USOO884.0881B2
(12) United States Patent (10) Patent No.: US 8,840,881 B2 J00SS et al. (45) Date of Patent: Sep. 23, 2014
(54) METHODS AND COMPOSITIONS FOR OTHER PUBLICATIONS TREATING PROSTATE CANCER OR INDUCING A HUMORAL IMMUNE Schweinfest et al. Cancer Res 1997:57:2961-5.* RESPONSE AGAINST PROSTATE CANCER Kelley et al. Surgery 2000: 128:353-60.* Gumbs et al. JOP. J. Pancreas 2002:3:109-115.* (75) Inventors: Karin Jooss, San Diego, CA (US); Fraser et al. Cancer Res 2005:65:6228-36.* Thomas Harding, San Francisco, CA Yan et al. Mole Ther 2005; 11:363-72.* (US); Minh Nguyen, San Francisco, CA Yan et al. Mole Ther 2006:13:357-65.* (US); Kathryn E. Koprivnikar, Takahashi et al. Brit J Cancer 2002:86:940-6.* PCT International Search Report, mailed Jun. 9, 2010, for Interna Cupertino, CA (US) tional Application No. PCT/US2009/004865, filed Aug. 27, 2009. PCT Written Opinion, mailed Jun. 9, 2010, for International Appli (73) Assignee: Aduro Gvax Inc., Berkeley, CA (US) cation No. PCT/US2009/004865, filed Aug. 27, 2009. PCT International Preliminary Reporton Patentability, issuedMar. 1, (*) Notice: Subject to any disclaimer, the term of this 2011, for International Application No. PCT/US2009/004865, filed patent is extended or adjusted under 35 Aug. 27, 2009. U.S.C. 154(b) by 855 days. Abe et al., 1995, “Antitumor effect induced by granulocyte/macroph age-colony-stimulating factor gene-modified tumor vaccination: (21) Appl. No.: 12/546,399 comparison of adenovirus- and retrovirus-mediated genetic transduction.” J. Canc. Res. Clin. Oncol. 121 : 587-592. (22) Filed: Aug. 24, 2009 Adams et al., 1995, “Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA (65) Prior Publication Data sequence.” Nature 377 (6547 SUPPL), 3-174. US 2010/O150946A1 Jun. 17, 2010 Altschul et al., 1990, “Basic Local Alignment Search Tool.” J. Mol. Biol. 215:403-410. An et al., 2006, "A critical role for the histidine residues in the Related U.S. Application Data catalytic function of acyl-CoA:cholesterol acyltransferase catalysis: evidence for catalytic difference between ACAT1 and ACAT2.” (60) Provisional application No. 61/092,676, filed on Aug. FEBS Lett. 580(11), 2741-2749. 28, 2008. Aoki et al., 1992, "Expression of murine interleukin 7 in a murine glioma cell line results in reduced tumorigenicity in vivo..” Proc Natl (51) Int. Cl. Acad Sci USA. 89(9):3850-4. A6 IK 4.8/00 (2006.01) Armstrong et al., 2002, “Cytokine modified tumor vaccines.” Surg A6 IK39/00 (2006.01) Oncol ClinNAm. 11(3):681-96. (52) U.S. Cl. Asano et al., 1997, “Conservation and diversity of eukaryotic trans lation initiation factor eIF3.” J. Biol. Chem. 272(2): 1101-1 109. CPC. A61 K39/00II (2013.01); A61 K 2039/55522 Balakirev et al., 2003, "Otubains: a new family of cysteine proteases (2013.01); A61K 48/00 (2013.01); A61 K in the ubiquitin pathway.” EMBO Rep. 4(5):517-522. 2039/5156 (2013.01); A61 K 2039/5152 Bartee et al., 2004, "Down regulation of major histocompatibility (2013.01) complex class I by human ubiquitin ligases related to viral immune USPC ...... 424/93.21; 424/93.2 evasion proteins.” J. Virol. 78(3): 1109-1120. (58) Field of Classification Search Batzer et al., 1991, “Enhanced evolutionary PCR using None oligonucleotides with inosine at the 3'-terminus.” Nucleic Acid Res. See application file for complete search history. 19:5081. Bell et al., 1988, "Functional cooperativity between transcription (56) References Cited factors UBF1 and SL1 mediates human ribosomal RNA synthesis.” Science 241(4870): 1192-1197. U.S. PATENT DOCUMENTS (Continued) 5,637.483. A 6, 1997 Dranoff 5,904,920 A 5, 1999 Dranoff Primary Examiner — Janice Li 5,985,290 A 11, 1999 Jaffee (74) Attorney, Agent, or Firm — Michael A. Whittaker; 6,033,674. A 3, 2000 Jaffee Acuity Law Group, P.C. 6,277,368 B1 8, 2001 Hiserodt 6.350.445 B1 2/2002 Jaffee 6.464,973 B1 10/2002 Levitsky (57) ABSTRACT 6,468,986 B1 * 10/2002 Zuckermann et al...... 514.44 R The present invention relates to prostate cancer markers, 7,226,606 B2* 6, 2007 McArthur et al...... 424,277.1 7,939,271 B2 5/2011 Jooss et al. compositions comprising Such markers, and methods of 2006/0057127 A1 3, 2006 Liu et al. using Such markers to induce or increase an immune response 2007/02242O1 A1* 9/2007 Wu et al...... 424,155.1 against prostate cancer. An immune response against the 2007/0231298 A1 10/2007 Li et al. markers correlates with an immune response, in particular a 2008.0075744 A1 3/2008. Hiserodt et al. humoral immune response, against prostate cancer cells 2009/0028857 A1 1/2009 Li et al. which immune response is preferably associated with pro phylaxis of prostate cancer, treatment of prostate cancer, and/ FOREIGN PATENT DOCUMENTS oramelioration of at least one symptom associated with pros WO WOOOf 26676 5, 2000 tate Cancer. WO WOOO,726.86 12/2000 WO WO 2008/109030 A2 9, 2008 9 Claims, 27 Drawing Sheets US 8,840,881 B2 Page 2
(56) References Cited Ciszak et al., 2006, "How dihydrolipoamide dehydrogenase-binding protein binds dihydrolipoamide dehydrogenase in the human OTHER PUBLICATIONS pyruvate dehydrogenase complex.” J. Biol. Chem. 281 (1):648-55. Coux et al., 1996, "Structure and functions of the 20S and 26S Bennett et al., 1984. "Biochemical investigations on a patient with a proteasomes.” Annu. Rev. Biochem. 65:801-847. defect in cytosolic acetoacetyl-CoA thiolase, associated with mental Darrow et al., 1989, “The Role of HLA Class I Antigens in Recog nition of Melanoma Cells by Tumor-Specific Cytotoxic T Lympho retardation.” J. Inherit. Metab. Dis. 7(3):125-128. cytes.” J. Immunol. 142:3329-35. Bilbe et al., 1992, "Restin: a novel intermediate filament-associated Defeo-Jones et al., 1991, “Cloning of cDNAs for cellular proteins protein highly expressed in the Reed-Sternberg cells of Hodgkin's that bind to the retinoblastomageneproduct.” Nature 352(6332):251 disease.” EMBO J. 11(6):2103-2113. 254. Blanket al., 2005, "Interaction of PD-L1 on tumor cells with PD-1 on DeLuca et al., 2006, "Kinetochore microtubule dynamics and attach tumor-specific T cells as a mechanism of immune evasion: implica ment stability are regulated by Hec 1.” Cell 127(5):969-982. tions for tumor immunotherapy.” Cancer Immunol. Immunother. DeLuca-Flaherty et al., 2006, "Uncoating protein (hsc70) binds a 54:307-314. conformationally labile domain of clathrin light chain LCato stimu Bodey et al., 2000, "Failure of Cancer Vaccines: The Significant late ATP hydrolysis.” Cell 62(5):875-887. Limitations of this Approach to Immunotherapy.' Anticancer Res. Dou et al., 1996, “Cloning of human neuronatin gene and its local 20(4):2665-76. ization to chromosome-20d 11.2-12: the deduced protein is a novel Bomont et al., 2005. “Unstable microtubule capture at kinetochores proteolipid.” Brain Res. 723(1-2):8-22. depleted of the centromere-associated protein CENP-F.” EMBO J. Douet al., 1996, "Structure and organization ofthehuman neuronatin 24(22):3927-3939. gene.” Genomics 33(2):292-297. Boon et al., 1997, "Cancer Tumor Antigens.” Curr Opin Immunol. Dranoff et al., 1993, "Vaccination of irradiated tumor cells engi neered to secrete murine granulocyte-macrophage colony-stimulat Oct. 1; 9(5):681-683. ing factor stimulates potent, specific, and long-lasting anti-tumor Borello et al., 2002, "GM-CSF-based cellular vaccines: a review of immunity.” PNAS 90:3539-3543. the clinical experience.” Growth Factor Rev. 13(2):185-93. Dunphy et al., 2005, "Antigen-specific IgG elicited in subjects with Bradford et al., 2006, "Cancer immunomics: using autoantibody prostate cancer treated withflt3 ligand.” J. Immunother. May signatures in the early detection of prostate cancer.” Urol Oncol. Jun:28(3):268-75. May-Jun:24(3):237-42. Dworniczak et al., 1987. "Structure and expression of a human gene Bruderer et al., 2004, “The AAA ATPase p97/VCP interacts with its coding for a 71 kdheat shock 'cognate' protein.” Nucleic Acids Res. alternative co-factors, Ufoll-Npl4 and p47, through a common bipar 15(13):5181-5197. tite binding mechanism.” J Biol. Chem. 279(48):49609-16. Ermini et al., 2005. “Different glycoforms of the human GPI-an Burstein et al., 2005, "COMMD proteins, a novel family of structural chored antigen CD52 associate differently with lipid microdomains and functional homologs of MURR1.” J. Biol. Chem. in leukocytes and sperm membranes.” Biochem. BiophyS.Res. Com 280(23):22222-32. mun. 338 (2):1275-1283. Cantrell et al., 1985. “Cloning, sequence, and expression of a human Faber et al., 1998, “Huntingtin interacts with a family of WW domain granulocyte/macrophage colony-stimulating factor.” Proc. Natl. proteins.” Hum Mol Genet. 7(9): 1463-74. Acad. Sci. 82:6250-6254. Fattaey et al., 1993, "Characterization of the retinoblastoma binding Cárcamo et al., 2006, “Galectin-8 binds specific beta1 integrins and proteins RBP1 and RBP2.” Oncogene 8(11):3149-3156. induces polarized spreading highlighted by asymmetric lamellipodia Fearon et al., 1990, “Interleukin-2 Production by Tumor Cells in Jurkat T cells.” Exp. Cell Res. 312(4):374-386. Bypasses T Helper Function in the Generation of an Antitumor Carlsson et al., 2007. "Affinity of galectin-8 and its carbohydrate Response.” Cell 60:397:403. Feng et al., 2006, "CENP-F is a novel microtuble-binding protein that recognition domains for ligands in Solution and at the cell Surface.” is essential for kinetochore attachments and affects the duration of the Glycobiology 17(6):663-676. mitotic checkpoint delay.” Chromosoma 1 15(4):320-329. Casiano et al., 2006, "Tumor-associated antigen arrays for the Feng et al., 2004, “The many faces of filamin: a versatile molecular serological diagnosis of cancer.” Mol. Cell. Proteomics. scaffold for cell motility and signaling.” Nat Cell Biol. 6(11): 1034 Oct:5(10): 1745-59. 38. Cha et al., 2006, "Inhibition of mixed-lineage kinase (MLK) activity Filppula et al., 1998, “Delta3,5-delta2,4-dienoyl-CoA isomerase during G2-phase disrupts microtubule formation and mitotic pro from rat liver. Molecular characterization.” J. Biol. Chem. gression in HeLa cells.” Cell. Signal. 18(1):93-104. 273(1):349-355. Chadee et al., 2004. "MLK3 is required for mitogen activation of Forni et al., 1988, “Helper strategy in tumor immunology: Expansion B-Raf, ERK and cell proliferation.” Nat. Cell Biol. 6(8):770-776. of helper lymphocytes and utilization of helper lymphokines for Chang et al., 2000, "Immunogenetic Therapy of Human Melanoma experimental and clinical immunotherapy.” Cancer and Met. Utilizing Autologous Tumor Cells Transduced to Secrete Granulo Reviews 7:289-309. cyte-Macrophage Colony-Stimulating Factor.” Human Gene Gallo et al., 1994, "Identification and characterization of SPRK, a Therapy 11:839-850. novel Src-homology 3 domain-containing proline-rich kinase with Chaudhuri et al.,. 1997, "Biochemical characterization of mamma serine/threonine kinase activity.” J. Biol. Chem. 269(21): 15092 lian translation initiation factor 3 (eIF3). Molecular cloning reveals 15100. that p110 subunit is the mammalian homologue of Saccharomyces Gansbacher et al., 1990, “Retroviral Vector-mediated gamma inter cerevisiae protein Prt 1.” J. Biol. Chem. 272(49):30975-83. feron Gene Transfer into Tumor Cells Generates Potent and Long Chen et al., 1997. “Neuropilin-2, a novel member of the neuropilin Lasting Antitumor Immunity.” Cancer Res. 50:7820-7825. family, is a high affinity receptor for the Samaphorins Sema E and Gansbacher et al., 1990, "Interleukin 2 Gene Transfer into Tumor Sema IV but not Sema III.” Neuron 19(3):547-559. Cells Abrogates Tumorigenicity and Induces Protective Immunity.” Chen et al., 1998, “Semaphorin-neuropilin interactions underlying J. Exp. Med. 172:1217-1224. sympathetic axon responses to class III Semaphorins.” Neuron Gardiner et al., 2002, "Annotation of human chromosome 21 for 21(6): 1283-1290. relevance to Down syndrome: gene structure and expression analy Chen et al., 1997, “HEC binds to the seventh regulatory subunit of the sis.” Genomics 79(6): 833-843. 26S proteasome and modulates the proteolysis of mitotic cyclins.” J. Gasson, J., 1991, “Molecular Physiology of Granulocyte-Macroph Biol. Chem. 272(38): 24081-24087. age Colony-Stimulating Factor.” Blood 77(6): 1131-45. Ciferrietal., 2005, "Architecture of the human ndc80-hec1 complex. Giger et al., 1998, “Neuropilin-2 is a receptor for semaphorin IV: a critical constituent of the outer kinetochore.” J. Biol. Chem. insight into the structural basis of receptor function and specificity.” 280(32): 29088-95. Neuron 21(5):1079-1092. US 8,840,881 B2 Page 3
(56) References Cited Imai et al., 2002, "Cloning and characterization of the highly expressed ETEA gene from blood cells of atopic dermatitis patients.” OTHER PUBLICATIONS Biochem. Biophys. Res. Commun. 297(5):1282-1290. Inuzuka et al., 2005, "SERINC, an activity-regulated protein family, Gilles et al., 1991. "Nucleoside diphosphage kinase from human incorporates serine into membrane lipid synthesis.” J. Biol. Chem. erythrocytes. Structural characterization of the two polypeptide 280(42):35776-83. chains responsible for heterogeneity of the hexameric enzyme.” J. Jaffee et al., 1995, “Gene Therapy: Its Potential Applications in the Biol. Chem. 266 (14), 8784-8789. Treatment of Renal-Cell Carcinoma.” Seminars in Oncology Golumbecket al., 1991, “Treatment of Established Renal Cancer by 22(1): 81-91. Tumor Cells Engineered to Secrete Interleukin-4.” Science 254:713 Jaffee et al., 2001, “Novel Allogeneic Granulocyte-Macrophage T16. Colony-Stimulating Factor-Secreting Tumor Vaccine for Pancreatic Gonzatti-Haces, et al., 1988, "Characterization of the TPR-MET Cancer: A Phase I Trial of Safety and Immune Activation.” J. Clin. oncogene p65 and the MET protooncogene p140 protein-tyrosine Oncol. 19:145-156. kinases.” Proc. Natl. Acad. Sci. U.S.A. 85(1):21-25. Jantzen et al., 1990, “Nucleolar transcription factor hUBF contains a Granneman et al., 2003, "The human Imp3 and Imp4 proteins form a DNA-binding motif with homology to HMG proteins.” Nature ternary complex with hMpp10, which only interacts with the U3 and 344(6269):830-836. snoRNA in 60-80S ribonucleoprotein complexes.” Nucleic Acids Jindal et al., 1989, “Primary structure of a human mitochondrial Res. 31(7): 1877-1887. proteinhomologous to the bacterial and plant chaperonins and to the Guo et al., 2004. “Identification and characterization of a novel 65-kilodalton mycobacterial antigen.” Mol. Cell. Biol.9(5)2279-83. cytoplasm protein ICF45 that is involved in cell cycle regulation.” J. Kalies et al., 1996, “Membrane topology of the 12- and the 25-kDa Biol. Chem. 279(51):53498–53505. Subunits of the mammalian signal peptidase complex. J. Biol. Chem. Halabiet al., 2003, “Prognostic model for predicting survival in men 271(7):3925-3929. with HRPC.” Journal of Clinical Oncology 21(7): 1232-7. Kamakaka et al., 1998, Sir- and silencer-independent disruption of Hammond et al., 2001, “In vitro selection and characterization of silencing in Saccharomyces by Sas10p. Genetics 149(2):903-14. Bcl-X(L)-binding proteins from a mix of tissue-specific mRNA dis Kang et al., 2004. “Genomic organization, tissue distribution and play libraries.” J. Biol. Chem. 276(24):20898-20906. deletion mutation of human pyridoxine 5'-phosphate oxidase.” Eur J Harding et al., 2006, "Humoral immune response induced to filamin Biochem. 271 (12):2452-61. B in patients with metastatic hormone-refractory GM-CSF Kawakami et al., 1992, "Shared Human Melanoma Antigens: Rec transduced allogenic prostate cancer vaccine (GVAX(R).” Proceed ognition by Tumor-Infiltrating Lymphocytes in HLA-A2.1- ings of the Annual Meeting of the Am. Association for Cancer Research 47:680, Abstract No. 2894. Transfected Melanomas.” J. Immunol. 148:638-643. Harding et al., 2007. “Identification of antibody responses induced in Klein et al., 1976, “Properties of the K562 Cell Line, Derived from a patients with metastatic hormone-refractory prostate cancer (HRPC) Patient with Chronic Myeloid Leukemia.” Int. J. Cancer 18:421-431. treated with a GM-CSF-transduced allogenic prostate cancer Kocet al., 2001, “The large subunit of the mammalian mitochondrial therapy.” Proceedings of the Annual Meeting of the Am. Association ribosome. Analysis of the complement of ribosomal proteins for Cancer Research 48:981, Abstract No. 4139. present.” J. Biol. Chem. 276(47):43958-69. Harrington et al., 2001, “Creation of genome-wide protein expres Kondo et al., 1997, “p47 is a cofactor for p97-mediated membrane sion libraries using random activation of gene expression' Nat. fusion.” Nature. 388(6637):75-8. Biotechol. 19(5):440-445. Krangel et al., 1987. "Structurally divergent human T cell receptor Hartmann et al., 1993, "A tetrameric complex of membrane proteins gamma proteins encoded by distinct C gamma genes.” Science in the endoplasmic reticulum.” Eur, J. Biochem. 214(2):375-381. 237(4810):64-67. Hase et al., 2003, “Direct interation with nup 153 mediates binding of Kreft et al., 2006, “Membrane topology of the yeast endoplasmic Tpr to the periphery of the nuclear pore complex.” Mol. Biol. Cell reticulum-localized ubiquitin ligase Doa 10 and comparison with its 14(5):1923-1940. human ortholog TEB4 (MARCH-VI).” J. Biol. Chem. 281 (8):4646 Hiromasa et al., 2004, “Organization of the cores of the mammalian 4653. pyruvate dehydrogenase complex formed by E2 and E2 plus the Krullet al., 2004. "Nucleoporins as components of the nuclear pore E3-binding protein and their capacities to bind the E1 and E3 com complex core structure and Tpr as the architectural element of the ponents.” J. Biol. Chem. 279(8):6921-6933. nuclear basket.” Mol. Biol. Cell 15(9):4261-4277. Hjelmqvist et al., 2002, “ORMDL proteins are a conserved new Kubota et al., 1994, "Identification of six Tcp-1-related genes encod family of endoplasmic reticulum membrane proteins.” Genome biol. ing divergent subunits of the TCP-1-containing chaperonin. Curr. 3(6):1-16. Biol. 4(2):89-99. Hocket al., 1991, “Interleukin 7 Induces CD4+ T Cell-dependent Kume et al., 1991, “The glycine cleavage system. Molecular cloning Tumor Rejection.” J. Exp. Med. 174: 1291-1298. of the chicken and human glycine decarboxylase cDNAS and some Homet al., 1991, “Common Expression of Melanoma Tumor-Asso characteristics involved in the deduced protein structures.” J. Biol. ciated Antigens Recognized by Human Tumor Infiltrating Lympho Chem. 266(5):3323-3329. cytes: Analysis by Human Lymphocyte Antigen Restriction.” J. Kurochkin et al., 2001, "ALEX1, a novel human armadillo repeat Immunother, 10:153-164. protein that is expressed differentially in normal tissues and carcino Huang et al., 1994, “Role of Bone Marrow-Derived Cells in Present mas.” Biochem. Biophys. Res. Commun. 280:340:347. ing MHC Class I-Restricted Tumor Antigens.” Science 264:961-965. Kurschner et al., 1998, "CIPP, a novel multivalent PDZ domain Huang et al., 2003, "A specific splicing variant of SVH, a novel protein, selectively interacts with Kir4.0 family members, NMDA human armadillo repeat protein, is up-regulated in hepatocellular receptor Subunits, neurexins, and neuroligins.” Mol. Cell. Neurosci. carcinomas.” Cancer Res. Jul. 1:63(13):3775-82. 11(3).:161-172. Huebner et al., 1985. “The Human Gene Encoding GM-CSF Is at Lee et al., 1997, “Genetic Immunotherapy of Established Tumors 5q21-q32, the Chromosome Region Deleted in the 5q-Anomaly.” with Adenovirus-Murine Granulocyte-Macrophage Colony-Stimu Science 230(4731): 1282-5. lating Factor.” Human Gene Therapy 8:187-193. Hurwitz et al., 1998, “CTLA-4 blockade synergizes with tumor Lehner et al., 2004, "A protein interaction framework for human derived granulocyte-macrophage colony-stimulating factor for treat mRNA degradation.” Genome Res. 14(7): 1315-1323. ment of an experimental mammary carcinoma.” Proc. Natl. Acad. Lerman et al., 2000, "The 630-kb lung cancer homozygous deletion Sci. U.S.A. 95:10067-10071. region on human chromosome 3p21.3; identification and evaluation Hurwitz et al., 2000, "Combination Immunotherapy of Primary Pros of the resident candidate tumor Supperssor genes. The International tate Cancer in a Transgenic Mouse Model Using CTLA-4 Blockade.” Lung Cancer Chromosome 3p21.3 Tumor Suppressor Gene Consor Cancer Research 60:2444-2448. tium.” Cancer Res.60(21):6116-6133. US 8,840,881 B2 Page 4
(56) References Cited Ngo et al., 1998, “Absence of pyridoxine-5'-phosphate oxidase (PNPO) activity in neoplastic cells: isolation, characterization, and OTHER PUBLICATIONS expression of PNPO cDNA” Biochemistry 37(21): 7741-8. N'Guyen et al., 1985. “The HLA-AW24 gene: sequence, surround Leung et al., 1996, “Cloning of novel kinectin splice variants with ings and comparison with the HLA-A2 and HLA-A3 genes.” alternative C-termini: Structure, distribution and evolution of mouse Immunogenetics 21(5):479-89. kinectin.” Immunol. Cell Biol. Oct:74(5):421-33. Oettgenet al., 1991. The History of Cancer Immunotherapy, Biologic Li et al., 1995, “Evidence for a regulated interaction between Therapy of Cancer, Chap. 6, pp. 87-119: Devita et al. (eds.). heterotrimeric G proteins and caveolin.” J. Biol. Chem. Ohtsuka et al., 1985, "An Alternative Approach to 270(26): 15693-15701. Deoxyoligonucleotides as Hybridization Proves by Insertion of Liao et al., 1995, "CENP-F is a protein of the nuclear matrix that Deoxyinosine at Ambiguous Codon Positions.” J. Biol. Chem. assembles onto kinetochores at late G2 and is rapidly degraded after 260:2605-2608. mitosis.” J. Cell Biol. 130(3):507-518. Padovani et al., 2006, "Energetics of interaction between the G-pro Lilley et al., 2005. “Multiprotein complexes that link dislocation, tein chaperone, MeaB, and B12-dependent methylmalonyl-CoA ubiquitination, and extraction of misfolded proteins from the mutase.” J. Biol. Chem. 281 (26):17838-17844. endoplasmic reticulum membrane.” Proc. Natl. Acad. Sci. U.S.A. Pan et al., 2007. “Neuropilin-1 binds to VEGF121 and regulates 102(40): 14296-14301. endothelial cell migration and sprouting.” J. Biol. Chem. Linstedt et al., 1993, "Giatin, a novel conserved Golgi membrane 282(33):24049-24056. protein containing a cytoplasmic domain of at least 350 kDa.” Mol. Pang et al., 1995, “Prostate Tissue Specificity of a Prostate-Specific Biol. Cell 4(7):679-693. Antigen Promoter Isolated from a Patient with Prostate Cancer.” Liou et al., 1997, "Elucidation of the subunit orientation in CCT Hum. Gene Ther. 6(11): 1417-1426. (chaperonin containing TCP1) from the subunit composition of Pearson et al., ImprovedTools for Biological Sequence Comparison. CCT5 micro-complexes.” EMBO.J. 16(14):4311-4316. Proc. Natl. Acad. Sci. USA 85:2444-2448 (1988). Little et al., 1992, “Molecular definition of an elusive third HLA-A9 Pelicci et al., 1987. “Molecular diversity of the human T-gamma molecule: HLA-A9.3.” Immunogenetics 35(1):41-5. constant region genes.” Science 237(4818): 1051-1055. Liu et al., 2005. “Investigating the allosterism of acyl Peters et al., 2003, "RNA editing and regulation of Drosphila 4f-rnp CoA:cholesterol acyltransferase (ACAT) by using various sterols: in expression by Sas-10 antisense readthrough mRNA transcripts.” vitro and intact cell studies.” Biochem. J. 391 (PT2):389-397. RNA. 9(6)698-710. Lo et al., 2006, "PGAM5, a Bcl-XL-interacting Protein, Is a Novel Pierre et al., 1994, Molecular characterization of two functional Substrate for the Redox-regulated Keap 1-dependent Ubiquitin domains of CLIP-170 in vivo J. Cell. Sci. 107(PT 7): 1909-1920. Ligase Complex.” J. Biol. Chem. 281 (49):37893-37903. Pierre et al., 1992, “CLIP-170 links endocytic vesicles to Lozzio et al., 1975. “Human Chronic Myelogenous Leukemia Cell micotubules.” Cell 70(6):887-900. Line With Positive Philadelphia Chromosome.” Blood 45(3):321 Player et al., 2003, "Identification of TDE2 gene and its expression in 334. non-small cell lung cancer.” Int. J. Cancer 107(2):238-243. Mach et al., 2000, "Cytokine-secreting Tumor Cell Vaccines.” Curr. Pons et al., 1988, “Cloning and cDNA sequence of the Opin. Immunol. 12(5):571-5. dihydrolipoamide dehydrogenase component human alpha-ketoacid Mach et al., 2000, "Differences in Dendritic Cells Stimulated in vivo dehydrogenase complexes.” Proc. Natl. Acad. Sci. U.S.A. by Tumors Engineered to Secrete Granulocyte-Macrophage Colony 85(5): 1422-1426. Stimulating Factor or Flt3-Ligand.” Cancer Res.60(12):3239-46. Popowicz et al., 2006, "Filamins: promiscuous organizers of the Maeda et al., 2004, “The T cell receptor gamma chain alternate cytosckeleton.” Trends Biochem Sci. 31(7):411-9. reading frame protein (TARP), a prostate-specific protein localized in Porgador et al., 1994, "Immunotherepy of Tumor Metastasis via mitochondria.” J. Biol. Chem. 279(23):24561–24568. Gene Therapy.” Nat. Immun. 13(2-3): 113-30. Mao et al., 1997. “T-cell oncogene rhombotin-2 interacts with Qin et al., 2006, “Development of a “reverse capture” autoantibody retinoblastoma-binding protein 2.” Oncogene 14(13): 1531-1539. microarray for studies of antigen-autoantibody profiling.” Proteom McNeel et al., 2000, "Antibody immunity to prostate cancer associ ics. (6)3199-3209. ated antigens can be detected in the serum of patients with prostate Raz et al., 1991, “Molecular cloning and chromosomal mapping of a cancer.” J Urol. 164(5):1825-9. human galactoside-binding protein.” Cancer Res. 51 (8):2173-2178. McNeil et al., 1990, "Anti-phospholipid antibodies are directed Reymond et al., 2001, “From PREDs and open reading frames to against a complex antigen that includes a lipid-binding inhibitor of cDNA isolation: revisiting the human chromosome 21 transcription coagulation: beta 2-glycoprotein 1 (apolipoprotein H).” Proc. Natl. map.” Genomics 78(1-2):46-54. Acad. Sci. U.S.A. 87(11):4120-24. Robertson, SP, 2004 "Molecular pathology of filamin A: diverse Methotet al., 1997. “The human homologue of the yeast Prtl protein phenotypes, many functions.” Clin Dysmorphol. Jul;13(3): 123-31. is an integral part of the eukaryotic initiation factor 3 complex and Roobol et al., 1995, “Cytoplasmic chaperonin complexes enter interacts with p170.” J. Biol. Chem. 272(2): 1110-1116. neurites developing in vitro and differ in Subunit composition within Meyer et al., 1998, “The p47 co-factor regulates the ATPase activity single cells.” 108(Pt 4): 1477-1488. of the membrane fusion protein, p97.” FEBS Lett. 437(3):255-57. Rosengard et al., 1989, “Reduced Nm23/Awd protein in tumor Michel et al., 2005, "PATJ connects and stabilizes apical and lateral metastasis and aberrant Drosophila development.” Nature components of tight junctions in human intestinal cells.” J. Cell. Sci. 342(6246): 177-180. 118(PT 17):4049-4057. Rossolini et al., 1994. “Use of Deoxyinosine-containing primers vs Mina-Osorio et al., 2007. “A role for galectin-3 in CD13-mediated degenerate primers for polymerase chain reactioni based on ambigu homotypic aggregation of monocytes.” Biochem. Biophys. Res. ous sequence information.” Mol. Cell. Probes 8:91-98. Commun. 353(3):605-610. Sahin et al., 1995, “Human neoplasms elicit multiple specific Nagaiet al., 1998, “Irradiated tumor cells adenovirally engineered to immune responses in the autologous host.” Proc Natl AcadSci USA. Secrete granulocye? marcophage-colony-stimulating factor estab Dec. 5:92(25): 11810-3. lished antitumor immunity and eliminate pre-existing tumors in Salgia et al., 2003, "Vaccination with Irradiated Autologous Tumor Syngeneic mice.” Cancer Immunol. Immunother, 47:72-80. Cells Engineered to Secrete Granulocyte-Macrophage Colony Needleman et al., 1970, "A General Method Applicable to the Search Stimulating Factos Augments Antitumor Immunity in Some Patients for Similarities in the Amino Acid Sequence ofTwo Proteins.” J. Mol. with Metastatic Non-Small-Cell Lung Carcinoma.” J. Clin. Oncol. Biol. 48:443-453. 21:624-30. Nemunaitis et al., 2004. “Granulocyte-Macrophage Colony-Stimu Scharfet al., 1998, “Identification of a candidate modifying gene for lating Factor Gene-Modified Autologous Tumor Vaccines in Non spinal muscular atrophy by comparative genomics.” Nat. Genet. Small-Cell Lung Cancer.” J. Natl. Cancer Inst. 96(4):326-31. Sep;20(1):83-6. US 8,840,881 B2 Page 5
(56) References Cited Teng et al., 1991, “Long-term Inhibition of Tumor Growth by Tumor Necrosis Factor in the Absence of Cachexia or T-cell Immunity.” OTHER PUBLICATIONS PNAS 88:3535-3539 Thomas et al., 2004. "Mesothelin-specific CD8+ T Cell Responses Scherer et al., 1997 "Association of phosphofructokinase-M with Provide Evidence of In vivo Cross-Priming by Antigen-Presenting caveolin-3 in differentiated skeletal myotobes. Dynamic regulation Cells in Vaccinated Pancreatic Cancer Patients.” J. Exp. Med. by extracellular glucose and intracellular metabolites.” J. Biol. Chem. 200(3):297-306. 272(33):20698-20705. Tijssen, P, 1993, Laboratory Techniques in Biochemistry and Schram et al., 1987. “Human peroxisomal 3-oxoacyl-coenzyme A Molecular Biology—Hybridization with Nucleic Acid Probes part 1 thilase deficienty.” Proc. Natl. Acad. Sci. U.S.A. 84(8):2494-2496. chapter 2, "Overview of principles of hybridization and the stragegy Seelig et al., 1994, "Macrogolgin—a new 376 kD Golgi complex of nucleic acid probe assays.” Elsevier, New York. outer membrane protein as target of antibodies in patients with rheu Townsley et al., 1997, “Dominant-negative cyclin-selective ubiquitin matic diseases and HIV infections.” J. Autoimmun. 7(1):67-91. carrier protein E2-C/UbcH10 blocks cells in metaphase.” Proc. Natl. Seko et al., 2003, "Activation of RhoA and inhibition of myosin Acad. Sci. U.S.A. 94(6):2362-2367. phosphatase as important components in hypertension in vascular Trauger et al., 2002, "Kinetic mechanism for human Rho-Kinase II (ROCK-II).” Biochemistry 41(28):8948-8953. Smooth muscle.” Circ. Res. 92(4):411-418. Tsurumi et al., 1996, “cDNA cloning and functional analysis of the Silverman et al., 2004, “Human Rifl, ortholog of a yeast telomeric p97 subunit of the 26S proteasome, a polypeptide identical to the protein, is regulated by ATM and 53BP1 and functions in the S-phase type-1 tumor-necrosis-factor-receptor-assocoated protein-2/55.11.” checkpoint.” Genes Dev. 18(17):2108-2119. Eur, J. Biochem. 239(3):912-921. Simons et al., 1997, "Bioactivity of Autologous Renal Cell Carci Twells et al., The sequence and gene characterization of a 400-kb noma Vaccines Generated by ex Vivo Granulocyte-Macrophage candidate region for IDDM4 on chromosome 11q13, Genomics 72: Colony-Stimulating Factor Gene Transfer.” Cancer Res. 57:1537-46. 231-242, 2001. Simons et al., 1999. “Induction of Immunity to Prostate Cancer Usui et al., 1997, "cDNA cloning and mRNA expression analysis of Antigens: Results of a Clinical Trial of Vaccination with Irradiated the human neuronatin. High level expression in human pituitary Autologous Prostate Tumor Cells Engineered to Secrete Granulo gland and pituitary adenomas.” J. Mol. Neurosci. 9(1):55-60. cyte-Macrophage Colony-Stimulating Factor using ex Vivo Gene Vaccaro et al., 2001, “Distinctbinding specificity of the multiple PDZ Transfer. Cancer Res. 59:5160-5168. domains of INADL, a human protein with homology to INAD from Simpson et al., 2000, "Systematic Subcellular localization of novel Drosophila melanogaster.” J. Biol. Chem. 276(45):42122-42130. proteins identified by large-scale cDNA sequencing.” EMBO Rep. Valdmanis et al., 2007, "Mutations in the KIAAO 196 Gene at the 1(3):287-292. SPG8 Locus Cause Hereditary Spastic Paraplegia.” Am J Hum Smith et al., 1981, "Comparison of Biosequences.” Adv. Appl. Math. Genet. Jan;80(1): 152-61. 2:482-489. Valentin et al., 1992, “The distribution of the CDW52 molecule on blood cells and characterization of its involvement in T cell activa Sohda et al., 1994, "Molecular cloning and sequence analysis of a tion.” Transplantation 54(1):97-104. human 372-kDA protein localized in the Golgi complex.” Biochem. van Elsas et al., 1999. “Combination Immunotherapy of B16 Mela Biophys. Res. Commun. 205(2): 1399-1408. noma Using Anti-Cytotoxic T Lymphocyte-associated Antigen 4 Soiffer et al., 2003, “Molecular Cloning and Sequence Analysis of a (CTLA-4) and Granulocyte/Macrophase Colony-Stimulating Factor Human 372-kDA Protein Localized in the Golgi Complex.” J. Clin. (GM-CSF)-producing Vaccines Induces Rejection of Subcutaneous Oncol. 21:3343-50. and Metastatic Tumors Accompanied by Autoimmune Depigmenta Soiffer et al., 1998, “Vaccination with Irradiated, Autologous Mela tion.” J. Exp. Med. 190(3):355-366. noma Cells Engineered to Secrete Granulocyte-Macrophage Colony Varambally et al., 2005. “Integrative genomic and proteomic analysis Stimulating Factor by Adenoviral-Mediated Gene Transfer Aug of prostate cancer reveals signatures of metastatic progression.” Can ments Antitimor Immunity in Patients with Metastatic Melanola.” cer Cell. Nov;8(5):393-406. Proc. Natl. Acad. Sci. U.S.A.95:13141-13146. Venner et al., 1990, “Nucleotide sequences and novel structural fea Soker et al., 1998, “Neuropilin-1 is expressed by endothelial and tures of human and Chinese hamster hsp60 (chaperonin) gene fami tumor cells as an isoform-specific receptor for vascular endothelial lies.” DNA Cell Biol. 9(8):545-552. growth factor.” Cell 92(6):735-745. Voit et al., 1995, “Activation of mammalian ribosomal gene tran Song et al., 1995, “Association of RING finger protein with the Scription requires phosphorylation of the nucleolar transcription fac cytoplasmic domain of the human type-2 tumor necrosis factor recep tor UBF.” Nucleic Acids Res. 23(14): 2593-2599. tor.” Biochem. J. 309(Pt3):825-829. Wang et al., 2005, "Autoantibody signatures in prostate cancer.” N Sonnichsen et al., 1998, “A role forgiantin in docking COPIvesicles Engl J Med. Sep. 22:353(12): 1224-35. to Golgi membranes.” J. Cell Biol. 140(5):1013-1021. Wang et al., 1999, “Oligomeric complexes involved in translocation Strausberg et al., 2002, "Mammalian Gene Collection Program of proteins across the membrane of the endoplasmic reticulum.' Team. Generation and initial analysis of more than 15,000 full-length FEBS Lett. 457(3):316-322. human and mouse cDNA sequences.” Proc. Natl. Acad. Sci. U.S.A. Watanabe et al., 2006, “CD52 is a novel costimulatory molecule for Dec. 24;99(26): 16899-903. induction of CD4+ regulatory T cells.” Clin. Immunol. 120(3):247 Sueishi et al., 2000, "The forkhead-associated domain of Ki-67 anti 259. gen interacts with the novel kinesin-like protein Hklp2.” J. Biol. Westendorf et al., 1998, “M phase phosphoprotein 10 is a human U3 Chem. 275(37): 28888-28892. Small nucleolar ribonucleoprotein component.” Mol. Biol. Cell Suzuki et al., 2001, “Structural compensation for the deficit of rRNA 9(2):437-449. with proteins in the mammalian mitochondrial ribosome. Systematic Witke et al., 1998, “In mouse brain profilin I and profilin II associate analysis of protein components of the large ribosomal subunit from with regulators of the endocytic pathway and actin assembly.” EMBO mammalian mitochondria.” J. Biol. Chem. 276(24):21724-21736. J. 17(4):967-976. Takahashi et al., 1998, “Semaphorins A and E act as antagonists of Wong et al., 1996, “Involvement of p90rsk in neurite outgrowth neuropilin-1 and agonists of neuropolin-2 recepors.” Nat. Neurosci. mediated by the cell adhesion molecule L1.” J. Biol. Chem. 1(6):487-493. 271 (30): 18217-18223. Tang et al., 1996, “Molecular cloning of caveolin-3, a novel member Xing et al., 1996, “Coupling of the RAS-MAPK pathway to gene of the caveolin gene family expressed predominantly in muscle.” J. activation by RSK2, a growth factor-regulated CREB kinase.” Sci Biol. Chem. 271(4):2255-2261. ence 273(5277):959-963. Tassi et al., 1999, "Human JIK, a novel member of the STE20 kinase Xu et al., 2004, “Human Rifl protein binds aberrant telomeres and family that inhibits JNK and is negtively regulated by epidermal aligns along anaphase midZone microtubules.” J. Cell Biol. growth factor.” J. Biol. Chem. 274(47):33287-33295. 167(5):819-830. US 8,840,881 B2 Page 6
(56) References Cited Dunphy et al., “New approaches to identification of antigenic candi dates for future prostate cancer immunology.” Update Cencer Thera OTHER PUBLICATIONS peutics (2006) 1:273-284. EPO, Communication—extended European search report dated Dec. Ye et al., 2001, “The AAA ATPase Cdc48/p97 and its partners trans 27, 2011 for European patent app. No. 111653.06.9. port proteins from the ER into the cytosol.” Nature. Dec. GeneCards online database, FAM136A, GeneCards ID (GCID) GCO2M070523, printed Apr. 11, 2012. 6:414(68.64):652-6. PhosphoSitePlus online database, FAM136A, Reference No. Ye. Yet al., 2005. “Inaugural Article: Recruitment of the p97 ATPase Q96C01 (UniProtKB), printed Apr. 11, 2012. and ubiquitin ligases to the site of retranslocation at the endoplasmic HPRD, Human Protein Reference Database (online), FAM136A. reticulum membrane.” Proc. Natl. Acad. Sci. U.S.A. 102(40): 14132 printed Apr. 11, 2012. 14138. NCBI, National Center for Biotechnology Information (online), Yu et al., 2007, “Galectin-3 interaction with Thomsen-Friedenreich GenBank ID No. EAW99815.1, modified Feb. 4, 2010, submitted by disaccharide on cancer-associated MUC1 causes increased cancer Celera Genomics Sep. 2, 2005. NCBI, National Centerfor Biotechnology Information (online), Ref cell endothelial adhesion.” J. Biol. Chem. 282(1):773-781. erence Sequence NM 032822.2, modified Mar. 26, 2012, replaced Zanin-Zhorov et al., 2006, "Heat shock protein 60 enhances CD4+ prior NCBI sequence on Jun. 7, 2008. CD25+ regulatory T cell function via innate TLR2 signaling.” J. Clin. NCBI, National Centerfor Biotechnology Information (online), Ref Invest. 116(7):2022-2032. erence Sequence NP 11621.1.2, modified Mar. 26, 2012, originally Zhang et al., 2000, "Cloning of DPK, a novel dendritic cell-derived uploaded Jun. 7, 2008. protein kinase activating the ERK1/ERK2 and JNK/SAPK path PRNewswire online press release, Cell Genesys, “Cell Genesys ways.” Biochem. Biophys. Res. Commun. 274(3):872-879. reports association between immune response and patient Survival in Zhao et al., 1995, “RSK3 encodes a novel pp.90rsk isoform with a Phase 2 trial of GVAX ...' Feb. 15, 2008. unique N-terminal sequence: growth factor-stimulated kinase func tion and nuclear translocation.” Mol. Cell. Biol. 15 (8):4353-4363. * cited by examiner U.S. Patent Sep. 23, 2014 Sheet 1 of 27 US 8,840,881 B2
(NPO roxie 5 -phosphate oxase
2 i
. s
- ---, -i-
..., St at Class Class 2 3. Box Plot - Description
FIG. 1 U.S. Patent Sep. 23, 2014 Sheet 2 of 27 US 8,840,881 B2
FLNB Fiari 3, teti (actin iriding prote: 278
& 0.5 C .
