Proc. Natl. Acad. Sci. USA Vol. 84, pp. 2130-2134, April 1987 Biochemistry Two promoters, one inducible and one constitutive, control transcription of the Streptomyces lividans galactose operon (galactose induction kinetics/galactokinase gene fusion/Sl nuclease mapping) JAMES A. FORNWALD*, FRANCIS J. SCHMIDT*t, CRAIG W. ADAMS*t, MARTIN ROSENBERG*, AND MARY E. BRAWNER*§ *Department of Molecular Genetics, Smith Kline & French Laboratories, 709 Swedeland Road, Swedeland, PA 19479; and tDepartment of Biochemistry, University of Missouri, Columbia, MO 65212 Communicated by Allan M. Campbell, November 14, 1986 (received for review August 1, 1986)

ABSTRACT Galactose utilization in Streptomyces lividans set of genes in Streptomyces lividans because it is subject to was shown to be controlled by an operon that is induced in the glucose repression (10) and galactose induction (11). This presence of galactose and repressed by glucose. Two promot- paper describes the isolation and characterization of the ers, gaIPi and galP2, which direct transcription of two distinct promoters that direct transcription of the St. lividans gal polycistronic transcripts, have been identified. galPI is located operon. We demonstrate that the St. lividans galactose immediately upstream of the operon and is induced in the utilization genes are organized within a polycistronic operon. presence of galactose. This promoter directs transcription of Transcription of the gal operon is controlled by two inde- the gaiT, gaIE, and galK genes. The second promoter, gaLP2, pendently regulated promoters: galPI, which is responsible is located within the operon just upstream of the gaIE gene. for galactose-dependent transcription of the operon, and This promoter is responsible for constitutive transcription of galP2, a constitutive promoter that directs transcription of the galE and galK genes. Comparison of the S. lividans gal the galE and galK genes. operon to the Escherichia coligal operon indicates the presence of a constitutive promoter positioned upstream ofgalE in both MATERIALS AND METHODS operons. We suggest that coupling the operon's constitutive promoter to the galE gene fulfills a physiological requirement Bacterial Strains and Plasmids. The Streptomyces strains for constitutive UDPgalactose 4-epimerase expression in Strep- used in this study were St. lividans 1326 (12) and St. lividans tomyces. 12K, galK12 (11). E. coli strain K21, which is a galK derivative of MM294 (13), was constructed by phage P1 The coordinate activation of sets of genes often involves transduction of the galK mutation from C600K- (14). complex combinations of regulatory signals. Many basic Plasmid pK21 was constructed by ligation of the EcoRI- concepts about the mechanisms of gene expression in bac- HindIII fragment from pSK03 (15), which contains the teria were formulated from work with the carbon catabolic Streptomyces fertility factor SCP2 replication and stability and amino acid biosynthetic operons of Escherichia coli (1, functions (16), to the EcoRI-HindIII fragment of pK04 (14), 2). There are, however, many organisms that utilize different which contains the E. coli galK gene and the pBR322 origin regulatory mechanisms to accomplish the same metabolic of replication. Fragments containing the galPI or galP2 events. For example, the genes responsible for galactose promoters were inserted upstream of the galK gene using the utilization in E. coli are organized within a polycistronic unique HindIll and BamHI sites. Standard procedures were operon. The operon is transcribed from two overlapping used for transformation of E. coli (17) and St. lividans (18). promoters, PI and P2. The PI promoter is positively acti- Galactokinase Assays. St. lividans was grown in 1 liter of vated by a cAMP-receptor protein, whereas P2 is repressed SLAB medium [0.1% (NH4)2SO4/0.2% L-asparagine/0.9% upon PI activation. Both promoters are negatively regulated K2HPO4/0.1% NaH2PO4/0.2% yeast extract/0.05% MgC12/ by the gal repressor (3). The galactose utilization genes of 0.001% CaCl2/0.2% trace elements (19)]. After 18 hr at 280C Saccharomyces cerevisiae are also clustered and coordinate- in a triple-baffled, fernbach flask, 100 ml of the culture was ly expressed. However, each gene is transcribed from its own harvested for galactokinase assays. The remainder of the promoter. The promoters are negatively controlled by the culture was divided into 300-ml samples to which galactose, gal80 gene product and positively activated by the gal4 gene glucose, or both galactose and glucose were each added to a product (4). As in E. coli, galactose utilization in Sa. final concentration of 1% (wt/vol). Galactokinase expression cerevisiae is subject to catabolite repression. Catabolite was measured enzymatically (14, 20) or was visualized by repression in Sa. cerevisiae, however, is not mediated by immunoblotting (11). cAMP but by the hexokinase isoenzyme PII (5, 6). Thus, the Si Nuclease Mapping. St. lividans 1326 was grown in 50 ml processes that control gene activation reflect both the unique of Ym (0.3% yeast extract/0.5% Bacto-peptone/0.3% malt biology of individual organisms and universal principles of extract/5 mM MgCl2) containing 1% glucose. After 18 hr at gene expression. 280C, the cells were harvested, washed with an equal volume We are interested in gene regulation in the Gram positive, of SLAB medium and then resuspended in 50 ml of SLAB differentiating bacterium Streptomyces. Members of this medium. Ten milliliters of the washed cell suspension was genus express a variety of interesting gene sets including used to inoculate 50 ml of Ym containing 1% galactose or 1% those responsible for its morphological differentiation (7) and glucose. After 14 hr ofgrowth, the cells were quick-cooled by the biosynthesis ofantibiotics (8, 9). We have chosen to study the galactose utilization operon as an example of a regulated Abbreviations: GAL-RNA, RNA isolated from S. lividans grown in the presence ofgalactose; GLU-RNA, RNA isolated from S. lividans grown in the presence of glucose. The publication costs of this article were defrayed in part by page charge T-Present address: Beckman Instruments, Inc., 200 S. Kraemer payment. This article must therefore be hereby marked "advertisement" Boulevard, Brea, CA 92621. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed.

