Identification and Characterization of In-Planta Expressed Secreted Effectors from M

Home , Aspartylglucosaminidase, Chitin deacetylase, Magnaporthe

Identification and Characterization of

In-planta Expressed Secreted Effector Proteins from Magnaporthe oryzae

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Pattavipha Songkumarn, M.S.

Graduate Program in Plant Pathology

The Ohio State University

2013

Dissertation Committee:

Dr. Guo-Liang Wang, Advisor

Dr. Pierluigi (Enrico) Bonello

Dr. Thomas K. Mitchell

Dr. David M. Mackey

Pattavipha Songkumarn

2013

Abstract

Rice blast disease, caused by the fungus Magnaporthe oryzae, is one of the most serious diseases of rice. Interactions between rice and M. oryzae involve the recognition of cellular components and the exchange of complex molecular signals from both partners. How these interactions occur in rice is still elusive. Previously, we employed gene expression profiling, including robust-long serial analysis of gene expression (RL-SAGE), massively parallel signature sequencing (MPSS), and sequencing by synthesis (SBS), to examine transcriptome profiles of infected rice leaves. A total of 6,413 in-planta expressed fungal genes, including 851 genes encoding putative effector proteins, were identified. To elucidate the molecular basis of interactions between rice and M. oryzae upon infection, we combined the results from gene expression profiling with high throughput gene cloning, and rapid protoplast transient expression assay for large-scale identification of M. oryzae effector proteins that induce cell death in rice plants. In total, seven M. oryzae proteins were found to induce cell death in rice protoplasts and six of them were found to induce cell death in the non-host plant, Nicotiana benthamiana. However, this cell death only occurred when the proteins contained the signal peptide for secretion to the extracellular space. Although these seven M. oryzae effectors are diverse in their sequence and structure, the physiological basis of cell death induced by most of these effectors is similar. Among all identified effectors, three effectors, i.e., MGG_05232,

MGG_08370, MGG_08409, contain carbohydrate-binding modules (CBMs). To elucidate the ii pathogenesis function of the three CBM-containing effectors, we generated transgenic

M. oryzae strains that carried out gene replacement and gene overexpression. Among the three of them, the MGG_08409 effector containing cellulose binding domain showed pathogenic function in rice. In addition, MGG_08409 binds to cellulose, the component of plant cell wall, and has glucanase activity against cellulose substrate. This study demonstrates that our integrative genomic approach is effective for the identification of in-planta expressed cell death- inducing effector from M. oryzae, which may play important role facilitating colonization and fungal growth during infection. Characterization of these fungal effector proteins will provide new insights into the molecular basis of the rice and M. oryzae interactions.

iii

Dedicated to my beloved family:

Narong, Wanchern, Natinee and Peerapat Songkumarn

Acknowledgements

I would like to express my gratitude to my advisor, Dr. Guo-Liang Wang for giving me the opportunity, intellectual and providing supports. Your encouragement, guidance, understanding and patience have provided a good basis for the present thesis.

In addition, I wish to thank my SAC members: Dr. Pierluigi (Enrico) Bonello, Dr. David M.

Mackey, and Dr. Thomas K. Mitchell for their suggestions and assistance for my research.

I also thank all Wang lab members who always be there whenever I need help.

Thank you for your help, encouragement, and discussion during the development of my experiments. Thank for Dr. Songbiao Chen, I am very grateful and fortunate to have you as my mentor. My sincere thank goes to Maria, without invaluable friendly assistance, I could not complete my work. I am thankful to Gautam and Chanho, both of you are such great friends.

Thank you very much for your continuous advice, encouragement and your precious friendship throughout my graduate program.

I also thanks The Royal Thai Government and Kasetsart University for providing me all support as a Thai scholar.

Finally, I would like to give special thanks to my family for their love and supports.

They always stand by me. This thesis is simply impossible without them.

VITA

1993-1997……………………………………………….B.S. (Microbiology), Prince of Songkla University,

Songkla, Thailand

1997-2001……………………….……………………….M.S. (Microbiology), Kasetsart University,

Bangkok, Thailand

2001-2006……………………………………………….Lecturer, Nakhon Si Thammarat Rajabhat University,

Nakhon Si Thammarat, Thailand

2006-2011………………………………………………Thai Government Scholar

PUBLICATIONS

Chen, S., Songkumarn, P., Venu, R., Gowda, M., Bellizzi, M., Hu, J., Liu, W., Ebbole, D., Mitchell,

T., and Wang, G. L. (2012). Identification and Characterization of In-planta Expressed

Secreted Effectors from Magnaporthe oryzae that Induce Cell Death in Rice. Mol. Plant-

Microbe Interact. Inpress. (Co-first author)

Park, C. H., Chen, S., Shirsekar, G., Zhou, B., Khang, C. H., Songkumarn, P., Ning, Y., Wang, R.,

Bellizzi, M., Valent, B., and Wang, G. L. (2012). The Magnaporthe oryzae effector

AvrPiz-t targets the RING E3 ligase APIP6 for suppression of PAMP-triggered immunity

in rice. Plant Cell 24, 4748-4762.

Chen, S., Songkumarn, P., Liu, J., and Wang, G. L. (2009). A versatile zero background T-vector

system for gene cloning and functional genomics. Plant Physiol. 150, 1111-1121.

Chen, S. M. Gowda, R. C. Venu, P. Songkumarn, C. H. Park, M. Bellizzi, D. Ebbole, G. L. Wang.

(2009). Isolation and functional analysis of putative effectors from M. oryzae using

integrated genomic approaches. In Advances in Genetics, Genomics and Control of Rice

Blast Disease, Eds. G.L. Wang and B. Valent, Springer, pp 93-103.

FIELDS OF STUDY

Major Field: Plant Pathology

vii

TABLES OF CONTENTS

Abstract………………………………………………………………………………………………...……………………………………ii

Dedication………………………………………………………………………………………………………………………………….iv

Acknowledgements……………………………………………………………………………………………………………….……v

Vita……………………………………………………………………………………………………………………………….……………vi

List of figures…………………………………………………………………………………………………………………..…………ix

List of tables…………………………………………………………………………………………………………………..…….….xiii

Chapter 1 Introduction……………………………………………………………………………………………….………………1

Chapter 2 Identification and Characterization of In-planta Expressed Secreted Effectors from M. oryzae that Induce Cell Death in Rice…………………………………………………………………………..29

Chapter 3 Functional analysis of M. oryzae carbohydrate binding module (CBM)- containing effectors………………………………………………………………………………….………………………………70

Chapter 4 Conclusion and Future Challenges………………………………………………………….………………151

Bibliography……………………………………………………………………………………………………………………………157

Appendix...... 191

viii

LIST OF FIGURES

1.1 M. oryzae infection cycle and rice blast symptoms…………………………………………..…………………..5

1.2 Diagram of development of biotrophic interfacial complex (BIC) during rice-leaf sheath invasion………………………………………..………………………………………………………………………….……………….13

1.3 Summary statistics for gene expression profiling by RL-SAGE, MPSS and SBS, and identifying of in-planta expressed M. oryzae genes encoding putative secreted protein…………………….……..24

1.4 Gene expression profiling of M. oryzae during its interaction with rice……………………..………..26

1.5 Gene Ontology (GO) annotation of In-planta expressed M. oryzae putative secreted protein………………………………………………………………………………………………………………………………….….27

2.1. The improved rice protoplast isolation method…………………………….…………………………………..33

2.2. Construction of the ZeBaTA system………………………….…………………………………………….………….36

2.3. RT-PCR validation of putative effector genes……………………………………………………………………..50

2.4. Identification of five in-planta expressed putative secreted proteins that induce cell death in rice cells…………………………………………………………………………………………….……..…………………………..55

2.5. Transient expression of M. oryzae cell death inducing proteins in the non-host plant,

N. benthamiana………………………………………………………………………………………………..………………………57

2.6. In-planta expression pattern of the five MoCDIPs……………………………………………………..……….59

2.7. Validation of the secretory feature of the five MoCDIPs by yeast secretion analysis….………61

3.1. Schematic diagram of the major structures of a plant cell wall…………………….…………………….76

3.2. A diagram illustrating PCR amplifications of the components for MGG_05232 gene deletion by split marker………………………………………………………………………………………………………………..………..82

3.3. Schematic views of 5 MoCDIPs show structural analyses of MGG_03356, MGG_05531,

MGG_07986, MGG_08409, and MGG_10234…………………………………………………….……………………..95

3.4. Schematic diagram of the strategy used for identification of M. oryzae genes encoding CBM- containing effector proteins………………………………..……………………………………………………………………97

3.5. Identification of M. oryzae CBM-containing proteins that induce cell death in rice cells…101

3.6. Transient expression of M. oryzae genes encoding for CBM-containing proteins in non-host plant, N. benthamiana……………………………………………..……………………………………………………………..104

3.7. In-planta expression pattern of the M. oryzae genes encoding CBM-containing proteins,

MGG_05232 and MGG_08370………………….………………………………………………………...………………….107

3.8. Validation of the secretory feature of M. oryzae CBM-containing proteins, MGG_05232 and

MGG_08370 by yeast secretion analysis………………………………………………………………….……………..109

3.9. Schematic views of MGG_05232 and MGG_08370………………………………………….………….……112

3.10. Cellular localization of MGG_05232:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 6-12 hours after inoculation (HAI), to observe spore germination, and at 24-36 HAI to observe the invading IH………………………………………………………114

3.11. Cellular localization of MGG_08370:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 18-36 HAI…………………………………………………..……………115

3.12. Cellular localization of MGG_08409:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 24-36 HAI……………………………………………………..…………116

3.13. Target gene replacement of MGG_05232 in isolate KJ201, and knockout confirmation…………………………….………………………………………………………………………………………….…119

3.14. Southern blot analysis of the mgg_05232 knockout mutants…………………………………………120

3.15. Pathogenicity analysis of the mgg_05232 knockout mutants by a punch inoculation method……………………………………………………………………………………………………………………………………122

3.16. Pathogenicity analysis of the MGG_05232 overexpression mutants by a punch inoculation method…………………………………………………………………………………………………………………………………..123

3.17. Pathogenicity analysis of the mgg_05232 knockout mutants and the MGG_05232 overexpression mutants by spray method………………………………………………………..…………………….124

3.18. Growth analysis of the mgg_05232 knockout mutants on CM agar containing cell wall perturbing agents…………………………………………………………………..…………………………….…………………127

3.19. Pathogenicity analysis of the MGG_08370 overexpression mutants by a punch inoculation method………………………………………………………………………………………………………………...131 xi

3.20. Pathogenicity analysis of the MGG_08370 overexpression mutants by a spray method…………………………………………………………………………………………………………………………………..132

3.21. Pathogenicity analysis of overexpression MGG_08409 mutants by a punch inoculation method……………………………………………………………………………………………………………………….………….136

3.22. Pathogenicity analysis of overexpression MGG_08409 mutants by a spray method.....….137

3.23. Cellulose binding activity of MGG_08409……………………………………………………………………….141

3.24. Cellulose degradation activity of MGG_08409…………………….…………………………………………142

xii

LIST OF TABLES

2.1. Media and solutions used for rice protoplast system………………….……………………………………..46

2.2. The list of the 42 M. oryzae putative secreted protein genes selected for functional analysis…………………………………………………………………………………….…………………………………….…………52

2.3. Inhibition assays of MoCDIPs-induced cell death in rice protoplasts and N. benthamiana leaves………………………………………………………………………………………………………………………………..……..65

3.1. The list of 15 M. oryzae genes encoding CBM-containing effector proteins for functional identification……………………………………………………………………………………………………………….……………98

3.2. Comparison of conidiation, germination, and appressorium formation of M. oryzae isolate KJ201 wild-type, knockout mgg_05232-1, and mgg_05232-2…………………………….…………………128

A.1. List of putative expressed M. oryzae secretory protein genes identified using RL-SAGE,

MPSS, and SBS technologies……………………………………………………………….……………………….………….191

B.1 The list of 29 M. oryzae CBM-containing protein genes identified using RL-SAGE, MPSS and

SBS technologies……………………………………………………………………………………………….……….…………..209

C.1. The list of primers used in this study……………………………………………………………………………….210

xiii

Chapter 1

Introduction

Significance of rice and rice blast

Rice (Oryzae sativa) is one of the world’s most important crops and staple food for more than half of the world’s population. The demand of rice continues to increase as the population continues to grow. However, current rice production is not meeting this increase in demand.

Despite the increase of rice consumers, rice production decreased from the annual growth rate of 1.7% during 1990-2000 to 1.2% during 2000-2006 (Khush and Jena, 2009). This challenges us to improve better rice varieties with higher yield level and greater yield stability to overcome the losses caused by biotic and abiotic stresses.

Among biotic stresses, blast disease caused by ascomycete fungus Magnaporthe oryzae is the most important disease in rice worldwide (Ou, 1985; Howard and Valent, 1996). It causes significant crop losses in rice and is estimated to destroy up to 18% of the rice harvest annually

(Soanes et al., 2012). The severe outbreak of the blast fungus can lead to the death of rice seedlings or damage the grain-bearing structures, as well as hamper grain filling in mature plants (Howard and Valent, 1996; Talbot, 2003). The use of genetic resistance is the biological and economical option to fight ever-changing pathotypes of the devastating blast fungus.

Efforts to study blast resistance in rice have been extensive, approximately 85 major resistance

(R) genes have been mapped, and 18 R genes have been cloned (Wang et al., 2012). Many of them have been employed in the breeding program, however the problems of short durability of the monogenic blast resistance cultivars is a crisis due to the adaptation of the rice blast pathogen in a favor environment (Mackill and Bonman, 1992). Thus, several strategies, including multiline varieties, varietal mixtures, pyramiding of different types of major R genes, as well as breeding for quantitative or partial resistance based on minor genes or quantitative trait loci

(QTLs) have been recommended for extending the durability of resistance (Khush and Jena,

2009).

There is not only economic and social significance to the rice blast fungus, but rice and

M. oryzae pathosystem has become a model for the study of plant fungal interaction regarding to the availability of genome sequences of both rice (International Rice Genome Sequencing

Project, 2005) and M. oryzae (Dean et al., 2005), as well as the well-established molecular and genetic techniques (Ribot et al., 2008). These valuable resources will help to increase our understanding, on a molecular basis, of pathogenesis as well as plant cellular processes, in particular, host immune signaling during the rice-M. oryzae interactions. The outcome might open novel avenues to control fungal diseases.

Cytology of the rice blast infection process and disease symptom

M. oryzae is a hemibiotrophic, filamentous, haploid, heterothallic fungus classified in phylum Ascomycota, class Pyrenomycetes, order Diaporthales and family Magnaporthaceae

(Cannon, 1994) with the anamorph name Pyricularia grisea. The early stages of rice blast fungus infection arise from spore attachment to the leaf surface. The conidia, which are three-celled, asexual spores, recognize the hydrophobic and hard surface of rice leaves. The spores then germinate and produce germ tubes which later form appressoria, specialized structures at the end of germ tubes. The mature appressoria become melanized (Tucker and Talbot, 2001) and accumulation of glycerol generates high turgor pressure (as high as 8 MPa). The appressoria then form penetration pegs. With high turgor pressure, penetration pegs cause fungus to rupture plant cuticles and cell walls, then enter internal tissue (de Jon et al., 1997).

After penetration, fungus develops bulbous primary infection hypha (IH), encased in extra- invasive hypha membranes (EIHMs) in the first epidermis cell. Later, the lumen of this first infected cell is quickly filled with primary hypha. The IH move through plasmodesmata and breach the cell wall to reach the adjacent cell, then the IH form secondary infectious hypha invading through other cells (Kankanala et al., 2007). Within 4-5 days of penetration, symptoms of rice blast with necrotic tissue develope. In the necrotic lesion, the blast fungus sporulates and spreads to new plants (Figure 1.1A) (Ribot et al., 2008).

The symptoms of rice blast can be found in different parts of the infected plant (Tebeest et al., 2007). When M. oryzae infects susceptible rice leaves, the fungus produces the gray-green and water-soaked lesion with the darker green border appears as an early state of symptomatic state. The lesion expands quickly with a diamond shaped appearance, and in a later state,

3 the lesion becomes brown with a necrotic border. In addition, the center of the brown necrotic lesion is light tan in color, indicating fungus sporulation (Figure 1.1B). M. oryzae is able to infect at the node of rice necks as well, causing a rotten neck or neck blast (Figure 1.1B). When it infects at the rice panicles, a brown discoloration can be observed. The severe infection in panicles causes them to fall over.

Figure 1.1. M. oryzae infection cycle and rice blast symptoms. (A) M. oryzae starts its infection cycle when conidia spores land on the rice leaf surface; spores start to geminate and form appressorium to mediate penetration peg into host tissue, leading to fungal invasion and colonization. Later, infected cells form the blast lesion from which the fungus sporulates and spreads to new plants (Ribot et al, 2008). (B) Diversity of rice blast symptoms in different parts of rice; leaf, nodes, and necks (Cereal Knowledge Bank IRRI, 2009).

A contemporary view of plant immunity

Plants are subjected to microbial agents including bacteria, fungi and oomycetes.

Most of them fail to cause disease in plants; only pathogenic ones can be established (Chrisholm et al., 2006). Successful pathogens initially need to overcome the plant’s pre-formed barriers such as cuticles and cell walls, and also need to detoxify host constitutive antimicrobial compounds (Ingle et al., 2006). Once pathogens are able to overcome pre-formed barriers, they are faced with the plant non-self-surveillance system, which perceives pathogen invasion at the cell surface. This first layer of plant immunity is called “PAMP-triggered immunity (PTI)”, which is triggered upon the perception of molecular patterns common to many types of microorganisms, so called “pathogen-associated molecular patterns (PAMPs)” or “microbe- associated molecular patterns (MAMPs)”. Additionally, this perception of PAMPs or MAMPs at the cell surface is operated through pattern recognition receptors (PRRs); as a result, pathogen growth is restricted at the site of infection (Chrisholm et al., 2006). Nevertheless, plant pathogens have adapted the means to suppress PTI through evolution. Two general strategies are used for this purpose: interruption of the recognition cell surface, secretion another set of small molecules, so called “effectors” into host plants to interfere resistance mechanism and aid pathogenic microorganism parasitism (Abramovitch et al., 2003; Chrisholm et al., 2006). In turn, plants have evolved the means to detect effectors, subsequently eliciting the second layer of plant immunity, called “Effector-triggered immunity (ETI)”. ETI involves recognition of pathogen effectors or of the action of pathogen effectors by plant resistance (R) proteins. The outcome of

ETI limits pathogen growth before pathogen proliferation (Chrisholm et al., 2006).

Unsurprisingly, pathogens seem to have developed strategies to interrupt ETI by mutations in

6 effector proteins to avoid R protein recognition or ETI suppression by other effectors

(Houterman et al., 2008).

The most well-known PAMPs and PRR pair are flagellin, protein subunit of flagella from bacteria (Gomez-Gomez and Boller, 2002) and the Arabidopsis flagellin receptor, FLS2

(FLAGELLIN-SENSING 2). A synthetic 22 amino acid peptide of flagellin, a highly conserved part from N-terminal region, is found to be sufficient to act as potent elicitor (Felix et al., 1999).

Mutant screening for plants which were insensitive to flagellin resulted in identification of flagellin receptor FLS2 (Gomez-Gomez and Boller, 2002). In addition, recognition of flg22 by FLS2 mediates reactive oxygen species (ROS) generation, protein phosphorylation, mitogen activated protein (MAP) kinase signaling activation, PR proteins accumulation, and also restriction of pathogen growth (Felix et al., 1999; Asai et al., 2002; Zipfel et al., 2004). Other than flg22/FLS2 recognition, Escherichia coli Ef-Tu (Elongation factor thermo unstable) acting as a PAMP/MAMP was discovered (Kunze et al., 2004). Small peptides in an acetylated N-terminal region of EF-Tu, designated elf18 and elf26 were sufficient for host receptor activation in Arabidopsis (Kunze et al., 2004). Afterward, a corresponding receptor of elf18 and elf26, named EFR was identified by screening T-DNA insertion mutants for insensitivity to elf18 and elf26, but not to flg22

(Zipfel et al., 2005). In rice, a receptor-like protein known as CEBiP containing LysM transmembrane domain was discovered (Kaku et al., 2006). With the notion that chitin oligosaccharides have ability to induce plant defense response, using suspension-cultured rice cells to isolate plasma membrane proteins with high affinity binding to chitin leads to identification of CEBiP (Kaku et al., 2006). The recognition of chitin oligosaccharides by CEBiP brings about enhanced resistance to M. oryzae in rice plants (Kishimoto et al., 2010).

Subsequently chitin oligosaccharide perceiving chitin elicitor receptor kinase 1, CERK1 was identified and shown to be crucial for chitin signaling in Arabidopsis (Miya et al., 2007).

As aforementioned, the first layer of immunity can be counterattacked by effector proteins secreted from pathogenic microorganisms in either apoplastic or cytoplasmic spaces.

Nevertheless, plants also evolve to adapt other types of receptor to specifically recognize pathogen effectors either directly or indirectly. These plant receptors associated with ETI are R proteins, which are commonly represented in the large family of NB-LRR (nucleotide binding site-leucine-rich repeat) proteins. The outcome of recognition is often associated with a hypersensitive response, a form of rapid apoptotic cell death with local necrotic feature, which blocks the pathogen infection site (Jone and Dangl, 2006). Thus ETI is a more rapid, prolonged, and effective defense response than PTI. Different mechanisms in effector recognition by

R protein have been revealed. Direct interaction between the products of R genes and effector proteins was recognized, as demonstrated in flax resistant (R) protein and its corresponding Avr protein (Ellis et al., 2007). However, only a few studies reported direct interaction (Jia et al.,

2000). This leads to guard hypothesis of R gene function in which R proteins monitor or guard targets of their corresponding effectors (Dangl and Jones, 2001). For instance, Arabidopsis RPM1 recognizes phosphorylated forms of RIN4 caused by the action of AvrRpm1/AvrB, a corresponding Avr protein of RPM1. The recognition of the modified RIN4 leads to activation of R protein-mediated resistance (Mackey et al., 2002). Recently new model was proposed that

R proteins may monitor the mimic form of effector target, called a decoy protein (van der Hoorn and Kamoun, 2008).

Effector biology

Definition of the term “Effectors”

The term “effectors” has several different definitions within scientific community. In this dissertation, we employed a broad definition of pathogen effectors proposed by Kamoun’s group to define the term: “effectors” are all secreted pathogen proteins and secreted small molecules which alter host cell structure and function (Kamoun, 2006; Hogenhout et al., 2009).

With this broader definition, virulence factors or toxins associated with promoting infection, and avirulence factors or elicitors associated with inducing defense responses are considered as effectors (Kamoun, 2006; Hogenhout et al., 2009).