: www-six-A---xx-xxxx 1.5 s I -2.3 s r i
s, i. E. 3.
3.5 Sub Class Cass 2 Box Plot - Description
FIG 2 U.S. Patent Sep. 23, 2014 Sheet 3 of 27 US 8,840,881 B2
FIG. 3A: G-9803 Trial Design Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Follow 1 2 3 4 5 6 7 8 9 10 11 12 up 1
WEEKS OO O2 04 O6 O8 10 12 14 16 18 20 22 24 Metastatic low dose (500/100 q2 wks - Low Dose) n=24 Metastatic high dose (500/300 q2 wks - High Dose) n=10 PSA-rising low dose (500/100 q2 wks - Low Dose) n=21
FIG. 3B: G-0010 Trial Design Dose Dose DOSe Dose Dose Dose Follow 1 2 3 4 5 6 up 1
WEEKS
OO O2 O4 06 08 10 12 14 16 18 20 22 24 Dose 1 (100 d4 wks x6 - Low Dose) n=3 Dose 2A (200 d4 wks x6 - Low Dose) n=29 Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Dose Follow 1 2 3 4 5 6 7 8 9 10 11 12 up 1
WEEKS
OO O2 04 06 08 10 12 14 16 18 20 22 24 Dose 2B (200 q2 wks X12 - Mid Dose) n=24 Dose 3/4 (300 q2 wks X12 - High Dose) n=3 (500/300 q2 wks - High Dose) n=19 U.S. Patent Sep. 23, 2014 Sheet 4 of 27 US 8,840,881 B2
FIG. 4A ApaLI (6865) CMV IE enhancer/promoter Neol (42) HindIII (712) ! --- NCC (59.75} : W. R5 kan resistance gene : Hindi (268) bGH polyA N. - HIVU5 N. RRE \ N. pKCCMV HLA-2402 Flag $8 II indiil 1877 \ sww. HindIII (185 7 187 bp HIVR sy\ \ s HIV SEN U3 as: *::::: Aid (2103) Y s --- EcoR1 (4664) Y2 ^a cPPTICS Ncol (4480). Clai (2327) WHV PRE / / \ \ inli (2332) ApaII (4281) I , CMV prolenh Flag tag A Nicu (2647) Psi (3717) bamlil (2932) NCO (2936) Avci (2976) HAA24 Pst (3548)
FIG. 4B
Protein A1 A2 A24 A1 A2 A24 A1 A2 A24 A1 A2 A24 A1 A2 A24
45kDa ->
Patienti 104. 302 307 437 Anti-flag U.S. Patent Sep. 23, 2014 Sheet 5 Of 27 US 8,840,881 B2
FIG. 4C
OO -at- HLA-A24 Ab- --> MST 17.6 n=28 90 80 -- HLA-A24 Abt - MST 43.5 n=30 70 p=0.04 60 SO 40 30 2O 10
O 10 2O 30 40 50 60 FO Months post-GVAX U.S. Patent Sep. 23, 2014 Sheet 6 of 27 US 8,840,881 B2
Patient if
FIG. 5B
as OTUB2 Ab + 90 80 70 SO 50 AO 30 2O 10
months U.S. Patent Sep. 23, 2014 Sheet 7 Of 27 US 8,840,881 B2
p C drix CAWIE enhancer promoter w / HIV-1 Rus
FG. 6A kan resistance gene pKCCMV - FLJ14668Flag (516 bp. G pola - A cPPTICTs HIV SIN U3 N cist 23a) WHV PRE CMW profenh Flag tag \ i (33)
Sin agio) FG 6B \ Evil (335) F458
s 4 s
r t C d 3
2 . ...
8 2 E. s s 2v. s R .... s so awe so sess sess ro or sa 2 . 8. 8.3.88. 8.... 88: B 88 88. 88.8.R. 88: W 88.88.3888 88 ...... 88:. . 888. . . 88: 88: 88 3. 88:8 8 88.88 8. 8.8 : 888 88.88. 88:888 888 ... 8.83.38 83.3888: N - vs SN-3 Sky3. SNEraska-SNS ASSSSS-Pop SNgha SSSNgao Patient U.S. Patent Sep. 23, 2014 Sheet 8 of 27 US 8,840,881 B2
oil, it. ^ - 6 SY-3S-SSSYSSYNeals SASSYSSSNSSSSSSSSS Patient
F.G. 6D 100 rare -- FLJ14868 Ab- - MST 20.7 n=31 9) -- FLJ14868 Ab+ --> MST 42.6 n-34 8O p=0.002 70 SO 50 40 30 2O O
O 1O 20 30 O 50 60 70 Months post-GVAX U.S. Patent Sep. 23, 2014 Sheet 9 Of 27 US 8,840,881 B2
F.G. 6E Low-dose (n=25) Mic-close (n=18) High-dose (n=22) 50- DHalabi prediction 7 16. H. Kaplan-Meier E 40 E 11 S2 ao E 18 6. 20 - - . is 10
Ab- A- Ab- A- Ab- Abh F14668 Ab Stats
FIG. 6F High-dose - 80
a 70. Mid-dose 73% o 61% t s r wa - - . E
ha Ab- Ab- a. % of FLJ14668 Abildose group U.S. Patent Sep. 23, 2014 Sheet 10 of 27 US 8,840,881 B2
pUC or CWE enhanceri promoter F.G. 7A -1 RUS
kan resistance gene pKCCMV-NNATFlag 626.4 bp. w:-
bGH polyA cPPTICTs HNUs is & - Cial (2327) HV ? a CMV profenh HS us Ban HT (2932) W PRE \ WXmal (2938) \ \sing (2 3) FIG. 7B \ EcoRI (2950) NNAT Flagtag
3.
s
3. 88.83 . S. . s 8.8 : ... ^ - & beSaNiaSSK's SSSNirvasiaSaygrgas3\SSSSSSS-SNgcases: SSNg-S Patient U.S. Patent Sep. 23, 2014 Sheet 11 of 27 US 8,840,881 B2
FIG. 7C
100. 90 -- MINAT Ab+we - MST 34 On-48 80. -three NNAT Ab-we - MST 9.9 n=17 70 p=<0.001 60 50 40. 30 2O O
O O 2O 30 40 50 60 Months post-GVAX U.S. Patent Sep. 23, 2014 Sheet 12 of 27 US 8,840,881 B2
FG. 8A 25,
28
o 15 S. " E g d l c 10 o
5s i. ... hill. N - " - as ^ S-S-33x3&SNirarasi,SNgar8 SSSSN-3s SSN-3SSSSSSS Patient
F.G. 8B
OO -i- Cardiolipin Ab+we -->MST 38. On 40 -- Cardiolipin Ab-we --MST 14.95 n=24 70, p=0.03apada S 60 50 40 30. - 2 O O O O 2O 3C O 50 60 month post-treatment U.S. Patent Sep. 23, 2014 Sheet 13 Of 27 US 8,840,881 B2
FIG. 9
10090 -ie- FLJ and/or HLA-A24 Ab + MST 43.5 n-41 80 as FLJ and HLA-A24 Ab -> MST 142n=24
50 40 3O 2O 10
months U.S. Patent Sep. 23, 2014 Sheet 14 of 27 US 8,840,881 B2
F.G. 10
OO -- NNAT and for Cardiolipin Ab+ -> MST 32.0 n=50 90 80 -dre NMAT and Cardiolipin Ab- - MST 9.8 n=14 70 p=<0.0001 60 50. 40 30 20 x 10 O to 20 30 40 50 60 Months post-GVAX U.S. Patent Sep. 23, 2014 Sheet 15 Of 27 US 8,840,881 B2
FIG. 11
100 rew -- FLJ14668/HLA-A24 Cardio Ab+ MST34.8 n-47 90 8O --- FLJ14668.HLA-A24 Cardio Ah-- - MST 114 n. 19 TO p=<0.0001 SO SO 40 30 2O O
O O 20 30 40 SO 6O FO Months post-GVAX U.S. Patent Sep. 23, 2014 Sheet 16 of 27 US 8,840,881 B2
FIG. 12A 1OO -n. OTUB2 and/or HLA-A24 AD+ “ MST 35.2 n=23 90 8O -- OTUB2 and HLA-A24 Ab- - MST 17.2 n=9 70 p=0.01.07 SO SO AO 30 2O 10 O
months
F.G. 12 100-rrymorr, -- OTUB2 and/or HLA-A24 Ab+ MST 55.9 n=15 9. 80 -- OTUB2 and HLA-A24 Ab- --> MST 28.6 n=6 70 p=0.01.03 SO 50 40 30 2O 1O O 10 20 30 40 50 60 FO months F.G. 12C
100 -a- OTUB2 and/or HLA-A24 Ab+ MST 38.2 n=40 90 80 -- OTUB2 and HLA-A24 Ab- --> MST 18.1 n=25 70 p40.0001 60 SO 40 30 2O 10 O
months U.S. Patent Sep. 23, 2014 Sheet 17 Of 27 US 8,840,881 B2
F.G. 13A
8 75 ODOSe level 2A 5 o: DOSe level 2B 50- DDOSe level 3/4 C O C Cld r O n S Antigen
F.G. 13B
52O O HLA-A24 Al- HLA-A24 As 5.93 - 0.56 n=41 9.23 - 1.02 n=30 E0.0035 U.S. Patent Sep. 23, 2014 Sheet 18 of 27 US 8,840,881 B2
FIG. 13C 35 30 h 25 20 k
A AA AAA A 10 AAAA' AA OTUB2 A- OTUEB2. A 5.60 0.46 n=37 9.62 - 1.13 nE29 p=0.000777
FIG. 13D
2 O 15 O
O FLJ Ab- FLA 5.16 - 0.49 n=32 9.44 - 0.96 n=34 p=0.0002 U.S. Patent Sep. 23, 2014 Sheet 19 Of 27 US 8,840,881 B2
100 -- SELSA) + 90 mana SELS Ab 80s 70 60
40w 30 20 10 2 so do so so to months
MST=51.9 mOnthS n=14 MST-26.1 months n=55 P-O.O273 HR-0.4685
FIG. 14 U.S. Patent Sep. 23, 2014 Sheet 20 Of 27 US 8,840,881 B2
Survival of HGD2AG0010 group A:Survival proportions Survival of HGD2AGO010 group B:Survival proportions f 1 are --e. re-aw we, 1 rar-We. its 1 - -We 2 7 3 fl.
0. o 20 3. 4. 50 6) month post treatment 0 10 20 30 40 so so month post treatment
median survival median survival +ve, patient 29.1 m. n=13. +ve. patient. 27.1 m. n-13; -ve patient. 14.05 m. n-12 -we. patient. 19.05 m. n=6 p value. 0.092 p value. 0.2463
Survival of HGD2A G0010 group 34:Survival proportions Survival of HGD2AG0010 total:Survival proportions
are re. -re we, nitri-we, is 1 wers ve. 7 E 3 s C.
10 20 30 AO so o 1. 20 30 40 50 SO month post treatment month post treatment
median Survival median survival +ve, patient 35 m. n=13, --ve. patient 32 m. n-39 -ve, patient. 25.9 m. nr2 -we. patient: 14.05 m. n=20 p value. 0.49 p value: 0.0179 FIG. 15 U.S. Patent Sep. 23, 2014 Sheet 21 of 27 US 8,840,881 B2
Survival of SSR3 G0010 group A:Survival proportions Survival of SSR3 G0010 group B:Survival proportions 1 -- +ve ca- +ve, s mlrr-ve. s t mir-ve. 2 2
r 7 3 8 s s a. .
0 0 2 30 40 50 60 0 10 20 30 AO 50 60 month post-treatment month post-treatment
median survival median survival +we. patient: 45.1 m. n=7; +we. patient: 29.55 m no.12; -ve. patient 19.5 m. nr 18 -ve. patient: 17,75m. n=6 p value: 0.0923 p value: 0.1872
Survival of SSR3 G0010 group 34: Survival proportions Survival of SSR3 G0010 total:Survival proportions 12 -- +ve w-r--ve. s mirn we. -- -We o 2 s s 7 w E d g clyS. s . . i
O 10 20 30 40 50 0 0 20 30 40 50 60 month of post-treatment month of post-treatment
median survival median survival +ve. patient: 44.9 m. n=15; +ve. patient 43.5 m. n=34: -ve. patient: 28.9 m. neA -we, patient 19.4 m. n-28 p value. 0.3216 p value: 0.0043 U.S. Patent Sep. 23, 2014 Sheet 22 of 27 US 8,840,881 B2
+ve, percentage of patient in different group HIGD2A
grOup A group B grOup 3/4
FIG. 17 U.S. Patent Sep. 23, 2014 Sheet 23 of 27 US 8,840,881 B2
SSR3 O.D comparison
O.D of normal O.D of pre O.D of post
Mean: 0.2267 it Mean: Mean: 0.6562 0.01881 0.2996 0.03781 NE20 0.01613 N=62 NE62
P value: normal vs. pre: P = 0.0188 pre VS. post: P C 0.0001 normal vs. post: P < 0.0001
FIG. 18 U.S. Patent Sep. 23, 2014 Sheet 24 of 27 US 8,840,881 B2
100 man MRP2 A+ 90 an NRP2 Ab 80s 70 SO 50s
30. 2O &w O to 20 so 40 so so to months
MST=34 months, n=36 MST=21 months, n=33 p=0.0503; HR=0.5999
F.G. 19 U.S. Patent Sep. 23, 2014 Sheet 25 Of 27 US 8,840,881 B2
FG 20A
B16F1 OGMKC)
LLC.GMKd.gp100
LLC.GMKd Trp2
F.G. 20B
Trp2 gp100
U.S. Patent Sep. 23, 2014 Sheet 26 of 27 US 8,840,881 B2
Trp2 Peptide Stimulation gp100 Peptide Stimulation 150 - *O 1 OO 1 O O 5 O 50 FIG 21 U.S. Patent Sep. 23, 2014 Sheet 27 Of 27 US 8,840,881 B2 Survival in B16F10 murine melanoma model 100 90 Ha HBSS 80 water LLC.GMKd.Trp2 s 70 -- LLC. GMKd. Trp2/gp100 60 rada LLC Control 50 g 40 *P=<0.01 30 c - 20 O 10 20 30 40 50 60 70 80 Days post-Challenge FIG. 22 US 8,840,881 B2 1. 2 METHODS AND COMPOSITIONS FOR al. Proc Natl Acad Sci USA 1998 95:13141-6: Simons et al. TREATING PROSTATE CANCER OR Cancer Res 1997 57:1537–46; Jaffee et al. J. Clin Oncol 2001 INDUCING A HUMORAL IMMUNE 19:145-56; Salgia et al. Clin Oncol2003 21:624-30; Soifferet RESPONSE AGAINST PROSTATE CANCER al. J. Clin Oncol 2003 21:3343-50: Nemunaitis et al. J Natl Cancer Inst. 2004 Feb. 1896(4):326-31; Borello and Pardoll, CROSS REFERENCE TO PRIORAPPLICATIONS Growth Factor Rev. 13(2):185-93, 2002; and Thomas et al., J. Exp. Med. 200(3)297-306, 2004). This application claims the benefit of U.S. Provisional Administration of genetically modified GM-CSF-express Application No. 61/092,676 filed Aug. 28, 2008 and is incor ing cancer cells to a patient results in an immune response and porated by reference in its entirety. 10 preliminary clinical efficacy against prostate and other can cers has been demonstrated in Phase I/II clinical trails. How 1. FIELD OF THE INVENTION ever, there remains a need for improved methods and com positions for increasing the effectiveness of Such therapies. The present invention relates to prostate cancer markers, These and other needs are provided by the present invention. compositions comprising Such markers, and methods of 15 using Such markers and compositions to induce or increase an 3. SUMMARY immune response against prostate cancer. An immune response against the markers correlates with an immune The present invention provides prostate cancer markers, response, in particular a humoral immune response, against compositions comprising Such markers, and methods of prostate cancer cells which immune response is preferably using Such markers to induce or increase an immune response associated with prophylaxis of prostate cancer, treatment of against prostate cancer. An immune response against the prostate cancer, and/or amelioration of at least one symptom markers correlates with an immune response, in particular a associated with prostate cancer. humoral immune response, against prostate cancer cells which immune response is preferably associated with pro 2. BACKGROUND 25 phylaxis of prostate cancer, treatment of prostate cancer, and/ oramelioration of at least one symptom associated with pros The immune system plays a critical role in the pathogen tate Cancer. esis of a wide variety of cancers. When cancers progress, it is Thus, in a first aspect, the invention provides a composition widely believed that the immune system either fails to for the treatment of prostate cancer in a subject, the compo respond Sufficiently or fails to respond appropriately, allow 30 sition comprising one or more populations of cells genetically ing cancer cells to grow. Currently, standard medical treat modified to express the coding sequence for a cytokine and ments for cancer including chemotherapy, surgery, radiation the coding sequence of one or more prostate tumor-associated therapy and cellular therapy have clear limitations with antigens selected from the group consisting of HLA-A24. regard to both efficacy and toxicity. To date, these approaches FLJ14668, Cardiolipin, Neuronatin (NNAT), Selenoprotein have met with varying degrees of success dependent upon the 35 (SELS), HIG1 domain family, member 2A (HIGD2A), Sig type of cancer, general health of the patient, stage of disease nal sequence receptor, gamma (SSR3) and Neuropilin 2 at the time of diagnosis, etc. Improved strategies that combine (NRP2). In some embodiments, the composition comprises specific manipulation of the immune response to cancer in one or more populations of cells genetically modified to combination with standard medical treatments may provide a express the coding sequence for a cytokine and the coding means for enhanced efficacy and decreased toxicity. 40 sequence of one, two, three, four, five, six, seven or eight One therapeutic approach to cancer treatment involves the prostate tumor-associated antigens selected from the group use of genetically modified tumor cells which express cytok consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, ines locally at the vaccine site. Activity has been demon SELS, HIGD2A, SSR3 and NRP2. strated in tumor models using a variety of immunomodula In another aspect, the invention provides a method for the tory cytokines, including IL-4, IL-2, TNF-alpha, G-CSF, 45 treatment of prostate cancer in a subject, comprising admin IL-7, IL-6 and GM-CSF, as described in Golumbeck PT et al., istering a composition to a subject with prostate cancer, the Science 254:13-716, 1991; Gansbacher Bet al., J. Exp. Med. composition comprising one or more populations of cells 172:1217-1224, 1990; Fearon E R et al., Cell 60:397-403, genetically modified to express the coding sequence for a 1990; Gansbacher B et al., Cancer Res. 50:7820-25, 1990; cytokine and the coding sequence of one or more prostate Teng Met al., PNAS 88:3535-3539, 1991; Columbo M Pet 50 tumor-associated antigens selected from the group consisting al., J. Exp. Med. 174: 1291-1298, 1991: Aoki et al., Proc Natl of HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, AcadSci USA. 89(9):3850-4, 1992: Porgador A, et al., Nat. HIGD2A, SSR3 and NRP2. In some embodiments, the com Immun. 13(2-3): 113-30, 1994: DranoffG et al., PNAS position comprises one or more populations of cells geneti 90:3539-3543, 1993; Lee CT et al., Human Gene Therapy cally modified to express the coding sequence for a cytokine 8:187-193, 1997; Nagai E et al., Cancer Immunol. Immu 55 and the coding sequence of one, two, three, four, five, six, nother. 47:2-80, 1998 and Chang A et al., Human Gene seven or eight prostate tumor-associated antigens selected Therapy 11:839-850, 2000, respectively. The use of autolo from the group consisting of HLA-A24, FLJ14668, Cardio gous cancer cells as vaccines to augment anti-tumor immu lipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. nity has been explored for Sometime. See, e.g., Oettgenet al., In another aspect, the invention provides a method for “The History of Cancer Immunotherapy'. In: Biologic 60 inducing a de novo immune response in a Subject against one Therapy of Cancer, Devita et al. (eds.) J. Lippincot Co., pp or more prostate tumor-associated antigens, comprising 87-199, 1991; Armstrong TD and Jaffee E. M., Surg. Oncol administering a composition to a subject with prostate cancer, ClinNAm.11(3):681-96, 2002; and Bodey Bet al., Antican the composition comprising one or more populations of cells cer Res 20(4):2665-76, 2000). genetically modified to express the coding sequence for a Several phase I/II human trials using GM-CSF-secreting 65 cytokine and the coding sequence of one or more prostate autologous or allogeneic tumor cell vaccines have been per tumor-associated antigens selected from the group consisting formed (Simons et al. Cancer Res 199959:5160-8: Soifferet of HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, US 8,840,881 B2 3 4 HIGD2A, SSR3 and NRP2. In some embodiments, the com positions described herein, a first population of cells comprise position comprises one or more populations of cells geneti tumor cells genetically modified to express the coding cally modified to express the coding sequence for a cytokine sequence of a cytokine, and a second population of cells and the coding sequence of one, two, three, four, five, six, comprise bystander cells genetically modified to express the seven or eight prostate tumor-associated antigens selected coding sequence for one or more prostate tumor-associated from the group consisting of HLA-A24, FLJ14668, Cardio antigens selected from the group consisting of HLA-A24. lipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and In another aspect, the invention provides a method for NRP2. In some embodiments, the tumor cells are autologous increasing an immune response in a Subject against one or cells. In some the embodiments, the tumor cells are alloge more prostate tumor-associated antigens, comprising admin 10 neic cells. istering a composition to a subject with prostate cancer, the In some embodiments of the compositions and methods composition comprising one or more populations of cells provided herein, the cytokine expressed by the cytokine-ex genetically modified to express the coding sequence for a pressing population of genetically modified cells is selected cytokine and the coding sequence of one or more prostate from the group consisting of interferon alpha (IFN-O.), inter tumor-associated antigens selected from the group consisting 15 feron beta (IFN-B), interferon gamma (IFN-Y), interleukin-1 of HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, (IL-1). IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, HIGD2A, SSR3 and NRP2. In some embodiments, the com IL-11, IL-12, tumor necrosis factor alpha (TNF-C), tumor position comprises one or more populations of cells geneti necrosis factor beta (TNF-B), erythropoietin (EPO), MIP3A, cally modified to express the coding sequence for a cytokine intracellular adhesion molecule (ICAM), macrophage colony and the coding sequence of one, two, three, four, five, six, stimulating factor (M-CSF), granulocyte colony stimulating seven or eight prostate tumor-associated antigens selected factor (GCSF), and granulocyte-macrophage colony stimu from the group consisting of HLA-A24, FLJ14668, Cardio lating factor (GM-CSF). In particular embodiments, the lipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. cytokine is GM-CSF. In some embodiments, the Subject is a mammal. In some In some embodiments, the composition comprising one or embodiments, the Subject is a human. In some embodiments, 25 more populations of cells genetically modified to express the the immune response is a humoral immune response. In some coding sequence for a cytokine and the coding sequence of embodiments, the immune response is a cellular immune one, two, three, four, five, six, seven or eight prostate tumor response. associated antigens selected from the group consisting of In some embodiments, the genetically modified cells are HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, rendered proliferation incompetent by irradiation. 30 SSR3 and NRP2. In some embodiments, the composition In some embodiments, administration of the composition comprises one or more populations of cells genetically modi comprising one or more populations of cells genetically fied to express the coding sequence for a cytokine and the modified to express the coding sequence for a cytokine and coding sequence of one prostate tumor-associated antigen the coding sequence of one or more prostate tumor-associated selected from the group consisting of HLA-A24, FLJ14668, antigens selected from the group consisting of HLA-A24. 35 Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and Some embodiments, the composition comprises one or more NRP2 results in enhanced therapeutic efficacy relative to populations of cells genetically modified to express the cod administration of a composition comprising a single popula ing sequence for a cytokine and the coding sequence of two tion of cells genetically modified to express the coding prostate tumor-associated antigens selected from the group sequence for a cytokine or the coding sequence of one or more 40 consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, said prostate tumor-specific antigens alone. In some embodi SELS, HIGD2A, SSR3 and NRP2. In some embodiments, the ments, enhanced therapeutic efficacy is measured by composition comprises one or more populations of cells increased overall Survival time. In some embodiments, genetically modified to express the coding sequence for a enhanced therapeutic efficacy is measured by increased pro cytokine and the coding sequence of three prostate tumor gression-free Survival. In some embodiments, enhanced 45 associated antigens selected from the group consisting of therapeutic efficacy is measured by decreased tumor size. HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, In some embodiments of the compositions described SSR3 and NRP2. In some embodiments, the composition herein, the same population of cells is genetically modified to comprises one or more populations of cells genetically modi express the coding sequence for a cytokine and one or more fied to express the coding sequence for a cytokine and the prostate tumor-associated antigens selected from the group 50 coding sequence of four prostate tumor-associated antigens consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, selected from the group consisting of HLA-A24, FLJ14668, SELS, HIGD2A, SSR3 and NRP2. In some embodiments, the Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In population of genetically modified cells are autologous. In Some embodiments, the composition comprises one or more Some embodiments, the population of genetically modified populations of cells genetically modified to express the cod cells are allogeneic. In some embodiments, the population of 55 ing sequence for a cytokine and the coding sequence of five genetically modified cells are bystander cells. prostate tumor-associated antigens selected from the group In some embodiments of the compositions and methods consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, provided herein, two different populations of cells are geneti SELS, HIGD2A, SSR3 and NRP2. In some embodiments, the cally modified to express the coding sequence for a cytokine composition comprises one or more populations of cells and one or more prostate tumor-associated antigens selected 60 genetically modified to express the coding sequence for a from the group consisting of HLA-A24, FLJ14668, Cardio cytokine and the coding sequence of six prostate tumor-asso lipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In some ciated antigens selected from the group consisting of HLA embodiments, one of the populations of genetically modified A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 cells are autologous. In some embodiments, one of the popu and NRP2. In some embodiments, the composition comprises lations of genetically modified cells are allogeneic. In some 65 one or more populations of cells genetically modified to embodiments, one of the population of genetically modified express the coding sequence for a cytokine and the coding cells are bystander cells. In some embodiments of the com sequence of seven prostate tumor-associated antigens US 8,840,881 B2 5 6 selected from the group consisting of HLA-A24, FLJ14668, sequence for a cytokine and the coding sequence of FLJ14668 Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In and SELS. In some embodiments, the composition comprises Some embodiments, the composition comprises one or more one or more populations of cells genetically modified to populations of cells genetically modified to express the cod express the coding sequence for a cytokine and the coding ing sequence for a cytokine and the coding sequence of eight sequence of FLJ14668 and HIGD2A. In some embodiments, prostate tumor-associated antigens selected from the group the composition comprises one or more populations of cells consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, genetically modified to express the coding sequence for a SELS, HIGD2A, SSR3 and NRP2. cytokine and the coding sequence of FLJ14668 and SSR3. In In some embodiments, the composition comprises one or Some embodiments, the composition comprises one or more more populations of cells genetically modified to express the 10 populations of cells genetically modified to express the cod coding sequence for a cytokine and the coding sequence of ing sequence for a cytokine and the coding sequence of HLA-A24. In some embodiments, the composition com FLJ14668 and NRP2. In some embodiments, the composition prises one or more populations of cells genetically modified comprises one or more populations of cells genetically modi to express the coding sequence for a cytokine and the coding fied to express the coding sequence for a cytokine and the sequence of FLJ14668. In some embodiments, the composi 15 coding sequence of Cardiolipin and NNAT. In some embodi tion comprises one or more populations of cells genetically ments, the composition comprises one or more populations of modified to express the coding sequence for a cytokine and cells genetically modified to express the coding sequence for the coding sequence of Cardiolipin. In some embodiments, a cytokine and the coding sequence of Cardiolipin and SELS. the composition comprises one or more populations of cells In some embodiments, the composition comprises one or genetically modified to express the coding sequence for a more populations of cells genetically modified to express the cytokine and the coding sequence of NNAT. In some embodi coding sequence for a cytokine and the coding sequence of ments, the composition comprises one or more populations of Cardiolipin and HIGD2A. In some embodiments, the com cells genetically modified to express the coding sequence for position comprises one or more populations of cells geneti a cytokine and the coding sequence of SELS. In some cally modified to express the coding sequence for a cytokine embodiments, the composition comprises one or more popu 25 and the coding sequence of Cardiolipin and SSR3. In some lations of cells genetically modified to express the coding embodiments, the composition comprises one or more popu sequence for a cytokine and the coding sequence of HIGD2A. lations of cells genetically modified to express the coding In some embodiments, the composition comprises one or sequence for a cytokine and the coding sequence of Cardio more populations of cells genetically modified to express the lipinand NRP2. In some embodiments, the composition com coding sequence for a cytokine and the coding sequence of 30 prises one or more populations of cells genetically modified SSR3. In some embodiments, the composition comprises one to express the coding sequence for a cytokine and the coding or more populations of cells genetically modified to express sequence of NNAT and SELS. In some embodiments, the the coding sequence for a cytokine and the coding sequence composition comprises one or more populations of cells of NRP2. genetically modified to express the coding sequence for a In some embodiments, the composition comprises one or 35 cytokine and the coding sequence of NNAT and HIGD2A. In more populations of cells genetically modified to express the Some embodiments, the composition comprises one or more coding sequence for a cytokine and the coding sequence of populations of cells genetically modified to express the cod HLA-A24 and FLJ14668. In some embodiments, the compo ing sequence for a cytokine and the coding sequence of NNAT sition comprises one or more populations of cells genetically and SSR3. In some embodiments, the composition comprises modified to express the coding sequence for a cytokine and 40 one or more populations of cells genetically modified to the coding sequence of HLA-A24 and Cardiolipin. In some express the coding sequence for a cytokine and the coding embodiments, the composition comprises one or more popu sequence of NNAT and NRP2. In some embodiments, the lations of cells genetically modified to express the coding composition comprises one or more populations of cells sequence for a cytokine and the coding sequence of HLA genetically modified to express the coding sequence for a A24 and NNAT. In some embodiments, the composition com 45 cytokine and the coding sequence of SELS and HIGD2A. In prises one or more populations of cells genetically modified Some embodiments, the composition comprises one or more to express the coding sequence for a cytokine and the coding populations of cells genetically modified to express the cod sequence of HLA-A24 and SELS. In some embodiments, the ing sequence for a cytokine and the coding sequence of SELS composition comprises one or more populations of cells and SSR3. In some embodiments, the composition comprises genetically modified to express the coding sequence for a 50 one or more populations of cells genetically modified to cytokine and the coding sequence of HLA-A24 and express the coding sequence for a cytokine and the coding HIGD2A. In some embodiments, the composition comprises sequence of SELS and NRP2. In some embodiments, the one or more populations of cells genetically modified to composition comprises one or more populations of cells express the coding sequence for a cytokine and the coding genetically modified to express the coding sequence for a sequence of HLA-A24 and SSR3. In some embodiments, the 55 cytokine and the coding sequence of HIGD2A and SSR3. In composition comprises one or more populations of cells Some embodiments, the composition comprises one or more genetically modified to express the coding sequence for a populations of cells genetically modified to express the cod cytokine and the coding sequence of HLA-A24 and NRP2. In ing sequence for a cytokine and the coding sequence of Some embodiments, the composition comprises one or more HIGD2A and NRP2. In some embodiments, the composition populations of cells genetically modified to express the cod 60 comprises one or more populations of cells genetically modi ing sequence for a cytokine and the coding sequence of fied to express the coding sequence for a cytokine and the FLJ14668 and Cardiolipin. In some embodiments, the com coding sequence of SSR3 and NRP2. position comprises one or more populations of cells geneti In some embodiments, the composition comprises one or cally modified to express the coding sequence for a cytokine more populations of cells genetically modified to express the and the coding sequence of FLJ14668 and NNAT. In some 65 coding sequence for a cytokine and the coding sequence of embodiments, the composition comprises one or more popu HLA-A24, FLJ14668 and Cardiolipin. In some embodi lations of cells genetically modified to express the coding ments, the composition comprises one or more populations of US 8,840,881 B2 7 8 cells genetically modified to express the coding sequence for position comprises one or more populations of cells a cytokine and the coding sequence of HLA-A24, FLJ14668 genetically modified to express the coding sequence for a and NNAT. In some embodiments, the composition com cytokine and the coding sequence of HLA-A24, SSR3 and prises one or more populations of cells genetically modified NRP2. to express the coding sequence for a cytokine and the coding 5 In some embodiments, the composition comprises one or sequence of HLA-A24, FLJ14668 and SELS. In some more populations of cells genetically modified to express the embodiments, the composition comprises one or more popu coding sequence for a cytokine and the coding sequence of lations of cells genetically modified to express the coding FLJ14668, Cardiolipinand NNAT. In some embodiments, the sequence for a cytokine and the coding sequence of HLA composition comprises one or more populations of cells A24, FLJ14668 and HIGD2A. In some embodiments, the 10 genetically modified to express the coding sequence for a composition comprises one or more populations of cells cytokine and the coding sequence of FLJ14668, Cardiolipin genetically modified to express the coding sequence for a and SELS. In some embodiments, the composition comprises cytokine and the coding sequence of HLA-A24, FLJ14668 one or more populations of cells genetically modified to and SSR3. In some embodiments, the composition comprises express the coding sequence for a cytokine and the coding one or more populations of cells genetically modified to 15 sequence of FLJ14668, Cardiolipin and HIGD2A. In some express the coding sequence for a cytokine and the coding embodiments, the composition comprises one or more popu sequence of HLA-A24, FLJ14668 and NRP2. In some lations of cells genetically modified to express the coding embodiments, the composition comprises one or more popu sequence for a cytokine and the coding sequence of lations of cells genetically modified to express the coding FLJ14668, Cardiolipin and SSR3. In some embodiments, the sequence for a cytokine and the coding sequence of HLA composition comprises one or more populations of cells A24, Cardiolipin and NNAT. In some embodiments, the com genetically modified to express the coding sequence for a position comprises one or more populations of cells geneti cytokine and the coding sequence of FLJ14668, Cardiolipin cally modified to express the coding sequence for a cytokine and NRP2. In some embodiments, the composition comprises and the coding sequence of HLA-A24, Cardiolipin and one or more populations of cells genetically modified to SELS. In some embodiments, the composition comprises one 25 express the coding sequence for a cytokine and the coding or more populations of cells genetically modified to express sequence of FLJ14668, NNAT and SELS. In some embodi the coding sequence for a cytokine and the coding sequence ments, the composition comprises one or more populations of of HLA-A24, Cardiolipin and HIGD2A. In some embodi cells genetically modified to express the coding sequence for ments, the composition comprises one or more populations of a cytokine and the coding sequence of FLJ14668, NNAT and cells genetically modified to express the coding sequence for 30 HIGD2A. In some embodiments, the composition comprises a cytokine and the coding sequence of HLA-A24, Cardiolipin one or more populations of cells genetically modified to and SSR3. In some embodiments, the composition comprises express the coding sequence for a cytokine and the coding one or more populations of cells genetically modified to sequence of FLJ14668, NNAT and SSR3. In some embodi express the coding sequence for a cytokine and the coding ments, the composition comprises one or more populations of sequence of HLA-A24, Cardiolipin and NRP2. In some 35 cells genetically modified to express the coding sequence for embodiments, the composition comprises one or more popu a cytokine and the coding sequence of FLJ14668, NNAT and lations of cells genetically modified to express the coding NRP2. In some embodiments, the composition comprises one sequence for a cytokine and the coding sequence of HLA or more populations of cells genetically modified to express A24, NNAT and SELS. In some embodiments, the composi the coding sequence for a cytokine and the coding sequence tion comprises one or more populations of cells genetically 40 of FLJ14668, SELS and HIGD2A. In some embodiments, the modified to express the coding sequence for a cytokine and composition comprises one or more populations of cells the coding sequence of HLA-A24, NNAT and HIGD2A. In genetically modified to express the coding sequence for a Some