DOCSLIB.ORG

Cyclic AMP-Dependent Constitutive Expression of Gal Operon: Use of Repressor Titration to Isolate Operator Mutations (Promoters/Plasmid/Escheriehia Coli) M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cyclic AMP-Dependent Constitutive Expression of Gal Operon: Use of Repressor Titration to Isolate Operator Mutations (Promoters/Plasmid/Escheriehia Coli) M Proc. Natl. Acad. Sci. USA Vol. 80, pp. 4775-4779, August 1983 Genetics Cyclic AMP-dependent constitutive expression of gal operon: Use of repressor titration to isolate operator mutations (promoters/plasmid/Escheriehia coli) M. IRANI*, L. OROSZt, S. BUSBYt, T. TANIGUCHIO, AND S. ADHYAS Lahoratorv of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205 Communicated by Bernard D. Davis, April 1, 1983 ABSTRACT When the gal operator region is present in a mul- described here showed constitutive synthesis of gal enzymes ticopy plasmid it binds to all ("titrates") the gal repressor and "in- only in cya+ cells and not in cya- cells. duces" the chromosomal gal operon. To make operator mutations (Oa) with reduced affinity toward the repressor, plasmid DNA was MATERIALS AND METHODS irradiated with UV light and mutant derivatives were isolated that were unable to release the chromosomal gal genes from repres- The E. coli K-12 strains used in this study are C600 (F- thi- sion. Then with such an Oa plasmid operator revertants were iso- thr- leu- lacY- suII), SA1293 (Hfr H thi- galRss), SA1293C lated that had reacquired the ability to release repression. Both (SA1293 ilv-2: :TnlO cya-1039), and Ml101 [F- his- str relAl sets of mutations have been localized by DNA sequence analysis. lac- lacPuv5 A(gal-bio) A(galR-lysA)]. All other strains used, When the Oa mutations were transferred from the plasmid to the including those described in Table 1, were derived from Ml101 chromosome by recombination these mutant operators were found by a single or successive steps of P1 phage transduction with to make gal expression constitutive (independent of repressor) but appropriate markers. The ilv-2:TnlO and cya-854 alleles pres- still dependent on cAMP, whereas the previously reported gal op- ent in some of the strains originated from BM4468 of A. Camp- erator mutants (0C) are constitutive both in the presence and in bell and CA8306 of J. Beckwith, respectively. Phage strains the absence of cAMP. The titration method of isolating mutants AcI857 A(attL-int)313 A(gal)165, AcI857lySA galR,8, and Plkc enables the isolation of strains with operator mutations that also are from our collection. The AcI857 gal8dc transducing phage affect normal promoter activity, and it provides an easy way to was obtained from D. Court and is described in Fig. 2. isolate revertants of operator mutations. The media composition are from Miller (9). Ampicillin and tetracycline were used at' 50 and 15 ,ug/ml, respectively. AgalOa The initial controlling step of a negatively regulated operon is phage, described in Results, were distinguished from AgalO+ the modulation of transcription initiation from its promoter by by spotting on methyl f-D-thiogalactoside/galactose minimal binding of specific repressor molecules with the operator site agar plates, seeded with a Agal (Ak) strain. On this plate cells (1).'The operator is usually identified by mutations (QC) that constitutively making gal enzymes grow but those that are in- make the operon constitutive but do not affect the promoter. ducible do not (8). However, when the operator and promoter loci overlap, con- Restriction enzymes, RNA polymerase, phage T4 DNA li- ventional selection would preclude the isolation of strains with gase, and pBR322 DNA were from Bethesda Research Labo- operator mutations located in the overlap region. In this paper ratories or New England BioLabs and were used as recom- we describe a method for isolating the full range of gal operator mended by them. Calf intestinal alkaline phosphatase was from mutations with a reduced affinity for gal repressor. Boehringer, polynucleotide kinase from P-L Biochemicals, and The gal operon can be transcribed from either of its two hydrazine, dimethyl sulfate, and piperidine from Eastman-Ko- overlapping promoters, PG1 or PG2 (Fig. 1; refs. 3, 6, and 7; dak. Kinase and epimerase assay reagents were from Sigma. unpublished data). On gal DNA, pGi-promoted transcription The radioisotopes [ y-32P]ATP and [a-32P]UTP were supplied starts at +1 position (S1), and PG2 at -5 (S2). cAMP and its by New England Nuclear and ['4C]galactose by Amersham. The receptor protein (CRP) regulate the activities of PGi and PG2 in CRP was a gift from