while UISO and MKL-1 cells demonstrate the inverse relationship of p16INK4A

103 and pRB expression, WaGa cells express p16INK4A and have increased pRB levels compared to MKL-1 cells (Figure 4.3B). While further investigation into the effects of p16INK4A expression and GSK-J4 sensitivity in MCC lines is warranted, collectively these data may suggest that p16INK4A expression does not necessarily confer GSK-J4 sensitivity in MCCs and that this sensitivity to KDM6B/A inhibition likely is not mediated through the same mechanisms as HPV16 E7 expressing cells. Finally, the p16INK4A- deleted lung carcinoma line, A-549, was sensitive to GSK-J4 treatment; however, preliminary data in a p16INK4A expressing small cell lung carcinoma line, DMS 79 , suggest a selective sensitivity with an approximately 4 fold decrease in viability over the A-549 cells (Figure A.3). Consistent with our model, pRB is deleted in OVCAR-8 (Lee et al., 2013) and truncated in DMS 79 (Barretina et al., 2012; Cerami et al., 2012; Gao et al., 2013); therefore, this likely confers their sensitivities to KDM6B/A inhibition.

Interestingly, TOV21G has been reported to express pRB (Flak et al., 2010); however, the functionality of pRB in these cells is not known, but given our results, it is likely nonfunctional. In addition, preliminary treatment with a pan jumonji demethylase inhibitor may indicate that these lines are sensitive to additional jumonji demethylase inhibition (Figure A.3).

Finally, our investigation of KDM6B, KDM6A, p16INK4A, and p14ARF levels in these cell lines revealed that expression of KDM6B does not correlate with p16INK4A or p14ARF expression; however, expression of p16INK4A and p14ARF are strongly correlated (Figure 4.4), consistent with reports that the p14ARF and p16INK4A containing CDKN2 locus is frequently deleted in cancers (reviewed in (Kim and

Sharpless, 2006)).

This study revealed that depletion of p16INK4A selectively affected the viability of the p16INK4A expressing breast carcinoma cell line, MDA-MB-468, but not the p16INK4A-deleted line, MDA-MB-231.

This selectivity may be a result of inverse expression patterns of p16INK4A and pRB in these cells, similar to the alterations in the pRB pathway observed in E7 expressing cells. As the MDA-MB-468 cell line lacks pRB, it suggests that the oncogenic alterations in the p16INK4A/pRB pathway may be similar to those induced by HPV16 E7; therefore, it would be interesting to explore the use of KDM6B inhibitors or

CDK4/6 activators as a means to treat these p16INK4A expressing breast carcinomas and other p16INK4A

104 highly expressing carcinomas. Indeed, preliminary treatment of a p16INK4A expressing small cell lung carcinoma line, DMS 79, with a KDM6B/A inhibitor had stronger effects on viability than the p16INK4A- deleted non-small cell lung carcinoma line, A-549 (Figure A.3). However, effects on cell viability of

KDM6B/A inhibition in high-grade serous ovarian lines were not as distinct and further evaluation is required to determine the efficacy of treatment of these lines with KDM6B inhibition. Furthermore, as levels of p16INK4A and KDM6B do not correlate, not all p16INK4A expressing carcinomas may be sensitive to KDM6B inhibition.

105

CHAPTER FIVE

Summary, discussion, and future directions

106

Summary

The high-risk HPV E6 and E7 oncoproteins dramatically reprogram the host cell and alter a variety of cellular signaling pathways during transformation. The greatest consequences are the promotion of cellular proliferation through the degradation of the p53 and pRB tumor suppressors, by the

E6 and E7 proteins, respectively. The E7 protein has been shown by multiple groups to be associated with epigenetic factors and can have dramatic effects on the epigenetic state of genes, in particular the p16INK4A tumor suppressor. While some insight into how E7 epigenetically alters the p16INK4A promoter leading to its transcription have been reported, further details of this complex process have not been investigated. Moreover, E7 expressing cells have been shown to be dependent on the expression of p16INK4A and some epigenetic regulators for survival; however, due to the drastic effects of epigenetic reprogramming as a consequence of E7, it is unclear if E7 expressing cells are dependent on other epigenetic factors for survival. Finally, several carcinomas express high levels of p16INK4A, but investigations into the necessity of p16INK4A for the survival of these carcinomas have not been explored.

It was the aim of the studies in this dissertation to further explore the epigenetic alterations induced by E7 on the p16INK4A promoter leading to its activation, elucidate whether E7 expressing cells require other epigenetic factors for their survival and investigate the role of p16INK4A depletion on the viability of other p16INK4A high carcinomas.

Chapter 2: Alteration of the epigenetic state of tumor suppressor p16INK4A by the human papillomavirus E7 oncoprotein

Previous investigations on the role of E7 expression in the epigenetic activation of p16INK4A have demonstrated that repressive H3K27 trimethylation is reduced and activating H3K4 trimethylation is increased (Kotake et al., 2009; McLaughlin-Drubin et al., 2011). Derepression of p16INK4A during expression of oncogenic RAS has been shown to also involve removal of repressive H2AK119 monoubiquitination (Ribeiro et al., 2012; Sahtoe et al., 2016). We found that following expression of

HPV16 E7 in primary HFKs, the H2AK119 monoubiquityl mark was reduced along with the H3K27

107 trimethyl mark and the H3K4 trimethyl mark was increased. In addition, we reported that increases in the activating H3K27 acetyl mark on the p16INK4A promoter is a consequence of E7 expression. We evaluated the effects of E7 expression on the expression of various negative and positive epigenetic regulators of p16INK4A transcription and our findings revealed that expression of these factors is generally unaffected as a consequence of E7 expression excluding a subset which showed increased expression. However, recruitment of these factors appear to be affected in E7 expressing cells, specifically the activating H3K4 methyltransferase MLL1 and H2AK119 monoubiquityl reader ZRF1, although further studies are required to validate this observation. Paradoxically, we observed increases in recruitment of the H3K27 methyltransferase EZH2 to the p16INK4A promoter following E7 expression, which has been reported by other investigators (Hyland et al., 2011; McLaughlin-Drubin et al., 2011). Therefore, to resolve this discrepancy, we sought to determine if the EZH2 found at the promoter is a component of the canonical repressive PRC2 complex and/or phosphorylated as phosphorylation inhibits its repressive activity and promotes activating functions. Intriguingly, in E7 expressing cells, we observed phosphorylated EZH2 at the p16INK4A promoter; however, the occupancy of PRC2 (as determined by SUZ12 recruitment) was increased. In addition, the H3K27 trimethyl mark was increased although p16INK4A expression was not repressed, implying that the epigenetic regulation of p16INK4A is complex and H3K27 trimethylation may not be sufficient for repression.

Chapter 3: Epigenetic regulators ASXL1, MLL1, BRD4, and ZRF1 are necessary for survival of

HPV16 E6 and E7 expressing cells

HPV16 E7 has been shown to induce epigenetic alterations in host cells. Investigations by several groups have shown that expression of E7 globally decreases H3K27 trimethylation and increases the expression of PcGs KDM6A, KDM6B, and EZH2 (Hyland et al., 2011; Kotake et al., 2009;

McLaughlin-Drubin et al., 2011). In addition, KDM6A/B responsive HOX genes are aberrantly expressed in E7 cells (McLaughlin-Drubin et al., 2011). This reprogramming imparts vulnerabilities in cellular signaling processes, one of which is the necessity of KDM6A/B and p16INK4A expression. In

108 order to determine if additional epigenetic regulators are necessary for the survival of E7 expressing cells, we performed an RNAi screen to identify factors that are required for the survival of primary HFKs expressing HPV16 E7 as well as E6 as both of these proteins are consistently expressed in cervical carcinomas. We discovered a plethora of factors that were required for the survival of E6/E7 expressing

HFKs. Focusing on factors associated with polycomb gene regulation, including MLL1, ASXL1, and

ZRF1, we validated that depletion of these factors in HPV16 E6/E7 expressing cervical carcinoma lines,

CaSki and SiHa reduced viability of these cells. In addition, depletion of BRD4, a transcriptional activator that binds acetylated histones, also negatively affected viability of these cells. Viability of

E6/E7 expressing HFKs was decreased following depletion of ZRF1, MLL1, ASXL1, and BRD4 validating our results from our initial screen. We determined that both oncoproteins contributed to the viability effects observed in ASXL1 depleted HFKs, while it appeared that E6 and E7 contribute to the effects in MLL1 and BRD4 HFKs, respectively.

Chapter 4: Inhibition of histone demethylase KDM6B inhibits survival of a variety of HPV-negative carcinoma cell lines possibly through a p16INK4A-dependent mechanism

Like cervical carcinomas, several cancers including high-grade serous ovarian, basal-like breast, lung and Merkel cell carcinomas, express high levels of p16INK4A, typically through the loss of pRB function; therefore, we hypothesized that these carcinomas contain similar cellular reprogramming that would render them susceptible to p16INK4A depletion like is observed in cervical carcinomas. Comparison of two breast carcinoma lines revealed that MDA-MB-468 cells express high levels of p16INK4A and related p15INK4B, but not pRB. Conversely, MDA-MB-231 cells expressed pRB; however, p16INK4A and p15INK4B were not detected. Depletion of p16INK4A, but not p14ARF or p15INK4B, reduced the viability of the p16INK4A high breast carcinoma cell line, MDA-MB-468, while having little effect on the viability of the p16INK4A deleted line, MDA-MB-231. Treatment with a small molecule inhibitor (GSK-J4) of the p16INK4A activating demethylase KDM6B had similar effects in the two lines. In addition, GSK-J4 treatment may selectively affect viability in some p16INK4A expressing carcinoma cell lines. However, no

109 correlation was observed between the expression of the H3K27 demethylases KDM6B and KDM6A and the expression of p16INK4A in a variety of lung, breast, and ovarian carcinoma cell lines, indicating that

GSK-J4 sensitivity in these lines may not necessarily be p16INK4A dependent.

110

General discussion and future directions

This dissertation aimed to understand how HPV16 E7 alters the epigenetic landscape of cells.

The majority of the work described in this dissertation was performed with primary cells to add to the biological relevance of these data. Therefore, the full appreciation of the work in this dissertation is achieved through the understanding of the large amount of time spent optimizing basic experiments for use in primary cells as working with these cells is quite technically challenging. We chose to perform most of the experiments described in this dissertation in primary HFKs primarily for the ability to investigate the specific contributions of the HPV oncoproteins to the various biological effects that we studied. While experiments performed in cervical carcinoma cell lines are important for determining therapeutic significance, they contain many mutations that could potentially obscure effects caused by the expression of the HPV oncoproteins alone. As mentioned above, HFKs are biologically relevant as they represent a natural host cell being derived from foreskin tissue; however, they grow slowly, are difficult to manipulate, and generally do not perform favorably in most experimental systems. We explored several cancer cell lines to identify ones that would provide more ease in experimentation; however, many cell lines do not express p16INK4A due to deletions or epigenetic silencing through promoter methylation and as experiments involving expression of p16INK4A constituted a majority of the work in this dissertation, it was necessary to use cells lines that could express p16INK4A. We also assessed several cell lines derived from normal human squamous epithelia, but could not identify a suitable line that recapitulated p16INK4A regulation similar to primary HFKs; therefore much time was spent optimizing experimental conditions to gain interpretable data from these cells.

Expression of p16INK4A in response to oncogenic RAS expression has been well studied; however, comparatively little is known about E7-mediated induction of p16INK4A. Previous studies on H3K27 trimethylation following E7 expression have revealed decreased levels of the H3K27 trimethyl mark

(Kotake et al., 2009; McLaughlin-Drubin et al., 2011). One of the most intriguing findings in this dissertation is that E7-induced p16INK4A expression can be activated despite the presence of H3K27 trimethylation. Here we reported, in six independent HFK populations, three expressing E6 and E7 and

111 three with E7 alone, increases in the repressive H3K27 trimethyl mark in these cells as compared to control HFKs. This result is not always consistent as other HFK populations expressing E7 alone, shown in this dissertation and previous experiments (not shown), have decreased H3K27 trimethylation following expression of E7. These results are puzzling as expression of p16INK4A appears to be unaffected by the increased H3K27 trimethylation. Therefore, the data suggest that H3K27 trimethylation is not sufficient to repress p16INK4A transcription and/or removal of the H3K27 trimethyl mark is not necessary for p16INK4A activation. Investigation into the minimal marks required for activation or repression of p16INK4A have not been investigated and would be of great interest to further the understanding of epigenetic regulation of gene expression. Moreover, given that H3K27 trimethylation is increased, as opposed to remaining unchanged, may suggest that the p16INK4A gene is transitioning to a repressed state from an active state. Very little is known about this transition, as p16INK4A expression usually triggers cellular signaling pathways that result in growth arrest and senescence that is permanent. It is unclear how this increase in H3K27 trimethylation as a consequence of E7 expression is induced. Given that this increase is not consistently observed, may imply that alterations in the enzymes that govern the epigenetic state may become altered as a result of cellular signals that may include growth conditions, age of cells, and metabolic state at the time of harvest; however, these hypotheses require further exploration. In addition, it has been reported that E7 expression results in a global reduction of H3K27 trimethylation as determined by immunofluorescence and western blotting. The total levels of the H3K27 trimethyl mark determined by western blotting were increased in the E6/E7 expressing HFKs that had increased H3K27 trimethylation of p16INK4A, indicating a global impact on H3K27 trimethylation. It would be interesting to determine the other gene targets associated with increases in H3K27 trimethylation and their transcriptional state. Moreover, global analysis of H3K4 trimethylation would also be exciting to investigate.

Expression of E7 has been reported to alter expression of several PRC2 components. Levels of

EED and SUZ12 have been shown to remain unchanged in HFKs expressing E6 and E7 (Hyland et al.,

2011). However, our data show conflicting results as SUZ12 transcription and translation are increased

112 following the expression of E7 alone. The effects of the E6 oncoprotein on the epigenetic landscape of cells, specifically p16INK4A, have not been explored and it is plausible that E6 could attenuate the increase in SUZ12 expression caused by E7 as the activities induced by E7 are often counterbalanced by E6.

However, given that these cells also had increases in H3K27 trimethylation, this increase in SUZ12 expression correlates with the alterations in H3K27 trimethylation observed. Counterintuitive with the decreases in H3K27 trimethylation typically observed following E7 expression, EZH2 expression has been reported to be increased as a consequence of E7 expression (Hyland et al., 2011; McLaughlin-

Drubin et al., 2011). Consistent with these reports, we also observed increased expression, both transcriptionally and translationally, in HFK populations expressing E7 over control vectors. Two potential models have been proposed to resolve the contradiction of high EZH2 expression with decreases in the H3K27 trimethyl mark and center around the phosphorylation state of EZH2. The first model suggests that phosphorylation of EZH2 at serine 21 (S21) by AKT does not prevent its interaction with

PRC2 components SUZ12 or EED, but reduces its affinity for H3 substrates (Cha et al., 2005). This is a plausible model as E7 and E6, activate AKT (Menges et al., 2006; Spangle and Munger, 2010); therefore, the increased expression of EZH2 may be inconsequential in E7 expressing cells. The second model proposes that S21 phosphorylation switches EZH2 from a transcriptional repressor to an activator by its dissociation with PRCs and association with androgen receptor containing transcription factor complexes

(Xu et al., 2012). We sought to investigate the effect of E7 expression on the phosphorylation of EZH2.

Levels of phosphorylation at S21 were increased in HFKs expressing E7 over control vectors, suggesting that overexpressed EZH2 is in a phosphorylated state and given the models above may explain p16INK4A expression despite the presence of high levels of EZH2. To distinguish between these two models, we performed ChIP to determine if the EZH2/phosphorylated EZH2 was in a canonical SUZ12 containing

PRC2 complex. Following expression of E7, both EZH2 and phospho(S21) EZH2 were increased on the p16INK4A promoter, although one of the ChIP analyzes of phospho(S21) was weak compared to background. Analysis of SUZ12 occupancy revealed that SUZ12 was not only present on the p16INK4A promoter, but was increased during E7 expression. These data would favor the first model whereby

113 phosphorylated EZH2 associates with PRC2 components, but does not methylate H3. However, H3K27 trimethylation was not reduced in these cells. On the contrary, levels were increased and taken together with the presence of EZH2 and SUZ12 more closely resemble a repressed epigenetic state of p16INK4A.

As mentioned above, it is curious that despite the presence of EZH2, SUZ12, and H3K27 trimethyl marks, p16INK4A transcription is still induced as a consequence of E7 expression. Therefore, we propose a model where H3K27 trimethylation and PRC2 occupancy on the p16INK4A promoter is not sufficient for complete repression of transcription. Indeed, PRC1 occupancy has been reported to be the better determinant of gene repression. Consistent with this, in one population of E7 expressing HFKs (POP A), we observed no change in H3K27 trimethylation (or EZH2/SUZ12 occupancy) and a decrease in

H2AK119 monoubiquitination. However, of the other two populations of E7 expressing HFKs where

H3K27 trimethylation was increased (and EZH2/SUZ12), we only have data for one population that illustrates H2AK119 monoubiquitination was unchanged. It would have been very interesting to determine the H2AK119 monoubiquitination state of the other population to uncover if it was decreased or remained unchanged. Moreover, we observed increases in the activating H3K4 trimethyl mark in these cells, which is consistent with the p16INK4A activation we observed and strengthens the argument that

H3K27 trimethylation is not sufficient for repression. Given these results, we have developed a model where expression of HPV16 E7 or E6/E7 results in the increase of H3K27 trimethylation in some populations of HFKs through an unknown mechanism. In addition, expression of HPV16 E7 or E6/E7 in

HFKs results in the phosphorylation of S21 on EZH2 and increases its recruitment to the p16INK4A promoter along with PRC2 component, SUZ12; however, the presence of the H3K27 trimethyl mark is not sufficient to repress p16INK4A transcription and further repression is required likely through H2AK119 monoubiquitination (Figure 5.1). Clearly, more investigation into the dynamics of H3K27 trimethylation,

H2AK119 monoubiquitination and PRC1/2 occupancy is needed to understand the complexity of the p16INK4A transcription in the presence of PRC2/H3K27 trimethylation. In addition, it would be insightful to explore the effects of AKT inhibitors on the recruitment of EZH2/phospho(S21) EZH2 to the p16INK4A promoter and understand its role in p16INK4A gene transcription.

114

Figure 5.1. Recruitment of S21 phosphorylated EZH2 to the p16INK4A promoter is not sufficient to repress p16INK4A expression. In some populations of HFKs expressing HPV16 E7 (or E6/E7), EZH2 is phosphorylated at serine 21 (S21) and is recruited to the p16INK4A promoter along with PRC2 component, SUZ12. This recruitment corresponds to an increase in H3K27 trimethylation; however, p16INK4A transcription is not repressed, suggesting additional repressive marks are required. The mechanisms that induce these changes only in some populations of HFKs expressing HPV oncoproteins are unknown.

115

While several studies have investigated the roles of PRC1 components on p16INK4A transcription in response to oncogenic RAS expression, little is known about how E7 expression alters PRC1 expression and recruitment. Two groups have reported that E7 expression reduces the levels and recruitment of the PRC1 activator protein, BMI1 to the p16INK4A promoter (Hyland et al., 2011; Kotake et al., 2009). We began to investigate how E7 alters the expression and recruitment of RING1B, which catalyzes the monoubiquitination reaction on H2AK119. Our preliminary data in primary HFKs suggested that E7 expression may not alter levels of RING1B; however, recruitment to the p16INK4A promoter may be reduced (not shown). However, these experiments were not technically vigorous and warrant further repetition to draw definitive conclusions. This dissertation did explore the effects of E7 expression on the levels and recruitment of the H2AK119 monoubiquitin reader, ZRF1. The expression of E7 does not alter the levels of ZRF1 in primary HFKs indicating that increased levels of ZRF1 are not necessary for p16INK4A induction in these cells. Therefore, we investigated ZRF1 recruitment to the p16INK4A promoter following expression of E7 and observed that E7 expression increases the recruitment of ZRF1 in the two HFK populations evaluated. Consistent with its ability to displace PRC1, this increase in recruitment resulted in a decrease in the H2AK119 monoubiquitin mark in one population of

E7 expressing cells. Intriguingly, the population of HFKs with the greater increase in ZRF1 recruitment exhibited a very minimal decrease in the H2AK119 monoubiquitin mark.