Considering the sites in host plants where effectors function, two classes can be found: apoplastic effectors and cytoplasmic effectors. Apoplastic effectors are the secreted molecules from pathogens which locate in extracellular space, where they carry out their function.

They are thought to interact with extracellular targets or plant surface receptors. In contrast, cytoplasmic effectors need to translocate inside the plant cell (Kamoun, 2006).

Effector secretion and effector delivery inside plant

Unlike plant pathogenic bacteria, the biology of effectors is still elusive in plant fungal pathogens, including in M. oryzae. In plant Gram-negative bacterial pathogens, translocation of effectors is mediated via type III secretion system (T3SS) (Espinosa and Alfano, 2006; Block et al.,

2008); however the analogous processes of effector delivery are not described in fungi. In fact

T3SSs inject effector proteins through a needle-like secretion structure, a continuous channel which delivers secreted proteins from bacterial cytoplasm into host cytoplasm (Cornelis and

Gijsegem, 2000). T3SSs are encoded by hrp (hypersensitive response and pathogenicity) genes.

Disruption of hrp genes causes loss of ability to elicit HR as well as ability to cause disease

(Lindgren et al., 1986). In summary, the principal function of hrp-encoded TTSS seems to be the translocation of effectors into the plant cytoplasm to facilitate pathogen colonization (Bretz and

Hutcheson, 2004).

Fungal pathogen effectors generally are produced and secreted through secretory pathways. In the initial step, most secretory protein synthesis takes place on free ribosomes in the cytoplasm, and then synthesized nascent proteins are bound to rough endoplasmic reticulum (ER) via specific signal sequences to complete their protein translation (Lodish et al.,

2000). Typically, eukaryotic signal peptides comprise of 20-30 amino acid residues. The N- terminus of signal peptides usually contain amino acid residues, providing a positive charge and a highly hydrophobic core which may facilitate to form proper topology of the protein during translocation, whereas C-terminus are hydrophilic. These signal peptides are cleaved from the polypeptide chain during its transfer into the ER lumen (Cooper, 2000). After, newly synthesized secreted proteins are localized in the ER lumen. They are incorporated into small transport vesicles which fuse to cis-Golgi reticulum and move toward to trans-Golgi cisterna afterwards.

The newly secreted proteins then are sorted into secretory vesicles where they are stored inside and prepared for exocytosis at the cell surface, through the plasma membrane (Lodish et al.,

2000).

Recently, studies based on M. oryzae in organization of secretory pathway have been revealed. A MgAPT2 coding a Golgi body-localized protein which involves in exocytosis pathway was well characterized. M. oryzae mgapt2 knockout transformants were found to loss the ability

10 to secrete of various extracellular proteins, pathogenicity, and the induction of HR in incompatible interaction (Gilbert et al., 2006). Furthermore, M. oryzae chaperon KAR2 and LHS1, putative Hsp70 family proteins, play a role in protein translocation in ER. Mutation of LHS1 displays defective secretion of a range of extracellular enzymes, and impacts pathogenicity as well as fails to locate the known avirulent protein, Avr-Pita, into BICs (Biotrophic interfacial complexes), previously known structure associated with M. oryzae effector localization (Yi et al.,

2009). In eukaryotic cells, SNARE (solution N-ethylmaleimide-factor attachment protein receptor) proteins have been implicated in intracellular membrane fusion of secretory vesicles

(Chen and Scheller, 2011). Recently, two SNARE proteins, MoSec22 and MoVam7 in M. oryzae were characterized. M. oryzae MoSec22 and MoVam7 are homologs of Saccharomyces cerevisiae Sec22 and Vam7p, respectively, which have been reported to function in vesicle trafficking (Cao and Barlowe, 2000; Yu and Lemmon, 2001). Complementation of MoSec22 or

MoVam7 in S. cerevisiae sec22 or vam7p mutants rescued their yeast phenotypes in sensitivity to cell wall perturbing agent, implicating that MoSec22 and MoVam7 may have functions similar to Sec22 and Vam7p. In addition, MoSec22 and MoVam7 displayed functions related to exocytotic transport extracellular enzymes, stress tolerance, growth, and pathogenicity in

M. oryzae (Song et al., 2010; Dou et al., 2011).

Once effector proteins are secreted via secretory machinery of plant pathogenic microorganism, they need to translocate in extracellular or intracellular space of host plants to exert their functions. Structures associated with effector delivery are distinct among pathogens.

Cladosporium fulvum, which causes leaf mold in tomato, penetrates infectious hypha inside apoplastic space where the fungus secreted effectors exist (Kombrink et al., 2011).

Some filamentous fungi such as rust and powdery mildew, or oomycetes such as Phytophthora species produce haustoria, a specialized structure invaginated inside host cell. The haustoria still remains separated from plant cytoplasm by double membrane system, so called extrahaustorial membrane (EHM) (Ellis et al., 2009). In rice, M. oryzae forms an invasive hypha (IH) structure during host invasion in rice plants. The IH is sealed in a plant membrane known as the extra- invasive hyphal membrane (EIHM), which is able to form distinct dome-shaped membrane caps at the primary hyphal tip as well as the filamentous IH hypha tip during invasion to adjacent cell

(Kankanala et al., 2007). This membrane cap is recognized as biotrophic interfacial complex (BIC) afterward (Figure 1.2) (Khang et al., 2010). Mosquera et al. (2009) identified M. oryzae BAS1-4 genes (Biotrohy-Associated Secreted genes) which are highly upregulated in biotrophic IH.

Interestingly, the four BAS proteins fused with fluorescent protein accumulate in BIC structures, implicating the role of BAS1-4 proteins during biotrophic invasion (Mosquera et al., 2009).

In addition, Khang et al. (2010) demonstrated that rice blast effectors translocate into rice cytoplasm. In Khang’s study, PWL2, the protein confers species-specific avirulence toward weeping lovegrass, Eragrostis curvula (Sweigard et al., 1995), and BAS1 are accumulated preferentially in BICs. Additionally, PWL2 and BAS1, fusing with nuclear-targeting fluorescent protein, are able to demonstrate nuclear localization, indicating that PWL2 and BAS1 need to be translocated from the BIC, across EHIM to enter into the cytoplasm in order to localize in the nucleus. Interestingly, it is likely that PWL2 move ahead of M. oryzae growth. Presumably it may pre-dispose host cells to infection (Khang et al., 2010).

Figure 1.2. Diagram of development of biotrophic interfacial complex (BIC) during rice-leaf sheath invasion. The pictures illustrate how PWL2 protein fusing with GFP accumulates in BIC. (A) Cartoon summarizing the BIC development. BIC associates with biotrophic interaction between rice-M. oryzae. M. oryzae invaded rice cell and formed primary IH, sealed in EIHM. Fluorescence can be observed in the BIC, located in the tip of primary IH and still remaining in the first BIC during bulbous IH differentiation. After the first-invaded-cell was completed invading with IH, the IH exhibited constriction when it crossed the plant cell wall in to next cell. In this stage, fluorescence disappeared from the BIC in previously invaded cell. By contrast, fluorescence can be observed again in the newly-invaded cell. (B) The fluorescence appeared in BIC structure in the first IH; after bulbous IH started forming, fluorescence still remained visible in BIC structure in first-invaded cell. The black arrows indicate fluorescence in BIC structure. (C) When IH started to form in adjacent cell. Fluorescence appeared in new BICs (new IH tips). By contrast, it disappeared from the first invaded-cell. The white arrows indicate fluorescence in BIC structures of the newly-invaded cell (Khang et al, 2010).

To translocate across the host membrane to cytoplasm, oomycete effectors require the conserved motif, i.e., RxLR-EER, in host translocation (Birch et al., 2006; Whisson et al., 2007).

The RxLR-EER motif is in the N-terminal region adjacent to a signal peptide. In fact, the core conserved RxLR, comprising of Arginine-any kind of amino acid-Leucine-Arginine sequences, frequently presented with less well conserved EER. In addition, the EER motif comprises of

Glutamic acid-Glutamic acid-Arginine sequences within 30 amino acid residues toward the C- terminus of the motif sequences (Govers and Bouwmeester, 2008). Interestingly, the RxLR motif resembles the PEXEL/VTS, a Plasmodium export element/vacuolar targeting signal of human malaria pathogen, Plasmodium sp. (Bhattacharjee et al., 2006). Whisson et al. (2007) provided the first evidence that RxLR-EER motif is involved in host translocation. In the study, an RxLR-EER containing protein Avr3a was used as a reporter to determine translocation effect in transgenic plants carrying R3a. The results demonstrated that RxLR-EER motif is required neither for protein secretion, nor for targeting haustoria. In fact, this motif is required for effector translocation inside host cells, since mutation of RxLR-EER motif causes the failure of Avr3a to elicit HR in plants carrying R3a (Whisson et al., 2007). Similar results were observed by Dou et al.

(2008) who reported that RxLR-dEER motif, including surrounding sequences, are required to deliver effector proteins in to plant cell.

Recently, a similar conserved motif, an LxAR, was found in M. oryzae. A predicted motif

([LI]x-AR[SE][DSE]) as well as [RK]CxxCxxxxxxxxxxxxH were found in AvrPii and AvrPiz-t, respectively (Yoshida et al., 2009; Liu et al., 2010). Furthermore, Li and Yang (2011) developed algorithms to search for conserved motif RxLx, similar to RxLR motif of oomycete, across 1,270

M. oryzae secreted proteins, presenting in the 5th edition of M. oryzae genome database of

Broad Institute of MIT and Harvard (www.broadinstitute.org). In total, 297 putative secreted proteins were found to contain RxLx motif located within 100 amino acid residues downstream of N-terminal predicted signal peptide. However, further biological experiments are required to verify a role in translocation of all proposed conserved motifs.

As noted above, it is most likely that intracellular structures involving effector delivery do not directly interact with the cytoplasmic space of host cells. Instead, these structures still remain separated from the cytoplasm by other membranes. Thus, cytoplasmic effectors need to be taken up from apoplastic space into host cytoplasm to exert their functions. Recently, the host cell surface molecule PI3P, phosphatidylinositol-3-phosphate, has been reported to mediate translocation inside host cell. It has been suggested that RxLR motifs of oomycete effectors, as well as degenerated RxLR motif from fungal pathogens, facilitate their effectors to bind to PI3P and then mediate effector endocytosis (Kale et al., 2010).

Functions of pathogen effectors during plant-pathogen interaction

Plant pathogens secrete effectors inside host plants to modulate host immunity and to facilitate their parasitism in the host plant. The processes are involved in secretion of effector molecules, either in extracellular space or intracellular space, to disarm host defense response.

(Ellis et al., 2009; De Jonge et al., 2011). However, several pathogen effectors are recognized by host resistance proteins either directly or indirectly and elicit host defense response.

These effectors are considered to have avirulence function.

Effectors are able to display their virulence function either in the extracellular space or in cytoplasmic space of host cells. The virulence functions of apoplastic effectors have been

15 revealed in a number of fungi and oomycetes. Most likely the functions of apoplastic effectors are related to enzyme inhibitors as well as prevention of PTI. As demonstrated in Phytophthora sojae, glucanase inhibitors, i.e., GPI1 and GIP2, are secreted effector proteins that inhibit soybean GaseAE, and endo-beta-1,3 glucanase, which is involved in plant defense (Rose et al.,

2002). Furthermore, Avr2 from Cladosporium fulvum was demonstrated to inhibit host cysteine proteases such as Rcr3 and Pip1, which are involved in plant immunity (Krüger et al., 2002;

Rooney et al., 2005). In addition, the C. fulvum effector Avr4 containing chitin-binding domain is secreted in plant extracellular space and binds to chitin in order to protect chitinous hypha from plant chitinase (van den Burg et al., 2006; van Esse et al., 2007). Recently, a novel function of apoplastic effector to evade PTI was revealed. C. fulvums Ecp6 containing LysM domain was demonstrated to bind to chitin oligosaccharides. It was postulated that Ecp6 function in chitin sequestering prevents chitin-triggered immunity in plants (de Jonge et al., 2010). Interestingly, similar function was also demonstrated in M. oryzae Spn1 (Mentlak et al., 2012).

Cytoplasmic effectors employ different strategies to manipulate host cellular functions.

It is postulated that a fundamental function of effectors is to suppress host defense (Hogenhout et al., 2009). As state above, perception of PAMPs by PRR activates a MAP kinase signaling.

This PTI pathway can be inhibited by several plant pathogenic effectors. The Pseudomonas syringae Avr effectors, AvrPto and AvrPtoB, suppress PTI by targeting PAMP receptors; FLS2,

EFR, and CERK1 (Xiang et al., 2008). Also, P. syringae HopAI1 interacts with MPK3 and MPK6 resulting in PTI suppression (Zhang et al., 2007). Besides targeting to MAP kinase signaling cascade, the pathogenic effector also targets plant cellular trafficking. For instance, P. syringae

HopM1 interacts with AtMIN7 for degradation. Indeed AtMIN7 involves in the activation of ARF

GTPases which function in intercellular vesicle trafficking (Nomura et al., 2006). In addition, pathogenic effectors have been implicated in interfering with chloroplast function.

For examples, P. syringae HopI1 was shown to target to chloroplast as well as to suppress host defense (Jelenska et al., 2007). Also the wheat fungus Pyrenophora tritici-repentis secretes ToxA, which is internalized into wheat mesophyll and localized in chloroplasts (Manning et al., 2005) to interact with a chloroplast-localized protein (Manning et al., 2007). Furthermore, there are evidences to support the notion that pathogen effectors have a function in the host nucleus.

For instance, TAL effectors, i.e., AvrBs3, AvrXa27, and pthXo1 from Xanthomonas sp. were found to have a role in regulation of host target gene expression (Marois et al., 2002; Gu et al., 2002;

Yang et al., 2006). It was also reported that pathogen effectors play a role in interfering with

RNA metabolism of host proteins. For example, P. syringae pv. tomato HopU1, acting as mono-

ADP-ribosyltransferase (ADP-RT) targets Arabidopsis GR-RBPs, RNA binding proteins. It performs

ADP rybosylation of host GR-RBPs protein such that HopU1 interferes with host RNA metabolism, possibly by decreasing the ability of host RNA binding protein to bind to RNA

(Fu et al., 2007). Interestingly, several studies imply that pathogen effectors play a role involving in the 26S proteasome pathway for protein degradation in their host. Proteins degraded via 26S proteasome pathway are usually ubiquitinated by E3 ligases, one of the enzymes involved in ubiquitination. For instance, Rastonia solanacearum secreted F-box-containing GALA effectors shown to interact with Arabidopsis Skp1-like proteins. In fact, both GALA effectors and host

Skp1-like proteins play their functions in ubiquitination as part of ubiquitin E3 ligase complexes.

Furthermore, the F box domain was shown to be important for virulence function in GALA. Thus, it is most likely that GALA effector may take advantage from host ubiquination component to alter host protein function (Angot et al., 2006). As stated above, HopM1 interacts with

Arabidopsis AtMIN7. It was also demonstrated that HopM1 degrades AtMIN7 through the ubiquitin proteasome system (Nomura et al., 2006). In addition, the role of effectors in evading of ETI mediated by 26S proteasome pathway was demonstrated. P. syringae AvrPtoB lacking its

E3 ligase domain was shown to interact with tomato Fen kinase protein, triggering ETI in tomato plants carrying the R protein Prf (Rosebrock et al., 2007). However, the full-length AvrPtoB containing C-terminal E3 ligase domain was demonstrated to interact with Fen, resulting in degradation of Fen protein through the 26S proteasome pathway. In addition, the degradation of Fen in tomato plants leads to disease susceptibility. Thus, it is most likely that AvrPtoB evades

ETI by employing an E3 ligase function for degrading the Fen protein (Rosebrock et al., 2007).

Another example of effector function related to E3-ligases was demonstrated in Phytophthora infestans AVR3a which was shown to target host ubiquitin E3-ligase CMPG1. Previously, CMPG1 was shown to be involved in plant defense (González-Lamothe et al., 2006). It is postulated that

AVR3a function promotes suppression of plant immunity. AVR3a performs stabilization of host protein CMPG1 by manipulation of the host ubiquitin proteasome system (Bos et al., 2010).

In our laboratory, we have shown that M. oryzae AvrPiz-t plays a role in PTI suppression in rice plants. AvrPiz-t interacts with the rice E3 ubiquitin ligase APIP6 (AvrPiz-t Interacting Protein 6), and to suppress E3 ligase activity of APIP6 in vitro. Silencing of APIP6 reduces ROS generation triggered by flg22, and also enhances susceptibility to compatible M. oryzae isolate. Thus, these results suggested that AvrPiz-t targets a component of host 26S proteasome pathway for suppression of PTI (Park et al., 2012).

Characterization of M. oryza effectors

In M. oryzae, a larger number of genes (up to 1,306) coding for putative secreted proteins have been predicted from the genome of a laboratory strain 70-15 (Dean et al., 2005;

Yoshida et al., 2009). To date, seven effectors have been confirmed as Avr proteins. PWL1 and

PWL2, members of PWL (pathogenicity towards weeping lovegrass) gene family were the first two cloned among all M. oryzae Avr genes. Indeed, both PWL1 and PWL2 confer species-specific avirulence toward weeping lovegrass and finger millet. However, no avirulence function was observed in rice plants (Kang et al., 1995; Swigard et al., 1995). With map-based cloning, Orbach et al. (2000) cloned the second Avr gene, Avr-Pita, which encodes a putative protein of 223 amino acids in size, and is predicted to contain fungal zinc-dependent metalloprotease (Orbach et al., 2000). The mature protein is 176 amino acids in size after processing, with the avirulence capability toward its cognate R protein Pi-ta (Orbach et al., 2000). Another such study was performed by Li et al. (2009), who employed map-based cloning strategies to clone AvrPiz-t, which confers avirulence on rice carrying the R gene, Piz-t. This gene encodes a putative secreted protein predicted to be unique across other fungi, and no homologues are presented in the M. oryzae genome. Recently, Yoshida et al. (2009) performed a comparative genome study between M. oryzae isolate 70-15 and isolate Ina68. They found that an additional 1.68 Mb of

DNA sequence present in only isolate Ina68, but not in isolate 70-15. The novel 1.68 Mb region contains 316 additional candidate effectors. With the association genetics strategy, three Avr genes, i.e., AvrPia, AvrPii, and Avr-Pik/km/kp were identified and confer avirulence function to rice plants carrying their cognate R genes.

Besides seven M. oryzae effectors that are Avr proteins, the role of few M. oryzae effector in virulence or pathogenesis is known. Currently, a new mechanism used by M. oryzae effector protein Slp1 (Secreted LysM Protein1) was revealed for the avoidance of rice PTI.

Slp1 was predicted to have LysM domains, previously known to bind to chitin oligosaccharides

(de Jonge et al., 2010). Slp1 protein-fusing fluorescent protein was shown to accumulate at rice-

M. oryzae interface during the early stage of infection. Furthermore, it was demonstrated that

Slp1 binds to chitin, and has the capability to evade chitin-triggered immunity via competition with CEBiP in chitin binding. The Slp1 mutation affects the virulent function of M. oryzae.

Taken together, these results suggest that Slp1 has a function in chitin sequestering to evade chitin-triggered immunity, thus contributing to rapid fungus spread during infection (Mentlak et al., 2012). In our laboratory, Park et al. (2012) elucidated the virulence function of the

M. oryzae avirulence effector AvrPiz-t. AvrPiz-t is secreted into BIC and translocated in the rice cytoplasm. Transgenic rice ectopic expressed AvrPiz-t gene in the Piz-t lacking rice background was shown to suppress ROS generation triggered by flg22 and chitin, as well as to enhance susceptibility to M. oryzae. Collectively, these results suggest that AvrPiz-t functions to suppress

PTI in rice.

Preliminary results in the identification of In-planta expressed secreted effector genes from

M. oryzae during infection.

Over the past decades, the studies of molecular processes related to M. oryzae infection in rice plants have been focused on the process of conidia attachment, germ tube germination, appressorium formation and penetration (Howard and Valent, 1996; Talbot, 2003; Dean et al.,

2005). However, the molecular events that occur after appressoria penetration of the plant cell wall, and the molecular mechanisms underlying the M. oryzae-rice interaction, remain elusive

(Gilbert et al., 2006). As stated earlier, a large number of genes (up to 1306) coding for putative secreted proteins have been predicted from the genome of M. oryzae isolate 70-15 (Dean et al.,

2005; Yoshida et al., 2009). However, few effector proteins have been identified and characterized in their functions. To identify putative in planta expressed secreted effector proteins during infection, we employed deep transcriptome analysis approaches, including robust long serial analysis of gene expression (RL-SAGE) (Gowda et al., 2004), massive parallel signature sequencing (MPSS) (Brenner et al., 2000; Meyers et al., 2004; Nobuta et al., 2007), and sequencing-by-synthesis (SBS) (German et al., 2008; Venu et al., 2011) approaches to study gene expression profiles of rice and M. oryzae either compatible or incompatible interaction.

Data obtained from the three transcriptome analysis technologies were combined with two published data sets of M. oryzae secreted genes from Dean et al. (2005) and from Choi et al.

(2010) to identify M. oryzae putative secreted effector proteins for our study.

Gene expression profiling in blast-infected rice leaves

To obtain more comprehensive gene expression profiles of M. oryzae during compatible and incompatible interactions with rice, we constructed one RL-SAGE, eleven MPSS and seven

SBS libraries for deep sequencing. The RL-SAGE library was generated from rice (cv. Nipponbare) leaves inoculated with the compatible isolate Che86061 at 96 hpi (Figure 1.3). A total of 18,154 significant signatures were obtained from the library. Among them, 3,105 (17.1%) and 12,263

(67.5%) significant signatures matched to the M. oryzae and rice genomes, respectively.

The unmatched signatures may be due to sequencing errors or are located in the sequencing gaps in both genomes. Only 14 signatures matched to both the M. oryzae and rice genomes, signifying that the majority of the signatures were genome-specific. We identified 3,091 signatures specifically matching to the M. oryzae genome, which correspond to 3,000 previously annotated M. oryzae genes.

Eleven MPSS libraries were generated from the leaves of wild-type or transgenic

Nipponbare plants carrying the blast resistance gene Pi9 (Qu et al., 2006). The plants were inoculated with M. oryzae isolate KJ201 during the compatible (3, 6, 12, 24, 48 and 96 hpi) or incompatible interactions (3, 6, 12, 24, and 48 hpi) (Figure 1.3). As expected, more signatures matched to the M. oryzae genome in the compatible interactions compared to those in the incompatible interactions. A total of 57,671 significant signatures were obtained from the five incompatible interactions MPSS libraries. Among these, 724 (1.2%), and 38,024 (65.9%) significant signatures uniquely matched to the M. oryzae and rice genome respectively.

