Microbial Infection Activation of Dendritic Cells During Neutrophils Instruct Recruitment and Cross-Talk in the Innate Immune Sy

Home , Dendritic cell

Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection This information is current as of September 28, 2021. Soumaya Bennouna, Susan K. Bliss, Tyler J. Curiel and Eric Y. Denkers J Immunol 2003; 171:6052-6058; ; doi: 10.4049/jimmunol.171.11.6052 http://www.jimmunol.org/content/171/11/6052 Downloaded from

References This article cites 41 articles, 24 of which you can access for free at:

http://www.jimmunol.org/content/171/11/6052.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Cross-Talk in the Innate Immune System: Neutrophils Instruct Recruitment and Activation of Dendritic Cells during Microbial Infection1

Soumaya Bennouna,* Susan K. Bliss,* Tyler J. Curiel,† and Eric Y. Denkers2*

Type I inflammatory cytokines are essential for immunity to many microbial pathogens, including Toxoplasma gondii. Dendritic cells (DC) are key to initiating type 1 immunity, but neutrophils are also a source of chemokines and cytokines involved in Th1 response ignition. We found that T. gondii triggered neutrophil synthesis of CC chemokine ligand (CCL)3, CCL4, CCL5, and CCL20, chemokines that were strongly chemotactic for immature DC. Moreover, supernatants obtained from parasite-stimulated polymorphonuclear leukocytes induced DC IL-12(p40) and TNF-␣ production. Parasite-triggered neutrophils also released factors that induced DC CD40 and CD86 up-regulation, and this response was dependent upon parasite-triggered neutrophil TNF-␣ production. In vivo evidence that polymorphonuclear leukocytes exert an important influence on DC activation was obtained by Downloaded from examining splenic DC cytokine production following infection of neutrophil-depleted mice. These animals displayed severely curtailed splenic DC IL-12 and TNF-␣ production, as revealed by ex vivo flow cytometric analysis and in vitro culture assay. Our results reveal a previously unrecognized regulatory role for neutrophils in DC function during microbial infection, and suggest that cross-talk between these cell populations is an important component of the innate immune response to infection. The Journal of Immunology, 2003, 171: 6052–6058. http://www.jimmunol.org/ he intracellular protozoan parasite Toxoplasma gondii is a fection, a response that is dependent upon chemokine receptor major opportunistic parasite in immunocompromised pa- CXCR2 (12, 13). Neutrophils produce several important proin- T tients, and 30–50% of the population worldwide is flammatory cytokines and chemokines, including IL-12, TNF-␣, asymptomatically infected with this microbial pathogen (1, 2). T. CC chemokine ligand (CCL)3 (macrophage inflammatory protein gondii normally elicits a robust type 1 cytokine response, in which (MIP)-1␣) and CCL4 (MIP-1␤) during in vitro stimulation with T. CD4ϩ and CD8ϩ T lymphocytes produce IFN-␥ that is essential in gondii and other microbial pathogens (14, 15). Most importantly, mediating resistance to infection (3, 4). However, in the genetic mice depleted of PMN using an Ab against Gr-1 (Ly6G) are un- absence of IL-10 and during oral infection of certain inbred mouse able to survive acute toxoplasmosis. Lack of resistance in neutro- strains, Toxoplasma triggers dysregulated type 1 cytokine produc- phil-depleted animals is associated with defective type 1 cytokine by guest on September 28, 2021 tion, leading to pathology and death (5–7). responses during infection with Toxoplasma and several other mi- Understanding how the type 1 cytokine response is initiated dur- crobial pathogens (16–20). Collectively, these data suggest that ing infection with Toxoplasma and other microbial pathogens is an PMN may play a role in orchestrating early immunity through area of major interest. Dendritic cells (DC),3 through their ability production of cytokines and chemokines that promote develop- to capture Ag, migrate to secondary lymphoid organs, simultaneously ment of Th1 T lymphocytes. present antigenic peptide, and release IL-12, are important in driving Although PMN are well-known as the first cell type to arrive at Th1 differentation (8, 9). Indeed, injection of soluble tachyzoite (TZ) the site of infection, it is not clear how they could influence T cell Ag, and infection with live parasites, results in rapid activation of differentiation, which is conventionally thought to be driven by DC IL-12-producing DC in the spleen (10, 11). Nevertheless, the cellular in secondary lymphoid organs (21). In this study, we present an and molecular events leading to DC activation and Th1 differentiation explanation for this conundrum. We found that parasite-triggered during in vivo infection are ill-defined. neutrophils release CCL3, CCL4, CCL5 (RANTES), and CCL20 Recent studies have shown that T. gondii infection induces rapid (MIP-3␣), chemokines that together display potent chemotactic influx of polymorphonuclear leukocytes (PMN) to the site of in- activity for immature bone marrow-derived DC. Parasite-stimulated PMN also release soluble factors that trigger DC activation, as measured by IL-12(p40) and TNF-␣ production, as well as up-regulation *Department of Microbiology and Immunology, College of Veterinary Medicine, of costimulatory molecules CD40 and CD86. We demonstrate that † Cornell University, Ithaca, NY 14853; and Tulane Medical School, Tulane Univer- ␣ sity, New Orleans, LA 70112 DC activation is driven at least in part by PMN-derived TNF- . The physiological relevance of these data is suggested by the finding that Received for publication June 6, 2003. Accepted for publication September 30, 2003. in vivo PMN depletion results in defective splenic DC cytokine re- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance sponses during infection. The data point to a model in which neutro- with 18 U.S.C. Section 1734 solely to indicate this fact. phils instruct DC recruitment and activation, leading in turn to Th1 1 This work was supported by National Institutes of Health Grants AI47888 (to cell activation and ultimately immunity to microbial infection. E.Y.D.) and AI44322 (to T.J.C.). 2 Address correspondence and reprint requests to Dr. Eric Y. Denkers, Department of Materials and Methods Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Mice Ithaca, NY 14853-6401. E-mail address: [email protected] 3 Abbreviations used in this paper: DC, dendritic cell; PMN, polymorphonuclear leu- C57BL/6 and Swiss-Webster female mice, 6–8 wk of age, were obtained kocyte; TZ, tachyzoite; CCL, CC chemokine ligand; MIP, macrophage inflammatory from Taconic Farms (Germantown, NY). TNF knockout and wild-type protein; PEC, peritoneal exudate cell. counterparts (B6129SF2/J) were purchased from The Jackson laboratory