J. Krakow. opposite ways, stimulating transcription from PG1 and inhib- The plasmid DNAs were prepared by lysing the cells with iting transcription at PG2. Thus, synthesis beginning at Si pre- Triton X-100 followed by chromatography on Sepharose 4B dominates in wild-type (cya+) cells, and synthesis beginning at (Pharmacia) (10). DNA fragments for RNA transcription, DNA S2 predominates in adenylate cyclase mutants (cya-). Analysis sequence analysis, or protection against DNase digestion were of promoter mutations and other studies have established that separated on polyacrylamide gels and extracted by the methods cAMP-CRP binds at a single target site (cat), located around described by Maxam and Gilbert (11). For ligation, the DNA position -35. Binding at this site is responsible for both stim- ulation of transcription at PGI and inhibition at PG2 (2, 4, 5). The Abbreviations: CRP, cAMP receptor protein; bp, base pair(s); Gal', ga- gal repressor protein, the product of the galR gene, regulates lactose-utilizing; Gal-, galactose-negative; TMGs, sensitive to methyl both the promoters (6, 8). The operator defined by several Oc ,B3D-thiogalactoside; AmpR, ampicillin resistant. mutations and galR- mutations derepress the synthesis of the * Present address: Dept. of Biochemistry, University of Washington, gal enzymes and they do it in both cya+ and cya- cells-i.e., Seattle, WA 98195. they make both and PG2 constitutive. t Present address: Dept. of Genetics, Attila Jozsef -University, Szeged, PGI Hungary. Unlike the previously reported OC mutants, the 03 mutants t Present address: Institut Pasteur, Dept. Biologie Moleculaire, Paris, France. The publication costs of this article were defrayed in part by page charge § Present address: Dept. of Biochemistry, Kouchi Medical College, payment. This article must therefore be hereby marked "advertise- Nangoku-Shi, Kouchi, Japan. ment" in accordance with 18 U.S.C. §1734 solely to indicate this fact. ¶To whom reprint requests should be addressed. 4775 Downloaded by guest on September 27, 2021 4776 Genetics: lrani et al. Proc. Natl. Acad. Sci. USA 80 (1983) pMl3 EcoRi I Hind III I I I I AN galE K 1L gaIT 1L gal i I -_ ,' OPERATOR CAT '9 GT - _ _ '9'9 ~~~~CA '9 ~~~~~~~~0'33,3 -137 -80 -70 - 60 -50 -40 -30 -20 -10 +1 +10 +45 CCAA---GGCTAAATTCTTGTGTAAACGATTCCACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTITATG TATGGTTATTTCATACCATAAG ---CCG GGTT---CCGATTTAAGAACACATTTGCTAA&GTGATTAAATAAGGTACAGTGTSiAAA AGCGTAGAAACAATAC T ACCI TAAAGTATGGTATTC---GGC B1 °38°034°S°4 S2 ACT A T A TGA T A T SI 01e3 0e3o5 G T C A FIG. 1. Structure of the plasmid pMI3 as described in ref. 2 and the gal operon ofEscherichia coli. The gal controlling region covers the two transcription starts S1 (+ 1) and S2 (-5) and their respective promoters, including the Pribnow sequences (boxed regions) (3), the cat site around the -35 region (4), and the operator segment around -58 (5). The coordinates referto the start point ofthe cAMP CRP-dependentgal transcription, S1, taken to be + 1. The operator is amplified and shows the sequence changes associated with the three oa mutations, Ol, Oa, and O', described in this paper along with seven O' mutations, including O°1, described before (5, 6). The plasmid pMI3 carries the regulatory region extending from +45 to -187, between the HindMI and EcoRI sites of pBR322. The BstEII restriction site present at +42 has been used to reconstitute the intact gal operon from pMI3 as described in the text and Fig. 2. Small square indicates base protected by cAMP CRP from methylation by dimethyl sulfate. Wavy underlinings indicate protection against DNase digestion by cAMP*CRP at the 3' side of the indicated base (4). fragments were isolated from agarose gels by the perchlorate that reduces the binding of the repressor to the plasmid gal method (12). Transformations were performed with host cells operators, it would fail to derepress the chromosomal gal genes. that were.aged for 3-24 hr in 75 mM CaCl2 on ice. To perform the current study, we inserted a small fragment of For DNA sequence analysis, the plasmid DNA was opened gal DNA containing all known control sites into plasmid pBR322. with HindIll and the 5' ends were labeled with polynucleotide The resultant plasmid, pMI3, harbors a 270-bp piece of gal DNA kinase. After digestion with EcoRI, the 270-base-pair (bp) frag- that contains the operator, two promoters (including the two ment was isolated from a 5% (wt/vol) polyacrylamide gel and transcription start sites), and the coding sequence for the first its sequence was determined by the method of Maxam and Gil- six