embodiments, the composition comprises one or more cytokine and the coding sequence of FLJ14668, SELS and populations of cells genetically modified to express the cod SSR3. In some embodiments, the composition comprises one ing sequence for a cytokine and the coding sequence of HLA 45 or more populations of cells genetically modified to express A24, NNAT and SSR3. In some embodiments, the composi the coding sequence for a cytokine and the coding sequence tion comprises one or more populations of cells genetically of FLJ14668, SELS and NRP2. In some embodiments, the modified to express the coding sequence for a cytokine and composition comprises one or more populations of cells the coding sequence of HLA-A24, NNAT and NRP2. In some genetically modified to express the coding sequence for a embodiments, the composition comprises one or more popu 50 cytokine and the coding sequence of FLJ14668, HIGD2A and lations of cells genetically modified to express the coding SSR3. In some embodiments, the composition comprises one sequence for a cytokine and the coding sequence of HLA or more populations of cells genetically modified to express A24, SELS and HIGD2A. In some embodiments, the com the coding sequence for a cytokine and the coding sequence position comprises one or more populations of cells geneti of FLJ14668, HIGD2A and NRP2. In some embodiments, the cally modified to express the coding sequence for a cytokine 55 composition comprises one or more populations of cells and the coding sequence of HLA-A24, SELS and SSR3. In genetically modified to express the coding sequence for a Some embodiments, the composition comprises one or more cytokine and the coding sequence of FLJ14668, SSR3 and populations of cells genetically modified to express the cod NRP2. ing sequence for a cytokine and the coding sequence of HLA In some embodiments, the composition comprises one or A24, SELS and NRP2. In some embodiments, the composi 60 more populations of cells genetically modified to express the tion comprises one or more populations of cells genetically coding sequence for a cytokine and the coding sequence of modified to express the coding sequence for a cytokine and Cardiolipin, NNAT and SELS. In some embodiments, the the coding sequence of HLA-A24, HIGD2A and SSR3. In composition comprises one or more populations of cells Some embodiments, the composition comprises one or more genetically modified to express the coding sequence for a populations of cells genetically modified to express the cod 65 cytokine and the coding sequence of Cardiolipin, NNAT and ing sequence for a cytokine and the coding sequence of HLA HIGD2A. In some embodiments, the composition comprises A24, HIGD2A and NRP2. In some embodiments, the com one or more populations of cells genetically modified to US 8,840,881 B2 9 10 express the coding sequence for a cytokine and the coding embodiments, the composition comprises one or more popu sequence of Cardiolipin, NNAT and SSR3. In some embodi lations of cells genetically modified to express the coding ments, the composition comprises one or more populations of sequence for a cytokine and the coding sequence of HLA cells genetically modified to express the coding sequence for A24, FLJ14668, Cardiolipin and SELS. In some embodi a cytokine and the coding sequence of Cardiolipin, NNAT and 5 ments, the composition comprises one or more populations of NRP2. In some embodiments, the composition comprises one cells genetically modified to express the coding sequence for or more populations of cells genetically modified to express a cytokine and the coding sequence of HLA-A24, FLJ14668, the coding sequence for a cytokine and the coding sequence Cardiolipin and HIGD2A. In some embodiments, the com of Cardiolipin, SELS and HIGD2A. In some embodiments, position comprises one or more populations of cells geneti the composition comprises one or more populations of cells 10 genetically modified to express the coding sequence for a cally modified to express the coding sequence for a cytokine cytokine and the coding sequence of Cardiolipin, SELS and and the coding sequence of HLA-A24, FLJ14668, Cardio SSR3. In some embodiments, the composition comprises one lipin and SSR3. In some embodiments, the composition com or more populations of cells genetically modified to express prises one or more populations of cells genetically modified the coding sequence for a cytokine and the coding sequence 15 to express the coding sequence for a cytokine and the coding of Cardiolipin, SELS and NRP2. In some embodiments, the sequence of HLA-A24, FLJ14668, Cardiolipin and NRP2. composition comprises one or more populations of cells In some embodiments, the composition comprises one or genetically modified to express the coding sequence for a more populations of cells genetically modified to express the cytokine and the coding sequence of Cardiolipin, HIGD2A coding sequence for a cytokine and the coding sequence of and SSR3. In some embodiments, the composition comprises HLA-A24, Cardiolipin, NNAT and SELS. In some embodi one or more populations of cells genetically modified to ments, the composition comprises one or more populations of express the coding sequence for a cytokine and the coding cells genetically modified to express the coding sequence for sequence of Cardiolipin, HIGD2A and NRP2. In some a cytokine and the coding sequence of HLA-A24, Cardio embodiments, the composition comprises one or more popu lipin, NNAT and HIGD2A. In some embodiments, the com lations of cells genetically modified to express the coding 25 position comprises one or more populations of cells geneti sequence for a cytokine and the coding sequence of Cardio cally modified to express the coding sequence for a cytokine lipin, SSR3 and NRP2. and the coding sequence of HLA-A24, Cardiolipin, NNAT In some embodiments, the composition comprises one or and SSR3. In some embodiments, the composition comprises more populations of cells genetically modified to express the one or more populations of cells genetically modified to coding sequence for a cytokine and the coding sequence of 30 express the coding sequence for a cytokine and the coding NNAT, SELS and HIGD2A. In some embodiments, the com sequence of HLA-A24, Cardiolipin, NNAT and NRP2. position comprises one or more populations of cells geneti In some embodiments, the composition comprises one or cally modified to express the coding sequence for a cytokine more populations of cells genetically modified to express the and the coding sequence of NNAT, SELS and SSR3. In some coding sequence for a cytokine and the coding sequence of embodiments, the composition comprises one or more popu 35 HLA-A24, NNAT, SELS and HIGD2A. In some embodi lations of cells genetically modified to express the coding ments, the composition comprises one or more populations of sequence for a cytokine and the coding sequence of NNAT, cells genetically modified to express the coding sequence for SELS and NRP2. In some embodiments, the composition a cytokine and the coding sequence of HLA-A24, NNAT, comprises one or more populations of cells genetically modi SELS and SSR3. In some embodiments, the composition fied to express the coding sequence for a cytokine and the 40 comprises one or more populations of cells genetically modi coding sequence of NNAT, HIGD2A and SSR3. In some fied to express the coding sequence for a cytokine and the embodiments, the composition comprises one or more popu coding sequence of HLA-A24, NNAT, SELS and NRP2. lations of cells genetically modified to express the coding In some embodiments, the composition comprises one or sequence for a cytokine and the coding sequence of NNAT, more populations of cells genetically modified to express the HIGD2A and NRP2. In some embodiments, the composition 45 coding sequence for a cytokine and the coding sequence of comprises one or more populations of cells genetically modi HLA-A24, SELS, HIGD2A and SSR3. In some embodi fied to express the coding sequence for a cytokine and the ments, the composition comprises one or more populations of coding sequence of NNAT, SSR3 and NRP2. cells genetically modified to express the coding sequence for In some embodiments, the composition comprises one or a cytokine and the coding sequence of HLA-A24, SELS, more populations of cells genetically modified to express the 50 HIGD2A and NRP2. coding sequence for a cytokine and the coding sequence of In some embodiments, the composition comprises one or SELS, HIGD2A and SSR3. In some embodiments, the com more populations of cells genetically modified to express the position comprises one or more populations of cells geneti coding sequence for a cytokine and the coding sequence of cally modified to express the coding sequence for a cytokine HLA-A24, HIGD2A, SSR3 and NRP2. and the coding sequence of SELS, HIGD2A and NRP2. In 55 In some embodiments, the composition comprises one or Some embodiments, the composition comprises one or more more populations of cells genetically modified to express the populations of cells genetically modified to express the cod coding sequence for a cytokine and the coding sequence of ing sequence for a cytokine and the coding sequence of SELS, FLJ14668, Cardiolipin, NNAT and SELS. In some embodi SSR3 and NRP2. ments, the composition comprises one or more populations of In some embodiments, the composition comprises one or 60 cells genetically modified to express the coding sequence for more populations of cells genetically modified to express the a cytokine and the coding sequence of FLJ14668, Cardio coding sequence for a cytokine and the coding sequence of lipin, NNAT and HIGD2A. In some embodiments, the com HIGD2A, SSR3 and NRP2. position comprises one or more populations of cells geneti In some embodiments, the composition comprises one or cally modified to express the coding sequence for a cytokine more populations of cells genetically modified to express the 65 and the coding sequence of FLJ14668, Cardiolipin, NNAT coding sequence for a cytokine and the coding sequence of and SSR3. In some embodiments, the composition comprises HLA-A24, FLJ14668, Cardiolipin and NNAT. In some one or more populations of cells genetically modified to US 8,840,881 B2 11 12 express the coding sequence for a cytokine and the coding coding sequence for a cytokine and the coding sequence of sequence of FLJ14668, Cardiolipin, NNAT and NRP2. HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS and In some embodiments, the composition comprises one or HIGD2A. In some embodiments, the composition comprises more populations of cells genetically modified to express the one or more populations of cells genetically modified to coding sequence for a cytokine and the coding sequence of 5 express the coding sequence for a cytokine and the coding Cardiolipin, NNAT, SELS and HIGD2A. In some embodi sequence of HLA-A24, FLJ14668, Cardiolipin, NNAT, ments, the composition comprises one or more populations of SELS and SSR3. In some embodiments, the composition cells genetically modified to express the coding sequence for comprises one or more populations of cells genetically modi a cytokine and the coding sequence of Cardiolipin, NNAT, fied to express the coding sequence for a cytokine and the SELS and SSR3. In some embodiments, the composition 10 coding sequence of HLA-A24, FLJ14668, Cardiolipin, comprises one or more populations of cells genetically modi NNAT, SELS and NRP2. fied to express the coding sequence for a cytokine and the In some embodiments, the composition comprises one or coding sequence of Cardiolipin, NNAT, SELS and NRP2. more populations of cells genetically modified to express the In some embodiments, the composition comprises one or coding sequence for a cytokine and the coding sequence of more populations of cells genetically modified to express the 15 FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A and SSR3. coding sequence for a cytokine and the coding sequence of In some embodiments, the composition comprises one or NNAT, SELS, HIGD2A and SSR3. In some embodiments, more populations of cells genetically modified to express the the composition comprises one or more populations of cells coding sequence for a cytokine and the coding sequence of genetically modified to express the coding sequence for a FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A and NRP2. cytokine and the coding sequence of NNAT, SELS, HIGD2A In some embodiments, the composition comprises one or and NRP2. more populations of cells genetically modified to express the In some embodiments, the composition comprises one or coding sequence for a cytokine and the coding sequence of more populations of cells genetically modified to express the Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. coding sequence for a cytokine and the coding sequence of In some embodiments, the composition comprises one or SELS, HIGD2A, SSR3 and NRP2. 25 more populations of cells genetically modified to express the In some embodiments, the composition comprises one or coding sequence for a cytokine and the coding sequence of more populations of cells genetically modified to express the HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A coding sequence for a cytokine and the coding sequence of and SSR3. In some embodiments, the composition comprises HLA-A24, FLJ14668, Cardiolipin, NNAT and SELS. In one or more populations of cells genetically modified to Some embodiments, the composition comprises one or more 30 express the coding sequence for a cytokine and the coding populations of cells genetically modified to express the cod sequence of HLA-A24, FLJ14668, Cardiolipin, NNAT, ing sequence for a cytokine and the coding sequence of HLA SELS, HIGD2A and NRP2. A24, FLJ14668, Cardiolipin, NNAT and HIGD2A. In some In some embodiments, the composition comprises one or embodiments, the composition comprises one or more popu more populations of cells genetically modified to express the lations of cells genetically modified to express the coding 35 coding sequence for a cytokine and the coding sequence of sequence for a cytokine and the coding sequence of HLA FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and A24, FLJ14668, Cardiolipin, NNAT and SSR3. In some NRP2. embodiments, the composition comprises one or more popu In some embodiments, the composition comprises one or lations of cells genetically modified to express the coding more populations of cells genetically modified to express the sequence for a cytokine and the coding sequence of HLA 40 coding sequence for a cytokine and the coding sequence of A24, FLJ14668, Cardiolipin, NNAT and NRP2. HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A In some embodiments, the composition comprises one or and SSR3. more populations of cells genetically modified to express the In some embodiments, the composition comprises one or coding sequence for a cytokine and the coding sequence of more populations of cells genetically modified to express the FLJ14668, Cardiolipin, NNAT, SELS and HIGD2A. In some 45 coding sequence for a cytokine and the coding sequence of embodiments, the composition comprises one or more popu HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, lations of cells genetically modified to express the coding SSR3 and NRP2. sequence for a cytokine and the coding sequence of In some embodiments of the compositions and methods FLJ14668, Cardiolipin, NNAT, SELS and SSR3. In some provided herein, the composition further comprises a tyrosine embodiments, the composition comprises one or more popu- 50 kinase inhibitor selected from the group consisting of gefiti lations of cells genetically modified to express the coding mib, erolotinib and imatinib. sequence for a cytokine and the coding sequence of In some embodiments of the compositions and methods FLJ14668, Cardiolipin, NNAT, SELS and NRP2. provided herein, the composition further comprises an addi In some embodiments, the composition comprises one or tional cancer therapeutic agent. In some embodiments, the more populations of cells genetically modified to express the 55 additional cancer therapeutic agent is an anti-CTLA4 anti coding sequence for a cytokine and the coding sequence of body. In some embodiments, the one or more populations of Cardiolipin, NNAT, SELS, HIGD2A and SSR3. In some cells of the cellular immunotherapy composition are further embodiments, the composition comprises one or more popu genetically modified to express an anti-CTLA-4 antibody. In lations of cells genetically modified to express the coding Some embodiments, the additional cancer therapeutic agentis sequence for a cytokine and the coding sequence of Cardio 60 an anti-PD-1 antibody. In some embodiments, the one or lipin, NNAT, SELS, HIGD2A and NRP2. more populations of cells of the cellular immunotherapy In some embodiments, the composition comprises one or composition are further genetically modified to express an more populations of cells genetically modified to express the anti-PD-1 antibody. coding sequence for a cytokine and the coding sequence of The invention further provides kits comprising one or more NNAT, SELS, HIGD2A, SSR3 and NRP2. 65 populations of cells genetically modified to express the cod In some embodiments, the composition comprises one or ing sequence for a cytokine and the coding sequence of one or more populations of cells genetically modified to express the more prostate tumor-associated antigens selected from the US 8,840,881 B2 13 14 group consisting of HLA-A24, FLJ14668, Cardiolipin, Neu FIG. 6C presents the fold-induction of tetanus toxoid IgG/ ronatin (NNAT), Selenoprotein (SELS), HIG1 domain fam IgM antibodies in G-0010 patients. ily, member 2A (HIGD2A), Signal sequence receptor, FIG. 6D presents a correlation of FLJ14668 Ab induction gamma (SSR3) and Neuropilin 2 (NRP2), for use according with survival in G-0010 patients following GVAX immuno to the description provided herein. 5 therapy. MST-median survival time. The invention further provides methods of making a com FIG. 6E presents a comparison of predicted and actual position comprising one or more populations of cells geneti survival in FLJ14668 antibody positive and negative patient cally modified to express the coding sequence for a cytokine populations in G-0010. and the coding sequence of one or more prostate tumor FIG. 6F presents G-0010 FLJ14668 antibody dose-re associated antigens selected from the group consisting of 10 Sponse. HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, FIG. 7A presents plasmid map of pKCCMV-NNATFlag. SSR3 and NRP2. The methods comprise obtaining one or more population of cells and modifying the one or more FIG. 7B presents the fold-induction of NNAT IgG/IgM population of cells by introducing into the cells: (i) a nucleic antibodies in G-0010 patients. acid molecule comprising a nucleic acid sequence encoding a 15 FIG. 7C presents the association of NNAT Ab immune cytokine operably linked to a promoter; (ii) one or more response and survival in G-0010. nucleic acid molecules comprising a nucleic acid sequence FIG. 8A presents the fold-induction of Cardiolipin IgG/ encoding a prostate tumor-associated antigen selected from IgM antibodies in G-0010 patients. the group consisting of HLA-A24, FLJ14668, Cardiolipin, FIG.8B presents the association of Cardiolipin Ab immune NNAT, SELS, HIGD2A, SSR3 and NRP2; and (iii) a nucleic response and survival in G-0010. acid molecule comprising a nucleic acid sequence encoding a FIG. 9 presents the association of HLA-A24 and/or selectable marker operably linked to a promoter. FLJ14668 immune response and survival in G-0010. FIG. 10 presents the association of NNAT and/or Cardio 4. BRIEF DESCRIPTION OF THE FIGURES lipin immune response and survival in G-0010 25 FIG.11 presents the association of FLJ14668 and/or HLA FIG. 1 presents the expression patterns of PNPO with A24 and/or Cardiolipin immune response and Survival in increasing prostate cancer disease grade derived from the G-OO10. Oncomine database. In FIG. 1, Class 1: Normal prostate FIG. 12A presents a correlation of HLA-A24 and/or (n=41), Class 2: Prostate cancer (n-62), Class 3: Lymph node OUTEB2 Ab induction with Survival in G-98.03 metastatic metastasis (n=9), P-value: 1.25E-5, and Correlation=0.408. 30 hormone refractory prostate cancer (HRPC) patients follow FIG. 2 presents the expression patterns of FLNB with ing GVAX immunotherapy. MST-median survival time. increasing prostate cancer disease grade derived from the FIG. 12B presents a correlation of HLA-A24 and/or Oncomine database. In FIG. 2, Class 1: Prostate carcinoma OUTB2 Ab induction with survival in G-9803 PSA-rising (n=59), Class 2: Metastatic prostate cancer (n=20), and HPRC patients following GVAX immunotherapy. P-value: 4.6E-7. 35 MST-median survival time. FIG. 3A presents the trial design for the G-9803 Phase II FIG. 12C presents a correlation of HLA-A24 and/or GVAX immunotherapy clinical trial in chemotherapy-naive OUTEB2 Ab induction with Survival in G-0010 metastatic patients with hormone-refractory prostate cancer (n=55). The HPRC patients following GVAX immunotherapy. trial enrolled PSA-rising patients, who were treated with low MST-median survival time. dose GVAX immunotherapy; as well as metastatic patients, 40 FIG. 13A presents the effect of GVAX immunotherapy who were treated with both low and high-dose GVAX immu dose level on HLA-A24, FLJ14668 and OUTB2 antibody notherapy. induction in G-0010 patients. FIG. 3B presents the trial design for the G-0010 Phase II FIG. 13B presents the effect of the number of GVAX GVAX immunotherapy clinical trial in chemotherapy-naive vaccinations per patient on HLA-A24 antibody induction in patients with hormone-refractory prostate cancer (HRPC) 45 G-0010 patients. (n=80). The trial enrolled metastatic patients, who were FIG. 13C presents the effect of the number of GVAX treated with low, mid and high-dose GVAX immunotherapy. vaccinations per patient on OUTB2 antibody induction in FIG. 4A presents a plasmid map of pKCCMVHLA G-0010 patients. A2402Flag. FIG. 13D presents the effect of the number of GVAX FIG. 4B presents representative blots of HLA-A24 probed 50 vaccinations per patient on FLJ14668 antibody induction in with post-vaccination serum from immuno-positive G-0010 G-0010 patients. patients treated with GVAX immunotherapy for prostate can FIG. 14 presents a correlation of SELS Ab induction with cer. Serum was diluted 1:500. survival in G-0010 patients following GVAX immuno FIG. 4C presents a correlation of HLA-A24 Ab induction therapy. MST-median survival time. with survival in G-0010 patients following GVAX immuno 55 FIG. 15 presents a correlation of HIGD2A Ab induction therapy. MST-median survival time. with survival in G-0010 patients following GVAX immuno FIG. 5A presents the fold-induction of OUTB2 antibody therapy. MST-median survival time. titer in G-0010 patients following GVAX immunotherapy for FIG. 16 presents a correlation of SSR3Ab induction with prostate cancer. survival in G-0010 patients following GVAX immuno FIG. 5B presents a correlation of OUTB2 Ab induction 60 therapy. MST-median survival time. with survival in G-9803 patients following GVAX immuno FIG. 17 presents the percentage of patients in groups A, B, therapy. MST-median survival time. and 3/4, respectively, with induction of HIGD2A or SSR3Ab FIG. 6A presents a plasmid map of pKCCMVHLA following GVAX immunotherapy. A2402Flag. FIG. 18 presents an O.D. comparison of SSR3Ab titer in FIG. 6B presents the fold-induction of FLJ14668 antibody 65 normal (untreated) subjects, in patients before GVAX immu titer in G-0010 patients following GVAX immunotherapy for notherapy (pre’), and in patients following GVAX immuno prostate cancer. therapy (“post'). US 8,840,881 B2 15 16 FIG. 19 presents a correlation of NRP2 Ab induction with others. The definition includes, without limitation, those hor survival in G-0010 patients following GVAX immuno mones that act locally and do not circulate in the blood, and therapy. MST-median survival time. which, when used in accord with the present invention, will FIG. 20A presents flow cytometry analyses of expression result in an alteration of an individual’s immune response. of the GM-CSF and the B 16-associated antigens Trp2 and gp 5 The term “cytokine' or “cytokines' as used herein refers to 100 by Lewis Lung Carcinoma (LLC) cells modified to the general class of biological molecules, which affect cells of secrete GM-CSF and to over-express either of the two B16 the immune system. The definition is meant to include, but is associated antigens Trp2 (LLC.GMKd.Trp2) and gp100 not limited to, those biological molecules that act locally or (LLC.GMKd.gp100). The expression levels of GM-CSF on may circulate in the blood, and which, when used in the unmodified B16F10 cells (negative control) are represented 10 compositions or methods of the present invention serve to by the shaded histogram. The open histograms represent GM regulate or modulate an individual’s immune response to CSF expression levels of the B16F10.GMKd, LLC.G- cancer. Exemplary cytokines for use in practicing the inven MKdgp100, and LLC.GMKd.Trp2 cells. For Trp2 and tion include, but are not limited to, interferon-alpha (IFN gp100 expression, the antibody isotype control is represented alpha), IFN-beta, and IFN-gamma, interleukins (e.g., IL-1 to by shaded histograms and specific antibodies against Trp2 15 IL-29, in particular, IL-2, IL-7, IL-12, IL-15 and IL-18), and gp 100 are represented by open histograms. tumor necrosis factors (e.g., TNF-alpha and TNF-beta), FIG.20B PCR analyses of the fold increase in gene copies erythropoietin (EPO), MIP3a, ICAM, macrophage colony of the melanoma-associated antigens Trp2 and gp 100 in the stimulating factor (M-CSF), granulocyte colony stimulating single-antigen Lewis Lung Carcinoma immunotherapy cells factor (G-CSF) and granulocyte-macrophage colony stimu (B16F10.GMKd, LLC.GMKd.Trp2, and LLC.G- 20 lating factor (GM-CSF). MKd.gp100) compared to the B16 cell line. As used herein, the terms "cancer”, “cancer cells”, “neo FIG. 21 presents specific T-cell responses induced by plastic cells”, “neoplasia”, “tumor, and “tumor cells' (used administration of lentivirus modified LLC cell lines. B16F10 interchangeably) refer to cells that exhibit relatively autono tumor-bearing C57BL/6 animals were immunized on day 3 mous growth, so that they exhibit an aberrant growth pheno after tumor cell implantation (2x10E5 cells) with 3x10E6 25 type or aberrant cell status characterized by a significant loss allogeneic GM-C SF-secreting B16F10 cells of control of cell proliferation. A tumor cell may be a hyper (B16F10.GMKd) as multivalent antigen immunotherapy or plastic cell, a cell that shows a lack of contact inhibition of with GM-CSF-secreting LLC cells modified to over-express growth in vitro or in vivo, a cell that is incapable of metastasis either of the two B16-associated antigens Trp2 (LLC.G- in vivo, or a cell that is capable of metastasis in vivo. Neo MKd.Trp2) or gp100 (LLC.GMKd.gp 100) as single B16 30 plastic cells can be malignant or benign. It follows that cancer antigen-specific immunotherapies. cells are considered to have an aberrant cell status. FIG. 22 presents survival data of mice immunized with "Tumor cells' may be derived from a primary tumor or GM-CSF-secreting Lewis Lung Carcinoma (LLC) cells derived from a tumor metastases. The “tumor cells' may be modified to express one or two of B16-associated antigens, recently isolated from a patient (a “primary tumor cell’) or Trp2 (LLC.GMKd.Trp2) and Trp2/gp100 (LLC.G-35 may be the product of long term in vitro culture. MKd.Trp2/gp100) and challenged with a lethal dose of live The term “primary tumor cell' is used in accordance with B16F10 cells. the meaning in the art. A primary tumor cell is a cancer cell that is isolated from a tumor in a mammal and has not been 5. DETAILED DESCRIPTION OF THE extensively cultured in vitro. INVENTION 40 The term “antigen from a tumor cell' and “tumor antigen” and "tumor cellantigen’ and "tumor-associated antigen' may The present invention provides prostate cancer markers, be used interchangeably herein and refer to any protein, pep compositions comprising Such markers, and methods of tide, carbohydrate or other component derived from or using Such markers to induce or increase an immune response expressed by a tumor cell which is capable of eliciting an against prostate cancer. The markers, compositions, immu- 45 immune response. The definition is meant to include, but is noglobulins, and methods are useful, for example, for induc not limited to, whole tumor cells, tumor cell fragments, ing or increasing an immune response, in particular a humoral plasma membranes taken from a tumor cell, proteins purified immune response, against prostate cancer cells which from the cell Surface or membrane of a tumor cell, unique immune response is preferably associated with prophylaxis carbohydrate moieties associated with the cell surface of a of prostate cancer, treatment of prostate cancer, and/or ame- 50 tumor cell or tumor antigens expressed from a vector in a cell. lioration of at least one symptom associated with prostate The definition also includes those antigens from the surface of CaCC. the cell, which require special treatment of the cells to access. Without intending to be bound to any particular theory or The term “genetically modified tumor cell as used herein mechanism of action, it is believed that one aspect of the refers to a composition comprising a population of cells that immune response induced by therapy with genetically modi- 55 has been genetically modified to express a transgene, and that fied tumor cells that express a cytokine and a prostate tumor is administered to a patient as part of a cancer treatment associated antigen is an immune response against certain regimen. The genetically modified tumor cell vaccine com polypeptides expressed by the genetically modified tumor prises tumor cells which are “autologous' or “allogeneic' to cell and/or cells from the tumor afflicting the subject. It is also the patient undergoing treatment or “bystander cells' that are believed that this immune response plays an important role in 60 mixed with tumor cells taken from the patient. Generally, the the effectiveness of this therapy to treat, e.g., prostate cancer. genetically modified tumor cell is of the same general type of tumor cell as is afflicting the patient, e.g., if the patient is 5.1 Definitions afflicted with metastatic prostate cancer, the genetically modified tumor cell is also a metastatic prostate cancer cell. A By the term “cytokine' or grammatical equivalents, herein 65 GM-CSF-expressing genetically modified tumor cell vaccine is meant the general class of hormones of the cells of the may be referred to herein as “GVAX'R). Autologous and immune system, including lymphokines, monokines, and allogeneic cancer cells that have been genetically modified to US 8,840,881 B2 17 18 express a cytokine, e.g., GM-CSF, followed by readministra intranasal, intravenous (including via an indwelling catheter), tion to a patient for the treatment of cancer are described in intratumoral, via an afferentlymph vessel, or by another route U.S. Pat. Nos. 5,637,483, 5,904,920, 6,277,368 and 6,350, that is suitable in view of the patients condition. The com 445, each of which is expressly incorporated by reference positions of this invention may be administered to the Subject herein. A form of GM-CSF-expressing genetically modified 5 at any site. For example, they can be delivered to a site that is cancer cells or a “cytokine-expressing cellular vaccine’ for “distal to or “distant from the primary tumor. the treatment of pancreatic cancer is described in U.S. Pat. The term “induced immune response' or “de novo immune Nos. 6,033,674 and 5,985,290, both of which are expressly response' as used herein means that a specific immune acti incorporated by reference herein. A universal immunomodu vation is detectable (e.g. detection of a B-cell and/or T-cell latory cytokine-expressing bystander cell line is described in 10 response). An example of an induced immune response is U.S. Pat. No. 6,464.973, expressly incorporated by reference detection of an amount of an antibody that binds an antigen herein. which is not detected prior to administration of a cytokine The term "enhanced expression” as used herein, refers to a expressing cellular vaccine of the invention. cell producing higher levels of a particular protein than would The term “increased immune response' as used herein be produced by the naturally occurring cellor the parental cell 15 means that a detectable increase of a specific immune activa from which it was derived. Cells may be genetically modified tion is detectable (e.g. an increase in B-cell and/or T-cell to increase the expression of a cytokine, such as GM-CSF, or response). An example of an increased immune response is an a prostate tumor-associated antigen. The expression of cytok increase in the amount of an antibody that binds an antigen ine or tumor antigen may be increased using any method which is detected a lower level prior to administration of a known in the art, such as genetically modifying promoter cytokine-expressing cellular vaccine of the invention. regions of genomic sequences or genetically altering cellular Another example, is an increased cellular immune response. signaling pathways to increase production of the cytokine or A cellular immune response involves T cells, and can be tumor antigen. Also, cells can be transduced with a vector observed in vitro (e.g. measured by a Chromium release coding for the cytokine or tumor antigen, or immunogenic assay) or in vivo. An increased immune response is typically fragments thereof. 25 accompanied by an increase of a specific population of By the term "systemic immune response' or grammatical immune cells. equivalents herein is meant an immune response which is not By the term “retarding the growth of a tumor is meant the localized, but affects the individual as a whole, thus allowing slowing of the growth rate of a tumor, the inhibition of an specific Subsequent responses to the same stimulus. increase in tumor size or tumor cell number, or the reduction As used herein, the term “proliferation-incompetent” or 30 in tumor cell number, tumor size, or numbers of tumors. “inactivated refers to cells that are unable to undergo mul The term “inhibiting tumor growth” refers to any measur tiple rounds of mitosis, but still retain the capability to express able decrease in tumor mass, tumor volume, amount of tumor proteins such as cytokines or tumor antigens. This may be cells or growth rate of the tumor. Measurable decreases in achieved through numerous methods known to those skilled tumor mass can be detected by numerous methods known to in the art. Embodiments of the invention include, but are not 35 those skilled in the art. These include direct measurement of limited to, treatments that inhibit at least about 95%, at least accessible tumors, counting of tumor cells (e.g. present in about 99% or substantially 100% of the cells from further blood), measurements of tumor antigens (e.g. Prostate Spe proliferation. In one embodiment, the cells are irradiated at a cific Antigen (PSA), Alphafetoprotein (AFP) and various dose of from about 50 to about 200 rads/min or from about visualization techniques (e.g. MRI, CAT-Scan and X-rays). 