(Bar Harbor, ME). Animals were housed in filter-covered isolator cages in hours later, supernatants from the cultures were recovered and either used the animal facility of the College of Veterinary Medicine at Cornell Uni- immediately or stored at Ϫ80°C. versity (Ithaca, NY) which is accredited by the American Association for Accreditation of Laboratory Care. Splenic CD11cϩ DC isolation Parasites and infections DC in the spleen were isolated as described elsewhere (11). Briefly, spleno- cyte suspensions were prepared in DMEM supplemented with PenStrep, 10 TZ of the virulent T. gondii strain RH were maintained by biweekly pas- mM HEPES, and 1 mM EDTA and erythrocytes were lysed in Red Cell sage on human foreskin fibroblasts in complete medium (cDMEM) com- Lysis Buffer (Sigma-Aldrich). The remaining cells were washed, resus- posed of DMEM (Life Technologies, Gaithersburg, MD) supplemented pended at 2.5 ϫ 108 cells/ml in MACS buffer, then incubated with CD11c- with 1% FCS (HyClone Laboratories, Logan, UT), 100 U/ml penicillin, conjugated magnetic microbeads for 15 min at 4°C. After washing, the cell and 100 ␮g/ml streptomycin (PenStrep; Life Technologies). T. gondii cysts suspension was passed through a column (25 MS; Miltenyi Biotec) in the were harvested from brain homogenates of Swiss-Webster mice that were presence of a magnet, and unbound cells were removed by several washes infected 1 mo earlier with the ME49 parasite strain. Infections were ac- in MACS buffer. Columns were then removed from the magnetic field, and complished by i.p. injection of 20 ME49 cysts. In vivo neutrophil depletion CD11cϩ-enriched cells were flushed through, washed, and resuspended in was accomplished by i. p. injection of 200 ␮g of RB6-8C5 or NIMP-R14 cDMEM for culture. Cell populations isolated in this manner were rou- mAb every 48 h. tinely Ͼ70% CD11cϩ.

Reagents and Ab PMN cultures LPS (Escherichia coli strain 0111:B4) and fMLP were purchased from Bone marrow and peritoneal PMN (2 ϫ 106/ml) were cultured in the pres- Sigma-Aldrich (St. Louis, MO). FITC-conjugated Abs speciﬁc for CD11c ence of TZ (0.5:1 ratio of parasites to cells) at 37°Cin5%CO in 96-well and Ly6G, PE-conjugated Abs speciﬁc for IL-12 (p40/p70) (C15.6), 2