From the six compatible interaction libraries, a total of 63,132 significant signatures were obtained. Among them, 2,545 (4%), and 41,784 (66.1%) significant signatures uniquely matched

22 to the M. oryzae and rice genomes, respectively. All together 3,216 annotated M. oryzae genes were identified from both the compatible and incompatible MPSS libraries.

The same leaf tissues used for the generation of the MPSS libraries (the compatible interaction at 6, 12, 24, and 96 hpi, and the incompatible interaction at 6, 12, and 24 hpi) were used for the construction of the seven SBS libraries (Figure 1.3). A total of 65,299 significant signatures were obtained from the three incompatible interaction SBS libraries. Among them,

3,492 (5.3%) and 49,706 (76.1%) significant signatures specifically matched to the M. oryzae and rice genomes, respectively. A total of 68,825 significant signatures were obtained from the four compatible interaction SBS libraries. Signatures matching to the M. oryzae genome were 5,283

(7.7%) and those matching to the rice genome were 50,756 (73.7%). The SBS signatures from both compatible and incompatible interactions together identified 4,781 annotated M. oryzae genes. All together, a total of 6,413 annotated M. oryzae genes expressed during infection process were identified using the three expression profiling technologies (Figure 1.3).

Figure 1.3. Summary statistics for gene expression profiling by RL-SAGE, MPSS and SBS, and identifying of in-planta expressed M. oryzae genes encoding putative secreted protein.

Identification of genes encoding putative secreted protein expressed during infection

Secreted proteins are known to play essential roles during fungal-plant interaction

(Rep, 2005; Zhang and Zhou, 2010). Thus, we focused on the analysis of the secreted protein genes that were identified in the transcriptome libraries described above. To obtain most putative secreted protein genes from the in-planta expressed gene collections, we used two

M. oryzae secreted protein datasets by Dean et al. (2005) (referred to as Dataset I) and by Choi et al. (2010) (referred to as Dataset II) as references for manual annotation. A total of 851 distinct secreted protein genes were identified from both datasets (Figure 1.3, Appendix A,

Table A.1). About 85.7% (264/308) of the putative secreted protein genes identified in Dataset I were present in Dataset II (Figure 1.4D). When comparing among RL-SAGE, MPSS and SBS libraries made from rice leaves inoculated with compatible isolates at the same time-point

(96 hpi) (RL-SAGE-96 h, MPSS-96 h, and SBS-96 h), over two times more secreted protein genes were identified from the SBS-96 h library than from the other two libraries in both Dataset I and

II (Figure 1.4B and C).

To gain more insight on the function of in-planta expressed secreted proteins involved in the rice-M. oryzae interaction, we conducted a gene ontology (GO) based classification.

This analysis revealed that most in-planta expressed secreted proteins are associated with metabolic processes, followed by developmental processes, cellular processes, and multicellular organismal processes (Figure 1.5A). For molecular functions, most in-planta expressed secreted proteins are associated with catalytic activity and binding (Figure 1.5B)

Figure 1.4. Gene expression profiling of M. oryzae during its interaction with rice. (A) Clustering analysis of all M. oryzae genes identified in the libraries of RL-SAGE-96 h, MPSS-96 h, and SBS-96 h, respectively. (B) Clustering analysis of putative M. oryzae secreted protein genes retrieved from Dataset I (Dean et al., 2005) in RL-SAGE-96 h, MPSS-96 h, and SBS-96 f, respectively. (C) Clustering analysis of putative M. oryzae secreted protein genes retrieved from Dataset II (Choi et al., 2010) in RL-SAGE-96 h, MPSS-96 h, and SBS-96 h, respectively. (D) Clustering analysis of putative M. oryzae secreted protein genes in all time points libraries retrieved from Dataset 1, and Dataset II, respectively.

Figure 1.5. Gene Ontology (GO) annotation of In-planta expressed M. oryzae putative secreted protein. (A) Classification based on Biological Process (B) Classification based on Molecular Function.

Research hypothesis and objectives

Our hypothesis states that M. oryzae putative effectors that were identified during rice -

M. oryzae interaction play an important role facilitating colonization and fungal growth during infection. The main objectives of this dissertation were (1) to screen for novel M. oryzae effectors that are involved in fungal pathogenicity or host cell death, and (2) to functionally characterize these effectors at the molecular and biochemical levels. In the second chapter, we will present the results from the first objective, where we developed few approaches to identify the novel effectors, particularly those involved in cell death induction, as well as characterization of these novel cell-death inducing effectors. In the third chapter, we will present the results from the characterization of a specific group of cell death inducing effectors that contain carbohydrate binding module (CBM), including on the pathogenicity, protein accumulation during infection process, and biochemical function of the CBM-containing effectors. In the last chapter, we will summarize the main findings from this dissertation project and present future perspectives for the continuation of this study.

Chapter 2

Identification and Characterization of In-planta Expressed Secreted Effectors

from M. oryzae that Induce Cell Death in Rice

Introduction

During infection stage, plant pathogenic microorganisms secrete proteins, so called

“effectors”, in their host to modulate host cell processes and facilitate parasitism (Kamoun,

2007). As reviewed in chapter 1, significant advances have been made in discovery and functional characterization of pathogenic bacteria effectors that provide better understanding of bacterial pathogenesis as well as plant immunity (Feng and Zhou, 2011). By contrast, the studies on fungal effectors, including M. oryzae effectors have lagged behind those of bacterial effectors.

In M. oryzae, a large number of genes (up to 1,306) coding for putative secreted proteins have been predicted from the genome of laboratory isolate 70-15 (Dean et al., 2005;

Yoshida et al., 2009). To date, seven M. oryzae secreted proteins, i.e., PWL1, PWL2 (Kang et al.,

1995; Sweigard et al., 1995), Avr-Pita (Orbach et al., 2000), Avr-Pia, Avr-Pii, Avr-Pik/km/kp

(Yoshida et al., 2009), and AvrPiz-t (Li et al., 2009) have been confirmed as avirulence (Avr) proteins presumably recognized by the corresponding resistance gene products. In addition, a few secreted proteins, i.e., MPG1 (Talbot et al., 1993), EMP1 (Ahn et al., 2004), MHP1

(Kim et al., 2005), MSP1 (Jeong et al., 2007), MC69 (Saitoh et al. 2012), and Slp1 (Mentlak et al.,

2012) are required for pathogenicity. In addition, four biotrophy-associated secreted proteins

BAS1-4 have been characterized (Mosquera et al., 2009). However, the majority of M. oryzae secreted proteins have not been experimentally tested for their functions in pathogenicity and interaction with host targets.

To gain more insight on the function of effectors during plant-microbe interactions, several functional genomic pipelines have been developed to identify and functionally characterize effectors. A pipeline includes: 1) use of data mining tools for effector identification and 2) functional assays to analyze and validate candidate effector genes (Kamoun, 2006).

This approach has proven to be successful in effector discoveries, such as Phytophthora infestans EPI1, apoplastic effectors (Tian et al., 2004), and P. infestans AVR3a (Bos et al., 2003).

To identify novel M. oryzae effectors, we established a functional genomic pipeline in which, firstly, the M. oryzae putative effector genes are identified by integrating the data from gene expression profiling during the rice-M. oryzae interactions with the published data of

M. oryzae secreted proteins (Dean et al., 2005; Choi et al., 2010). Secondly, we employ transient expression assays in rice protoplasts for cell death-function analysis of the effectors.

Thus, the purpose of the literature review in the chapter is to provide the foundation on how to identify the M. oryzae putative effectors used in this study; the potential use of transient expression in rice protoplasts for effector-functional analysis; as well as the significance of cell death in plant-pathogen interactions.

In-planta Expressed Secreted Proteins of M. oryzae

As described in chapter 1, we have established three different gene expression profiling approaches, including RL-SAGE, MPSS, and SBS to examine transcriptome profiles of infected rice leaves. A total of 6,413 in-planta expressed fungal genes including 851 genes encoding predicted effector proteins were identified. These putative secreted proteins may play important roles during M. oryzae-rice interactions.

Transient Protoplast System for Gene Functional Analyses in Rice

The rapid growth in genomic data has impelled gene functional characterization in plants. However, the function of a vast number of the genes is still elusive. Typically, candidate genes should be under- or over-expressed in transgenic plants in order to obtain a phenotype.

The generation of stable transgenic lines has provided a powerful tool for investigating gene functions in plants. The relatively expensive cost and time-consuming process for stable transformation restrict the use of this approach, particularly for the large-scale assays.

By contrast, the use of transient expression assay helps to facilitate gene functional analysis in a large-scale, since gene activity can be measured in a way that is accessible and immediate following DNA delivery (Deskeyser et al., 1990; Sheen, 2001; Chen et al., 2006). The transient expression method has been routinely used in plants for determining promoter activity, examining subcellular localization and targeting of protein (Bruce et al., 1989). Several techniques have been employed for the transient expression system; among them, transient expression assay utilizing protoplasts is one of the widely used approaches to analyze gene activity in plants.

Plant protoplasts are usually isolated from leaf tissue or suspension culture cells.

This method has been proven to be a versatile system for gene functional analysis, since mesophyll protoplasts still retain their cell identity and differentiated state (Chen et al., 2006).

The mesophyll protoplasts derived from leaf tissue have been widely utilized for study of gene function in several plant species, such as maize, Arabidopsis (Sheen, 2001), and tobacco

(Tao et al., 2002). By contrast, the difficulty in protoplast isolation due to rice leaf structure and the loss of differentiated state in rice protoplasts isolated from suspension culture cells impede their use in gene functional analysis in rice. In our laboratory, Chen et al. (2006) have established an efficient method for rice protoplasts isolation, in which a large number of rice protoplasts can be obtained from rice stem and sheath tissues of young seedlings, approximately 40-fold higher than the yield of protoplasts isolated from leaves of the same seedlings when using the condition described in the paper (Figure 2.1). With the PEG-mediated transfection procedure

(Tao et al., 2002), high-efficiency transient expression of exogenous genes in rice protoplasts can be reached (Chen et al., 2006).

Figure 2.1. The improved rice protoplast isolation method. (A) Large amounts of protoplasts can be obtained from stem and sheath tissues of young rice seedlings. (B) Comparison of the yield of protoplasts isolated from stems and sheaths. (C) High efficiency of gene transfection and expression in rice protoplasts. Rice protoplast transfection efficiency was checked using a GFP driven by the constitutive 35S promoter. The percentage of the transfected cells was routinely scored in the range between 50% and 70% (Chen et al., 2006).

The Potential Use of the Rice Protoplast System for Functional Analysis of Putative effectors from M. oryzae

Transient gene expression system is one of the potential approaches to examine elicitor activity of pathogen effectors in plants. Mindrinos et al. (1994) developed a transient assay to test specificity of the RPS2 gene for an AvrRpt2-generated signal. The approach employed co-bombardment to express RPS2 as well as a reporter gene, Escherichia coli uidA gene encoding B-glucuronidase (GUS) in plants pre-infected with Psuedomonas syringae carrying

AvrRpt2. By using this method, the specificity of R-Avr genes can be determined by investigating the level of GUS activity. The low level of GUS activity indicates the cell death phenotype which is the outcome of the interaction. With the modification of the transient expression system described by Mindrinos et al. (1994), Jia et al. (2000) optimized the approach to analyze the function of the Avr-Pita protein in intact rice seedlings using particle bombardment to co-introduce the test gene and a GUS reporter gene.

In our laboratory, we modified the transient expression system to analyze the function of M. oryzae secreted proteins in rice cells. Instead of using particle bombardment, we employed the protoplast system for expression of interesting genes. The protoplast system has several advantages over the use of the bombardment-mediated system, including high efficiency and repeatability of transfection as well as facile assay of transfected samples.

Furthermore, we developed a plant expression vector system, called “Zero background T-vector system (ZeBaTA)” to express M. oryzae secreted protein-encoding genes in rice protoplasts for functional analysis (Chen et al., 2009). The ZeBaTA system provides simple, highly-efficient direct cloning of PCR-amplified DNA fragments with almost no self-ligation. The improved

T-vector system takes advantage of the restriction enzyme XcmI to generate a T-overhang after digestion. Thus PCR amplification fragments can be easily cloned due to the ability of terminal transferase of some DNA polymerases to add a 3’A overhang for each end of PCR product.

In addition, the negative selection marker gene ccdB was also included in the ZeBATA cloning vector to eliminate the self-ligation background after transformation (Figure 2.2A). Moreover, to express gene in rice protoplasts, a plant expression vector was constructed, which employed a maize ubiquitin promoter (Christensen and Quail, 1996) to drive high-level expression genes of interest (Figure 2.2B). Thus, this system facilitates large scale gene cloning and functional analysis (Chen et al., 2009).

Figure 2.2. Construction of the ZeBaTA system. (A) Schematic representation of direct cloning of PCR product using the ZeBaTA vector system. The linker of the vector (in grey) is removed after XcmI digestion, yielding a linearized T-vector. (B) ZeBaTA-based expression vector for gene overexpression in rice protoplasts.

Programmed Cell Death in Plant-Pathogen Interactions

Cell death is crucial for eukaryotes in term of maintaining tissue and organ homeostasis in collaboration with cell proliferation, growth, and differentiation (Gadjev et al., 2008).The term

“Programmed cell death (PCD)” refers to a genetically controlled process which involves in selective elimination of unwanted or damaged cells in eukaryotes (Gadjev et al., 2008).

Plant-pathogen interaction involves manipulation of PCD pathways. It is associated with either disease resistance or susceptibility, depending on the infection stage and pathogen’s lifestyle

(Devarenne and Martin, 2007). During a resistant interaction, PCD is induced, leading to a process called “hypersensitive response (HR)” which leads to pathogen growth restriction.

In plants without genetic disease resistance, pathogens secrete molecules that serve as virulence factors to facilitate their parasitism. These secreted molecules involve PCD by either cell-death induction or suppression of cell death (Greenberg and Yao, 2004).

The well-known cell death response in plants is HR associated with a resistance response. As mentioned in chapter 1, plants employ two layers of immune system to combat pathogen attack. The first layer is referred to as PTI (PAMPs-triggered Immunity), triggered by the recognition of PRRs (Pattern Recognition Receptors) to PAMPs (Pathogen-Associated

Molecular Patterns). The second layer is referred to ETI (Effector-triggered Immunity), triggered by recognition of the resistance proteins to their corresponding Avr proteins, or to the results of

Avr actions. It is well known that the latter layer of immunity, ETI, is often associated with the HR.

During HR, plants sacrifice some of its cells by rapidly collapsing tissues surrounding the site of pathogen infection. As a result, HR restricts the growth of pathogen. This localized 37 response often collaborates with the systemic acquire resistance, induced in the distal parts of plants. In addition, varieties of phenolic compounds are synthesized and deposited to strengthen cell walls. Furthermore, phytoalexin and proteins with antimicrobial activity so called

“pathogenesis related proteins” are synthesized and accumulated to restrict the propagation and development of the pathogen (Dangl et al., 1996).

Majors players associated with the activation of HR are reactive oxygen species (ROS), nitric oxide (NO), calcium and proton pumps, mitogen-activated protein kinases (MAPKs), and salicylic acid (SA) (Iakimova et al., 2005). The initial responses of the host in an incompatible reaction are rapid ion fluxes through the plasma membrane and a burst of H2O2 and superoxide anions, leading to inward Ca+2 activated MAPKs cascades, global transcriptional reprogramming, and rapid cell death. ROS is biphasic; the shorter wave in the first phase function as a signal, while the second phase is prolonged and provides sustained ROS production for PCD initiation

(Lamb and Dixon, 1997). ROS, including hydrogen peroxide, super oxide anions, and hydroxyl radicals, enhances the lipid peroxidation which affects membrane permeability, alters some essential proteins, and causes DNA damage (Baker et al., 1993). In addition, the importance of

NO in HR was established in several works. De Pinto et al. (2002) demonstrated that synergistic

NO and H2O2 are important factors in the initiation of cell death. In addition, it has been shown that SA enhances the formation of ROS, as well as modulates the inhibition of catalase and ascorbate peroxidase, the ROS removal enzymes in plants. These processes are coordinated by the MAPK cascades (Iakimova et al., 2005).

Besides plant disease resistance, PCD also has been associated with susceptible interactions. A number of pathogen effectors such as toxins act as virulence factors and elicit

PCD (Spassieva et al., 2002; Gechev et al., 2004; Chivasa et al., 2005; Manning and Cluffetti,

2005). Manning and Cluffetti (2005) demonstrated that Pyrenophora tritici-repentis ToxA need to cross the plasma membrane from apoplasm. Its virulence function in toxicity is required the internalization of ToxA into cells. The AAL-toxin and FB1, produced by the tomato pathogen

Alternaria alternate, and Fusarium verticillioides, respectively act as sphingosine analogues to inhibit ceramide synthase, a key enzyme in sphingosine metabolism leading to cell death

(Spassieva et al., 2002). FB1 activates extracellular ATP depletion, which may be a general feature of hypersensitive cell death (Chivasa et al., 2005). Cochilobolus victoriae produces victorin, a host-selective toxin which is able to trigger PCD in oats (Navarre and Wolpert, 1999).

Victorin causes chromatin condensation, DNA laddering, and cell shrinkage, the morphological appearances found in animal apoptosis (Coffeen and Wolpert, 2004). The Victorin toxin was found to hijack HR by interacting with CC-NBS-LRR protein LOV1. The outcome of the interaction contributes to disease susceptibility to C. victoriae in Arabidopsis (Lorang et al., 2007).

Research hypothesis and research objectives

In this chapter, the specific aim is to identify and characterize in-planta expressed cell death-inducing effectors from M. oryzae. Previously, 851 genes encoding predicted effector proteins were identified using our established gene expression profiling approaches; RL-SAGE,

MPSS, and SBS. As well-known functions of phytopathogenic effectors either in cell death induction or in cell death suppression have been demonstrated in the past decade, we hypothesize that our predicted effector proteins from M. oryzae during the infection stage contain a number of cell death inducing effectors. Identification of cell death inducing effectors may lead to better understanding of pathogenesis of rice blast fungus, as well as of plant immunity.

Materials and Methods

Plant materials and fungal strains

Rice cultivar Nipponbare seedlings were grown in a growth chamber (Conviron Ltd.,

Winnipeg, Canada) with 80% relative humidity, 12 hours of light (500 umol photons m-2sec-1) at

26oC followed by 12 hours of dark at 20oC. M. oryzae isolate KJ201 was maintained in frozen storage and cultured on oatmeal agar plates (30 g oatmeal and 15 g agar in 1 L distilled water) at

25oC in dark condition for 7 days, and then under continuous light condition for 7 days.

Rice inoculations were performed on three-week-old rice seedlings. A suspension of 2x105 spores ml-1 in 0.01% tween20 solution was sprayed on rice plants, and the infected tissues were collected at 0, 24, 48, 72, 96, and 120 hours after inoculation for reverse transcription polymerase chain reaction (RT-PCR) analysis.

M. oryzae isolate KJ201 was grown in minimal medium lacking nitrogen source (0.5 g/L

KCl, 0.5 g/L MgSO4, 1.5 g/L KH2PO4, 0.1% (v/v) trace elements) at 25oC, 200 rpm for 10 days in dark condition. The harvested mycelia were filtered and grinded, then a sample was taken immediately into a -80oC freezer for RNA isolation.

Cloning of M. oryzae genes encoding putative secreted proteins

About 100 putative secreted protein genes with high expression levels were first selected from the libraries for cloning. However, with it was difficult to clone some of the genes because the proportion of fungal RNA in the total RNA from infected rice leaves was relatively low. Some of the genes were cloned from M. oryzae EST clones or from M. oryzae genomic DNA

41 for those with no introns. The genes were amplified by PCR using gene-specific primers and cloned into the plant expression vector pXUN (Chen et al., 2009).

The fragments of in-planta expressed M. oryzae secreted protein genes were PCR amplified following the protocol provided in the platinum Taq DNA polymerase kit (Invitrogen,

USA). DNA fragments were amplified using platinum Taq DNA polymerase and gene-specific pairs of primers corresponding to the full-length (FL-) ORF regions or truncated coding region

(NS-) that exclude the predicted signal peptide sequence but have an engineered ATG start codon (Appendix C, Table C.1). PCR was performed for 22 cycles using the following parameters; initial denaturation at 94oC for 30 seconds followed by 22 cycles of 94oC for 30 seconds; 55oC for

30 seconds; 72oC for 1 minute per Kb and a final extension at 72oC for 5 minutes. PCR products were purified with MinElute Gel Extraction Kit (QIAGEN, CA) before cloning in the pXUN vector.

The five identified genes encoding for cell death inducing proteins were further cloned into pGD (Goodin et al., 2002) to make vectors for Agrobacterium-mediated transformation on

Nicotiana benthamiana leaves. The pXUN vector contained two BamHI recognition sites outside the insertion region. Therefore, the BamHI-digested fragments containing FL- and NS-

MGG_03356, FL- and NS- MGG_05531, FL- and NS- MGG_08409, as well as FL- and NS-

MGG_10234 from pXUN-based plasmids were inserted into the BamHI site of pGD, respectively.

For MGG_07986 that contains two BamHI sites in the coding region, a partial digestion with

BamHI was used to generate the FL-and NS- MGG_07986 fragments from the pXUN-based plasmids.

Protoplast transient expression assay

Transient expression assays in the protoplasts of rice were carried out following previously described procedures (Chen et al., 2006). About 100 de-husked rice cultivar

Nipponbare seeds were sterilized by using 40% Clorox solution for 20 minutes. Rice seeds were germinated on ½ MS medium after washing with sterile H2O 10 times. Rice seedlings were grown at 26oC in the dark for about 2 weeks. Using a razor blade, the stems, including the sheaths of the seedlings, were cut into 1-2 mm pieces inside the hood. The chopped tissues were put into a petri dish with 12 ml enzyme solution (Table 2.1), followed by incubaing in the dark with gentle shaking at 40 rpm at room temperature for about 4 hours to digest the tissue.

The enzyme solution was gently removed from the tissue using a glass pipet, then 10 ml W5 medium was added to each petri dish. The protoplasts were released by shaking at 80 rpm for

1 hour. The W5 medium containing protoplasts were filtered with a 53 um nylon mesh.

The filtered medium was transferred into round-bottomed 8 ml glass tubes. The protoplasts were collected by spinning at 150 x g for 4 minutes at room temperature. The protoplasts were used for transfection after removing W5 medium and re-suspending in suspension medium.

Plasmid DNA was prepared in 40% PEG solution before the protoplasts were ready for transfection. 40% PEG solution was usually stored at -20oC. The PEG solution was thawed in a hot water bath at 70oC, and let it cool down at room temperature before use.