2130 Downloaded by guest on September 28, 2021 Biochemistry: Fornwald et al. Proc. Natl. Acad. Sci. USA 84 (1987) 2131 the addition of 50 ml of 20 mM NaN3 in 95% ethanol that had A been cooled to -70'C. RNA was isolated by phenol extrac- 12 tion and centrifugation through a cushion of 5.7 M CsCl (21). RNA (75 gg) was hybridized to a 5' end-labeled DNA fragment (22), which was present in excess. The hybridiza- tion temperature was 3-40C above the melting temperature of the probe. The hybridization reaction was terminated by adding one-fifth of the reaction mixture to 0.1 ml of S1 buffer (0.28 M NaCl/0.05 M NaOAc, pH 4.6/4.5 mM ZnSO4) containing 50, 150, or 300 units of S1 nuclease. ImE

0. RESULTS 0 0. Galactose Induction of the St. lividans galK Gene. We r-JE previously demonstrated that galactokinase synthesis is in- ducible when St. lividans is grown in medium containing 0 galactose (11). Here, we examine in more detail the kinetics of galactokinase expression 1, 3, and 6 hr after the addition E of galactose, glucose, or both galactose and glucose to the c growth medium (Fig. 1A). A significant increase in galacto- kinase activity was observed 1 hr after the addition of galactose. Galactose induction continued for 6 hr. After 6 hr, no further increase in galactokinase activity was observed (data not shown). When glucose and galactose were added simultaneously to the medium, galactokinase levels were 2 4 6 50% less than those in the presence of galactose alone. No Time after sugar addition, hr induction ofgalactokinase expression was observed when St. lividans was grown in the presence ofglucose. Interestingly, B O hr 1 hr 3 hr 6 hr when St. lividans is grown in glucose, the basal levels of [- galactokinase expression are significantly higher than the -J D-JD -J D n < i < -i < J < J < n nonspecific background produced by a galK mutant host, St. 0 O0 CD CDo C0J CD 0 0 C00CD lividans 12K (11). Apparently, even when uninduced, St. lividans expresses a high basal level of galactokinase. -- The St. lividans gal Operon Is Transcribed as Two Polycis- tronic mRNAs. The St. lividans galK gene was cloned in E. "illi. coli by complementation of an E. coli galK mutant. E. coli Il _ w galT and galE mutants were also complemented by the same 4.5-kilobase (kb) HindIII-Sac I fragment that contains the St. * - Sa - lividans galK gene (Fig. 2), which suggests that these genes 4 are tightly linked. The gene organization and structure of the galactose utilization genes within the HindIII-Sac I fragment were determined by (i) complementation of E. coli galT, galE, or galK mutants and (ii) complete DNA sequencing (unpublished results). This analysis showed that the genes are organized in the order galT galE galK, and they are tran- FIG. 1. Effects of galactose (GAL), glucose (GLU), and both scribed in the same direction. These results suggest that the galactose and glucose (GAL/GLU) on galactokinase synthesis in St. St. lividans galT, galE, and galK genes might comprise part lividans 1326. Galactokinase synthesis was