tissue culture plate (Corning Costar, Cambridge, MA). Eighteen hours Downloaded from ␣ b TNF- (MP6-XT22), class II MHC I-A (AF6-120.1), CD40 (3/23), CD80 later, supernatants from the cultures were recovered, filtered through a (16-10A1), CD86 (GL1), Gr-1(Ly-6G), and purified rat-anti MIP-1␤ (A ␮ ␣ 0.2- m membrane (Corning, Corning, NY), and either used immediately 65-2), and anti-TNF- blocking Abs (MP6-XT3 and G281-2626) were or stored at Ϫ80°C. To remove specific chemokines, peritoneal PMN su- obtained from BD PharMingen (San Diego, CA). Purified antisera specific ␮ ␣ ␣ pernatants were incubated with anti-chemokine Ab (each at 15 g/ml) at for MIP-1 (M20), MIP-3 (A-20), and RANTES (C-19) were obtained 4°C on a shaker for 2 h, then protein G-agarose beads (Santa Cruz Bio- from Santa Cruz Biotechnology (Santa Cruz, CA). Normal rat and goat Ig technology) were added to supernatants for an additional 4 h under the were purchased from Jackson ImmunoResearch Laboratories (West Grove, same conditions. The supernatants were then spun at 1000 rpm for 4 min PA). Anti-CD11c and anti-MHC class II magnetic microbeads were pur- and the bead-free supernatants were collected and either used immediately http://www.jimmunol.org/ chased from Miltenyi Biotec (Auburn, CA). RB6-8C5 mAb (IgG2b) was or stored at Ϫ80°C. Anti-TNF-␣ treatments were performed with a com- kindly provided by Dr. R. L. Coffman (DNAX Research Institute, Palo bination of two neutralizing Ab at saturating concentrations (BD Phar- Alto, CA). NIMP-R14, a rat IgG2b Ab that selectively binds to mouse Mingen) or control Ab in PMN supernatants during DC treatment. neutrophils (22), was provided by Dr. F. Tacchini-Cottier (World Health Organization Immunology Research and Training Center, University of Lausanne, Epalinges, Switzerland). RT-PCR RNA was isolated, reverse-transcribed, and subjected to PCR amplification Bone marrow PMN purification as described (25). The primer sequences used were: ␤-actin, TGACGGG Neutrophils were isolated from mouse bone marrow following a previously GGTCACCCACACTGTGCCCATCTA (sense), CTAGAAGCATTGCG GTGGACGATGGAGGG (antisense); CCL3, CGGAAGATTCCACG published protocol (23). Briefly, single cell suspensions of bone marrow by guest on September 28, 2021 cells were collected from femur and tibia and resuspended in DMEM sup- CCAATTC (sense), GGTTGAGGAACGTGTCCTGAAG (antisense); plemented with 5% FCS and 1% PenStrep. Cells were then centrifuged at CCL4, CCCACTTCCTGCTGTTTCTCTTAC (sense), AGCAGAGAAA 500 ϫ g for 7 min at 4°C and resuspended in HBSS (Ca2ϩ-free) supple- CAGCAATGGTGG (antisense); CCL5, CCACGTCAAGGAGTATTTC mented with 0.38% sodium citrate. The cell suspension was layered on top TACACC (sense), CTGATTTCTTGGGTTTGCTGTG (antisense); CCL20, of a step gradient consisting of 52, 65, and 75% Percoll diluted in Ca2ϩ- TACTCCACCTCTGCGGCGAATCAGAA (sense), GTGAAACCTCCAAC ϫ CCCAGCAAGGTT (antisense). The cDNA was amplified 27 cycles (CCL3), free HBSS, and centrifuged at 1500 g for 30 min at 4°C. Neutrophils ␤ were recovered at the interface of the 65 and 75% Percoll layers. The 29 cycles (CCL4, CCL5 and -actin), and 35 cycles (CCL20) (20). proportion of neutrophils, determined by Diff-Quik staining of cytospin preparations, was routinely Ͼ90%. Flow cytometry To analyze DC surface markers, Fc receptors were blocked in FACS buffer Isolation of peritoneal neutrophils (PBS, 1% BSA, and 0.1% sodium azide) containing 10% normal mouse Mice were i.p. injected with 1 ml of 10% thioglycollate (Difco Laborato- serum for 15 min at 0°C, then cells were stained with optimal concentra- ries, Detroit, MI). Eighteen hours later, peritoneal exudate cells (PEC) were tions of FITC-conjugated anti-CD11c in combination with PE-conjugated antisera specific for class II MHC, CD40, CD80, and CD86 for 30 min at obtained by lavage with ice-cold PBS. PEC were washed in PBS, passed ϩ through a 70-␮m nylon cell strainer, and erythrocytes in the suspension 0°C. For intracellular cytokine detection, splenic CD11c were blocked, were lysed using Red Cell Lysis Buffer (Sigma-Aldrich). PEC were then stained with FITC-conjugated anti-CD11c, then cells were fixed in 3% 7 ϫ paraformaldehyde (Sigma-Aldrich), 0.1 mM CaCl2, and 0.1 mM MgCl2 for washed, resuspended to 2 10 cells/ml in MACS buffer composed of ϩ Dulbecco’s PBS (Life Technologies) containing 0.5% BSA (Sigma- 30 min at 0°C. CD11c cells were subsequently washed in permeabiliza- Aldrich), 1 mM EDTA (Fisher Scientific, Pittsburgh, PA), and incubated tion buffer (PBS with 0.075% saponin) and incubated for 15 min at 0°Cin for 15 min at 4°C with anti-MHC class II magnetic microbeads. After permeabilization buffer containing 10% normal mouse serum. After two washing, the mixture was transferred to columns installed within a mag- washes in permeabilization buffer, PE-conjugated anti-IL-12 or anti- netic apparatus to remove MHC class II-expressing cells, according to the TNF-␣ or control Ab was added, cells were incubated for 30 min at 0°C manufacturer’s instructions (Miltenyi Biotec). and subsequently washed for flow cytometric analysis. Data was acquired on a FACSCalibur system (10,000 events per sample) and analyzed with Bone marrow-derived DC cultures CellQuest software (BD Immunocytometry Systems, San Jose, CA). Generation of bone marrow-derived DC was accomplished following a Chemotaxis previously published protocol (24). Briefly, single cell bone marrow preparations were obtained as described above, cells were washed in RPMI Cell migration was assessed using a disposable 96-well chemotaxis cham- 1640 (Fisher Scientific) and resuspended at 2 ϫ 105 cells/ml in bone mar- ber (ChemoTx no. 101-5; Neuroprobe, Gaithersburg, MD). The wells con- row-derived DC medium composed of RPMI 1640 supplemented with 1% tained either medium, fMLP (10Ϫ6 M), or test sample supernatants. The PenStrep, 10% FCS, 50 ␮M 2-ME, and 20 ng/ml GM-CSF (Peprotech, framed polycarbonate filter (5-␮m pore size) was installed over wells and Rocky Hill, NJ). Cells were plated on 100 ϫ 15 mm standard sterile poly- 30 ␮l of cells, resuspended in cDMEM (1.5 ϫ 106/ml), were added to the styrene Petri dishes (Fisher Scientific) and cultured for 9 days at 37°Cin filter surface. In control wells, cells were directly resuspended in superna-

5% CO2. Fresh DC medium, containing GM-CSF, was added on days 3, 6, tants from PMN-TZ cocultures. After incubation (90 min at 37°Cin5% and 8 after culture initiation. On day 9, cells were resuspended in cDMEM CO2), the number of cells that migrated through the filter into the wells was alone or in the presence of different stimuli at 37°Cin5%CO2. Eighteen counted in five high power fields under a phase-contrast microscope. 6054 NEUTROPHIL-DC INTERACTION DURING Toxoplasma INFECTION