About 10 ug DNA of a pXUN-based construct of M. oryzae secreted protein genes and

10 ug of the CaMV 35S promoter-Gus construct were prepared in a 2.0 ml tube for each tested protein. Then 200 ul (usually 1.5-2.5 x 106 cells/ml) of suspended protoplasts were added to the tube, then 220 ul of 40% PEG solution was added and mixed immediately by gently shaking. 43

After the samples were incubated for 20 minutes at room temperature, about 1.0 ml of W5 medium was added to the tubes to dilute 40% PEG. The transfected samples were incubated overnight (about 14 hours) for GUS activity assay.

The transfected protoplasts were collected by centrifuging at 5,000 rpm for 5 minutes.

The supernatant was removed carefully, then 200 ul of 1 x CCLR (Cell Culture Lysis Reagent from

Luciferase Assay System, Promega, USA) was added to the tubes. The protoplasts were mixed in a vortex vigorously for 30 seconds, then centrifuged at 5,000 rpm for 5 minutes. Finally, the supernatant cell lysate was taken for GUS assay.

To perform GUS activity assay, 40 ul of cell lysate was transferred to a 96 well-plate.

100 ul of 2xGUS assay buffer (Jefferson et al., 1987) was added in each well and mixed well.

The assay mixture was incubated at 37oC in the dark for about 2-4 hours. The reaction was stopped by adding 0.2 M Na2CO3 to 20 ul of assay mixture and the mixture was detected with a fluorometer.

Agro-Infiltration Assay in N. benthamiana

Agrobacterium tumefaciens strain GV3101 carrying different pGD-based constructs of

M. oryzae secreted protein genes was grown in liquid YEP media supplemented with 50 mg/ml kanamycin and 50 mg/ml rifampicin at 28oC in a shaking incubator at 200 rpm. After 18 hours, bacterial cells were collected at 3,200 g for 20 minutes and re-suspend in MES buffer (10 mM

MgCl2 and 10 mM MES, pH 5.6) to a final OD600 of 0.7 for all constructs. After acetosyringone was added to a final concentration of 150 uM, bacterial suspension was kept at room temperature and in the dark for 3 hours before it was used for agro-infiltration in to leaves of

44 two month-old N. benthamiana. A. tumefaciens strain GV3101 carrying the empty pGD vector

(Goodin et al., 2002), and pGD-WtsE (Ham et al., 2008) were used as a negative and positive control, respectively.

Table 2.1. Media and solutions used for rice protoplast system

Media and Compositions Solutions Enzyme Solution 1.5% cellulase, 0.3% macerozyme in K3 Medium, Filter sterilized, store at - 20 oC K3 Medium 10X B5 Macro 100 ml, 100X B5 Micro (I) 10 ml, 1000X B5 Micro (II) 1 ml, 100X B5 Vitamines 10 ml, 200X MES (0.1g/ml) 5 ml, 500X myo-inositol (0.05

g.ml) 2 ml, 100X NH3NO3 (25 mg/ml) 10 ml, 100x CaCl2 (75 mg/ml) 10 ml, 100X Xylose (25 mg/ml) 10 ml, 0.4 M Sucrose 137 g. Adjust pH 5.6-5.8 by 1 M KOH, filter-sterilized. Store at 4 oC

W5 Medium 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES. Adjust pH 5.7 by 1 M KOH, filter-sterilized. Store at 4 oC

Suspension 0.4 M Mannitol, 20 mM CaCl2, 5 mM MES. Adjust pH 5.7 by 1 M KOH, filter- medium sterilized. Store at 4 oC

PEG Solution 40% PEG 4000, 0.4 M Mannitol, 100 mM Ca(NO3)2. Adjust pH 7.0 by 1 M KOH, filter-sterilized. Store at -20 oC

10X B5 Macro KNO3 25 g, (NH4)2SO4 1.34 g, CaCl2.2H2O 1.5 g, MgSO4.7H2O 2.5 g,

(1L) NaH2PO4.H2O 1.5 g

Dissolve CaCl2 and other ingredients in separate beakers, then combine and bring to 1 Liter, store at 4oC

100X B5 Micro (I) Dissolve well of MnSO4.H2O 0.78 g and ZnSO4.7H2O 0.2 g in 400 ml ddH2O;

(1L) Dissolve H3BO3 0.3 g and KI 0.075 g in 400 ml ddH2O. Slowly combine two o solutions, and ddH2O to a final volume 1 L, store at 4 C

1000X B5 Micro Dissolve NaMoO4.2H2O 0.250 g, CuSO4.5H2O 25 mg, CoCl2.6H2O 25 mg in o (II) (1L) ddH2O to a final volume 1 L, store at 4 C 100X B5 Vitamins Dissolve Vitamin B1 (Thiamine-HCl) 1g, Vitamin B6 (Pyridoxine-HCl) 0.1 g,

o (1L) and Nicotinic acid 0.1 g in ddH2O to a final volume 1 L, store at 4 C

Yeast Secretion Assay

The pYST-2 vector (Lee et al., 2006), which contains a truncated suc2 invertase gene lacking the signal peptide sequence, was used for secretion assay of the M. oryzae secreted proteins in yeast. PCR fragments of FL- and NS- version of M. oryzae secreted protein genes were amplified using corresponding primers (Appendix C, Table C.1), respectively.

The fragments were digested with EcoRI and NotI and then inserted in to the EcoRI and NotI site of the plasmid pYST-2 to fuse in-frame with suc2. The resulting plasmids were transformed into the invertase negative yeast (Saccharomyces cerevisiae)strain DBYα2445 (Lee et al., 2006).

After transformation, yeast cells were grown directly on sucrose medium (1% yeast extract, 2% peptone, 2%sucrose, and 2% agar). Secretion of invertase fusion proteins was determined by observing the recovery of yeast on sucrose medium.

Cell death inhibition assays

The calcium channel inhibitor LaCl3 was used for cell death inhibition assay.

LaCl3 (Sigma-Aldrich, St Louis, MO) was dissolved in distilled water. For rice protoplast transient expression assay, LaCl3 was applied to protoplasts immediately after transfection with final concentration of 1 mM. For agro-infiltration on N. benthamiana leaves, LaCl3 was applied to re-suspended A. tumefaciens cultures with final concentrations of 1 mM.

Transient expression assays were performed under dark conditions to determine whether cell death induced by M. oryzae secreted proteins is light-dependent. For rice protoplast transient expression assay, isolated protoplasts were incubated in the dark for 30 minutes before transfection, and then incubated in the dark all the time after transfection.

For agro-infiltration assay, N. benthamiana plants were pre-kept in the dark for 30 minutes

(Qutob et al., 2006), then infiltrated in darkness and maintained in the dark after agroinfiltration.

To determine whether cell death induced by M. oryzae secreted proteins is suppressed by the anti-apoptotic protein Bcl-XL, the binary vector pPTN250 (Dickman et al., 2001) which contains a human anti-apoptotic gene bcl-xl, was introduced into the A. tumefaciens strain

GV3101. The A. tumefaciens culture carrying the bcl-xl expression vector or empty control vector was first infiltrated into N. benthamiana leaves. The same infiltration sites were inoculated with A. tumefaciens cultures containing the pGD constructs of M. oryzae secreted proteins, and the two cell death inducing WtsE, and Bax gene 24 hours later.

Gene Expression Analysis by RT-PCR

Inoculated leaf tissues harvested at 0, 24, 48, 72, 96 and 120 hour point inoculation (hpi) and mycelia tissue were subjected to total RNA isolation using the TRIzol solution (Invitrogen

Life Technology, Carlsbad, CA). Total RNA from appressoria was prepared previously in the laboratory and was used directly for further steps. N. benthamiana leaves agroinfiltrated with pGD harboring FL- or NS- MoCDIPs were harvested 36 hours after agro-infiltration. All total RNA samples were treated with RNase-free DNase1 (Ambion, Austin, TX) to remove DNA contamination. The poly (A+) mRNA was isolated from one microgram of total RNA using

Promega’s Reverse Transcription System (Promega, Madison, WI) according to the manufacturer’s instructions RT-PCR was performed under standard conditions with primers corresponding to target genes as given in Appendix C, Table C.1.

Results

1. Validation of the M. oryzae secreted protein genes identified by RL-SAGE, MPSS, and SBS with RT-PCR

The aforementioned gene expression profiling in the rice-M. oryzae interaction using three different technologies, i.e., RL-SAGE, MPSS, and SBS, led to the identification of a total of

6,413 in-planta expressed fungal genes, including 851 genes encoding predicted effector proteins. We first used RT-PCR to validate some of the expressed genes-encoding putative effector proteins. About 25 expressed genes with high expression levels from the libraries were randomly selected to observe gene expression in leaf tissues of the rice cultivar Nipponbare inoculated with the M. oryzae isolate KJ201, a compatible isolate, at different time points after inoculation (24, 48, 72, 96, and 120 hpi). Among 25 M. oryzae putative effector protein genes, the transcripts of 14 of them (56%) were observed in the infected leaves (Figure 2.3), with most becoming apparent by 72 hpi. For some genes, multiple bands of the PCR products were found due to unspecific primers. For the rest of genes, no transcripts were observed that might be due to the low proportion of fungal RNA in relation to total RNA from infected rice leaves.

In conclusion, our RT-PCR analysis confirms that some putative effector protein genes identified in the expression profiling libraries are expressed in the infected leaf tissues.

Figure 2.3. RT-PCR validation of putative effector genes Total RNA was extracted from rice cultivar Nipponbare leaves infected with the M. oryzae isolate KJ201 at different time points (0, 24, 48, 72, 96, and 120 hpi). RT-PCR was performed using gene specific primers. (The set of genes on the left panel were analyzed by Andy Rhinehart)

2. ZeBATA system for large-scale cloning of M. oryzae genes encoding putative effector proteins

About 100 putative secreted protein genes with high expression levels from the libraries were first selected for cloning into the pXUN vector. We found that it was difficult to clone some of these genes because the proportion of the fungal RNA in the total RNA isolated from infected rice leaves was relatively low. Thus we cloned some of the genes from M. oryzae EST clones, or from M. oryzae genomic DNA for those with no intron. With the high efficiency and feasibility of the ZeBaTA gene cloning system, a total 42 in-planta expressed M. oryzae putative secreted protein genes (Table 2.2) were selected for functional characterization. For each of the selected genes, two versions of transfection plasmids were constructed, one containing the full-length open reading frame (ORF) (referred to as FL) and the other containing the truncated encoding region without the signal peptide sequence but with an engineered ATG start codon (referred to as NS). A total of 84 in-planta expressed M. oryzae putative secreted gene construct, including with and without the signal peptide, were made for further functional analysis.

Table 2.2. The list of the 42 M. oryzae putative secreted protein genes selected for functional analysis

No. Gene ID CDS size Gene Annotation from Types of the libraries that (bp) M. oryzae database genes were identified of Broadmit Institute of MIT and Harvard RL-SAGE MPSS SBS 1 MGG_00194 1407 Conserved hypothetical protein 2 MGG_00505 1931 Septation protein SUN4 3 MGG_00539 1304 Hypothetical protein 4 MGG_02368 1974 Galactose oxidase 5 MGG_02546 387 Predicted protein 6 MGG_03326 721 Conserved hypothetical protein 7 MGG_03356 1068 Ricin B lectin:Parallel beta-helix repeat 8 MGG_03369 664 Conserved hypothetical protein 9 MGG_03593 1452 Conserved hypothetical protein 10 MGG_03746 996 Acetylxylan esterase 1 11 MGG_03968 1278 Conserved hypothetical protein 12 MGG_04202 1571 MAS3 protein 13 MGG_04237 1054 Conserved hypothetical protein 14 MGG_04582 1626 Conserved hypothetical protein 15 MGG_04795 348 Predicted protein 16 MGG_04841 726 Predicted protein 17 MGG_05092 1158 Conserved hypothetical protein 18 MGG_05344 683 Conserved hypothetical protein 19 MGG_05456 929 Conserved hypothetical protein 20 MGG_05531 957 Conserved hypothetical protein 21 MGG_06478 657 Predicted protein 22 MGG_07016 1047 Conserved hypothetical protein 23 MGG_07607 477 Conserved hypothetical protein 24 MGG_07686 769 Cellulose-growth-specific protein precursor 25 MGG_07955 745 Endo-1,4-beta-xylanase 1 26 MGG_07986 342 Predicted protein 27 MGG_08096 1071 Transmembrane emp24 domian- containing protein 29 28 MGG_08409 876 Cellulose-growth-specific protein 29 MGG_08416 1674 Lipase 1 30 MGG_08957 381 Predicted protein 31 MGG_09134 602 Conserved hypothetical protein 32 MGG_09147 1047 Conserved hypothetical protein 33 MGG_09398 1422 Conserved hypothetical protein 34 MGG_09465 1061 Conserved hypothetical protein 35 MGG_09842 989 Conserved hypothetical protein 36 MGG_09918 1361 Conserved hypothetical protein 37 MGG_09998 622 Conserved hypothetical protein Continued 52

Table 2.2. continued

No. Gene ID CDs size Gene Annotation from Types of the libraries that (bp) M. oryzae database genes were identified of Broadmit Institute of MIT and Harvard RL-SAGE MPSS SBS 38 MGG_10004 552 Conserved hypothetical protein 39 MGG_10234 540 Conserved hypothetical protein 40 MGG_10532 744 Conserved hypothetical protein 41 MGG_10679 435 Conserved hypothetical protein 42 MGG_10824 918 Conserved hypothetical protein

3. Identification of M. oryzae cell death inducing effectors using the rice protoplast transient expression system

To identify M. oryzae secreted proteins involved in host cell death, transient expression of M. oryzae secreted proteins in rice protoplasts were performed. In the assay, the cell death was monitored by the reduced expression level of a co-transfected GUS reporter gene in rice protoplasts (Figure 2.4A). A total of 42 secreted protein genes with two different versions; one containing the full-length ORF (-FL) and the other containing the truncated encoding region without the signal peptide sequence but with an engineered ATG start codon (-NS) were employed for transient expression assay in rice protoplasts. The transient assay revealed that

5 out of 42 secreted protein genes of the FL-version, i.e., MGG_03356, MGG_05531,

MGG_07986, MGG_08409, and MGG_10234 caused a significant reduction in GUS activity when expressed in rice protoplasts (Figure 2.4B), suggesting that these five proteins can induce cell death in rice cells. Thus, we referred to the five proteins as MoCDIPs (M. oryzae cell death inducing proteins). In addition, transient expression of all 42 examined genes of the NS-version did not result in any reduction in cell viability, indicating that these proteins most likely function in the plant apoplastic space.

Figure 2.4. Identification of five in-planta expressed putative secreted proteins that induce cell death in rice cells. (A) Schematic representation of the rice protoplast transient expression assay approach to the identification of M. oryzae secreted proteins that can induce rice cell death. Rice protoplasts were co-transfected with a reporter GUS construct (Promoter-GUS-Tnos) and the other construct (Promoter-M. o gene-Tnos) carrying M. oryzae secreted protein gene. Rice cell viability was detected based on monitoring the reduced GUS expression level. (B) Ectopic expression of full-length of five M. oryzae cell death inducing proteins in rice protoplasts resulted in reduction in cell viability. CK, protoplast sample co-transfected with a GUS reporter and an empty vector control; 1-5, protoplast samples co-transfected with a GUS reporter and the other construct carrying MGG_03356, MGG_05531, MGG_07986, MGG_08409, and MGG_10234, respectively. Data bars show averages of three triplicate samples in one experiment. Each experiment was repeated at least three times with similar results.

4. Transient expression of M. oryzae cell death inducing effectors in N. benthamiana

Many pathogen effectors induce cell death in non-host plants (Rep, 2005). To determine whether the five M. oryzae cell death inducing effectors have cell death effects in non-host plants, transient expression assays were performed in N. benthamiana leaves using these five

MoCDIPs via an Agrobacterium-mediated transient expression approach. A. tumefaciens containing the empty vector pGD, or a pGD recombinant expressing WtsE were used as negative and positive controls, respectively. WtsE is a bacterial type III effector that induces cell death in both host and non-host plants (Ham et al., 2008). Consistent with results from the protoplast assays, infiltration of N. benthamiana leaves with the Agrobacterium strains expression

FL-MGG_03356, FL-MGG_07986, FL-MGG_08409, and FL-MGG_10234 resulted in cell death response (Figure 2.5A). On the contrary, infiltration of the FL-MGG_05531 strain, as well as infiltration of the strains carrying the constructs expressing the NS- version of five MoCDIPs did not result in cell death in the infiltrated area. RT-PCR analysis was performed to examine the transient expression of the five MoCDIPs, and the results showed that both the FL- and NS- of the five genes were expressed at similar levels in the infiltrated N. benthamiana leaves

(Figure 2.5B). These results confirmed that MGG_03356, MGG_07986, MGG_08409, and

MGG_10234 but not MGG_05531 induce cell death in both monocot and dicot species.

The timing and appearance of the cell death in N. benthamiana leaves induced by the

FL-MoCDIPs strains were not as strong as that induced by the WtsE strain. The cell death symptom induced by the WtsE strain usually started at 36-48 hours after agro-infiltration, and the symptoms induced by the FL-MGG_03356, FL-MGG_07986, and MGG_08409 strains generally appeared at 2-3 days after agro-infiltration with a severe cell death around the

56 infiltrated site. However, the symptom induced by FL-MGG_10234 generally was visible at 4-6 days after agro-infiltration with weak necrotic spots in the infiltrated area, indicating a delayed pattern in cell death induction.

Figure 2.5. Transient expression of M. oryzae cell death inducing proteins in the non-host plant, N. benthamiana. (A) Transient expression assay of the five MoCDIPs in N. benthamiana leaves by using agroinfiltration approach. Agroinfiltration was performed on the same side of each leaf side by side with A. tumefaciens carrying an empty vector control (pGD), a positive control (WtsE), constructs with full-length MoCDIPs (FL-MoCDIPs) or constructs with non-signal peptide MoCDIPS (NS-MoCDIPs), respectively. (B) RT-PCR analysis of MoCDIPs expression in agroinfiltrated N. benthamiana leaves. Total RNA was extracted from N. benthamiana leaves at 36 hpi. CK, RT-PCR result from tissues infiltrated with the empty vector control. 1, RT-PCR results from tissues infiltrated with FL- MoCDIPs; 2, RT-PCR result from tissues infiltrated with NS- MoCDIPs

5. Gene expression analysis of the M. oryzae cell death inducing effector genes

To experimentally confirm that the five M. oryzae cell death inducing effector encoding genes are expressed in the infected rice leaves, and determine their expression pattern in appressoria and mycelia, RT-PCR was carried out using the RNA extracted from Nipponbare rice leaves inoculated with the compatible blast isolate KJ201 at different time points after inoculation, i.e., 0, 24, 48, 72, 96, and 120 hpi and from M. oryzae appressoria and mycelia.

Because of the low proportion of the fungal mass in the infected leaves at early infection stages, the Mo28S transcript was not detected before 72 hpi. Similar to the Mo28S transcript, the MGG_05531 and MGG_08409 transcripts were detected from the infected rice leaves only at 72 hpi, and the transcripts of MGG_03356, MGG_07986, and MGG_10234 were detected from the infected rice leaves at 96 hpi (Figure 2.6). This result confirmed that all the five

MoCDIPs were expressed during infection stages. The transcripts of MGG_03356 and

MGG_05531 were detected in both appressoria and mycelia with relatively higher expression, and the transcripts of MGG_07986, MGG_08409, and MGG_10234 were detected only in appressoria (Figure 2.6).

Figure 2.6. In-planta expression pattern of the five MoCDIPs. Total RNA samples extracted from rice cultivar Nipponbare leave, which were infected by M. oryzae isolate KJ201 with different time points (0, 24, 48, 72, 96, or 120 hpi), and from in vitro grown M. oryzae appressorium (A) and mycelium (M) were subjected to RT-PCR using specific primers.

6. Validation of the secretory feature of the M. oryzae cell death inducing effectors by

Yeast Secretion Analysis

To functionally investigate the predicted secretion feature of the five identified

M. oryzae cell death inducing effectors, a yeast secretion assay was performed following the method previously published (Lee at al., 2006). The sequences of both FL- and NS- MoCDIPs were fused in frame to the N-terminal end of a yeast invertase (suc2) gene lacking its own signal peptide sequence. The fusion constructs were transformed into the yeast strain DBYα2445, an invertase-deficient mutant (Lee et al., 2006), and the transformed yeasts were grown directly on sucrose medium and assayed for secretion. As expected, the yeast strain transformed with the constructs containing the NS-version of M. oryzae genes fusing with suc2 did not grow on the sucrose medium (Figure 2.7). Without invertase, the yeast strain had no catalytic factor to facilitate the decomposition of sucrose into fructose and glucose as the carbon source.

In contrast, all five constructs containing the FL-version of M. oryzae genes fusing with suc2 enabled the yeast mutant strain to grow on sucrose medium, confirming that the predicted signal peptides of the five MoCDIPs are functional in directing the invertase fusions to the secretory pathway. Combination of these results with the result of transient expression in rice protoplasts indicates that the five MoCDIPs most likely function in the plant apoplastic space.

Figure 2.7. Validation of the secretory feature of the five MoCDIPs by yeast secretion analysis. (A) Schematic diagram of the yeast secretion trap vector (pYST) developed by Lee et al., 2006. cDNA insertion at EcoRI and NotI restriction sites. The vector contains the promoter (PADHI) and terminator (TADHI) of the alcohol dehydrogenase gene. A suc2 represents a yeast inverstase gene lacking its own signal peptide and initiator methionine. (B) The diagram of yeast secretion trap assay to determine the secretory property of protein. The full-length or non-signal peptide versions of MoCDIPs were fused in frame with suc2, and were transformed to invertase- deficient yeast mutant, DBYα2445. Constructs containing functional signal peptide lead to the

Figure 2.7. continued expression of invertase enzyme coding by suc2. The transformed DBYα2445 yeasts with the secreted invertase property were able to utilize sucrose and grew on the sucrose medium, but not the transformed DBYα2445 yeasts lacking secreted invertase property. (C) Yeast DBYα2445 strains were cultured directly onto sucrose medium after transfection. The cells transformed with constructs containing the fusions with predicted signal peptide sequence (FL-MoCDIPs- suc2) grew on the medium (upper panels); No cells transformed with constructs containing the fusions without predicted signal peptide sequence (NS-MoCDIPs-suc2) grew on the medium (lower panels)

7. Physiological basis of the plant cell death induced by M. oryzae effectors

Previous studies have shown that plant cell death induced by some microbial toxins or effectors share some conserved mechanisms (Asai et al., 2000; Qutob et al., 2006). To further characterize the physiological properties of the cell death induced by the MoCDIPs, we performed inhibition assays in rice protoplasts and N. benthamiana leaves. Two cell death inducing proteins, i.e., WtsE and Bax, were also included in the assays as the controls.