Recruitment to the p16INK4A promoter of the trithorax group protein MLL1 has been investigated in the context of both oncogenic RAS and E7 expression. Kotake et al. have demonstrated that recruitment is increased following expression of E7 in WI-38 cells (Kotake et al., 2009). To further their studies, we determined that expression of MLL1, or the MLL1 activator WRD5, is not increased in E7 expressing primary HFKs; however, MLL1 recruitment appears to be increased in these cells. Further corroborating their results, we observed an increase in H3K4 trimethylation in two of the three populations with increased MLL1 recruitment implicating the importance MLL1 in the activation of p16INK4A through the deposition of activating H3K4 trimethylation marks on the promoter. However, both the ZRF1 and MLL1 ChIP signals were low compared to background IgG in some of the populations

116 evaluated; therefore the strength of these data require improvement to decisively implicate ZRF1 and

MLL1 as necessary for activation of p16INK4A in E7 expressing cells. Our group has previously reported an increase in the H3K27 demethylase KDM6B following expression of E7 (McLaughlin-Drubin et al.,

2011); however, we did not observe any changes in transcription in the studies in this dissertation. This lack of increase has also been reported by Hyland et al. and may be due to differences in analysis methods

(Hyland et al., 2011). However, these HFKs exhibited increases in H3K27 trimethylation and it is plausible that this increase in a result of the lack of increase in expression of KDM6B observed in these cells; therefore, it would be interesting to determine the KDM6B occupancy on the p16INK4A promoter in these cells. In addition, it is interesting to note that the H3K4 demethylase, KDM5B, plays a role in cellular senescence (Chicas et al., 2012). Studies in murine cells suggest that KDM5B functions in pRB repressive complexes to repress E2F target genes through demethylation leading to gene silencing during senescence (Nijwening et al., 2011). We did not investigate how HPV16 E7 expression alters KDM5B as p16INK4A has not been demonstrated to be an E2F target gene; however, it would be interesting to determine whether expression of HPV16 E7 reduces KDM5B occupancy on the p16INK4A promoter leading to its activation.

While the effects on H3K27 and H3K4 trimethylation by E7 have been established, this was the first study to determine the effects on H2AK119 monoubiquitination. The expression of E7 results in a decrease of the repressive H2AK119 monoubiquitin mark, similar to observations in cells expressing oncogenic RAS. As mentioned previously, this loss in monoubiquitination may be attributed to the increase in ZRF1 recruitment and subsequent displacement of PRC1 instead of increased ZRF1 expression which is observed in RAS expressing cells (Ribeiro et al., 2012). As the specific deubiquitinase that removes this mark on the p16INK4A promoter has not been clearly defined, it was not investigated in this dissertation. Candidates for this process include USP21 and BAP1 as they have been shown to be responsible for the deubiquitination of other polycomb repressed genes (LaFave et al., 2015;

Nakagawa et al., 2008; Sahtoe et al., 2016; Scheuermann et al., 2010). While we clearly demonstrated

117 that E7 reduces H2AK119 monoubiquitination, further investigations into the mechanism of this decrease including PRC1 occupancy and recruitment of deubiquitinases are required.

In addition to H2AK119 deubiquitination, this was the first study to correlate loss of H3K27 trimethylation with an increase in H3K27 acetylation in E7 expressing cells and link it to active gene transcription of p16INK4A. We further add to the existing model of p16INK4A activation in the presence of

HPV16 E7 by demonstrating that removal of repressive H2AK119 monoubiquitination and deposition of activating H3K4 trimethylation and H3K27 acetylation in primary HFKs renders p16INK4A transcriptionally active (Figure 5.2). Furthermore, we show that alterations in these marks may be mediated through the binding of MLL1 and ZRF1 to the p16INK4A promoter.

The epigenetic regulation of polycomb repressed genes, including p16INK4A, is complex and there is evidence of substantial crosstalk among epigenetic factors and complexes that lead to repression or activation. Many studies have focused on crosstalk of repressive complexes, and little is known about the coordination of complexes leading to p16INK4A activation. Ubiquitination of H2AK119 has been shown to inhibit enzymatic activity of MLL1 and it has been suggested that ZRF1 may aid in the recruitment of

MLL1, KDM6B, and deubiquitinases to the p16INK4A promoter following oncogenic RAS expression

(Endoh et al., 2012; Nakagawa et al., 2008; Ribeiro et al., 2012). We have just begun to explore the crosstalk of the core complexes and epigenetic modifications on the p16INK4A promoter and sought to determine what factors/marks are necessary and are limiting for p16INK4A activation. However, as p16INK4A expression is necessary for the survival of E7 expressing cells, depletion of these activating factors causes reduced cell viability before ChIP analysis can be performed. We were in the early stages of exploring ectopic p16INK4A expression to rescue viability of activating factor depleted cells, in order to perform ChIP analysis. Ubiquitination of H2AK119 also inhibits the activity of H3K36 methyltransferases (Yuan et al., 2013). Trimethylation of H3K36 is considered a mark of active gene expression and has not been investigated for E7-mediated p16INK4A expression. In addition, p16INK4A has been shown to carry repressive H3K9 trimethylation (Li et al., 2010b); however, if E7 expression causes a reduction in this mark on the p16INK4A promoter and what demethylase is responsible has not been

118

Figure 5.2. Expression of HPV16 E7 alters the core histone modifications leading to p16INK4A activation. Previous groups (grayed areas of model) have shown that p16INK4A activation in response to HPV16 E7 expression results from decreased H3K27 trimethylation by KDM6B and increased H3K4 trimethylation by MLL1 in various cell types. We report that p16INK4A activation as a consequence of HPV16 E7 expression also results from decreased H2AK119 monoubiquitination, possibly facilitated by the H2AK1119 monoubiquitin reader ZRF1. In some populations of HFKs, expression of HPV16 E7 results in phosphorylation of EZH2 at serine 21 and its recruitment to the p16INK4A promoter, along with PRC2 component SUZ12, is increased, corresponding to an increase in H3K27 trimethylation, but not p16INK4A repression. In addition, activating H3K4 trimethylation and recruitment of MLL1 are increased in HFKs. Finally, we demonstrated that loss of H3K27 trimethylation is accompanied by gain of H3K27 acetylation on the p16INK4A promoter.

119 studied. It is interesting that KDM3B, a H3K9 demethylase, was shown to be required for survival of

E6/E7 expressing HFKs in our screen that will be discussed at length below. ChIP-sequencing analysis performed by Joseph Costello at UCSF and accessible through the Encyclopedia of DNA elements

(ENCODE) database for the presence of H3K9 trimethyl marks of the p16INK4A promoter revealed that

H3K9 trimethylation spans a 200 bp region around the transcription start site in normal primary HFKs

(GEO:GSM817225 (Consortium, 2012; Sloan et al., 2016)). However, the regions surrounding the transcription start site were fairly devoid of H3K36 trimethylation, a marker of active gene transcription

(GEO:GSM941737 (Consortium, 2012; Sloan et al., 2016)), consistent with silenced p16INK4A expression in normal cells. Finally, the transcription factors ID1 and ETS1/2 are important for the regulation of p16INK4A and were not explored in this dissertation and it is unknown how E7 expression alters these factors and would be worth investigation.

As this project was very focused in its scope of investigating the core epigenetic alterations near the transcription start site of the p16INK4A gene, this work could be expanded to investigate additional histone modifications, such as H3K79 trimethylation, which overlaps with H3K4 trimethylation on active genes, or activating H4K20 methylation which is regulated during the cell cycle and increases during S phase (Black et al., 2012). Histone modifications are not just localized at the transcription start sites. For instance, H3K36 trimethylation is spread across the entire gene peaking at the 3’ end and H3K27 trimethyl marks are propagated throughout the gene to inhibit RNA polymerase II elongation (reviewed in

(Black et al., 2012)). ChIP-sequencing of these marks on the p16INK4A gene to determine their distribution would provide insight into how these marks are propagated and potentially provide mechanisms for how these marks affect transcription initiation and elongation by RNA polymerase II. Likely a more interesting outcome of these types of experiments would be the uncovering of additional genes that are epigenetically altered during E7 expression. As mentioned previously, E7 causes global reductions in

H3K27 trimethylation (McLaughlin-Drubin et al., 2011); however, the gene targets are unknown. As E7 has been shown to associate with factors that regulate histone acetylation, it would be interesting to determine if acetylation/deacetylation of histones is important for the activation of p16INK4A.

120

The role of E6 in the alteration of epigenetic regulations leading to gene activation or repression has largely remained untouched. The majority of the work has focused on the inactivation of p53 through perturbations in acetyltransferases (ADA3, KAT5, p300) caused by interaction with E6 (reviewed in

(Vande Pol and Klingelhutz, 2013)). However, low and high-risk E6 proteins have been shown to interact with the histone methyltransferases CARM1, PRMT1 and SET7, negatively modulating their enzymatic activities (Hsu et al., 2012). Whether E6 modulates specific histone modifications on genes is unknown. Since we observed increases in H3K27 trimethylation on the p16INK4A promoter following the expression of both E6 and E7, it would be interesting to determine if E6 contributes to this effect and uncover the mechanisms by which E6 induces this change in H3K27 trimethylation.

The cellular signals that respond to E7 expression leading to p16INK4A activation are not known.

Although similar to RAS, studies in this dissertation as well as other groups have demonstrated that the signaling events between RAS and E7 are different (Table 5.1), typically in regard to the expression of the epigenetic factors that regulate p16INK4A expression. Specifically, the studies performed in this dissertation have shown that increased expression of ZRF1 or decreased expression of SUZ12 is not important for p16INK4A activation in response to E7 like in oncogenic RAS expressing cells. Therefore, this work has demonstrated that the cell does not respond to all oncogenic stimuli in the exact manner.

The mechanisms by which the cell senses E7 are not clear. Studies using E7 mutants were inconclusive as p16INK4A activation could not be attributed to one particular region of E7 (Margret McLaughlin-Drubin, unpublished). One potential mechanism that we explored was p16INK4A activation due to the replicative stress and DNA damage induced by E7. Induction of these stressors by hydroxyurea has been shown to cause homeotic transformations in Drosophila embryos (Landais et al., 2014). HOX gene expression is dysregulated in cervical carcinomas leading to aberrant expression of several HOX genes (reviewed in

(McLaughlin-Drubin and Munger, 2013)). KDM6B, a regulator of HOX gene expression, also governs p16INK4A expression; therefore, we were interested if we could recapitulate increased p16INK4A expression and KDM6B expression by inducing DNA damage and replication stress in normal HFKs. Treatment of

HFKs with hydroxyurea, induced expression of both KDM6B and p16INK4A in preliminary experiments

121

Table 5.1. Updated review of epigenetic regulation of p16INK4A as a consequence of HPV16 E7 expression. Modulation of the core epigenetic marks associated with p16INK4A expression are shown with the cell type used in the study indicated in parentheses. Expression and recruitment of the associated complexes and proteins are also shown. Question marks (?) denote areas to be explored. Results from this dissertation are indicated in blue.

122

(Figure A.5), arguing that the DNA damage and replication stress caused by E7 may trigger the cell to upregulate KDM6B and consequently p16INK4A for self preservation.

The second aim of this dissertation was to understand how E6 and E7 epigenetically reprogram cells through the identification of epigenetic factors that are essential to survival of E6/E7 expressing primary cells. To this end, we performed an RNAi screen for epigenetic factors that selectively affected survival of HPV16 E6/E7 oncoprotein expressing primary HFKs and not control vector HFKs. The shRNA library consisted of 3476 shRNAs targeting 553 assorted histone modification readers, writers, and erasers as well as chromatin remodelers. Primary HFKs were chosen for this screen in part for their novelty as this is the first of this type of epigenetic cell viability screen to be performed with primary cells. Additionally, primary cells were used to identify factors that, when depleted, selectively affected survival of E6/E7 cells, but not control cells. Several cervical carcinoma cell lines exist; however, there are no adequately matched control cell lines that could be used. Primary cells provided us with a well defined system to study E6/E7 specific effects. However, use of primary cells came with a host of challenges. First, development of a new culturing system amenable to the parameters of the screen was necessary. For this particular type of screen that uses a cell viability readout, cells are grown for either 16 cell doublings or 35 days, and for primary HFKs this equates to about five passages given their slow growth rate in culture. Primary HFKs have a limited lifespan in culture as they begin to undergo cellular senescence as a result of increased p16INK4A expression due to cell culture stress after approximately eight passages. Collection of primary HFKs from neonatal foreskin samples, transduction with the viral oncoproteins, followed by selection takes in excess of 25 days in culture corresponding to two or three passages before the resulting populations can even be expanded to generate the cell numbers needed for screening. Although we were using a relatively small lentiviral shRNA library not requiring large amounts of cells, to obtain the number needed for adequate library representation, cells needed to be expanded for at least two or three additional passages. Therefore, we were required to adopt a different method for sustained growth of these cells in culture. Growing HFKs in the presence of a Rho kinase

(ROCK) inhibitor has been shown to increase the lifespan of these cells through “conditional

123 immortalization” while retaining apparently normal cellular responses and no appearance of DNA crisis

(Chapman et al., 2010). Using this method, which also requires the presence of mitomycin-treated 3T3 J2

“feeder” cells, HFKs were sustained for over 70 days in culture equating to 13 passages without any signs of senescence (Figure A.4). In addition, p16INK4A expression in HFKs cultured with ROCK inhibitor was lower as compared to HFKs cultured without ROCK inhibitor (Figure A.4). With this new culturing system, we performed several optimizations to determine infection conditions to provide efficient infection and adequate shRNA library representation, including determination of cell seed density and amounts of puromycin and virus. In addition, as this new culturing system requires the presence of feeder cells, we performed mock infections to determine how the presence or absence of feeder cells affects infection efficiency. Moreover, puromycin-resistant feeder cells were generated to allow for continued growth of the HFKs during selection, as removal of feeder cells for several days negatively impacted growth of the HFKs.

The screen was performed twice using a pool of two independent HFK populations expressing

HPV16 E6/E7 or control vectors, with a total of four replicates per group. Ideally, we aimed for infection rates between 30 and 50%; however, rates for both screens were lower than anticipated (CTL 1: 0.4%,

E6/E7 1: 4%, CTL 2: 15%, E6/E7 2: 4.2%). More importantly, the shRNA representation for the two screens was borderline acceptable (CTL 1: 7.82 x 104, E6/E7 1: 1.41 x 106, CTL 2: 3.23 x 106, E6/E7 2:

1.91 x 106) and should be at least above 1.05 x 106 for this library. In addition, despite the improved culturing conditions, the proliferation of the control HFKs began to decrease with increased passaging and little genomic DNA (gDNA) was isolated from the last passage of these cells. As the second screen appeared more promising, we sent the isolated gDNA to the Broad Institute for sequencing and analysis.

As expected, the control HFK gDNA sample from the last passage did not amplify well during the PCR determination of shRNA reads. Furthermore, the four replicates from each group (CTL and E6/E7) were not very consistent. Taken together, the success of the screen was sub-optimal; however, with suggestions from the Broad Institute, we analyzed hits that were generally lost from the E6/E7 population, instead of hits that were lost in only the E6/E7 populations, but not control populations. We also

124 analyzed hits that were lost in E6/E7 HFKs, but not control HFKs using the reads from the earliest point after infection; however, we did not put much faith in these hits as the increased likelihood for false positives due to the lack of time needed to enrich for true hits. During our collaboration with the Broad

Institute, we discussed repeating this screen with their epigenetic CRISPR library that they were in the process of developing to validate the hits. While outside of the scope of this dissertation, we did not proceed with a CRISPR based screen; however, the Broad generously provided us with the initial Cas9 viruses to begin optimization in HFKs. A more feasible approach would be to follow-up these results in cervical carcinoma cells and validate in HFKs.

Both E6 and E7 have been reported to interact with epigenetic modifiers and it was interesting that some of the hits uncovered in both data sets have been shown to interact with E6 and/or E7. The top scoring hit from our E6/E7 data set, DNMT1 has been reported to be stimulated through binding of

HPV16 E7 (Burgers et al., 2007). In addition, the binding and stimulation of DNMT1 methyltransferase activity is shared with the adenovirus 5 E1A protein (Burgers et al., 2007). This interaction by E7 has been shown to repress E-cadherin expression to evade immune system detection (Laurson et al., 2010) and E6 upreuglates DNMT1 through a p53-dependent mechanism (Au Yeung et al., 2010). E6 has been reported to modulate the activity of the arginine methyltransferase PRMT1 and bind to the histone acetyltransferase KAT5 and target it for degradation (Hsu et al., 2012; Jha et al., 2010). From our data set of hits that selectively affect survival of E6/E7 HFKs, but not control HFKs, HPV16 E6 has been shown to bind to TADA3, a histone acetyltransferase transcriptional co-activator of p53 that is targeted by E6 for degradation by E6AP blocking p53 mediate transcription through prevention of acetyl stabilization (Hu et al., 2009; Kumar et al., 2002). Both beta and HPV16 E6 proteins and high and low-risk E7 interact with the histone acetyltransferase and transcriptional coactivator p300 impairing its activator functions (Bernat et al., 2003; Howie et al., 2011; White et al., 2012; Zimmermann et al., 1999). Finally, high-risk E7 binds to SMARCA4 blocking its repression of the c-fos promoter (Lee et al., 2002). Detailed discussions of the hits that we further validated (ASXL1, MLL1, BRD4, and ZRF1) are below.

125

Additional sex combs like 1 (ASXL1) is one of three homologues of the Drosophila additional sex combs gene, a polycomb group protein responsible for segment identity and mutations are associated with homeotic transformations. ASXL proteins regulate the recruitment of repressive PRC and activator

TrX complexes to coordinate gene expression. The ASXL1 protein consists of PHD and ASXN domains responsible for binding to DNA or histones. ASXH, ASXM1, and ASXM2 domains are sites for binding partners of ASXL1 including BAP1, LSD1, NCOA1, and nuclear hormone receptors (reviewed in (Katoh,

2013)). Mutations in ASXL1 are associated with acute and chronic myeloid leukemia and

Myelodysplastic syndrome, which is a group of related hematopoietic disorders, and a precursor to the development of AML (Katoh, 2013). ASXL1, along with ASXL3, mutations are frequently observed in patients with Böhring-Opitz syndrome, a disorder characterized by facial and body malformations and intellectual impairment (Hoischen et al., 2011). Colorectal cancer cell lines frequently exhibit ASXL1 mutations, while mutations in a variety of other cancers including castration-resistant prostate, breast, liver, and head and neck carcinomas are infrequent (Grasso et al., 2012; Li et al., 2011; Stephens et al.,

2012; Stransky et al., 2011; Williams et al., 2010). Overexpression due to gene amplification is found in about 5% of cervical carcinomas (Scotto et al., 2008). ASXL1 is a member of the polycomb repressive deubiquitinase complex (PR-DUB) and is important for the activation of BAP1, which deubiquitinates

H2AK119 on polycomb repressed genes (Sahtoe et al., 2016). A possible mechanism for the requirement of ASXL1 expression in the survival of E6/E7 expressing cells may be attributed to the activator function of ASXL1 by relieving PRC1 ubiquitin repression on polycomb repressed genes. Indeed, cervical carcinomas exhibit dysregulated HOX gene expression that could be facilitated through ASXL1 activity

(reviewed in (McLaughlin-Drubin and Munger, 2013)). Additionally, H2AK119 monoubiquitination has been reported to inhibit the activity of MLL1, which deposits activating H3K4 trimethylation (Endoh et al., 2012; Nakagawa et al., 2008). Although not directly implicated in relieving PRC mediated p16INK4A repression, ASXL1 necessity in E6/E7 expressing cells could be dependent on its ability to activate p16INK4A expression through relieving H2AK119 monoubiquitination repression and facilitating MLL1 activity. Furthermore, loss of H2AK119 monoubiquityl marks weakens the interaction of PRC2 on

126 polycomb repressed genes creating a reduction in H3K27 trimethyl levels (Scheuermann et al., 2010).

Previous studies in E7 expressing cells have shown global decreases in H3K27 trimethylation

(McLaughlin-Drubin et al., 2011), possibly implicating ASXL1 mediated H2AK119 derepression on several gene targets in E7 expressing cells (Figure 5.3).