Cytokine ELISA of PMN failed to induce DC chemotaxis, implicating PMN factors IL-12(p40) was measured as previously described (26), and TNF-␣ was released in response to the parasite (data not shown). measured using a commercially obtained kit (BD PharMingen). The CCR5 ligands CCL3, CCL4, and CCL5, as well as the CCR6 ligand CCL20, function as factors chemotactic for immature Statistical analysis DC (27, 28). Therefore, we asked whether T. gondii could induce The statistical signiﬁcance of the data was analyzed using an unpaired PMN synthesis of these chemokines. As shown in Fig. 1B, mRNA two-tailed Student’s t test. for CCL3, CCL4, CCL5, and CCL20 were rapidly up-regulated in PMN cocultured with T. gondii. To determine whether these che- Results mokines were involved in the DC chemotactic activity of PMN-T. Toxoplasma stimulated PMN release factors chemotactic for DC gondii coculture supernatants, we depleted chemokines using anti- To determine whether PMN exposed to T. gondii released soluble chemokine Ab conjugated to protein G-agarose beads. Depletion factors capable of inﬂuencing DC activity, we analyzed cell-free of CCL3, CCL4, and CCL5 decreased the chemotactic effect of supernatants from PMN-TZ cocultures for their ability to elicit supernatants derived from PMN-TZ cultures. Anti-CCL20 Ab in- bone marrow DC chemotaxis. Under the conditions used, ϳ60% duced a greater decrease in the chemotactic index and a combina- of PMN were infected at the termination of the cocultures. Super- tion of both anti-CCR5 ligand and anti-CCL20 Ab reduced the natants from PMN-TZ cocultures contained factors strongly che- level of migration to that obtained in medium alone (Fig. 1C). motactic for immature DC (Fig. 1A). T. gondii was required to Importantly, these Ab had no effect on DC chemotaxis mediated elicit this response, since PMN cultured in medium alone by fMLP, a chemotactic peptide that exerts its effects through (PMN-M) failed to release DC chemotactic factors. To distinguish binding to its own unique receptors (29) (Fig. 1C). Downloaded from increased chemotaxis vs chemokinesis, PMN-TZ supernatant was TZ-stimulated PMN activate immature DC placed in the same chamber as the DC in the cell migration assay (Fig. 1A, Contr). In this case, movement into the counting chamber The ability of PMN factors, as well as T. gondii itself, to induce did not occur. Supernatants collected from parasites in the absence immature DC maturation was determined by measuring up-regulation of the costimulatory molecule CD40. As shown in Fig. 2,

relative to medium (Fig. 2A), LPS (Fig. 2B) induced strong CD40 http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 1. Toxoplasma stimulated PMN release DC chemotactic factors. A, Bone marrow-derived DC chemotaxis assay in presence of medium alone (M), cell-free supernatants derived from PMN cultured in medium alone (PMN-M), or from PMN infected with TZ (PMN-TZ). Contr, control FIGURE 2. TZ-stimulated neutrophils release factors inducing DC for chemotaxis, in which PMN-TZ supernatant was placed in the same CD40 up-regulation. Bone marrow-derived DC were cultured with (A) me- chamber as the DC. B, RT-PCR analysis of chemokines expressed by PMN dium, (B) LPS (1 ␮g/ml), (C) live TZ (0.5:1 ratio of parasites to cells), (D) incubated with medium alone or cocultured with TZ for 2 h. C, DC che- TZ supernatants, (E) cell-free supernatants from PMN in medium motaxis assay with cell-free supernatants incubated with control Ab (Ⅺ), (PMN-M) in presence of control Ab, (F) PMN-M with anti-TNF-␣ block- a combination of anti-CCL3 (MIP-1␣), -CCL4 (MIP-1␤), and -CCL5 ing Ab, (G) cell-free supernatants from PMN cocultured with live TZ (RANTES) Ab (^), anti-CCL20 (MIP-3␣) mAb (u), and a combination of (PMN-TZ) in presence of control Ab, (H) PMN-TZ with anti-TNF-␣ anti-CCL3, -CCL4, -CCL5, and -CCL20 Ab (f). Data are representative of blocking Ab. After 18 h, DC were subjected to FACS analysis using anti- p Ͻ 0.01 (PMN-TZ supernatants ϩ control CD11c and anti-CD40 Ab. The results show the gated CD11cϩ population ,ء .four different experiments p Ͻ 0.01 (PMN- stained with anti-CD40 (bold line) and an isotype control (thin line). The ,ءء ;(Ab vs PMN-TZ supernatants ϩ anti-CCR5 ligands TZ supernatants ϩ anti-CCR5 ligands vs PMN-TZ supernatants in pres- numbers indicate percent of cells positive for CD40. This experiment was ence of a combination of all four Ab). repeated twice with similar results. The Journal of Immunology 6055

FIGURE 3. PMN-derived TNF-␣ is required to induce DC costimulatory molecule up-regulation. DC were cultured in the presence of medium (M), LPS, or PMN supernatants (SN) prepared from either wild-type (WT) or TNF-␣ knockout (KO) neutrophils. PMN SN were prepared by incubation with either medium or TZ. After 18 h, expression of CD40 and CD86 was assessed on CD11cϩ cells. This experiment was repeated twice with essentially identical results. FIGURE 5. T. gondii-stimulated neutrophils secrete factors that stimulate DC IL-12 and TNF-␣ production. Bone marrow-derived DC were cultured with TZ (0.5:1 ratio of parasites to cells), PMN-M, and PMN-TZ. up-regulation. Direct DC infection (Fig. 2C) and DC incubation Supernatants were collected for IL-12(p40) (A) and TNF-␣ (B) cytokine Downloaded from with secreted parasite products (Fig. 2D) induced low levels of ELISA 18 h after culture initiation. M, medium; PMN-M, cell-free super- activation. Supernatants from unstimulated PMN also induced a natants from PMN stimulated with medium; PMN-TZ, cell-free superna- low amount of CD40 up-regulation (Fig. 2E), but culture ﬂuid tants from PMN stimulated with T. gondii. nd, none detected. Data are representative of greater than ﬁve different experiments. from PMN-T. gondii cocultures displayed strong DC activating capability (Fig. 2G). Importantly, the ability of PMN supernatants to induce CD40 up-regulation was abrogated with neutralizing anti- http://www.jimmunol.org/

TNF-␣ mAb (Fig. 2H). Similar results were obtained when MHC class II and CD86 expression was examined (data not shown). These results suggested involvement of TNF-␣ in DC activation by PMN-TZ, but it was possible that PMN-TZ supernatants contained factors eliciting DC TNF-␣, which then activated the cells in an autocrine manner. To determine the source of TNF-␣, neutrophils were isolated from TNF-␣ knockout mice and subjected to

T. gondii coculture. Supernatants from TNF-␣-deﬁcient PMN-TZ by guest on September 28, 2021 cultures failed to induce DC up-regulation of either CD40 or CD86 (Fig. 3). In contrast, wild-type PMN-TZ supernatants induced DC costimulatory molecule up-regulation that achieved levels similar to that induced by LPS. The results demonstrate that neutrophil- derived TNF-␣ plays an important role in DC activation, as measured by CD40 and CD86 up-regulation. Next, we determined whether TNF-␣ alone could activate bone marrow-derived DC. Accordingly, DC were incubated for 18 h with increasing amounts of exogenous TNF-␣, then expression of CD40 and CD86 was evaluated by FACS analysis. As shown in Fig. 4, high levels of costimulatory molecule up-regulation were seen only in the presence of 1 ng/ml or higher of TNF-␣.