followed for 6 hr after the addition of galactose, glucose, or both galactose and glucose. (A) or all of an operon. Kinetics of galactokinase induction. (B) Identification of galacto- To determine the operon organization of the galT, galE, kinase produced in St. lividans during galactokinase induction by and galK genes, transcripts encoded by this gene cluster were immunoblotting (11). Galactokinase purified from E. coli (outside identified by S1 nuclease mapping. The DNA fragments used lanes of the gel) was used as a molecular weight standard. in these mapping experiments were a series of overlapping fragments covering the entire operon from the 5' end of the gal operon transcript, produced only in the presence of galT gene to the 3' end of the galK gene. End-labeled DNA galactose, is approximately 600 bases upstream of the Bgl II fragments were hybridized to RNA isolated from St. lividans site. grown in the presence of galactose (GAL-RNA) or glucose (GLU-RNA). Our analysis identified 5' ends for only two P" c0 - _O a c_$-IP- 0>3 0 transcripts, and hence it suggests that the expression of the CP > 0,> acs) operon is directed from two transcription start sites. Three I Z cIO ll Qa- z LlJ representative examples of the S1 analysis are shown in Fig. 3. galT galE galK The 5' end of one transcript was localized using a 690-base Pl pair (bp) Nru I-Bgl II fragment, which contains 130 bp that are upstream of the 5' end of galT and 560 bp of the galT P2 coding sequence (Fig. 3A). A 600-base segment of this 1 kb= I fragment was protected from S1 nuclease digestion selec- tively by GAL-RNA (Fig. 3A, lane 3). No protection of this FIG. 2. Restriction map of the St. lividans gal operon. The fragment was observed with GLU-RNA (lane 2) or yeast location and orientation of the operon's structural genes are shown tRNA (lane 1). These results indicate that the 5' end of one by arrows. P1 and P2, promoters galPi and galP2, respectively. Downloaded by guest on September 28, 2021 2132 Biochemistry: Fornwald et al. Proc. Natl. Acad. Sci. USA 84 (1987)

C 2 3

- 872 B 2 3 - 603 FULL LENGTH

- 310 281 - 271 --- 0 - 234 2 3 A 310 FULL LENGTH 271 - 194 -FULL LENGTH t-603 bp .4 - 234

. - 310 - 281 - 271 - 234 -0* :Wla - 194 - 118 - 194

H) - rn 0 6 = E 0 0 0- 0 I ~~Is z ?L U) U i z z V) Cf) 2 z

gal PI C&& A 0-. 90 09=L > o C.)0 Z 100 bp= I gal P2 - pUC Atoop Send gal E Vend galK

FIG. 3. S1 mapping of the gal operon transcripts. (A) The 5' end of the TEK transcript was localized using a 690-bp Nru I-Bgl II fragment. (B) The 5' end ofthe galEK transcript was localized using a 300-bp EcoRI-Sal I fragment. (C) The galE/galK intercistronic region was examined using a 620-bp Pvu II-Nar I fragment. Each of the probes was hybridized to yeast tRNA (lanes 1), GLU-RNA (lanes 2), or GAL-RNA (lanes 3). Shown at the bottom of each panel is a partial restriction map of the fragments used in the S1 mapping analysis. An * denotes the position of the 5' end-label. Molecular weight standards consisted of end-labeled, Hae III-digested 4X174 DNA.