Calcium signaling has been shown to play an important role in the cell death process

(Lecourieux et al., 2002; Boudsocq et al., 2010). To determine whether calcium signaling is required for the cell death induced by MoCDIPs, LaCl3, a calcium channel inhibitor, was applied in the inhibition assays. Application of LaCl3 blocked cell death induced by the transient expression of all MoCDIPs, suggesting that cell death process that is mediated by these proteins is dependent on a calcium signaling pathway.

Light intensity has been demonstrated to be an important factor for cell death induction triggered by some toxins or effectors (Asai et al., 2000; Qutob et al., 2006). To test whether cell death induced by MoCDIPs is light-dependent, we transfected MoCDIPs in rice protoplasts in the light or in the dark. There was no difference of cell viability between the protoplast samples incubated in either conditions, indicating that the cell death process induced by MoCDIPs did not induce any cell death lesions in the leaves of N. benthamiana kept in the dark (Table 2.3).

This suggests that the MoCDIPs -induced cell death in N. benthamiana leaves is light dependent.

Studies have shown that some anti-apoptotic proteins such as BCL-2 family proteins and bax inhibitor-1 (BI-1) can suppress various types of cell death and are functionally conserved in

63 yeast, plants and mammals (Watanabe and Lam, 2009). Overexpression of anti-apoptotic proteins was shown to inhibit cell death induced by multiple stimuli, revealing that various types of cell death may have a common downstream mechanism (Dickman et al., 2001). The anti- apoptotic protein Bcl-xl, a member of the BCL-2 family, was tested to determine whether it can inhibit cell death caused by these five MoCDIPs. Pre-infiltrated with A. tumefaciens cells harboring the Bcl-xl expression vector, following with post-infiltrated with A. tumefaciens cells harboring MoCDIPs, WtsE or Bax did not produce cell death symptoms. In contrast,

N. benthamiana leaves pre-infiltrated with the culture containing the empty vector showed obvious cell death symptoms induced by the transient expression of MoCDIPs, WtsE or Bax.

These results indicate that cell death in N. benthamiana leaves induced by MoCDIPs is suppressed by the anti-apoptotic protein (Table 2.3).

Table 2.3. Inhibition assays of MoCDIPs-induced cell death in rice protoplasts and

N. benthamiana leaves

Effector Applications or Treatments

a b LaCl3 Dark Bcl_xl

RP NBL RP NBL RP NBL

MGG_03356 - - + - ND -

MGG_05531 - ND + ND ND ND

MGG_07986 - - + - ND -

MGG_08409 - - + - ND -

MGG_10234 - - + - ND -

WtsE - - + - ND -

Bax - - + - ND -

Cell death inhibition assay procedures are described in Material and Methods section. RP, rice protoplasts; NBL, N. benthamiana leaves. “+” and “-” represent cell death or no cell death,

a respectively. ND, not determined. LaCl3 was dissolved in distilled water, and same volume of water was applied to rice protoplasts or N. benthamiana leaves as control; bAn empty vector pGD was applied as control. No effects of controls on cell death assays was observed.

Discussion

Transcriptional analysis of the M. oryzae effector genes in infected rice plants has provided a starting point for functional analysis of the in-planta expressed genes in the rice-

M. oryzae interaction. Over the past two decades, several M. oryzae avirulence/pathogenicity effector genes have been isolated by map-based cloning (Kang el al., 1995; Swergard et al.,

1995; Orbach et al., 2000), genetic association analysis (Yoshida et al., 2009), or loss-of-function

(Talbot et al., 1993; Ahn et al., 2004; Kim et al., 2005; Jeong et al., 2007) approaches. The first two procedures are time-consuming, tedious and expensive. As for loss-of-function approach, it is often hampered by the fact that many genes may have overlapping functions. For example, many knockout mutants of secreted protein genes have no identifiable phenotype (Mosquera et al., 2009; Saitoh et al., 2012). Thus, a cost-effective and high-efficiency gain-of-function method would be a valuable alternative approach to the identification of M. oryzae effectors.

Our laboratory established three high-throughput technologies, i.e., RL-SAGE, MPSS, and SBS, for profiling the transcriptome of M. oryzae-infected rice tissue. From the profiling libraries, we identified a total of 6,413 M. oryzae genes, including 851 genes that are predicted to encode putative secreted proteins. Our RT-PCR analysis confirmed the in-planta expression of some of the genes.

As for gain-of-function identification, the agro-infiltration transient assay is a widely used approach for characterizing function of phytopathogen effectors in many Solanaceous plants, especially in N. benthamiana and N. tabacum (Munkvold and Martin, 2009). However, this agro-infiltration method is not applicable in monocot plants. We previously reported a protoplast transient expression system to perform assays directly in rice cells (Chen et al.,

2009). Recently, Yoshida et al. (2009) and Okuyama et al. (2011) detected hypersensitive reaction (HR) in rice protoplasts co-expressing R gene and cognate Avr gene from M. oryzae Avr-

Pia, Avr-Pii, Avr-Pik/km/kp and rice blast resistance gene Pia. In this study, we identified five

M. oryzae effectors that induce cell death in rice cells. The results demonstrated that the rice protoplast expression assay is an efficient method for large-scale screening of putative effectors that induce cell death or HR reaction.

Unlike many bacterial pathogens that deliver effector proteins inside host cells via a type III secretion system, eukaryotic plant pathogens, like oomycetes and fungi, seem to secrete a large number of extracellular proteins via the eukaryotic (type II) secretory pathway, which depends on excocytosis of secretory vesicle derived from Golgi apparatus to cross the cytoplasmic membrane (Panstruga and Dodds, 2009). Some secreted proteins are translocated into host cells and function in the host cytoplasm to suppress host defense. Many others function in the host apoplastic space to facilitate the parasitic lifestyle of pathogens. The latter include degrading enzymes, toxins or inhibitors of plant enzymes. More recently, a broader definition of the term “effector” was suggested to include these secreted proteins, as they exert some effect on plant cells (Hogenhout et al., 2009). Over the past few decades, several apoplastic effectors with toxin or elicitor activity that can induce cell death in plants have been identified from eukaryotic plant pathogens (Rep, 2005). Many of these apoplastic effectors play a positive role in virulence of the hemibiotrophic or necrotrophic plant pathogens (Qutob et al.,

2006; Ottman et al., 2009). With broad definition of the term “effector” from Hogenhout et al.

(2009) and cell death inducing phenotypes obtained from ectopic expression of M. oryzae

67 putative secreted protein genes in plants, we considered that the five in-planta expressed putative secreted proteins are novel effectors that induce plant cell death.

Given the fact that these genes are expressed during infection stages, especially 96 hpi

(Figure 2.6), we speculate that some of these cell death inducing effectors may facilitate the colonization of M. oryzae during the late necrotrophic phase of the blast infection, which is a common mechanism among different pathosystems (Gijzen and Nurnberger, 2006).

As demonstrated in NLPs (Necrosis- and Ethylene-inducing Peptide 1-Like Proteins),

Phytophthora sojae transcripts encoding PsojNIP and Collectotrichum higginsianumg transcripts encoding ChNLP1 were shown to be highly expressed during transition from biotrophy to necrotrophy (Qutob et al., 2002; Kleemann et al., 2012). In addition, a gene encoding ChToxB from C. higginsianum has similar expression pattern as those two genes (Kleemann et al., 2012).

Interestingly, it was demonstrated that C. higginsianum was able to secrete antagonistic effector, ChEC3, which suppresses cell death induced by ChNLP1. It was proposed that ChEC3 may interfere the ability of plant to perceive damage-associated molecular pattern (DAMPs) generated by ChNLP1 effector rather than interfere with ChNLP1 itself or its activity. This finding reveals the function of antagonistic effector in maintaining host cell viability to facilitate pathogen infection. Identification of M. oryzae effectors that are able to suppress cell death triggered by five MoCDIPs may provide new knowledge on function of different M. oryzae effectors during infection.

Our analysis revealed that four MoCDIPs induced cell death in the non-host plant,

N. benthamiana. We further provide the evidence that the active plant metabolism was

2+ required for this type of cell death. As demonstrated in inhibition assay, LaCl3, a nonspecific Ca

68 channel inhibitor blocked MoCDIPs induced cell death. Indeed, an active host cell metabolism was reported to be required for PCD (Asai et al., 2000). In addition, light is essential to activate expression of the Arabidopsis PAL genes, which are important in both plant development and plant defense response (Ohl et al., 1990). Previously toxin-induced plant cell death such as

Nep1-like protein and AVR/R protein-mediated HR was described to be light dependent

(Qutob et al., 2006). In this study, we also demonstrated that cell death induced by MoCDIPs in

N. benthamiana appeared to depend on light, but this characteristic was not observed in rice protoplasts. As reported previously, the etiolated rice protoplasts were not suitable for investigating many cellular processes, particularly those involving chloroplasts (Zhang et al,

2012). Furthermore, cell death phenotype induced by MoCDIPs is suppressed by Bcl-xl, an anti- apoptotic protein. In summary, we demonstrated that cell death induced by the five different

M. oryzae cell death inducing effectors share similar physiological phenotypes, such as response to light, response to inhibitors of calcium channel, and response to Bcl-xl-mediated cell death suppression. These results together suggest that the cell death-inducing mechanism of the five

M. oryzae cell death inducing effectors might be similar.

Chapter 3

Functional analysis of M. oryzae carbohydrate binding module (CBM) - containing effectors

Introduction

Carbohydrate binding module (CBM) is defined as a part of amino acid sequences within a protein that posses carbohydrate binding activity. This module is usually found in carbohydrate-active enzyme (Cantarel et al., 2009). CBMs are helper domains in proteins that have self-governing folding and the ability to recognize carbohydrate arrangement (Boraston et al., 2004). In general, the function of CBMs is to promote the association of the enzymes to their substrates in biological processes related to metabolism, development, defense mechanism and pathogenesis (Guillen et al., 2010). In fungi, CBMs are involved in many biological events such as morphogenesis, cell wall biogenesis, vegetative growth as well as structural support (Saporito-Irwin et al., 1995; Popolo et al., 2008; Nakajima et al., 2010; and

Guillen et al., 2010). However, the role of fungal CBMs underlying plant-fungal interaction is still elusive.

Carbohydrate binding modules and their general functions

CBMs are non-catalytic carbohydrate recognition modules associated with catalytic modules such as glycoside hydrolases. Generally, CBMs bring the catalytic modules into close contact with the substrates, and thus enhance the ability of enzymes for their substrate 70 degradation (Guillen et al, 2010). Although most of CBMs are present together with other catalytic modules such as glycoside hydrolases and glucanosyltransferases, some of them are not appended to any catalytic modules (Obembe et al., 2007). The specific recognition of CBMs to their substrates primarily requires the proper orientation and aromatic residue-position in the binding site of CBMs. In addition, other conditions such as hydrogen bond formation between substrates, polar residues in the binding site of proteins (McLean et al., 2000), and the presence of calcium during interaction play a minor role in ligand recognition (Bolam et al.,

2004).

The non-catalytic carbohydrate binding modules were initially defined as cellulose binding domains, since the first protein containing this domain was bound to crystalline cellulose (Boraston et al., 2004). Later, the term “CBM” was adopted to reflect diversities in ligand recognition such as cellulose, chitin, B-glucans, starch, glycogen, and xylan. Based on amino acid sequence similarities, currently CBMs are grouped into 64 families and were reported in the Carbohydrate Active Enzymes database (http://www.cazy.oryg) (Cantarel et al.,

2009).

In general, CBMs have three functions to serve for their catalytic modules. The first function is in a proximity effect. CBMs facilitate condensation of enzymes onto their substrates by maintaining the proximity between enzymes and their corresponding substrates, resulting in rapid degradation of polysaccharides. Secondly, CBMs act as a targeting function. This notion has been adopted from the observation that different CBM families attached to the same catalytic modules show distinct capacities for substrate degradation (Boraston et al., 2004).

Lastly, the role of CBMs in disruptive function has been demonstrated. The Cellobiohydrolase I

71 containing a cellulose binding domain (CBD) from Penicillium janthinellum displays a non- hydrolytic disruption of the crystalline cellulose structure (Gao et al., 2001).

CBMs and their roles during plant-pathogen interactions

It has become more evident that CBMs play crucial roles during plant-pathogen interactions. To be pathogenic, microorganisms need to access the plant interior and overcome the host cell wall to get inside plant cells. In this step, several CBM-containing proteins were reported to be involved in cell wall degradation, cell wall interruption, and cell wall modulation.

It is known that several pathogenic bacteria and fungi employ cell wall degradation enzymes such as cellulase, xylanase, esterase and pectinase as virulent factors to degrade plant cell walls

(Aparna et al., 2009). A number of these enzymes harbor CBMs which help their catalytic modules to target their substrates (Cantarel et al., 2009). In some cases, a disruption of carbohydrate anchor site abolishes the virulent function of the pathogen as demonstrated in a LipA, a cell-wall degrading esterase from Xanthomonas oryzae (Aparna et al., 2009). To combat the pathogen, plants have evolved the ability to sense the soluble cell wall degradation products which elicit a defense response. This eliciting function was shown in LipA, which induces rice defense response, including callose deposition and programmed cell death. The actual elicitor was thought to be the product from the action of LipA, since the supernatant of the heat- inactivated crude product from LipA-treated rice plant can elicit host defense response

(Jha et al., 2007).

In addition to their virulent function through direct degradation of the plant cell wall,

CBM-containing proteins have been reported to play a role in cell wall disruption and modification. As demonstrated in Trichoderma asperellum, a Swollenin protein is comprised of 72 an N-terminal CBD and a C-terminal expansin-like domain. The protein was reported to function in swelling of the plant cell wall to facilitate plant root colonization. When the CBD domain was absent from a Swollenin protein, the full function of the protein was affected (Brotman et al.,

2008). This report was correlated with the previous report on a Swollenin of Trichoderma reesei, which has a similar protein structure containing CBD and an expansin-like domain. The protein displays disruption activity on cellulosic materials through interference with hydrogen bond formation between cell wall polysaccharides without catalytic function (Saloheimo et al., 2002).

In addition, CBM29 of Piromyces equi, which has ligand specificity on xylan, galactomannan, glucomannan, and hydroxyethylcelluose, was demonstrated to modulate plant cell wall arrangement. Ectopic expression of the two tandem CBM29 encoding genes derived from a cellulase/hemicellulase complex of Piromyces equi reduced the stem elongation rate, enlarged the xylem and breakdowned cortical cells (Obembe et al., 2007). Furthermore, Heterodera schachtii, a cyst soybean nematode, secretes a cellulose-binding protein (CBP) upon entering inside plant cells. This protein potentially targets pectin methylesterase protein3 (PME3), a plant cell wall-modifying enzyme. Transgenic Arabidopsis ectopically expressing the CBP gene and transgenic plants overexpressing PME3 display similar phenotypes, in which they develop longer roots and enhanced susceptibility to nematodes. By contrast, a pme3 knockout mutant displays the opposite phenotypes. All together, these results insinuate that H. schachtii CBP plays a role in cell wall modulation to facilitate cyst nematode parasitism (Hewezi et al., 2008). Additionally, it was reported that the cellulose-binding elicitor lectin (CBEL), a cell wall glycoprotein of

Phytophthora parasitica, modulates the cell wall deposition of polysaccharide and enables pathogen adhesion to cellulosic substrates (Gaulin et al., 2002). All evidence support the notion

73 that CBMs play a crucial role in cell wall disruption and cell wall modification to facilitate pathogen establishment.

To combat the strategies of pathogens in cell wall disruption and cell wall modification, plants develop the surveillance system for perception of microorganism at the cell surface to establish defense response. This is supported by evidence of the CBM-containing proteins with a function in eliciting plant defense response. The Swollenin from Trichoderma was shown to induce the expression of local defense genes within 24 hours of injection of Swollenin CBD in cucumber leaves. Interestingly, this defense response is capable of protecting plants against both bacterial and fungal pathogens (Brotman et al., 2008). Furthermore, CBEL from

P. parasitica was proposed to be a novel PAMP. Recombinant CBEL proteins were shown to elicit necrotic lesions and defense gene expression when the proteins were applied to tobacco plants.

Jasmonic acid pathway and ethylene pathway were shown to be involved in CBEL-inducing necrosis lesion (Khatib et al., 2004). In addition, intact synthesized peptides derived from a CBD region were shown to be sufficient in eliciting defense response. These findings support the notion that CBDs are a novel class of PAMPs, with a function in evoking plant defense response upon cellulosic attachment (Gaulin et al., 2006).

The Plant cell wall

The plant cell wall is crucial for many processes, including in plant growth, development, maintenance and reproduction. It acts in defense response during plant-microbe interaction.

The plant cell wall is usually classified into two types: primary walls that surround the growing cell, usually considered to be relatively unspecialized and similar in all cell types; and secondary walls which are thickened, lignin-containing structures that are formed after the termination of 74 cell enlargement. The walls usually surround specialized cells such as vessel elements or fiber cells.

In plant cell walls, cellulose is embedded in a highly hydrated matrix providing both strength and flexibility. It consists of a collection of linear chain beta-1,4-linked D-glucoses that interact with each other via hydrogen bonds to form crystalline microfibrils. The highly hydrate matrix is composes of two major types of polysaccharides; hemicelluloses and pectins, plus a small amount of structural protein. Cellulose microfibrils are coated with hemicelluloses such as xyloglucan, xylan, glucomannan, arabinoxylan, and callose (beta-1,3-glucan) which bind microfibrils to one another. Additionally, cellulose and hemicellulose are embedded in pectic polysaccharides, including homogalacturonan, rhamnogalacturonan, arabinan, and galactan, which act as interlockers of all matrixes and prevent aggregation and collapse of cell wall components (Figure 3.1).

Figure 3.1. Schematic diagram of the major structures of a plant cell wall. Cellulose microfibrils are embedded in a polysaccharide matrix, which includes hemicelluloses and pectins (Laurie, 2001)

Mechano-sensing of cell wall damage

Plant cell wall-associated defense sensing is well understood. This includes the perception of endogenous signals such as plant cell wall-derived fragments, as well as cell wall integrity sensing. To perceive cell wall damage, plasma membrane receptor proteins, such as

RLKs, are required to mediate signal transduction. WAKs, wall-associated kinases, were reportedly involved in this step. WAK1 harbors extracellular epidermal growth factor (EGF)-like motif, and likely has a cytoplasmic kinase domain (He et al., 1996). Indeed several reports demonstrated the association between WAK1 and pectin (Wagner and Kohorn, 2001; Decreux and Messiaen, 2005). The truncated protein WAK167-254aa was shown to bind to polygalacturonic acid, oligogalacturonides and pectins in a calcium-induced conformation (Decreux and

Messiaen, 2005). In addition, WAK 1 was shown to be upregulated during pathogen infection as well as SA treatment (He et al., 1998). The notion described above implies that WAK receptors can perceive pectin integrity during pathogen infection, and consequently trigger plant defense response.

Arabidopsis CESA6 is involved in biosynthesis of cellulosic components of the primary cell wall (Desprez et al., 2007). The prc1-1 mutant plants (=cesa6) of AtCESA6 are cellulose deficient, have a short hypocotyl, and also accumulate ectopic lignin and callose. Screening of mutants that suppress the prc1-1 phenotype without rescuing cellulose synthesis leads to identification of THESEUS1 (THE1), the CrRLK1-like family members (Hématy et al., 2007).

A T-DNA insertion mutant of THE1 restores normal stature, and gene misregulation, as well as ectopic lignification in some cellulose-deficient mutants. This suggests that THE1 is involved in cellulose sensing (Hématy et al., 2007).

Research hypothesis and research objectives

In this chapter, our hypothesis is that M. oryzae secretes effector proteins containing

CBMs into rice cells to facilitate colonization and fungal growth during infection. As stated earlier, CBM-containing effectors play an important roles during plant-pathogen interactions.

However, the function of CBM-containing effectors in M. oryzae is still elusive. Clarifying the function of CBM-containing effectors will increase our understanding of potentially novel mechanisms used by M. oryzae to suppress plant immunity. The main objectives of this chapter are (1) to screen for novel M. oryzae CBM-containing effectors that are involved in host cell death, (2) to investigate protein accumulation during infection process, (3) to define the function of M. oryzae CBM-containing effectors in pathogenesis, and (4) to elucidate the biochemical function of M. oryzae CBM-containing effectors

Materials and Methods

Rice Blast Inoculation and Disease Evaluations

Plant materials for spray inoculation

Rice cultivar Nipponbare seedlings or rice cultivar Toride were grown in a growth chamber (Conviron Ltd., Winnipeg, Canada) with 80% relative humidity, 12 hours of light (500 umol photons m-2sec-1) at 26oC followed by 12 hours of dark at 20oC. M. oryzae isolate KJ201 or transformed strain overexpressing a CBM-containing gene, or transformed strain with the deletion of the CBM gene were maintained in frozen storage and cultured on oatmeal agar plates (30 g oatmeal and 15 g agar in 1 L distilled water) at 25oC in dark condition for 7 days, and then under continuous light condition for 7 days. Rice inoculations were performed on three- week-old rice seedlings. A suspension of 2x105 spores ml-1 in 0.01% tween20 solution was sprayed on rice plants. At 6-7 days after inoculation, disease severity was observed and photographed, and the infected tissues were collected for fungal biomass evaluation. The fungal biomass in infected rice leaf tissues was quantified using a slight modification of a previously described method (Kawano et al., 2010). In brief, a small piece of infected rice tissue (3x1 cm) was cut for DNA extraction using the standard CTAB extraction protocol. The DNA was treated with 1 ul RNase A (10 mg ml-1) to remove RNA. DNA based-qPCR was carried out using the iQ5 real-time PCR detection system (Bio-Rad). Relative fungal growth was calculated by using the threshold cycle value (CT) of M. oryzae Pot2 DNA against the CT of rice ubiquitin DNA. The CTs of

OsUbq and MoPot2 were measured, and the CT of OsUbp was subtracted from the CT of MoPot2.

Relative fungal growth was then calculated as a ratio (MoPot2/OsUbq) represented by the

C (OsUBQ)-C (MoPot2) equation E T T , in which the amplification efficiency, E, is 2 for the primer pairs designed for the respective genes.