amino acids of the galE cistron (Fig. 1). When pMI3 (galO+) bert (11). is introduced into a strain (SA1293) carrying a gal super-re- For UV light mutagenesis, host cells were irradiated with 13 pressor mutation, galRS, it changes the cell phenotype from J/m2 and were transformed immediately with DNA samples galactose-negative (Gal-) to galactose-utilizing (Gal'). Thus, previously.irradiated with a dose of 540 J/m2. For isolation of SA1293/pMI3 grows on galactose minimal agar plates and forms revertants, cells were grown overnight in the presence of N- red colonies on MacConkey galactose agar plates. SA1293 with- methyl-N'-nitro-N-nitrosoguanidine at 100 pug/ml in LB me- out the plasmid does not grow on minimal galactose and forms dium. white colonies on MacConkey galactose agar plates, because Epimerase and kinase assay conditions have been described the super-repressor binds to the operator even in the presence previously (13).
Load more

Recommended publications
  • Transcriptional Units
    Proc. Natl. Acad. Sci. USA Vol. 76, No. 7, pp. 3194-3197, July 1979 Biochemistry Cyclic AMP as a modulator of polarity in polycistronic transcriptional units (positive regulation/rho factor/lactose and galactose operons/catabolite repression) AGNES ULLMANNt, EVELYNE JOSEPHt, AND ANTOINE DANCHINt tUnite de Biochimie Cellulaire, Institut Pasteur, 75724 Paris Cedex 15, France; and tInstitut de Biologie Physico-Chimique, 75005 Paris, France Communicated by Frangois Jacob, April 16, 1979 ABSTRACT The degree of natural polarity in the lactose scribed by Watekam et al. (7, 8) in sonicated bacterial extracts. and galactose operons of Escherichia coli is affected by aden- One unit is the amount of enzyme that converts 1 nmol of osine 3',5'-cyclic monophosphate (cAMP). This effect, mediated substrate per min at 280C (except for UDPGal epimerase, for by the cAMP receptor protein, is exerted at sites distinct from the promoter. Experiments performed with a mutant bearing which the assay temperature was 220C). a thermosensitive rho factor activity indicate that cAMP relieves Reagents and Enzymes. They were obtained from the fol- polarity by interfering with transcription termination. Con- lowing companies: trimethoprim from Calbiochem; all radio- flicting results in the literature concerning the role of cAMP active products from Amersham; isopropyl-f3-D-thiogalactoside receptor protein and cAMP in galactose operon expression can (IPTG), D-fucose, cAMP, UDPglucose dehydrogenase, and all be reconciled by the finding that cAMP stimulates the expres- substrates from Sigma; and all other chemicals from Merck. sion of operator distal genes without significantly affecting the proximal genes. Therefore, it appears necessary to reevaluate the classification o(the galactose operon as exhibiting cAMP- RESULTS mediated catabolite repression at the level of transcription Natural Polarity in Lactose Operon.
    [Show full text]
  • Sudips Revised Thesis
    Investigation Of The Behavior Of The Gal4 Inhibitor Gal80 Of The GAL Genetic Switch In The Yeast Saccharomyces Cerevisiae Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Sudip Goswami, M.S. Graduate Program in Molecular Genetics The Ohio State University 2014 Dissertation Committee Dr. James Hopper, Advisor Dr. Stephen Osmani Dr. Hay-Oak Park Dr. Jian-Qiu Wu ii Copyright by Sudip Goswami 2014 iii ABSTRACT The DNA-binding transcriptional activator Gal4 and its regulators Gal80 and Gal3 constitute a galactose-responsive switch for the GAL genes of Saccharomyces cerevisiae. Gal4 binds to upstream activation sequences or UASGAL sites on GAL gene promoters as a dimer both in the absence and presence of galactose. In the absence of galactose, a Gal80 dimer binds to and masKs the Gal4 activation domain, inhibiting its activity. In the presence of galactose, Gal3 interacts with Gal80 and relieves Gal80’s inhibition of Gal4 activity allowing rapid induction of expression of GAL genes. In the first part of this work (Chapter 2) in-vitro chemical crosslinking coupled with SDS PAGE and native PAGE analysis were employed to show that the presence of Gal3 that can interact with Gal80 impairs Gal80 self association. In addition, live cell spinning disK confocal imaging showed that dissipation of newly discovered Gal80-2mYFP/2GFP clusters in galactose is dependent on Gal3’s ability to interact with Gal80. In the second part (Chapter 3), extensive analysis of Gal80 clusters was carried out which showed that these clusters associate strongly with the GAL1-10-7 locus and this association is dependent on the presence of the UASGAL sites at this locus.