The bromodomain containing 4 (BRD4) protein, first identified as a component of the mediator complex, is a transcriptional activator through binding of acetylated histones and regulation of RNA polymerase II (Dhalluin et al., 1999; Jiang et al., 1998). BRD4 contains two bromodomains which facilitate chromatin binding through the interaction with acetylated lysine on histones. A rare disorder, nut midline carcinoma, is the most notable aberration of BRD4 arising from the translocations of the nuclear protein in testis (NUT) and BRD4 genes. These aggressive thymic carcinomas are resistant to treatment and almost always lethal (French et al., 2003). Missense mutations and amplifications are frequently observed in cancers, while deletions are seen in squamous cell cervical carcinomas as determined through analysis of the cBioPortal for Cancer Genomics (Cerami et al., 2012; Gao et al.,

2013). BRD4, along with mediator and H3K27 acetylation, are commonly found at large clusterings of enhancer elements termed super-enhancers (Pott and Lieb, 2015). Super-enhancer elements drive the transcription of oncogenes during cancer initiation and often results in the necessity of these gene for cell survival (Chapuy et al., 2013; Hnisz et al., 2013; Loven et al., 2013). DNA viruses have utilized BRD4 to promote viral gene transcription and genome maintenance during latency. The Epstein-Barr virus (EBV)

EBNA1 protein interacts with BRD4 to facilitate genome segregation (Lin et al., 2008). EBNA2 proteins promote viral gene transcription as well as cellular genes, such as MYC and BCL2 that drive lymphoblastoid proliferation. EBNA2 and BRD4 localize at super-enhancer sites on these genes to drive transcription (Zhou et al., 2015). The association of the E2 protein of bovine papillomavirus with BRD4 is important for viral genome segregation during mitosis (You et al., 2004). However, the E2 protein of

HPV16 does not depend on BRD4 for genome tethering (McPhillips et al., 2006), but it is important for the transactivation function of E2 and through the blocking of activation by BRD4 of RNA polymerase II in the early viral lifecycle, E2 acts as a transcriptional repressor of the E6 and E7 proteins (McPhillips et

127 al., 2006; Smith et al., 2014; Smith et al., 2010; Yan et al., 2010). The transcriptional activation nature of

BRD4 may contribute to the dependence of its expression in E6/E7 cells, and may be generally lethal to normal cells following depletion. A plausible mechanism for E6/E7 expressing cells dependence on

BRD4 expression may result from BRD4 occupancy of sites of HPV16 integration (Figure 5.3). Loss of

BRD4 has been shown to induce senescence in E6/E7 expressing cells as a result of decreased E6/E7 oncogene expression in a small subset of cell lines, although it is unknown whether this is cell type specific (Dooley et al., 2016). BRD4 inhibitors have shown promise for treatment of cancers, and have been particularly successful in the treatment of c-MYC driven tumors (reviewed in (Shu and Polyak,

2016)). Evaluation of BRD4 inhibitors in cervical carcinomas may be a promising therapeutic as BRD4 inhibition in viral associated carcinomas, such as EBV have been explored (Liang et al., 2016).

Mixed-Lineage Leukemia 1 (MLL1) is the homologue of the Drosophila trithorax protein important in gene activation through methylation of H3K4 and mediates expression of HOX genes. The methyltransferase activity is contained in the C-terminal SET domain and additional domains facilitate protein-protein interactions required for activation or repression of activity and recruitment to target genes in addition to DNA and histone binding (reviewed in (Winters and Bernt, 2017)). Truncating mutations that abrogate the methyltransferase function cause a rare genetic disorder, Wiedemann-Steiner syndrome, characterized by intellectual impairment, short stature, hairy elbows, and facial abnormalities (Jones et al.,

2012). Various leukemias occur as a consequence of genomic rearrangements resulting in MLL1 fusions with up to 80 partners, most common being the AF4, AF9, and ENL proteins generating acute lymphoblastic leukemia (ALL), myeloid leukemias (AML), and lymphoid leukemias (reviewed in

(Winters and Bernt, 2017)). Rearrangement of MLL1 with other gene partners is the most common alteration in leukemias and account for greater than 70% of infant and 10% of adult leukemias (Krivtsov and Armstrong, 2007). Mutations in MLL1 occur infrequently in cervical carcinomas; however, mutations are typically missense and can result in deep deletions (cBioPortal for Cancer Genomics

(Cerami et al., 2012; Gao et al., 2013)). Given its importance in transcriptional activation, MLL1 is targeted by viral proteins to assist in transcription of viral genes during infection. The VP16 protein of

128

Figure 5.3. Proposed models of HPV16 E6/E7 expressing cells dependence on ASXL1, MLL1, BRD4, and ZRF1 for survival. Identification and validation of screen hits ASXL1, MLL1, BRD4, and ZRF1 revealed that E6/E7 expressing cells require their expression for survival. Our results have shown that ZRF1 and MLL1 recruitment may be increased in HPV16 E7 expressing cells and activate p16INK4A transcription through the alterations of H2AK119 monoubiquitination and H3K4 trimethylation, respectively. In addition, H2AK119 deubiquitination by the PR-DUB complex, of which ASXL1 is a component, has been shown to activate other polycomb repressed genes; therefore, it is plausible that derepression of p16INK4A through the removal of H2AK119 monoubiquitination may be mediated by this complex. Although we do not exclude the possibility of other gene targets of these epigenetic modifiers, we hypothesize that necessity of the expression of ZRF1, MLL1, and ASXL1 in HPV16 E6/E7 expressing cells may be p16INK4A-dependent. Additionally, BRD4 has been shown to bind to super-enhancer elements (SE) near sites of HPV16 genome integration and drive the transcription of the integrated viral oncoproteins in some cell lines. Loss of BRD4 may reduce the transcription of these genes leading to cellular senescence in E6/E7 transformed cells.

129 herpes simplex virus-1 recruits a MLL1 containing complex to the immediate early promoter to drive viral transcription (Huang et al., 2006). Like BRD4, the dependence of expression of MLL1 in E6/E7 expressing cells may be a result of its transcriptional activation nature. However, MLL1 positively regulates p16INK4A expression during E7-indcuced OIS (this dissertation and (Kotake et al., 2007)); therefore, the effects on cell viability in E6/E7 expressing cells may be p16INK4A dependent (Figure 5.3).

Indeed, suppression of PCR2 mediated repression of p16INK4A and related p14ARF was attributed to the effectiveness of anti-proliferative and differentiation effects observed in MLL1 fusion leukemias (Danis et al., 2015). Investigation into the effects on cell survival in E6/E7 expressing and non-expressing cells and determination of the dependence of p16INK4A would further clarify the mechanism of MLL1 necessity in E6/E7 expressing cells. A small molecule inhibitor, MM-102, which targets the interaction between

MLL1 and WRD5 has been shown to reduce cell growth and induce apoptosis in MLL1 fusion leukemias

(Karatas et al., 2013) and its efficacy in reducing survival of E6/E7 expressing cervical carcinoma cells would be particularly interesting to evaluate as a potential therapeutic.

Zuotin-Related Factor 1 (ZRF1 also known as DNAJC2 or MPP11) is a member of the M-phase phosphoprotein family and functions as a chaperone through the stimulation of Hsp70 proteins and as an activator of polycomb repressed genes during differentiation and OIS. The ZRF1 protein contains a DNA binding DnaJ domain and an ubiquitin binding motif near the amino terminus (Richly and Di Croce,

2011). The carboxyl terminus contains two SANT domains which facilitate chromatin remodeling

(Richly and Di Croce, 2011). ZRF1 aberrations in cancers are mostly due to amplifications and the upregulation of ZRF1 is very common in some forms of leukemias (Cerami et al., 2012; Gao et al., 2013;

Richly and Di Croce, 2011). Cervical cancers display a low frequency of mutation in ZRF1; however, high copy numbers and expression are found in head and neck cancers although the HPV status of the samples in these studies are unknown (Cerami et al., 2012; Gao et al., 2013; Resto et al., 2000). ZRF1 has been shown to regulate p16INK4A expression during RAS-induced OIS through the binding of the repressive H2AK119 monoubiquitin mark (Ribeiro et al., 2012). This binding displaces the repressive

PRC1 complex that catalyzes H2AK119 monoubiquitination. It has been suggested that ZRF1 may

130 recruit the activating complexes to the p16INK4A promoter including MLL1 and deubiquitinases (Ribeiro et al., 2012). In addition, presence of H2AK119 monoubiquitination inhibits the activity of MLL1

(Nakagawa et al., 2008). Therefore, lack of ZRF1 expression in HPV16 E7 expressing cells is likely p16INK4A dependent. Interestingly, in preliminary experiments, knockdown of ZRF1 also reduced the transcription of KDM6B which derepresses p16INK4A potentially adding another layer of p16INK4A regulation (data not shown). It would be of interest to determine if p16INK4A activation by ZRF1 is the mechanisms by which E7 expressing cells depend through the exploration of ubiquitin binding mutants and/or p16INK4A ectopic expression.

While not the primary focus of this dissertation, the hits DNMT1 and KDM3B were explored.

The DNA methyltransferase, DNMT1, was the top scoring hit from the screen in E6/E7 HFKs and is important for the epigenetic silencing of p16INK4A in KRAS-positive colorectal cancers (Serra et al.,

2014). As the high-risk E7 protein has been shown to bind to DNMT1, it would be of interest to explore whether this interaction contributes to the loss of viability seen with DNMT1 loss in E6/E7 expressing cells. Our experiments in DNMT1 depletion in E6, E7, or E6/E7 expressing HFKs revealed that both oncoproteins may contribute to the loss of viability phenotype; however, due to the variability in the effects among the HFK populations, it is difficult to definitively interpret the data and further investigation is required for all of the hits that we validated to determine the primary oncoprotein that drives the loss in viability. Another interesting hit is the H3K9 demethylase KDM3B as silenced p16INK4A carries H3K9 trimethylation deposited by SUV39H2 (Li et al., 2010b). KDM3B depletion in E6/E7 expressing HFKs and the HPV16 positive cervical carcinoma cell line, CaSki had moderate effects on viability between 15-30%. Although requiring further investigation, it appeared that both E6 and E7 contribute to the observed effects on viability, possibly indicating a p16INK4A-independent mechanism for these effects. These results are consistent with preliminary experiments in the cervical carcinoma cell lines, CaSki and SiHa, where treatment with a pan-selective jumonji demethylase inhibitor (JIB-04) that targets KDM3B along with other H3K9, H3K4, and H3K27 demethylases reduced survival of these cells

131 to greater extents (Figure A.3). Preliminary treatment of other carcinoma cell lines that express p16INK4A also caused a reduction in viability (Figure A.3).

The function of enzymes that regulate histone modifications are largely impacted by the presence of metabolites. Enzymes that catalyze DNA and histone methylation require S-adenosylmethionine, while histone acetylation, deacetylation, and ubiquitination reactions require Acetyl-CoA, NAD+, and

ATP, respectively (Chiacchiera et al., 2013). Histone demethylases have been categorized into two groups determined by their cofactor usage. The FAD-dependent amine oxidase group of demethylases

(KDM1 and LSD1 families), require oxygen and FAD to demethylate lysine residues generating formaldehyde and hydrogen peroxide as byproducts (Chiacchiera et al., 2013). The second class of demethylases, containing the Jumonji C domain (JMJD), forms the largest group of demethylases and utilizes oxygen, Fe(II), and α-ketoglutarate producing succinate, formaldehyde and CO2 as byproducts

(Chiacchiera et al., 2013). Availability of these cofactors greatly influences the activity of these histone modifying enzymes. For instance, reduction of the availability of molecular oxygen, possibly through hypoxic conditions, and α-ketoglutarate through the modulation of the TCA cycle, globally impacts the enzymatic activities of the JMJD family of demethylases (Chiacchiera et al., 2013). Detailed study on the effects of E6 and E7 expression on the metabolic landscape would provide potential mechanisms for how these oncoproteins modulate the activities of these epigenetic enzymes. Given the extensive alterations

E6 and E7 have on host pathways, there is no doubt that they would have effects on the intracellular metabolic pools.

As a fraction of HPV-negative carcinomas, like high-grade serous ovarian, lung, and basal-like breast carcinomas express high levels of p16INK4A, we were interested in determining if these carcinomas also require p16INK4A for survival. Basal-like breast carcinomas are highly metastatic and overexpression of p16INK4A is linked to poor prognosis and survival (Bohn et al., 2010; Meseure et al., 2016; Milde-

Langosch et al., 2001). Our analysis of two breast carcinoma cell lines revealed an inverse relationship between p16INK4A expression and levels of the downstream effector, pRB. The MDA-MB-468 line expressed high levels of p16INK4A and also the related INK family member p15INK4B, but lacked detectable

132 pRB. Conversely, the MDA-MB-231 cell line expressed pRB, but lacked p16INK4A and p15INK4B.

Furthermore, like HPV16 E7 expressing cells, the p16INK4A expressing MDA-MB-468 line required p16INK4A expression for survival, while p16INK4A depletion in MDA-MB-231 cells did not affect viability.

Moreover, both cell lines were not sensitive to depletion of p15INK4B or the p14ARF tumor suppressor, which is transcribed from the same locus, but activates the p53 pathway. The genetic makeup of these cells both corroborates our results and provides explanations for the observed phenotypes. MDA-MB-

468 cells have also been reported to lack pRB (Robinson et al., 2013) and the entire CDKN2 locus, which encodes p14ARF, p15INK4B, and p16INK4A, is deleted in MDA-MB-231 cells (Cerami et al., 2012; Gao et al.,

2013; Reinhold et al., 2012). It follows that MDA-MB-231 cells would not require expression of p16INK4A, p15INK4B, or p14ARF for survival as they have adapted mechanisms to prevent this dependence; moreover, it has been reported that these cells harbor a gain of function mutation in p53, the downstream effector of p14ARF activation (Cerami et al., 2012; Gao et al., 2013; Neve et al., 2006). Our group has observed that treatment of HPV16 E7 expressing cells, which lack functional pRB, with either siRNAs or kinase-dead CDK4/6 mutants can reverse the effects on cell survival in p16INK4A-depleted cells

(McLaughlin-Drubin et al., 2013). Our group has proposed the model that in cells that have lost pRB function, CDK4/6 activity needs to be suppressed for these cells to remain viable likely mediated through additional substrates of CDK4/6 and that continued expression of p16INK4A is required to maintain these substrates in an unphosphorylated form. Interesting candidates include FOXM1 and SMAD3 as these proteins have been shown to be relevant in senescence responses (Anders et al., 2011). Investigation into the CDK4/6 status of the p16INK4A expressing and pRB lacking MDA-MB-468 cell line, revealed that these cells do not harbor any mutations in CDK4/6 (cBioPortal for Cancer Genomics (Cerami et al., 2012;

Gao et al., 2013)), and is consistent with our proposed model that in cells that lack pRB function, suppression of CDK4/6, through high p16INK4A expression, allows cells to remain viable and p16INK4A inhibition can overcome this viability. Consequently, analysis of MDA-MB-231 cells, which express pRB, CDK6 is not found to be deleted or mutated (cBioPortal for Cancer Genomics (Cerami et al., 2012;

Gao et al., 2013)). Therefore, one would predict that exogenous expression of CDK4/6 mutants that

133 cannot be targeted by p16INK4A in MDA-MB-468 cells would reduce their survival and that reduction of

CDK4/6 activity, through siRNAs, kinase-dead mutants, or the use of CDK4/6 inhibitors in MDA-MB-

231 cells would also have a negative effect on cell viability and would be interesting investigations to pursue.

Our analysis of KDM6B inhibition in various carcinoma lines revealed that p16INK4A expressing cell lines may be more sensitive to KDM6B inhibition by the KDM6B/A small molecule inhibitor, GSK-

J4. Treatment of the p16INK4A expressing breast line, MDA-MB-468 resulted in a decrease in cell viability and preliminary experiments in the p16INK4A-deleted line MDA-MB-231 indicate that they are not as sensitive to GSK-J4 treatment. However, MDA-MB-231 cells did exhibit some degree of decreased cell viability following GSK-J4 treatment (Figure A.3). As p16INK4A is deleted in these lines, this sensitivity to GSK-J4 is not p16INK4A dependent and may be mediated through KDM6A regulated genes, or other KDM6B targets. In fact, KDM6B expression was higher in these cells than the p16INK4A expressing MDA-MB-468 cell line. Like the breast carcinoma cell lines, lung carcinoma lines appeared to display selective sensitivity to KDM6B inhibition. Treatment of the p16INK4A-deleted non-small cell line, A-549 with GSK-J4 did not impact cell viability to the extent that preliminary treatment of p16INK4A expressing small cell line DMS 79 (Figure A.3). Although the data is preliminary and requires further validation, it suggests that lung carcinoma lines with high p16INK4A expression may be more sensitive to

GSK-J4 treatment. Results of GSK-J4 treatment in ovarian carcinoma lines were less clear. While GSK-

J4 treatment decreased cell viability in a highly p16INK4A expressing line, OVCAR-8, survival of a p16INK4A-deleted ovarian line, OVCAR-5, was also affected with the greatest effects seen at higher concentrations of GSK-J4. The degree of p16INK4A expression did not appear to determine sensitivity to

GSK-J4 as TOV21G cells with low p16INK4A expression were still sensitive to GSK-J4 treatment.

Collectively, these data suggest that sensitivity to GSK-J4 may result from other KDM6B/A targets.

Like HPV, Merkel cell polyomavirus (MCPyV) is a DNA virus that is found in a vast majority of an aggressive and rare skin cancer, Merkel cell carcinoma (MCC). The large T antigen of MCPyV binds and inactivates pRB and in a study of MCC tumor samples by Lassacher et al. revealed that over 95% of

134 the MCC tumors were associated with expression of p16INK4A (Lassacher et al., 2008). Therefore, we were interested if MCC cells were also sensitive to GSK-J4 treatment, like HPV16 E7 expressing cells.

Analysis of three MCC lines (UISO [MCPyV negative], WaGa [MCPyV positive], and MKL-1 [MCPyV positive]) for the expression of p16INK4A and pRB did not show any correlation among MCPyV presence, p16INK4A expression, or pRB expression. The MCPyV negative MCC line UISO expressed p16INK4A, but also low levels of pRB. The MCPyV positive MCC line WaGa also expressed p16INK4A and higher levels of pRB than UISO. Conversely, levels of p16INK4A were not detected in the MCPyV positive line MKL-1, but pRB was expressed. Treatment of MKL-1 cells with GSK-J4 reduced cell viability; however, preliminary experiments in UISO and WaGa cells appeared to show that sensitivity to GSK-J4 may not be dependent on p16INK4A expression, but rather presence of MCPyV as both MKL-1 and WaGa cells were more sensitive than UISO cells (Figure A.3).

It is clear from our results that KDM6B/A inhibition may have the potential as a therapeutic for the treatment of certain forms of lung, ovarian, breast, and MCC carcinomas. GSK-J4 has been investigated for the treatment of multiple myeloma and T-cell acute lymphoblastic leukemia (Benyoucef et al., 2016; Gkotzamanidou et al., 2013). In addition, EZH2 is overexpressed in some ovarian, breast, non-small cell lung and MCC carcinomas and is linked with aggressiveness and poor prognosis ((Harms et al., 2017) and reviewed in (Kim and Roberts, 2016)). The exploration of EZH2 inhibitors in a subset of these carcinomas as combination therapies has shown promise (Fillmore et al., 2015; Shen et al., 2013;

Takashina et al., 2016; Tan et al., 2007). Interestingly, EZH2 is also overexpressed in cervical carcinomas and depletion causes G1 arrest and apoptosis (McLaughlin-Drubin and Munger, 2013).

Despite the high levels of EZH2, H3K27 trimethylation is globally reduced and the relationship between

EZH2 and H3K27 trimethylation would be interesting to investigate in these carcinoma cell lines that express high levels of p16INK4A.