120 to about 140 rads/min prior to administration to the 40 Decreases in the tumor growth rate typically correlates with mammal. Typically, when using irradiation, the levels longer Survival time for a mammal with cancer. required are 2,500 rads, 5,000 rads, 10,000 rads, 15,000 rads By the term “therapeutically effective amount’ or gram or 20,000 rads. In several embodiments of the invention the matical equivalents herein refers to an amount of an agent, cells produce beta-filamin or immunogenic fragment thereof, e.g., a cytokine-expressing cellular vaccine of the invention, two days after irradiation, at a rate that is at least about 10%, 45 that is sufficient to modulate, either by stimulation or sup at least about 20%, at least about 50% or at least about 100% pression, the immune response of an individual. This amount of the pre-irradiated level, when standardized for viable cell may be different for different individuals, different tumor number. In one embodiment of the invention, cells are ren types, and different preparations. The “therapeutically effec dered proliferation incompetent by irradiation prior to admin tive amount' is determined using procedures routinely istration to the subject. 50 employed by those of skill in the art such that an “improved By the term “individual”, “subject' or grammatical equiva therapeutic outcome results. lents thereof is meant any one individual mammal. As used herein, the terms “improved therapeutic outcome' By the term “reversal of an established tumor' or gram and "enhanced therapeutic efficacy.” relative to cancer refers matical equivalents herein is meant the Suppression, regres to a slowing or diminution of the growth of cancer cells or a Sion, or partial or complete disappearance of a pre-existing 55 solid tumor, or a reduction in the total number of cancer cells tumor. The definition is meant to include any diminution in or total tumor burden. An "improved therapeutic outcome” or the size, potency or growth rate of a pre-existing tumor. "enhanced therapeutic efficacy” therefore means there is an The terms “treatment”, “therapeutic use’, or “medicinal improvement in the condition of the patient according to any use' as used herein, shall refer to any and all uses of the clinically acceptable criteria, including an increase in life claimed compositions which remedy a disease state or symp 60 expectancy or an improvement in quality of life (as further tom, or otherwise prevent, hinder, retard, or reverse the pro described herein) gression of disease or other undesirable symptoms in any way The term “nucleic acid refers to deoxyribonucleotides or whatsoever. ribonucleotides and polymers thereof (“polynucleotides’) in The term “administered’ refers to any method that intro either single- or double-stranded form. Unless specifically duces the cells of the invention (e.g. cancer vaccine) to a 65 limited, the term encompasses nucleic acids containing mammal. This includes, but is not limited to, intradermal, known analogues of natural nucleotides that have similar parenteral, intramuscular, Subcutaneous, intraperitoneal, binding properties as the reference nucleic acid and are US 8,840,881 B2 19 20 metabolized in a manner similar to naturally occurring nucle For sequence comparison, typically one sequence acts as a otides. Unless otherwise indicated, a particular nucleic acid reference sequence to which test sequences are compared. molecule/polynucleotide also implicitly encompasses con When using a sequence comparison algorithm, test and ref servatively modified variants thereof (e.g. degenerate codon erence sequences are input into a computer, Subsequence Substitutions) and complementary sequences and as well as coordinates are designated if necessary, and sequence algo the sequence explicitly indicated. Specifically, degenerate rithm program parameters are designated. The sequence com codon Substitutions may be achieved by generating parison algorithm then calculates the percent sequence iden sequences in which the third position of one or more selected tity for the test sequence(s) relative to the reference sequence, (or all) codons is substituted with mixed-base and/or deoxyi based on the designated program parameters. nosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 10 Optimal alignment of sequences for comparison can be (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). Nucle conducted, e.g., by the local homology algorithm of Smith & otides are indicated by their bases by the following standard Waterman, Adv. Appl. Math. 2:482 (1981), by the homology abbreviations: adenine (A), cytosine (C), thymine (T), and alignment algorithm of Needleman & Wunsch, J. Mol. Biol. guanine (G). 15 48: 443 (1970), by the search for similarity method of Pearson Stringent hybridization conditions' and “stringent wash & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by conditions’ in the context of nucleic acid hybridization computerized implementations of these algorithms (GAP, experiments such as Southern and Northern hybridizations BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics are sequence dependent, and are different under different Software Package, Genetics Computer Group, 575 Science environmental parameters. Longer sequences hybridize at Dr. Madison, Wis.), by the BLAST algorithm, Altschuletal. higher temperatures. An extensive guide to the hybridization J. Mol. Biol. 215: 403-410 (1990), with software that is pub of nucleic acids is found in Tijssen (1993) Laboratory Tech licly available through the National Center for Biotechnology niques in Biochemistry and Molecular Biology-Hybridiza Information, or by visual inspection (see generally, Ausubel tion with Nucleic Acid Probes part 1 chapter 2 “Overview of et al., infra). For purposes of the present invention, optimal principles of hybridization and the strategy of nucleic acid 25 alignment of sequences for comparison is most preferably probe assays' Elsevier, New York. Generally, highly stringent conducted by the local homology algorithm of Smith & hybridization and wash conditions are selected to be about 5° Waterman, Adv. Appl. Math. 2: 482 (1981). C. to 20°C. (preferably 5°C.) lower than the thermal melting As used herein, a "peptide' refers to anamino acid polymer point (T) for the specific sequence at a defined ionic strength containing between about 8 and about 12 amino acids linked and pH. Typically, under highly stringent conditions a probe 30 together via peptide bonds. A peptide according to the present will hybridize to its target subsequence, but to no other unre lated sequences. invention can comprise additional atoms beyond those of the The T is the temperature (under defined ionic strength and 8 to twelve amino acids, so long as the peptide retains the pH) at which 50% of the target sequence hybridizes to a ability to bind an MHCI receptor, e.g., an HLA-A2 receptor, perfectly matched probe. Very stringent conditions are 35 and formaternary complex with the T-cell receptor, the MHC selected to be equal to the T for a particular probe. An I receptor, and the peptide. example of stringent hybridization conditions for hybridiza Conservative substitution” refers to the substitution in a tion of complementary nucleic acids that have more than 100 polypeptide of an amino acid with a functionally similar complementary residues on a filter in a Southern or northern amino acid. The following six groups each contain amino blot is 50% formamide with 1 mg of heparin at 42°C., with 40 acids that are conservative Substitutions for one another: the hybridization being carried out overnight. An example of Alanine (A), Serine (S), and Threonine (T) highly stringent wash conditions is 0.15MNaCl at 72°C. for Aspartic acid (D) and Glutamic acid (E) about 15 minutes. An example of stringent wash conditions is Asparagine (N) and Glutamine (Q) a 0.2xSSC wash at 65° C. for 15 minutes (see, Sambrook, Arginine (R) and Lysine (K) infra, for a description of SSC buffer). Often, a high strin 45 Isoleucine (I), Leucine (L), Methionine (M), and Valine gency wash is preceded by a low stringency wash to remove (V) background probe signal. An example medium stringency Phenylalanine (F), Tyrosine (Y), and Tryptophan (W). wash for a duplex of, e.g., more than 100 nucleotides, is The term “about as used herein, unless otherwise indi 1xSSC at 45° C. for 15 minutes. An example low stringency cated, refers to a value that is no more than 10% above or wash for a duplex of, e.g., more than 100 nucleotides, is 50 below the value being modified by the term. For example, the 4-6xSSC at 40° C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically term “about 5 g/kg' means a range of from 4.5 ug/kg to 5.5 involve salt concentrations of less than about 1.0M Naion, ug/kg. As another example, "about 1 hour” means a range of typically about 0.01 to 1.0 M Na ion concentration (or other from 48 minutes to 72 minutes. Where the term “about salts) at pH 7.0 to 8.3, and the temperature is typically at least 55 modifies a value that must be an integer, and 10% above or about 30° C. Stringent conditions can also be achieved with below the value is not also an integer, the modified value the addition of destabilizing agents such as formamide. In should be rounded to the nearest whole number. For example, general, a signal to noise ratio of 2x (or higher) than that "about 12 amino acids’ means a range of 11 to 13 amino observed for an unrelated probe in the particular hybridiza acids. tion assay indicates detection of a specific hybridization 60 The term “physiological conditions, as used herein, refers The terms “identical' or percent “identity” in the context of to the Salt concentrations normally observed in human serum. two or more nucleic acid or protein sequences, refer to two or One skilled in the art will recognize that physiological con more sequences or Subsequences that are the same or have a ditions need not mirror the exact proportions of allions found specified percentage of amino acid residues or nucleotides in human serum, rather, considerable adjustment can be made that are the same, when compared and aligned for maximum 65 in the exact concentration of Sodium, potassium, calcium, correspondence, as measured using one of the sequence com chloride, and other ions, while the overallionic strength of the parison algorithms described herein or by visual inspection Solution remains constant. US 8,840,881 B2 21 22 5.2 Antigens Associated with Therapy with Proliferation dimeric phospholipid synthesized from two lipid substrates, Incompetent Tumor Cells that Express GM-CSF and a Pros CDP-diacylglycerol and phosphatidylglycerol. Its synthesis tate Tumor-Associated Antigen is catalyzed by the enzyme CL synthase, which is encoded by In certain aspects as described below, the invention pro the gene CRD1 (CLS1). It is typically present in metaboli vides methods that comprise inducing or increasing immune 5 cally active cells of the heart and skeletal muscle. It has also responses against antigens associated with a likelihood of been observed in certain bacterial membranes. It serves as an responsiveness to treatment with proliferation-incompetent insulator and stabilizes the activity of protein complexes tumor cells that express cytokines, e.g., GM-CSF. In some important to the electron transport chain Anti-cardiolipin embodiments, the therapies are predicted to result in an antibodies can also be increased in numerous conditions, improved therapeutic outcome for the Subject, for example, a 10 including malaria and tuberculosis (McNeil et al., 1990). See reduction in the level of PSA in the patient’s serum, a McNeil, H. P. Simpson, R.J., Chesterman, C. N. Krilis, S.A. decrease in cancer-associated pain or improvement in the Anti-phospholipid antibodies are directed against a complex condition of the patient according to any clinically acceptable antigen that includes a lipid-binding inhibitor of coagulation: criteria, including but not limited to a decrease in metastases, beta 2-glycoprotein I (apolipoprotein H). Proc. Natl. Acad. an increase in life expectancy oran improvement in quality of 15 Sci. U.S.A. 87 (11): 4120 (1990). life. The antigens may be expressed endogenously by cells As Cardiolipin is a phospholipid, and thus not encoded by native to the Subject or may be exogenously provided to the a nucleic acid sequence, the phrase "genetically modified to Subject by, e.g., the administered genetically modified tumor express the coding sequence of Cardiolipin” as used herein cells. The discussion below briefly describes examples of refers to any genetic modification of a cell or population of Such antigens. cells which results in the increased production of Cardiolipin HLA class I histocompatibility antigen (alias MHC class I in the cell. Thus, in Some embodiments, a cell genetically antigen A*24, Aw-24, A-9) is a 40689 Da protein of 365 modified to express Cardiolipin in accordance with the meth amino acids (SEQID NO: 1) encoded on chromosome 6 (En ods provided herein is genetically modified to express an trez, Gene cytogenetic band 6p21.3). Representative nucle enzyme which catalyzes the synthesis of Cardiolipin, e.g., CL otide sequence HLA-A2402 is shown (SEQID NO: 2). HLA 25 synthase. In other embodiments, a cell genetically modified A24 belongs to the HLA class I heavy chain paralogues to express Cardiolipin in accordance with the methods pro (Nguyen et al. 1985; Little et al. 1992). This class 1 molecule vided herein is gentically modified to express an enzyme is a heterodimer consisting of a heavy chain and a light chain which catalyzes the synthesis of the cardiolipin precursors (B-2 microglobulin). The heavy chain is anchored in the CDP-diacylglycerol and phosphatidylglycerol. In some membrane as a single-pass type I membrane protein. HLA 30 embodiments, the enzyme is CDP-diacylglycerol synthase 1 A24 plays a central role in the immune system by presenting (CDS1). In some embodiments, the enzyme is CDP-diacylg peptides derived from the endoplasmic reticulum lumen. The lycerol synthase 2 (CDS2). following alleles of A-24 are known: A*2401, A*2402. NNAT (alias Peg5, MGC 1439) encodes 2 different iso A*2403, A*2406, A*2408 (A9HH), A*2410 (A*24JV), forms of Neuronatin alpha (9237Da, 81 amino acids, SEQID A*2413 (A*24YM) and A*2414 (A*24SA). Allele A*2402 35 NO: 7) and beta (6022 Da, 54 amino acids, SEQID NO:32). is represented in all major racial groups. Allele A*2406 and The Beta (or #2) variant lacks an alternate in-frame exon allele A*2413 are found in the Australian Aboriginal popula compared to alpha (or #1) variant, resulting in an isoform that tion. Allele A*2414 is found in individuals of South American is shorter compared to isoform alpha. NNAT is encoded on descent. See N’Guyen C. Sodoyer R, Trucy J, Strachan T. chromosome 20 (Ensembl cytogenetic band: 20q11.23). Rep Jordan B. R. The HLA-AW24 gene: sequence, surroundings 40 resentative nucleotide sequence NM 005386 (transcript vari and comparison with the HLA-A2 and HLA-A3 genes. ant 1: SEQID NO: 8) and NM 181689(transcript variant 2: Immunogenetics. 1985: 21(5):479-89. PMID: 2987115 and SEQ ID NO: 33). Neuronatin is a proteolipid that may be Little AM, Madrigal JA, Parham P. Molecular definition of involved in the regulation of ion channels during brain devel an elusive third HLA-A9 molecule: HLA-A9.3. Immunoge opment (Duo and Joseph 1996a). The encoded protein may netics. 1992: 35(1):41-5. PMID: 1729171 45 also play a role informing and maintaining the structure of the FLJ14668encodes a protein (SEQ ID NO:3), also desig nervous system, specifically in the segment identity in the nated hypothetical protein LOC84908 (NP 116211), on hindbrain and pituitary development, and maturation or chromosome 2 ENSEMBL cytogenetic band: 2p13.3). A rep maintenance of the overall structure (Usui et al. 1997). This resentative nucleotide sequence encoding FLJ14667 protein gene is found within an intron of the BLCAP gene, but on the is NM 032822 (SEQ ID NO: 4). The protein sequence for 50 opposite strand. This gene is imprinted and is expressed only FLJ14668 is most similar to the human Sm G protein, a from the paternal allele, while BLCAP is not imprinted. “common protein component of the snRNP. The region of Abundant in 18-24 week old fetal brain. Postnatally its greatest homology is within the Sm 1 and 2 motifs that char expression declines and only minimal levels are present in acterize the protein members of the Smgroup and it is there adulthood (Duo and Joseph 1996b). See Usui.H., Morii.K., fore thought that LOC84908 bears some functional similar 55 Tanaka.R., Tamura.T., Washiyama.K., Ichikawa.T. and ity, however, function and role are currently unknown Kumanishi.T. cDNA cloning and mRNA expression analysis (Lehner and Sanderson 2004: Simpson et al. 2000) See Leh of the human neuronatin. High level expression in human ner, B. and Sanderson, C.M., A protein interaction framework pituitary gland and pituitary adenomas. J. Mol. Neurosci. 9 for human mRNA degradation, Genome Res. 14 (7), 1315 (1), 55-60 (1997). PMID: 9356927and Dou.D. and Joseph.R. 1323 (2004). PMID: 15231747 and Simpson, J.C., Wellen 60 Cloning of human neuronatin gene and its localization to reuther, R., Poustka, A., Pepperkok, R. and Wiemann, S., chromosome-20d 11.2-12: the deduced protein is a novel Systematic subcellular localization of novel proteins identi proteolipid Brain Res. 723 (1-2), 8-22 (1996a). PMID: fied by large-scale cloNA sequencing, EMBO Rep. 1 (3), 8813377 and Dou.D. and Joseph.R. Structure and organiza 287-292 (2000). tion of the human neuronatin gene Genomics 33 (2), 292-297 Cardiolipin (bisphosphatidyl glycerol) is an important 65 (1996b). PMID: 8660979 component of the inner mitochondrial membrane, where it SELS (Alias: VIMP, ADOs, SBBI8, SEPS1, AD-015, constitutes about 20% of the total lipid. Cardiolipin is a MGC2553, MGC104346) is a 21116 Da protein (representa US 8,840,881 B2 23 24 tive amino acid sequence NP 982298.1: SEQID NO: 11) of (VEGF). This protein may play a role in cardiovascular devel 189 amino acids encoded on chromosome 15q26.3 (Ensembl opment and axon guidance (Giger et al. 1998; Takahashi et al. cytogenetic band). Representative nucleotide sequence 1998; Chenet al. 1998). Multiple transcript variants encoding NM 203472 (SEQ ID NO: 12). SELS is involved in the distinct isoforms have been identified for this gene. See Chen, degradation process of misfolded endoplasmic reticulum H., He, Z. Bagri, A. and Tessier-Lavigne, M. Semaphorin (ER) luminal proteins, participating in the transfer of mis neuropilin interactions underlying sympathetic axon folded proteins from the ER to the cytosol, where they are responses to class III semaphorins, Neuron 21 (6), 1283-1290 destroyed by the proteasome in a ubiquitin-dependent man (1998); Giger, R. J., Urquhart, E. R. Gillespie, S. K. Leven ner (Ye et al. 2005). SELS may act by serving as a linker good, D.V., Ginty, D.D. and Kolodkin, A. L., Neuropilin-2 is between DERL1, which mediates the retrotranslocation of 10 a receptor for semaphorin IV: insight into the structural basis misfolded proteins into the cytosol, and the ATPase complex of receptor function and specificity, Neuron 21 (5), 1079 VCP, which mediates the translocation and ubiquitination 1092 (1998); Takahashi, T., Nakamura, F. Jin, Z. Kalb, R. G. and Suggesting that it forms a membrane complex with and Strittmatter, S. M. Semaphorins A and E act as antago DERL1 that serves as a receptor for VCP (Lilley et al. 2005). nists of neuropilin-1 and agonists of neuropilin-2 receptors, See Ye. Y., Shibata, Y., Kikkert, M., van Voorden, S., Wiertz, 15 Nat. Neurosci. 1 (6), 487-493 (1998); and Chen, H., Chedotal, E. And Rapoport, T. A. Inaugural Article: Recruitment of the A., He, Z. Goodman, C. S. and Tessier-Lavigne, M. Neuro p97 ATPase and ubiquitin ligases to the site of retrotranslo pilin-2, a novel member of the neuropilin family, is a high cation at the endoplasmic reticulum membrane. Proc. Natl. affinity receptor for the semaphorins Sema E and Sema IV but Acad. Sci. U.S.A. 102 (40), 14132-14138 (2005); and Lilley, not Sema III, Neuron 19 (3), 547-559 (1997). B. N. and Ploegh, H. L. Multiprotein complexes that link 5.3 Methods of Using Antigens dislocation, ubiquitination, and extraction of misfolded pro The present invention provides an methods of inducing or teins from the endoplasmic reticulum membrane. Proc. Natl. increasing an immune response to prostate cancer in a mam Acad. Sci. U.S.A. 102 (40), 14296-14301 (2005). malian, preferably a human, Subject. Desirably, the method HIGD2A (alias MGC2198) encodes a 1 1529 Da protein effects a systemic immune response, i.e., a T-cell response (reference NP 620175) of 106 amino acids (SEQID NO:5) 25 and/or a B-cell response, to the cancer. In some embodiments, encoded on chromosome 5 (Ensembl cytogenetic band: the method comprises administering to the patient a cellular 5q35.2). Representative nucleotide sequence NM 138820 immunotherapy composition, wherein the cellular immuno (SEQ ID NO: 6). Current function and role is unknown. therapy composition comprises cells which are genetically Potentially encodes a multi-pass membrane protein (Straus modified to express a cytokine and one or more prostate berg et al. 2002). See Strausberg et al. Generation and initial 30 tumor-associated antigens. The one or more prostate tumor analysis of more than 15,000 full-length human and mouse associated antigens can be one or more of the antigens of the cDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 99 (26), cancer found in the patient under treatment. In some embodi 16899-16903 (2002). PMID: 12477932 ments, the prostate tumor-associated antigen is selected from SSR3 (alias TRAPG, SSR gamma) is a 21080 Da protein the group consisting of HLA-A24, FLJ14668, Cardiolipin, (representative protein sequence NP 009038.1 (SEQ ID 35 Neuronatin (NNAT), Selenoprotein (SELS), HIG1 domain NO:9)) of 185 amino acids encoded on chromosome 3q25.31 family, member 2A (HIGD2A), Signal sequence receptor, (Ensembl cytogenetic band). Representative nucleotide gamma (SSR3) and Neuropilin 2 (NRP2). The cells can be sequence NM 007107 (SEQ ID NO: 10). The signal rendered proliferation incompetent, Such as e.g., by irradia sequence receptor (SSR) is a glycosylated endoplasmic tion. Upon administration of the cytokine-expressing cellular reticulum (ER) membrane receptor associated with protein 40 immunotherapy, an immune response to the cancer can be translocation across the ER membrane (Wang et al. 1999). elicited or enhanced. The SSR is comprised of four membrane proteins/subunits: Thus, in one aspect, the method is effective to stimulate a alpha, beta, gamma, and delta (Hartmann et al. 1993). The systemic immune response in a prostate cancer patient, com first two are glycosylated subunits and the latter two are prising administering to the patientatherapeutically effective non-glycosylated Subunits. The protein encoded by this gene 45 amount of a cellular immunotherapy composition comprising is the gamma Subunit and is predicted to span the membrane one or more populations of proliferation incompetent cells four times. See Wang, L. and Dobberstein, B. Oligomeric genetically modified to express a cytokine and a prostate complexes involved in translocation of proteins across the tumor associated antigen. The systemic immune response to membrane of the endoplasmic reticulum. FEBS Lett. 457(3), the cellular immunotherapy may result in tumor regression or 316-322 (1999); and Hartmann, E., Gorlich, D., Kostka, S., 50 inhibit the growth of the tumor. In some embodiments, the Otto, A., Kraft, R., Knespel, S., Burger, E., Rapoport, T. A. prostate cancer is metastatic prostate cancer. In some embodi and Prehn, S. A tetrameric complex of membrane proteins in ments, the prostate cancer is refractory to hormonetherapy. In the endoplasmic reticulum. Eur. J. Biochem. 214 (2), 375-381 Some embodiments, the primary prostate tumor has been (1993). treated, e.g., by ablation or rescission and metastases of the Nrp2 (aliases NP2, NPN2, PRO2714, MGC126574, 55 primary prostate cancer are treated by immunotherapy as VEGF165R2) encodes the 104831 Da, 931 amino acid pro described herein. tein neuropilin-2 (representative amino acid sequence In another aspect, the method is effective to increase or NP 003863; SEQ ID NO: 13) encoded on chromosome enhance a systemic immune response in a prostate cancer 2q33.3 (Ensembl cytogenetic band). Representative nucle patient, comprising administering to the patient a therapeuti otide sequence NM 003872.2 (SEQID NO: 14). This gene 60 cally effective amount of a cellular immunotherapy compo encodes a member of the neuropilin family of receptor pro sition comprising one or more populations of proliferation teins (Chen et al. 1997). The encoded transmembrane protein incompetent cells genetically modified to express a cytokine binds to SEMA3C protein sema domain, immunoglobulin and a prostate-tumor associated antigen. The systemic domain (Ig), short basic domain, secreted, (semaphorin)3C} immune response to the cellular immunotherapy may result and SEMA3F protein sema domain, immunoglobulin 65 in tumor regression or inhibit the growth of the tumor. In some domain (Ig), short basic domain, secreted, (semaphorin)3F, embodiments, the prostate cancer is metastatic prostate can and interacts with vascular endothelial growth factor cer. In some embodiments, the prostate cancer is refractory to US 8,840,881 B2 25 26 hormonetherapy. In some embodiments, the primary prostate modified cells are autologous. In some embodiments, one of tumor has been treated, e.g., by ablation or rescission and the populations of genetically modified cells are allogeneic. metastases of the primary prostate cancer are treated by In some embodiments, one of the population of genetically immunotherapy as described herein. modified cells are bystander cells. In some embodiments of Typically the genetically modified cells are rendered pro the compositions described herein, a first population of cells liferation incompetent prior to administration. In one comprise tumor cells genetically modified to express the cod embodiment, the mammal is a human who harbors prostate ing sequence or a cytokine, and a second population of cells tumor cells of the same type as the genetically modified cells comprise bystander cells genetically modified to express the of the cellular immunotherapy. In a preferred embodiment, an coding sequence for one or more prostate tumor-associated improved therapeutic outcome is evident following adminis 10 antigens selected from the group consisting of HLA-A24. tration of the genetically modified cells to the subject. Any of FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and the various parameters of an improved therapeutic outcome NRP2. In some embodiments, the tumor cells are autologous for a prostate cancer patient known to those of skill in the art cells. In some the embodiments, the tumor cells are alloge may be used to assess the efficacy of the cellular immuno neic cells. therapy, e.g., decreased serum concentrations of tumor spe 15 In certain embodiments, the methods of the invention uti cific markers, increased overall Survival time, increased pro lize combination immunotherapies that comprise a cellular gression-free Survival, decreased tumor size, decreased bone immunotherapy provided herein and one or more additional metastasis marker response, increased impact on minimal cancer therapeutic agents, e.g., agents that enhance anti-tu residual disease, increased induction of antibody response to mor immunity. Any cancer therapeutic agent known in the art the cancer cells that have been rendered proliferation-incom may be combined with the cellular immunotherapy provided petent, increased induction of delayed-type-hypersensitivity herein to induce or increase an immune response in a subject (DTH) response to injections of autologous tumor, increased against one or more prostate tumor-associated antigens. induction of T cell response to autologous tumor or candidate For example, recent studies suggest that PD-L1/PD-1 tumor-associated antigens, increased impact on circulating T interaction plays a pivotal role in the immune evasion of cell and dendritic cell numbers, phenotype, and function, 25 tumors from the host immune system (Blank et al. Cancer cytokine response, decreased concentrations of prostate-spe Immunol. Immunother. 54(4):307-14 (2005)), and that block cific antigen (PSA), reduced slope of PSA doubling time, ade of PD-L1/PD-1 interaction, e.g., with an antibody which increased PSA doubling time, reduced metastasis as mea specifically binds PD-1, may serve as one possible mecha Sured by bone scan, increased time to progression, increased nism for enhancing anti-tumor immunity. Accordingly, in one Survival time as compared to the Halabi nomogram, 30 aspect of the invention, the invention provides a composition decreased serum concentrations of ICTP, or decreased con for cancer immunotherapy comprising an anti-PD-1 antibody centrations of serum C-reactive protein. See Halabi et al., and one or more populations of cells genetically modified to 2003.J Clin Oncol 21:1232-7, for a description of the Halabi express the coding sequence for a cytokine and the coding nomogram. sequence of one or more prostate tumor-associated antigens In one approach, the cellular immunotherapy comprises a 35 selected from the group consisting of HLA-A24, FLJ14668, single population of cells that is modified to express a cytok Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In ine, e.g. GM-CSF, and a prostate tumor-associated antigen. In some embodiments, the genetically modified cells are further another approach, the immunotherapy comprises a combina modified to express the anti-PD-1 antibody. In another aspect tion of two or more populations of cells individually modified of the invention, the invention provides a method for inducing to express one component of the immunotherapy, e.g. a cytok 40 or increasing an immune response in a Subject against one or ine or a prostate tumor-associated antigen. more prostate tumor-associated antigens, comprising admin In general, a cytokine-expressing cellular immunotherapy istering a composition to a subject with prostate cancer, the for use in practicing the methods described herein comprises composition comprising an anti-PD-1 antibody and one or tumor cells selected from the group consisting of autologous more populations of cells genetically modified to express the tumor cells, allogeneic tumor cells and tumor cell lines (i.e., 45 coding sequence for a cytokine and the coding sequence of bystander cells). In one aspect of the invention, the cells of the one or more prostate tumor-associated antigens selected from cellular immunotherapy are administered to the same indi the group consisting of HLA-A24, FLJ14668, Cardiolipin, vidual from whom they were derived (autologous). In another NNAT, SELS, HIGD2A, SSR3 and NRP2. In some embodi aspect of the invention, the cells of the cellular immuno ments, the genetically modified cells are further modified to therapy and the tumor are derived from different individuals 50 express the anti-PD-1 antibody. Methods of administering a (allogeneic or bystander). cytokine-expressing cellular immunotherapy in combination By way of example, in one approach, the same population with an anti-PD-1 antibody are described in U.S. patent appli of cells is genetically modified to express the coding sequence cation Ser. No. 12/178,122, the contents of which are incor for a cytokine and one or more prostate tumor-associated porated by reference in their entireties. antigens selected from the group consisting of HLA-A24. 55 In addition, anti-CTLA-4 blockade together with the use of FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and GM-CSF-modified tumor cell vaccines has been shown to be NRP2. In some embodiments, the population of genetically effective in a number of experimental tumor models. Such as modified cells are autologous. In some embodiments, the mammary carcinoma (Hurwitz et al., Proc Natl Acad Sci population of genetically modified cells are allogeneic. In USA. 95(17):10067-71 (1998)), primary prostate cancer Some embodiments, the population of genetically modified 60 (Hurwitz A. etal. (2000) Cancer Research 60 (9): 2444-8) and cells are bystander cells. melanoma (van Elsas, A et al. (1999) J. Exp. Med. 190: In yet another approach, two different populations of cells 355-66). Accordingly, in one aspect of the invention, the are genetically modified to express the coding sequence for a invention provides a composition for cancer immunotherapy cytokine and one or more prostate tumor-associated antigens comprising an anti-CTLA-4 antibody and one or more popu selected from the group consisting of HLA-A24, FLJ14668, 65 lations of cells genetically modified to express the coding Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In sequence for a cytokine and the coding sequence of one or Some embodiments, one of the populations of genetically more prostate tumor-associated antigens selected from the US 8,840,881 B2 27 28 group consisting of HLA-A24, FLJ14668, Cardiolipin, In other embodiments, the nucleic acid sequence may encode NNAT, SELS, HIGD2A, SSR3 and NRP2. In some embodi more than one tumor antigen, each operably linked to a pro ments, the genetically modified cells are further modified to moter yet independently transcribed from the same nucleic express the anti-CTLA-4 antibody. In another aspect of the acid sequence. In yet other embodiments, the nucleic acid invention, the invention provides a method for inducing or 5 sequence may encode both a cytokine and a tumor antigen, or increasing an immune response in a Subject against one or more than one tumor antigen, from the same promoter by more prostate tumor-associated antigens, comprising admin utilizing an expression vector that is capable of producing istering a composition to a subject with prostate cancer, the polycistronic or mRNA. Within these embodiments, certain composition comprising an anti-CTLA-4 antibody and one or internal ribosome entry site (IRES) sequences may be utilized more populations of cells genetically modified to express the 10 coding sequence for a cytokine and the coding sequence of to allow for expression of a polycistronic message comprising one or more prostate tumor-associated antigens selected from the coding sequence for a cytokine and a tumor antigen, or the group consisting of HLA-A24, FLJ14668, Cardiolipin, one or more tumor antigens. Preferred IRES elements NNAT, SELS, HIGD2A, SSR3 and NRP2. In some embodi include, but are not limited to the mammalian BiPIRES and ments, the genetically modified cells are further modified to 15 the hepatitis C virus IRES. express the anti-CTLA-4 antibody. Any and all methods of introduction into a cell or popula Additional cancer therapeutic agents that find use in com tion of cells, typically tumor cells, are contemplated accord bination with the cellular immunotherapies described herein ing to the invention. The method is not dependent on any include tyrosine kinase inhibitors. Administration of a cytok particular means of introduction and is not to be so construed. ine-expressing cancer immunotherapy composition in com The “vector” may be a DNA molecule such as a plasmid, bination with at least one tyrosine kinase inhibitor results in virus or other vehicle, which contains one or more heterolo enhanced immunotherapeutic potency, i.e., an increase in the gous or recombinant DNA sequences, e.g., a nucleic acid number and/or proliferation of activated T-cells, relative to sequence encoding a cytokine and/or a tumor antigen under administration of either the cytokine-expressing cancer the control of a functional promoter and in some cases further immunotherapy composition or the tyrosine kinase inhibitor 25 including an enhancer that is capable of functioning as a alone. See, e.g., U.S. Patent Application Publication No. vector, as understood by those of ordinary skill in the art. An 2007/0231298, the contents of which are incorporated by appropriate viral vector includes, but is not limited to, a reference in their entireties. Accordingly, in one aspect of the retrovirus, a lentivirus, an adenovirus (AV), an adeno-associ invention, the invention provides a composition for cancer ated virus (AAV), a simian virus 40 (SV-40), a bovine papil immunotherapy comprising a tyrosine kinase inhibitor and 30 one or more populations of cells genetically modified to loma virus, an Epstein-Barr virus, a herpes virus, a vaccinia express the coding sequence for a cytokine and the coding virus, a Moloney murine leukemia virus, a Harvey murine sequence of one or more prostate tumor-associated antigens sarcoma virus, a murine mammary tumor virus, and a Rous selected from the group consisting of HLA-A24, FLJ14668, sarcoma virus. Non-viral vectors are also included within the Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2. In 35 Scope of the invention. Some embodiments, the tyrosine kinase inhibitor is selected Any Suitable vector can be employed that is appropriate for from the group consisting of gefitimib, erolotinib and ima introduction of nucleic acids into eukaryotic tumor cells, or tinib. In another aspect of the invention, the invention pro more particularly animal tumor cells, such as mammalian, vides a method for inducing or increasing an immune e.g., human, tumor cells. Preferably the vector is compatible response in a subject against one or more prostate tumor 40 with the tumor cell, e.g., is capable of imparting expression of associated antigens, comprising administering a composition the coding sequence for a cytokine and/or tumor antigen and to a subject with prostate cancer, the composition comprising is stably maintained or relatively stably maintained in the a tyrosine kinase inhibitor and one or more populations of tumor cell. Desirably, the vector comprises an origin of rep cells genetically modified to express the coding sequence for lication and the vector may or may not also comprise a a cytokine and the coding sequence of one or more prostate 45 “marker' or “selectable marker function by which the vector tumor-associated antigens selected from the group consisting can be identified and selected. While any selectable marker of HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, can be used, selectable markers for use in Such expression HIGD2A, SSR3 and NRP2. In some embodiments, the vectors are generally known in the art and the choice of the tyrosine kinase inhibitor is selected from the group consisting proper selectable marker will depend on the host cell. of gefitimib, erolotinib and imatinib. Methods of administer 50 Examples of selectable marker genes which encode proteins ing a cytokine-expressing cellular immunotherapy in combi that confer resistance to antibiotics or other toxins include nation with a tyrosine kinase inhibitor are described in U.S. ampiciilin, methotrexate, tetracycline, neomycin (Southern Patent Application Publication No. 2007/0231298, the con and Berg, J., 1982), myco-phenolic acid (Mulligan and Berg, tents of which are incorporated by reference in their entire 1980), puromycin, Zeo-mycin, hygromycin (Sugden et al., ties. 55 1985) or G418. 