T. gondii-stimulated neutrophils secrete factors that induce IL-12(p40) and TNF-␣ production by DC We next asked whether supernatants from PMN-T. gondii cocultures triggered DC cytokine production. As shown in Fig. 5A, supernatants from PMN-T. gondii cocultures induced DC IL-12 release to levels similar or greater than that seen with directly infected DC. Interestingly, while T. gondii alone elicited minimal DC TNF-␣ production, supernatants from PMN-T. gondii cocultures triggered robust production of this proinflammatory cytokine (Fig. 5B). As shown in the figure, and as previously reported (26), PMN themselves produced IL-12 and TNF-␣ when stimulated with T. gondii. Nevertheless, levels produced by neutrophils are FIGURE 4. Direct DC activation by in vitro stimulation with exogenous TNF-␣. Bone marrow-derived DC were stimulated for 18 h with the indi- low relative to that induced by DC. This is of interest because high ␣ cated concentrations of rTNF-␣, then cells were stained with mAb to CD40 levels of exogenous TNF- are required to fully activate DC (Fig. and CD86 (bold lines) and subjected to FACS analysis, gating on 4). The results suggest that PMN-derived TNF-␣ acts in concert CD11chigh cells. Isotype controls are represented by thin lines. The num- with other presently undefined factors to achieve full DC costimu- bers indicate percent of cells falling within the indicated gate. latory molecule up-regulation. 6056 NEUTROPHIL-DC INTERACTION DURING Toxoplasma INFECTION

acute infection (16). As shown in Fig. 6A, FACS intracellular cytokine staining of an enriched CD11cϩ DC population shows 50 and 54% of cells in the infected group expressing IL-12 and TNF-␣, respectively. In striking contrast, neutropenic infected animals displayed a 2-fold decrease in both TNF-␣ and IL-12 expression (Fig. 6A). Nevertheless, there was also the possibility that the anti-Gr-1 mAb used to deplete neutrophils was also removing Gr-1ϩ IL-12ϩ DC. Accordingly, we examined the Gr-1 phenotype of IL-12-positive cells in spleens from infected mice. As shown in Fig. 6B, among total splenocytes virtually all IL-12-positive cells were Gr-1 negative. In addition, we enriched for CD11cϩ DC and found that the small population that expressed Gr-1 was IL-12- negative (Fig. 6B). To conﬁrm these results, an enriched population of CD11cϩ DC was isolated from 7-day T. gondii-infected mice and cultured in medium or with TZ. Correlating with the intracellular staining results, DC-enriched cells from infected animals produced both IL-12(p40) and TNF-␣ during ex vivo stimulation (Fig. 6C). In contrast, DC isolated from neutropenic

infected animals were severely impaired in ability to produce Downloaded from IL-12(p40) and most strikingly, TNF-␣. As with bone marrow- derived DC responses to TZ (Fig. 5), splenic DC from noninfected mice produced IL-12 but not TNF-␣ when cultured with the parasite. In control experiments, depletion of Gr-1-expressing cells in spleen populations from noninfected mice had no signiﬁcant im-

pact on parasite-stimulated IL-12 production (control, 6.0 Ϯ 0.2 http://www.jimmunol.org/ ng/ml vs 6.8 Ϯ 0.3 ng/ml). These results conﬁrm that splenic Gr-1ϩ CD11cϩ DC do not contribute to IL-12 production during either in vivo or in vitro infection.