Although KDM6B is induced in HPV16 E7 expressing cells and is important for the derepression of p16INK4A (McLaughlin-Drubin et al., 2011), HPV negative carcinoma cell lines with high p16INK4A expression did not have high levels of KDM6B, indicating that recruitment, more than expression, of

135

KDM6B is more important to p16INK4A activation. However, this lack of correlation between p16INK4A and KDM6B levels could potentially suggest that derepression by KDM6B is not critical for p16INK4A activation in these carcinomas. Indeed, our data in HPV16 E7 expressing HFKs suggests that loss of

H3K27 trimethylation is not required for p16INK4A expression. It would be interesting to determine the levels of H3K27 trimethylation and KDM6B recruitment to the p16INK4A promoter in these cells. In addition, the levels of KDM6B and related H3K27 demethylase, KDM6A, did not correlate. This was not entirely surprising as even though they have redundant catalytic functions, they have non-overlapping target gene sets. Collectively, these data indicate that p16INK4A expression is not a predictor of KDM6B expression and may explain why p16INK4A expression did not necessarily confer GSK-J4 sensitivity in the carcinoma lines evaluated.

In conclusion, our data in HPV negative p16INK4A expressing carcinoma cell lines revealed that these carcinomas share similarities with HPV associated carcinomas, with pRB inactivations and p16INK4A/KDM6B necessity. Therefore, it would be interesting to expand our investigations of the hits from our epigenetic screen to these p16INK4A expressing carcinomas, specifically, the targets that may be p16INK4A dependent. Indeed, BRD4 inhibition with the JQ1 inhibitor induced G1 arrest, senescence, and apoptosis in triple-negative breast cancers, which have upregulated BRD4 expression (Shu and Polyak,

2016). Evaluation of the effects on cell viability following depletion of hits identified from our screen in

HPV16 E6/E7 HFKs may provide potential therapeutic avenues for these p16INK4A expressing HPV negative carcinomas.

136

Abban, C.Y., Bradbury, N.A., and Meneses, P.I. (2008). HPV16 and BPV1 infection can be blocked by the dynamin inhibitor dynasore. Am J Ther 15, 304-311.

Agelli, M., and Clegg, L.X. (2003). Epidemiology of primary Merkel cell carcinoma in the United States. J Am Acad Dermatol 49, 832-841.

Agger, K., Cloos, P.A., Rudkjaer, L., Williams, K., Andersen, G., Christensen, J., and Helin, K. (2009). The H3K27me3 demethylase JMJD3 contributes to the activation of the INK4A-ARF locus in response to oncogene- and stress-induced senescence. Genes Dev 23, 1171-1176.

Ali, H., Donovan, B., Wand, H., Read, T.R., Regan, D.G., Grulich, A.E., Fairley, C.K., and Guy, R.J. (2013). Genital warts in young Australians five years into national human papillomavirus vaccination programme: national surveillance data. BMJ 346, f2032.

Anders, L., Ke, N., Hydbring, P., Choi, Y.J., Widlund, H.R., Chick, J.M., Zhai, H., Vidal, M., Gygi, S.P., Braun, P., et al. (2011). A systematic screen for CDK4/6 substrates links FOXM1 phosphorylation to senescence suppression in cancer cells. Cancer Cell 20, 620-634.

Andujar, P., Wang, J., Descatha, A., Galateau-Salle, F., Abd-Alsamad, I., Billon-Galland, M.A., Blons, H., Clin, B., Danel, C., Housset, B., et al. (2010). p16INK4A inactivation mechanisms in non- small-cell lung cancer patients occupationally exposed to asbestos. Lung Cancer 67, 23-30.

Ansari, K., Kasiri, S., and Mandal, S. (2012). Histone methylase MLL1 has critical roles in tumor growth and angiogenesis and its knockdown suppresses tumor growth in vivo. Oncogene.

Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., Davis, A.P., Dolinski, K., Dwight, S.S., Eppig, J.T., et al. (2000). Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-29.

Au Yeung, C.L., Tsang, W.P., Tsang, T.Y., Co, N.N., Yau, P.L., and Kwok, T.T. (2010). HPV-16 E6 upregulation of DNMT1 through repression of tumor suppressor p53. Oncol Rep 24, 1599-1604.

Avvakumov, N., Torchia, J., and Mymryk, J. (2003). Interaction of the HPV E7 proteins with the pCAF acetyltransferase. Oncogene 22, 3833-3841.

Bachmann, I.M., Halvorsen, O.J., Collett, K., Stefansson, I.M., Straume, O., Haukaas, S.A., Salvesen, H.B., Otte, A.P., and Akslen, L.A. (2006). EZH2 expression is associated with high proliferation rate and aggressive tumor subgroups in cutaneous melanoma and cancers of the endometrium, prostate, and breast. J Clin Oncol 24, 268-273.

Bandyopadhyay, D., and Medrano, E.E. (2003). The emerging role of epigenetics in cellular and organismal aging. Exp Gerontol 38, 1299-1307.

Barradas, M., Anderton, E., Acosta, J.C., Li, S., Banito, A., Rodriguez-Niedenfuhr, M., Maertens, G., Banck, M., Zhou, M.M., Walsh, M.J., et al. (2009). Histone demethylase JMJD3 contributes to epigenetic control of INK4a/ARF by oncogenic RAS. Genes Dev 23, 1177-1182.

Barretina, J., Caponigro, G., Stransky, N., Venkatesan, K., Margolin, A.A., Kim, S., Wilson, C.J., Lehar, J., Kryukov, G.V., Sonkin, D., et al. (2012). The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-607.

137

Benyoucef, A., Palii, C.G., Wang, C., Porter, C.J., Chu, A., Dai, F., Tremblay, V., Rakopoulos, P., Singh, K., Huang, S., et al. (2016). UTX inhibition as selective epigenetic therapy against TAL1-driven T-cell acute lymphoblastic leukemia. Genes Dev 30, 508-521.

Bernard, B.A., Bailly, C., Lenoir, M.C., Darmon, M., Thierry, F., and Yaniv, M. (1989). The human papillomavirus type 18 (HPV18) E2 gene product is a repressor of the HPV18 regulatory region in human keratinocytes. Journal of virology 63, 4317-4324.

Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., zur Hausen, H., and de Villiers, E.M. (2010). Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401, 70-79.

Bernat, A., Avvakumov, N., Mymryk, J., and Banks, L. (2003). Interaction between the HPV E7 oncoprotein and the transcriptional coactivator p300. Oncogene 22, 7871-7881.

Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.

Bian, C., Xu, C., Ruan, J., Lee, K.K., Burke, T.L., Tempel, W., Barsyte, D., Li, J., Wu, M., Zhou, B.O., et al. (2011). Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation. The EMBO journal 30, 2829-2842.

Bieda, M., Xu, X., Singer, M.A., Green, R., and Farnham, P.J. (2006). Unbiased location analysis of E2F1-binding sites suggests a widespread role for E2F1 in the human genome. Genome Res 16, 595-605.

Bienkowska-Haba, M., Patel, H.D., and Sapp, M. (2009). Target cell cyclophilins facilitate human papillomavirus type 16 infection. PLoS pathogens 5, e1000524.

Bitler, B.G., Aird, K.M., Garipov, A., Li, H., Amatangelo, M., Kossenkov, A.V., Schultz, D.C., Liu, Q., Shih Ie, M., Conejo-Garcia, J.R., et al. (2015). Synthetic lethality by targeting EZH2 methyltransferase activity in ARID1A-mutated cancers. Nature medicine 21, 231-238.

Black, J.C., Van Rechem, C., and Whetstine, J.R. (2012). Histone lysine methylation dynamics: establishment, regulation, and biological impact. Mol Cell 48, 491-507.

Bodily, J., and Laimins, L.A. (2011). Persistence of human papillomavirus infection: keys to malignant progression. Trends Microbiol 19, 33-39.

Bohn, O.L., Fuertes-Camilo, M., Navarro, L., Saldivar, J., and Sanchez-Sosa, S. (2010). p16INK4a expression in basal-like breast carcinoma. Int J Clin Exp Pathol 3, 600-607.

Bose, S., Evans, H., Lantzy, L., Scharre, K., and Youssef, E. (2005). p16(INK4A) is a surrogate biomarker for a subset of human papilloma virus-associated dysplasias of the uterine cervix as determined on the Pap smear. Diagn Cytopathol 32, 21-24.

Boyer, S.N., Wazer, D.E., and Band, V. (1996). E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway. Cancer Res 56, 4620-4624.

138

Bracken, A.P., Kleine-Kohlbrecher, D., Dietrich, N., Pasini, D., Gargiulo, G., Beekman, C., Theilgaard- Monch, K., Minucci, S., Porse, B.T., Marine, J.C., et al. (2007). The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells. Genes Dev 21, 525-530.

Bracken, A.P., Pasini, D., Capra, M., Prosperini, E., Colli, E., and Helin, K. (2003). EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. The EMBO journal 22, 5323-5335.

Bray, F., Ren, J.S., Masuyer, E., and Ferlay, J. (2013). Estimates of global cancer prevalence for 27 sites in the adult population in 2008. International journal of cancer Journal international du cancer 132, 1133-1145.

Brehm, A., Miska, E.A., McCance, D.J., Reid, J.L., Bannister, A.J., and Kouzarides, T. (1998). Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597-601.

Brehm, A., Nielsen, S.J., Miska, E.A., McCance, D.J., Reid, J.L., Bannister, A.J., and Kouzarides, T. (1999). The E7 oncoprotein associates with Mi2 and histone deacetylase activity to promote cell growth. The EMBO journal 18, 2449-2458.

Bringold, F., and Serrano, M. (2000). Tumor suppressors and oncogenes in cellular senescence. Exp Gerontol 35, 317-329.

Broniarczyk, J., Massimi, P., Bergant, M., and Banks, L. (2015). Human Papillomavirus Infectious Entry and Trafficking Is a Rapid Process. Journal of virology 89, 8727-8732.

Brotherton, J.M., Fridman, M., May, C.L., Chappell, G., Saville, A.M., and Gertig, D.M. (2011). Early effect of the HPV vaccination programme on cervical abnormalities in Victoria, Australia: an ecological study. Lancet 377, 2085-2092.

Bryan, B.B., Schnitt, S.J., and Collins, L.C. (2006). Ductal carcinoma in situ with basal-like phenotype: a possible precursor to invasive basal-like breast cancer. Mod Pathol 19, 617-621.

Bryant, H.E., Schultz, N., Thomas, H.D., Parker, K.M., Flower, D., Lopez, E., Kyle, S., Meuth, M., Curtin, N.J., and Helleday, T. (2005). Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913-917.

Buck, C.B., Thompson, C.D., Pang, Y.Y., Lowy, D.R., and Schiller, J.T. (2005). Maturation of papillomavirus capsids. Journal of virology 79, 2839-2846.

Burgers, W.A., Blanchon, L., Pradhan, S., de Launoit, Y., Kouzarides, T., and Fuks, F. (2007). Viral oncoproteins target the DNA methyltransferases. Oncogene 26, 1650-1655.

Campisi, J. (2005). Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell 120, 513-522.

Campisi, J., and d'Adda di Fagagna, F. (2007). Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol 8, 729-740.

139

Cerami, E., Gao, J., Dogrusoz, U., Gross, B.E., Sumer, S.O., Aksoy, B.A., Jacobsen, A., Byrne, C.J., Heuer, M.L., Larsson, E., et al. (2012). The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov 2, 401-404.

Cha, T.L., Zhou, B.P., Xia, W., Wu, Y., Yang, C.C., Chen, C.T., Ping, B., Otte, A.P., and Hung, M.C. (2005). Akt-mediated phosphorylation of EZH2 suppresses methylation of lysine 27 in histone H3. Science 310, 306-310.

Chapman, S., Liu, X., Meyers, C., Schlegel, R., and McBride, A.A. (2010). Human keratinocytes are efficiently immortalized by a Rho kinase inhibitor. The Journal of clinical investigation 120, 2619-2626.

Chapuy, B., McKeown, M.R., Lin, C.Y., Monti, S., Roemer, M.G., Qi, J., Rahl, P.B., Sun, H.H., Yeda, K.T., Doench, J.G., et al. (2013). Discovery and characterization of super-enhancer-associated dependencies in diffuse large B cell lymphoma. Cancer Cell 24, 777-790.

Chen, L.S., Wei, J.B., Zhou, Y.C., Zhang, S., Liang, J.L., Cao, Y.F., Tang, Z.J., Zhang, X.L., and Gao, F. (2005a). Genetic alterations and expression of inhibitor of growth 1 in human sporadic colorectal cancer. World J Gastroenterol 11, 6120-6124.

Chen, Z., Trotman, L.C., Shaffer, D., Lin, H.K., Dotan, Z.A., Niki, M., Koutcher, J.A., Scher, H.I., Ludwig, T., Gerald, W., et al. (2005b). Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 436, 725-730.

Chi, P., Allis, C.D., and Wang, G.G. (2010). Covalent histone modifications--miswritten, misinterpreted and mis-erased in human cancers. Nature reviews Cancer 10, 457-469.

Chiacchiera, F., Piunti, A., and Pasini, D. (2013). Epigenetic methylations and their connections with metabolism. Cell Mol Life Sci 70, 1495-1508.

Chicas, A., Kapoor, A., Wang, X., Aksoy, O., Evertts, A.G., Zhang, M.Q., Garcia, B.A., Bernstein, E., and Lowe, S.W. (2012). H3K4 demethylation by Jarid1a and Jarid1b contributes to retinoblastoma-mediated gene silencing during cellular senescence. Proceedings of the National Academy of Sciences of the United States of America 109, 8971-8976.

Chiesa-Vottero, A.G., Malpica, A., Deavers, M.T., Broaddus, R., Nuovo, G.J., and Silva, E.G. (2007). Immunohistochemical overexpression of p16 and p53 in uterine serous carcinoma and ovarian high-grade serous carcinoma. International journal of gynecological pathology : official journal of the International Society of Gynecological Pathologists 26, 328-333.

Christensen, N.D., Cladel, N.M., and Reed, C.A. (1995). Postattachment neutralization of papillomaviruses by monoclonal and polyclonal antibodies. Virology 207, 136-142.

Chung, C.H., and Gillison, M.L. (2009). Human papillomavirus in head and neck cancer: its role in pathogenesis and clinical implications. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 6758-6762.

Ciferri, C., Lander, G.C., Maiolica, A., Herzog, F., Aebersold, R., and Nogales, E. (2012). Molecular architecture of human polycomb repressive complex 2. Elife 1, e00005.

140

Collado, M., Gil, J., Efeyan, A., Guerra, C., Schuhmacher, A., Barradas, M., Benguría, A., Zaballos, A., Flores, J., Barbacid, M., et al. (2005). Tumour biology: senescence in premalignant tumours. Nature 436, 642.

Collett, K., Eide, G.E., Arnes, J., Stefansson, I.M., Eide, J., Braaten, A., Aas, T., Otte, A.P., and Akslen, L.A. (2006). Expression of enhancer of zeste homologue 2 is significantly associated with increased tumor cell proliferation and is a marker of aggressive breast cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 12, 1168-1174.

Conger, K.L., Liu, J.S., Kuo, S.R., Chow, L.T., and Wang, T.S. (1999). Human papillomavirus DNA replication. Interactions between the viral E1 protein and two subunits of human dna polymerase alpha/primase. The Journal of biological chemistry 274, 2696-2705.

Consortium, E.P. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.

Crusius, K., Rodriguez, I., and Alonso, A. (2000). The human papillomavirus type 16 E5 protein modulates ERK1/2 and p38 MAP kinase activation by an EGFR-independent process in stressed human keratinocytes. Virus Genes 20, 65-69.

Cubie, H.A. (2013). Diseases associated with human papillomavirus infection. Virology 445, 21-34.

Culp, T.D., Budgeon, L.R., Marinkovich, M.P., Meneguzzi, G., and Christensen, N.D. (2006). Keratinocyte-secreted laminin 5 can function as a transient receptor for human papillomaviruses by binding virions and transferring them to adjacent cells. Journal of virology 80, 8940-8950. d'Adda di Fagagna, F., Teo, S.H., and Jackson, S.P. (2004). Functional links between telomeres and proteins of the DNA-damage response. Genes Dev 18, 1781-1799.

Dai, C.Y., and Enders, G.H. (2000). p16 INK4a can initiate an autonomous senescence program. Oncogene 19, 1613-1622.

Danis, E., Yamauchi, T., Echanique, K., Haladyna, J., Kalkur, R., Riedel, S., Zhu, N., Xie, H., Bernt, K.M., Orkin, S.H., et al. (2015). Inactivation of Eed impedes MLL-AF9-mediated leukemogenesis through Cdkn2a-dependent and Cdkn2a-independent mechanisms in a murine model. Exp Hematol 43, 930-935 e936.

Dasgupta, J., Bienkowska-Haba, M., Ortega, M.E., Patel, H.D., Bodevin, S., Spillmann, D., Bishop, B., Sapp, M., and Chen, X.S. (2011). Structural basis of oligosaccharide receptor recognition by human papillomavirus. The Journal of biological chemistry 286, 2617-2624.

Davy, C.E., Jackson, D.J., Wang, Q., Raj, K., Masterson, P.J., Fenner, N.F., Southern, S., Cuthill, S., Millar, J.B., and Doorbar, J. (2002). Identification of a G(2) arrest domain in the E1 wedge E4 protein of human papillomavirus type 16. Journal of virology 76, 9806-9818.

Day, P.M., Gambhira, R., Roden, R.B., Lowy, D.R., and Schiller, J.T. (2008). Mechanisms of human papillomavirus type 16 neutralization by l2 cross-neutralizing and l1 type-specific antibodies. Journal of virology 82, 4638-4646. de Villiers, E.M., Fauquet, C., Broker, T.R., Bernard, H.U., and zur Hausen, H. (2004). Classification of papillomaviruses. Virology 324, 17-27.

141

DeGregori, J., and Johnson, D.G. (2006). Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med 6, 739-748.

Dell, G., Wilkinson, K.W., Tranter, R., Parish, J., Leo Brady, R., and Gaston, K. (2003). Comparison of the structure and DNA-binding properties of the E2 proteins from an oncogenic and a non- oncogenic human papillomavirus. J Mol Biol 334, 979-991.

Demers, G.W., Halbert, C.L., and Galloway, D.A. (1994). Elevated wild-type p53 protein levels in human epithelial cell lines immortalized by the human papillomavirus type 16 E7 gene. Virology 198, 169-174.

Dhalluin, C., Carlson, J.E., Zeng, L., He, C., Aggarwal, A.K., and Zhou, M.M. (1999). Structure and ligand of a histone acetyltransferase bromodomain. Nature 399, 491-496.

Dietrich, N., Bracken, A.P., Trinh, E., Schjerling, C.K., Koseki, H., Rappsilber, J., Helin, K., and Hansen, K.H. (2007). Bypass of senescence by the polycomb group protein CBX8 through direct binding to the INK4A-ARF locus. EMBO J 26, 1637-1648.

Dimova, D.K., and Dyson, N.J. (2005). The E2F transcriptional network: old acquaintances with new faces. Oncogene 24, 2810-2826.

Disbrow, G.L., Hanover, J.A., and Schlegel, R. (2005). Endoplasmic reticulum-localized human papillomavirus type 16 E5 protein alters endosomal pH but not trans-Golgi pH. Journal of virology 79, 5839-5846.

Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature biotechnology 34, 184-191.

Dooley, K.E., Warburton, A., and McBride, A.A. (2016). Tandemly Integrated HPV16 Can Form a Brd4- Dependent Super-Enhancer-Like Element That Drives Transcription of Viral Oncogenes. MBio 7.

Doorbar, J. (2006). Molecular biology of human papillomavirus infection and cervical cancer. Clin Sci (Lond) 110, 525-541.

Doorbar, J., Ely, S., Sterling, J., McLean, C., and Crawford, L. (1991). Specific interaction between HPV- 16 E1-E4 and cytokeratins results in collapse of the epithelial cell intermediate filament network. Nature 352, 824-827.

Doorbar, J., and Gallimore, P.H. (1987). Identification of proteins encoded by the L1 and L2 open reading frames of human papillomavirus 1a. Journal of virology 61, 2793-2799.

Doorbar, J., Parton, A., Hartley, K., Banks, L., Crook, T., Stanley, M., and Crawford, L. (1990). Detection of novel splicing patterns in a HPV16-containing keratinocyte cell line. Virology 178, 254-262.

Dou, Y., Milne, T.A., Ruthenburg, A.J., Lee, S., Lee, J.W., Verdine, G.L., Allis, C.D., and Roeder, R.G. (2006). Regulation of MLL1 H3K4 methyltransferase activity by its core components. Nature structural & molecular biology 13, 713-719.