The 5' end of the second gal operon transcript was No additional 5' ends were identified by S1 analysis, and localized using a 300-bp EcoRI-Sal I fragment (Fig. 3B). This hence only two mRNAs are transcribed from the gal operon. fragment consists of 20 bp of the polylinker sequence from The 5' end of one transcript, designated galTEK, mapped pUC18 (23) and a 280-bp Pvu II-Sal I fragment, which near the 5' end of the galT gene. The 5' end of the second contains 80 bp of the galT 3' end, 95 bp of the galT/galE intercistronic region, and 105 bp ofthe galE coding sequence. A 200-base segment of the EcoRI-Sal I fragment was pro- A B GGTCA /A tected from S1 nuclease digestion when it was hybridized to AC CSI A either GLtJ-RNA (Fig. 3B, lane 2) or GAL-RNA (lane 3). The 194-bast segment protected from S1 nuclease digestion (lanes -12 G A 2 and 3) appears to be an artifact created during S1 nuclease G digestion; it was not observed during high-resolution S1 C +1 mapping of this transcript (Fig. 4B). These data indicate that G the 5' end of a second gal operon transcript, produced in the presence of glucose or galactose, is approximately 200 bases upstream of the Sal I site. G When this same EcoRI-Sal I fragment was hybridized with A G +8 GAL-RNA, a second S1 nuclease-protected segment was detected (Fig. 3B, lane 3). The second protected segment : +1 comigrated with the entire Pvu II-Sal I fragment (data not shown). This fragment presumably resulted from protection by the same galactose-specific RNA identified above. Transcription across the galE/galK intercistronic region c was similarly examined. As shown at the bottom of Fig. 3C, the galE/galKjunction is contained within a 268-bp Sau3Ai- T \A +9 d_:~~C Nar I fragment. Within this fragment are 155 bp ofthe 3' end ofgalE, the 38-bp galE/galKjunction, and 75 bp ofthe 5' end ;E;~~C of galK. When this fragment was 5' end-labeled at the Nar I F. cL co site, the entire 268-base segment was protected from S1 5' gaiT 3 gaiT 5' ga/E nuclease digestion both with GLU-RNA (lane 2) and GAL- ga/Pl ga/P2 RNA (lane 3), indicating the absence of a transcription start site within To assess the galE/galK intercistronic region. FIG. 4. High-resolution S1 mapping of the galTEK transcript (A) whether transcription continued through the galE/galKjunc- and galEK transcript (B). The 5' end of the galTEK transcript was tion, the Sau3Al-Nar I fragment containing the galE/galK identified using a 160-bp Tha I-Taq I fragment. The 5' end of the intercistronic region was 3' end-labeled at the Sau3Ai site. galEK transcript was identified using a 210-bp Pvu 11-Ban I frag- The entire 268-base fragment was protected from S1 nuclease ment. An * denotes the position of the 5' end-label. DNA sequence digestion with both GLU-RNA and GAL-RNA (data not assignments were made by running base-specific chemical cleavage These results show that all traverses fragments (33) in parallel. The position ofthe 5' end has been adjusted shown). transcription to account for differences in mobility between the S1 nuclease- the galE/galK junction. Transcription through this region protected fragment and the chemical cleavage fragments (24). The presumably initiates at the two potential start sites defined numbers indicate the nucleotide position within the DNA sequence above. relative to the 5' end of the transcript. Downloaded by guest on September 28, 2021 Biochemistry: Fornwald et al. Proc. Natl. Acad. Sci. USA 84 (1987) 2133 transcript, designated galEK, mapped within the galT/galE Table 1. Rates of galactokinase expression intercistronic region. To determine the extent of the operon Units of galactokinase traversed by each transcript, it was necessary to distinguish between hybridization to the galTEK or galEK transcript in Plasmid GAL GLU GAL/GLU the S1 mapping experiments. The transcripts could be dis- pK21 150 500 470 tinguished because the galTEK transcript was selectively pK21galPJ 13,360 1,020 3,850 induced by galactose, whereas galEK RNA was expressed pK21galP2 4,760 5,520 3,200 independently of the carbon source. Therefore, the S1 Galactokinase units are expressed as pmol of [14C]galactose protection pattern observed in the GAL-RNA hybridizations phosphate per mg of protein per min. Galactokinase expression was defined the region encompassed by the galTEK transcript, assayed 6 hr after the addition of galactose (GAL), glucose (GLU), whereas the GLU-RNA hybridizations defined the extent of or both galactose and glucose (GAL/GLU). the galEK transcript. The results show that the galTEK transcript extends through the entire gal operon from the 5' end of galT to within 50 bp downstream of the galK 3' end. with the differential expression pattern observed for the gal The galEK transcript traverses only the galE and galK genes operon transcripts. We conclude that the galTEK mRNA and extends from the 5' end of galE to within 50 bp results from transcription directed by a galactose-inducible