    [Show full text]
  • NADP, Corepressor for the Bacillus Catabolite Control Protein Ccpa
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 9590–9595, August 1998 Microbiology NADP, corepressor for the Bacillus catabolite control protein CcpA JEONG-HO KIM,MARTIN I. VOSKUIL, AND GLENN H. CHAMBLISS* Department of Bacteriology, University of Wisconsin-Madison, E. B. Fred Hall, Madison, WI 53706 Communicated by T. Kent Kirk, University of Wisconsin, Madison, WI, June 10, 1998 (received for review February 12, 1998) ABSTRACT Expression of the a-amylase gene (amyE)of (18), and the presence of a conserved effector-binding domain Bacillus subtilis is subject to CcpA (catabolite control protein in CcpA (3) together strongly suggest the necessity of an A)-mediated catabolite repression, a global regulatory mech- effector(s) such as a corepressor to activate CcpA. To date, anism in Bacillus and other Gram-positive bacteria. To deter- HPr, a phosphocarrier protein in the phosphoenolpyruvate- mine effectors of CcpA, we tested the ability of glycolytic :sugar phosphotransferase system, and two glycolytic metab- metabolites, nucleotides, and cofactors to affect CcpA binding olites, fructose-1,6-diphosphate (FDP) and glucose-6- to the amyE operator, amyO. Those that stimulated the phosphate, have been proposed as effectors of CcpA (19–22). DNA-binding affinity of CcpA were tested for their effect on HPr is phosphorylated in two different fashions: ATP- transcription. HPr-P (Ser-46), proposed as an effector of dependent phosphorylation at Ser-46 and phosphoenolpyru- CcpA, also was tested. In DNase I footprint assays, the affinity vate-dependent phosphorylation at His-15 (23). In the ptsH1 of CcpA for amyO was stimulated 2-fold by fructose-1,6- mutant strain, the serine residue at position 46 of HPr is diphosphate (FDP), 1.5-fold by oxidized or reduced forms of replaced with an alanine, which eliminates phosphorylation of NADP, and 10-fold by HPr-P (Ser-46).
    [Show full text]
  • Studies with the Escherichia Coli Galactose Operon Regulatory Region Carrying a Point Mutation That Simultaneously Inactivates T
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Volume 219, number 1, 189-196 FEB 04899 July 1987 Studies with the Escherichia coli galactose operon regulatory region carrying a point mutation that simultaneously inactivates the two overlapping promoters Interactions with RNA polymerase and the cyclic AMP receptor protein Sreenivasan Ponnambalarn, Annick Spassky* and Stephen Busby Department of Biochemistry, University of Birmingham, PO Box 363, Birmingham B15 2TT, England and *D~partement de Biologie Molbculaire, lnstitut Pasteur, 25 Rue du Dr Roux, 75724 Paris Cedex 15, France Received 22 April 1987 We report in vitro studies of the interactions between purified E. coli RNA polymerase and DNA from the regulatory region of the E. coli galactose operon which carries a point mutation that simultaneously stops transcription initiation at the two normal start points, $1 and $2. In the presence of this point muta- tion, transcription initiates at a third start point 14/15 bp downstream of $1, showing that inactivation of the two normally active promoters, P1 and P2, unmasks a third weaker promoter, P3. Transcription initia- tion in the gal operon is normally regulated by the cyclic AMP receptor protein, CRP, that binds to the gal regulatory region and switches transcription from P2 to PI. With the point mutation, CRP binding swit- ches transcription from P3 to P1, although the formation of transcriptionally competent complexes at P1 is very slow. The results are discussed with respect to the mechanism of transcription activation by the CRP factor and the similarities between the regulatory regions of the galactose and lactose operons.