142

Dyson, N. (1998). The regulation of E2F by pRB-family proteins. Genes Dev 12, 2245-2262.

Dziduszko, A., and Ozbun, M.A. (2013). Annexin A2 and S100A10 regulate human papillomavirus type 16 entry and intracellular trafficking in human keratinocytes. Journal of virology 87, 7502-7515.

Enders, G.H. (2003). The INK4a/ARF locus and human cancer. Methods Mol Biol 222, 197-209.

Endoh, M., Endo, T.A., Endoh, T., Isono, K., Sharif, J., Ohara, O., Toyoda, T., Ito, T., Eskeland, R., Bickmore, W.A., et al. (2012). Histone H2A mono-ubiquitination is a crucial step to mediate PRC1-dependent repression of developmental genes to maintain ES cell identity. PLoS Genet 8, e1002774.

Engels, E.A., Frisch, M., Goedert, J.J., Biggar, R.J., and Miller, R.W. (2002). Merkel cell carcinoma and HIV infection. Lancet 359, 497-498.

Evander, M., Frazer, I.H., Payne, E., Qi, Y.M., Hengst, K., and McMillan, N.A. (1997). Identification of the alpha6 integrin as a candidate receptor for papillomaviruses. Journal of virology 71, 2449- 2456.

Fan, C., Oh, D.S., Wessels, L., Weigelt, B., Nuyten, D.S., Nobel, A.B., van't Veer, L.J., and Perou, C.M. (2006). Concordance among gene-expression-based predictors for breast cancer. N Engl J Med 355, 560-569.

Farmer, H., McCabe, N., Lord, C.J., Tutt, A.N., Johnson, D.A., Richardson, T.B., Santarosa, M., Dillon, K.J., Hickson, I., Knights, C., et al. (2005). Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917-921.

Feng, H., Shuda, M., Chang, Y., and Moore, P.S. (2008). Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 319, 1096-1100.

Ferbeyre, G., de Stanchina, E., Querido, E., Baptiste, N., Prives, C., and Lowe, S.W. (2000). PML is induced by oncogenic ras and promotes premature senescence. Genes Dev 14, 2015-2027.

Ferlay, J., Soerjomataram, I., Ervik, M., Dikshit, R., Eser, S., Mathers, C., Rebelo, M., Parkin, D.M., Forman, D., and Bray, F. (2013). Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11. International Agency for Research on Cancer.

Fillmore, C.M., Xu, C., Desai, P.T., Berry, J.M., Rowbotham, S.P., Lin, Y.J., Zhang, H., Marquez, V.E., Hammerman, P.S., Wong, K.K., et al. (2015). EZH2 inhibition sensitizes BRG1 and EGFR mutant lung tumours to TopoII inhibitors. Nature 520, 239-242.

Finnen, R.L., Erickson, K.D., Chen, X.S., and Garcea, R.L. (2003). Interactions between papillomavirus L1 and L2 capsid proteins. Journal of virology 77, 4818-4826.

Flak, M.B., Connell, C.M., Chelala, C., Archibald, K., Salako, M.A., Pirlo, K.J., Lockley, M., Wheatley, S.P., Balkwill, F.R., and McNeish, I.A. (2010). p21 Promotes oncolytic adenoviral activity in ovarian cancer and is a potential biomarker. Mol Cancer 9, 175.

Florin, L., Sapp, C., Streeck, R.E., and Sapp, M. (2002). Assembly and translocation of papillomavirus capsid proteins. Journal of virology 76, 10009-10014.

143

Fothergill, T., and McMillan, N.A. (2006). Papillomavirus virus-like particles activate the PI3-kinase pathway via alpha-6 beta-4 integrin upon binding. Virology 352, 319-328.

Francis, D.A., Schmid, S.I., and Howley, P.M. (2000). Repression of the integrated papillomavirus E6/E7 promoter is required for growth suppression of cervical cancer cells. Journal of virology 74, 2679-2686.

French, C.A., Miyoshi, I., Kubonishi, I., Grier, H.E., Perez-Atayde, A.R., and Fletcher, J.A. (2003). BRD4-NUT fusion oncogene: a novel mechanism in aggressive carcinoma. Cancer Res 63, 304- 307.

Gao, J., Aksoy, B.A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S.O., Sun, Y., Jacobsen, A., Sinha, R., Larsson, E., et al. (2013). Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Science signaling 6, pl1.

Gauthier, M.L., Berman, H.K., Miller, C., Kozakeiwicz, K., Chew, K., Moore, D., Rabban, J., Chen, Y.Y., Kerlikowske, K., and Tlsty, T.D. (2007). Abrogated response to cellular stress identifies DCIS associated with subsequent tumor events and defines basal-like breast tumors. Cancer Cell 12, 479-491.

Giroglou, T., Florin, L., Schafer, F., Streeck, R.E., and Sapp, M. (2001). Human papillomavirus infection requires cell surface heparan sulfate. Journal of virology 75, 1565-1570.

Giuliano, A.R., Tortolero-Luna, G., Ferrer, E., Burchell, A.N., de Sanjose, S., Kjaer, S.K., Munoz, N., Schiffman, M., and Bosch, F.X. (2008). Epidemiology of human papillomavirus infection in men, cancers other than cervical and benign conditions. Vaccine 26 Suppl 10, K17-28.

Gkotzamanidou, M., Shammas, M.A., Qi, J., Samur, M.K., Hideshima, T., Dimopoulos, M.A., Anderson, K.C., Bradner, J.E., and Munshi, N. (2013). Inhibition Of H3K27-Methylome As a Novel Therapeutic Strategy In Multiple Myeloma. In ASH 2013 Annual Meeting (New Orleans, LA).

Goodwin, E.C., and DiMaio, D. (2000). Repression of human papillomavirus oncogenes in HeLa cervical carcinoma cells causes the orderly reactivation of dormant tumor suppressor pathways. Proceedings of the National Academy of Sciences of the United States of America 97, 12513- 12518.

Grasso, C.S., Wu, Y.M., Robinson, D.R., Cao, X., Dhanasekaran, S.M., Khan, A.P., Quist, M.J., Jing, X., Lonigro, R.J., Brenner, J.C., et al. (2012). The mutational landscape of lethal castration-resistant prostate cancer. Nature 487, 239-243.

Guenova, M., Rassidakis, G.Z., Gorgoulis, V.G., Angelopoulou, M.K., Siakantaris, M.R., Kanavaros, P., Pangalis, G.A., and Kittas, C. (1999). p16INK4A is regularly expressed in Hodgkin's disease: comparison with retinoblastoma, p53 and MDM2 protein status, and the presence of Epstein-Barr virus. Mod Pathol 12, 1062-1071.

Halbert, C.L., Demers, G.W., and Galloway, D.A. (1991). The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. Journal of virology 65, 473-478.

Hansen, K.H., Bracken, A.P., Pasini, D., Dietrich, N., Gehani, S.S., Monrad, A., Rappsilber, J., Lerdrup, M., and Helin, K. (2008). A model for transmission of the H3K27me3 epigenetic mark. Nat Cell Biol 10, 1291-1300.

144

Harms, K.L., Chubb, H., Zhao, L., Fullen, D.R., Bichakjian, C.K., Johnson, T.M., Carskadon, S., Palanisamy, N., and Harms, P.W. (2017). Increased expression of EZH2 in Merkel cell carcinoma is associated with disease progression and poorer prognosis. Hum Pathol 67, 78-84.

He, X.T., Cao, X.F., Ji, L., Zhu, B., Lv, J., Wang, D.D., Lu, P.H., and Cui, H.G. (2009). Association between Bmi1 and clinicopathological status of esophageal squamous cell carcinoma. World J Gastroenterol 15, 2389-2394.

Hecht, S.S. (1999). Tobacco smoke carcinogens and lung cancer. J Natl Cancer Inst 91, 1194-1210.

Herbst, R.S., Heymach, J.V., and Lippman, S.M. (2008). Lung cancer. N Engl J Med 359, 1367-1380.

Herfs, M., Yamamoto, Y., Laury, A., Wang, X., Nucci, M.R., McLaughlin-Drubin, M.E., Munger, K., Feldman, S., McKeon, F.D., Xian, W., et al. (2012). A discrete population of squamocolumnar junction cells implicated in the pathogenesis of cervical cancer. Proceedings of the National Academy of Sciences of the United States of America 109, 10516-10521.

Hernandez-Munoz, I., Taghavi, P., Kuijl, C., Neefjes, J., and van Lohuizen, M. (2005). Association of BMI1 with polycomb bodies is dynamic and requires PRC2/EZH2 and the maintenance DNA methyltransferase DNMT1. Mol Cell Biol 25, 11047-11058.

Herschkowitz, J.I., He, X., Fan, C., and Perou, C.M. (2008). The functional loss of the retinoblastoma tumour suppressor is a common event in basal-like and luminal B breast carcinomas. Breast cancer research : BCR 10, R75.

Hnisz, D., Abraham, B.J., Lee, T.I., Lau, A., Saint-Andre, V., Sigova, A.A., Hoke, H.A., and Young, R.A. (2013). Super-enhancers in the control of cell identity and disease. Cell 155, 934-947.

Hoischen, A., van Bon, B.W., Rodriguez-Santiago, B., Gilissen, C., Vissers, L.E., de Vries, P., Janssen, I., van Lier, B., Hastings, R., Smithson, S.F., et al. (2011). De novo nonsense mutations in ASXL1 cause Bohring-Opitz syndrome. Nat Genet 43, 729-731.

Hoppenot, C., Eckert, M.A., Tienda, S.M., and Lengyel, E. (2018). Who are the long-term survivors of high grade serous ovarian cancer? Gynecol Oncol 148, 204-212.

Howie, H.L., Katzenellenbogen, R.A., and Galloway, D.A. (2009). Papillomavirus E6 proteins. Virology 384, 324-334.

Howie, H.L., Koop, J.I., Weese, J., Robinson, K., Wipf, G., Kim, L., and Galloway, D.A. (2011). Beta- HPV 5 and 8 E6 promote p300 degradation by blocking AKT/p300 association. PLoS pathogens 7, e1002211.

Howlader, N., Noone, A.M., Krapcho, M., Miller, D., Bishop, K., Kosary, C.L., Yu, M., Ruhl, J., Tatalovich, Z., Mariotto, A., et al. (2017). SEER Cancer Statistics Review, 1975-2014.

Hsu, C.H., Peng, K.L., Jhang, H.C., Lin, C.H., Wu, S.Y., Chiang, C.M., Lee, S.C., Yu, W.C., and Juan, L.J. (2012). The HPV E6 oncoprotein targets histone methyltransferases for modulating specific gene transcription. Oncogene 31, 2335-2349.

145

Hu, Y., Ye, F., Lu, W., Hong, D., Wan, X., and Xie, X. (2009). HPV16 E6-induced and E6AP-dependent inhibition of the transcriptional coactivator hADA3 in human cervical carcinoma cells. Cancer Invest 27, 298-306.

Huang, J., Kent, J.R., Placek, B., Whelan, K.A., Hollow, C.M., Zeng, P.Y., Fraser, N.W., and Berger, S.L. (2006). Trimethylation of histone H3 lysine 4 by Set1 in the lytic infection of human herpes simplex virus 1. Journal of virology 80, 5740-5746.

Huh, K., Zhou, X., Hayakawa, H., Cho, J.Y., Libermann, T.A., Jin, J., Harper, J.W., and Munger, K. (2007). Human papillomavirus type 16 E7 oncoprotein associates with the cullin 2 ubiquitin ligase complex, which contributes to degradation of the retinoblastoma tumor suppressor. Journal of virology 81, 9737-9747.

Huh, K.W., DeMasi, J., Ogawa, H., Nakatani, Y., Howley, P.M., and Munger, K. (2005). Association of the human papillomavirus type 16 E7 oncoprotein with the 600-kDa retinoblastoma protein- associated factor, p600. Proceedings of the National Academy of Sciences of the United States of America 102, 11492-11497.

Huibregtse, J.M., Scheffner, M., and Howley, P.M. (1991). A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18. The EMBO journal 10, 4129- 4135.

Hwang, E.S., Nottoli, T., and Dimaio, D. (1995). The HPV16 E5 protein: expression, detection, and stable complex formation with transmembrane proteins in COS cells. Virology 211, 227-233.

Hwang, S.G., Lee, D., Kim, J., Seo, T., and Choe, J. (2002). Human papillomavirus type 16 E7 binds to E2F1 and activates E2F1-driven transcription in a retinoblastoma protein-independent manner. The Journal of biological chemistry 277, 2923-2930.

Hyland, P., McDade, S., McCloskey, R., Dickson, G., Arthur, K., McCance, D., and Patel, D. (2011). Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes. Journal of virology 85, 10999-11006.

IARC (2007). IARC Monographs on the Evaluation of Carcinogenic Risks to Humans: Human Papillomaviruses (Lyon, France).

Ilves, I., Kivi, S., and Ustav, M. (1999). Long-term episomal maintenance of bovine papillomavirus type 1 plasmids is determined by attachment to host chromosomes, which Is mediated by the viral E2 protein and its binding sites. Journal of virology 73, 4404-4412.

Ingham, P.W. (1983). Differential expression of bithorax complex genes in the absence of the extra sex combs and trithorax genes. Nature 306, 591-593.

Ingham, P.W. (1985). Genetic control of the spatial pattern of selector gene expression in Drosophila. Cold Spring Harbor symposia on quantitative biology 50, 201-208.

Itahana, K., Dimri, G., and Campisi, J. (2001). Regulation of cellular senescence by p53. Eur J Biochem 268, 2784-2791.

Italiano, A., Ribrag, R., Soria, J., Michot, J., Schmitt, A., Postel-Vinay, S., Bijou, F., Thomson, B., Keilhack, H., Blakemore, S.J., et al. (2015). Phase 1 Study of Tazemetostat (EPZ-6438), an

146

Inhibitor of Enhancer of Zeste-Homolog 2 (EZH2): Preliminary Safety and Activity in Relapsed or Refractory Non-Hodgkin Lymphoma (NHL) Patients. Blood 126, 473.

Jarrard, D.F., Modder, J., Fadden, P., Fu, V., Sebree, L., Heisey, D., Schwarze, S.R., and Friedl, A. (2002). Alterations in the p16/pRb cell cycle checkpoint occur commonly in primary and metastatic human prostate cancer. Cancer letters 185, 191-199.

Jemal, A., Simard, E.P., Dorell, C., Noone, A.M., Markowitz, L.E., Kohler, B., Eheman, C., Saraiya, M., Bandi, P., Saslow, D., et al. (2013). Annual Report to the Nation on the Status of Cancer, 1975- 2009, featuring the burden and trends in human papillomavirus(HPV)-associated cancers and HPV vaccination coverage levels. J Natl Cancer Inst 105, 175-201.

Jha, S., Vande Pol, S., Banerjee, N.S., Dutta, A.B., Chow, L.T., and Dutta, A. (2010). Destabilization of TIP60 by human papillomavirus E6 results in attenuation of TIP60-dependent transcriptional regulation and apoptotic pathway. Mol Cell 38, 700-711.

Jiang, Y.W., Veschambre, P., Erdjument-Bromage, H., Tempst, P., Conaway, J.W., Conaway, R.C., and Kornberg, R.D. (1998). Mammalian mediator of transcriptional regulation and its possible role as an end-point of signal transduction pathways. Proceedings of the National Academy of Sciences of the United States of America 95, 8538-8543.

Joerger, A.C., Ang, H.C., Veprintsev, D.B., Blair, C.M., and Fersht, A.R. (2005). Structures of p53 cancer mutants and mechanism of rescue by second-site suppressor mutations. The Journal of biological chemistry 280, 16030-16037.

Johnson, K.M., Kines, R.C., Roberts, J.N., Lowy, D.R., Schiller, J.T., and Day, P.M. (2009). Role of heparan sulfate in attachment to and infection of the murine female genital tract by human papillomavirus. Journal of virology 83, 2067-2074.

Jones, D.L., Thompson, D.A., and Munger, K. (1997). Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239, 97-107.

Jones, P.A., and Baylin, S.B. (2007). The epigenomics of cancer. Cell 128, 683-692.

Jones, W.D., Dafou, D., McEntagart, M., Woollard, W.J., Elmslie, F.V., Holder-Espinasse, M., Irving, M., Saggar, A.K., Smithson, S., Trembath, R.C., et al. (2012). De novo mutations in MLL cause Wiedemann-Steiner syndrome. Am J Hum Genet 91, 358-364.

Kaae, J., Hansen, A.V., Biggar, R.J., Boyd, H.A., Moore, P.S., Wohlfahrt, J., and Melbye, M. (2010). Merkel cell carcinoma: incidence, mortality, and risk of other cancers. J Natl Cancer Inst 102, 793-801.

Kaelin, W.G., Jr. (2005). The concept of synthetic lethality in the context of anticancer therapy. Nature reviews Cancer 5, 689-698.

Karatas, H., Townsend, E.C., Cao, F., Chen, Y., Bernard, D., Liu, L., Lei, M., Dou, Y., and Wang, S. (2013). High-affinity, small-molecule peptidomimetic inhibitors of MLL1/WDR5 protein-protein interaction. J Am Chem Soc 135, 669-682.

Katoh, M. (2013). Functional and cancer genomics of ASXL family members. British journal of cancer 109, 299-306.

147

Kennison, J.A., and Tamkun, J.W. (1988). Dosage-dependent modifiers of polycomb and antennapedia mutations in Drosophila. Proceedings of the National Academy of Sciences of the United States of America 85, 8136-8140.

Khleif, S.N., DeGregori, J., Yee, C.L., Otterson, G.A., Kaye, F.J., Nevins, J.R., and Howley, P.M. (1996). Inhibition of cyclin D-CDK4/CDK6 activity is associated with an E2F-mediated induction of cyclin kinase inhibitor activity. Proceedings of the National Academy of Sciences of the United States of America 93, 4350-4354.

Kidani, K., Osaki, M., Tamura, T., Yamaga, K., Shomori, K., Ryoke, K., and Ito, H. (2009). High expression of EZH2 is associated with tumor proliferation and prognosis in human oral squamous cell carcinomas. Oral Oncol 45, 39-46.

Kim, K.H., and Roberts, C.W. (2016). Targeting EZH2 in cancer. Nature medicine 22, 128-134.

Kim, W.Y., and Sharpless, N.E. (2006). The regulation of INK4/ARF in cancer and aging. Cell 127, 265- 275.

Kiyono, T., Hiraiwa, A., Fujita, M., Hayashi, Y., Akiyama, T., and Ishibashi, M. (1997). Binding of high- risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein. Proceedings of the National Academy of Sciences of the United States of America 94, 11612-11616.

Klaes, R., Friedrich, T., Spitkovsky, D., Ridder, R., Rudy, W., Petry, U., Dallenbach-Hellweg, G., Schmidt, D., and von Knebel Doeberitz, M. (2001). Overexpression of p16(INK4A) as a specific marker for dysplastic and neoplastic epithelial cells of the cervix uteri. International journal of cancer Journal international du cancer 92, 276-284.

Knipe, D.M., and Howley, P.M. (2013). Fields Virology, 6th edn (Philadelphia, PA: Wolters Kluwer/Lippincott Williams & Wilkins Health).

Kommoss, S., du Bois, A., Ridder, R., Trunk, M.J., Schmidt, D., Pfisterer, J., and Kommoss, F. (2007). Independent prognostic significance of cell cycle regulator proteins p16(INK4a) and pRb in advanced-stage ovarian carcinoma including optimally debulked patients: a translational research subprotocol of a randomised study of the Arbeitsgemeinschaft Gynaekologische Onkologie Ovarian Cancer Study Group. British journal of cancer 96, 306-313.

Kotake, Y., Cao, R., Viatour, P., Sage, J., Zhang, Y., and Xiong, Y. (2007). pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene. Genes Dev 21, 49-54.

Kotake, Y., Naemura, M., Kitagawa, K., Niida, H., Tsunoda, T., Shirasawa, S., and Kitagawa, M. (2016). Oncogenic Ras influences the expression of multiple lncRNAs. Cytotechnology 68, 1591-1596.

Kotake, Y., Nakagawa, T., Kitagawa, K., Suzuki, S., Liu, N., Kitagawa, M., and Xiong, Y. (2011). Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene. Oncogene 30, 1956-1962.