5.4 Immunogenic Compositions Comprising Cells In practicing the methods of the present invention, a vector Expressing a Cytokine and One or More Prostate Tumor comprising a nucleic acid sequence encoding a cytokine and/ Associated Antigens or a tumor antigen may be transferred to a cell in vitro, 5.4.1. Introduction of Cytokine and Prostate Tumor-Asso preferably a tumor cell, using any of a number of methods ciated Antigen into Cells 60 which include but are not limited to electroporation, mem In one aspect of the invention, a nucleic acid sequence (i.e., brane fusion with liposomes, Lipofectamine treatment, high a recombinant DNA construct or vector) encoding a cytokine velocity bombardment with DNA-coated microprojectiles, ora tumorantigen operably linked to a promoteris introduced incubation with calcium phosphate-DNA precipitate, DEAE into a cell or population of cells. In some embodiments, the dextran mediated transfection, infection with modified viral nucleic acid sequence may encode both a cytokine and a 65 nucleic acids, direct microinjection into single cells, etc. Pro tumor antigen, each operably linked to a promoter yet inde cedures for the cloning and expression of modified forms of a pendently transcribed from the same nucleic acid sequence. native protein using recombinant DNA technology are gen US 8,840,881 B2 29 30 erally known in the art, as described in Ausubel, et al., 2007 Further exemplary vector systems for use in practicing the and Sambrook, et al., 2002, expressly incorporated by refer invention include second, third and fourth generation lentivi ence, herein. ral vectors, U.S. Pat. Nos. 6,428,953, 5,665,577 and 5,981, Reference to a vector or other DNA sequence as “recom 276 and WO 00/72686, each of which is expressly incorpo binant’ merely acknowledges the operable linkage of DNA rated by reference herein. sequences which are not typically operably linked as isolated Additional exemplary vector systems for use in practicing from or found in nature. A "promoter' is a DNA sequence that the present invention include adenoviral vectors, described directs the binding of RNA polymerase and thereby promotes for example in U.S. Pat. No. 5,872,005 and International RNA synthesis. “Enhancers' are cis-acting elements that Patent Publication No. WO 00/72686, each of which is stimulate or inhibit transcription of adjacent genes. An 10 expressly incorporated by reference herein. enhancer that inhibits transcription also is termed a “silencer.” Enhancers can function (i.e. be operably linked to a coding Yet another vector system that is preferred in practicing the sequence) in either orientation, over distances of up to several methods described herein is a recombinant adeno-associated kilobase pairs (kb) from the coding sequence and from a vector (ra AV) system, described for example in International position downstream of a transcribed region. Regulatory (ex 15 Patent Publication Nos. WO 98/46728 and WO 00/72686, pression/control) sequences are operatively linked to a Samulski et al., Virol. 63:3822-3828 (1989) and U.S. Pat. nucleic acid coding sequence when the expression/control Nos. 5,436,146, 5,753,500, 6,037,177, 6,040,183 and 6,093, sequences regulate the transcription and, as appropriate, 570, each of which is expressly incorporated by reference translation of the nucleic acid sequence. Thus, expression/ herein. control sequences can include promoters, enhancers, tran In one preferred embodiment, one or more viral or nonviral Scription terminators, a start codon (i.e., ATG) in front of the vectors are utilized to deliver a cytokine, e.g., human GM coding sequence, a splicing signal for introns, and stop CSF transgene (coding sequence), and one or more prostate codons. tumor-associated antigen (coding sequence) to a human Recombinant vectors for the production of cellular immu tumor cell ex vivo. After transduction, the cells are irradiated notherapies of the invention provide the proper transcription, 25 to render them proliferation incompetent. The proliferation translation and processing signals (e.g., splicing and polyade incompetent cytokine, e.g., GM-CSF and tumor antigen nylation signals) such that the coding sequence for the cytok expressing tumor cells are then re-administered to the patient ine and/or tumor antigen is appropriately transcribed and (e.g., by the intradermal or Subcutaneous route) and thereby translated in the tumor cells into which the vector is intro function as a cancer vaccine. The human tumor cell may be a duced. The manipulation of such signals to ensure appropri 30 primary tumor cell or derived from a tumor cell line. ate expression in host cells is within the skill of the ordinary In general, the genetically modified tumor cells include one skilled artisan. The coding sequence for the cytokine and/or or more of autologous tumor cells, allogeneic tumor cells and the tumor antigen may be under the control of (i.e., operably tumor cell lines (i.e., bystander cells). The tumor cells may be linked to) its own native promoter, or a non-native (e.g. het transduced in vitro, ex vivo or in vivo. Autologous and allo erologous) promoter, including a constitutive promoter, e.g., 35 geneic cancer cells that have been genetically modified to the cytomegalovirus (CMV) immediate early promoter/en express a cytokine, e.g., GM-CSF, followed by readministra hancer, the Rous sarcoma virus long terminal repeat (RSV tion to a patient for the treatment of cancer are described in LTR) or the SV-40 promoter. U.S. Pat. Nos. 5,637.483, 5,904,920 and 6,350,445, expressly Alternately, a tissue-specific promoter (a promoter that is incorporated by reference herein. A form of GM-CSF-ex preferentially activated in a particular type of tissue and 40 pressing genetically modified tumor cells or a “cytokine results in expression of a gene product in that tissue) can be expressing cellular vaccine” (“GVAX'(R), for the treatment used in the vector. Such promoters include but are not limited of pancreatic cancer is described in U.S. Pat. Nos. 6,033,674 to a liver specific promoter (Ill C R. et al., Blood Coagul and 5,985,290, expressly incorporated by reference herein. A Fibrinolysis 8 Suppl 2:S23-30, 1997) and the EF-1 alpha universal immunomodulatory genetically modified bystander promoter (Kim D Wet al. Gene. 91(2):217-23, 1990, Guo Z 45 cell line is described in U.S. Pat. No. 6,464.973, expressly Set al. Gene Ther. 3(9):802-10, 1996: U.S. Pat. Nos. 5,266, incorporated by reference herein. 491 and 5.225.348, each of which expressly incorporated by An allogeneic form of GVAX(R) wherein the cellular vac reference herein). Inducible promoters also find utility in cine comprises one or more prostate tumor cell lines selected practicing the methods described herein, such as a promoter from the group consisting of DU145, PC-3, and LNCaP is containing the tet responsive element (TRE) in the tet-on or 50 described in WO/0026676, expressly incorporated by refer tet-off system as described (ClonTech and BASF), the met ence herein. LNCaP is a PSA-producing prostate tumor cell allothienein promoter which can be upregulated by addition line, while PC-3 and DU-145 are non-PSA-producing pros of certain metal salts and rapamycin inducible promoters tate tumor cell lines (Pang S. et al., Hum Gene Ther. 1995 (Rivera et al., 1996, Nature Med, 209): 1028-1032;Yeet al., November; 6(11):1417-1426). 2000, Science 283: 88-91; Sawyer T K et al., 2002, Mini Rev 55 Clinical trials employing GM-CSF-expressing cellular Med. Chem. 2(5):475-88). Large numbers of suitable tissue vaccines (GVAX(R) have been undertaken for treatment of specific or regulatable vectors and promoters for use in prac prostate cancer, melanoma, lung cancer, pancreatic cancer, ticing the current invention are known to those of skill in the renal cancer, and multiple myeloma. A number of clinical art and many are commercially available. trials using GVAX(R) cellular vaccines have been described, Exemplary vector systems for use in practicing the inven 60 most notably in melanoma, and prostate, renal and pancreatic tion include the retroviral MFG vector, described in U.S. Pat. carcinoma (Simons J W et al. Cancer Res. 1999: 59:5160 No. 5,637.483, expressly incorporated by reference herein. 5168; Simons J W et al. Cancer Res 1997: 57:1537-1546; Other useful retroviral vectors include pl.), pEm and alpha Soiffer R et al. Proc. Natl. Acad. Sci. USA 1998; 95:13141 SGC, described in U.S. Pat. No. 5,637,483 (in particular 13146; Jaffee, et al. J. Clin Oncol2001; 19:145-156; Salgia et Example 12), U.S. Pat. Nos. 6,506,604, 5,955,331 and U.S. 65 al. J. Clin Oncol 2003 21:624–30; Soiffer et al. J. Clin Oncol Ser. No. 09/612,808, each of which is expressly incorporated 2003 21:3343-50: Nemunaitis et al. J Natl Cancer Inst. 2004 by reference herein. Feb. 1896(4):326-31). US 8,840,881 B2 31 32 By way of example, in one approach, one or more prostate producing cells may be adjusted according, for example, to tumor-associated tumor antigens described herein are the level of cytokine and/or tumor antigen produced by a expressed by an allogeneic or bystander cell line while a given cellular immunotherapy composition. cytokine (e.g., GM-CSF) is expressed by autologous or allo In some embodiments, cytokine-producing cells of the cel geneic cells. The GM-CSF coding sequence is introduced lular immunotherapy are administered in a dose that is into the tumor cells using a viral or non-viral vector and capable of producing at least 500 ng of GM-CSF per 24 hours routine methods commonly employed by those of skill in the per one million cells. In some embodiments, prostate tumor art. The preferred coding sequence for GM-CSF is the associated-tumor antigen-producing cells of the cellular genomic sequence described in Huebner K. et al., Science immunotherapy are administered in a dose that is capable of 230(4731): 1282-5, 1985, however, in some cases the cDNA 10 producing at least 500 ng of the particular tumor antigen per form of GM-CSF finds utility in practicing the methods 24 hours per one million cells. Determination of optimal cell (Cantrell et al., Proc. Natl. Acad. Sci., 82,6250-6254, 1985). dosage and ratios is a matter of routine determination and In one aspect of the invention, the invention provides a within the skill of a practitioner of ordinary skill, in light of method of making a cellular immunotherapy composition, the disclosure provided herein. comprising obtaining one or more population of cells and 15 In treating a prostate cancer patient according to the meth modifying the one or more population of cells by introducing ods described herein, the attending physician may administer into the cells: (i) a nucleic acid molecule comprising a nucleic lower doses of the cellular immunotherapy composition and acid sequence encoding a cytokine operably linked to a pro observe the patients response. Larger doses of the cellular moter; (ii) one or more nucleic acid molecules comprising a immunotherapy may be administered until the an improved nucleic acid sequence encoding a prostate tumor-associated therapeutic outcome is evident. antigen selected from the group consisting HLA-A24. Cytokine and tumor antigen expressing cells of the cellular FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and immunotherapy of the invention are processed to remove NRP2; and (iii) a nucleic acid molecule comprising a nucleic most additional components used in preparing the cells. In acid sequence encoding a selectable marker operably linked particular, fetal calf serum, bovine serum components, or to a promoter. In a particular embodiment, the cytokine is 25 other biological Supplements in the culture medium are GM-CSF. The nucleic acid molecule comprising a nucleic removed. In one embodiment, the cells are washed, such as by acid sequence encoding a cytokine operably linked to a pro repeated gentle centrifugation, into a suitable pharmacologi moter, and the one or more nucleic acid molecules comprising cally compatible excipient. Compatible excipients include a nucleic acid sequence encoding one or more prostate tumor various cell culture media, isotonic saline, with or without a associated antigens, can be any nucleic acid molecule Suitable 30 physiologically compatible buffer, for example, phosphate or for gene transfer as described above. While any selectable hepes, and nutrients such as dextrose, physiologically com marker can be used, in particular embodiments, the selectable patible ions, or amino acids, particularly those devoid of other marker is an antibiotic resistance gene. Such as hygromycin immunogenic components. resistance. In some embodiments, a genetically modified A composition for administration in vivo can comprise mammalian, preferably human cell line is cultured in culture 35 appropriate carriers or diluents, which further can be phar medium comprising at least 400 ug hygromycin/ml culture maceutically acceptable. For example, carrying reagents, medium. Such as albumin and blood plasma fractions and inactive 5.4.2. Administration thickening agents, may be used. The means of making such a The genetically modified tumor cells can be cryopreserved composition have been described in the art. See, e.g., Rem prior to administration. Preferably, the genetically modified 40 ington's Pharmaceutical Sciences 19th edition, Genarro, A. tumor cells are irradiated at a dose of from about 50 to about Ed. (1995). 200 rads/min, even more preferably, from about 120 to about In pharmaceutical dosage form, the cellular immuno 140 rads/min prior to administration to the patient. Prefer therapy composition described herein can be used alone or in ably, the cells are irradiated with a total dose sufficient to appropriate association, as well as in combination, with other inhibit substantially 100% of the cells from further prolifera 45 pharmaceutically active compounds as are known in the art. tion. Thus, desirably the cells are irradiated with a total dose 5.4.3. Autologous Cells of from about 10,000 to 20,000 rads, optimally, with about The use of autologous genetically modified cells express 15,000 rads. Typically more than one administration of cytok ing a cytokine, e.g. GM-CSF and one or more prostate tumor ine (e.g., GM-CSF) and prostate tumor-associated antigen associated tumor antigens provides advantages since each producing cells is delivered to the Subject in a course of 50 patient's tumor expresses a unique set of tumor antigens that treatment. Dependent upon the particular course of treatment, can differ from those found on histologically-similar, MHC multiple injections may be given at a single time point with matched tumor cells from another patient. See, e.g., the treatment repeated at various time intervals. For example, Kawakami et al., J. Immunol. 148, 638-643 (1992); Darrow an initial or “priming treatment may be followed by one or et al., J. Immunol., 142,3329-3335 (1989); and Homet al., J. more “booster treatments. Such “priming” and “booster 55 Immunother, 10, 153-164 (1991). In contrast, MHC treatments are typically delivered by the same route of admin matched tumor cells provide the advantage that the patient istration and/or at about the same site. When multiple doses need not be taken to Surgery to obtain a sample of their tumor are administered, the first immunization dose may be higher for genetically modified tumor cell production. than Subsequent immunization doses. For example, a 5x10° In one preferred aspect, the method of treating prostate prime dose may be followed by several booster doses of 10° 60 cancer comprises: (a) obtaining tumor cells from a mamma to 3x10 GM-CSF and tumor antigen producing cells. lian Subject harboring a prostate tumor; (b) genetically modi A single injection of cytokine and tumorantigen producing fying the tumor cells to render them capable of producing an cells is typically between about 10° to 10 cells, e.g., 1x10, increased level of GM-CSF and one or more prostate tumor 2x10, 3x10, 4x10, 5x10, 6x10, 7x10, 8x10, 9x10, associated antigens relative to unmodified tumor cells; (c) 10, 2x10", 5x10", or as many as 10 cells. In one embodi 65 rendering the modified tumor cells proliferation incompetent; ment, there are between 10° and 10 cytokine-producing cells and (d) readministering the genetically modified tumor cells per unit dose. The number of cytokine and tumor antigen to the mammalian subject from which the tumor cells were US 8,840,881 B2 33 34 obtained or to a mammal with the same MHC type as the incompetent; and (d) administering the tumor cell line to a mammal from which the tumor cells were obtained. The mammalian Subject (host) having at least one tumor that is of administered tumor cells are autologous and MHC-matched the same type of tumor as that from which the tumor cell line to the host. Preferably, the composition is administered intra was obtained. In some embodiments, the administered tumor dermally, Subcutaneously or intratumorally to the mamma cell line is allogeneic and is not MHC-matched to the host. lian Subject. Such allogeneic lines provide the advantage that they can be In some cases, a single autologous tumor cell may express prepared in advance, characterized, aliquoted in vials con GM-CSF alone or GM-CSF plus one or more prostate tumor taining known numbers of transgene (e.g., GM-CSF) associated antigens. In other cases, GM-CSF and the one or expressing cells and stored (i.e. frozen) Such that well char more prostate tumor-associated antigens may be expressed 10 by different autologous tumor cells. In one aspect of the acterized cells are available for administration to the patient. invention, an autologous tumor cell is modified by introduc Methods for the production of genetically modified alloge tion of a vector comprising a nucleic acid sequence encoding neic cells are described for example in WO 00/72686, GM-CSF, operatively linked to a promoter and expression/ expressly incorporated by reference herein. control sequences necessary for expression thereof. In 15 In one approach to preparing genetically modified alloge another aspect, the same autologous tumor cell or a second neic cells, a nucleic acid sequence (transgene) encoding GM autologous tumor cell can be modified by introduction of a CSF alone or in combination with the nucleic acid coding vector comprising a nucleic acid sequence encoding one or sequence for one or more prostate tumor-associated antigens more prostate tumor-associated antigens operatively linked to is introduced into a cell line that is an allogeneic tumor cell a promoter and expression/control sequences necessary for line (i.e., derived from an individual other than the individual expression thereof. The nucleic acid sequence encoding the being treated). In another approach, a nucleic acid sequence one or more prostate tumor-associated antigens can be intro (transgene) encoding GM-CSF alone or in combination with duced into the same or a different autologous tumor cell using the nucleic acid coding sequence for one or more prostate the same or a different vector. The nucleic acid sequence tumor-associated antigens is introduced into separate alloge encoding the one or more prostate tumor-associated antigens 25 neic tumor cell lines. In yet another approach two or more may or may not further comprise a selectable marker different genetically modified allogeneic cell lines (e.g. sequence operatively linked to a promoter. Desirably, the LNCAP and PC-3) expressing GM-CSF and one or more autologous tumor cell expresses high levels of GM-CSF and/ prostate tumor-associated antigens are administered in com or the one or more prostate tumor-associated antigens. bination, typically at a ratio of 1:1. In general, the cell or 5.4.4. Allogeneic Cells 30 Researchers have sought alternatives to autologous and population of cells is from a tumor cell line of the same type MHC-matched cells as tumor vaccines, as reviewed by Jaffee as the tumor or cancer being treated, e.g. prostate cancer. The et al., Seminars in Oncology, 22, 81-91 (1995). Early tumor nucleic acid sequence encoding the prostate tumor-associated vaccine strategies were based on the understanding that the antigens may be introduced into the same or a different allo vaccinating cells function as the antigen presenting cells 35 geneic tumor cell using the same or a different vector. The (APCs) that present tumor antigens on their MHC class I and nucleic acid sequence encoding the prostate tumor-associated II molecules, and directly activate the T cell arm of the antigens (s) may or may not further comprise a selectable immune system. The results of Huang et al. (Science, 264. marker sequence operatively linked to a promoter. Desirably, 961-965, 1994), indicate that professional APCs of the host the allogeneic cell line expresses high levels of GM-CSF rather than the vaccinating cells prime the T cell arm of the 40 and/or the one or more prostate tumor-associated antigens. immune system by secreting cytokine(s) such as GM-CSF In another aspect, one or more genetically modified GM such that bone marrow-derived APCs are recruited to the CSF expressing allogeneic cell lines can be exposed to an region of the tumor. The bone marrow-derived APCs take up antigen, e.g. a prostate tumor-associated antigen, Such that the whole cellular protein of the tumor for processing, and the patient’s immune response to the antigen is increased in then present the antigenic peptide(s) on their MHC class I and 45 the presence of GM-CSF, e.g., analogeneic or bystander cell II molecules, thereby priming both the CD4+ and the CD8+ T that has been genetically modified to express GM-CSF. Such cell arms of the immune system, resulting in a systemic exposure may take place ex vivo or in vivo. In one preferred tumor-specific anti-tumor immune response. Without being embodiment, the antigen is a peptide comprising an amino bound by theory, these results suggest that it may not be acid sequence obtained from HLA-A24, FLJ14668, Cardio necessary or optimal to use autologous or MHC-matched 50 lipin, NNAT, SELS, HIGD2A, SSR3 or NRP2, as described cells in order to elicit an anti-cancer immune response and extensively above. In Such cases, the composition can be that the transfer of allogeneic MHC genes (from a genetically rendered proliferation-incompetent, typically by irradiation, dissimilar individual of the same species) can enhance tumor wherein the allogeneic cells are plated in a tissue culture plate immunogenicity. More specifically, in certain cases, the and irradiated at room temperature using a Cs source, as rejection of tumors expressing allogeneic MHC class 1 mol 55 further described herein. Analogeneic cellular vaccine com ecules has resulted in enhanced systemic immune responses position of the invention may comprise allogeneic cells plus against Subsequent challenge with the unmodified parental other cells, i.e. a different type of allogeneic cell, an autolo tumor. See, e.g., Jaffee et al., Supra, and Huang et al., Supra. gous cell, or a bystander cell that may or may not be geneti As used herein, a “tumor cell line' comprises cells that cally modified. If genetically modified, the different type of were initially derived from a tumor. Such cells typically 60 allogeneic cell, autologous cell, or bystander cell may express exhibit indefinite growth in culture. In one aspect, the method GM-CSF and/or one or more prostate tumor-associated anti for treating prostate cancer comprises: (a) obtaining a tumor gens. The ratio of allogeneic cells to other cells in a given cell line; (b) genetically modifying the tumor cell line to administration will vary dependent upon the combination. render the cells capable of producing an increased level of a Any suitable route of administration can be used to intro cytokine, e.g., GM-CSF, and one or more prostate tumor 65 duce an allogeneic cell line composition into the patient, associated antigens relative to the unmodified tumor cell line; preferably, the composition is administered intradermally, (c) rendering the modified tumor cell line proliferation Subcutaneously or intratumorally. US 8,840,881 B2 35 36 5.4.5. Bystander Cells cells should not be greater than 1:1. Appropriate ratios of In one further aspect, a universal immunomodulatory bystander cells to tumor cells or tumor antigens can be deter genetically modified transgene-expressing bystander cell that mined using routine methods known in the art. expresses at least one transgene, e.g. a nucleic acid sequence Typically a minimum dose of about 3500 rads is sufficient encoding a cytokine, e.g. GM-CSF, or a prostate tumor-asso to inactivate a cell and render it proliferation-incompetent, ciated antigen, can be used in the immunotherapies described although doses up to about 30,000 rads are acceptable. In herein. The same universal bystander cell line may express some embodiments, the cells are irradiated at a dose of from more than one transgene or individual transgenes may be about 50 to about 200 rads/min or from about 120 to about expressed by different universal bystander cell lines. The 140 rads/min prior to administration to the mammal. Typi universal bystander cell line comprises cells which either 10 cally, when using irradiation, the levels required are 2,500 naturally lack major histocompatibility class I (MHC-I) anti rads, 5,000 rads, 10,000 rads, 15,000 rads or 20,000 rads. In gens and major histocompatibility class II (MHC-II) antigens one embodiment, a dose of about 10,000 rads is used to or have been modified so that they lack MHC-I antigens and inactivate a cell and render it proliferation-incompetent. It is MHC-II antigens. In one aspect, a universal bystander cell understood that irradiation is but one way to render cells line can be modified by introduction of a vector wherein the 15 proliferation-incompetent, and that other methods of inacti vector comprises a nucleic acid sequence encoding a trans vation which result in cells incapable of multiple rounds of gene, e.g., a cytokine Such as GM-CSF, and/or one or more cell division but that retain the ability to express transgenes prostate tumor-associated antigens, operably linked to a pro (e.g. cytokines and/or tumor antigens) are included in the moter and expression control sequences necessary for expres present invention (e.g., treatment with mitomycin C, cyclo sion thereof. In another aspect, the same universal bystander heximide, and conceptually analogous agents, or incorpora cell line or a seconda universal bystander cell line is modified tion of a Suicide gene by the cell). by introduction of a vector comprising a nucleic acid 5.4.6. Cytokines sequence encoding at least one additional transgene, e.g., a A “cytokine' or grammatical equivalent, includes, without cytokine such as GM-CSF, and/or one or more prostate limitation, those hormones that act locally and do not circu tumor-associated antigens, operatively linked to a promoter 25 late in the blood, and which, when used in accordance with and expression control sequences necessary for expression the present invention, will result in an alteration of an indi thereof. The nucleic acid sequence encoding the transgene(s) vidual’s immune response. Also included in the definition of may be introduced into the same or a different universal cytokine are adhesion or accessory molecules which result in bystander cell line using the same or a different vector. The an alteration of an individual’s immune response. Thus, nucleic acid sequence encoding the transgene(s) may or may 30 examples of cytokines include, but are not limited to, inter not further comprise a selectable marker sequence opera feron alpha (IFN-O.), interferon beta (IFN-?3), interferon tively linked to a promoter. Any combination of transgene(s) gamma (IFN-Y), interleukin-1 (IL-1). IL-2, IL-3, IL-4, IL-5, that stimulate an anti-tumor immune response can be used. IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, tumor necrosis The universal bystander cell line preferably grows in defined, factor alpha (TNF-C.), tumor necrosis factor beta (TNF-B), i.e., serum-free medium, preferably as a Suspension. 35 erythropoietin (EPO), MIP3A, intracellular adhesion mol An example of a preferred universal bystander cell line is ecule (ICAM), macrophage colony stimulating factor K562 (ATCCCCL-243; Lozzio et al., Blood 45(3): 321-334 (M-CSF), granulocyte colony stimulating factor (GCSF), (1975); Klein et al., Int. J. Cancer 18: 421-431 (1976)). A granulocyte-macrophage colony stimulating factor (GM detailed description of the generation of human bystander cell CSF), LIF, LT, TGF-P. a-EFN, P-IFN, BCGF, and CD2. lines is described for example in U.S. Pat. No. 6,464,973, 40 Descriptions of the aforementioned cytokines as well as other expressly incorporated by reference herein. applicable immunomodulatory agents may be found in Desirably, the universal bystander cell line expresses high “Cytokines and Cytokine Receptors.” A. S. Hamblin, D. Male levels of the transgene, e.g. a cytokine such as GM-CSF (ed.), Oxford University Press, New York, N.Y. (1993)), or the and/or one or more prostate tumor-associated antigens. “Guidebook to Cytokines and Their Receptors. N. A. Nicola In the methods provided herein, the one or more universal 45 (ed.), Oxford University Press, New York, N.Y. (1995)). bystander cell lines can be incubated with an autologous Where therapeutic use in humans is contemplated, the cytok cancer antigen, e.g., provided by an autologous tumor cell ines will preferably be substantially similar to the human (which together comprise a universal bystander cell line com form of the protein or will have been derived from human position), then the universal bystander cell line composition sequences (i.e., of human origin). In one preferred embodi can be administered to the patient. Any suitable route of 50 ment, the cytokine of the cellular immunotherapy described administration can be used to introduce a universal bystander herein is GM-CSF. cell line composition into the patient. Preferably, the compo Additionally, cytokines of other mammals with substantial sition is administered intradermally, Subcutaneously or intra structural homology and/or amino acid sequence identity to tumorally. the human forms of a given cytokine, will be useful when Typically, the autologous cancer antigen can be provided 55 demonstrated to exhibit similar activity on the human by a cell of the cancer to be treated, i.e., an autologous cancer immune system. Similarly, proteins that are substantially cell. In Such cases, the composition is rendered proliferation analogous to any particular cytokine, but have conservative incompetent by irradiation, wherein the bystander cells and changes of protein sequence, can also be used. Thus, conser cancer cells are plated in a tissue culture plate and irradiated Vative Substitutions in protein sequence may be possible with at room temperature using a Cs source, as detailed above. 