    [Show full text]
  • Chapter 21 Operons: Fine Control of Bacterial Transcription
    Chapter 21 Operons: Fine Control of Bacterial Transcription The E. coli genome contains over 3000 genes. Some of these are active all the time because their products are in constant demand. But some of them are turned off most of the time because their products are rarely needed. For example, the enzymes required for the metabolism of the sugar arabinose would be useful only when arabinose is present and when the organism’s favorite energy source, glucose, is absent. Such conditions are not common, so the genes encoding these enzymes are usually turned off. Why doesn’t the cell just leave all its genes on all the time, so the right enzymes are always there to take care of any eventuality? The reason is that gene expression is an expensive process. It takes a lot of energy to produce RNA and protein. In fact, if all of an E. coli cell’s genes were turned on all the time, production of RNAs and proteins would drain the cell of so much energy that it could not compete with more effi cient organisms. Thus, control of gene expression is essential to life. Gene regulation is the device to insure that proteins are synthesized in exactly the amounts they are needed and only when they are needed. Transcriptional regulation: gene expression is controlled by regulatory proteins Negative regulation: - A repressor protein inhibits transcription of a specific gene. - In this case, inducer (antagonist of the repressor) is needed to allow transcription. Positive regulation: - Activator works to increase the frequency of transcription of an gene (operon) Transcriptional regulation: gene expression is controlled by regulatory proteins Operons Operons and the resulting transcriptional regulation of gene expression permit prokaryotes to rapidly adapt to changes in the environment: new carbon sources, lack of an amino acid, etc.
    [Show full text]
  • The Regulation of Transcription Initiation in Bacteria
    Annual Reviews www.annualreviews.org/aronline Ann.Rev. Genet. 1985. 19:35547 Copyright© 1985 by AnnualReviews Inc. All rights reserved THE REGULATION OF TRANSCRIPTIONINITIATION IN BACTERIA William S. Reznikoff I, Deborah A. Siegele 2, Deborah W. Cowingz, and2 Carol A. Gross Departmentsof Biochemistry~ andBacteriology 2, Collegeof Agriculturaland Life Sciences, Universityof Wisconsin,Madison, Wisconsin 53706 CONTENTS INTRODUCTION..................................................................................... 355 PROMOTERSTRUCTURE ......................................................................... 356 THEREGULATION OF E~TM TRANSCRIPTIONINITIATION ............................ 360 NegativeRegulation of TranscriptionInitiation ............................................. 361 Positive Regulationof TranscriptionInitiation .............................................. 363 DNATopology Regulation of TranscriptionInitiation ...................................... 365 DNAModification and the Regulationof GeneExpression ............................... 366 MODIFICATION OF HOLOENZYMESTRUCTURE AND THE REGULATION OF GENEEXPRESSION ................................................................... 366 E. coil ~r7° .......................................................................................... 367 ~2 by University of Wisconsin - Madison on 03/29/07. For personal use only. The HeatShock Response and ~r ............................................................. 368 The E. coli ntrA (glnF) Protein: AnotherSigma Factor ..................................
    [Show full text]
  • Molecular Mechanisms of Transcription Initiation at Gal Promoters and Their Multi-Level Regulation by Galr, CRP and DNA Loop
    Biomolecules 2015, 5, 2782-2807; doi:10.3390/biom5042782 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review Molecular Mechanisms of Transcription Initiation at gal Promoters and their Multi-Level Regulation by GalR, CRP and DNA Loop Dale E.A. Lewis * and Sankar Adhya Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892-4255, USA; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-301-496-9129; Fax: +1-301-496-2212. Academic Editors: Sivaramesh Wigneshweraraj and Deborah M. Hinton Received: 11 May 2015 / Accepted: 25 September 2015 / Published: 16 October 2015 Abstract: Studying the regulation of transcription of the gal operon that encodes the amphibolic pathway of D-galactose metabolism in Escherichia coli discerned a plethora of principles that operate in prokaryotic gene regulatory processes. In this chapter, we have reviewed some of the more recent findings in gal that continues to reveal unexpected but important mechanistic details. Since the operon is transcribed from two overlapping promoters, P1 and P2, regulated by common regulatory factors, each genetic or biochemical experiment allowed simultaneous discernment of two promoters. Recent studies range from genetic, biochemical through biophysical experiments providing explanations at physiological, mechanistic and single molecule levels. The salient observations highlighted here are: the axiom of determining transcription start points, discovery of a new promoter element different from the known ones that influences promoter strength, occurrence of an intrinsic DNA sequence element that overrides the transcription elongation pause created by a DNA-bound protein roadblock, first observation of a DNA loop and determination its trajectory, and piggybacking proteins and delivering to their DNA target.