downstream of the 3' end of the galK gene. Apparently both promoter designated galPi and that the galEK transcript transcripts share a common termination region which is originates from a constitutive promoter designated galP2 downstream of the galK gene. (Fig. 2). Precise Positioning of the 5' Ends of the gal Operon Tran- scripts. More precise mapping ofthe 5' ends ofthe gal operon DISCUSSION transcripts was accomplished by high-resolution S1 mapping. We have shown that galactose utilization in St. lividans A number of S1 nuclease-protected fragments were detected involves induction of a polycistronic operon containing the from mapping the 5' end of the galTEK transcript (Fig. 4A). galT, galE, and galK genes. Furthermore, galactose induc- We are uncertain if these fragments represent multiple 5' tion of the operon is regulated, in a large part, at the level of ends from this transcript or ifthey are artifacts created during transcription. Two promoters have been identified, which are the S1 nuclease digestion. The most abundant of these totally separate and are independently regulated. Transcrip- fragments is 71 bp from the Taq I site or 26 bases from the tion from the galactose-inducible promoter, galPi, results in inferred galT translation initiation codon. The 5' end of the a polycistronic mRNA, which contains the galT, galE, and galEK transcript is 120 bp from the Ban I site or 5 bases from galK coding regions. A second promoter, galP2, directs the the inferred galTtranslation termination codon (Fig. 4B). The transcription ofanother polycistronic mRNA containing both sequences surrounding each of these apparent transcription the galE and galK coding sequences. Transcription from start sites and the proposed 5' nucleotide start for both galP2 is responsible for the significant basal levels of transcripts are shown in Fig. 5. galactokinase observed in the absence ofgalactose induction. Two Promoters Regulate Expression of the St. lividans gal Other examples of clustered gene sets recently isolated Operon. The 5' ends of the gal operon transcripts defined from Streptomyces include those responsible for glycerol above could be derived either from transcription initiation (gly) utilization (25) and actinorhodin (act) (8) and methyl- events and/or from RNA processing. To distinguish between enomycin (mmr) (9) biosynthesis. Gene disruption analysis of these alternatives, we tested fragments containing the 5' ends these gene sets suggests that these genes are organized within ofthe St. lividans gal operon transcripts directly for promoter polycistronic operons (9, 25, 26). Detailed transcriptional activity by gene fusion experiments (11, 15). Each fragment analysis of the gly, act, and mmr gene sets should reveal the was cloned upstream of the E. coli galK gene in a low copy molecular details of operon organization for these gene sets. number gene fusion vector, pK21. The two fragments used in The St. lividans gal operon exhibits some similarities to the this analysis were (i) the 1.1-kb HindIII-Bgl II fragment E. coli gal operon. Both are polycistronic operons that are containing 550 bp upstream of the 5' end of the galTEK galactose induced. Galactose induction of these operons is transcript and 560 bp of galT coding sequence and (ii) the inhibited by glucose. Transcription of both operons is regu- 1.5-kb Bgl II-Mlu I fragment containing 450 bp upstream of lated by two promoters, and both operons exhibit rather high the 5' end of the galEK transcript, the 95 bp galTIgalE basal levels ofgalactokinase due to constitutive transcription intercistronic region, and 920 bp ofthe galE coding sequence from one of these promoters. Although superficially similar, (Fig. 2). the molecular details of the operons are quite distinct. Galactokinase expression was stimulated by both frag- The promoter organization of the St. lividans gal operon ments (Table 1). More importantly, the HindIII-Bgl II differs markedly from the organization of the E. coli operon. fragment directed galactokinase synthesis selectively in the The promoters that regulate the E. coli operon overlap and presence of galactose. Promoter activity was repressed by are located at the 5' end of the operon. The St. lividans glucose as shown by a reduction in galactokinase levels when operon has two totally separate promoters. One promoter is galactose and glucose were added to the growth medium. In at the 5' end ofthe operon, and the second overlaps the 3' end contrast, the Bgl II-Mlu I fragment activated comparable of the first gene and the operon's first intercistronic bound- levels of galactokinase regardless of the carbon source used ary. Interestingly, the change in promoter organization has in the growth medium (Table 1). Hence, the promoter been accompanied by a change in gene organization. The activities defined in these fusion experiments are consistent gene order of the St. lividans operon is galT galE galK,