Plant materials for punch inoculation

Rice cultivar Nipponbare seedlings and M. oryzae isolates were prepared as described above. Blast inoculations were performed on six to eight-week-old rice plants. A suspension of

5x105 spores ml-1 in 0.01% tween20 solution was employed for punch inoculation. In brief, rice leaves were lightly wounded with a mouse ear punch, and 10 ul of spore suspension was added to the wounding site. Both sides of the inoculated area were sealed with Scotch tapes to hold the spore suspension, and the inoculated plants were returned to the growth chamber. Lesions were photographed at 9-10 days after inoculation, and lesion area was measured by analyzing the photographs with Adobe®Photoshop software; the number of pixels with and without lesion was determined in a 3400-mm2 area. To determine the blast sporulation rate on the lesions, a portion of the lesion (about 3x1 cm) was cut from the leaf and placed in a microcentrifuge tube containing 100 ul of distilled water with 1% Tween20. The samples were vigorously mixed in a vortex mixer for 2 minutes to dislodge the spores, and the number of spore ml-1 was determined with a microscope and a hemacytometer. The fungal biomass was evaluated as described above.

Rice leaf sheath inoculation

Rice leaf sheath inoculation was performed as described (Kankanala et al., 2007). Spore suspension of transgenic knockout transformants or overexpressing transformants of the CBM genes was inoculated on rice leaf sheath. About 5-cm-long sheath piece of four-week-old plants

80 were applied with 300 ul of spore suspension (1 x 105 spore ml-1) and were kept in moisture

Petri dish. The inner epidermal layer was excised for microscopy using an epifluorescence microscope (ECLIPSE 80i, Nikon).

M. oryzae protoplast transformation

Gene deletion by split marker

The N-terminus half of hygromycin cassette was amplified using the HYS3 and HY3 primers from pCB1004 (Carroll et al., 1994). The C-terminus half of hygromycin cassette was amplified using the YGAS and YG2 primers from the same vector. The left border of MGG_05232 was amplified using MGG_05232L and MGG_05232Lad (R primer including a hygromycin- adapter specific sequences), while the right border of MGG_05232 was amplified using

MGG_05232Rad (F primer including a hygromycin-adapter specific sequences) and

MGG_05232R. Both the left and right borders were amplified from the genomic DNA of

M. oryzae isolate KJ201. The unpurified products of a half C-terminus and a left border were employed for overlapping PCR using MGG_05232LB and YG2 primers to generate fusion of a left border-half hygromycin cassette. Also, the unpurified products of a half N-terminus and a right border were employed for overlapping PCR using the MGG_05232RB and HY3 primers to generate fusion of a right border-half hygromycin cassette (Figure 3.2). The PCR products of both components were used directly for the transformation in M. oryzae protoplasts.

PCR conditions were described in chapter 2. Primers sequences are provided in Appendix C,

Table C.1.

Figure 3.2. A diagram illustrating PCR amplifications of the components for MGG_05232 gene deletion by split marker. (A) PCR amplification of the half hygromycin cassette. The N-terminus half of hygromycin cassette is amplified using the HYS3 and HY3 primers from pCB1004, while the C-terminus half is amplified using the YGAS and YG2 primers. (B) PCR amplification of the left and right borders of MGG_05232 from M. oryzae genomic DNA. The left border of MGG_05232 was amplified using MGG_05232L and MGG_05232Lad (R primer including a hygromycin- adapter specific sequences), while the right border of MGG_05232 was amplified using MGG_05232Rad (F primer including a hygromycin-adapter specific sequences) and MGG_05232R. (C) Overlapping PCR amplification of the right border fusing with the N-terminal half of hygromycin cassette using MGG_05232RB and HY3 primers, and the left border fusing with the C-terminal half of hygromycin cassette using MGG_05232LB and YG2 primers.

Plasmid construction

To construct overexpression plasmid, the CBM gene coding region was amplified with gene-specific primers followed the protocol described in chapter 2. The pFret vector modified from pCB1636 (obtained from Dr. Mitchell’s lab) harboring constitutive promoter from the

M. oryzae ribosomal protein 27 gene was used to clone M. oryzae gene based on the TA cloning strategy. This construct then was transformed into Escherichia coli strain DH10B using electroporation method. The purified plasmid from E. coli was used to transform into M. oryzae protoplasts.

To construct GFP fusion plasmid, the promoter region (about 1 kb) and gene coding region were amplified from the genomic DNA of the M. oryzae isolate KJ201 mycelia, if intron was not present. In the case of presence of an intron, overlapping PCR was employed to clone the fragments. The amplified fragments were cloned into pCB1636:GFP (obtained from

Dr. Mitchell’s lab). This construct was then transformed into E. coli strain DH10B using electroporation method. The purified plasmid from E. coli was used to transform into M. oryzae protoplasts.

M. oryzae protoplasts preparation and transformation

Five ml of M. oryzae conidia spore suspension (about 1x107 spores ml-1) was inoculated in 100 ml complete media (CM) (6 g of yeast extract, 6 g of casamino acid, and 10 g of sucrose in

1 L distilled water) at 28oC, 3 days under shaker condition (250 rpm). The fresh mycelia then were collected by passing through 3 layers of sterilized Miracloth and washed with sterilized

20% sucrose solution at least 2 times. About 2 mg of fresh mycelia was treated with 30 ml of

83 sterilized lysing enzyme [4 g of lysing enzyme powder (from Trichoderma harzianum, Sigma),

100 ml of 20% sucrose solution]. The enzyme-treated sample was incubated for 4 hours at room temperature. After incubation, M. oryzae protoplasts were collected by passing through 3 layers of sterilized Miracloth. M. oryzae protoplasts were collected by centrifugation at 3,500 rpm,

10 minutes at room temperature. The protoplasts were washed three times with 1xSTC solution

[20% sucrose, 50 mM Tris-HCl (pH 8.0), 50 mM CaCl2 in 1 L distilled water], and were collected by centrifugation with same conditions described above. M. oryzae protoplasts were diluted to

1x108 protoplasts ml-1. The protoplasts were aliquoted into 200 ul in 1.5 ml sterilized centrifuge tubes and were kept at -20oC.

To transform DNA fragments or DNA plasmids in M. oryzae protoplasts, 0.5 ug of DNA was added into 200 ul of M. oryzae protoplasts. Then 1 ml of PTC solution (40% polyethylene glycol in 1XSTC) was added into the mixture of protoplasts and DNA. Mixture solution was incubated at room temperature for 15 minutes, and TB3 media (3 g of yeast extract, 3 g of casamino acids, and 20% sucrose in 1 L distilled water) was added and cultured overnight.

The transformants were grown in TB3 media with Hygromycin B (250 ug/ml).

True transformants were confirmed by PCR or RT-PCR or Southern blot analysis.

Southern blot analysis

Genomic DNA of the M. oryzae isolate KJ201 and mgg_05232 knockout lines was digested with AvaI for 6 hours. Digested DNA samples were run on gel electrophoresis, and transfered to the HybondTM blot overnight. Southern blot analysis was performed by following the protocol of ECL direct nucleic acid labeling and detection system (Amersham).

Assays for vegetative growth, conidia production, conidia germination, appressoria formation

Disc of mycelia, about 3 mm2 in size, grown in CM plate were individually cultured in CM agar with 200 ug/ml Calcoflour white, 0.01%SDS, and 200 ug/ml Congo red, and cultured at 28oC in dark condition. The diameter of each M. oryzae was measured after 7 days of incubation.

The ability to produce conidia was measured by counting the number of conidia from seven-day-old culture on V8 agar plate (80 ml V8 juice, 920 ml distilled water, 15 g agar). Conidia were collected by flooding V8 agar plate with 5 ml of sterilized distilled water. The number of conidia was counted using a hemacytometer under a microscope.

Conidia (1x104 spore ml-1) suspension was measured on a plastic coverslip. About 40 ml of conidia suspension was dropped on a plastic coverslip which was permanently fixed on a glass slide using a clear-nail polish. The prepared slide was placed in a moist box at room temperature. Conidia germination was measured at 1 hour after conidia spore preparation.

Conidia germination was measured as the percentage ration of germinating conidia to total conidia.

Appressorium formation was measured on a plastic coverslip. About 40 ul of conidia suspension (1x104 spore ml-1) was dropped on a plastic coverslip fixed on the glass slide.

The prepared slide was placed in a moisten box at 28oC. After 9 hours of incubation, the percentage of appressorium formation was determined by microscopic examination of at least

100 appressoria per replicate in at least three independent experiments.

Cloning of M. oryzae genes encoding CBM-containing proteins

The genes were cloned from cDNA of M. oryzae mycelia, or from cDNA of M. oryzae- infected rice, or from genomic DNA of M. oryzae mycelia when intron are not present in their genes. The genes were amplified by PCR using gene-specific primers and cloned into the plant expression vector pXUN (Chen et al., 2009) with the protocols described in chapter 2.

These constructs were employed for rice protoplast transient expression experiments.

In addition, MGG_08409, MGG_05232, and MGG_08370 with or without signal peptides were also cloned into pXUN-CHA to facilitate protein detection in Western blot analysis.

The genes were further cloned into pGD (Goodin et al., 2002) to make vectors for

Agrobacterium-mediated transformation on Nicotiana benthamiana leaves. The pXUN vector contained two BamHI recognition sites outside the insertion region. Therefore, the BamHI- digested fragments containing the full-length (FL-) of the genes and the truncated coding region without signal peptide (NS-) from the pXUN-based plasmids were inserted into the BamHI site of pGD, respectively. These constructs were employed for agroinfiltration assays in

N. benthamiana.

Protoplast transient expression assay and agroinfiltration assay in N. benthamiana

Transient expression assays in the protoplasts of rice and agroinfiltration assay in

N. benthamiana were carried out following the protocols described in chapter 2.

In order to investigate the protein accumulation of the FL- and NS- version of

MGG_05232, MGG_08409, and MGG_08370, Agrobacterium tumefaciens strain GV3101 carrying FL- or NS- of the gene fusing with the HA epitope tag was grown in liquid YEP media

86 supplemented with 50 mg/ml kanamycin and 50 mg/ml rifampicin at 28oC in a shaking incubator at 200 rpm. After 18 hours, bacterial cells were collected at 3,200 g for 20 minutes and re-suspend in MES buffer (10 mM MgCl2 and 10 mM MES, pH 5.6) to a final OD600 of 1.5 for all constructs except 1.0 for the pGD-p19 construct, and 0.25 for the pGD-TAP tag construct

(an internal control). After acetosyringone was added to a final concentration of 150 uM, bacterial suspension was kept at room temperature and in the dark for 3 hours before it was used for agroinfiltration in to leaves of two month-old N. benthamiana. A GV3101 carrying the pGD-GFP vector was used as a negative control.

Protein purification and western blot analysis

Samples from N. benthamiana infiltrated tissues were harvested after 24-36 hours after agroinfiltration. Total protein from leaf tissues was extracted with protein extraction buffer

(50 mM Tris-MES pH 8.0, 0.5M Sucrose, 1 mM MgCl2, 10 mM EDTA, 5 mM DTT, and plant protease inhibitor cocktail). Insoluble debris was pelleted by centrifugation at 13,000 rpm for

10 minutes. Protein concentration was measured by Bio-Rad protein assay reagent (Bio-Rad).

The 5% SDS sample loading was added, and samples were boiled for 5 minutes. Samples of the reaction were then separated on a 15% SDS-PAGE gel. The HA and TAP signals were detected by western blotting with the anti-HA antibody, or with the peroxidase anti-peroxidase (PAP) antibody, respectively, followed by chemiluminescence with the ECL kit (Promega, USA).

Gene Expression Analysis by RT-PCR

Inoculated leaf tissues harvested at 0, 24, 48, 72, 96 and 120 hours point inoculation

(hpi) and mycelium tissue was subjected to total RNA isolation using the TRIzol solution

(Invitrogen Life Technology, Carlsbad, CA). Total RNA from appressoria was prepared previously in the laboratory and was used directly for further steps. N. benthamiana leaves agroinfiltrated with pGD harboring FL- or NS- MoCDIPs were harvested 36 hours after agro-infiltration. All total

RNA samples were treated with RNase-free DNase1 (Ambion, Austin, TX) to remove DNA contamination. The poly (A+) mRNA was isolated from one microgram of total RNA using

Yeast Secretion Assay

Cellulose binding assay

The binding of recombinant proteins to cotton linters, a microcrystalline cellulose substrate (Sigma) were performed as described by Koseki et al. (2008). Purified proteins (5 ug) in

50 mM sodium acetate buffer (pH 5) were incubated at room temperature for 2 hours with 1% cotton linters in a final volume 50 ul. The tubes were centrifuged at 15,000 g for 2 minutes, and the supernatants were removed from the pellets, and were added with 5%SDS loading buffer.

These samples then were boiled for 10 minutes, and were kept in ice box before protein separation in SDS-PAGE. To elute proteins from the pellets, the pellets were washed with the same buffer two times. Then, 50 ul of same buffer with 5% SDS loading buffer was added in to the washed-pellets, and the samples were boiled for 10 minutes to release the bound proteins from the cellulose substrate. The boiled-samples were centrigued at 15,000 g for 2 minutes, and the supernatants were taken and used for protein seperatation. All samples including the supernatants from the first step and the supernatants after proteins releasing from the cellulose substrate were separate on 15% SDS-PAGE and stained with Coomassie Brilliant Blue.

After destaining of Coomassie Brilliant Blue, the SDS-PAGE gel was photographed to visualize the protein bands presented in each samples for cellulose binding analysis.

Endoglucanase activity assay

Recombinant proteins with different concentration (2.5, 5, and 10 ug) were mixed with

1% carboxymethylcellulose (CMC, Sigma) in 50 mM sodium acetate buffer (pH 5.0) with a final volume 500 ul. The sample mixtures were incubated at room temperature for 2 hours.

The samples were centrifuged at 15,000 g for 2 minutes, and supernatants were used for endoglucanase activity assay using dinitrosalicylic acid (DNS: 1.4%DNS, 0.28% phenol, 0.07% 89 sodium sulfite, 28% Na-K-tartarate) reagent method. After 2 hours incubation, an equal volume of DNS reagent was added in each tube. The samples then were heated at 95oC for color development. The absorbance at 540 nm was measured with the OD reader.

Disc of M. oryzae mycelia, 3 mm2 in size, from the wild-type isolate and the transgenic mutants were placed in 5 ml of minimal media (0.5 g/L KCl, 0.5 g/L MgSO4, 1.5 g/L KH2PO4, 0.1%

(v/v) trace elements , 2% CMC). All transgenic M. oryzae lines and wild-type isolate were incubated at 28oC in dark and shaking condition at 250 rpm. After 5 days of inoculation, mycelia of each sample were separated and the liquid samples were used for endoglucanase activity assay. The modified CMC assay was performed in 96-well PCR plates as described in Xiao et al.

(2005). Firstly, each well of PCR strip was added 60 ul of liquid sample and 60 ul of DNS reagent.

The mixture samples in PCR strip were heated at 95oC for 5 minutes in PCR machine for color development. All incubated mixtures were transferred to each well of microplate.

The absorbance at 540 nm was measured with a plate reader. Glucose solution at different concentration was used for obtaining the standard curve.

Results

1. Sequence and structural analysis of MoCDIPs

To study the characteristics of the five MoCDIPs in more detail, their amino acid sequences were used for BLASTP searches against the M. oryzae database of the Broad Institute of MIT and Harvard, as well as the NCBI nr database. In addition, domain-motif analysis was performed using SMART (Simple Modular Architecture Research Tool) (Schultz et al., 1998;

Letunic et al., 2012), SUPERFAMILY HMM search tool (Gough et al., 2001), as well as searching against the Pfam database. Results from BLASTP searches and domain-motif searches of the

5 MoCDIPs are described below.

1). MGG_03356

MGG_03356 is assigned to ricin B lectin : Parallel beta-helix with 355 amino acid residues. BLASTP searches against the M. oryzae database and the NCBI nr database indicated that MGG_03356 has no protein homologs in M. oryzae. However, this protein does show similarity to ricin B proteins from other microorganisms. In addition, domain analysis using

SMART tools and SUPERFAMILY HMM search tools revealed that amino acid residues between positions 50-307 of MGG_03356 were predicted to be a pectin lyase-like domain. Also, Parallel beta-helix repeats (PbH1s), usually found in the tertiary structures of pectin lyases, were predicted at the amino acid residues between positions 163-185, 269-291, and 292-324 (Figure

3.3A). Pectin lyases are responsible for degradation of pectin polymer, resulting in the formation of unsaturated oligogalacturonides (Yadav et al., 2009). In addition, pectin lyases were reported to be involved in disease development. For example, the pectin lyase gene in Colletotrichum gloeosporioides was shown to be a virulence factor in avocado fruit (Yakoby et al., 2001). 91

2). MGG_05531

MGG_05531 is assigned to Adenylate cyclase interacting protein, ACI1, or MAC1 interacting protein1 with 173 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_05531 has a relatively large number of homologs in the sequenced genome of M. oryzae as well as in other microorganisms. Homology searches also revealed that MGG_05531 belongs to family of CFEM-containing proteins, which may function as cell-surface receptors, signal transducers, or as adhesion molecules in host- fungi interactions (Kulkarni et al., 2004). Searching against the Pfam databases, a CFEM domain was predicted to be located in the amino acid sequence position between 28-93 (Figure 3.3B).

3). MGG_07986

MGG_07986 is assigned to a hypothetical protein with 113 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_07986 has no homologs in the M. oryzae genome or in the sequenced genomes of other organisms.

No domains or motifs were found from searching against domain or motif prediction tools

(Figure 3.3C).

4). MGG_08409

MGG_08409 is assigned to a cellulose growth-specific protein, containing 295 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_08409 has a relatively large number of homologs in the sequenced genome of M. oryzae and other microorganism. MGG_08409 was a highly conserved homolog to glycosyl hydrolase family 61 proteins. Searching against the Pfam database, amino acid sequences at the

92 positions between 19-226 were predicted to be glycosyl hydrolase family 61. Furthermore, amino acid sequences at the positions between 263-295 were predicted to be CBM1, which was previously known as CBD (Figure 3.3D). Glycosyl hydrolase are a large group of enzymes that hydrolyze glycosidic bonds of carbohydrate substrate. The family 61 of glycosyl hydrolases was classified based on the weak activity in endo-1,4-B-D-glucanase. In addition, it was shown to degrade lignocellulose when used in combination with other cellulases (Cantarel et al., 2009).

5). MGG_10234

MGG_10234 is assigned to a hypothetical protein with 179 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_10234 has no homolog proteins in M. oryzae. In addition, MGG_10234 shares similarity to ricin B lectin proteins, but there is no sequence similarity between MGG_10234 and MGG_03356. With

SUPERFAMILY HMM search tool, Metalloproteases (zincins) catalytic domain was predicted at the amino acid sequences between the positions 34-114 (Figure 3.3E). In human pathogenic microorganisms, zinc metalloproteases are involved in human pathogenesis. The proteases can digest a wide variety of host proteins that cause necrotic tissue in structural component of the cornea or basement membrane (Miyoshi et al., 2000). In M. oryzae, Avr-Pita that is recognized by the corresponding R protein Pi-ta is a putative protein containing conserved metalloprotease domain (Orbach et al., 2000). However, its virulence function is still elusive. Interestingly, in plant-microbe interactions, fungalysin metalloprotease secreted by Fusarium veticilliodes may be involved in manipulation of plant immunity, since the protein was shown to truncate maize class IV chitinases, defense proteins associated with plant defense (Naumann et al., 2011).

To characterize the function of MoCDIPs in depth, we particularly focused on

MGG_08409, since the function in PAMP elicitor and the virulent function of cellulose-binding proteins was demonstrated in other plant pathogenic microorganisms and nematodes. We were also interested in studying the function of the M. oryzae CBM-containing effectors, because we found that 29 of 54 M. oryzae genes harboring various types of CBMs were shown to be expressed during infection on rice plants. This information suggests an important function of the

CBM-containing proteins during the infection stage. For other MoCDIPs, some of them were functionally characterized by other lab members and collaborators. MGG_03356, predicted to be a pectin lyase protein, was studied by Burbano-Fiqueroa (2009). Transgenic M. oryzae overexpressing MGG_03356 are shown to be able to overcome the HR response elicited during an incompatible interactions. It is proposed that pectin, a component of plant cell walls is degraded by pectin lyase encoded by MGG_03356. The degradation of pectin results in the reduction of plant sensing to pathogen attack. MGG_05531, or ACI1 was characterized by Deng and Dean (2008). ACI1 was shown to interact with MACI (Kulkarni and Dean, 2004), a key protein in the cAMP pathway which modulates appressorium formation. Unsurprisingly, ACI1 was found to be required for normal appressorium formation. However, no function in pathogenicity was identified due to functional redundancy of the homolog protein.

Figure 3.3. Schematic views of 5 MoCDIPs show structural analyses of MGG_03356 (A), MGG_05531 (B), MGG_07986 (C), MGG_08409 (D), and MGG_10234 (E). The predicted domains or motifs of MoCDIPs are represented as color rectangles.

2. Identification and cloning of M. oryzae genes encoding CBM-containing effector proteins

To identify more M. oryzae CBM-containing effectors, we used a gene search tool based on the PFAM domain in the M. oryzae databases of Broad Institute of MIT and Harvard to search for genes encoding CBM-containing proteins. We also employed the CAZY databases

(http://www.cazy.org) that provided a list of the genes encoding CBM-containing proteins from various organisms, including M. oryzae. Searching against two databases, we identified 56

M. oryzae genes encoding CBM-containing proteins. These genes harbor different CBM families, which are predicted to bind to different carbohydrate substrates, including cellulose, B-1,3 glucan, xylan, arabinofuranose, and chitin. To obtain putative M. oryzae effectors harboring

CBM, we matched the 56 M. oryzae genes with 851 M. oryzae genes encoding predicted effector proteins identified previously by our RL-SAGE, MPSS, and SBS approaches (Chen et al.,

2012). In total, 29 M. oryzae CBM-containing effectors were identified (Appendix B, Table B.1).

We excluded 6 genes with same sequences encoding for CBM18 (chitin binding module), and

2 genes, MGG_08409 and MGG_10040, that were cloned previously. Thus, fifteen of 21 genes were cloned into the plant expression vector pXUN for further analysis (Figure 3.4, and Table

3.1).

Figure 3.4. Schematic diagram of the strategy used for identification of M. oryzae genes encoding CBM-containing effector proteins.