Kotake, Y., Ozawa, Y., Harada, M., Kitagawa, K., Niida, H., Morita, Y., Tanaka, K., Suda, T., and Kitagawa, M. (2013). YB1 binds to and represses the p16 tumor suppressor gene. Genes Cells 18, 999-1006.

148

Kotake, Y., Zeng, Y., and Xiong, Y. (2009). DDB1-CUL4 and MLL1 mediate oncogene-induced p16INK4a activation. Cancer Res 69, 1809-1814.

Krimpenfort, P., Ijpenberg, A., Song, J.Y., van der Valk, M., Nawijn, M., Zevenhoven, J., and Berns, A. (2007). p15Ink4b is a critical tumour suppressor in the absence of p16Ink4a. Nature 448, 943- 946.

Krivtsov, A.V., and Armstrong, S.A. (2007). MLL translocations, histone modifications and leukaemia stem-cell development. Nature reviews Cancer 7, 823-833.

Kumar, A., Zhao, Y., Meng, G., Zeng, M., Srinivasan, S., Delmolino, L.M., Gao, Q., Dimri, G., Weber, G.F., Wazer, D.E., et al. (2002). Human papillomavirus oncoprotein E6 inactivates the transcriptional coactivator human ADA3. Mol Cell Biol 22, 5801-5812.

Lace, M.J., Anson, J.R., Turek, L.P., and Haugen, T.H. (2008). Functional mapping of the human papillomavirus type 16 E1 cistron. Journal of virology 82, 10724-10734.

LaFave, L.M., Beguelin, W., Koche, R., Teater, M., Spitzer, B., Chramiec, A., Papalexi, E., Keller, M.D., Hricik, T., Konstantinoff, K., et al. (2015). Loss of BAP1 function leads to EZH2-dependent transformation. Nat Med 21, 1344-1349.

Lam, A.K., Ong, K., Giv, M.J., and Ho, Y.H. (2008). p16 expression in colorectal adenocarcinoma: marker of aggressiveness and morphological types. Pathology 40, 580-585.

Landais, S., D'Alterio, C., and Jones, D.L. (2014). Persistent replicative stress alters polycomb phenotypes and tissue homeostasis in Drosophila melanogaster. Cell Rep 7, 859-870.

Lassacher, A., Heitzer, E., Kerl, H., and Wolf, P. (2008). p14ARF hypermethylation is common but INK4a-ARF locus or p53 mutations are rare in Merkel cell carcinoma. The Journal of investigative dermatology 128, 1788-1796.

Laurson, J., Khan, S., Chung, R., Cross, K., and Raj, K. (2010). Epigenetic repression of E-cadherin by human papillomavirus 16 E7 protein. Carcinogenesis 31, 918-926.

Lazarczyk, M., Cassonnet, P., Pons, C., Jacob, Y., and Favre, M. (2009). The EVER proteins as a natural barrier against papillomaviruses: a new insight into the pathogenesis of human papillomavirus infections. Microbiol Mol Biol Rev 73, 348-370.

Lechner, M.S., and Laimins, L.A. (1994). Inhibition of p53 DNA binding by human papillomavirus E6 proteins. Journal of virology 68, 4262-4273.

Lee, A.C., Fenster, B.E., Ito, H., Takeda, K., Bae, N.S., Hirai, T., Yu, Z.X., Ferrans, V.J., Howard, B.H., and Finkel, T. (1999). Ras proteins induce senescence by altering the intracellular levels of reactive oxygen species. The Journal of biological chemistry 274, 7936-7940.

Lee, D., Lim, C., Seo, T., Kwon, H., Min, H., and Choe, J. (2002). The viral oncogene human papillomavirus E7 deregulates transcriptional silencing by Brm-related gene 1 via molecular interactions. The Journal of biological chemistry 277, 48842-48848.

149

Lee, M.H., Choi, B.Y., Cho, Y.Y., Lee, S.Y., Huang, Z., Kundu, J.K., Kim, M.O., Kim, D.J., Bode, A.M., Surh, Y.J., et al. (2013). Tumor suppressor p16(INK4a) inhibits cancer cell growth by downregulating eEF1A2 through a direct interaction. J Cell Sci 126, 1744-1752.

Lewis, E.B. (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565-570.

Lewis, P.H. (1947). New mutants report. Drosoph Inf Serv 21, 69.

Li, G., Margueron, R., Ku, M., Chambon, P., Bernstein, B.E., and Reinberg, D. (2010a). Jarid2 and PRC2, partners in regulating gene expression. Genes Dev 24, 368-380.

Li, M., Zhao, H., Zhang, X., Wood, L.D., Anders, R.A., Choti, M.A., Pawlik, T.M., Daniel, H.D., Kannangai, R., Offerhaus, G.J., et al. (2011). Inactivating mutations of the chromatin remodeling gene ARID2 in hepatocellular carcinoma. Nat Genet 43, 828-829.

Li, Q., Wang, X., Lu, Z., Zhang, B., Guan, Z., Liu, Z., Zhong, Q., Gu, L., Zhou, J., Zhu, B., et al. (2010b). Polycomb CBX7 directly controls trimethylation of histone H3 at lysine 9 at the p16 locus. PLoS One 5, e13732.

Li, Y., Nichols, M.A., Shay, J.W., and Xiong, Y. (1994). Transcriptional repression of the D-type cyclin- dependent kinase inhibitor p16 by the retinoblastoma susceptibility gene product pRb. Cancer Res 54, 6078-6082.

Liang, J., Zhou, H., Gerdt, C., Tan, M., Colson, T., Kaye, K.M., Kieff, E., and Zhao, B. (2016). Epstein- Barr virus super-enhancer eRNAs are essential for MYC oncogene expression and lymphoblast proliferation. Proceedings of the National Academy of Sciences of the United States of America 113, 14121-14126.

Lin, A., Wang, S., Nguyen, T., Shire, K., and Frappier, L. (2008). The EBNA1 protein of Epstein-Barr virus functionally interacts with Brd4. Journal of virology 82, 12009-12019.

Liu, X., Dakic, A., Zhang, Y., Dai, Y., Chen, R., and Schlegel, R. (2009). HPV E6 protein interacts physically and functionally with the cellular telomerase complex. Proceedings of the National Academy of Sciences of the United States of America 106, 18780-18785.

Longworth, M., and Laimins, L. (2004). The binding of histone deacetylases and the integrity of zinc finger-like motifs of the E7 protein are essential for the life cycle of human papillomavirus type 31. Journal of virology 78, 3533-3541.

Loo, Y.M., and Melendy, T. (2004). Recruitment of replication protein A by the papillomavirus E1 protein and modulation by single-stranded DNA. Journal of virology 78, 1605-1615.

Lopez-Bueno, A., Mavian, C., Labella, A.M., Castro, D., Borrego, J.J., Alcami, A., and Alejo, A. (2016). Concurrence of Iridovirus, Polyomavirus, and a Unique Member of a New Group of Fish Papillomaviruses in Lymphocystis Disease-Affected Gilthead Sea Bream. Journal of virology 90, 8768-8779.

Lord, C.J., Tutt, A.N., and Ashworth, A. (2015). Synthetic lethality and cancer therapy: lessons learned from the development of PARP inhibitors. Annu Rev Med 66, 455-470.

150

Loven, J., Hoke, H.A., Lin, C.Y., Lau, A., Orlando, D.A., Vakoc, C.R., Bradner, J.E., Lee, T.I., and Young, R.A. (2013). Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell 153, 320-334.

Lukas, J., Parry, D., Aagaard, L., Mann, D.J., Bartkova, J., Strauss, M., Peters, G., and Bartek, J. (1995). Retinoblastoma-protein-dependent cell-cycle inhibition by the tumour suppressor p16. Nature 375, 503-506.

Madison, K.C. (2003). Barrier function of the skin: "la raison d'etre" of the epidermis. The Journal of investigative dermatology 121, 231-241.

Malumbres, M., and Barbacid, M. (2001). To cycle or not to cycle: a critical decision in cancer. Nature reviews Cancer 1, 222-231.

Margueron, R., Justin, N., Ohno, K., Sharpe, M.L., Son, J., Drury, W.J., 3rd, Voigt, P., Martin, S.R., Taylor, W.R., De Marco, V., et al. (2009). Role of the polycomb protein EED in the propagation of repressive histone marks. Nature 461, 762-767.

Margueron, R., and Reinberg, D. (2011). The Polycomb complex PRC2 and its mark in life. Nature 469, 343-349.

Masterson, P.J., Stanley, M.A., Lewis, A.P., and Romanos, M.A. (1998). A C-terminal helicase domain of the human papillomavirus E1 protein binds E2 and the DNA polymerase alpha-primase p68 subunit. Journal of virology 72, 7407-7419.

McLaughlin-Drubin, M., Crum, C., and Münger, K. (2011). Human papillomavirus E7 oncoprotein induces KDM6A and KDM6B histone demethylase expression and causes epigenetic reprogramming. Proceedings of the National Academy of Sciences of the United States of America 108, 2130-2135.

McLaughlin-Drubin, M., Park, D., and Munger, K. (2013). The p16INK4A tumor suppressor is necessary for survival of cervical carcinoma cell lines. Proc Natl Acad Sci USA.

McLaughlin-Drubin, M.E., Huh, K.W., and Munger, K. (2008). Human papillomavirus type 16 E7 oncoprotein associates with E2F6. Journal of virology 82, 8695-8705.

McLaughlin-Drubin, M.E., Meyers, J., and Munger, K. (2012). Cancer associated human papillomaviruses. Curr Opin Virol 2, 459-466.

McLaughlin-Drubin, M.E., and Munger, K. (2009). Oncogenic activities of human papillomaviruses. Virus Res 143, 195-208.

McLaughlin-Drubin, M.E., and Munger, K. (2013). Biochemical and functional interactions of human papillomavirus proteins with polycomb group proteins. Viruses 5, 1231-1249.

McPhillips, M.G., Oliveira, J.G., Spindler, J.E., Mitra, R., and McBride, A.A. (2006). Brd4 is required for e2-mediated transcriptional activation but not genome partitioning of all papillomaviruses. Journal of virology 80, 9530-9543.

Menges, C.W., Baglia, L.A., Lapoint, R., and McCance, D.J. (2006). Human papillomavirus type 16 E7 up-regulates AKT activity through the retinoblastoma protein. Cancer Res 66, 5555-5559.

151

Meseure, D., Vacher, S., Alsibai, K.D., Nicolas, A., Chemlali, W., Caly, M., Lidereau, R., Pasmant, E., Callens, C., and Bieche, I. (2016). Expression of ANRIL-Polycomb Complexes- CDKN2A/B/ARF Genes in Breast Tumors: Identification of a Two-Gene (EZH2/CBX7) Signature with Independent Prognostic Value. Mol Cancer Res 14, 623-633.

Meyers, C. (1996). Organotypic (raft) epithelial tissue culture system for the differentiation-dependent replication of papillomavirus. Methods in Cell Science 18, 201-210.

Mi, H., Muruganujan, A., Casagrande, J.T., and Thomas, P.D. (2013). Large-scale gene function analysis with the PANTHER classification system. Nature protocols 8, 1551-1566.

Michaloglou, C., Vredeveld, L.C., Soengas, M.S., Denoyelle, C., Kuilman, T., van der Horst, C.M., Majoor, D.M., Shay, J.W., Mooi, W.J., and Peeper, D.S. (2005). BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-724.

Milde-Langosch, K., Bamberger, A.M., Rieck, G., Kelp, B., and Loning, T. (2001). Overexpression of the p16 cell cycle inhibitor in breast cancer is associated with a more malignant phenotype. Breast cancer research and treatment 67, 61-70.

Mimori, K., Ogawa, K., Okamoto, M., Sudo, T., Inoue, H., and Mori, M. (2005). Clinical significance of enhancer of zeste homolog 2 expression in colorectal cancer cases. Eur J Surg Oncol 31, 376-380.

Mistry, N., Simonsson, M., and Evander, M. (2007). Transcriptional activation of the human papillomavirus type 5 and 16 long control region in cells from cutaneous and mucosal origin. Virol J 4, 27.

Moody, C.A., and Laimins, L.A. (2010). Human papillomavirus oncoproteins: pathways to transformation. Nature reviews Cancer 10, 550-560.

Moody, S.E., Boehm, J.S., Barbie, D.A., and Hahn, W.C. (2010). Functional genomics and cancer drug target discovery. Curr Opin Mol Ther 12, 284-293.

Moore, C.E., Wiatrak, B.J., McClatchey, K.D., Koopmann, C.F., Thomas, G.R., Bradford, C.R., and Carey, T.E. (1999). High-risk human papillomavirus types and squamous cell carcinoma in patients with respiratory papillomas. Otolaryngol Head Neck Surg 120, 698-705.

Morel, D., Almouzni, G., Soria, J.C., and Postel-Vinay, S. (2017). Targeting chromatin defects in selected solid tumors based on oncogene addiction, synthetic lethality and epigenetic antagonism. Ann Oncol 28, 254-269.

Mungamuri, S.K., Wang, S., Manfredi, J.J., Gu, W., and Aaronson, S.A. (2015). Ash2L enables P53- dependent apoptosis by favoring stable transcription pre-initiation complex formation on its pro- apoptotic target promoters. Oncogene 34, 2461-2470.

Munger, K., Basile, J.R., Duensing, S., Eichten, A., Gonzalez, S.L., Grace, M., and Zacny, V.L. (2001). Biological activities and molecular targets of the human papillomavirus E7 oncoprotein. Oncogene 20, 7888-7898.

Munger, K., Hayakawa, H., Nguyen, C.L., Melquiot, N.V., Duensing, A., and Duensing, S. (2006). Viral carcinogenesis and genomic instability. EXS, 179-199.

152

Munger, K., Werness, B.A., Dyson, N., Phelps, W.C., Harlow, E., and Howley, P.M. (1989). Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. The EMBO journal 8, 4099-4105.

Murphy, N., Ring, M., Heffron, C.C., King, B., Killalea, A.G., Hughes, C., Martin, C.M., McGuinness, E., Sheils, O., and O'Leary, J.J. (2005). p16INK4A, CDC6, and MCM5: predictive biomarkers in cervical preinvasive neoplasia and cervical cancer. J Clin Pathol 58, 525-534.

Nakagawa, T., Kajitani, T., Togo, S., Masuko, N., Ohdan, H., Hishikawa, Y., Koji, T., Matsuyama, T., Ikura, T., Muramatsu, M., et al. (2008). Deubiquitylation of histone H2A activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation. Genes Dev 22, 37-49.

Narita, M., and Lowe, S.W. (2004). Executing cell senescence. Cell Cycle 3, 244-246.

Neumeister, P., Albanese, C., Balent, B., Greally, J., and Pestell, R.G. (2002). Senescence and epigenetic dysregulation in cancer. The international journal of biochemistry & cell biology 34, 1475-1490.

Neve, R.M., Chin, K., Fridlyand, J., Yeh, J., Baehner, F.L., Fevr, T., Clark, L., Bayani, N., Coppe, J.P., Tong, F., et al. (2006). A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 10, 515-527.

Nigro, J.M., Baker, S.J., Preisinger, A.C., Jessup, J.M., Hostetter, R., Cleary, K., Bigner, S.H., Davidson, N., Baylin, S., Devilee, P., et al. (1989). Mutations in the p53 gene occur in diverse human tumour types. Nature 342, 705-708.

Nijwening, J.H., Geutjes, E.J., Bernards, R., and Beijersbergen, R.L. (2011). The histone demethylase Jarid1b (Kdm5b) is a novel component of the Rb pathway and associates with E2f-target genes in MEFs during senescence. PLoS One 6, e25235.

Nowak, K., Kerl, K., Fehr, D., Kramps, C., Gessner, C., Killmer, K., Samans, B., Berwanger, B., Christiansen, H., and Lutz, W. (2006). BMI1 is a target gene of E2F-1 and is strongly expressed in primary neuroblastomas. Nucleic Acids Res 34, 1745-1754.

Ohtani, N., Brennan, P., Gaubatz, S., Sanij, E., Hertzog, P., Wolvetang, E., Ghysdael, J., Rowe, M., and Hara, E. (2003). Epstein-Barr virus LMP1 blocks p16INK4a-RB pathway by promoting nuclear export of E2F4/5. The Journal of cell biology 162, 173-183.

Ohtani, N., Zebedee, Z., Huot, T.J., Stinson, J.A., Sugimoto, M., Ohashi, Y., Sharrocks, A.D., Peters, G., and Hara, E. (2001). Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409, 1067-1070.

Oliveira, J.G., Colf, L.A., and McBride, A.A. (2006). Variations in the association of papillomavirus E2 proteins with mitotic chromosomes. Proceedings of the National Academy of Sciences of the United States of America 103, 1047-1052.

Papanicolaou, G.N., and Traut, H.F. (1997). The diagnostic value of vaginal smears in carcinoma of the uterus. 1941. Arch Pathol Lab Med 121, 211-224.

Pare, R., Shin, J.S., and Lee, C.S. (2016). Increased expression of senescence markers p14(ARF) and p16(INK4a) in breast cancer is associated with an increased risk of disease recurrence and poor survival outcome. Histopathology 69, 479-491.

153

Pasini, D., Cloos, P.A., Walfridsson, J., Olsson, L., Bukowski, J.P., Johansen, J.V., Bak, M., Tommerup, N., Rappsilber, J., and Helin, K. (2010). JARID2 regulates binding of the Polycomb repressive complex 2 to target genes in ES cells. Nature 464, 306-310.

Patel, D., Huang, S.M., Baglia, L.A., and McCance, D.J. (1999). The E6 protein of human papillomavirus type 16 binds to and inhibits co-activation by CBP and p300. The EMBO journal 18, 5061-5072.

Pearson, M., Carbone, R., Sebastiani, C., Cioce, M., Fagioli, M., Saito, S., Higashimoto, Y., Appella, E., Minucci, S., Pandolfi, P.P., et al. (2000). PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature 406, 207-210.

Pena, A.N., and Pereira-Smith, O.M. (2007). The role of the MORF/MRG family of genes in cell growth, differentiation, DNA repair, and thereby aging. Ann N Y Acad Sci 1100, 299-305.

Petruk, S., Sedkov, Y., Johnston, D.M., Hodgson, J.W., Black, K.L., Kovermann, S.K., Beck, S., Canaani, E., Brock, H.W., and Mazo, A. (2012). TrxG and PcG proteins but not methylated histones remain associated with DNA through replication. Cell 150, 922-933.

Pim, D., and Banks, L. (1999). HPV-18 E6*I protein modulates the E6-directed degradation of p53 by binding to full-length HPV-18 E6. Oncogene 18, 7403-7408.

Pott, S., and Lieb, J.D. (2015). What are super-enhancers? Nat Genet 47, 8-12.

Prickaerts, P., Adriaens, M.E., Beucken, T.V.D., Koch, E., Dubois, L., Dahlmans, V.E.H., Gits, C., Evelo, C.T.A., Chan-Seng-Yue, M., Wouters, B.G., et al. (2016). Hypoxia increases genome-wide bivalent epigenetic marking by specific gain of H3K27me3. Epigenetics Chromatin 9, 46.

Pyeon, D., Pearce, S.M., Lank, S.M., Ahlquist, P., and Lambert, P.F. (2009). Establishment of human papillomavirus infection requires cell cycle progression. PLoS pathogens 5, e1000318.

Rayess, H., Wang, M.B., and Srivatsan, E.S. (2012). Cellular senescence and tumor suppressor gene p16. International journal of cancer Journal international du cancer 130, 1715-1725.

Reinhold, W.C., Sunshine, M., Liu, H., Varma, S., Kohn, K.W., Morris, J., Doroshow, J., and Pommier, Y. (2012). CellMiner: a web-based suite of genomic and pharmacologic tools to explore transcript and drug patterns in the NCI-60 cell line set. Cancer Res 72, 3499-3511.

Resto, V., Caballero, O., Buta, M., Westra, W., Wu, L., Westendorf, J., Jen, J., Hieter, P., and Sidransky, D. (2000). A putative oncogenic role for MPP11 in head and neck squamous cell cancer. Cancer research 60, 5529-5535.

Ribeiro, J., Morey, L., Mas, A., Gutierrez, A., Luis, N., Mejetta, S., Richly, H., Benitah, S., Keyes, W., and Di Croce, L. (2012). ZRF1 controls oncogene-induced senescence through the INK4-ARF locus. Oncogene.