- -35 -10 +1 gal Pi TTGTTTGATTGTGAT.GT-ACAGGGGGGTGGTGGGTTGTGATGTbTTATGTTTGATTGTGTT>GG

.1 gal P2 CTCCACCTGGAACTTTTCACTTCCGCCGTACGTCCGGCAAGCTGAAGTTCCTCG FIG.5. Nucleotide sequence of the galP1 and galP2 promoter regions. The transcription start sites are indicated as +1. The -10 and -35 regions are indicated above the sequence. The direct repeat sequences are indicated by horizontal arrows. Downloaded by guest on September 28, 2021 2134 Biochemistry: Fornwald et al. Proc. Natl. Acad Sci. USA 84 (1987)

whereas the gene order of the E. coli operon is galE galT Miller, J. H. & Reznikoff, W. S. (Cold Spring Harbor Labo- galK. Note that in both operons the constitutive promoter is ratory, Cold Spring Harbor, NY), pp. 303-324. positioned upstream of the galE gene. As described below, 4. Oshima, Y. (1982) in The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, eds. this may have important physiological relevance to the Strathern, J. N., Jones, E. W. & Broach, J. R. (Cold Spring organism's ability to utilize galactose. Harbor Laboratory, Cold Spring Harbor, NY), pp. 159-180. Internal promoters in E. coli have been identified within a 5. Matsumoto, K., Uno, I., Ishikawa, T. & Oshima, Y. (1983) J. number of operons including those that encode the /34,' (27), Bacteriol. 156, 898-900. a (28), and ao (29) subunits of RNA polymerase and the 6. Entian, K.-D., Kopetzki, E., Frohlich, K.-U. & Mecke, D. enzymes for tryptophan biosynthesis (30). It seems likely that (1984) Mol. Gen. Genet. 198, 50-54. internal promoters ensure expression of certain distal genes 7. Chater, K. F. (1984) in Microbial Development, eds. Losick, during different physiological conditions. The St. lividans R. & Shapiro, L. (Cold Spring Harbor Laboratory, Cold Spring galP2 promoter may also serve this purpose. In both E. coli Harbor, NY), pp. 89-116. 8. Malpartida, F. & Hopwood, D. A. (1984) Nature (London) and St. lividans, UDPgalactose 4-epimerase is expressed 309, 462-464. constitutively because the constitutive promoter is immedi- 9. Chater, K. F. & Bruton, C. J. (1985) EMBO J. 4, 1893-1897. ately upstream of the galE gene. In E. coli it is known that 10. Hodgson, D. A. (1982) J. Gen. Microbiol. 128, 2417-2430. UDPgalactose 4-epimerase is required for cell wall biosyn- 11. Brawner, M. E., Auerbach, J. I., Fornwald, J. A., Rosenberg, thesis whether or not galactose is the carbon source (3). We M. & Taylor, D. P. (1985) Gene 40, 191-201. suspect that in St. lividans there is a similar requirement for 12. Lomovskaya, N. D., Mkrtumian, N. M., Gostimskaya, N. L. constitutive UDPgalactose 4-epimerase expression and that & Danilenko, V. N. (1972) J. Virol. 9, 258-262. the internal, constitutive galP2 promoter fulfills this require- 13. Meselson, M. & Yuan, R. (1968) Nature (London) 217, 1110- ment. 1114. 14. McKenney, K., Shimatake, H., Court, D., Schmeissner, U. & The mechanism by which glucose represses galactose Rosenberg, M. (1981) in Gene Amplification and Analysis: induction of the St. lividans gal operon is at present unclear. Structural Analysis of Nucleic Acids, eds. Chirikjian, J. & No direct evidence has been found that indicates any role of Papas, T. (Elsevier, New York), Vol. 2, pp. 383-415. cAMP during glucose repression in Streptomyces coelicolor 15. Rosenberg, M., Brawner, M., Gorman, J. & Reff, M. (1986) in (10). Glucose clearly inhibits galactose uptake (10). Thus, Genetic Engineering, eds. Setlow, J. K. & Hollaender, A. glucose may repress galactose induction of the St. lividans (Plenum, New York), Vol. 8, pp. 151-180. gal operon, at least in part, by galactose exclusion. 