Table 3.1. The list of 15 M. oryzae genes encoding CBM-containing effector proteins for functional identification

No. Gene ID CDS size Gene Annotation from M. oryzae database CBM family (bp) of Broad Institute of MIT and Harvard 1 MGG_02245 1140 Endo-1,4-beta-xylanase CBM1 2 MGG_05232 729 Conserved hypothetical protein CBM52 3 MGG_05620 1569 Alpha-galactosidase1 CBM35 4 MGG_06009 1503 Alpha-N-arabinofuranosidase CBM42 5 MGG_08370 1602 1,3-beta-glucanosyltransgerase gel3 CBM43 6 MGG_08408 1137 Conserved hypothetical protein CBM1 7 MGG_08496 1368 Endo1-,4-beta-xylanase CBM6 8 MGG_10083 1131 Endoglucanase3 CBM1 9 MGG_10333 1227 Chitinase CBM1 10 MGG_10621 1533 Xylosidase/arabinosidase CBM6 11 MGG_10972 891 Endoglucanase1 CBM1 12 MGG_11036 2526 Conserved hypothetical protein CBM1 13 MGG_13241 1011 Endoglucanase4 CBM1 14 MGG_14726 1173 Alpha-L-arabinofuranosidase CBM1 15 MGG_15430 1296 Endo-1,4-beta-xylanaseA CBM1 16* MGG_08409 888 Cellulose growth-specific protein CBM1 CBM1 represents Carbohydrate Binding Module1, predicted to bind to cellulose.

CBM6 represents Carbohydrate Binding Module6, predicted to bind to amorphous cellulose and xylan.

CBM35 represents Carbohydrate Binding Module35, predicted to bind to xylan.

CBM42 represents Carbohydrate Binding Module42, predicted to bind to arabinofuranose.

CBM43 represents Carbohydrate Binding Module43, predicted to bind to beta-1,3-glucan, usually protein harboring this module carries a c-terminal membrane anchor domain.

CBM52 represents Carbohydrate Binding Module52, predicted to bind to beta-1,3-glucan.

MGG_08409 is a CBM-containing protein previously described in chapter 2 to have the role in cell-death induction in rice protoplasts.

3. Identification of cell death inducing M. oryzae CBM-containing effectors using the rice protoplast transient expression system

Previously, Phytophthora parasitica CBEL, a protein with two CBDs classified in the

CBM1 family, was able to elicit necrotic lesion and defense gene expression in tobacco leaves

(Gaulin et al., 2006). Also, our results showed that MGG_08409 containing CBD induces cell death in rice cells (see chapter 2). In addition, the cell death induced by MGG_08409 share some

PCD characteristics with known cell death-inducer proteins. Thus, we speculated that proteins containing CBD may share a similar role in cell death induction. Furthermore, CBEL protein from oomycetes was thought to elicit PCD through interaction with the cell wall. This suggests that proteins containing other CBM families involved in plant cell wall component binding may have cell-death inducing function.

To identify M. oryzae CBM-containing effector proteins involved in host cell death, transient expression of M. oryzae CBM-containing effector proteins in rice protoplasts were carried out. In the assay, the cell death is monitored by the reduced expression level of a co-transfected GUS reporter gene in rice protoplasts. There were a total of 15 CBM-containing protein genes with two different versions: one containing the full-length open reading frame

(ORF) (-FL) and the other containing the truncated encoding region without the signal peptide sequence, but with an engineered ATG start codon (-NS), which were employed for transient expression assay in rice protoplasts. The transient assay revealed that among 15 genes, two M. oryzae CBM-containing effector protein genes, i.e., MGG_05232 and MGG_08370 were able to reduce GUS activity when genes were expressed in FL-version in rice protoplasts.

By contrast, the gene expression of NS-version did not show reduction in GUS activity (Figure

3.5). The results indicated that MGG_05232 and MGG_08370, which are CBM-containing effector proteins, have function in cell death induction in rice cells, and most likely function in extracellular space.

In fact, we found that two novel M. oryzae cell death-inducing effectors did not contain

CBD domain. MGG_05232 harbors CBM 52, which is predicted to bind to beta-1,3-glucan,

MGG_08370 also harbors CBM 43, which is predicted to bind to beta-1,3 glucan, and associated with a C-terminal membrane anchor domain. Surprisingly, no M. oryzae effectors containing

CBD domain were found to induce cell death.

100

Figure 3.5. Identification of M. oryzae CBM-containing proteins that induce cell death in rice cells. Ectopic expression of full-length (-FL) and truncated version without signal peptide (-NS) of fifteen M. oryzae CBM-containing proteins in rice protoplasts. CK, protoplast sample co-transfected with a GUS reporter and an empty vector control; the others, protoplast samples co-transfected with a GUS reporter and the other construct carrying M. oryzae genes containing CBM. Data bars show averages from three triplicate samples in one experiment. Each experiment was repeated at least three times with similar results.* Indicates significant difference from CK with FL-MGG_05232 and FL-MGG_08370 at P<0.02 (t-test).

101

4. Transient expression of two M. oryzae genes encoding CBM-containing proteins, MGG_05232 and MGG_08370, in N. benthamiana

Previously, we have shown that MGG_08409 induces cell death in the non-host plant

N. benthamiana. We wanted to determine whether MGG_05232 and MGG_08370 also have cell death effects in the non-host plant. Transient expression assays of MGG_05232 and

MGG_08370 were performed in N. benthamiana leaves via the Agrobacterium-mediated transient expression method. A. tumefaciens containing the empty vector pGD, or a pGD recombinant expressing WtsE were used as negative and positive controls, respectively.

Consistent with results from the protoplast assays, infiltration of N. benthamiana leaves with the Agrobacterium strains expressing FL-MGG_05232 and FL-MGG_08370 resulted in cell death response (Figure 3.6A). By contrast, infiltration of the strains carrying the constructs expressing the NS-MGG_05232 and NS-MGG_08370 did not result in cell death in the infiltrated area. These results confirmed that MGG_05232, and MGG_08370 induced cell death in N. benthamiana similar to cell death induced by MGG_08409 in non-host plant. In addition, the appearance of the cell death in N. benthamiana leaves induced by the FL_MGG_05232 strain was stronger than those induced by the other five FL-MoCDIPs strains, previously described in chapter 2, but slightly weaker than the cell death induction by WtsE strain. The cell-death symptom induced by the FL_MGG_05232 strain appeared 2-3 days after agroinfiltration, while FL_MGG_08370 induced very weak cell death at 4-6 days after agro-infiltration. To rule out the possibility that instability in NS-MGG_05232, NS-MGG_08370, and NS-MGG_08409 proteins cause the failure of cell death induction in N. benthamiana, we performed western blot analysis to observe protein accumulation of FL- and NS- versions of the three CBM-containing proteins during transient expression of their genes in N. benthamiana. The mixtures of A. tumefaciens containing a PGD-

102 harboring TAP gene, an internal control and A. tumefaciens containing a PGD recombinant expressing FL- or NS- of each MGG_05232:HA, MGG_08370:HA, and MGG_08409:HA were used for agroinfiltration in N. benthamiana leaves. The samples were harvested 36 hours after agroinfiltration and proteins from each sample were subjected to western blot analysis.

Cell death induction by the three CBM-containing effectors fusing with the HA tag in

N. benthamiana were demonstrated in figure 3.6B, confirming the proper function of recombinant proteins. The western blot analysis results indicated that relative to the TAP protein, an internal control, the level of protein accumulation in the FL- and NS- versions of the three CBM-containing effector proteins were similar in the agroinfiltrated N. benthamiana leaf areas (Figure 3.6C), indicating that these proteins function in cell death induction only when their signal peptides were present. The result suggests that MGG_05232, MGG_08370, and

MGG_08409 function in apoplastic space to cause cell death of plant cells.

103

Figure 3.6. Transient expression of M. oryzae genes encoding for CBM-containing proteins in non-host plant, N. benthamiana. (A) Transient expression assay of the MGG_05232, MGG_08370, and MGG_08409 in N. benthamiana leaves using agroinfiltration approach. Agroinfiltration was performed on the same side of each leaf side by side with A. tumefaciens carrying and empty vector control (pGD), a positive control (WtsE), constructs with full-length MGG_05232, MGG_08370, and MGG_08409 or constructs with non-signal peptide MGG_05232, MGG_08370, and MGG_08409, respectively. (B) Transient expression assay of MGG_05232- CHA, MGG_08370-CHA, and MGG_08409-CHA in N. benthamiana leaves by using agroinfiltration.

104

Figure 3.6. continued

Agroinfitration was performed on the same side of each leaf side by side with the mixing suspension of A. tumefaciens carrying pGD-TAP (internal control), A. tumefaciens carrying pGD- p19, and A. tumefacien carrying FL- CBM gene fusing HA/or NS- CBM gene fusing HA. The similar mixing suspension except A. tumefacien carrying GFP-CHA/or empty pGD was also used as negative control. Cell-death induction in infiltrated areas was observed in 48-96 hrs after agroinfiltration. (C). Western blot with the anti-HA antibody to quantify the FL- and NS- version of three CBM-containing effector proteins. The TAP tag gene was expressed as an internal control, and the proteins was detected by western blot with the peroxidase anti-peroxidase (PAP) antibody.

105

5. Gene expression analysis of the M. oryzae genes encoding CBM-containing proteins

To experimentally confirm that MGG_05232 and MGG_08370 are expressed during infection in rice, and to determine their expression pattern in appressoria and mycelia, RT-PCR was performed using the total RNA extracted from Nippobare rice leaves infected with the compatible isolate KJ201 at different time points post inoculation (0, 24, 48, 72, 96, and 120 hpi), as well as from appressoria and mycelia. The expression of MGG_05232 was observed in the infected rice leaves at 96 and 120 hpi, while the expression of MGG_08370 was detected in the infected rice leaves at 120 hpi. In addition, MGG_05232 and MGG_08370 were expressed in appressoria and in mycelia as well (Figure 3.7). This result confirmed that MGG_05232 and

MGG_08370 were expressed at the infection stages.

106

Figure 3.7. In-planta expression pattern of the M. oryzae genes encoding CBM-containing proteins, MGG_05232 and MGG_08370. Total RNA samples extracted from infected rice cultivar Nipponbare leaves, 0, 24, 48, 72, 96, or 120 hours after inoculation with M. oryzae isolate KJ201, from in vitro grown M. oryzae appressoria (A) and mycelia (M) were subjected to RT-PCR using specific primers.

107

6. Validation of the secretory feature of the M. oryzae CBM-containing proteins by the Yeast

Secretion Analysis System

To observe the function of the predicted secretion feature of the two identified CBM- containing cell death inducing effectors, MGG_05232 and MGG_08370, we performed a yeast secretion assay, described in chapter2. The sequences of both FL- and NS-, either MGG_05232 or MGG_08370, were fused in frame to the N-terminal end of a yeast invertase (suc2) gene lacking its own signal peptide sequence. The fusion constructs were transformed into the yeast strain DBYα2445, an invertase-deficient mutant, and the transformed yeasts were grown directly on a sucrose medium and assayed for secretion. Consistent with previous observations, the yeast strain transformed with the constructs containing the NS-versions of MGG_05232 or

MGG_08370 fused with suc2 did not grown on sucrose medium (Figure 3.8), due to the lack of secreted invertase to catalyze the decomposition of sucrose into fructose and glucose as the carbon source. By contrast, the FL-version of MGG_05232 or MGG_08370 fusing with suc2 enabled the yeast mutant strain to grow on the sucrose medium, confirming that the predicted signal peptides of MGG_05232 and MGG_08370 function in protein secretion. Combined with the results from transient expression in rice protoplasts, and in N. benthamiana, we concluded that MGG_05232 and MGG_08370 required their signal peptide for cell death function in the plant apoplastic space.

108

Figure 3.8. Validation of the secretory feature of M. oryzae CBM-containing proteins, MGG_05232 and MGG_08370 by yeast secretion analysis. (A) Schematic diagram of the yeast secretion trap vector (pYST) developed by Lee et al., 2006. Either full-length or non-signal peptide versions of cDNA insertion are inserted at EcoRI and NotI restriction sites. The vector contains the promoter (PADHI) and terminator (TADHI) of the alcohol dehydrogenase gene. suc2 represents a yeast inverstase gene lacking its own signal peptide and initiator methionine. The constructs were transformed to an invertase-deficient yeast mutant, DBYα2445. Constructs containing functional signal peptides lead to the expression of an invertase enzyme coding by suc2. The transformed DBYα2445 yeasts with the secreted invertase property were able to utilize sucrose and grew on the sucrose medium, but not the transformed DBYα2445 yeasts lacking secreted invertase property.

109

Figure 3.8. continued

(B) Yeast DBYα2445 strains were cultured directly onto sucrose medium after transfection. The cells (with the red-arrow heads) transformed with constructs containing FL-MGG_05232:suc2 or constructs containing FL-MGG_08370:suc2 grew on the medium containing sucrose (upper panels); No cells containing NS-MGG_05232:suc2 or constructs containing NS-MGG_08370:suc2 grew on the medium containing sucrose (lower panels).

110

7. Sequence and structural analysis of M. oryzae CBM-containing proteins, MGG_05232 and

MGG_08370

1) MGG_05232

MGG_05232 is assigned to a hypothetical protein with 113 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_05232 has protein homologs neither in the M. oryzae genome nor in the sequenced genomes of other organisms. Homology searches also revealed that MGG_05232 contains CBM family 52 (CBM 52) at amino acid sequences between positions 20-72 (Figure 3.9). CBM 52 is predicted to bind to beta-1,3-glucan, since the high affinity of binding was first demonstrated in Eng1 endo-beta,1,3- glucanase protein containing CBM52 from Schizosaccharomyces pombe (Martín-Cuadrado et al.,

2008).

2) MGG_08370

MGG_08370 is assigned to 1,3-beta-glucanosyltransferase gel3 with 533 amino acid residues. BLAST searches against the M. oryzae database and the NCBI nr database indicated that MGG_08370 has homology to proteins from other microorganisms but no homolog protein in M. oryzae. In addition, homology searches also revealed that MGG_08370 contains a GAS1 domain at amino acid sequences between positions 16-334. Amino acid residues between the positions 383-475 were predicted to be from the carbohydrate binding module family 43

(CBM43), formerly known as X8 modules (Figure 3.9). GAS1 domain was demonstrated to be essential for membrane anchoring of glycolipid proteins in Saccharomyces cerevisiae (Nuoffer et al., 1991). CBM 43 is predicted to bind to beta-1,3-glucan with the presence of membrane

111 anchor domain. The ability to bind to beta-1,3-glucan was demonstrated with the olive pollen protein containing X8 domain, Ole e 10 (Barral et al., 2004). Furthermore, Arabidopsis GPI- anchor plasmodesmal neck protein containing X8 domain was shown to bind to callose, a plant polysaccharide composed of B-1,3-glucan (Simpson et al., 2009).

Figure 3.9. Schematic views of M. oryzae CBM-containing proteins show structural analyses of MGG_05232 (A) and MGG_08370 (B). The predicted domains or motifs are represented as colored rectangles.

112

8. Protein localization of M. oryzae CBM-containing proteins during rice leaf sheath infection

To investigate the localization of the M. oryzae CBM-binding proteins MGG_05232,

MGG_08370, and MGG_08409, during biotrophic invasion of rice, we generated transgenic transformants harboring individual CBM-containing protein gene fusing eGFP under control of a 1 kb native promoter fragment in isolate KJ201. Infected rice leaf sheath epidermal tissue was used to investigate protein localization at 24-48 hours. We found that during the biotrophic stage, MGG_05232:eGFP proteins accumulated at the invasive hypha (IH), most likely in cytoplasm. We could not observe the protein in the biotrophic interfacial complex (BIC) or in the outline of the IH. Surprisingly, the protein could be observed predominantly in the spore tips during investigation of the samples at 6 hours after inoculation (Figure 3.10). In the case of

MGG_08370:GFP proteins, we found that this protein accumulated in nonspecific structures.

The fluorescently labeled proteins were observed in appressoria and in the IH during the biotrophic invasion (Figure 3.11). We also found that MGG_08409:eGFP proteins accumulated at the tip of the IH during biotrophic invasion. However, we could not observe protein localization in the BIC (Figure 3.12).

113

Figure 3.10. Cellular localization of MGG_05232:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 6-12 hours after inoculation (HAI), to observe spore germination, and at 24-36 HAI to observe the invading IH. During spore germination, the MGG_05232:eGFP was observed predominantly in the spore tips. Also, the MGG_05232:eGFP accumulated in the IH is most likely not specific to the outline of the IH.

114

Figure 3.11. Cellular localization of MGG_08370:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 18-36 HAI. (A) The MGG_08370:eGFP was not observed during spore germination. (B) The MGG_08370:eGFP was observed in appressoria and (C) in the invasive hypha (IH) during the invasive stage.

115

Figure 3.12. Cellular localization of MGG_08409:eGFP in M. oryzae isolate KJ201 during biotrophic growth on rice sheath epidermal cells at 24-36 HAI. (A) The MGG_08409:eGFP was not observed in spore and vegetative hypha. (B) The MGG_08409:eGFP was not observed during spore germination. (B) The MGG_08409:eGFP was slightly observed in appressoria and (D) the MGG_08409:eGFP was observed at the tip of the IH during the invasive stage.

116

9. Characterization of the CBM-containing proteins MGG_05232, MGG_08370, and

MGG_08409

9.1 Phenotypic characterization of MGG_05232

9.1.1 Pathogenecity analysis of mgg_05232 transgenic knockout and overexpression mutants

In order to determine the role of MGG_05232 in pathogenicity, we generated mgg_05232 transgenic knockout and overexpression mutants. We performed gene replacement by the split-marker strategy (Jeong et al., 2007), in which the target gene is replaced with the homologous sequence flanking the hph (hygromycin B phosphotransferase gene) cassette to generate knockout mutants (Figure 3.13A). Targeted replacement mutants were identified by

PCR (Figure 3.13B), and were further confirmed by RT-PCR (Figure 3.13C) and by Southern blot analysis (Figure 3.14). The two individual knockout transformants mgg_05232-1 and mgg_05232-2, which were confirmed by RT-PCR and Southern blot analysis, were further used for pathogenicity analysis.

To generate the MGG_05232 overexpression mutants, an overexpression cassette containing the constitutive promoter from the M. oryzae ribosomal protein 27 gene was fused in frame with the MGG_05232 coding region, and then was transformed into isolate KJ201.

Finally, the MGG_05232 overexpression mutants were confirmed by RT-PCR (Figure 3.16A).

In total, we obtained three transformants: OX-MGG_05232-1, OX-MGG_05232-2, and OX-

MGG_05232-4, which were used for pathogenicity analysis.

To determine whether MGG_05232 is involved in pathogenicity, spore suspensions of the two independent knockout transformants, three dependent overexpression transformants,

117 and the wild-type were employed for punch inoculation in susceptible rice cultivar Nipponbare.

Ten days after inoculation, lesion sizes of blast infection, sporulation, and relative fungal growth were evaluated. Each experiment was repeated at least three times with similar results.

The results demonstrated that either mgg_05232 transgenic knockout mutants, or the

MGG_05232 overexpression mutants did not show significant differences in their lesion sizes, spore numbers, or relative fungal growth compared with the wild-type (Figure 3.15 and Figure

3.16). In addition, we assessed the role of MGG_05232 in pathogenicity by spray method.

Spore suspensions of the two knockout transformants, the two overexpression transformants, and the wild-type were used for spray inoculation. Spray inoculation of all mutants and wild- type KJ201 were performed in the compatible rice cultivar Nipponbare, and the incompatible rice cultivar Toride. After five days of inoculation, relative fungal growth from infected leaf tissues was evaluated. No difference in relative fungal growth was observed among compatible rice cultivar Nipponbare tissues inoculated with the knockout mutants, the overexpressed mutants, and the wild-type (Figure 3.17A, B). Furthermore, either the knockout mutants or the overexpression mutants did not affect the resistant phenotype generated from incompatible interaction (Figure 3.17C).

118

Figure 3.13. Target gene replacement of MGG_05232 in isolate KJ201, and knockout confirmation. (A) Strategy for the replacement of MGG_05232 by the split-marker gene replacement system. A chimeric PCR product of 1 kb upstream region of MGG_05232 fusing with a half of hygromycin resistant gene (Hph) from N-terminus site, and a chimeric PCR product of 1 kb downstream region of MGG_05232 fusing with a half of hygromycin resistant gene from C-terminus site were generated. Both chimeric PCR fusing fragments were transformed to M. oryzae isolate KJ201 protoplasts via PEG-mediated method. Homolog recombination occurs during gene replacement process. (B) PCR confirmation of knockout mutants using gene-pecific primers (left panel) or using primers specific to upstream regions of left border, and to downstream regions of right border (right panel) were performed. (C) RT-PCR for expression analysis of MGG_05232 in wild-type KJ201, and two knockout transformants, mgg_05232-1 and mgg_05232-2, was performed using gene specific primers and B-tubulin gene-specific primers as control.

119

Figure 3.14. Southern blot analysis of the mgg_05232 knockout mutants. (A) Organization of the MGG_05232 locus before homologous recombination (wild-type) and after homologous recombination (knockout). Three different probes: upstream region of MGG_05232-specific probe (Probe No.1), and coding region of MGG_05232-specific probe (Probe No.2), and coding region of Hph-specific probe (Probe No.3) were used for Southern blot analysis. (B) Total genomic DNA from wild-type and genomic DNA from two different knockout mutants were digested with AvaI,

120

Figure 3.14. continued and then subjected for Southern blot analysis using the three previously described probes. Hybridization with probe no.1 yielded a 1,149 bp product from the wild-type, and 2,893 bp product from the knockout mutants. Hybridization with probe No.2 yielded the 1,149 bp product from the wild-type, but no product from the knockout mutants; hybridization with probe No.3 yielded a 2,443 bp product from the knockout, but no product from the wild-type. 121

Figure 3.15. Pathogenicity analysis of the mgg_05232 knockout mutants by a punch inoculation method. (A) RT-PCR confirmation of wild-type KJ201 and mgg_05232 knockout transformants, mgg-05232-1, mgg-05232-2. MGG_05232 gene-specific primers and M. oryzae B-tubulin gene- specific primers were used for RT-PCR. (B) Punch inoculations of spore suspensions (5x105 spores ml-1) of the wild-type; and transgenic knockout transformants, mgg_05232-1 and mgg_05232-2 on rice cultivar Nipponbare leaves of 6-week-old plants. Leaves were photographed 10 days after inoculation. (C) Lesion area, (D) sporulation, and (E) relative fungal growth on the inoculated leaves were measured or assayed 10 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results.

122

Figure 3.16. Pathogenicity analysis of the MGG_05232 overexpression mutants by a punch inoculation method. (A) RT-PCR confirmation of wild-type and transgenic overexpression transformants, OX-MGG_05232-1, OX-MGG_05232-2, OX-MGG_05232-4, using MGG_05232 gene-specific primers and M. oryzae B-tubulin gene-specific primers as control. (B) Punch inoculations of spore suspensions (5x105 spores ml-1) of wild-type; and of transgenic overexpression transformants, OX_MGG_05232-1, OX-MGG_05232_2, and OX-MGG_05232-4 on rice cultivar Nipponbare leaves of 6-week-old plants. Leaves were photographed 7 days after inoculation. (C) Lesion area, (D) sporulation, and (E) relative fungal growth on the inoculated leaves were measured or assayed 7 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results.