Ribeiro, J.D., Morey, L., Mas, A., Gutierrez, A., Luis, N.M., Mejetta, S., Richly, H., Benitah, S.A., Keyes, W.M., and Di Croce, L. (2013). ZRF1 controls oncogene-induced senescence through the INK4-ARF locus. Oncogene 32, 2161-2168.

154

Richards, K.F., Bienkowska-Haba, M., Dasgupta, J., Chen, X.S., and Sapp, M. (2013). Multiple heparan sulfate binding site engagements are required for the infectious entry of human papillomavirus type 16. Journal of virology 87, 11426-11437.

Richards, K.F., Mukherjee, S., Bienkowska-Haba, M., Pang, J., and Sapp, M. (2014). Human papillomavirus species-specific interaction with the basement membrane-resident non-heparan sulfate receptor. Viruses 6, 4856-4879.

Richards, R.M., Lowy, D.R., Schiller, J.T., and Day, P.M. (2006). Cleavage of the papillomavirus minor capsid protein, L2, at a furin consensus site is necessary for infection. Proceedings of the National Academy of Sciences of the United States of America 103, 1522-1527.

Richly, H., Aloia, L., and Di Croce, L. (2011). Roles of the Polycomb group proteins in stem cells and cancer. Cell Death Dis 2, e204.

Richly, H., and Di Croce, L. (2011). The flip side of the coin: role of ZRF1 and histone H2A ubiquitination in transcriptional activation. Cell cycle (Georgetown, Tex) 10, 745-750.

Robinson, T.J., Liu, J.C., Vizeacoumar, F., Sun, T., Maclean, N., Egan, S.E., Schimmer, A.D., Datti, A., and Zacksenhaus, E. (2013). RB1 status in triple negative breast cancer cells dictates response to radiation treatment and selective therapeutic drugs. PLoS One 8, e78641.

Roden, R.B., Day, P.M., Bronzo, B.K., Yutzy, W.H.t., Yang, Y., Lowy, D.R., and Schiller, J.T. (2001). Positively charged termini of the L2 minor capsid protein are necessary for papillomavirus infection. Journal of virology 75, 10493-10497.

Romagosa, C., Simonetti, S., Lopez-Vicente, L., Mazo, A., Lleonart, M.E., Castellvi, J., and Ramon y Cajal, S. (2011). p16(Ink4a) overexpression in cancer: a tumor suppressor gene associated with senescence and high-grade tumors. Oncogene 30, 2087-2097.

Roman, A., and Munger, K. (2013). The papillomavirus E7 proteins. Virology.

Sahtoe, D.D., van Dijk, W.J., Ekkebus, R., Ovaa, H., and Sixma, T.K. (2016). BAP1/ASXL1 recruitment and activation for H2A deubiquitination. Nat Commun 7, 10292.

Sano, T., Oyama, T., Kashiwabara, K., Fukuda, T., and Nakajima, T. (1998). Expression status of p16 protein is associated with human papillomavirus oncogenic potential in cervical and genital lesions. The American journal of pathology 153, 1741-1748.

Satyanarayana, A., and Rudolph, K.L. (2004). p16 and ARF: activation of teenage proteins in old age. The Journal of clinical investigation 114, 1237-1240.

Scheffer, K.D., Gawlitza, A., Spoden, G.A., Zhang, X.A., Lambert, C., Berditchevski, F., and Florin, L. (2013). Tetraspanin CD151 mediates papillomavirus type 16 endocytosis. Journal of virology 87, 3435-3446.

Scheffner, M., Huibregtse, J.M., Vierstra, R.D., and Howley, P.M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505.

155

Schelhaas, M., Ewers, H., Rajamaki, M.L., Day, P.M., Schiller, J.T., and Helenius, A. (2008). Human papillomavirus type 16 entry: retrograde cell surface transport along actin-rich protrusions. PLoS pathogens 4, e1000148.

Schelhaas, M., Shah, B., Holzer, M., Blattmann, P., Kuhling, L., Day, P.M., Schiller, J.T., and Helenius, A. (2012). Entry of human papillomavirus type 16 by actin-dependent, clathrin- and lipid raft- independent endocytosis. PLoS pathogens 8, e1002657.

Scheuermann, J.C., de Ayala Alonso, A.G., Oktaba, K., Ly-Hartig, N., McGinty, R.K., Fraterman, S., Wilm, M., Muir, T.W., and Muller, J. (2010). Histone H2A deubiquitinase activity of the Polycomb repressive complex PR-DUB. Nature 465, 243-247.

Schuettengruber, B., Bourbon, H.M., Di Croce, L., and Cavalli, G. (2017). Genome Regulation by Polycomb and Trithorax: 70 Years and Counting. Cell 171, 34-57.

Schwartz, S. (2000). Regulation of human papillomavirus late gene expression. Ups J Med Sci 105, 171- 192.

Schwartz, Y.B., and Pirrotta, V. (2007). Polycomb silencing mechanisms and the management of genomic programmes. Nat Rev Genet 8, 9-22.

Scotto, L., Narayan, G., Nandula, S.V., Arias-Pulido, H., Subramaniyam, S., Schneider, A., Kaufmann, A.M., Wright, J.D., Pothuri, B., Mansukhani, M., et al. (2008). Identification of copy number gain and overexpressed genes on chromosome arm 20q by an integrative genomic approach in cervical cancer: potential role in progression. Genes Chromosomes Cancer 47, 755-765.

Selinka, H.C., Florin, L., Patel, H.D., Freitag, K., Schmidtke, M., Makarov, V.A., and Sapp, M. (2007). Inhibition of transfer to secondary receptors by heparan sulfate-binding drug or antibody induces noninfectious uptake of human papillomavirus. Journal of virology 81, 10970-10980.

Selinka, H.C., Giroglou, T., Nowak, T., Christensen, N.D., and Sapp, M. (2003). Further evidence that papillomavirus capsids exist in two distinct conformations. Journal of virology 77, 12961-12967.

Selinka, H.C., Giroglou, T., and Sapp, M. (2002). Analysis of the infectious entry pathway of human papillomavirus type 33 pseudovirions. Virology 299, 279-287.

Serra, R.W., Fang, M., Park, S.M., Hutchinson, L., and Green, M.R. (2014). A KRAS-directed transcriptional silencing pathway that mediates the CpG island methylator phenotype. Elife 3, e02313.

Serrano, M., Hannon, G.J., and Beach, D. (1993). A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366, 704-707.

Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593-602.

Shafaroudi, A.M., Mowla, S.J., Ziaee, S.A., Bahrami, A.R., Atlasi, Y., and Malakootian, M. (2008). Overexpression of BMI1, a polycomb group repressor protein, in bladder tumors: a preliminary report. Urol J 5, 99-105.

156

Shen, D.H., Chan, K.Y., Khoo, U.S., Ngan, H.Y., Xue, W.C., Chiu, P.M., Ip, P., and Cheung, A.N. (2005). Epigenetic and genetic alterations of p33ING1b in ovarian cancer. Carcinogenesis 26, 855-863.

Shen, L., Cui, J., Pang, Y.X., Ma, Y.H., and Liu, P.S. (2013). 3-Deazaneplanocin A is a promising therapeutic agent for ovarian cancer cells. Asian Pac J Cancer Prev 14, 2915-2918.

Shen, X., Kim, W., Fujiwara, Y., Simon, M.D., Liu, Y., Mysliwiec, M.R., Yuan, G.C., Lee, Y., and Orkin, S.H. (2009). Jumonji modulates polycomb activity and self-renewal versus differentiation of stem cells. Cell 139, 1303-1314.

Shu, S., and Polyak, K. (2016). BET Bromodomain Proteins as Cancer Therapeutic Targets. Cold Spring Harbor symposia on quantitative biology 81, 123-129.

Simon, J.A., and Lange, C.A. (2008). Roles of the EZH2 histone methyltransferase in cancer epigenetics. Mutat Res 647, 21-29.

Skalska, L., White, R.E., Franz, M., Ruhmann, M., and Allday, M.J. (2010). Epigenetic repression of p16(INK4A) by latent Epstein-Barr virus requires the interaction of EBNA3A and EBNA3C with CtBP. PLoS pathogens 6, e1000951.

Sloan, C.A., Chan, E.T., Davidson, J.M., Malladi, V.S., Strattan, J.S., Hitz, B.C., Gabdank, I., Narayanan, A.K., Ho, M., Lee, B.T., et al. (2016). ENCODE data at the ENCODE portal. Nucleic Acids Res 44, D726-732.

Smith, J.A., Haberstroh, F.S., White, E.A., Livingston, D.M., DeCaprio, J.A., and Howley, P.M. (2014). SMCX and components of the TIP60 complex contribute to E2 regulation of the HPV E6/E7 promoter. Virology 468-470, 311-321.

Smith, J.A., White, E.A., Sowa, M.E., Powell, M.L., Ottinger, M., Harper, J.W., and Howley, P.M. (2010). Genome-wide siRNA screen identifies SMCX, EP400, and Brd4 as E2-dependent regulators of human papillomavirus oncogene expression. Proceedings of the National Academy of Sciences of the United States of America 107, 3752-3757.

Smith, J.L., Lidke, D.S., and Ozbun, M.A. (2008). Virus activated filopodia promote human papillomavirus type 31 uptake from the extracellular matrix. Virology 381, 16-21.

Smith, P.P., Friedman, C.L., Bryant, E.M., and McDougall, J.K. (1992). Viral integration and fragile sites in human papillomavirus-immortalized human keratinocyte cell lines. Genes Chromosomes Cancer 5, 150-157.

Sorlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., et al. (2001). Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proceedings of the National Academy of Sciences of the United States of America 98, 10869-10874.

Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H., Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proceedings of the National Academy of Sciences of the United States of America 100, 8418-8423.

157

Soto, D.R., Barton, C., Munger, K., and McLaughlin-Drubin, M.E. (2017). KDM6A addiction of cervical carcinoma cell lines is triggered by E7 and mediated by p21CIP1 suppression of replication stress. PLoS pathogens 13, e1006661.

Spangle, J.M., and Munger, K. (2010). The human papillomavirus type 16 E6 oncoprotein activates mTORC1 signaling and increases protein synthesis. Journal of virology 84, 9398-9407.

Spoden, G., Freitag, K., Husmann, M., Boller, K., Sapp, M., Lambert, C., and Florin, L. (2008). Clathrin- and caveolin-independent entry of human papillomavirus type 16--involvement of tetraspanin- enriched microdomains (TEMs). PLoS One 3, e3313.

Stauffer, Y., Raj, K., Masternak, K., and Beard, P. (1998). Infectious human papillomavirus type 18 pseudovirions. J Mol Biol 283, 529-536.

Stephens, P.J., Tarpey, P.S., Davies, H., Van Loo, P., Greenman, C., Wedge, D.C., Nik-Zainal, S., Martin, S., Varela, I., Bignell, G.R., et al. (2012). The landscape of cancer genes and mutational processes in breast cancer. Nature 486, 400-404.

Stevaux, O., and Dyson, N.J. (2002). A revised picture of the E2F transcriptional network and RB function. Curr Opin Cell Biol 14, 684-691.

Straight, S.W., Herman, B., and McCance, D.J. (1995). The E5 oncoprotein of human papillomavirus type 16 inhibits the acidification of endosomes in human keratinocytes. Journal of virology 69, 3185-3192.

Stransky, N., Egloff, A.M., Tward, A.D., Kostic, A.D., Cibulskis, K., Sivachenko, A., Kryukov, G.V., Lawrence, M.S., Sougnez, C., McKenna, A., et al. (2011). The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-1160.

Straub, E., Dreer, M., Fertey, J., Iftner, T., and Stubenrauch, F. (2014). The viral E8^E2C repressor limits productive replication of human papillomavirus 16. Journal of virology 88, 937-947.

Struhl, G., and Akam, M. (1985). Altered distributions of Ultrabithorax transcripts in extra sex combs mutant embryos of Drosophila. The EMBO journal 4, 3259-3264.

Suganuma, T., and Workman, J.L. (2011). Signals and combinatorial functions of histone modifications. Annu Rev Biochem 80, 473-499.

Surviladze, Z., Dziduszko, A., and Ozbun, M.A. (2012). Essential roles for soluble virion-associated heparan sulfonated proteoglycans and growth factors in human papillomavirus infections. PLoS pathogens 8, e1002519.

Surviladze, Z., Sterk, R.T., DeHaro, S.A., and Ozbun, M.A. (2013). Cellular entry of human papillomavirus type 16 involves activation of the phosphatidylinositol 3-kinase/Akt/mTOR pathway and inhibition of autophagy. Journal of virology 87, 2508-2517.

Swanton, C., Mann, D.J., Fleckenstein, B., Neipel, F., Peters, G., and Jones, N. (1997). Herpes viral cyclin/Cdk6 complexes evade inhibition by CDK inhibitor proteins. Nature 390, 184-187.

158

Szklarczyk, D., Morris, J.H., Cook, H., Kuhn, M., Wyder, S., Simonovic, M., Santos, A., Doncheva, N.T., Roth, A., Bork, P., et al. (2017). The STRING database in 2017: quality-controlled protein- protein association networks, made broadly accessible. Nucleic Acids Res 45, D362-D368.

Tabrizi, S.N., Brotherton, J.M., Kaldor, J.M., Skinner, S.R., Cummins, E., Liu, B., Bateson, D., McNamee, K., Garefalakis, M., and Garland, S.M. (2012). Fall in human papillomavirus prevalence following a national vaccination program. J Infect Dis 206, 1645-1651.

Takashina, T., Kinoshita, I., Kikuchi, J., Shimizu, Y., Sakakibara-Konishi, J., Oizumi, S., Nishimura, M., and Dosaka-Akita, H. (2016). Combined inhibition of EZH2 and histone deacetylases as a potential epigenetic therapy for non-small-cell lung cancer cells. Cancer Sci 107, 955-962.

Tan, J., Yang, X., Zhuang, L., Jiang, X., Chen, W., Lee, P.L., Karuturi, R.K., Tan, P.B., Liu, E.T., and Yu, Q. (2007). Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells. Genes Dev 21, 1050-1063.

The Gene Ontology, C. (2017). Expansion of the Gene Ontology knowledgebase and resources. Nucleic Acids Res 45, D331-D338.

Tie, F., Banerjee, R., Stratton, C.A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz, M.O., Scacheri, P.C., and Harte, P.J. (2009). CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 136, 3131-3141.

Tuveson, D.A., Shaw, A.T., Willis, N.A., Silver, D.P., Jackson, E.L., Chang, S., Mercer, K.L., Grochow, R., Hock, H., Crowley, D., et al. (2004). Endogenous oncogenic K-ras(G12D) stimulates proliferation and widespread neoplastic and developmental defects. Cancer Cell 5, 375-387.

Van Doorslaer, K., Li, Z., Xirasagar, S., Maes, P., Kaminsky, D., Liou, D., Sun, Q., Kaur, R., Huyen, Y., and McBride, A.A. (2017). The Papillomavirus Episteme: a major update to the papillomavirus sequence database. Nucleic Acids Res 45, D499-D506. van Lohuizen, M., Verbeek, S., Scheijen, B., Wientjens, E., van der Gulden, H., and Berns, A. (1991). Identification of cooperating oncogenes in E mu-myc transgenic mice by provirus tagging. Cell 65, 737-752.

Vande Pol, S.B., and Klingelhutz, A.J. (2013). Papillomavirus E6 oncoproteins. Virology 445, 115-137.

Viens, L.J., Henley, S.J., Watson, M., Markowitz, L.E., Thomas, C.C., Thompson, T.D., Razzaghi, H., and Saraiya, M. (2016). Human Papillomavirus-Associated Cancers - United States, 2008-2012. MMWR Morb Mortal Wkly Rep 65, 661-666.

Voigt, P., Tee, W.W., and Reinberg, D. (2013). A double take on bivalent promoters. Genes Dev 27, 1318-1338. von Knebel Doeberitz, M. (2002). New markers for cervical dysplasia to visualise the genomic chaos created by aberrant oncogenic papillomavirus infections. Eur J Cancer 38, 2229-2242.

Vonlanthen, S., Heighway, J., Altermatt, H.J., Gugger, M., Kappeler, A., Borner, M.M., van Lohuizen, M., and Betticher, D.C. (2001). The bmi-1 oncoprotein is differentially expressed in non-small cell lung cancer and correlates with INK4A-ARF locus expression. British journal of cancer 84, 1372-1376.

159

Walboomers, J.M., Jacobs, M.V., Manos, M.M., Bosch, F.X., Kummer, J.A., Shah, K.V., Snijders, P.J., Peto, J., Meijer, C.J., and Munoz, N. (1999). Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. The Journal of pathology 189, 12-19.

Wang, J.L., Zheng, B.Y., Li, X.D., Nokelainen, K., Angstrom, T., Lindstrom, M.S., and Wallin, K.L. (2005). p16INK4A and p14ARF expression pattern by immunohistochemistry in human papillomavirus-related cervical neoplasia. Mod Pathol 18, 629-637.

Wang, Q., Griffin, H., Southern, S., Jackson, D., Martin, A., McIntosh, P., Davy, C., Masterson, P.J., Walker, P.A., Laskey, P., et al. (2004). Functional analysis of the human papillomavirus type 16 E1=E4 protein provides a mechanism for in vivo and in vitro keratin filament reorganization. Journal of virology 78, 821-833.

Weikert, S., Christoph, F., Kollermann, J., Muller, M., Schrader, M., Miller, K., and Krause, H. (2005). Expression levels of the EZH2 polycomb transcriptional repressor correlate with aggressiveness and invasive potential of bladder carcinomas. Int J Mol Med 16, 349-353.

Weinmann, A.S., Bartley, S.M., Zhang, T., Zhang, M.Q., and Farnham, P.J. (2001). Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol Cell Biol 21, 6820-6832.

White, E.A., Kramer, R.E., Tan, M.J., Hayes, S.D., Harper, J.W., and Howley, P.M. (2012). Comprehensive analysis of host cellular interactions with human papillomavirus E6 proteins identifies new E6 binding partners and reflects viral diversity. Journal of virology 86, 13174- 13186.

White, E.A., Munger, K., and Howley, P.M. (2016). High-Risk Human Papillomavirus E7 Proteins Target PTPN14 for Degradation. MBio 7.

WHO (2016). Human papillomavirus (HPV) and cervical cancer Fact sheet.

Williams, D.S., Bird, M.J., Jorissen, R.N., Yu, Y.L., Walker, F., Zhang, H.H., Nice, E.C., and Burgess, A.W. (2010). Nonsense mediated decay resistant mutations are a source of expressed mutant proteins in colon cancer cell lines with microsatellite instability. PLoS One 5, e16012.

Winters, A.C., and Bernt, K.M. (2017). MLL-Rearranged Leukemias-An Update on Science and Clinical Approaches. Front Pediatr 5, 4.

Woodham, A.W., Da Silva, D.M., Skeate, J.G., Raff, A.B., Ambroso, M.R., Brand, H.E., Isas, J.M., Langen, R., and Kast, W.M. (2012). The S100A10 subunit of the annexin A2 heterotetramer facilitates L2-mediated human papillomavirus infection. PLoS One 7, e43519.

Wu, L., Lee, S.Y., Zhou, B., Nguyen, U.T., Muir, T.W., Tan, S., and Dou, Y. (2013). ASH2L regulates ubiquitylation signaling to MLL: trans-regulation of H3 K4 methylation in higher eukaryotes. Mol Cell 49, 1108-1120.

Wysocka, J., Swigut, T., Milne, T.A., Dou, Y., Zhang, X., Burlingame, A.L., Roeder, R.G., Brivanlou, A.H., and Allis, C.D. (2005). WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. Cell 121, 859-872.

160

Xu, K., Wu, Z.J., Groner, A.C., He, H.H., Cai, C., Lis, R.T., Wu, X., Stack, E.C., Loda, M., Liu, T., et al. (2012). EZH2 oncogenic activity in castration-resistant prostate cancer cells is Polycomb- independent. Science 338, 1465-1469.

Yan, J., Li, Q., Lievens, S., Tavernier, J., and You, J. (2010). Abrogation of the Brd4-positive transcription elongation factor B complex by papillomavirus E2 protein contributes to viral oncogene repression. Journal of virology 84, 76-87.