60 out disturbing the functional abilities of the protein molecule, The ratio of bystander cells to autologous cancer cells in a and thus proteins can be made that function as cytokines in the given administration will vary dependent upon the combina present invention but have amino acid sequences that differ tion. With respect to GM-CSF-producing bystander cells, the slightly from currently known sequences. Such conservative ratio of bystander cells to autologous cancer cells in a given substitutions typically include substitutions within the fol administration should be such that a therapeutically effective 65 lowing groups: glycine, alanine, Valine, isoleucine, leucine; level of GM-CSF is produced. In addition to the GM-CSF aspartic acid, glutamic acid, asparagine, glutamine; serine, threshold, the ratio of bystander cells to autologous cancer threonine; lysine, arginine; and phenylalanine, tyrosine. US 8,840,881 B2 37 38 Granulocyte-macrophage colony stimulating factor (GM 93, 94, 95, 96, 97,98.99% or more % identity over its entire CSF) is a cytokine produced by fibroblasts, endothelial cells, length to a native GM-CSF coding sequence. For example, a T cells and macrophages. This cytokine has been shown to GM-CSF coding sequence can have at least 80, 85, 87, 89,90, induce the growth of hematopoetic cells of granulocyte and 91, 92,93, 94, 95, 96, 97,98.99% or more sequence identity macrophage lineages. In addition, it also activates the antigen to a sequence presented as SEQ ID NO: NO:15 or SEQ ID processing and presenting function of dendritic cells, which NO: NO:16, when compared and aligned for maximum cor are the major antigen presenting cells (APC) of the immune respondence, as measured a sequence comparison algorithm system. Results from animal model experiments have con (as described above) or by visual inspection. In one embodi Vincingly shown that GM-CSF producing cells are able to ment, the given% sequence identity exists over a region of the induce an immune response against parental, non-transduced 10 sequences that is at least about 50 nucleotides in length. In cells. another embodiment, the given "% sequence identity exists GM-CSF augments the antigen presentation capability of over a region of at least about 100 nucleotides in length. In the subclass of dendritic cells (DC) capable of stimulating another embodiment, the given "% sequence identity exists robust anti-tumor responses (Gasson et al. Blood 1991 Mar. over a region of at least about 200 nucleotides in length. In 15; 77(6): 1131-45; Mach et al. Cancer Res. 2000 Jun. 15: 15 another embodiment, the given "% sequence identity exists 60(12):3239-46; reviewed in Mach and Dranoff, Curr Opin over the entire length of the sequence. Preferably, the GM Immunol. 2000 October; 12(5):571-5). See, e.g., Boon and CSF has authentic GM-CSF activity, e.g., can bind the GM-C Old, Curr Opin Immunol. 1997 Oct. 1; 9(5):681-3). Presen SF receptor. tation of tumor antigen epitopes to T cells in the draining In some embodiments, the amino acid sequence for a lymph nodes is expected to result in Systemic immune cytokine such as GM-CSF has at least 80, 85, 87, 89,90,91, responses to tumor metastases. Also, irradiated tumor cells 92,93, 94, 95, 96, 97,98, 99% or more sequence identity to expressing GM-CSF have been shown to function as potent the sequence presented as SEQID NO: NO:17, when com vaccines against tumor challenge. Localized high concentra pared and aligned for maximum correspondence. tions of certain cytokines, delivered by genetically modified 5.4.7. Kits cells, have been found to lead to tumor regression (Abe et al., 25 The cellular immunotherapy compositions provided herein J. Canc. Res. Clin. Oncol. 121:587-592 (1995); Gansbacher can be included in a kit, container, pack, or dispenser together et al., Cancer Res. 50: 7820-7825 (1990); Formiet al., Cancer with instructions for administration. When the composition is and Met. Reviews 7: 289-309 (1988). PCT publication Supplied as a kit, the different components of the composition WO200072686 describes tumor cells expressing various may be packaged in separate containers so as to permit long cytokines. 30 term storage without losing the active components functions. In one embodiment, the cellular immunogenic composi The reagents included in the kits can be supplied in containers tion comprises a GM-CSF coding sequence operatively of any sort such that the life of the different components are linked to regulatory elements for expression in the cells of the preserved, and are not adsorbed or altered by the materials of vaccine. The GM-CSF coding sequence may code for a the container. For example, cytokine-expressing and/or pros murine or human GM-CSF and may be in the form of 35 tate tumor-associated antigen expressing cells may be housed genomic DNA (SEQ ID NO: 15; disclosed as SEQ ID NO: in containers such as test tubes, vials, flasks, bottles, Syringes, NO.1 in US Patent Publication NO. 2006/0057127, which is or the like. Containers may have a sterile access port, such as hereby incorporated by reference in its entirety) or cDNA a bottle having a stopper that can be pierced by a hypodermic (SEQ ID NO: 16; disclosed as SEQ ID NO: NO.:2 in US injection needle. Other containers may have two compart Patent Publication NO. 2006/0057127, which is hereby 40 ments that are separated by a readily removable membrane incorporated by reference in its entirety). In the case of that upon removal permits the components to mix. Remov cDNA, the coding sequence for GM-CSF does not contain able membranes may be glass, plastic, rubber, etc. intronic sequences to be spliced out prior to translation. In Kits may also be supplied with instructional materials. contrast, for genomic GM-CSF, the coding sequence contains Instructions may be printed on paper or other Substrate, and/ at least one native GM-CSF intron that is spliced out prior to 45 or may be supplied as an electronic-readable medium, Such as translation. In one embodiment, the GM-CSF coding a floppy disc, CD-ROM, DVD-ROM, Zip disc, videotape, sequence encodes the amino acid sequence presented as SEQ audio tape, etc. Detailed instructions may not be physically ID NO.: 17 (disclosed as SEQID NO.3 in US Patent Publi associated with the kit; instead, a user may be directed to an cation NO. 2006/0057127, which is hereby incorporated by interne web site specified by the manufacturer or distributor reference in its entirety). Other examples of GM-CSF coding 50 of the kit, or Supplied as electronic mail. sequences are found in Genbank accession numbers: Thus, in one aspect, the present invention provides a kit AF373868, AC034228, AC034216, M 10663 and comprising a composition comprising a population of cells NMOOO758. genetically modified to express the coding sequence for a A GM-CSF coding sequence can be a full-length comple cytokine and the coding sequence of one or more prostate ment that hybridizes to the sequence shown in SEQID NO:15 55 tumor-associated antigens selected from the group consisting or SEQ ID NO:16 under stringent conditions. The phrase HLA-A24, FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, “hybridizing to refers to the binding, duplexing, or hybrid SSR3 and NRP2. In some embodiments, the genetically izing of a molecule to a particular nucleotide sequence under modified cells are autologous. In some embodiments, the stringent conditions when that sequence is present in a com genetically modified cells are allogeneic. In some embodi plex mixture (e.g., total cellular) DNA or RNA. “Bind(s) 60 ments, the genetically modified cells are bystander cells. substantially refers to complementary hybridization In another embodiment, the kit comprises a first composi between a probe nucleic acid and a target nucleic acid and tion comprising a population of cells genetically modified to embraces minor mismatches that can be accommodated by express the coding sequence for a cytokine; and a second reducing the stringency of the hybridization media to achieve composition comprising a population of cells genetically the desired detection of the target nucleic acid sequence. 65 modified to express the coding sequence of one or more It therefore follows that the coding sequence for a cytokine prostate tumor-associated antigens selected from the group such as GM-CSF, can have at least 80, 85, 87, 89,90,91, 92, consisting of HLA-A24, FLJ14668, Cardiolipin, NNAT, US 8,840,881 B2 39 40 SELS, HIGD2A, SSR3 and NRP2. In some embodiments, the Humoral patient immune responses to a cell-based prostate first composition comprises a population of tumor cells and cancer immunotherapy have been evaluated to specifically the second population comprises a population of bystander identify which antigens may be specifically recognized by the cells. In some embodiments, the tumor cells are autologous. patients’ immune system following the therapy. Two differ In some embodiments, the tumor cells are allogeneic. ing methods have been used to characterize this response 6. EXAMPLES using patients Sera: i) serological analysis of gene expression libraries (SEREX) and ii) defined prostate cancer antigen The present invention is described by reference to the fol screening. From these two techniques, multiple antibody lowing Examples, which are offered by way of illustration responses to proteins derived from the immunotherapy have and are not intended to limit the invention in any manner. 10 been identified that are specifically induced or augmented Standard techniques well known in the art or the techniques following immunization. specifically described below are utilized. It will be appreci 6.1.1. Serological Analysis of Gene Expression Libraries ated that the methods and compositions of the instant inven (SEREX) tion can be incorporated in the form of a variety of embodi SEREX allows the systematic cloning of tumor antigens ments, only a few of which are disclosed herein. It will be 15 recognized by the autoantibody repertoire of cancer patients apparent to the artisan that other embodiments exist and do (Sahin et al. 1995; McNeel et al. 2000; Wang et al. 2005; not depart from the spirit of the invention. Thus, the described Dunphy et al. 2005; Qinet al. 2006). cDNA expression librar embodiments are illustrative and should not be construed as ies were constructed from the tumor cell lines used to com restrictive. prise the GVAX(R) immunotherapy (PC-3 and LNCaP pros Exemplary methods for producing recombinant viral vec tate cancer cell lines modified to secrete GM-CSF), packaged tors useful for making genetically altered tumor cells that into lambda-phage vectors, and expressed recombinantly in express GM-CSF, methods for using the genetically altered E. Coli. Recombinant proteins expressed during the lytic tumor cells that express GM-CSF in cancer therapies, par infection of bacteria were then blotted onto nitrocellulose ticularly prostate cancer therapies, are extensively described membranes and probed with diluted patient serum for iden in U.S. Patent Application Publication No. 2006/0057127, 25 tification of clones reactive with high-titered IgG antibodies. incorporated by reference in its entirety, and will not be repro This procedure was carried out for 8 patients treated with duced below. One such therapy that has been and is being cell-based prostate cancer immunotherapy. These patients evaluated in clinical trials for treatment of prostate cancer is were prioritized for SEREX analysis based upon survival GVAX(R) therapy. advantage. Survival advantage was determined by comparing 30 individual patient Survival time to a patient’s predicted Sur 6.1 Example 1 vival. Predicted survival was calculated using a published, validated nomogram based on seven prognostic variables Identification of Protein Targets of Host Antibody including PSA, ECOG performance status, Gleason score Responses Following Cell-Based Prostate Cancer Sum, alkaline phosphatase, hemoglobin, LDH and presence? Immunotherapy 35 absence of visceral metastatic disease (Halabi, et al. 2003). From the SEREX analysis of these 8 patients, multiple This example describes identification of protein targets of LNCaP/PC-3 derived cell protein clones reactive to the host antibody responses following allogeneic cancer immu patient sera post-immunotherapy were identified. Positive notherapy cells genetically modified to express GM-CSF. hits for the SEREX screen were then screened against pre Patients n=19 treated with high-dose cell-based cancer 40 immunotherapy serum to determine if the antibody response immunotherapy (e.g., 500 million cells followed by 300 mil to these proteins was augmented or induced following the lion cells every two weeks) demonstrate an increase in immunotherapy. median survival time (MST). The median survival has not yet For example, from patient 1, 24 proteins from an original been reached for this high dose group, and the final median list of 92 individual proteins (26%) have antibody responses survival will be no less than 29.1 months based on the current 45 that were induced upon GVAX(R) immunotherapy. The median follow-up time for these patients. In addition, there remainder of the responses (68 proteins) did not demonstrate was also a statistically significant increased antibody an increase in titer. For patient 2, 18 individual proteins from response to the cell-based cancer immunotherapy in the high a total of 47 (38%) had induced antibody titers following dose group with detectable antibodies directed against anti immunotherapy. For patient 3, 14/38 (37%) of antibody gens derived from the immunotherapy as determined by west 50 responses were induced following immunotherapy. Table 1, ern blot analysis using patient Sera harvested post-immuni below, provides a compiled list of induced antibody hits (143 Zation. proteins total) for all 8 patients screened by SEREX. TABLE 1. Hit pulled out Plugs Came using what From Which post serum? Xi Lib Gene Patient 1 X1 L,L,L. ACAT2 (acetyl-Coenzyme A acetyltransferase 2) X2 P, P ACAA1 X3 cDNA FLJ41756 fis X4 gP cDNA: FLJ22465 fis X5 P, P chromosome 20 open reading frame 43 X6 exosome component 5 (EXOSC5) X7 Huntingtin interacting protein K (HYPK) X8 keratin 10 (KRT10) Methylenetetrahydrofolate dehydrogenase (MTHFD1) X10 mitochondrial ribosomal protein L32 US 8,840,881 B2 41 42 TABLE 1-continued Hit pulled out Plugs Came using what From Which post serum? Xi Lib Gene X11 L. L. M-phase phosphoprotein 10 (MPHOSPH10) X12 gP, P RAP1 interacting factor homolog (yeast) (RIF1) X13 gP Restin (RSN) X14 P RNA binding motif protein 4 (RBM4) X15 gP, P, P S100 calcium binding protein A2 (S100A2) X1.6 L selenium binding protein 1 (SELENBP1) X17 gP, gP SVH protein (SVH) X18 gP, L translocated promoter region (to activated MET oncogene) X19 gP BRCC1 (BRCC1) X20 gP nucleophosmin (NPM1) X21 gP COP9 constitutive photomorphogenic homolog subunit 3 X22 P, P kinesin family member 15 (KIF15) X23 L Zinc finger protein 24 (KOX 17) (ZNF24) X24 P. L golgi autoantigen macrogolgin (with transmembrane signal) (GOLGB1) Patient 2 X25 P, P, P HLA X26 P 8S rRNA gene X27 P. P. P Bcl-XL-binding protein v68 (MGC5352) X28 P, P Cullin-associated and neddylation-dissociated 1 (CAND1) X29 P heat shock 60 kDa protein 1 (chaperonin) (HSPD1) X30 L, P, P hypothetical protein FLJ10534 X31 P MAX gene associated (MGA) (PREDICTED) X32 P, P, P Molybdenum cofactor Sulfurase (MOCOS) X33 P peroxisomal D3, D2-enoyl-CoA isomerase (PECI) X34 L, P, P ribonuclease III, nuclear (RNASEN) X35 P, P, P RNA binding motif protein 25 (RBM25) X36 P, P, P Sjogren's syndrome scleroderma autoantigen 1 X37 P, P SVH protein (SVH) X38 P TSR1, 20S rRNA accumulation, homolog (yeast) (TSR1) X39 gP, P, P RNA binding motif protein 25 (RBM25) X40 P Deltex 3-like (Drosophila) (DTX3L) X41 P, L, P recombining binding protein Suppressor of hairless X42 P Coiled-coil domain containing 18 (CCDC18) Patient 3 X43 P centromere protein F, 350/400ka (mitosin) (CENPF) X44 L. chromosome 1 open reading frame 80 (C1orf&O) X45 L. L. L. cleavage and polyadenylation specific factor 2 (CPSF2) X46 L Enoyl Coenzyme A hydratase 1, peroxisomal (ECH1) X47 filamin B, beta (actin binding protein 278) (FLNB) X48 L, P, P Gelongation factor, mitochondrial 2 (GFM2) X49 L, P, P heat shock 60 kDa protein 1 (chaperonin) (HSPD1) XSO L. heat shock 70 kDa protein 8 (HSPA8), transcript variant 2 X51 L, P heat shock 70 kDa protein 9B (mortalin-2) (HSPA9B) X52 P, L, L naD-like (Drosophila) (INADL) XS3 L umonji XS4 L. mRNA for mitotic kinesin-like protein-1 (MKLP-1 gene) X55 L, P, P Restin (RSN) XS6 L Ubiquinol-cytochrome c reductase hinge protein (UQCRH) Patient 4 X58 L PNPO Patient 5 X60 gP, gL, P chaperonin containing TCP1, subunit 5 (epsilon) (CCT5) X61 L, gL, gP chromosome 10 open reading frame 118 (C10orfl 18) X62 gL, gP Enoyl Coenzyme A hydratase 1, peroxisomal (ECH1) X63 P Eukaryotic translation initiation factor 3, Subunit 9eta, X64 gL, P Filamin B, beta (actin binding protein 278) (FLNB) X65 gL, gL, L heterogeneous nuclear ribonucleoprotein K (HNRPK), war 1 X66 gL, gP, P Huntingtin interacting protein K (HYPK) X67 P hypothetical protein FLJ14668 (FLJ14668) X68 L, gP, L hypothetical protein FLJ21908 (FLJ21908) X69 L interleukin enhancer binding factor 3, 90 kDa (ILF3), war 1 X70 P KIAAO310 X71 gP membrane-associated ring ringer (C3HC4) 6 (MARCH6) X72 P, gL, gP methylmalonyl Coenzyme A mutase (MUT) X73 gL, gP, P M-phase phosphoprotein 10 (MPHOSPH10) X74 gL, L myosin, heavy polypeptide 10, non-muscle (MYH10) X75 gP neuroblastoma breakpoint family, member 9, variant 13 (NBPF9)-predicted X76 L non-metastatic cells 1, protein (NM23A) expressed in (NME1), var 1 X77 P, P NSFL1 (p.97) cofactor (p47) (NSFL1C), var 1 X78 P Rho-associated, coiled-coil containing protein kinase 2 (ROCK2) X79 L ribosomal protein S15a (RPS15A), war 1 X80 gP, gP, P translocase of Outer mitochondrial membrane 70 homolog A (TOMM70A) US 8,840,881 B2 43 44 TABLE 1-continued Hit pulled out Plugs Came using what From Which post serum? Xi Lib Gene X81 gP upstream binding transcription factor, RNA polymerase I (UBTF) X82 L, L YTH domain containing 2 (YTHDC2) Patient 6 X83 gP Coiled-coil domain containing 46 (CCDC46), war 1 X84 gP KIAAO196 X85 gP ribosomal protein L21 (RPL21) X86 gP, gL, L SWI/SNF related, matrix assoc., actin dependent reg of chromatin (SMARCA3) X87 P hyroid hormone receptor interactor 12 (TRIP12) Patient 7 X92 disrupter of silencing 10 (SAS10) X94 heat shock 60 kDa protein 1 (chaperonin) (HSPD1) X96 high-mobility group box 2 (HMGB2) X97 interphase cyctoplasmic foci protein 45 (ICF45) X100 LSM3 homolog, U6 small nuclear RNA associated (LSM3) X101 methylmalonyl Coenzyme A mutase (MUT) X102 NSFL1 (p.97) cofactor (p47) (NSFL1C) X103 par-3 partitioning defective 3 homolog (C. elegans) (PARD3) X105 proteasome (prosome, macropain) 26S subunit, non ATPase, 2 (PSMD2) X107 SVH protein (SVH) X108 TAOkinase 3 (TAOK3) X110 golgi autoantigen, macrogolgin (with transmembrane signal), 1 (GOLGB1) X111 heat shock 70 kDa protein 8 (HSPA8) Patient 8 X113 L. kinetochore associated 2 (KNTC2) X118 PIT opioid growth factor receptor (OGFR) X120 P, P nexilin (Factin binding protein) (NEXN) X125 L NSFL1 (p.97) cofactor (p47) (NSFL1C) X126 L, L hypothetical protein FLJ21908 (FLJ21908) X128 L, P NADH dehydrogenase (ubiquinone) flavoprotein 2, 24 kDa (NDUFV2) X130 P chromosome 14 DNA sequence BAC C-2555O16 (see note for rest) X131 L, P ankyrin repeat and KH domain containing 1 (ANKHD1). (MASK-BP3) X132 L, L heterogeneous nuclear ribonucleoprotein K (HNRPK) X133 L, P kinesin family member 15 (KIF15) X134 L. translocated promoter region (to activated MET oncogene) (TPR) X135 L, L acetyl-Coenzyme A acetyltransferase 2(ACAT2) X136 L, P Huntingtin interacting protein K (HYPK) X137 L. InaD-like (Drosophila) (INADL) Patient 4 X138 L, P ring finger protein 8 (RNF8) cont. X139 L, P colony stimulating factor 2 (granulocyte-macrophage) (CSF2) X141 L, A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9) 6.1.2. Expanded Analysis of Induced Autoantibody but are present in at least 2 (of the 14 patients screened) Responses following immunotherapy. Response is absolute (on/off). Employing the compiled list of 143 proteins to which “Induced antigens (Table 3), were antibody responses that autoantibody responses were observed from the 8 patients, 50 are detectable pre-therapy in a proportion of patients and titer samples from a larger cohort of patients (up to 14 in total) is increased in at least 2 patients post-therapy (enhancement were screened to determine the frequency and selectivity of of pre-existing antibody response). antibody responses. Representative phage clones of each of the 143 proteins were screened against patient Sera pre and TABLE 2 post-immunotherapy. Results for all 8 patients from which 55 the clones were originally isolated, are presented in Tables 2 De novo antibody responses and 3, below. Frequency of Results from this expanded screen of patients sera indicate Genbank autoantibody that for a number of proteins, auto-antibodies are induced at a accession induction relatively high frequency following immunotherapy. For 60 Gene number Following GVAX(R) interpretation, these antigens have been grouped into 2 HLA-A gene, HLA-A24 NM 002116 8/13 (62%) classes as shown in Tables 2 and 3, below. Although grouped allele separately for presentation purposes, both groups of genes (de Filamin B, beta (FLNB) NM OO1457 7/12 (58%) NSFL1 (p97) cofactor NM 016143 3/6 (50%) novo and induced) may serve as an important marker of (p47) (NSFL1C) clinical benefit in patients. 65 Pyridoxine 5'phosphate NM 018129 6/13 (46%) De novo antigens (Table 2), were antibody responses that oxidase (PNPO) are not detectable pre-therapy in any patient Screened so far, US 8,840,881 B2 45 46 TABLE 2-continued TABLE 3-continued De novo antibody responses Induced antibody responses Frequency of Frequency of Genbank autoantibody Genbank pre-existing, accession induction accession un-augmented Gene number Following GVAX(R) Gene number autoantibody response SVH protein (SVH) NM 03.1905 49 (44%) Rho-associated, coiled-coil NM OO4850 6.9 Heat shock 60 kDa NM 002156 49 (44%) containing protein kinase 2 (HSPD1) 10 (ROCK2) YTH domain containing 2 NM 022828 3/10 (30%) Golgi autoantigen, NM 004.487 6.9 (YTHDC2) macrogolgin (with Chaperonin containing NM 012073 3/10 (30%) transmembrane signal), 1 TCP1, subunit 5 (CCT5) (GOLGB1) KIAAO196 NM 014846 2/7 (29%) Bcl-XL-binding protein NM 138575 3.13 InaD-like (Drosophila) NM 176878 3/12 (25%) 15 v68 (MGC5352) (INADL) Mitochondrial ribosomal NM O31903 10:14 Translocated promoter NM OO3292 2/8 (25%) protein L32 (MRPL32) region (to activated MET Kinesin family member 15 NM 020242 114 oncogene) (TPR) (KIF15) Disrupter of silencing 10 NM O2O368 2/8 (25%) Centromere protein F, NM 016343 2f12 (SAS10) 350/400ka (mitosin) Enoyl Coenzyme A NM 001398 3/13 (23%) (CENPF) hydratase 1, peroxisomal Membrane-associated ring NM OO5885 3.8 (ECH1) finger (C3HC4) 6 (MARCH6) Heat shock 70 kDa protein NM OO6597. 2/9 (22%) Coiled-coil domain NM OO10373.25 2.9 8 (HSPA8) 1532O1 containing 46 (CCDC46), NM 1455.036 Methylmalonyl Coenzyme NM OOO255 2/9 (22%) war 1 A mutase (MUT) 25 Restin (Reed-Steinberg NM 198240 2/11 (18%) LSM3 homolog, U6 Small NM O14463 2/9 (22%) cell-expressed nuclear RNA associated intermediate filament (LSM3) associated protein) (RSN) Dihydrolipoamide S- NM OO1931 2/9 (22%) Coiled-coil domain NM 206886 411 acetyltransferase (DLAT) containing 18 (CCDC18) Huntingtin interacting NM 016400 3/14 (21%) 30 Acetyl-Coenzyme A NM OO1607 114 protein K (HYPK) acyltransferase 1 Non-metastatic cells 1, NM 000269. 2/10 (20%) (ACAA1) protein (NM23A) 1981.75 expressed in (NME1) KIAAO310 XM 946.064 2/10 (20%) Therefore, in patients treated with cell-based prostate can Eukaryotic translation NM OO1037283, 2/10 (20%) 35 cer immunotherapy, a number of autoantibody responses are initiation factor 3, Subunit OO3751 9eta, 116 kDa (EIF3S9) induced at a relatively high frequency (FLNB, SVH, HSPD1, Acetyl-Coenzyme A NM O05891 2/14 (18%) MPHOSPH10, etc.). acetyltransferase 2 6.1.3. Cloning and Characterization of Antigens (ACAT2) The following list identifies to top 20 most frequent anti Proteasome (prosome, NM 002808 2/11 (18%) 40 body responses (from both the de novo and induced gene macropain) 26S subunit, non-ATPase, 2 (PSMD2) lists): Kinetochore associated 2 NM 006101 2/11 (18%) (KNTC2) TABLE 4 Interphase cytoplasmic NM O17872 2/13 (15%) protein 45 (ICF45) HLA-A gene, HLA-A24 allele 45 Filamin B, beta (FLNB) Translocated promoter NM OO3292 2/13 (15%) M-phase phosphoprotein 10 (MPHOSPH10) region (to activated MET TAO Kinase 3 (TAOK3) oncogene) NSFL1 (p.97) cofactor (p47) (NSFL1C) RAP1 interacting factor NM 0181.51 2/13 (15%) Upstream binding transcription factor, RNA polymerase 1 (UBTF) homolog (yeast) (RIF1) Pyridoxine 5'phosphate oxidase (PNPO) 50 SVH protein (SVH) Heat shock 60 kDa (HSPD1) 10. Jumonji, AT rich interactive domain 1A (RBBP2-like) (JARID1A) TABLE 3 11. Bcl-XL-binding protein v68 (MGC5352) 12. YTH domain containing 2 (YTHDC2) Induced antibody responses 13. Chaperonin containing TCP1, subunit 5 (CCT5) 55 14. Kinesin family member 15 (KIF15) Frequency of 15. InaD-like (Drosophila) (INADL) Genbank pre-existing, 16. Enoyl Coenzyme A hydratase 1, peroxisomal (ECH1) accession un-augmented 17. Huntingtin interacting protein K (HYPK) Gene number autoantibody response 18. Non-metastatic cells 1, protein (NM23A) expressed in (NME1) 19. Acetyl-Coenzyme A acetyltransferase 2 (ACAT2) M-phase phosphoprotein NM O05791 S.14 20. Methylmalonyl Coenzyme A mutase (MUT) 10 (MPHOSPH10) 60 TAO Kinase 3 (TAOK3) NM 016281 49 Upstream binding NM O14233 5/10 Full length genes are cloned into a mammalian based transcription factor, RNA expression system (e.g., a lentiviral expression plasmid) and polymerase 1 (UBTF) Jumonji, AT rich NM 005056 612 a FLAG-tag is added at the C-terminal end to aid with detec interactive domain 1A 65 tion and purification. Antibody responses to these high fre (RBBP2-like) (JARID1A) quency hits of 20 proteins are determined from all trials available (G98-03, G0010, VITAL-1/2) and the induction of US 8,840,881 B2 47 48 antibody response is examined in correlation to Survival. diluted in PBST+1% BSA. One and half hours post-serum These responses either alone, or grouped with the defined addition, plates were washed and then incubated with a Don antigen responses discussed below, are used for a number of key-anti Human IgG IgM HRP-conjugated secondary anti applications including a surrogate marker of immunotherapy body (Jackson) diluted at 1:10,000 in PBST for 1 hour at treatment, correlation with patient Survival data to provide an 5 room temperature. Plates were then washed and bound sec efficacy signature, clinical trial monitoring (biomarkers) and ondary antibody detected using TBM (KPL). Plates were then assay development of cell characterization marker for lot read at 450 nm. To determine induction of an FLNB antibody release (product characterization, comparability markers). response, the post-therapy O.D. value was divided by the Certain of the above-identified antigens were cloned and pre-therapy O.D to determine a fold induction. Fold induction characterized as set forth below. 10 levels 2 were considered significant. In patients 1,3,4, and 5. 6.1.3.1 Cloning, Protein Production and Antibody a significant fold increase in O.D. could be observed by the Response to FLNB in Patients Administered a Cell-Based post/pre ratio. In comparison IgG/IgM antibodies to tetanus Prostate Cancer Immunotherapy toxoid, a protein to which the majority of the population has FLNB was cloned with a C-terminus Flag tag into a len been actively vaccinated to, was unchanged (prefpost tivirus plasmid vector for protein production. To generate the 15 ration<2) following treatment indicating the increase in titer plasmid a FLNB intermediate was first cloned which con is FLNB specific. Results indicating patientantibody genera tained the 3' end of FLNB attached to C-terminal Flag tag tion to FLNB following therapy agree for western blot and sequence (in frame). To generate this clone, a PCR fragment ELISA analysis (i.e. patients 1, 3, 4, and 5 were positive). was generated using the forward primer (5'-actacctgatcagtgt 6.1.3.2 Cloning, Protein Production and Antibody caaa-3") (SEQ ID NO.: 18) and the reverse primer (5'- Response to PNPO Following Immunotherapy gtaatctecggaaggcactgtgacatgaaaag-3") (SEQ ID NO.: 19) PNPO was cloned with a C-terminus Flag tag into a len using a FLNB template obtained from Invitrogen (clone tivirus plasmid vector, using a PNPO clone identified from CSODKOO1YE14) and High Fidelity Expand PCR kit SEREX analysis to generate pKCCMVPNPOflag. PNPO (Roche). The resulting PCR product was cleaned by Qiagen flag was cloned by PCR attaching the Flagtag to the 3' end of PCR Purification kit, digested with BspE1 and then ligated 25 the gene using the forward primers (5'-gcctacccacaggagatticc) into a parental lentivirus plasmid vector pKCCMV p53 flag (SEQID NO. 20) and the reverse primer (5'-gtaatctecggaag which was previously digested with SmaI and BspE 1. To gtgcaagtcticteataga) (SEQID NO.: 21) using a SEREX iden generate the full length FLNB Flag tag vector, the following tified PNPO clone ass DNA PCR template. The PCR product fragments were ligated together: the Agel to Sal fragment was cleaned by Qiagen PCR purification kit, digested with from pKCCMVGFP, the BspE1 to Bcll fragment from the 30 Apal and BspE1, and ligated into identical sites in the paren Invitrogen FLNB clone CSODKOO1YE14, and the Bcll to tal vector pKCCMV p53 flagdR 1. The vector construct called Sall fragment from the FLNB intermediate described above. pKCCMVPNPOflag was then sequence verified. The vector construct called pKCCMVFLNBflag was fully Flag-tagged PNPO was produced in mammalian cells and sequenced. purified using affinity purification. In brief, twenty-four hours To express FLNB, Flag-tagged FLNB was produced in 35 before transfection, 10 75 cm plates were seeded with mammalian cells and purified using affinity purification. In 5x10e6 cells/plate HEK293 cells. Twenty-four hours later, brief, twenty-four hours before transfection, 1075 cm plates cells were transfected with 10 g/plate of pKCCMVPN were seeded with 5x10° cells/plate HEK293 cells. Twenty POflag using a calcium phosphate transfection kit (Clontech). four hours later, cells were transfected with 10 g/plate of Three days post-transfection cells were lysed with cell lysis pKCCMVFLNBflag using a calcium phosphate transfection 40 buffer (+protease inhibitors) and PNPO protein purified using kit (Clontech). Three days post-transfection cells were lysed Anti-Flag M2 affinity columns (Sigma) according to manu with cell lysis buffer (+protease inhibitors) and FLNB protein facturing instructions. purified using Anti-Flag M2 affinity columns (Sigma) For western analysis of patients antibodies to PNPO, 150 according to manufacturing instructions. ng of purified PNPO was separated on a Tris-Glycine gel For western blot analysis of patients antibodies to filamin 45 (Invitrogen) under reducing conditions and transferred to a B, 150 ng of purified filamin B was separated on a Tris nitrocellulose membrane. Blots were then blocked overnight Glycine gel (Invitrogen) under reducing conditions and trans with 3% nonfat dry milk in TBS and incubated with a 1:500 ferred to a nitrocellulose membrane. Blots were then blocked dilution of patients serum post-therapy for 3 hours. Blots overnight with 3% nonfat dry milk in TBS and incubated with were then washed in TBST and incubated with an IgG/IgM a 1:500 dilution of patients serum post-therapy for 3 hours. 50 specific donkey anti-human secondary antibody conjugated Blots were then washed in TBST and incubated with an to horseradish peroxidase for an hour and a half. Following IgG/IgM specific donkey anti-human secondary antibody TBST washes immunoreactive bands were visualized by conjugated to horseradish peroxidase for an hour and a half exposure of photographic film (Kodak) after the blots were Following TBST washes immunoreactive bands were visual treated with the ECL enhanced chemiluminescence system ized by exposure of photographic film (Kodak) after the blots 55 (Pierce). In samples from Patients 1, 2, 3, and 5, an immu were treated with the ECL enhanced chemiluminescence sys noreactive band at 30 kDa running at the predicted molecular tem (Pierce). Patients 1, 3, 4, and 5 an immunoreactive band weight of PNPO could be observed in the post-therapy serum at 280 kDa running at the predicted molecular weight could samples. Immunoreactivity was absent in pre-therapy be observed in the post-therapy serum samples, while immu samples. noreactivity was absent in pre-therapy samples. 60 96 well plates were coated with 250 ng/well of purified Patient antibodies to FLNB were also monitored in an PNPO overnight in bicarbonate buffer (coating buffer). The ELISA. To do so, 96 well plates were coated with 250 ng/well next day, wells were washed with PBST and then blocked of purified FLNB overnight in bicarbonate buffer (coating using 1% BSA in PBST for 3 hours at room temperature. buffer). Next day, wells were washed with PBST and then Following blocking, wells were washed in PBST and serum blocked using 1% BSA in PBST for 3 hours at room tempera 65 added at a range of concentrations (1:100-10,000) diluted in ture. Following blocking, wells were washed in PBST and PBST+1% BSA. One and half hours post-serum addition, serum added at a range of concentrations (1:100-10,000) plates were washed and then incubated with a Donkey-anti US 8,840,881 B2 49 50 Human IgG IgMHRP-conjugated secondary antibody (Jack room temperature. Following blocking, wells were washed in son) diluted at 1:10,000 in PBST for 1 hour at room tempera PBST and serum added at a range of concentrations (1:100 ture. Plates were then washed and bound secondary antibody 10,000) diluted in PBST+1% BSA. One and half hours post detected using TBM (KPL). Plates were then read at 450 nm. serum addition, plates were washed and then incubated with To determine induction of an PNPO antibody response, the a Donkey-anti Human IgG IgM HRP-conjugated secondary post-therapy O.D. value was divided by the pre-therapy O.D. antibody (Jackson) diluted at 1:10,000 in PBST for 1 hour at to determine a fold induction. Fold induction levels.>2 were room temperature. Plates were then washed and bound sec considered significant. In patients 1, 2, 3 and 5, a significant ondary antibody detected using TBM (KPL). Plates were then fold increase in O.D. could be observed by the post/pre ratio. read at 450 nm. To determine induction of a NSFL 1C anti In comparison, IgG/IgM antibodies to tetanus toxoid, a pro 10 tein against which the majority of the population has been body response, the post-therapy O.D. value was divided by actively vaccinated, were unchanged (prefpost ration<2) fol the pre-therapy O.D. to determine a fold induction. Fold lowing treatment. This indicates that the increase in titer was induction levels 2 were considered significant. In patients 1, PNPO specific. Results indicating patient antibody genera 3 and 4, a significant fold increase in O.D. to NSFL1C could tion to PNPO following therapy agreed for western blot and 15 be observed by the post/pre ratio. In comparison IgG/IgM ELISA analysis (i.e., patients 1, 2, 3 and 5 were positive for antibodies to tetanus toxoid, a protein to which the majority of both assays). the population has been actively vaccinated to, was 6.1.3.3. Cloning, Protein Production and Antibody unchanged (prefpost ration<2) following treatment indicat Response to NSFL1C ing the increase in titer is NSFL1C specific. Results indicat NSFL1C was cloned with a C-terminus Flag tag into a ing patient antibody generation to NSFL1C following treat lentivirus vector, using a NSFL1C clone identified from ment agree for western blot and ELISA analysis (i.e., patients SEREX analysis to generate pKCCMVNSFL1Cflag. 1, 3 and 4 were positive for both ELISA and western analy pKCCMVNSFL1Cflag was cloned by PCR attaching the sis). Flag tag to the 3' end of the NSFL1C gene and an ATG start 6.1.4. Expression Levels of Genes codonto the 5' end of the gene. To generate this PCR product, 25 The role of some of the high-frequency hits in prostate the forward primer (5'-ggg.cccgaatticatggcggcggagcga cancer progression through examining RNA expression lev caggaggcgctg) (SEQ ID NO.: 22) and the reverse primer els has been preliminarily examined. For example, FIGS. 1 (5'-gtaatctecggatgttaaccgctgcacgatga) (SEQ ID NO. 23) and 2 present the expression patterns of PNPO and FLNB, were used with the SEREX identified clone of NSFL 1C as the respectively, with increasing prostate cancer disease grade DNA PCR template and High Fidelity Expand PCR kit. The 30 derived from the Oncomine database (www.oncomine.com). PCR product was cleaned by Qiagen PCR Purification Kit, Expression of both PNPO and FLNB are induced upon pros digested with EcoR1 and BspE1, and ligated into identical tate cancer disease progression, tying in with their potential sites in the parental vector pKCCMV p53 flagdR 1. The result roles as tumor associated antigens. Expression of the closely ing vector construct pKCCMVNSFL 1Cflag was sequenced related family member filamin A (ABP280), is selectively verified. 