    [Show full text]
  • Isolation of the Gal Repressor (E
    Proc. Nat. Acad. Sci. USA Vol. 68, No. 8, pp. 1891-1895, August 1971 Isolation of the gal Repressor (E. coli/lac repressor/fucose/galactose/affinity chromatography) J. S. PARKS*, M. GOTTESMAN*, K. SHIMADAt, R. A. WEISBERGt, R. L. PERLMAN$, AND I. PASTAN* * Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health;t Laboratory of Biomedical Sciences, National Institute of Child Health and Human Development, National Institutes of Health; and $ Clinical Endocrinology Branch, National Institute of Arthritis and Metabolic Diseases, National Institutes of Health, Bethesda, Maryland 20014 Communicated by E. R. Stadtman, June 11, 1971 ABSTRACT The repressor of the galactose operon of I867Sam7) (6); Xh8Odlacp8 from PP70, F-,strRA(lac-proA),- Escherichia coli has been partially purified and identified Su- (Xh8OdlacpscJ857St68,Xh8Ocl857St68) (9); and X from as a protein. Induction of a lysogen in which X was linked N1383, Su-,galK-, Cultures were grown in to the bacterial gaiR and lysine genes resulted in a large (XcI857Sam7). increase in the production of the gal repressor. Single-step IL broth (10 g Bacto-tryptone-5 g yeast extract-5 g NaCl purification by affinity chromatography, using the ligand per liter) and induced by heating log-phase cultures at 40'C p-aminophenyl-B3-D-thiogalactoside linked to beaded agar- for 3-4 hr. Isolation and purification of bacteriophage and ex- ose, provided a convenient method of separating the gal traction of bacteriophage DNA have been described (10). To repressor from other DNA-binding proteins. Binding of gal repressor to Xpgal [32PJDNA was studied by assay of binding label phage DNA, 5 mCi Of 32p was added to 100 ml of cul- to a nitrocellulose filter.
    [Show full text]
  • Spot 42 RNA Mediates Discoordinate Expression of the E. Coli Galactose Operon
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon Thorleif Møller, Thomas Franch, Christina Udesen, Kenn Gerdes, and Poul Valentin-Hansen1 Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark The physiological role of Escherichia coli Spot 42 RNA has remained obscure, even though the 109-nucleotide RNA was discovered almost three decades ago. Structural features of Spot 42 RNA and previous work suggested to us that the RNA might be a regulator of discoordinate gene expression of the galactose operon, a control that is only understood at the phenomenological level. The effects of controlled expression of Spot 42 RNA or deleting the gene (spf) encoding the RNA supported this hypothesis. Down-regulation of galK expression, the third gene in the gal operon, was only observed in the presence of Spot 42 RNA and required growth conditions that caused derepression of the spf gene. Subsequent biochemical studies showed that Spot 42 RNA specifically bound at the galK Shine-Dalgarno region of the galETKM mRNA, thereby blocking ribosome binding. We conclude that Spot 42 RNA is an antisense RNA that acts to differentially regulate genes that are expressed from the same transcription unit. Our results reveal an interesting mechanism by which the expression of a promoter distal gene in an operon can be modulated and underline the importance of antisense control in bacterial gene regulation. [Key Words: Antisense RNA; galactose operon; riboregulation; small RNAs; Spot 42RN A; translational regulation] Received March 22, 2002; revised version accepted May 13, 2002.