Yap, K.L., Li, S., Munoz-Cabello, A.M., Raguz, S., Zeng, L., Mujtaba, S., Gil, J., Walsh, M.J., and Zhou, M.M. (2010). Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol Cell 38, 662-674.

Yoon, C.S., Kim, K.D., Park, S.N., and Cheong, S.W. (2001). alpha(6) Integrin is the main receptor of human papillomavirus type 16 VLP. Biochem Biophys Res Commun 283, 668-673.

You, J., Croyle, J.L., Nishimura, A., Ozato, K., and Howley, P.M. (2004). Interaction of the bovine papillomavirus E2 protein with Brd4 tethers the viral DNA to host mitotic chromosomes. Cell 117, 349-360.

Yu, G.Z., Zhu, M.H., Zhu, Z., Ni, C.R., Zheng, J.M., and Li, F.M. (2004). Genetic alterations and reduced expression of tumor suppressor p33(ING1b) in human exocrine pancreatic carcinoma. World J Gastroenterol 10, 3597-3601.

Yuan, G., Ma, B., Yuan, W., Zhang, Z., Chen, P., Ding, X., Feng, L., Shen, X., Chen, S., Li, G., et al. (2013). Histone H2A ubiquitination inhibits the enzymatic activity of H3 lysine 36 methyltransferases. The Journal of biological chemistry 288, 30832-30842.

Yuan, W., Wu, T., Fu, H., Dai, C., Wu, H., Liu, N., Li, X., Xu, M., Zhang, Z., Niu, T., et al. (2012). Dense chromatin activates Polycomb repressive complex 2 to regulate H3 lysine 27 methylation. Science 337, 971-975.

Zeitler, J., Hsu, C.P., Dionne, H., and Bilder, D. (2004). Domains controlling cell polarity and proliferation in the Drosophila tumor suppressor Scribble. The Journal of cell biology 167, 1137- 1146.

Zhang, P., Du, J., Sun, B., Dong, X., Xu, G., Zhou, J., Huang, Q., Liu, Q., Hao, Q., and Ding, J. (2006). Structure of human MRG15 chromo domain and its binding to Lys36-methylated histone H3. Nucleic Acids Res 34, 6621-6628.

Zhao, K.N., Liu, W.J., and Frazer, I.H. (2003). Codon usage bias and A+T content variation in human papillomavirus genomes. Virus Res 98, 95-104.

Zheng, Z.M., and Baker, C.C. (2006). Papillomavirus genome structure, expression, and post- transcriptional regulation. Front Biosci 11, 2286-2302.

Zhou, H., Schmidt, S.C., Jiang, S., Willox, B., Bernhardt, K., Liang, J., Johannsen, E.C., Kharchenko, P., Gewurz, B.E., Kieff, E., et al. (2015). Epstein-Barr virus oncoprotein super-enhancers control B cell growth. Cell Host Microbe 17, 205-216.

161

Zhou, J., Liu, W.J., Peng, S.W., Sun, X.Y., and Frazer, I. (1999). Papillomavirus capsid protein expression level depends on the match between codon usage and tRNA availability. Journal of virology 73, 4972-4982.

Zimmermann, H., Degenkolbe, R., Bernard, H.U., and O'Connor, M.J. (1999). The human papillomavirus type 16 E6 oncoprotein can down-regulate p53 activity by targeting the transcriptional coactivator CBP/p300. Journal of virology 73, 6209-6219.

162

APPENDIX 1

163

Figure A.1: Expression of screen hits ASXL1 and BRD4 in HPV16 E7 expressing HFKs through RT- qPCR. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01.

164

Table A.1: List of genes targeted by the CP0010 lentiviral shRNA epigenetic library (Broad Institute) used in screen.

Gene Symbol Gene ID # targeting hairpins

GFP -10 83

eGFP -44 80

BFP -40 65

Luciferase -43 25

LUCIFERASE -14 25

lacZ -15 20

RFP -12 19

LacZ -42 13

lacZsigma -16 12

pCopGreen -13 3

tGFP -11 3

AANAT 15 5

ACIN1 22985 7

AIRE 326 7

AKAP1 8165 6

ALG13 79868 5

ALKBH1 8846 5

ALKBH2 121642 5

ALKBH3 221120 7

ANKRD32 84250 7

ARCN1 372 3

ARID1A 8289 7

ARID1B 57492 5

165

Table A.1: (Continued).

ARID2 196528 6

ARID3A 1820 7

ARID3B 10620 7

ARID3C 138715 5

ARID4A 5926 7

ARID4B 51742 7

ARID5A 10865 7

ARID5B 84159 7

ARRB1 408 5

AS3MT 57412 7

ASF1A 25842 7

ASF1B 55723 7

ASH1L 55870 7

ASH2L 9070 7

ASXL1 171023 7

ASZ1 136991 5

ATAD2 29028 6

ATAD2B 54454 6

ATF7IP 55729 5

ATRX 546 5

AURKA 6790 6

AURKAPS1 6791 2

AURKB 9212 5

BAHCC1 57597 5

166

Table A.1: (Continued).

BAHD1 22893 5

BAZ1A 11177 7

BAZ1B 9031 5

BAZ2A 11176 7

BAZ2B 29994 7

BCOR 54880 5

BMI1 648 5

BPTF 2186 5

BRCA1 672 5

BRD1 23774 7

BRD2 6046 7

BRD3 8019 7

BRD4 23476 7

BRD7 29117 7

BRD8 10902 7

BRD9 65980 7

BRDT 676 7

BRPF1 7862 5

BRPF3 27154 7

BRWD1 54014 7

BRWD3 254065 7

C10orf32-AS3MT 100528007 7

C14orf169 79697 5

C14orf43 91748 4

167

Table A.1: (Continued).

C20orf20 55257 7

C20orf7 79133 7

CARM1 10498 6

CBX1 10951 6

CBX2 84733 7

CBX3 11335 7

CBX4 8535 7

CBX5 23468 7

CBX6 23466 5

CBX7 23492 7

CBX8 57332 6

CCNT1 904 5

CCNT2 905 5

CD2BP2 10421 7

CDC73 79577 7

CDK9 1025 6

CDYL 9425 7

CDYL2 124359 7

CECR2 27443 5

CHAF1A 10036 7

CHAF1B 8208 5

CHD1 1105 7

CHD2 1106 7

CHD3 1107 7

168

Table A.1: (Continued).

CHD4 1108 7

CHD5 26038 7

CHD6 84181 7

CHD7 55636 7

CHD8 57680 7

CHD9 80205 7

CHMP1B 57132 7

CHMP2A 27243 7

CHMP2B 25978 5

CHMP4A 29082 7

CHMP4B 128866 7

CHMP4C 92421 5

CHMP5 51510 5

CHMP6 79643 7

CHRAC1 54108 7

CLEC2D 29121 3

CLOCK 9575 5

COMMD3-BMI1 100532731 5

COQ3 51805 7

CRAMP1L 57585 5

CREBBP 1387 5

CTCF 10664 6

CTCFL 140690 5

CXXC1 30827 7

169

Table A.1: (Continued).

DEAF1 10522 7

DICER1 23405 5

DIDO1 11083 7

DMAP1 55929 7

DNAJC1 64215 5

DNAJC2 27000 5

DNMT1 1786 7

DNMT3A 1788 5

DNMT3B 1789 7

DNMT3L 29947 5

DOT1L 84444 5

DPF1 8193 7

DPF2 5977 7

DPF3 8110 6

ECE2 9718 7

EED 8726 7

EHMT1 79813 7

EHMT2 10919 4

EIF2S2 8894 3

EIF5B 9669 5

ELP3 55140 6

EP400 57634 5

EPC1 80314 7

EPC2 26122 7

170

Table A.1: (Continued).

ERCC8 1161 5

EZH1 2145 7

EZH2 2146 7

FBXL19 54620 6

FBXO11 80204 7

FOS 2353 5

FTO 79068 5

G2E3 55632 7

GATAD2A 54815 7

GATAD2B 57459 7

GFI1B 8328 4

GMEB1 10691 5

GMEB2 26205 6

GSG2 83903 7

GTF3C4 9329 4

HAT1 8520 5

HDAC1 3065 7

HDAC10 83933 7

HDAC11 79885 7

HDAC2 3066 7

HDAC3 8841 7

HDAC4 9759 7

HDAC5 10014 7

HDAC6 10013 7

171

Table A.1: (Continued).

HDAC7 51564 7

HDAC8 55869 7

HDAC9 9734 7

HELLS 3070 5

HEMK1 51409 5

HIF1AN 55662 7

HIF3A 64344 7

HIRA 7290 7

HLTF 6596 5

HMG20A 10363 7

HMG20B 10362 7

HMGA1 3159 5

HMGB1 3146 8

HMGB2 3148 5

HMGB3 3149 6

HMGB4 127540 6

HMGN1 3150 7

HMGN2 3151 5

HMGN3 9324 7

HMGN4 10473 7

HMGN5 79366 5

HMGXB4 10042 7

HOXD3 3232 7

HR 55806 7

172

Table A.1: (Continued).

HSPBAP1 79663 5

HUWE1 10075 5

IL4I1 259307 7

ING1 3621 7

ING2 3622 7

ING3 54556 7

ING4 51147 4

ING5 84289 7

INO80 54617 5

INTS12 57117 5

JARID2 3720 7

JHDM1D 80853 5

JMJD1C 221037 7

JMJD4 65094 7

JMJD5 79831 7

JMJD6 23210 6

JMJD7 100137047 5

JMJD8 339123 7

KAT2A 2648 7

KAT2B 8850 7

KAT5 10524 7

KAT6A 7994 7

KAT6B 23522 6

KAT7 11143 7

173

Table A.1: (Continued).

KAT8 84148 7

KDM1A 23028 7

KDM1B 221656 7

KDM2A 22992 7

KDM2B 84678 7

KDM3A 55818 7

KDM3B 51780 7

KDM4A 9682 7

KDM4B 23030 7

KDM4C 23081 7

KDM4D 55693 7

KDM4DL 390245 3

KDM5A 5927 6

KDM5B 10765 7

KDM5C 8242 7

KDM5D 8284 7

KDM6A 7403 8

KDM6B 23135 5

KIAA1456 57604 6

KLHDC3 116138 7

KLHDC9 126823 5

KTI12 112970 5

LBR 3930 7

MAEL 84944 5

174

Table A.1: (Continued).

MAOA 4128 7

MAOB 4129 7

MAP3K12 7786 7

MBD1 4152 7

MBD2 8932 7

MBD3 53615 7

MBD4 8930 5

MBD5 55777 5

MBD6 114785 7

MDM2 4193 7

MDM4 4194 7

MECOM 2122 5

MECP2 4204 7

MEN1 4221 5

METTL13 51603 7

METTL17 64745 5

METTL7A 25840 5

METTL7B 196410 7

MGEA5 10724 6

MIER1 57708 5

MIER2 54531 4

MIER3 166968 5

MINA 84864 7

MIS18BP1 55320 5

175

Table A.1: (Continued).

MLL 4297 6

MLL2 8085 7

MLL3 58508 7

MLL4 9757 6

MLL5 55904 7

MLLT1 4298 5

MLLT10 8028 7

MLLT3 4300 5

MLLT6 4302 7

MORF4L1 10933 6

MORF4L2 9643 5

MPHOSPH8 54737 7

MSL1 339287 7

MSL3 10943 7

MTA1 9112 5

MTA2 9219 5

MTA3 57504 3

MTF2 22823 7

MTOR 2475 3

MYSM1 114803 5

NAA60 79903 5

NAP1L1 4673 5

NAP1L2 4674 7

NAP1L3 4675 4

176

Table A.1: (Continued).

NAP1L4 4676 7

NAP1L5 266812 7

NASP 4678 6

NAT10 55226 5

NAT14 57106 4

NAT6 24142 5

NAT8 9027 5

NAT8B 51471 8

NAT8L 339983 4

NAT9 26151 5

NCAPD2 9918 7

NCAPD3 23310 7

NCOA3 8202 6

NCOR1 9611 5

NCOR2 9612 5

NHP2L1 4809 3

NIPBL 25836 7

NPM1 4869 6

NPTXR 23467 5

NSD1 64324 7

ORC1 4998 7

PADI4 23569 5

PAOX 196743 6

PAX5 5079 5

177

Table A.1: (Continued).

PAXIP1 22976 5

PBRM1 55193 7

PCGF6 84108 5

PDS5A 23244 5

PDS5B 23047 7

PHB 5245 5

PHC1 1911 7

PHC2 1912 7

PHC3 80012 7

PHF1 5252 7

PHF10 55274 7

PHF11 51131 6

PHF12 57649 7

PHF13 148479 7

PHF14 9678 7

PHF15 23338 7

PHF16 9767 7

PHF17 79960 7

PHF19 26147 6

PHF2 5253 7

PHF20 51230 7

PHF20L1 51105 7

PHF21A 51317 5

PHF21B 112885 7

178

Table A.1: (Continued).

PHF23 79142 7

PHF3 23469 5

PHF6 84295 7

PHF7 51533 7

PHF8 23133 7

PHIP 55023 7

PHRF1 57661 7

PICK1 9463 5

PIWIL2 55124 6

PIWIL4 143689 5

PML 5371 5

PPARGC1A 10891 5

PPOX 5498 7

PRDM1 639 7

PRDM10 56980 7

PRDM11 56981 7

PRDM12 59335 7

PRDM13 59336 7

PRDM14 63978 7

PRDM15 63977 4

PRDM16 63976 7

PRDM2 7799 8

PRDM4 11108 7

PRDM5 11107 7

179

Table A.1: (Continued).

PRDM6 93166 5

PRDM7 11105 7

PRDM8 56978 7

PRDM9 56979 7

PRM3 58531 2

PRMT1 3276 7

PRMT2 3275 7

PRMT3 10196 7

PRMT5 10419 7

PRMT6 55170 6

PRMT7 54496 7

PRMT8 56341 7

PSMA1 5682 3

PSMB2 5690 4

PSMD1 5707 3

PYGO1 26108 7

PYGO2 90780 6

RAI1 10743 7

RAN 5901 3

RB1 5925 5

RBBP4 5928 7

RBBP5 5929 6

RBBP7 5931 6

RBM14 10432 5

180

Table A.1: (Continued).

RCC1 1104 7

RCOR1 23186 5

RCOR2 283248 5

RCOR3 55758 4

RERE 473 5

RING1 6015 5

RNF17 56163 7

RNF2 6045 6

RNF20 56254 5

RNF40 9810 5

RPL5 6125 3

RPS11 6205 3

RPS15A 6210 3

RPS4X 6191 4

RPS6KA5 9252 5

RPS7 6201 3

RPS9 6203 3

RSF1 51773 7

RUVBL1 8607 5

RUVBL2 10856 5

SAMD11 148398 7

SAP130 79595 5

SAP18 10284 5

SAP30 8819 5

181

Table A.1: (Continued).

SAP30L 79685 7

SAT1 6303 5

SATB1 6304 5

SATB2 23314 4

SENP3 26168 5

SENP3-EIF4A1 100533955 4

SET 6418 5

SETBP1 26040 7

SETD1A 9739 7

SETD1B 23067 5

SETD2 29072 7

SETD3 84193 7

SETD4 54093 7

SETD5 55209 4

SETD6 79918 5

SETD7 80854 7

SETD8 387893 7

SETDB1 9869 5

SETDB2 83852 7

SETMAR 6419 5

SHPRH 257218 7

SIN3A 25942 7

SIN3B 23309 7

SIRT1 23411 7

182

Table A.1: (Continued).

SIRT2 22933 7

SIRT3 23410 5

SIRT4 23409 7

SIRT5 23408 7

SIRT6 51548 7

SIRT7 51547 7

SMARCA1 6594 7

SMARCA2 6595 7

SMARCA4 6597 7

SMARCA5 8467 7

SMARCAD1 56916 5

SMARCAL1 50485 6

SMARCB1 6598 7

SMARCC1 6599 5

SMARCC2 6601 7

SMARCD1 6602 7

SMARCD2 6603 5

SMARCD3 6604 7

SMARCE1 6605 7

SMC1A 8243 7

SMC1B 27127 7

SMC2 10592 5

SMC3 9126 7

SMC4 10051 7

183

Table A.1: (Continued).

SMCHD1 23347 5

SMN1 6606 14

SMN2 6607 14

SMNDC1 10285 7

SMOX 54498 7

SMYD1 150572 7

SMYD2 56950 6

SMYD3 64754 5

SMYD4 114826 7

SMYD5 10322 5

SND1 27044 7

SNRPE 6635 3

SP110 3431 5

SP140 11262 8

SP140L 93349 7

SPTY2D1 144108 7

SRCAP 10847 5

SS18 6760 7

SS18L1 26039 7

SS18L2 51188 4

SSRP1 6749 5

STAG1 10274 7

STAG2 10735 7

STAG3 10734 14

184

Table A.1: (Continued).

STAG3L1 54441 9

STAG3L2 442582 5

STAG3L3 442578 9

STK31 56164 7

SUDS3 64426 7

SUPT3H 8464 5

SUPT4H1 6827 5

SUPT5H 6829 5

SUPT6H 6830 5

SUPT7L 9913 5

SUV39H1 6839 7

SUV39H2 79723 7

SUV420H1 51111 7

SUV420H2 84787 7

SUZ12 23512 5

SYCP1 6847 7

TADA1 117143 5

TADA2A 6871 6

TADA2B 93624 5

TADA3 10474 5

TAF1 6872 7

TAF10 6881 5

TAF12 6883 5

TAF3 83860 7

185

Table A.1: (Continued).

TAF5 6877 5

TAF5L 27097 6

TAF6L 10629 5

TAF8 129685 5

TAF9 6880 5

TCF19 6941 4

TCF20 6942 6

TCF3 6929 5

TDRD1 56165 7

TDRD12 91646 5

TDRD3 81550 7

TDRD5 163589 5

TDRD6 221400 7

TDRD7 23424 7

TDRD9 122402 7

TDRKH 11022 7

TERF1 7013 6

TERF2 7014 5

TET1 80312 5

THUMPD2 80745 6

TMEM189- 387522 4 UBE2V1

TNP2 7142 5

TNRC18 84629 5

186

Table A.1: (Continued).

TOPBP1 11073 6

TP53 7157 5

TRAF7 84231 5

TRDMT1 1787 7

TRERF1 55809 5

TRIM24 8805 5

TRIM28 10155 7

TRIM33 51592 7

TRIM66 9866 5

TRMT5 57570 2

TRRAP 8295 7

TTF1 7270 5

TXNDC12 51060 5

TYW5 129450 7

UBE2A 7319 5

UBE2B 7320 5

UBE2E1 7324 5

UBE2I 7329 5

UBE2N 7334 5

UBE2V1 7335 5

UBR7 55148 7

UHRF1 29128 7

UHRF2 115426 7

USP22 23326 5

187

Table A.1: (Continued).

UTY 7404 5

WBSCR22 114049 7

WBSCR27 155368 7

WHSC1 7468 7

WHSC1L1 54904 5

YEATS2 55689 5

YEATS4 8089 5

ZFP57 346171 5

ZMYND11 10771 7

ZMYND8 23613 7

ZNF541 84215 5

188

Figure A.2: Effects on cell viability of shRNA depletion of additional screen hits and polycomb proteins in HPV16 E6/E7 expressing HFKs two days post transduction.

189

Figure A.2: (Continued).

190

Figure A.3: Treatment of HPV-negative and HPV-positive carcinoma lines with KDM6B/A inhibitor, GSK-J4, and pan-selective jumonji demethylase inhibitor, JIB-04. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01, **** P < 0.0001.

191

Figure A.3: (Continued).

192

Figure A.4: Impact of various culturing methods on expression of p16INK4A through RT-qPCR and lifespan in culture.

193

Figure A.4: (Continued).

194

Figure A.5: Hydroxyurea treatment of HFKs induces p16INK4A and KDM6B expression. Levels were determined by RT-qPCR. Statistically significant changes are indicated: ns not significant, *P < 0.05, ***P < 0.001.

195

Figure A.6: Inducible expression of HPV16 E7, p16INK4A, and KDM6B in HFKs as determined by RT- qPCR using the pLIX system for doxycycline-inducible HPV16 E7 expression. Statistically significant changes are indicated: ns not significant, *P < 0.05, **P < 0.01.

196