Discussion Production of IL-12 by the innate immune system is essential in triggering a Th1 response and in surviving T. gondii infection (30– 33). Dendritic cells, macrophages, and neutrophils have each been by guest on September 28, 2021 suggested as a source of this cytokine during Toxoplasma infection, and the ability of multiple cell types to serve as an IL-12 FIGURE 6. CD11cϩ DC from neutrophil-negative infected mice are de- source may, in part, account for the strong Th1 response elicited by fective in production of IL-12(p40) and TNF-␣. A, C57BL/6 mice were infection (10, 12, 25, 26, 30, 34, 35). Here, we reveal that cytokine neutrophil-depleted by i.p. injection of RB6C6.8C5 mAb. After Ab admin- and chemokine cross-talk in the innate immune system, in partic- istration, mice were i.p. infected with 100 ME49 cysts, and 7 days later, ϩ ular between PMN and DC, further promotes the Th1-inducing spleens were harvested and CD11c DC enriched using immunomagnetic properties of the latter cell type. beads conjugated to CD11c mAb. Flow cytometric analysis after gating on ϩ Neutrophils cocultured with live Toxoplasma produce soluble CD11c cells shows cells stained with PE-labeled anti-IL-12 or anti- TNF-␣ mAb. Numbers represent the percent of cells falling within the factors displaying several important effects on DC. In chemotaxis indicated gates. In B, splenocytes from day 7-infected mice were stained assays, supernatants from parasite-stimulated PMN cultures pos- with PE-labeled anti-IL-12 and FITC-labeled anti Gr-1 mAb. Also shown sessed strong chemotactic activity toward immature bone marrow- in B, CD11cϩ DC were enriched from the same population and assessed for derived DC. CCL3 (MIP-1␣), CCL4 (MIP-1␤), CCL5 (RANTES), IL-12 and Gr-1 expression. Percent of cells falling within the indicated and, in particular CCL20 (MIP-3␣) are chemotactic for immature gates is shown. In C, C57BL/6 mice were neutrophil-depleted by i.p. in- DC (27, 28). Our results and those of others show that PMN pro- jection of NIMP-R14 and splenocytes prepared 7 days postinfection. duce chemokines including CCR5 ligands and CCL20 (25, 27, 36). ELISA was performed on 18 h supernatants from CD11cϩ-enriched cells ϩ Ab blocking studies revealed that DC chemotaxis induced by PMN cultured with medium or TZ (0.5:1 ratio of parasites to cells). CD11c DC factors was due to the combined activities of these chemokines. were obtained from mice that were: NI, not infected; Inf, infected; PMN DC also released high levels of IL-12 in response to stimulation neg Inf, neutrophil-depleted and infected. Data are representative of three different experiments. with supernatants from T. gondii-PMN cocultures. In addition, direct infection of bone marrow and spleen-derived DC led to high amounts of IL-12 release, as did incubation with products released by extracellular tachyzoites (data not shown). Recent studies re- DC from neutrophil-depleted, infected mice are impaired in IL- veal a role for CCR5 and MyD88 in Toxoplasma-triggered DC ␣ 12 and TNF- production during in vivo T. gondii infection IL-12 production (34, 37). This is due, at least in part, to Toxo- The above results leave unresolved the question of whether PMN plasma cyclophilin-18, a protein that mediates its effects by bind- exert effects on DC during in vivo infection. To address this crit- ing to CCR5 on DC (38). Here, we found that Ab blocking of ical issue, PMN-negative mice, generated by anti-neutrophil mAb CCL3, CCL4, and CCL5 failed to inhibit the IL-12 response, mak- administration, were infected with T. gondii and splenic DC cyto- ing it unlikely that CCR5-binding chemokines present in the PMN kine production was examined at the peak of acute infection. We supernatants trigger DC IL-12 (data not shown). We cannot pres- have previously shown that PMN-depleted animals cannot survive ently distinguish the extent to which IL-12-inducing activity in the The Journal of Immunology 6057 parasite-stimulate PMN supernatants is attributable to Toxoplasma gondii cyclophilin exerts its effects in DC. We are currently ex- Ag itself, vs neutrophil factors released in response to the parasite. amining molecular recognition of parasite Ag by PMN. Given the above results with IL-12, it is striking that TNF-␣ Regardless of how neutrophils sense Toxoplasma, our data sug- release could not be attributed to the activity of parasite products gest a model in which PMN recruited to a site of infection are on DC. This is because direct DC infection, as well as incubation triggered by the parasite to release DC chemotactic molecules. The with secreted TZ factors (data not shown), elicited minimal increase in the local DC population would favor direct interactions TNF-␣. We similarly found that splenic DC fail to produce TNF-␣ with the parasite, promoting Ag uptake and infection, and initiat- after parasite stimulation. Indeed, lack of TNF-␣ in parasite-in- ing IL-12 synthesis. Parasite-triggered soluble PMN factors would fected cells reflects active suppression by the parasite in bone mar- also induce DC TNF-␣ production. Additionally, DC recruited to row-derived DC (our unpublished observations) and macrophages the developing inflammatory focus would be activated by PMN (39, 40). Nevertheless, we found that splenic DC released TNF-␣ products, in a process dependent upon TNF-␣. The DC, primed by when cells were isolated at day 7 of infection, and in vitro incu- neutrophils and armed with Ag, could then traffic to tissues of the bation with parasite Ag increased the amount of TNF-␣ released. draining lymph node, where they would initiate T cell activation The results suggest that CD11cϩ DC are capable of responding and Th1 subset selection. directly to the parasite by releasing TNF-␣ when isolated from a proinflammatory environment. Acknowledgments Parasite-stimulated neutrophil supernatants were capable of We thank Dr. M. Hesse for critical comments on this manuscript and Dr. L. strong CD40 up-regulation on DC, and this contrasted with the Del Rio for insightful discussion. relatively weak increase in expression occurring during direct DC Downloaded from infection. Furthermore, DC activation, as measured by up-regu- References lated CD40 expression, was abrogated in the presence of a neu- 1. Navia, B. A., C. K. Petito, J. W. M. Gold, E. S. Cho, B. D. Jordon, and tralizing TNF-␣ Ab. In this regard, we have also found that T. J. W. Price. 