16. Lydiate, D. J., Malpartida, F. & Hopwood, D. A. (1985) Gene The sequences upstream ofthe apparent transcription start 35, 223-235. sites for galPI and galP2 (Fig. 5) show no obvious regions of 17. Cohen, S. N., Chang, A. C. Y. & Hsu, L. (1973) Proc. Natl. Acad. Sci. USA 69, 2110-2114. homology with each other. In fact, the sequence composition 18. Thompson, C. J., Ward, J. M. & Hopwood, D. A. (1982) J. of these regions differs dramatically. The region extending Bacteriol. 151, 668-677. from +1 to -50 of the galPI promoter is A+T-rich (46%), 19. Hopwood, D. A. & Wright, H. M. (1978) Mol. Gen. Genet. which is far below the average G+C content ofStreptomyces 162, 307-317. DNA, which is 72-74% G+C (31). The analogous region 20. Wilson, D. B. & Hogness, D. S. (1966) Methods Enzymol. 8, within galP2 is slightly G+C-rich (54%). Two direct repeat 229-240. sequences are found within galPl. One is an imperfect 12-bp 21. Glisin, V., Crkvenjakov, R. & Byus, C. (1974) Biochemistry repeat positioned upstream of the -35 and -10 regions. The 13, 2633-2637. second is an imperfect 15-bp repeat that lies upstream of the 22. Berk, A. J. & Sharp, P. A. (1978) Proc. Natl. Acad. Sci. USA 75, 1274-1278. -35 region and overlaps the transcription start site (Fig. 5). 23. Yanish-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33, The role of these repeat sequences in galPI promoter 103-119. function and galactose induction is at present unclear. Final- 24. Sollner-Webb, B. & Reeder, R. H. (1979) Cell 18, 485-499. ly, the apparent total lack of homology between the Strep- 25. Seno, E. T., Bruton, C. J. & Chater, K. F. (1984) Mol. Gen. tomyces gal promoters suggests that different factors may be Genet. 193, 119-128. required for transcription from each of these promoters. St. 26. Hopwood, D. A., Bibb, M. J., Chater, K. F., Janssen, G., coelicolor has been shown to contain at least two different Malpartida, F. & Smith, C. P. (1986), in Regulation of Gene forms of RNA polymerase that differ in their promoter Expression, eds. Booth, I. & Higgins, C. (Cambridge Univ. recognition specificities (32). Thus, it is possible that expres- Press, Cambridge, England), pp. 251-276. 27. Barry, G., Squires, C. & Squires, C. (1979) Proc. Natl. Acad. sion of the St. lividans gal operon involves not only repres- Sci. USA 76, 4922-4926. sion and/or activation of galPi in response to galactose but 28. Cerretti, D. P., Dean, D., Davis, G. R., Bedwell, D. M. & also regulation dependent upon differential recognition ofthe Nomura, M. (1983) Nucleic Acids Res. 11, 2599-2616. galPI and galP2 promoters by different RNA polymerase 29. Taylor, W. E., Straus, D. B., Grossman, A. D., Burton, holoenzymes. Z. F., Gross, C. A. & Burgess, R. R. (1984) Cell 38, 371-381. 30. Jackson, E. N. & Yanofsky, C. (1972) J. Mol. Biol. 69, We thank J. Westpheling for helpful discussions and comments on 307-313. the manuscript, M. Hughes for coordination of the artwork, and M. 31. Enquist, L. W. & Bradley, S. C. (1971) Dev. Ind. Microbiol. McCullough for secretarial assistance. 12, 225-236. 1. Pastan, I. & Perlman, R. (1970) Science 169, 339-344. 32. Westpheling, J., Ranes, M. & Losick, R. (1985) Nature (Lon- 2. Kolter, R. & Yanofsky, C. (1982) Annu. Rev. Genet. 16, don) 313, 22-27. 113-134. 33. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65, 3. de Crombrugghe, B. & Pastan, I. (1980) in The Operon, eds. 499-580. Downloaded by guest on September 28, 2021