35 down-regulated with disease progression for comparison Flag-tagged NSFL 1C was produced in mammalian cells (Varambally et al. 2005). and purified using affinity purification. In brief, twenty-four 6.2 Example 2: Defined Prostate Cancer Antigen Screen hours before transfection, 1075 cm plates were seeded with 1ng 5x10e6 cells/plate HEK293 cells. Twenty-four hours later, This example describes the results of experiments cells were transfected with 10 ug/plate of 40 designed to assess humoral immune responses against pros pKCCMVNSFL1Cflag using a calcium phosphate transfec tate cancer antigens. In these experiments, a selection of 20 tion kit (Clontech). Three days post-transfection cells were genes that are associated with prostate cancer and have pre lysed with cell lysis buffer (+protease inhibitors) and viously demonstrated an interaction with the immune NSFL1C protein purified using Anti-Flag M2 affinity col response were selected for evaluation. The genes are set forth umns (Sigma) according to manufacturing instructions. 45 in Table 5, below. This list includes: For western analysis of patients antibodies to NSFL1C, 150 ng of purified NSFL 1C was separated on a Tris-Glycine TABLE 5 gel (Invitrogen) under reducing conditions and transferred to Prostate specific antigen (PSA) a nitrocellulose membrane. Blots were then blocked over Prostate-specific membrane antigen (PSMA) night with 3% nonfat dry milk in TBS and incubated with a 50 Prostatic acid phosphatase (PAP) Prostate stem cell antigen (PSCA) 1:500 dilution of patients serum post-therapy for 3 hours. NY-ESO-1 Blots were then washed in TBST and incubated with an LAGE IgG/IgM specific donkey anti-human secondary antibody Telomerase (hTERT) conjugated to horseradish peroxidase for an hour and a half. 55 Carcinoembryonic antigen (CEA) Following TBST washes immunoreactive bands were visual Her2/neu. ized by exposure of photographic film (Kodak) after the blots C.-methylacyl-CoA racemase (AMACR) were treated with the ECL enhanced chemiluminescence sys Glucose-regulated protein-78 kDa (GRP78) tem (Pierce). In serum from patients 1,3 and 4, an immunore P62 active band at 40 kDa correlating with the expected size of Cyclin-B1 NSFL1C could be observed in the post-therapy serum 60 TARP (T-cell receptor gamma alternate reading frame protein) samples. Immunoreactivity was absent in pre-therapy Filamin B (CGi identified) samples. Prostein ELISAS were also performed to assess immune response Survivin against NSFL1C. To do so. 96 well plates were coated with Prostase, Kallikrein 4 250 ng/well of purified NSFL 1C overnight in bicarbonate 65 buffer (coating buffer). Next day, wells were washed with All of these candidates were cloned into a plasmid expres PBST and then blocked using 1% BSA in PBST for 3 hours at sion system and recombinant proteins expressed using US 8,840,881 B2 51 52 FLAG-tag based immunoaffinity purification. Following pro First, peripheral blood monocytic cells (PBMCs) are iso tein production, patient serum was assessed in both a western lated from a subject to be assessed for cellular immune blot and/or in an ELISA format to immunoscreen candidates response against a filamin-B peptide and CD8+ cells are for antibody reactivity. Screening the patients from a mono isolated by fluorescence activated cell sorting (FACS). The therapy trial, 5 antigens associated with an autoantibody CD8+ cells are then incubated with, e.g., T2 cells loaded with response were identified as set forth in Table 6, below. the filamin-B peptide to be assessed, produced as described above. TABLE 6 Next, the samples are incubated for 12 hours, then 20 ul of Frequency of pre 10 3H-thymidine is added to each well and the sample incubated existing, un-X for an additional 12 hours. Cells are harvested and the plate is Genbank augmented Frequency of accession autoantibody autoantibody read in a beta counter to determine the amount of unincorpo Gene number response induction rated 3H-thymidine. 6.2.1.3 Detecting Activation of Cytotoxic T Lymphocytes Filamin B, beta NM OO1457 Of7 4f7 15 (FLNB) in Effector Assays Prostate-specific NM 004476 1/7 1/7 membrane antigen This example provides an exemplary method for detecting (PSMA) activation of cytotoxic T lymphocytes (CTLs) by monitoring Her2/neu. NM 004448 1/7 Of7 lysis of cells displaying an appropriate antigen, e.g., a fil NY-ESO-1 HSU87459 Of7 1.6 LAGE-1a HSA223O41 Of7 1.6 amin-B peptide presented on an MHC I receptor. The cytotoxic activity of the CTLs is measured in a stan dard 'Cr-release assay. Effector cells (CTLs) are seeded with 6.2.1. Cloning and Characterization of Antigens 'Cr-labeled target cells (5x10 cells/well) at various effec Following identification of proteins correlated with an tor:target cell ratios in 96-well U-bottom microtiter plates. antibody response in serum, antigen targets are further char 25 Plates are incubated for 4 h at 37° C., 5% CO. The 'Cr acterized for cellular immune response (T-cells) using periph release is measured in 100 ul Supernatant using a Beckman eral blood mononuclear cells (PBMCs) harvested from LS6500 liquid scintillation counter (Beckman Coulter, Brea, patients administered cell-based prostate cancer immuno Calif.). The percent specific cell lysis is calculated as (ex therapy. perimental release-spontaneous release)/(maximum 6.2.1.1 Detecting Activation of Cytotoxic T Lymphocytes 30 in IFN-Y Assays release-spontaneous release). Maximum release is obtained This example provides an exemplary method for detecting from detergent-released target cell counts and spontaneous activation of cytotoxic T lymphocytes (CTLs) by monitoring release from target cell counts in the absence of effector cells. IFN-Y expression by the CTLs in response to exposure to an 6.3 Autoantibody Detection Following Therapy Using Pro appropriate antigen, e.g., a filamin-B peptide presented on an 35 tein Microarrays MHC I receptor. In addition to SEREX and defined prostate tumor associ First, peripheral blood monocytic cells (PBMCs) are iso ated antigen screening, a third technique, autoantibody detec lated from a subject to be assessed for cellular immune tion using protein microarrays, was employed to determine response against a filamin-B peptide and CD8+ cells are therapy-related increases in patient antibody titer following isolated by fluorescence activated cell sorting (FACS). The 40 immunotherapy. Protein microarrays are new tools that pro CD8+ cells are then incubated with, e.g., T2 cells loaded with vide investigators with defined protein content for profiling the filamin-B peptide to be assessed, produced as described serum samples to identify autoantigen biomarkers (Casiano above, and in the presence of suitable cytokines for expanding etal. 2006: Bradfordet al. 2006; Qinet al. 2006). Invitrogen's Proto Array(R. Human Protein Microarrays (version 4) contain the CTL population. 45 IFN-Y release by the CTLs is measured using an IFN-y over 8,000 purified human proteins immobilized on glass ELISA kit (PBL-Biomedical Laboratory, Piscataway, N.J.). slides. Probing protein microarrays with serum from pre Briefly, purified IFN-y as standards or culture supernates therapy and post-therapy patient serum samples allows the from the CTL-T2 co-culture are transferred into wells of a identification of immunogenic proteins that are potential anti genS. 96-well plate pre-coated with a monoclonal anti-human 50 IFN-Y capture antibody and incubated for 1 h in a closed 6.3.1. Immune Response Biomarkers Identified by Pro chamber at 24°C. After washing the plate with PBS/0.05% to Array Analysis: Set 1 Tween 20, biotin anti-human IFN-Y antibody is added to the Immune Response Biomarker Profiling was performed by wells and incubated for 1 hat 24°C. The wells are washed and Invitrogen for seven serum samples: Pre-therapy and Post then developed by incubation with streptavidin horseradish 55 therapy serum samples for 3 patients and 1 normal serum peroxidase conjugate and TMB Substrate Solution. Stop solu donor for comparison. The reactivity of serum antibodies tion is added to each well and the absorbance is determined at against proteins on Proto Array(R. Human Protein Microarrays 450 nm with a SpectraMAX Plus plate reader (Stratagene, La was investigated. Comparisons were made across Sera from Jolla, Calif.). The amount of cytokine present in the CTL three individual prostate cancer patients prior to and follow culture supernatants is calculated based on the IFN-Y standard 60 ing treatment. For each patient, a number of proteins were CUV. identified exhibiting elevated signals (pixel intensity) in the 6.2.1.2 Detecting Activation of Cytotoxic T Lymphocytes post-treatment sample relative to the prostate cancer Samples in Proliferation Assays prior to therapy. While a number of markers were unique to This example provides an exemplary method for detecting the individual patients, several candidate autoantigens were activation of cytotoxic T lymphocytes (CTLs) by CTL pro 65 identified that were shared between multiple patients liferation in response to exposure to an appropriate antigen, included in the study. These included the proteins listed e.g., a filamin-B peptide presented on an MHC I receptor. below: US 8,840,881 B2 53 54 TABLE 7 increase in antibody titer, compared to a low signal back ground in the normal serum samples. OTUB2 Protein array analysis indicated 3 out of the 3 patients were ES positive for the protein product Mitogen-activated protein LOCS1240 is kinase kinase kinase 11 (NP 002410) of gene MAP3K11. Neuronatin Patients displayed a 7.7, 1.7 and 3.0-fold increase in antibody CD52 titer, compared to a low signal background in the normal ORM1-likes - serum samples. Mitogen-activated protein kinase kinase kinase 11 Protein array analysis indicated 3 out of the 3 patients were UBX domain containing 8 positive for the protein product UBX domain containing 8 (NP 055428) of gene UBXD8. Patients displayed a 5.9, 2.5 Protein array analysis indicated 2 of the 3 patients were and 2.3-fold increase in antibody titer for 1 clone and 3.0, 1.8 positive for the protein OTUB2 (Swiss-prot Q96DC9). and 1.6-fold increase for another clone, compared to a low Patients displayed a 14.1 and 7.7-fold increase in titer, com- signal background in the normal E. "Ein d b pared to a low signal background- 0 in normal serum samples. to Array6.3.2. Analysis:Immune SetResponse 2 Biomarkers Identified by Pro Protein array analysis indicated 3 out of the 3 patients were I R B ker Profili rf db positiveitive for theleproteinp protein product derived from FLJ14668 (NP Invitrogenmmune for Kesponse Pre-GVAX 131omarker and Post-GVAX Prouling serumwas performed samples forby 11621 1). Patients displayed a 36.2, 5.2 and 77-fold 1CaS 10 patients (8 patients from G-0010 and 2 from G-9803, in titer, compared to a low signal background in the normal described below). Patients were selected for Proto Array serum samples. 20 analysis based upon their improved clinical outcome when Protein array analysis indicated 3 out of the 3 patients were comparing predicted Survival (Halabi nomogram) to actual positive for the protein product of gene HIGD2A (NP (Table 8). 620175). Patients displayed a 3.5, 2.2 and 2.1-fold increase in antibody titer, compared to a low signal background in the TABLE 8 normal serum samples. 25 Protein array analysis indicated 3 out of the 3 patients were GVAX Patient Halabi Actual Survival increase positive for the protein product of gene LOC51240 (NP Study i SCOe survival (Actual - Halabi) 054901). Patients displayed a 5.2, 4.7 and 6.4-fold increase in G-0010 451 14 47.9 33.9 antibody titer, compared to a low signal background in the G-0010 57 15 44.9 29.9- 1 1 30 G-0010 2O2 21 52.2+ 31.2+ normal serum samples. G-0010 101 25 43.9- 18.9- Protein array analysis indicated 3 out of the 3 patients were G-0010 355 24 35.5- 11.5- positive for the protein product of gene Neuronatin (NP G-OO10 306 18 36.2+ 18.2+ 005377 (isoform A/NP 859017 (isoform B)). Patients dis- G-0010 205 24 48.3+ 24.3+ playedlaved a 8.0.2.3S.U. 2.5 and 2.6-foldi2.0-Iola increase in antibody uter.comtit G-0010G-98O3 268804 2122 41.5-38.5 20.5-16.5 pared to a low signal background in the normal serum 35 G-98O3 304 19 42 23 samples Protein array analysis indicated 3 out of the 3 patients were +indicates that actual survival has not yet been reached positive for the protein product of gene CD52(NP 001794). Comparisons were made across Sera from 10 individual Patients displayed a 4.1, 2.4 and 3.1-fold increase in antibody GVAX patients, and results were compared using M-Statis titer, compared to a low signal background in the normal 40 tics to determine the differential signals between pre and serum samples. post-GVAX populations that result in a significant P-value. Protein array analysis indicated 3 out of the 3 patients were Proteins that exhibited a significant increase in antibody titer positive for the protein product ORM1-like 3 (NP 644809) (p=<0.05), as determined by Proto Array, are displayed in of gene ORMDL3. Patients displayed a 5.6, 1.7 and 2.5-fold Table 9. TABLE 9 Pre- Post GVAX GVAX Pre-GVAX Post-GVAX Protein Description Database ID Count Count Prevalence Prevalence P-Value lectin, galactoside- BCO15818.1 O 9 8.3% 83.3% 5.9SE-OS binding, soluble, 8 (galectin 8) (LGALS8) Cardiolipin - known CARDIOLIPIN 1 9 16.7% 83.3% S.47E-04 Autoantigen UBX domain containing 8 BCO14001.1 O 7 8.3% 66.7%. 1.SSE-O3 (UBXD8) CD52 molecule NM OO1803.1 O 7 8.3% 66.7%. 1.SSE-O3 ORM1-like 1 NM 016467.1 1 10 16.7% 91.7%. 1.SSE-03 (S. cerevisiae) (ORMDL1) neuronatin (NNAT) NM 181689.1 2 9 25% 83.3% 2.74E-03 TCRgamma alternate NM OO1 003799.1 3 10 33.3% 91.7% S.42E-03 reading frame protein (TARP), nuclear gene encoding mitochondrial protein HIG1 domain family, NM 138820.1 3 10 33.3% 91.7% S.42E-03 member 2A (HIGD2A) serine incorporator 2 BCO 17085.1 O 6 8.3% 58.3% S.42E-03 (SERINC2) US 8,840,881 B2 55 56 TABLE 9-continued Pre- Post GVAX GVAX Pre-GVAX Post-GVAX Protein Description Database ID Count Count Prevalence Prevalence P-Value signal sequence receptor, NM 007107.2 O 6 8.3% 58.3% S.42E-03 gamma (translocon associated protein gamma) (SSR3) UBX domain containing NM 014613.1 O 6 8.3% 58.3% S.42E-03 8 (UBXD8) ORM1-like 3 NM 13928.0.1 1 7 16.7% 66.7% 9.88E-03 (S. cerevisiae) (ORMDL3) ribosomal protein S6 PV3846 1 7 16.7% 66.7% 9.88E-03 kinase, 90 kDa, polypeptide 2 (RPS6KA2) lectin, galactoside- BCOO1120.1 4 10 41.7% 91.7% .63E-O2 binding, soluble, 3 (LGALS3) selenoprotein S (SELS) BCOOS840.2 O 5 8.3% SO% .63E-O2 lectin, galactoside- BCO16486.1 O 5 8.3% SO% .63E-O2 binding, soluble, 8 (galectin 8) (LGALS8) chromosome 14 open BCO21701.1 O 5 8.3% SO% .63E-O2 reading frame 147 similar to CG10671-like BCO42179.1 O 5 8.3% SO% .63E-O2 (LOC161247) lectin, galactoside- BCOS3667.1 4 10 41.7% 91.7% .63E-O2 binding, soluble, 3 (LGALS3) caveolin 3 (CAV3) NM 001234.3 O 5 8.3% SO% .63E-O2 cytochrome b-561 domain NM 007022.1 O 5 8.3% SO% .63E-O2 containing 2 (CYB561D2) ORM1-like 2 NM 01418.2.2 O 5 8.3% SO% .63E-O2 (S. cerevisiae) (ORMDL2) signal peptidase complex BCOOO884.1 1 6 16.7% 58.3% 2.86E-O2 Subunit 1 homolog (S. cerevisiae) (SPCS1) hypothetical protein BCO14975.1 1 6 16.7% 58.3% 2.86E-O2 FLJ14668 chromosome 21 open BCO15596.1 1 6 16.7% 58.3% 2.86E-O2 reading frame 51 (C21orf51) kelch domain containing NM 1384.33.2 O 6 8.3% 58.3% 2.86E-O2 7B (KLHDC7B) presenilin enhancer 2 NM 172341.1 1 6 16.7% 58.3% 2.86E-O2 homolog (C. elegans) (PSENEN) Stearoyl-CoA desaturase BCOOS807.2 3 8 33.3% 75% 3.49E-O2 (delta-9-desaturase) (SCD) interferon regulatory BCO158O3.1 O 4 8.3% 41.7% 4.33E-O2 factor 2 (IRF2) TNF receptor-associated BCO18950.2 O 4 8.3% 41.7% 4.33E-O2 protein 1 (TRAP1) N-glycanase 1 (NGLY1) NM 018297.2 O 4 8.3% 41.7% 4.33E-O2 Derl-like domain family, NM O24295.1 O 4 8.3% 41.7% 4.33E-O2 member 1 (DERL1) hippocampus abundant NM 032318.1 O 4 8.3% 41.7% 4.33E-O2 gene transcript-like 2 (HLATL2) bridging integrator 1 NM 139348.1 O 4 8.3% 41.7% 4.33E-O2 (BIN1) similar to RIKEN cDNA XM 096472.2 O 4 8.3% 41.7% 4.33E-O2 17OOO2911S (LOC 143678) 6.4 Association of SEREX and Protoarray Antigen static patients. Patients in the PSA-only group had increasing Responses with Clinical Response in G-9803 and G-0010 PSA levels but negative bone scan. Patients in the metastatic GVAX Immunotherapy Trials for Prostate Cancer 60 group had overt metastatic disease (positive bone scan, bidi G-9803 (n=55 patients) and G-0010 (n=80 patients) are mensionally measurable disease, or both). All patients Phase IIGVAX immunotherapy trials in chemotherapy-naive received a priming dose of 500x10° (250x10 cells from each patients with hormone-refractory prostate cancer (HRPC; of PC3 and LNCaP cell lines). Patients in the PSA-only group FIGS. 3A and 3B). and the first 24 patients in the metastatic group received the The G-9803 study (FIG. 3A) included 2 different HRPC 65 low dose (LD) boost of 100 million cells (50 million of each patient populations and 2 dose levels. In relation to HRPC cell line). Since no dose limiting toxicities were seen at this patient populations, G-9803 enrolled PSA-rising and meta dose level, a high dose (HD) of 300x10 cells (150x10° of US 8,840,881 B2 57 58 each cell line) was given to 10 additional patients in the gel (Invitrogen) under reducing conditions and transferred to metastatic group. Each cell type was injected intradermally in a nitrocellulose membrane. Blots were then blocked over opposite limbs every 2 weeks for 6 months. night with 3% nonfat dry milk in TBS and incubated with a The G-0010 study enrolled metastatic HRPC patients only 1:500 dilution of G-0010 patients (n=65) serum post-GVAX (FIG.3B). The G-0010 study included 4 dose levels: therapy for 3 hours. Blots were then washed in TBST and Dose Level 1: Each vaccination consisted of 2 intradermal incubated with an IgG/IgM specific donkey anti-human sec injections of PC-3 cells to deliver a total of 50x10 cells, ondary antibody conjugated to horseradish peroxidase for an and 2 intradermal injections of LNCaP cells to deliver hour and a half. Following TBST washes immunoreactive 50x10 cells, for a total of 100x10 cells per dose. bands were visualized by exposure of photographic film Dose Level 2: Each vaccination consisted of 3 intradeinial 10 (Kodak) after the blots were treated with the ECL enhanced injections of PC-3 cells to deliver a total of 100x10° chemiluminescence system (Pierce). As shown in FIG. 4B, in cells, and 3 intradermal injections of LNCaP cells to patients 104,302,307 and 437 an immunoreactive band at 45 deliver 100x10 cells, for a total of 200x10 cells per kDa running at the predicted molecular weight of HLA dose. A24Flag could be observed in the post-GVAX serum Dose Level 3: Each vaccination consisted of up to 6 intra 15 samples. Immunoreactivity to additional HLA-A alleles (pro dermal injections of PC-3 cells to deliver 150x10 cells, duced as for HLA-A24) present in the GVAX immunotherapy and up to 6 intradermal injections of LNCaP cells to for prostate cancer (HLA-A1 and A2) was only observed in 1 deliver 150x10 cells, for a total of 300x10 cells per patient of 65 tested, patient 437. Immunostaining with an dose. HRP-linked anti-FLAG monoclonal antibody demonstrates Dose Level 4: The prime vaccination consisted of up to 10 equal loading of all HLA-A proteins. Immunoreactivity was intradermal injections of PC-3 cells to deliver 250x10 absent in pre-GVAX therapy samples (data not shown). cells, and up to 10 intradermal injections of LNCaP cells Twenty-five HRPC patients who received a full course (9 to deliver 250x10 cells, for a total of 500x10 cells per cycles) of Docetaxel (taxotere) chemotherapy were also dose. The boost vaccinations consisted of up to 6 intra evaluated for HLA-A24 immunoreactivity over the course of dermal injections of PC-3 cells to deliver 150x10 cells, 25 treatment (pre- and post-taxotere) by western blot analysis. and up to 6 intradermal injections of LNCaP cells to No patient induced a response over the course of therapy deliver 150x10 cells, for a total of 300x10 cells per indicating the specificity of HLA-A24 antibody induction to dose. GVAX immunotherapy for prostate cancer treated patients. The association between the induction of SEREX and Pro 6.4.1.4 Association of HLA-A24 Immune Response and to Array identified antibodies with G98-03 and G-0010 30 Survival patient Survival using Kaplan-Meyer endpoint analysis was The association of HLA-A24 Ab response with survival determined. As means of example, results for HLA-A24, was examined in the patients from the phase2G-0010 GVAX OTUB2, FLJ14668, NNAT and Cardiolipin are presented. immunotherapy for prostate cancer trial. Patients were scored 6.4.1. Association of HLA-A24 Ab Response to Survival in HLA-A24 antibody positive or negative dependent on west GVAX-treated prostate patients from the G-0010 trial 35 ern blot immunoreactivity and the potential association with 6.4.1.1 Cloning Strategy for HLA-A24 Survival analyzed using the Cox regression model, adjusted HLA-A24 was cloned with a C-terminus Flag tag into a for prognostic factors and dose group (FIG. 4C). Data from all lentivirus plasmid vector, using a purchased HLA-A2402 evaluable G-0010 pts demonstrate that induction of Ab to the plasmid clone (International Histocompatability Working PC-3-derived HLA-A24 is associated with survival. Among Group) to generate pKCCMVHLA-A24Flag (FIG. 4A). 40 HLA-A24 haplotype negative pts, the HLA-A24 Ab-positive Briefly, HLA-A2402Flag was cloned by PCR attaching the pts (n=30) had a median survival of 43 m vs. 18 m in Ab Flag tag to the 3' end of the gene using the forward primers negative pts (n=28), HR=0.53, p=0.04. Indicating a 47% (5'-atatggatccatgg.ccgtcatgg.cgccccg) (SEQ ID NO. 24) and reduction in hazard rate (HR) in those patients with HLA the reverse primer (5'-aatctecggacactttacaagctgtgagag) (SEQ A24 antibodies compared to those without antibodies, after ID NO. 25) using the HLA-A2402 plasmid clone ass DNA 45 controlling for the Halabi predicted survival. PCR template. The PCR product was cleaned by Roche gel 6.4.2. Association of OTUB2 Ab Response to Survival in extraction kit, digested with BamHI and BspE1, and ligated HRPC Patients Treated with GVAX Immunotherapy for Pros into identical sites in the parental vector pKCCMVNYESO1 tate Cancer flag. The vector construct called pKCCMVHLA-A2402Flag Employing an ELISA based-assay for determining anti has been sequenced verified. SEQID NOS. 26 and 27 repre 50 body titers, patients from G-9803 and G-0010 were evaluated sent the HLA-A2402Flag amino acid and nucleotide for OTUB2 antibody titer induction post-GVAX immuno sequence, respectively. therapy. Purified OTUB2 protein (200 ng) was coated onto an 6.4.1.2 HLA-A2402Flag Protein Production ELISA plate and blocked with Superblockbuffer for 2 hours. Flag-tagged HLA-A24 was produced in mammalian cells Patient serum both pre and post-GVAX immunotherapy was and purified using affinity purification. In brief, twenty-four 55 then added to the plates for 3 hours at room temperature. hours before transfection, 1075 cm plates were seeded with Following incubation, bound antibody was detected using a 5x10e6 cells/plate HEK293 cells. Twenty-four hours later, Donkey anti-human IgG-HRP conjugate secondary antibody cells were transfected with 10 ug/plate of pKCCMVHLA at 1:10,000 dilution. Induced antibody titers to OTUB2 were A2402Flag using a calcium phosphate transfection kit (Clon determined by dividing the well O.D. of the post-GVAX tech). Three days post-transfection cells were lysed with cell 60 sample with the pre-GVAXO.D. to provide a fold-induction. lysis buffer (+protease inhibitors) and HLA-A2402Flag pro Patients with a fold induction-2 fold, were considered posi tein purified using Anti-Flag M2 affinity columns (Sigma) tive for the survival analysis. An example of OTUB2 antibody according to manufacturing instructions. induction in G-0010 patients is shown in FIG. 5A. Survival of 6.4.1.3 Analysis of GVAX-Treated Patient Antibodies to those patients with induced Ab responses to OTUB2 were HLA-A24 Using Western Blot 65 then compared to OTUB2 negative patients in G-0010 and For western analysis of patients antibodies to HLA-A24, G-9803. A survival advantage was observed in both trials. A 200ng of purified HLA-A24 was separated on a Tris-Glycine representative survival analysis is shown in G-9803 PSA US 8,840,881 B2 59 60 rising HRPC patients. As shown in FIG. 5B, induction of adjusted for prognostic factors and dose group (FIG. 6D). antibodies to OTUB2 is associated with a 26.7 months longer Data from all evaluable G-0010 pts demonstrate that induc survival in G-9803 patients. The correlation with survival in tion of Ab to the FLJ14668 is significantly associated with the PSA-rising population of G-9803 is also statistically sig survival. Patients with an induction of antibody response to nificant (p=0.0266). 5 FLJ14668 protein (n=34) had a median survival of 43 m vs. 6.4.3. Association of FLJ14668 Ab Response to Survival in 21 m in antibody negative pts (n=31), p=0.002. GVAX-Treated Prostate Patients from the G-0010 Trial The patients with FLJ14668 antibody had 66% reduction 6.4.3.1 Cloning Strategy for FLJ14668 in hazard rate (HR), compared to those patients antibody FLJ14668 was cloned with a C-terminus Flag tag into a negative. Patient survival in FLJ14668 antibody positive and lentivirus plasmid vector, using a purchased synthetically 10 constructed FLJ14468Flag plasmid clone (GeneArt) to gen negative arms was also compared to predicted Survival (as erate pKCCMV-FLJ14668Flag (FIG. 6A). Briefly, the determined by the Halabinomogram) in G-0010 by dose level FLJ14668Flag transgene was excised from the parental plas (FIG. 6E). Results indicate that in all 3 G-0010 dose groups mid using EcoRI and Sal restriction enzymes and ligated into that Survival was significantly increased over predicted in identical sites in the parental vector pKCCMV p53flagdR 1. 15 FLJ14668 seroconverters compared to those patients were an The resulting vector construct, pKCCMV-FLJ14668Flag, increase in FLJ14668 tilter was not observed. Furthermore, was sequenced verified. SEQ ID NOS. 28 and 29 represent the proportion of patients FLJ14668 antibody positive was the FLJ14668Flag amino acid and nucleotide sequence, dose-responsive comparing low, mid and high G-0010 dose respectively. groups (FIG. 6F). 6.4.3.2 FLJ14668Flag Protein Production 6.4.4. Association of Neuronatin (NNAT) Ab Response to Flag-tagged FLJ14668 was produced in mammalian cells Survival in GVAX-Treated Prostate Patients from the G-0010 and purified using affinity purification. In brief, twenty-four Trial hours before transfection, 1075 cm plates were seeded with 6.4.4.1 Cloning Strategy for NNAT 5x10e6 cells/plate HEK293 cells. Twenty-four hours later, NNAT was cloned with a C-terminus Flag tag into a len cells were transfected with 10 ug/plate of pKCCMV 25 tivirus plasmid vector, using a purchased synthetically con FLJ14668Flag using a calcium phosphate transfection kit structed NNATFlag plasmid clone (GeneArt) to generate (Clontech). Three days post-transfection cells were lysed pKCCMV-NNATFlag (FIG. 7A). Briefly, the NNATFlag with cell lysis buffer (+protease inhibitors) and transgene was excised from the parental plasmid using EcoRI FLJ14668Flag protein purified using Anti-Flag M2 affinity and Sal restriction enzymes and ligated into identical sites in columns (Sigma) according to manufacturing instructions. 30 the parental vector pKCCMV p53 flagdR1. The resulting vec 6.4.3.3 Analysis of GVAX-Treated Patient Antibodies to FLJ14668. Using ELISA tor construct, pKCCMV-NNATFlag, was sequenced verified. 96 well plates were coated with 250 ng/well of purified SEQID NOS.30 and 31 represent the NNATFlag amino acid FLJ14668 overnight in bicarbonate buffer (coating buffer). and nucleotide sequence, respectively. Next day, wells were washed with PBST and then blocked 35 6.4.4.2 NNATFlag Protein Production using 1% BSA in PBST for 3 hours at room temperature. Flag-tagged NNAT was produced in mammalian cells and Following blocking, wells were washed in PBST and serum purified using affinity purification. In brief, twenty-four hours added at a 1:100 dilution in PBST+1% BSA. One and half before transfection, 10 75 cm plates were seeded with hours post-serum addition, plates were washed and then incu 5x10e6 cells/plate HEK293 cells. Twenty-four hours later, bated with a Donkey-anti Human IgG IgM HRP-conjugated 40 cells were transfected with 10 g/plate of pKCCMV-NNAT secondary antibody (Jackson) diluted at 1:10,000 in PBST for Flag using a calcium phosphate transfection kit (Clontech). 1 hour at room temperature. Plates were then washed and Three days post-transfection cells were lysed with cell lysis bound secondary antibody detected using TBM (KPL). Plates buffer (+protease inhibitors) and NNATFlag protein purified were then read at 450 nm. To determine induction of an using Anti-Flag M2 affinity columns (Sigma) according to FLJ14668 antibody response, the post-GVAXO.D value was 45 manufacturing instructions. divided by the pre-GVAXO.D to determine a fold induction 6.4.4.3 Analysis of GVAX-Treated Patient Antibodies to (FIG. 6B). Fold induction levels 2 were considered signifi NNAT Using ELISA cant (as determined by normal controls). In comparison IgG/ 96 well plates were coated with 400 ng/well of purified IgM antibodies to tetanus toxoid, a protein to which the NNAT overnight in bicarbonate buffer (coating buffer). Next majority of the population has been actively vaccinated to, 50 day, wells were washed with PBST and then blocked using was unchanged (pre?post ration<2) following GVAX-treat 1% BSA in PBST for 3 hours at room temperature. Following ment indicating the increase in titer specific to FLJ14668 blocking, wells were washed in PBST and serum added at a (FIG. 6C). Twenty-five HRPC patients who received a full 1:100 dilution in PBST+1% BSA. One and half hours post course (9 cycles) of Docetaxel (taxotere) chemotherapy were serum addition, plates were washed and then incubated with also evaluated for FLJ14668 immunoreactivity over the 55 a Donkey-anti Human IgG IgM HRP-conjugated secondary course of treatment (pre- and post-taxotere) by ELISA. No antibody (Jackson) diluted at 1:10,000 in PBST for 1 hour at patient induced a response over the course of therapy indicat room temperature. Plates were then washed and bound sec ing the specificity of FLJ14668 antibody induction to GVAX ondary antibody detected using TBM (KPL). Plates were then immunotherapy for prostate cancer treated patients. read at 450 nm. To determine induction of an NNAT antibody 6.4.3.4. Association of FLJ14668Flag Immune Response 60 response, the post-GVAXO.D value was divided by the pre and Survival in G-0010 GVAX O.D to determine a fold induction (FIG. 7B). Fold The association of FLJ14668 Ab response with survival induction levels 2 were considered significant (as deter was examined in the patients from the phase 2 G-0010 GVAX mined by normal controls). Twenty-five HRPC patients who immunotherapy for prostate cancer trial. Patients were scored received a full course (9 cycles) of Docetaxel (taxotere) che FLJ14668 antibody positive or negative dependent on a fold 65 motherapy were also evaluated for NNAT immunoreactivity induction of antibody titers-2 fold and the potential associa over the course of treatment (pre- and post-taxotere) by tion with Survival analyzed using the Cox regression model, ELISA. No patient induced a response over the course of US 8,840,881 B2 61 62 therapy indicating the specificity of NNAT antibody induc SELS antibody positive or negative dependent on a fold tion to GVAX immunotherapy for prostate cancer treated induction of antibody titers-2 fold and the potential associa patients. tion with Survival analyzed using the Cox regression model, 6.4.4.4 Association of NNATFlag Immune Response and adjusted for prognostic factors and dose group (FIG. 14). Survival in G-0010 Data from all evaluable G-0010 pts demonstrate that induc The association of NNAT Ab response with survival was tion of Ab to the SELS is significantly associated with sur examined in the patients from the phase 2 G-0010 GVAX vival. Patients with an induction of antibody response to immunotherapy for prostate cancer trial. Patients were scored SELS protein (n=14) had a median survival of 51.9 m vs. 26.1 NNAT antibody positive or negative dependent on a fold m in antibody negative pts (n=~55), p=0.0273. induction of antibody titers-2 fold and the potential associa 10 6.4.7. Antibody Response to HIGD2A in GVAX-Treated tion with Survival analyzed using the Cox regression model, Prostate Patients from the G-0010 Trial adjusted for prognostic factors and dose group (FIG. 7C). 6.4.7.1 Association of HIGD2A Immune Response and Data from all evaluable G-0010 pts demonstrate that induc Survival in G-0010 tion of Ab to the NNAT is significantly associated with sur The association of HIGD2AAb response with survival was vival. Patients with an induction of antibody response to 15 examined in the patients from the phase 2 G-0010 GVAX NNAT protein (n=48) had a median survival of 34m vs. 10 m immunotherapy for prostate cancer trial. Patients were scored in antibody negative pts (n=17), p=<0.001. HIGD2A antibody positive or negative dependent on a fold The patients with NNAT antibody had 69% reduction in induction of antibody titers-2 fold and the potential associa hazard rate (HR), compared to those patients antibody nega tion with Survival analyzed using the Cox regression model, tive. adjusted for prognostic factors and dose group (FIG. 15). 6.4.5. Antibody Response to Cardiolipin in GVAX-Treated Data from all evaluable G-0010 pts demonstrate that induc Prostate Patients from the G-0010 Trial tion of Ab to the HIGD2A is significantly associated with 6.4.5.1 Analysis of GVAX-Treated Patient Antibodies to survival. Patients with an induction of antibody response to Cardiolipin Using ELISA HIGD2A protein (n=39) had a median survival of 32 m vs. The induction of antibodies to cardiolipin were evaluated 25 14.05 m in antibody negative pts (n=20), p=0.0179. using a commercial kit (BioOuant). Briefly, patients serum 6.4.8. Antibody Response to SSR3 in GVAX-Treated Pros diluted at 1:100 in PBST was added to wells coated with tate Patients from the G-0010 Trial purified cardiolipin antigen. One and half hours post-serum 6.4.8.1 Association of SSR3 Immune Response and Sur addition, plates were washed 3xPBST and then incubated vival in G-0010 with enzyme-conjugated secondary antibody for 1 hour at 30 The association of SSR3Ab response with survival was room temperature. Plates were then washed and bound sec examined in the patients from the phase 2 G-0010 GVAX ondary antibody detected using TBM. Plates were then read immunotherapy for prostate cancertrial. Patients were scored at 450 nm. To determine induction of an cardiolipin antibody SSR3 antibody positive or negative dependent on a fold response, the post-GVAXO.D value was divided by the pre induction of antibody titers-2 fold and the potential associa GVAX O.D to determine a fold induction (FIG. 8A). Fold 35 tion with Survival analyzed using the Cox regression model, induction levels 2 were considered significant (as deter adjusted for prognostic factors and dose group (FIG. 16). mined by normal controls). Twenty-five HRPC patients who Data from all evaluable G-0010 pts demonstrate that induc received a full course (9 cycles) of Docetaxel (taxotere) che tion of Ab to the SSR3 is significantly associated with sur motherapy were also evaluated for an increase in Cardiolipin vival. Patients with an induction of antibody response to antibody titer over the course of treatment (pre- and post 40 SSR3 protein (n=34) had a median survival of 43.5 m vs. 19.4 taxotere) by ELISA. No patient induced a response over the m in antibody negative pts (n=28), p=0.0043. course of therapy indicating the specificity of Cardiolipin 6.4.9. Antibody Response to NRP2 in GVAX-Treated antibody induction to GVAX immunotherapy for prostate Prostate Patients from the G-0010 Trial cancer treated patients. 