1986. Cerebral toxoplasmosis complicating the acquired immune deficiency syndrome: clinical and neuropathological findings in 27 patients. Ann. gondii-stimulated human peripheral blood PMN induce TNF-␣- Neurol. 19:224. dependent increases in costimulatory molecule expression in hu- 2. Remington, J. S., and G. Desmonts. 1990. Toxoplasmosis. In Infectious Diseases of the Fetus and Newborn Infant. J. S. Remington and J. O. Klein, eds. man monocyte-derived DC (our unpublished observations). Super- W. B. Saunders, Philadelphia, p. 89. http://www.jimmunol.org/ natants prepared from TNF-␣ knockout neutrophils fail to induce 3. Denkers, E. Y., and R. T. Gazzinelli. 1998. Regulation and function of T cell- DC activation, implicating PMN as the source of this cytokine. mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. ␣ 11:569. Nevertheless, the amount of recombinant TNF- required to in- 4. Alexander, J., and C. A. Hunter. 1998. Immunoregulation during toxoplasmosis. duce similar levels of DC activation exceeded by 4-fold the Chem. Immunol. 70:81. amount released by parasite-stimulated PMN. This suggests that 5. Gazzinelli, R. T., M. Wysocka, S. Hieny, T. Scharton-Kersten, A. Cheever, R. Kuhn, W. Muller, G. Trinchieri, and A. Sher. 1996. In the absence of endog- another factor, derived from either PMN or DC, may synergize enous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal with neutrophil-derived TNF-␣ to promote DC activation. The immune response dependent upon CD4ϩ T cells and accompanied by overpro- ␥ ␣ identity of such factor(s) is currently under investigation in our duction of IL-12, IFN- , and TNF- . J. Immunol. 157:798. 6. Neyer, L. E., G. Grunig, M. Fort, J. S. Remington, D. Rennick, and C. A. Hunter. by guest on September 28, 2021 laboratory. Regardless, the ability of parasite-triggered PMN to 1997. Role of interleukin-10 in regulation of T-cell-dependent and T-cell-inde- induce DC CD40 up-regulation is likely to be important, because pendent mechanisms of resistance to Toxoplasma gondii. Infect. Immun. 65:1675. 7. Suzuki, Y., A. Sher, G. Yap, D. Park, L. Ellis Neyer, O. Liesenfeld, M. Fort, CD40L (CD154) is required for splenic DC activation during tox- H. Kang, and E. Gufwoli. 2000. IL-10 is required for prevention of necrosis in the oplasmosis (11). small intestine and mortality in both genetically resistant BALB/c and susceptible To address the physiological relevance of the data, mice were C57BL/6 mice following peroral infection with Toxoplasma gondii. J. Immunol. 164:5375. administered neutrophil-depleting mAb before infection. This 8. Palucka, K., and J. Banchereau. 2002. How dendritic cells and microbes interact treatment has previously been shown to result in defective Th1 to elicit or subvert protective immune responses. Curr. Opin. Immunol. 14:420. responses during infection with Toxoplasma and other microbial 9. Guermonprez, P., J. Valladeau, L. Zitvogel, C. Thery, and S. Amigorena. 2002. ϩ Antigen presentation and T cell stimulation by dendritic cells. Annu. Rev. Immu- pathogens (16, 18, 41). Our present studies show that CD11c nol. 20:621. splenic DC from infected neutrophil-depleted mice display severe 10. Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, ␣ R. N. Germain, and A. Sher. 1997. In vivo microbial stimulation induces rapid defects in IL-12 and TNF- production, suggesting that pathogen- CD40L-independent production of IL-12 by dendritic cells and their re-distribu- triggered PMN influence in vivo DC activation. Although one of tion to T cell areas. J. Exp. Med. 186:1819. the depleting Ab used in this study (RB6C6.8C5) also recognizes 11. Straw, A. D., A. S. MacDonald, E. Y. Denkers, and E. J. Pearce. 2003. CD154 ϩ plays a central role in regulating dendritic cell activation during infections that a subset of plasmacytoid-like Gr-1 (Ly6G) DC in the spleen, it is, induce Th1 or Th2 responses. J. Immunol. 170:727. nevertheless, highly unlikely that removal of this subset accounts 12. Bliss, S. K., B. A. Butcher, and E. Y. Denkers. 2000. Rapid recruitment of for the defective DC cytokine response. This is because it has been neutrophils with prestored IL-12 during microbial infection. J. Immunol. 165: 4515. shown that IL-12 produced by T. gondii Ag-triggered splenic DC 13. Del Rio, L., S. Bennouna, J. Salinas, and E. Y. Denkers. 2001. CXCR2 deficiency derives from CD11cϩGr-1 (Ly6G)Ϫ populations (42), and we also confers impaired neutrophil recruitment and increased susceptibility during Tox- ϩ oplasma gondii infection. J. Immunol. 167:6503. do not detect IL-12 expression among Gr-1 splenic DC from 14. Denkers, E. Y., L. D. Del Rio, and S. Bennouna. 2003. Neutrophil production of normal mice in the infection model used here (Fig. 6B). However, IL-12 and other cytokines during microbial infection. Chem. Immunol. 83:95. we cannot yet exclude the possibility that other non-PMN Gr-1ϩ 15. Cassatella, M. A. 1999. Neutrophil-derived proteins: Selling cytokines by the pound. Adv. Immunol. 73:369. cells play an in vivo role in instructing DC IL-12 production dur- 16. Bliss, S. K., L. C. Gavrilescu, A. Alcaraz, and E. Y. Denkers. 2001. Neutrophil ing Toxoplasma infection. depletion during Toxoplasma gondii infection leads to impaired immunity and It is not yet known how neutrophils recognize TZ. Inasmuch as lethal systemic pathology. Infect. Immun. 69:4898. 17. Romani, L., A. Mencacci, E. Cenci, G. Del Sero, F. Bistoni, and P. Puccetti. MyD88-negative PMN fail to produce IL-12 in response to the 1997. An immunoregulatory role for neutrophils in CD4ϩ T helper subset selec- parasite, it is likely that Toll-like receptors are involved in molec- tion in mice with candidiasis. J. Immunol. 158:2356. 18. Tateda, K., T. A. Moore, J. C. Deng, M. W. Newstead, X. Zeng, A. Matsukawa, ular recognition (37). The recent identification of Toxoplasma cy- M. S. Swanson, K. Yamaguchi, and T. J. Standiford. 2001. Early recruitment of clophilin-18 as a protein that induces DC IL-12 release implicates neutrophils determines subsequent T1/T2 host responses in a murine model of this molecule in neutrophil cytokine production (38). Indeed, we Legionella pneumophila pneumonia. J. Immunol. 166:3355. 19. Pedrosa, J., B. M. Saunders, R. Appelberg, I. M. Orme, M. T. Silva, and find that PMN express high levels of CCR5 (L. Del Rio and E.Y. A. M. Cooper. 2000. Neutrophils play a protective nonphagocytic role in sys- Denkers, unpublished observations), the ligand through which T. temic Mycobacterium tuberculosis infection of mice. Infect. Immun. 68:577. 6058 NEUTROPHIL-DC INTERACTION DURING Toxoplasma INFECTION