    [Show full text]
  • Region Immediately Adjacent to the L-Arabinose Operator in Escherichia Coli B/R' MARIANNE ELEUTERIO, BARBARA GRIFFIN, and DAVID E
    JOURNAL OF BACTERIOLOGY, Aug. 1972. p. 383-391 Vol. 111, No. 2 Copyright 0 1972 American Society for Microbiology Printed in U.S.A. Characterization of Strong Polar Mutations in a Region Immediately Adjacent to the L-Arabinose Operator in Escherichia coli B/r' MARIANNE ELEUTERIO, BARBARA GRIFFIN, AND DAVID E. SHEPPARD Department of Biological Sciences, University of Delaware, Newark, Delaware 19711 Received for publication 12 April 1972 Seven L-arabinose-negative mutations are described that map in three genet- ically distinct regions immediately adjacent to the araO (operator) region of the L-arabinose operon. All seven mutants revert spontaneously, exhibit a cis-dom- inant, trans-recessive polarity effect upon the expression of L-arabinose isom- erase (gene araA), and fail to respond to amber, ochre, or UGA suppressors. Three of these mutants exhibit absolute polarity and are not reverted by the mutangens 2-aminopurine, diethyl sulfate, and ICR-191. These may have arisen as a consequence of an insertion mutation in gene araB or in the initi- ator region of the L-arabinose operon. The four remaining mutants exhibit strong but not absolute polarity on gene araA and respond to the mutagens di- ethyl sulfate and ICR-191. Three of these mutants are suppressible by two in- dependently isolated suppressors that fail to suppress known nonsense codons. Partially polar Ara+ revertants with lesions linked to ara are obtained from three of the same four mutants. These polar mutants, their external suppres- sors, and their partially polar revertants are discussed in terms of the mecha- nism of initiation of expression of the L-arabinose operon.
    [Show full text]
  • Local and Global Regulation of Transcription Initiation in Bacteria Browning, Douglas F; Busby, Stephen J W
    University of Birmingham Local and global regulation of transcription initiation in bacteria Browning, Douglas F; Busby, Stephen J W DOI: 10.1038/nrmicro.2016.103 License: None: All rights reserved Document Version Peer reviewed version Citation for published version (Harvard): Browning, DF & Busby, SJW 2016, 'Local and global regulation of transcription initiation in bacteria', Nature Reviews Microbiology. https://doi.org/10.1038/nrmicro.2016.103 Link to publication on Research at Birmingham portal Publisher Rights Statement: Checked 11/08/2016 General rights Unless a licence is specified above, all rights (including copyright and moral rights) in this document are retained by the authors and/or the copyright holders. The express permission of the copyright holder must be obtained for any use of this material other than for purposes permitted by law. •Users may freely distribute the URL that is used to identify this publication. •Users may download and/or print one copy of the publication from the University of Birmingham research portal for the purpose of private study or non-commercial research. •User may use extracts from the document in line with the concept of ‘fair dealing’ under the Copyright, Designs and Patents Act 1988 (?) •Users may not further distribute the material nor use it for the purposes of commercial gain. Where a licence is displayed above, please note the terms and conditions of the licence govern your use of this document. When citing, please reference the published version. Take down policy While the University of Birmingham exercises care and attention in making items available there are rare occasions when an item has been uploaded in error or has been deemed to be commercially or otherwise sensitive.
    [Show full text]
  • Escherichia Coli LUCIA B
    JOURNAL oF BAcTERIOLoGY, June 1973, p. 1040-1044 Vol. 114, No. 3 Copyright 0 1973 American Society for Microbiology Printed in U.SA. Role of Cyclic Adenosine 3', 5'-Monophosphate in the In Vivo Expression of the Galactose Operon of Escherichia coli LUCIA B. ROTHMAN-DENES, JOANNE E. HESSE, AND WOLFGANG EPSTEIN Departments of Biophysics and Biochemistry, The University of Chicago, Chicago, Illinois 60637 Received for publication 22 December 1972 Studies of levels of galactokinase in Escherichia coli with mutations affecting synthesis of, or response to, cyclic adenosine 3', 5'-monophosphate show that this nucleotide does not play a major role in expression of the galactose operon, causing at most a twofold stimulation. The discrepancy between our in vivo results and the marked stimulation by cyclic adenosine 3', 5'-monophosphate in in vitro systems indicates that current cell-free systems lack a factor which allows efficient expression of the galactose operon even in the absence of cyclic adenosine 3', 5'-monophosphate or of the binding protein for this nucleotide. Genetic (7, 19, 20) and biochemical (2, 4, 6, 7) except for the presence of the araC+ and araCc67 evidence has accumulated in recent years, mutations, respectively. L104 is a strain constitutive showing that the catabolite repression of in- for the fl-methylgalactosidase transport system (13). ducible enzymes is mediated by cyclic adeno- Chemicals. [1-_4C]galactose was obtained from Calbiochem, and [U-_4C]glycerol was obtained from sine 3', 5'-monophosphate (c-AMP) and a pro- International Chemical and Nuclear Corp. tein factor (CRP) that specifically binds c-AMP. Bacterial growth and preparation of extracts.
    [Show full text]