6.4.9.1 Association of NRP2 Immune Response and Sur 6.4.5.2 Association of NNATFlag Immune Response and 45 vival in G-0010 Survival in G-0010 The association of NRP2 Ab response with survival was The association of Cardiolipin Ab response with survival examined in the patients from the phase 2 G-0010 GVAX was examined in the patients from the phase 2 G-0010 GVAX immunotherapy for prostate cancer trial. Patients were scored immunotherapy for prostate cancer trial. Patients were scored NRP2 antibody positive or negative dependent on a fold Cardiolipin antibody positive or negative dependent on a fold 50 induction of antibody titers-2 fold and the potential associa induction of antibody titers-2 fold and the potential associa tion with Survival analyzed using the Cox regression model, tion with Survival analyzed using the Cox regression model, adjusted for prognostic factors and dose group (FIG. 19). adjusted for prognostic factors and dose group (FIG. 8B). Data from all evaluable G-0010 pts demonstrate that induc Data from all evaluable G-0010 pts demonstrate that induc tion of Ab to the NRP2 is significantly associated with sur tion of Ab to the Cardiolipin is significantly associated with 55 vival. Patients with an induction of antibody response to survival. Patients with an induction of antibody response to NRP2 protein (n=36) had a median survival of 34m vs. 21 m Cardiolipin protein (n=40) had a median survival of 38 m Vs. in antibody negative pts (n=33), p=0.0503. 15 m in antibody negative pts (n=24), p=0.03. The patients 6.4.10. Antibody Response to HLA-A24 and/or FLJ14668 with an increase in Cardiolipin antibody titer had 53% reduc in GVAX-Treated Prostate Patients from the G-0010 Trial tion in hazard rate (HR), compared to those no increase. 60 In addition to single antigen/antibody analysis with Sur 6.4.6. Antibody Response to SELS in GVAX-Treated Pros vival, it is also possible to group antigens together to further tate Patients from the G-0010 Trial define the association of immune response with clinical 6.4.6.1 Association of SELS Immune Response and Sur response. FIG.9 demonstrates the association of being HLA vival in G-0010 A24 and/or FLJ14668 antibody positive with survival in The association of SELS Ab response with survival was 65 G-0010 patients. Patients with an induction of antibody examined in the patients from the phase 2 G-0010 GVAX response to HLA-A24 and/or FLJ14668 (n=41) had a median immunotherapy for prostate cancer trial. Patients were scored survival of 43.5 m vs. 14.2 m in patients negative for antibod US 8,840,881 B2 63 64 ies to both antigens (n=24), p=<0.001. The patients with 6.5 Induction Of Anti-Trp-2 and Gp 100 Immune antibodies to either antigen had a 55% reduction in hazard Responses in a Murine Melanoma Model Using Lentivirus rate (HR), compared to those patients antibody negative for Modified Lewis Lung Carcinoma Cells both antigens. To evaluate whether a cell line can be genetically modified 6.4.11. Antibody Response to NNAT and/or Cardiolipin in 5 to induce an immune response to specific tumor-related anti GVAX-Treated Prostate Patients from the G-0010 Trial gens, preclinical studies were performed in the murine B 16 melanoma model. In this model, treatment with irradiated FIG. 10 demonstrates the association of being NNAT and/ whole melanoma tumor cells genetically modified to secrete or Cardiolipin antibody positive with survival in G-0010 GM-CSF was initially shown to generate specific and long patients. Patients with an induction of antibody response to 10 lasting anti-tumor responses against a B16 tumor challenge. NNAT and/or Cardiolipin (n=50) had a median survival of 32 In these experiments the unrelated cell line, Lewis Lung m vs. 9.8 minpatients negative for antibodies to both antigens Carcinoma (LLC), was modified to secrete GM-CSF and (n=14), p=<0.001. over-express either of the two antigens Trp2 (LLC.G- 6.4.12. Antibody Response to FLJ14668 and/or HLA-A24 MKd.Trp2) or gp100 (LLC.GMKd.gp100) or both (LLC.G- and/or Cardiolipin in GVAX-Treated Prostate Patients from MKd.Trp2/gp100). Trp2 and gp100 each serve as melanoma the G-0010 Trial target antigens that were previously identified to be involved In addition to single and double antibody analysis with in the immune-mediated rejection of B16 murine tumors. Survival, it is also possible to group three antigens together to Lentiviral vectors encoding Trp2 or gp 100 under the control further define the association of immune response with clini of the CMV promoter were constructed according to standard cal response. FIG. 11 demonstrates the association of being molecular techniques. LLC cells were then transduced with FLJ14668 and/or HLA-A24 and/or Cardiolipin antibody lenti-Trp2 and/or gp 100 and cell populations analyzed for positive with survival in G-0010 patients. Patients with an antigen expression (FIG. 20). Analysis of the modified LLC induction of antibody response to FLJ14668 and/or HLA cell lines by FACs and PCR indicate Trp2 and gp100 protein A24 and/or Cardiolipin (n=47) had a median survival of 34.8 25 (FIG. 20A) and RNA expression (FIG.20B). m vs. 11.4 m in patients negative for antibodies to all three The B16 murine model was then used to evaluate the capa antigens (n=19), p=<0.0001. The patients with antibodies to bility of the LLC.GMKd.gp100, and LLC.GMKd.Trp2 cells either antigen had a 68% reduction in hazard rate (HR), to induce an antigens specific immune response. C57BL/6 compared to those patients antibody negative for all three animals were challenged with a lethal dose of 2x1OE5 antigens. 30 B16F10 cells. Three days post-challenge animals were immunized with 3x10E6 allogeneic GM-CSF-secreting 6.4.13. A Combination of HLA-A24 and OTUB2 Antibody B16F10 cells (B16F10.GMKd) as a multivalent antigen Responses Provide a Correlation with Patient Survival Across immunotherapy or with GM-CSF-secreting LLC cells modi Multiple GVAX Immunotherapy for Prostate Cancer Trials fied to over-express either of the two B16-associated antigens (G-0010 and G-9803) 35 Trp2 (LLC.GMKd.Trp2) or gp100 (LLC.GMKdgp100) as Antibody responses to HLA-A24 and OTUB2 were then single B16 antigen-specific immunotherapies. Seven days grouped together, given their correlation with Survival as after immunotherapy, spleens (n=5/group) were removed and single antigens, to observe their ability to predict clinical outcome in G-0010 and G-9803 as a combination. The Sur an ELISPOT assay was performed to evaluate the number of 40 activated, IFN-y secreting T-cells per 1x10E6 splenocytes vival of patients who were OTUB2 and/or HLA-A24 anti body induction positive was compared to those patients nega when stimulated for 24 hours with peptides derived from the tive for both responses. As shown in FIGS. 12A-12C, B16-associated antigens Trp2 or gp100. (FIG. 21). Results induction of antibodies to HLA-A24 and/or OUTB2 is asso demonstrated that in comparison to the control treated mice, ciated with a statistically longer survival time in G-9803 the genetically modified LLC cell lines LLC.GMKd.Trp2 metastatic HRPC patients (18 months increase in MST. 45 and LLC.GMkd.gp100 induced Trp2 and gp100 specific p=0.01.07, FIG. 12A), G-9803 PSA-rising HRPC patients immune responses, respectively. (27.3 months increase in MST, p=0.0103, FIG. 12B) and The ability of modified LLC cells LLC.GMKd.Trp2 and G-0010 metastatic HRPC patients (20.1 months increase in LLC.GMKd.Trp2/gp100 to extend survival was then exam MST, p<0.0001, FIG. 12C). ined in the C57BL/6 B16F10 melanoma model. Animals 50 were immunized on day 0 with 3x10E6 immunotherapy cells 6.4.14. The Induction of HLA-A24, OTUB2 or FLJ14668 and challenged 7 days later with a lethal dose of live B16F10 Immunoreactivity is Dose and Treatment Number Dependent cells. Compared to HBSS injected control mice, unmodified in G-9803 and G-0010 LLC.GMKd cells provided modest protection in the B 16 We examined the impact of GVAX immunotherapy dose tumor model (FIG.22). Anti-tumor protection was increased level in the G-0010 trial with the frequency of antibody 55 further by the use of LLC.GMKd.Trp2 and more significantly responses to HLA-A24, OTUB2 and FLJ14668 (FIG. 13A). with the double antigen expressing LLC.GMKd.Trp2/gp100 For all antigens examined, there was a step wise increase in immunotherapy (p=<0.01) with 90% of animals surviving the percentage of responding patients with increasing dose long-term (70 day post-challenge). level. The average number of treatments received in the anti 6.6 Evaluation of Anti-tumor Efficacy of Immunotherapy body positive versus antibody negative arms of the G-0010 60 with Proliferation Incompetent Tumor Cells that Express study were also compared for HLA-A24, OTUB2 and GM-CSF and a Prostate Tumor-Associated Antigen FLJ14668 (FIG. 13B-13d). On average antibody-negative The following provides exemplary methods for demon patients received 5.93, 5.6, 5.16 treatments for HLA-A24, strating that immunotherapy with cells genetically modified OTUB2 and FLJ14668, respectively. In comparison, patients to express GM-CSF and one or more prostate tumor-associ with an induced antibody response received 9.23, 9.62 and 65 ated antigens, e.g., HLA-A24, FLJ14668, Cardiolipin, 9.44 treatments for HLA-A24, OTUB2 and FLJ14668, NNAT, SELS, HIGD2A, SSR3, NRP2, etc. leads to enhanced respectively (p<0.01 for all antigens). anti-tumor efficacy relative to immunotherapy with cells US 8,840,881 B2 65 66 genetically modified to express GM-CSF or the one or more Bradford T.J. Wang X, Chinnaiyan AM. Cancer immunom prostate tumor-associated antigens alone, as described ics: using autoantibody signatures in the early detection of herein. prostate cancer. Urol Oncol. 2006 May-June; 24(3):237 An autologous, allogeneic or bystander cell line is modi 42 PMID: 16678056. 5 Qin S, Qiu W. Ehrlich J R, Ferdinand AS, Richie J. P. Oleary fied to express a cytokine, e.g., GM-CSF, and one or more MP, Lee ML, Liu BC. Development of a “reverse capture” prostate tumor-associated antigens, e.g., HLA-A24. autoantibody microarray for studies of antigen-autoanti FLJ14668, Cardiolipin, NNAT, SELS, HIGD2A, SSR3, body profiling. Proteomics. 2006 Apr. 5; NRP2, etc., or a murine homolog thereof. The antigens are Wang X, Yu J, Sreekumar A. Varambally S, Shen R. Giacherio cloned into a mammalian based expression vector (e.g., a D, Mehra R, Montie J E, Pienta KJ, Sanda MG, Kantoff P lentiviral expression plasmid) according to standard molecu 10 W. Rubin M A. Wei J. T. Ghosh D, Chinnaiyan A M. lar techniques. The cell line is transduced with expression Autoantibody signatures in prostate cancer. NEngl J. Med. vectors for the one or more antigens and cytokine, if not 2005 Sep. 22:353(12): 1224-35. already transduced with a cytokine expression vector, and Dunphy E. J. McNeel D G. Antigen-specific IgG elicited in analyzed for cytokine and antigen expression using standard subjects with prostate cancer treated with flt3 ligand. J. 15 Immunother. 2005 May-June; 28(3):268-75. techniques in the art, e.g. FACS, western blot, qRT-PCR, etc. McNeel DG, Nguyen LD,Storer BE, Vessella R, Lange PH, A murine mouse model, e.g., B16F10, is used to evaluate Disis M. L. Antibody immunity to prostate cancer associ the antigen specific tumor response. Animals are challenged ated antigens can be detected in the serum of patients with with a lethal dose of tumor cells, e.g., 2x1OE5B116F10 cells. prostate cancer. J. Urol. 2000 November; 164(5):1825-9. Three days post-challenge, the animals are immunized with Sahin U, Tureci O, Schmitt H, Cochlovius B, Johannes T. cells genetically modified to express cytokine, e.g., GM-CSF, Schmits R, Stenner F, Luo G, Schobert I, Pfreundschuh M. alone, or cytokine and one or more prostate tumor associated Human neoplasms elicit multiple specific immune antigens (or a murine homolog thereof). Seven days after responses in the autologous host. Proc Natl AcadSci USA. immunotherapy, animals are evaluated for antigen specific 1995 Dec. 5: 92(25): 11810-3. immune responses, e.g., IFN-Y secreting T-cells, pro-inflam 25 Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tom lins SA, Shah RB, Chandran U, Monzon FA, Becich MJ, matory cytokine secretion, effector CD8 T-cell infiltration Wei JT, PientaKJ, Ghosh D, Rubin MA, Chinnaiyan AM. into tumors, and the like. Integrative genomic and proteomic analysis of prostate A murine mouse model, e.g., B16F10, is also used to cancer reveals signatures of metastatic progression. Cancer evaluate anti-tumor efficacy in response to immunotherapy Cell. 2005 November; 8(5):393-406. with cells genetically modified to express a cytokine, e.g., 30 Halabi, et al. Prognostic model for predicting survival in men GM-CSF and one or more prostate tumor-associated antigens with HRPC: Journal of Clinical Oncology, 2003: 21 (7): (or a murine homolog thereof). Animals are immunized on 1232-7 day 0 with immunotherapy with cells genetically modified to While many specific examples have been provided, the express a cytokine, e.g., GM-CSF, one or more prostate above description is intended to illustrate rather than limit the tumor-associated antigens alone, or a cytokine and one or 35 invention. Many variations of the invention will become more prostate tumor-associated antigens. 7 days after immu apparent to those skilled in the art upon review of this speci notherapy, animals are given a lethal dose of live tumor cells. fication. The scope of the invention should, therefore, be Animals are monitored twice weekly for the development of determined not with reference to the above description, but Subcutaneous tumors and euthanize when tumors become instead should be determined with reference to the appended necrotic or exceed 1500 mm3 in volume. 40 claims along with their full scope of equivalents. All sequences referenced by accession number, publica REFERENCES tions, and patent documents cited in this application are incor porated by reference in their entirety for all purposes to the Casiano CA, Mediavilla-Varela M, Tan E. M. Tumor-associ same extent as if each individual publication or patent docu ated antigen arrays for the serological diagnosis of cancer. ment were so individually denoted. Citation of these docu Mol Cell Proteomics. 2006 October: 5(10): 1745-59. Epub ments is not an admission that any particular reference is 2006 May 29. Review. PMID: 16733262. “prior art” to this invention. SEQUENCE LISTING <16 Os NUMBER OF SEO ID NOS: 33 <21 Oc SEO ID NO 1 <211 LENGTH: 365 <212> TYPE PRT ORGANISM: Homo sapiens <4 OOs SEQUENCE: 1 Met Ala Wal Met Ala Pro Arg Thr Lieu Val Lieu. Lieu. Lieu. Ser Gly Ala 1. 5 1O 15 Leu Ala Lieu. Thr Glin Thir Trp Ala Gly Ser His Ser Met Arg Tyr Phe 2O 25 3 O Ser Thr Ser Val Ser Arg Pro Gly Arg Gly Glu Pro Arg Phe Ile Ala 35 4 O 45 US 8,840,881 B2 67 68 - Continued Wall Gly Val Asp Asp Thr Glin Phe Val Arg Phe Asp Ser Asp Ala SO 55 6 O Ala Ser Glin Arg Met Glu Pro Arg Ala Pro Trp Ile Glu Glin Glu Gly 65 70 7s 8O Pro Glu Trp Asp Glu Glu Thr Gly Llys Val Ala His Ser Glin 85 90 95 Thir Asp Arg Glu Asn Lieu. Arg Ile Ala Lieu. Arg Asn Glin Ser 105 11 O Glu Ala Gly Ser His Thir Lieu. Glin Met Met Phe Gly Cys Asp Val Gly 115 12 O 125 Ser Asp Gly Arg Phe Lieu. Arg Gly Tyr His Glin Tyr Ala Asp Gly 13 O 135 14 O Lys Asp Ile Ala Lieu Lys Glu Asp Lieu. Arg Ser Trp Thir Ala Ala 145 150 155 160 Asp Met Ala Ala Glin Ile Thr Lys Arg Llys Trp Glu Ala Ala His Wall 1.65 17O 17s Ala Glu Glin Glin Arg Ala Tyr Lieu. Glu Gly Thr Wall Asp Gly Lieu. 18O 185 19 O Arg Arg Tyr Lieu. Glu Asn Gly Lys Glu Thir Lieu. Glin Arg Thir Asp Pro 195 Pro Lys Thir His Met Thir His His Pro Ile Ser Asp His Glu Ala Thr 21 O 215 Lell Arg Trp Ala Lieu. Gly Phe Tyr Pro Ala Glu Ile Thir Lieu. Thir 225 23 O 235 24 O Trp Gln Arg Asp Gly Glu Asp Gln Thr Glin Asp Thr Glu Luell Wall Glu 245 250 255 Thir Arg Pro Ala Gly Asp Gly Thr Phe Gln Lys Trp Ala Ala Wall Wall 26 O 265 27 O Wall Pro Ser Gly Glu Glu Glin Arg Tyr Thr Cys His Wall Glin His Glu 27s 285 Gly Luell Pro Llys Pro Lieu. Thir Lieu Arg Trp Glu Pro Ser Ser Gln Pro 29 O 295 3 OO Thir Wall Pro Ile Val Gly Ile Ile Ala Gly Lieu. Wall Lell Luell Gly Ala 3. OS 310 315 32O Wall Ile Thir Gly Ala Val Val Ala Ala Wal Met Trp Arg Arg Asn. Ser 3.25 330 335 Ser Asp Arg Lys Gly Gly Ser Tyr Ser Glin Ala Ala Ser Ser Asp Ser 34 O 345 35. O Ala Glin Gly Ser Asp Val Ser Lieu Thr Ala Cys Wall 355 360 365 <210s, SEQ ID NO 2 &211s LENGTH: 1095 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 2 atggc.cgt.ca togcc.ccg aac cct cqtc ctgct actict cgggggc cct ggc cctgacc 6 O Cagacctggg caggct coca Ct c catgagg tatt to tcca catcc.gtgtc ccggc.ccggc 12 O cgcggggagc ccc.gctt cat tacgtggacg acacgcagtt cgtgcggttc 18O gacagogacg cc.gcgagc.ca gaggatggag CC9C9ggcgc cgtggataga gCaggagggg 24 O ccggagtatt gggacgagga gacagggaaa gtgaaggcc.c act cacagac tgaccgaga.g 3OO alacctg.cgga Ctact acaac Cagagcgagg ccggttctica caccctic cag 360 US 8,840,881 B2 71 72 - Continued gtgcac catg cattgcaatig acaaag.ccaa agattcaata gatgctggga gtaaggagct 360 t caggtgaag Cagcagctgg acagttgttgt gaccalagtgt gtggatgacc acatgcacct CatCCCaact atgaccalaga agatgaagga ggct ct citta t caattggala aataaaagta tittgc.cagtg gcc at Caggc tigagggcaag aatatattitt ttataaggaa ttgggaattit 54 O tagt cittitta agcaaagttt acgaatgaag aaatgaagga tggccacaag cqtaaggcat atgtcacttg cct ctdgaca citggittattt tatgttt cag tcc ctaaaaa atgaaatgga 660 aaaaagtggit gctaaatcga gtcagagata ttacaggaga gttittagagc titatt atttic 72 O Ctgtggc.cag tgcttgtc.ct ggcagtaagg citctocc ctg taacaa.gc.ca gagcc ct coa aggtaccaga citc.ttcttac tacacaggta ctaac aggct ggCaggittag agttggtgga 84 O gtctgaggag agatatttitc tictttgttgc caa.catcctg tttaccaaaa gtgtcaccc.c 9 OO acCatctt CC ataagctgttgaaacaaaatc aatgaggltda Cta acttaga agggaaagaa 96.O agttittctgg gtc.tttgttt tottgatttg ggg taattta tacaagggca tacaagttga ttittaagatg tggaactggg agg tagacta gtttggataa gaactittgaa atgttcc ttg tggat.ccc.ca tittctggit catcaagatgtg gatgtacatt t cittaaaatt attacatgct 14 O gcatctitt ca gcc tigagac ttgcagaaa Catgagaggit gatgacacac taattatggg 2OO alagcagaatt actggctgat ggc.ccctgag gctgttgttgta acaaaatgac aggacaatct 26 O tgcagtaa.ca Ctttcc cctt galagagaagg gggttittgat tgttgatatat act agitat ct 32O aggaatgaac agtaaaagag gag cagttgg c tacttgatt acaacagagt aaatgaagta Ctggatttgg gaaaacct gg ttitt attaga acatatggaa tgaaag.cct a cacctagoat 44 O tgcc tactta gcc ccctgaa tta acagagc ccalattgaga caaac Coctg gcaac aggaa SOO attcaaggga gaaaaagtaa goaacttggg Ctaggatgag ctgactic cct tagagcaaag 560 gagaga cagc CCC Cattacc aaataccatt tittgcctggg gcttgttgcag Ctggcagtgt t cct gcc.cca gcatggcacci ttattgttitt gatagcaact tcqttgaatt ttcaccaact tatt acttga aattataata tagcc tdtcc gtttgctgtt tcc aggctgt gatatattitt 74 O Cctagtggitt tgactittaaa aataaataag gtttaattitt c tocco 786 <210s, SEQ I D NO 5 &211s LENGT H: 106 212. TYPE : PRT &213s ORGAN ISM: Homo sapiens <4 OOs, SEQUE NCE: 5 Met Ala Thr Pro Gly Pro Wall Ile Pro Glu Wall Pro Phe Glu Pro Ser 1. 1O 15 Llys Pro Pro Wall Ile Glu Gly Lieu. Se Pro Thir Wall Arg Asn. Pro 2O 25 3O Glu Ser Phe Lys Glu Llys Phe Val Arg Llys Thr Arg Glu Asn. Pro Wall 35 4 O 45 Wall Pro Ile Gly Cys Lieu Ala Thr Ala Ala Ala Lell Thir Tyr Gly Lieu. SO 55 6 O Tyr Ser Phe His Arg Gly Asn. Ser Glin Arg Ser Glin Lell Met Met Arg 65 70 7s 8O Thr Arg Ile Ala Ala Gln Gly Phe Thir Wall Ala Ala Ile Lieu. Lieu. Gly 85 90 95 Lieu Ala Wall Thir Ala Met Lys Ser Arg Pro 1OO 105 US 8,840,881 B2 75 76 - Continued cgc.cagagga gCacttggca aggtoagtga ggggc.cagta gaccc.ccgga gaagcagtac 54 O cgacaatgac gaagatacca gatcc ct tcc Calacc Cottt gCaccggtcC Cactaagggg Cagggit cag agaggagggg ggataggggg agcagacccC tgagatctgg gCataggcac 660 cgcattctga tctgga caaa gtcgggacag CaC catcCCa gcc cc galagc Cagggcc atg 72 O Ccagcaggcc ccaccatgga aat Caaaa.ca cc.gcaccagc Cagcagaatg gacattctga catcgc.ca.gc cgacgc.cctg aatcttggtg cagcaccaac tgttgg.cggga 84 O Ctggagggca Cagttgagga aggagggtgg ttaagaaata Cagtggggcc citct cqctgt 9 OO c ccttgcc.ca ggg cacttgc atticoagc ct cgctgcattt gct ct ct cqa ttoccott to 96.O citcc to actg cct cocaa.gc CCaCCCtact CCaaaataat gtgtcacttg atttggaact attcaa.gcag taaaagtaaa tgaatcc.cac Ctt tact aaa. acact t t c to tgaac cc ccc 108 O ttgc.ccctica citgatc.ttgc ttitt.ccctgg t ct catgcag ttgttggt caa tattgttggta 114 O atcgctaatt gtactgattg tittaagtgtg cattagttgt ctagattgta 12 OO agct Cotgga ggaCagggac Cacct Ctaca aaaaataaaa. aaagtacctic c cctdtctic g 126 O cacagtgtc.c Caggaccctg cggtgcagta gaggcgcacc aaaaaaaaaa. aaaaaaaaaa. 132O aaaaaaaaaa. aaaaaaaa. 1338 <210s, SEQ ID NO 9 &211s LENGTH: 185 212. TYPE : PRT &213s ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 9 Met Ala Pro Lys Gly Ser Ser Lys Glin Glin Ser Glu Glu Asp Lieu. Luell 1. 1O 15 Lell Glin Asp Phe Ser Arg Asn Lieu Ser Ala Lys Ser Ser Ala Lieu. Phe 25 3O Phe Gly Asn Ala Phe Ile Wal Ser Ala Ile Pro Ile Trp Luell Tyr Trp 35 4 O 45 Arg Ile Trp His Met Asp Lieu. Ile Glin Ser Ala Wall Lell Tyr Ser Wall SO 55 6 O Met Thir Luell Val Ser Thr Tyr Lieu Wall Ala Phe Ala Asn. Wall 65 70 7s 8O Phe Wall Lieu Lys His Llys Val Ala Glin Lys Arg Glu Asp Ala Wall 85 90 95 Ser Glu Val Thr Arg Llys Lieu. Ser Glu Ala Asp Asn Arg Lys Met 105 11 O Ser Arg Lys Glu Lys Asp Glu Arg Ile Lieu. Trp Lys Asn Glu Wall 115 12 O 125 Ala Asp Glu Ala Thir Thir Phe Ser Ile Phe Tyr Asn Asn Thir Lieu. 13 O 135 14 O Phe Luell Wall Wal Wall Ile Wall Ala Ser Phe Phe Ile Lell Asn. Phe 145 150 155 160 Asn Pro Thir Val Asn Tyr Ile Lieu. Ser Ile Ser Ala Ser Ser Gly Lieu. 1.65 17O 17s Ile Ala Luell Leu Ser Thr Gly Ser Lys 18O 185 <210s, SEQ ID NO 10 &211s LENGTH: 555 &212s. TYPE: DNA US 8,840,881 B2 77 - Continued <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 10 atggct cota aaggcagctic caaac agcag tctgaggagg acctgct cot gCaggattt C 6 O agcc.gcaatc t ct cqgccaa gtc.ct cogcg citcttctitcg gaaacgc.gtt catcgtgtct 12 O gccatc.ccca tctggittata Ctggcgaata tgg catatgg at Cttattoa gtctgctgtt 18O ttgtatagtg tgatgacc ct agtaa.gcaca tatttgg tag c ctittgcata Caagaatgtg 24 O aaatttgttc t caagcacaa agtag cacag aagagggagg atgctgttt c caaagaagtg 3OO acticgaaaac tittctgaagc tgataataga aagatgtctic ggaaggagaa agatgaaaga 360 atcttgttgga agaagaatga agttgctgat tatgaagcta Calacatttt C cat cit totat aacaa.cactic tgttcc tiggit cgtggtcatt gttgct tcct tott catatt gaagaacttic aaccccacag tgaact acat attgtccata agtgctt cat caggact cat cgc cct c ctd 54 O tctactggct C Caaa. 555 <210s, SEQ I D NO 11 &211s LENGT H: 1.87 212. TYPE : PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 11 Met Glu Arg Glin Glu Glu Ser Lieu Ser Ala Arg Pro Ala Luell Glu Thir 1. 5 1O 15 Glu Gly Lieu. Arg Phe Lieu. His Thr Thr Val Gly Ser Lell Luell Ala Thr 25 30 Tyr Gly Trp Tyr Ile Val Phe Ser Cys Ile Lieu. Lell Tyr Wall Wall Phe 35 4 O 45 Glin Llys Lieu. Ser Ala Arg Lieu. Arg Ala Lieu. Arg Glin Arg Glin Lieu. Asp SO 55 6 O Arg Ala Ala Ala Ala Wall Glu Pro Asp Val Val Wall Arg Glin Glu 65 70 7s 8O Ala Lieu Ala Ala Ala Arg Lieu Lys Met Glin Glu Glu Lell Asn Ala Glin 85 90 95 Val Glu Lys His Lys Glu Lys Lieu. Lys Glin Lieu. Glu Glu Glu 105 11 O Arg Gln Lys Ile Glu Met Trp Asp Ser Met Glin Glu Gly Lys Ser Tyr 115 12 O 125 Lys Gly Asn Ala Lys Llys Pro Glin Glu Glu Asp Ser Pro Gly Pro Ser 13 O 135 14 O Thir Ser Ser Val Lieu Lys Arg Llys Ser Asp Arg Pro Luell Arg Gly 145 150 155 160 Gly Gly Tyr Asn Pro Lieu. Ser Gly Glu Gly Gly Gly Ala Ser Trp 1.65 17O 17s Arg Pro Gly Arg Arg Gly Pro Ser Ser Gly Gly 18O 185 <210s, SEQ I D NO 12 &211s LENGT H: 561 212. TYPE : DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 12 atggaacgcc aagaggagtc. tctgtc.cgcg cggc.cggc.cc tigaga.ccga ggggctg.cgc 6 O titcCtgcaca C cacggtggg Ct c cctgctg gcc acct atg gctgg tacat cqt Cttcagc 12 O US 8,840,881 B2 79 80 - Continued tgcatc ctitc tctacgtggit ctitt cagaag citttcc.gc.cc ggctalagagc Cttgaggcag 18O aggcagctgg accgagctgc ggctgctgttg gaacctgatg ttgttgttaa acgacaagaa 24 O gctittagcag ctgct cqact gaaaatgcaa. gaagaactaa atgcgcaagt tgaaaag cat 3OO aaggaaaaac tgaaacaact tgaagaagaa aaaaggagac agalagattga aatgtgggac 360 agcatgcaag aaggaaaaag ttacaaagga aatgcaaaga agc.cccagga ggalagacagt Cctgggcctt CCaCtt Catc. tgtcc tdaaa cggaaatcgg acagaaagcc tttgcgggga ggaggittata accc.gttgtc tggtgaagga ggcggagctt gct cotggag acctggacgc 54 O agaggc.ccgt. Catctggcgg a. 561 <210s, SEQ I D NO 13 &211s LENGT H: 926 212. TYPE : PRT &213s ORGAN ISM: Homo sapiens <4 OOs, SEQUENCE: 13 Met Asp Met Phe Pro Leu. Thir Trp Wall Phe Lieu. Ala Lell Phe Ser 1. 5 1O 15 Arg His Glin Val Arg Gly Glin Pro Asp Pro Pro Gly Gly Arg Lieu. 25 Asn Ser Lys Asp Ala Gly Tyr Ile Thir Ser Pro Gly Tyr Pro Glin Asp 35 4 O 45 Tyr Pro Ser His Glin Asn. Cys Glu Trp Ile Val Tyr Ala Pro Glu Pro SO 55 6 O Asn Gln Lys Ile Wall Lieu. Asn. Phe ASn Pro His Phe Glu Ile Glu Lys 65 70 7s 8O His Asp Cys Llys Tyr Asp Phe Ile Glu Ile Arg Asp Gly Asp Ser Glu 85 90 95 Ser Ala Asp Lieu. Lieu. Gly Llys His Cys Gly Asn Ile Ala Pro Pro Thir 105 11 O Ile Ile Ser Ser Gly Ser Met Leu Tyr Ile Llys Phe Thir Ser Asp Tyr 115 12 O 125 Ala Arg Glin Gly Ala Gly Phe Ser Lieu. Arg Tyr Glu Ile Phe Lys Thr 13 O 135 14 O Gly Ser Glu Asp Cys Ser Lys Asn Phe Thir Ser Pro Asn Gly Thir Ile 145 150 155 160 Glu Ser Pro Gly Phe Pro Glu Lys Tyr Pro His Asn Lell Asp Cys Thr 1.65 17O 17s Phe Thir Ile Lieu Ala Lys Pro Llys Met Glu Ile Ile Lell Glin Phe Lieu. 18O 185 19 O Ile Phe Asp Lieu. Glu. His Asp Pro Lieu. Glin Wall Gly Glu Gly Asp Cys 195 Trp Lieu. Asp Ile Trp Asp Gly Ile Pro His Wall Gly Pro 21 O 215 22O Lieu. Ile Gly Lys Tyr Cys Gly Thr Lys Thr Pro Ser Glu Luell Arg Ser 225 23 O 235 24 O Ser Thr Gly Ile Leu Ser Lieu. Thir Phe His Thr Asp Met Ala Wall Ala 245 250 255 Phe Ser Ala Arg Tyr Tyr Lieu Val His Glin Glu Pro Leu 26 O 265 27 O Glu Asn. Phe Gln Cys Asn Val Pro Leu Gly Met Glu Ser Gly Arg Ile 27s 28O 285 US 8,840,881 B2 81 82 - Continued Ala Asn Glu Glin Ile Ser Ala Ser Ser Thir Ser Asp Gly Arg Trp 29 O 295 3 OO Thir Pro Glin Glin Ser Arg Lell His Gly Asp Asp Asn Gly Trp Thir Pro 3. OS 310 315 Asn Luell Asp Ser Asn Glu Tyr Luell Glin Wall Asp Lell Arg Phe Luell 3.25 330 335 Thir Met Luell Thir Ala Ile Ala Thir Glin Gly Ala Ile Ser Arg Glu Thir 34 O 345 35. O Glin Asn Gly Tyr Tyr Wall Ser Luell Glu Wall Ser Thir Asn 355 360 365 Gly Glu Asp Trp Met Wall Tyr Arg His Gly Lys Asn His Wall Phe 37 O 375 Glin Ala Asn Asn Asp Ala Thir Glu Wall Wall Luell Asn Luell His Ala 385 390 395 4 OO Pro Luell Luell Thir Arg Phe Wall Arg Ile Arg Pro Glin Thir Trp His Ser 4 OS 415 Gly Ile Ala Luell Arg Lell Glu Luell Phe Gly Cys Arg Wall Thir Asp Ala 425 43 O Pro Ser Asn Met Lell Gly Met Luell Ser Gly Lell Ile Ala Asp Ser 435 44 O 445 Glin Ile Ser Ala Ser Ser Thir Glin Glu Tyr Luell Trp Ser Pro Ser Ala 450 45.5 460 Ala Arg Luell Wall Ser Ser Arg Ser Gly Trp Phe Pro Arg Ile Pro Glin 465 470 Ala Gln Pro Gly Glu Glu Trp Lieu Gln Wall Asp Lieu Gly Thr Pro Lys 485 490 495 Thir Wall Gly Wall Ile Ile Glin Gly Ala Arg Gly Gly Asp Ser Ile SOO 505 Thir Ala Wall Glu Ala Arg Ala Phe Wall Arg Phe Lys Wall Ser Tyr 515 525 Ser Luell Asn Gly Asp Trp Glu Tyr Ile Glin Asp Pro Arg Thir Glin 53 O 535 54 O Glin Pro Luell Phe Glu Gly Asn Met His Tyr Asp Thir Pro Asp Ile 5.45 550 555 560 Arg Arg Phe Asp Pro Ile Pro Ala Glin Tyr Wall Arg Wall Pro Glu 565 st O sts Arg Trp Ser Pro Ala Gly Ile Gly Met Arg Luell Glu Wall Luell Gly 585 59 O Asp Trp Thir Asp Ser Pro Thir Wall Glu Thir Lell Gly Pro Thir Wall 595 605 Ser Glu Glu Thir Thir Thir Pro Pro Thir Glu Glu Glu Ala Thir 610 615 62O Glu Gly Glu Asn Cys Ser Phe Glu Asp Asp Asp Luell Glin Luell 625 630 635 64 O Pro Ser Gly Phe Asn Asn Phe Asp Phe Luell Glu Glu Pro Cys Gly 645 650 655 Trp Met Asp His Ala Trp Luell Arg Thir Thir Trp Ala Ser Ser 660 665 67 O Ser Ser Pro Asn Asp Arg Thir Phe Pro Asp Asp Arg Asn Phe Luell Arg 675 685 Lell Glin Ser Asp Ser Glin Arg Glu Gly Glin Tyr Ala Arg Luell Ile Ser 69 O. 695 7 OO Pro Pro Wall His Lell Pro Arg Ser Pro Wall Cys Met Glu Phe Glin Tyr US 8,840,881 B2 83 84 - Continued 7 Os Glin Ala Thir Gly Gly Arg Gly Val Ala Lieu. Glin Wall Wall Arg Glu Ala 72 73 O 73 Ser Glin Glu Ser Llys Lieu Lleu Trp Val Ile Arg Glu Asp Glin Gly Gly 740 74. 7 O Glu Trp Lys His Gly Arg Ile Ile Leul Pro Ser Asp Met Glu Tyr 760 765 Glin Ile Wall Phe Glu Gly Val Ile Gly Lys Gly Arg Ser Gly Glu Ile 770 775 78O Ala Ile Asp Asp Ile Arg Ile Ser Thr Asp Val Pro Lell Glu Asn. Cys 79 O 79. 8OO Met Glu Pro Ile Ser Ala Phe Ala Val Asp Ile Pro Glu Ile His Glu 805 810 815 Arg Glu Gly Tyr Glu Asp Glu Ile Asp Asp Glu Glu Val Asp Trip 825 83 O Ser Asn Ser Ser Ser Ala Thir Ser Gly Ser Gly Ala Pro Ser Thr Asp 835 84 O 845 Glu Ser Trp Lieu. Tyr Thr Lieu. Asp Pro Ile Lell Ile Thir Ile 850 855 860 Ile Ala Met Ser Ser Lieu. Gly Val Lieu. Lieu. Gly Ala Thir Cys Ala Gly 865 87O 87s 88O Lell Luell Luell Tyr Cys Thr Cys Ser Tyr Ser Gly Lell Ser Ser Arg Ser 885 890 895 Thir Thir Lieu. Glu Asn Tyr Asn Phe Glu Lieu. Asp Gly Lieu Lys 9 OO 905 91O His Wall Llys Met Asn His Glin Ser Glu Ala 915 92 O 925 <210s, SEQ ID NO 14 &211s LENGTH: 2781 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 14 atggatatgt titcct ct cac ctgggitttitc ttagc cct ct acttittcaag acaccaagtg 6 O agaggccaac cagacccacc gtgcggaggt cgtttgaatt c caaagatgc tiggctatatic 12 O acct ct cocq gttacccc.ca ggact acccc t cccaccaga actgcgagtggattgtttac 18O gcc.ccc.gaac c caaccagaa gattgtcc to aactt Calacc ct cactittga aatcgagaag 24 O cacgactgca agtatgacitt tat cqagatt cgggatgggg acagtgaat C cqcagacct C 3OO Ctgggcaaac actgtgggaa catcgcc.ccg CCCaC catca t ct cotcggg ctic catgctic 360 tacatcaagt t cacct coga Ctacgc.ccgg Cagggggcag gctitct citct gcgctacgag atct tcaaga Caggct ctga agattgctica aaaaact tca caa.gc.cccala C9ggaccatc 48O gaat ct cotg ggtttcCtga gaagt atc.ca cacaacttgg actgcaccitt taccatcctg 54 O gccaaaccca agatggagat catcc togcag titcct gatct ttgacctgga gcatgaccct ttgcaggtgg gagaggggga ctgcaagtac gattggctgg a catctggga tiggcatt coa 660 Catgttggcc CCCtgattgg caagtact.gt gggaccaaaa caccctctga actitcgttca 72 O tCgacgggga tcotct coct gacctitt cac acgga catgg cggtggccala ggatggctt C actacctggit ccaccalagag C Cactagaga actitt cagtg caatgttcct 84 O CtgggCatgg agt ctggc.cg gattgctaat gaacagat.ca gtgcct catc tacct actict 9 OO US 8,840,881 B2 89 - Continued tacaag cago act gcc ct co aacco cqgaa act tcctgtg caa.cccagac tat cacctitt 360 gaaagttt ca aagaga acct gaaggactitt Ctgcttgtca tocc ctittga Ctgctgggag 42O Ccagtic Cagg agtaa 435 <210s, SEQ ID NO 17 &211s LENGTH: 144 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 17 Met Trp Lieu. Glin Ser Lieu Lleu Lieu. Lieu. Gly Thr Val Ala Cys Ser Ile 1. 5 1O 15 Ser Ala Pro Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro Trp Glu. His 2O 25 3O Val Asn Ala Ile Glin Glu Ala Arg Arg Lieu. Lieu. Asn Lieu. Ser Arg Asp 35 4 O 45 Thir Ala Ala Glu Met Asn. Glu. Thir Wall Glu Wall Ile Ser Glu Met Phe SO 55 6 O Asp Lieu. Glin Glu Pro Thr Cys Lieu. Glin Thr Arg Lieu. Glu Lieu. Tyr Lys 65 70 7s 8O Glin Gly Lieu. Arg Gly Ser Lieu. Thir Lys Lieu Lys Gly Pro Lieu. Thir Met 85 90 95 Met Ala Ser His Tyr Lys Gln His Cys Pro Pro Thr Pro Glu. Thir Ser 1OO 105 11 O Cys Ala Thr Glin Thr Ile Thr Phe Glu Ser Phe Lys Glu Asn Lieu Lys 115 120 125 Asp Phe Lieu. Leu Val Ile Pro Phe Asp Cys Trp Glu Pro Val Glin Glu 13 O 135 14 O <210s, SEQ ID NO 18 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 18 actacctgat cagtgtcaaa 2O <210s, SEQ ID NO 19 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 19 gtaatctocq galaggcactg tacatgaaa ag 32 <210s, SEQ ID NO 2 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 2O gcct accolac aggagattico 2O <210s, SEQ ID NO 21 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 21 US 8,840,881 B2 95 96 What is claimed is: genetically modified to express the coding sequence for GM 1. A method of cancer immunotherapy comprising: CSF and the coding sequence of one or more prostate tumor administering a composition to a subject with prostate associated antigens selected from the group consisting of cancer, the composition comprising one or more popu HLA-A24, FLJ14668 (SEQID NO. 3), Cardiolipin, NNAT, lations of cells genetically modified to express the cod SELS, HIGD2A, SSR3 and NRP2, wherein said administer ing sequence for granulocyte-macrophage colony ing increases an immune response against one or more of said stimulating factor (“GM-CSF) and the coding prostate tumor-associated antigens, wherein the cells com sequence of one or more prostate tumor-associated anti prise autologous tumor cells, allogenic tumor cells, or gens selected from the group consisting of HLA-A24. bystander cells. FLJ14668 (SEQID NO:3), Cardiolipin, NNAT, SELS, 10 4. The method of any of claims 1 to 3 wherein the prostate HIGD2A, SSR3 and NRP2, wherein the cells comprise tumor-associated antigen is FLJ14668 (SEQID NO. 3). autologous tumor cells, allogenic tumor cells, or 5. The method of any of claims 1 to 3, wherein a single bystander cells. population of cells is genetically modified to express the 2. A method of inducing a de novo immune response coding sequence for GM-CSF and one or more prostate against one or more prostate tumor-associated antigens com 15 tumor-associated antigens selected from the group consisting prising: administering a composition to a subject with pros of HLA-A24, FLJ14668 (SEQ ID NO. 3), Cardiolipin, tate cancer, the composition comprising one or more popula NNAT, SELS, HIGD2A, SSR3 and NRP2. tions of cells genetically modified to express the coding 6. The methodofany of claims 1 to 3, wherein two different sequence for GM-CSF and the coding sequence of one or populations of cells are genetically modified to express the more prostate tumor-associated antigens selected from the coding sequence for GM-CSF and one or more prostate group consisting of HLA-A24, FLJ14668 (SEQID NO:3), tumor-associated antigens selected from the group consisting Cardiolipin, NNAT, SELS, HIGD2A, SSR3 and NRP2, of HLA-A24, FLJ14668 (SEQ ID NO. 3), Cardiolipin, wherein said administering induces a de novo immune NNAT, SELS, HIGD2A, SSR3 and NRP2. response against one or more of said prostate tumor-associ 7. The method according to any of claim 1 to 3, wherein ated antigens, wherein the cells comprise autologous tumor 25 said genetically modified cells are allogenic. cells, allogenic tumor cells, or bystander cells. 8. The method according to claim 5, wherein said geneti 3. A method of increasing an immune response against one cally modified cells are allogenic. or more prostate tumor-associated antigens comprising: 9. The method according to claim 6, wherein said geneti administering a composition to a subject with prostate cancer, cally modified cells are allogenic. the composition comprising one or more populations of cells ck ck *k ck ck