20. Chen, L., Z. H. Zhang, and F. Sendo. 2000. Neutrophils play a critical role in the synthesis and resistance during acute infection with Toxoplasma gondii. J. Im- pathogenesis of experimental cerebral malaria. Clin. Exp. Immunol. 120:125. munol. 153:2533. 21. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, 32. Hunter, C. A., and J. S. Remington. 1995. The role of IL-12 in toxoplasmosis. B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu. Res. Immunol. 146:546. Rev. Immunol. 18:767. 33. Khan, I. A., T. Matsuura, and L. H. Kasper. 1994. Interleukin-12 enhances mu- 22. Tacchini-Cottier, F., C. Zweifel, Y. Belkaid, C. Mukankundiye, M. Vasei, rine survival against acute toxoplasmosis. Infect. Immun. 62:1639. P. Launois, G. Milon, and J. Louis. 2000. An immunomodulatory function for ϩ 34. Aliberti, J., C. Reis e Sousa, M. Schito, S. Hieny, T. Wells, G. B. Huffnage, and neutrophils during the induction of a CD4 Th2 response in BALB/c mice in- A. Sher. 2000. CCR5 provides a signal for microbial induced production of IL-12 fected with Leishmania major. J. Immunol. 165:2628. by CD8␣ϩ dendritic cells. Nat. Immunol. 1:83. 23. Kiefer, F., J. Brumell, N. Al-Alawi, S. Latour, A. Cheng, A. Veillette, S. Grinstein, and T. Pawson. 1998. The Syk protein tyrosine kinase is essential 35. Seguin, R., and L. H. Kasper. 1999. Sensitized lymphocytes and CD40 ligation for Fc␥ receptor signaling in macrophages and neutrophils. Mol. Cell. Biol. 18: augment interleukin-12 production by human dendritic cells in response to Tox- 4209. oplasma gondii. J. Infect. Dis. 179:467. 24. MacDonald, A. S., A. D. Straw, B. Bauman, and E. J. Pearce. 2001. CD8Ϫ 36. Akahoshi, T., T. Sasahara, R. Namai, T. Matsui, H. Watabe, H. Kitasato, dendritic cell activation status plays an integral role in influencing Th2 response M. Inooue, and H. Kondo. 2003. Production of macrophage inflammatory protein development. J. Immunol. 167:1982. 3␣ (MIP-3␣) (CCL20) and MIP-3␤ (CCL19) by human peripheral blood neu- 25. Bliss, S. K., A. J. Marshall, Y. Zhang, and E. Y. Denkers. 1999. Human poly- trophils in response to microbial pathogens. Infect. Immun. 71:524. morphonuclear leukocytes produce IL-12, TNF-␣, and the chemokines macroph- 37. Scanga, C. A., J. Aliberti, D. Jankovic, F. Tilloy, S. Bennouna, E. Y. Denkers, age-inflammatory protein-1␣ and -1␤ in response to Toxoplasma gondii antigens. R. Medzhitov, and A. Sher. 2002. Cutting edge: MyD88 is required for resistance J. Immunol. 162:7369. to Toxoplasma gondii infection and regulates parasite-induced IL-12 production 26. Bliss, S. K., Y. Zhang, and E. Y. Denkers. 1999. Murine neutrophil stimulation by dendritic cells. J. Immunol. 168:5997. ␥ by Toxoplasma gondii antigen drives high level production of IFN- -independent 38. Aliberti, J., J. G. Valenzuela, V. B. Carruthers, S. Hieny, J. Andersen, H. Charest, IL-12. J. Immunol. 163:2081. C. Reis e Sousa, A. Fairlamb, J. M. Ribeiro, and A. Sher. 2003. Molecular 27. Scapini, P., C. Laudanna, C. Pinardi, P. Allavena, A. Mantovani, S. Sozzani, and mimicry of a CCR5 binding-domain in the microbial activation of dendritic cells. M. A. Cassatella. 2001. Neutrophils produce biologically active macrophage in- Nat. Immunol. 4:485. flammatory protein-3␣ (MIP-3␣)/CCL20 and MIP-3␤/CCL19. Eur. J. Immunol. Downloaded from 39. Denkers, E. Y., L. Kim, and B. A. Butcher. 2003. In the belly of the beast: 31:1981. subversion of macrophage proinflammatory signaling cascades during Toxo- 28. Vecchi, A., L. Massimiliano, S. Ramponi, W. Luini, S. Bernasconi, R. Bonecchi, plasma gondii infection. Cell. Microbiol. 5:75. P. Allavena, M. Parmentier, A. Mantovani, and S. Sozzani. 1999. Differential responsiveness to constitutive vs. inducible chemokines of immature and mature 40. Butcher, B. A., L. Kim, P. F. Johnson, and E. Y. Denkers. 2001. Toxoplasma mouse dendritic cells. J. Leukocyte Biol. 66:489. gondii tachyzoites inhibit proinflammatory cytokine induction in infected mac- ␬ 29. Le, Y., P. M. Murphy, and J. M. Wang. 2002. Formyl peptide receptors revisited. rophages by preventing nuclear translocation of the transcription factor NF B. Trends Immunol. 23:541. J. Immunol. 167:2193. 41. Romani, L., F. Bistoni, and P. Puccetti. 1997. Initiation of T-helper cell immunity 30. Gazzinelli, R. T., S. Hieny, T. Wynn, S. Wolf, and A. Sher. 1993. IL-12 is http://www.jimmunol.org/ required for the T-cell independent induction of IFN-␥ by an intracellular parasite to Candida albicans by IL-12: the role of neutrophils. Chem. Immunol. 68:110. and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90: 42. Dalod, M., T. P. Salazar-Mather, L. Malmgaard, C. Lewis, C. Asselin-Paturel, 6115. F. Briere, G. Trinchieri, and C. A. Biron. 2002. Interferon ␣/␤ and interleukin 12 31. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, responses to viral infections: pathways regulating dendritic cell cytokine expres- G. Trinchieri, and A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-␥ sion in vivo. J. Exp. Med. 195:517. by guest on September 28, 2021