123

Figure 3.17. Pathogenicity analysis of the mgg_05232 knockout mutants and the MGG_05232 overexpression mutants by a spray method (A) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type; the mgg_05232 knockout transformants, mgg_05232-1 and mgg_05232-2; and the MGG_05232 overexpression transformants, OX-MGG_05232-1 and OX- MGG_05232-2 on rice cultivar Nipponbare leaves of 21-day-old plants. Leaves were photographed 5 days after inoculation. (B) Relative fungal growth on the inoculated leaves was assayed 5 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results.

124

Figure 3.17. continued

(C) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type; two knockout transformants, mgg_05232-1 and mgg_05232-2; and two overexpression transformants, OX- MGG_05232-1 and OX-MGG_05232-2 in rice cultivar Toride leaves of 21-day-old plants. Leaves were photographed 5 days after inoculation.

125

9.1.2 Morphological analysis of mgg_05232 knockout mutants.

MGG_05232 contains CBM52 which is predicted to bind to beta-1,3-glucan. Since beta-

1,3-glucan is a component of fungal cell wall, gene replacement of MGG_05232 locus may affect the fungal cell wall integrity. To determine this possibility, we tested the integrity of cell walls of the mgg_05232 knockout transformants. Mycelium disc (about 3 mm2 in size) were cultured on complete medium (CM) agar and CM agar with 200 ug/ml Calcoflour white, 0.01%SDS, and

200 ug/ml Congo red. Calcoflour white and Congo red are fluorochrome dyes that affect the biosynthesis of beta-1,3-glucan and chitin components of fungal cell walls (Roncero and Duran,

1985). Mutants defective in cell wall integrity would be sensitive to these cell wall perturbing agents. The results showed that the sensitivity of the transgenic knockout mgg_05232 transformants to SDS, Calcoflour white, and Congo red are not significantly different from that of the wild-type isolate (Figure 3.18).

We also observed the ability to produce conidia, the ability to germinate, and the ability of appressorium formation of the knockout mutants. The results showed that conidiation, germination, and appressorium formation of the mgg_05232 knockout transformants were indistinguishable from that of the wild-type isolate (Table 3.2).

126

Figure 3.18. Growth analysis of the mgg_05232 knockout mutants on CM agar containing cell wall perturbing agents. The colony morphology of isolate KJ201 wild-type, two knockout mutants, mgg_05232-1, mgg_05232-2, on CM media with 200 ug/ml Calcoflour white, 0.01% SDS, and 200 ug/ml Congo red after culturing for 7 days at 28oC.

127

Table 3.2. Comparison of conidiation, germination, and appressorium formation of wild-type KJ201 and knockout mutants, mgg_05232-1 and mgg_05232-2

128

9.2 Phenotypic characterization of MGG_08370

9.2.1 Pathogenicity analysis of MGG_08370 overexpression mutants

To determine the role of MGG_08370 in pathogenicity, we made an effort to generate

MGG_08370 gene-deletion mutants. However, we could not obtain the knockout mutants.

We also generated MGG_08370 overexpression mutants, in which an overexpression cassette containing the constitutive promoter from the M. oryzae ribosomal protein 27 gene was fused in frame with an MGG_08370 coding region, and then was transformed in isolate KJ201. With

RT-PCR confirmation, two independent MGG_08370 overexpression transformants,

OX-MGG_08370-2, OX-MGG_08370-3, were obtained and used for pathogenesis analysis (Figure

3.19A).

To determine whether MGG_08370 is involved in pathogenicity, spore suspensions of two individual overexpression transformants, OX-MGG_08370-2, OX-MGG_08370-3, and wild- type were subjected to punch inoculation on the susceptible rice cultivar Nipponbare. Seven days after inoculation, lesion sizes of blast infection, sporulation, as well as relative fungal growth were evaluated. Each experiment was repeated at least three times with similar results.

The results demonstrated that the MGG_08370 overexpression mutants did not show significant difference in lesion sizes, spore numbers, or relative fungal growth, compared with the wild- type (Figure 3.19B, C, D, E). We also assessed the role of MGG_08370 in pathogenicity by the spray method. Spore suspensions of the two overexpression transformants, OX-MGG_08370-2,

OX-MGG_08370-3, and wild-type were used for spray inoculation. The spray inoculation of both mutants and the wild-type isolate KJ201 were performed on the compatible rice cultivar

Nipponbare, and the incompatible rice cultivar Toride. After five days of inoculation, relative 129 fungal growth from infected leaf tissues was evaluated. The results demonstrated that no difference in relative fungal growth was observed between compatible rice cultivar Nipponbare tissues inoculated with the MGG_08370 overexpression mutants, and those inoculated with the wild-type (Figure 3.20A, B). Furthermore, overexpression mutants did not affect the resistant phenotype generated from the incompatible interaction (Figure 3.20C).

130

Figure 3.19. Pathogenicity analysis of the MGG_08370 overexpression mutants by a punch inoculation method. (A) RT-PCR confirmation of overexpression transformants OX-MGG_08370- 2 and OX-MGG_08370-3, and the wild-type using MGG_08370 gene-specific primers and M. oryzae B-tubulin gene-specific primers as the control. (B) Punch inoculations of spore suspensions (5x105 spores ml-1) of the wild-type and the overexpression transformants OX-MGG_08370-2 and MGG_08370-3 on rice cultivar Nipponbare leaves of 6-week-old plants. Leaves were photographed 7 days after inoculation. (C) Lesion area, (D) sporulation, and (E) relative fungal growth on the inoculated leaves were measured or assayed 10 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results.

131

Figure 3.20. Pathogenicity analysis of the MGG_08370 overexpression mutants by a spray method. (A) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type and two overexpression transformants OX-MGG_08370-2 and OX-MGG_08370-3 on rice cultivar Nipponbare leaves of 21 day-old plants. Leaves were photographed 5 days after inoculation. (B) Relative fungal growth on the inoculated leaves was assayed 5 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results.

132

Figure 3.20. continued

(C) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type and the overexpression transformants OX-MGG_08370-2 and OX-MGG_08370-3 on rice cultivar Toride leaves of 21 day-old plants. Leaves were photographed 5 days after inoculation.

133

9.3 Phenotypic characterization of MGG_08409

9.3.1 Pathogenicity analysis of MGG_08409 overexpression mutants in isolate KJ201 background

To determine the role of MGG_08409 in pathogenicity, an overexpression cassette containing the promoter of the M. oryzae ribosomal protein 27 gene fused in frame with the

MGG_08409 coding region was transformed into isolate KJ201. Transgenic MGG_08409 overexpression mutants were confirmed by RT-PCR (Figure 3.21A), and three different

MGG_08409 overexpression transformants, OX-MGG_08409-2, OX-MGG_08409-6, and OX-

MGG_08409-13, were used for pathogenicity analysis. In addition, we also made efforts to generate gene deletion mutant of MGG_08409 in KJ201, but we could not obtain any gene deletion mutants.

We used spore suspensions of the three individual overexpression transformants and the wild-type for punch inoculation on Nipponbare plants. Seven days after inoculation, lesion sizes of blast infection, sporulation, and relative fungal growth were evaluated. The results demonstrated that all MGG_08409 overexpression mutants showed enhanced virulence on the

Nipponbare plants, compared with the wild-type isolate (Figure 3.21B, C, D, E).

We also performed spray on Nipponbare plants with the MGG_08409 overexpression mutants. Five days after inoculation, disease severity and relative fungal growth were evaluated.

Our spray assay showed that the percentage of collapsed plants as well as relative M. oryzae biomass in inoculated plants were higher than those in plants inoculated with the wild-type

(Figure 3.22 B, C). Both punch and spray inoculations consistently showed that MGG_08409

134 overexpression transformants have enhanced disease virulence on rice plants, indicating a role of MGG_08409 in pathogenicity (Figure 3.22 A, B, C).

We also performed spray inoculation of the spore suspensions of three MGG_08409 overexpression transformants and the wild-type in the resistant rice cultivar Toride. However no phenotype difference was observed on the plants inoculated with the overexpression transformants and the wild-type KJ201 (Figure 3.22D)

135

Figure 3.21. Pathogenicity analysis of overexpression MGG_08409 mutants by a punch inoculation method. (A) RT-PCR confirmation of OX-MGG_08409-2, OX-MGG_08409-6 and OX-MGG_08409-13, and the wild-type using MGG_08409 gene-specific primers and M. oryzae B-tubulin gene-specific primers as control. (B) Punch inoculation of spore suspensions (5x105 spores ml-1) of the wild-type and OX-MGG_08409-2, OX-MGG_08409-6 and OX-MGG_08409-13 on rice cultivar Nipponbare leaves of 6-week-old plants. Leaves were photographed 7 days after inoculation. (C) Lesion area, (D) sporulation, and (E) relative fungal growth on the inoculated leaves were measured or assayed 10 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results. * indicate P<0.05 significant different from the wild-type (t-test).

136

Figure 3.22. Pathogenicity analysis of MGG_08409 overexpression by a spray method. (A) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type isolate KJ201 and OX-MGG_08409-2, OX-MGG_08409-6, and OX-MGG_08409-13 on rice cultivar Nipponbare leaves of 21 day-old plants. Leaves were photographed 5 days after inoculation. (B) Disease severity was expressed by the percent of collapsed plants inoculated with the wild-type and OX-MGG_08409-2, OX-MGG_08409-6, and OX-MGG_08409-13. (C) Relative fungal growth on the inoculated leaves was assayed 5 days after inoculation. Values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results. * indicate P<0.05 significant different from the wild-type (t-test).

137

Figure 3.22. continued

(D) Spray inoculations of spore suspensions (2x105 spores ml-1) of the wild-type and OX- MGG_08409-2, OX-MGG_08409-6, and OX-MGG_08409-13 on rice cultivar Toride leaves of 21 day-old plants. Leaves were photographed 5 days after inoculation.

138

9.3.2 Biochemical function analysis of M. oryzae MGG_08409

MGG_08409 is predicted to contain a GH61 (Glycoside hydrolase family 61) domain, which is originally classified based on the weak activity in endo-1,4-B-D-glucanase (Koseki et al.,

2008). A GH61 domain also has the ability in enhancing of cellulases to degrade lignocellulose

(Harris et al., 2010). Other than a GH61 domain, MGG_08409 contains a CBM1 (carbohydrate binding module 1) domain, which is characterized, based on the ability to bind to a cellulose substrate.

To observe the binding activity of MGG_08409 on a cellulose substrate, we created constructs for a MGG_08409 glutathione-S-transferase (GST)-fusion protein lacking an

N-terminal signal peptide (GST:MGG_08409), a truncated GST-fusion protein lacking an

N-terminal signal peptide and a CBM1 domain (GST:MGG_08409ΔCBM1), and a GST protein as a negative control. These proteins were assessed for their binding activity with cotton linters, a microcrystalline cellulose substrate (Sigma). The results showed that GST:MGG_08409 was found in the pellet fraction, but GST:MGG_08409ΔCBM1 and GST, a negative control, were found mainly in the supernatant. These results indicated that MGG_08409 is able to bind to cellulose substrates (Figure 3.23).

To investigate the role of MGG_08409 in cellulose degradation activity, we first employed purified GST:FL-MGG_08409 and purified MGG_08409 without GST protein to assess the cellulose degradation activity toward cellulose substrates. The GST protein and BSA protein

(Sigma) were used as negative controls. Also, a commercial cellulase (Onozuka R-10, Yakult

Pharmaceutical, Japan) was included as a positive control. The different amount of proteins (2.5,

5, and 10 ug) was incubated with 1% carboxymethylcellulose (CMC, Sigma) in a sodium acetate 139 buffer. After incubation, all samples were used for endoglucanase activity assay using dinitrosalicylic acid (DNS) reagent method. The results showed that, unlike commercial cellulase, purified GST:FL-MGG_08409 protein and purified MGG_08409 alone have a very weak endoglucanase activity toward CMC substrate (Figure 3.24A). No endoglucanase activity was detected from a BSA and a GST protein.

We also employed the MGG_08409 overexpression lines OX-MGG_08409-2, OX-

MGG_08409-6 and OX-MGG_08409-13 to investigate the role of MGG_08409 in cellulose degradation activity. The fungal mycelium disc (3 mm-2 in size) from the wild-type and from the three MGG_08409 overexpression lines were grown in minimal medium without nitrogen source and carbon source (Mathioni et al., 2011). Instead, 2% CMC was used as the major carbon source. After 5 days growing in the medium, the supernatant of each culture was used for endoglucanase assay using a DNS reagent method. The results showed that higher levels of total reducing sugars were obtained from the MGG_08409 overexpression transfromants compared with the wild-type (Figure 3.24B). Analyzing all the results from the cellulose degradation assay, it is most likely that MGG_08498 has a weak endoglucanase activity to degrade CMC substrate. Ectopic expression of MGG_08409 in the wild-type enhances the endoglucanase activity to degrade cellulose substrates.

140

Figure 3.23. Cellulose binding activity of MGG_08409. Five micrograms of purified GST protein (lane 2,3,4), purified GST:MGG_08409 protein (lane 5,6,7), and purified GST:MGG_08409ΔCBM1 (lane 8,9,10) were mixed with 1% cotton linters, a microcrystalline cellulose substrate (Sigma). The mixture of protein and substrate was incubated 2 hours, and was centrifuged to obtain supernatant (S) and pellet (P) fraction separately. Input (I) indicates the mixture of protein and substrate before separation. The samples were prepared for SDS-PAGE analysis.

141

Figure 3.24. Cellulose degradation activity of MGG_08409. (A) Endoglucanase activity of purified GST protein, purified GST:MGG_08409, purified MGG_08409, commercial BSA (sigma) and commercial cellulase (Onozuka R-10, Yakult Pharmaceutical, Japan). A different amount of proteins (2.5, 5. 10 ug) was incubated with 1% carboxymethylcellulose (CMC, Sigma), then was assayed for endoglucanase activity using a DNS reagent method. (B). Endoglucanase activity of the wild-type isolate KJ201 and three different MGG_08409 overexpression transformants.

142

Figure 3.24. continued

The wild-type isolate and all mutant transformants were grown in a modified minimal medium without nitrogen source and carbon source, and 2% CMC was added. After 5 day-incubation, all samples were collected and were used for an endoglucanase activity assay with a DNS reagent method. Enzymatic activity of carboxymethyl cellulose was assayed with a DNS reagent method. The values are the means of three replications, and error bars represent the standard error of the mean. Each experiment was repeated at least three times with similar results. * indicate P<0.05 significant different from the wildtype (t-test). 143

Discussion

1. Sequence and structural analysis of MoCDIPs

In chapter 2, we identified the five M. oryzae effectors that induce cell death in rice cells. The BLASTP search against the NCBI nr database, as well as domain/motif search, revealed that the five MoCDIPs are highly diverse in their sequences. While MGG_07986 does not share any significant similarity with other proteins, the rest of MoCDIPs have closely related homologs in M. oryzae or other microorganisms.

In the case of MGG_10234, the domain/motif search tool predicts that MGG_10234 contains a metalloprotease catalytic domain. Recently, it has been shown that metalloprotease secreted by Fusarium veticilliodes is able to cleave maize class IV chitinases, defense proteins associated in plant immunity (Naumann et al., 2011). This demonstrated the role of metalloprotease in plant defense manipulation.

Among the five MoCDIPs, MGG_03356 and MGG_08409 contain domains involved in plant cell wall degradation (Figure 3.3). For instance, a pectin lyase-like domain is found in

MGG_03356, and a glycosyl hydrolase family 61 (GH61) is found in MGG_08409. Previously, the pectin lyase gene of Colletotrichum gloeosporioides was revealed to have a role in virulence factors involved in disease development of the fungus in avocado fruit (Yakoby et al., 2001).

In addition, MGG_08409 belongs to a large family of cellulolytic enzymes, including endoglucanase, xylanase, and acetylxylan esterase, from a wide variety of microorganisms.

Several previous studies have observed that the expression of genes encoding members of this family of enzymes are modulated by MAPK signaling pathways, which play critical roles in regulating pathogenesis as well as other features (Madhani et al., 1999; Robert et al., 2000; 144

Lev and Horwitz, 2003). In addition to a GH61 domain, MGG_08409 contains CBM1, which is characterized by its ability to bind to cellulose (Cantarel et al., 2009). Recently, protein containing CBM1 from a cyst soybean nematode has been found to have a role in pathogenicity, in which this protein targets to plant cell wall-modifying enzyme to facilitate cyst nematode colonization (Hewezi et al., 2008). In addition, the CBD domain of CBM1-containing protein is implicated as a novel class of PAMP in oomycetes, since the synthetic peptides from CBD regions are sufficient to elicit plant immunity (Gaulin et al., 2006).

In summary, sequence and structural analysis as well as protein/motif search reveals that some MoCDIPs share significant similarity with known proteins in M. oryzae or other microorganisms. Some of these known proteins have demonstrated their roles related to pathogenicity or suppression of plant defense response.

2. Identification of M. oryzae CBM-containing proteins and functional characterization in cell death induction

The CBM1-containing proteins from nematodes and oomycetes were found to have a role in pathogenicity and in eliciting activity (Gaulin et al., 2006, Hewezi et al., 2008).

Furthermore, CBEL from oomycetes is thought to elicit PCD through interaction with the cell wall. Thus, we also speculated that M. oryzae proteins containing CBM bind to plant cell wall and induce cell death in rice.

In this study, we found that 29 of the 54 M. oryzae genes harboring various types of

CBMs were expressed during infection on rice plants. Of the 29 genes, 15 genes were cloned and used to characterize the cell-death inducing function in rice protoplasts and in

145

N. benthamiana. Surprisingly, only two CBM-containing proteins, MGG_05232 containing

CBM52 and MGG_08370 containing CBM43, have this function. Both CBM43 and CBM52 are predicted to bind to beta-1,3-glucan, but whether these two proteins were associated with the plant cell wall needs to be clarified, since beta-1,3-glucan is also one of the components of the fungal cell wall. A total of 11 M. oryzae CBM1-containing proteins (2 proteins from the chapter

2, and 9 proteins from the chapter3) were determined to have a role in cell death induction.

Only one protein, MGG_08409, can induce cell death in plant cells.

Previously, Gaulin et al. (2006) proposed that CBM1s (CBDs) are novel class of PAMPs in oomycetes. The synthesized peptide from this region is sufficient to induce host necrotic lesions.

Recently, the distinct evolution and biological roles of CBM1-containing proteins between oomycetes and fungi has been revealed. It is revealed, and it has been demonstrated that 90% of oomycetes’ CBM1-containing proteins are similar to CBEL, in which CBM1 correspond to non- catalytic module, PAN/Apple, known to interact with specific carbohydrates or proteins.

The oomycetes’ CBM1-containing proteins are utilized in adhesion to polysaccharide substrates and cell wall integrity. However, 70% of fungal CBM-1 containing proteins comprised of CBM1 are associated with catalytic domain involved in cellulose degradation. The fungal CBM1- containing proteins are implicated in plant cell wall degradation (Larroque et al., 2012).

3. Localization of the M. oryzae CBM-containing proteins during infection in rice cells

In planta live-cell imaging of blast biotrophic invasive hypha (IH) growing in the rice sheath facilitates observation of effector protein translocation inside host cells. Mosquera et al.

(2009) and Khang et al. (2010) provided evidence that M. oryzae effectors preferentially accumulated in the BIC, a novel interfacial structure corresponded with the first hyphal cells to 146 invade the host cell. Besides accumulation in BICs, the distinct patterns of effector localization are found. For instance, a BAS4 protein, a biotrophy-associated secreted protein 4, uniformly outlines of the IH (Mosquera et al., 2009). Recently, Mentlak et al. (2012) provided the evidence that Slp1, secreted LysM protein1, accumulates at the interface between the fungal cell wall and the rice plasma membrane during biotrophic growth. A Slp1 protein is specifically observed to outline of the bulbous IH and at the tip during invasion of new host cells. However, the accumulation of this protein in BIC could not be observed.

In our study, we generated transgenic transformants harboring individual CBM- containing protein gene by fusing eGFP under the control of a native 1 kb promoter fragment, to facilitate the observation of effector protein localization in rice cells. We found that

MGG_05232, MGG_08370, and MGG_08409 have distinct protein localization patterns during biotrophic invasion in rice leaf sheath. Among them, MGG_08409 share similar protein localization pattern with a Slp1. The fluorescently labeled MGG_08409 accumulated at the tip during invasion of new host cells. We also observed the fluorescently labeled protein outline the tip of IH. However, we did not observe the accumulation of this protein in the BIC. Mentak et al.

(2012) attempted to observe a Slp1 localization in the BIC by observing the co-localization of

Slp1:GFP with PWL2:mRFP, previously known to accumulate in the BIC. However, no co- localization of these two proteins was observed. When Slp1:GFP co-localized with BAS4:mRFP, which appears to be an apoplastic localization, the overlapping signal of the two fluorescently labeled proteins could be observed. This finding indicates that Slp1 may accumulate in apoplastic space. In the future, an experiment should be carried out to confirm hether

MGG_08409 localizes in host apoplastic space or inside rice cells.

147

In the case of MGG_05232, the accumulation of the fluorescently labeled MGG_05232 was found at the tip of spores as well as in the IH during biotrophic invasion, while the fluorescently labeled MGG_08370 was found in the appressorium as well as in the IH. Both of these fluorescently labeled proteins were not observed in the BIC or in outline of the IH. Besides

BIC-associated localization patterns and outline IH-associated localization patterns of M.oryzae effector proteins, distinct effector localization pattern were reported by Saitoh et al. (2012).

As shown for MC69, a secreted protein required for infection, the red mCherry fluorescently labeled MC69 was observed at all developmental stages, i.e., conidia before germination, mature appressoria, but not detected in the invaded hypha in planta. An effort to observe the translocation of MC69 in rice cell was made. With a modification of the method developed by

Khang et al. (2010), Saitoh et al. generated transgenic M. oryzae expressed

PW2p:MC69:mCherry:NLS to observe protein translocation in the plant cell. The results showed that MC69 was detected in the BIC in a weak manner, but was not detected in the nucleus.

These results indicate that MC69 does not translocate into the infected rice cell. To improve the observation of MGG_05232 and MGG_08370 protein localization, an improved strategy needs to be developed.

4. Pathogenicity analysis of the M. oryzae CBM-containing proteins

In order to determine the role of MGG_05232, MGG_08370, and MGG_08409 in pathogenicity, the effort to generate transgenic knockouts and overexpression transformants of these genes was made. Among the three genes, we only obtained transgenic knockouts for

MGG_05232 but not the others. The difficulty in obtaining knockout transformants from other two genes may be because of gene lethality. Usually, knockout mutants of gene required for

148 growth and metabolism of organisms lead to a lethal phenotype. Another case would be inaccessibility of some genetic locus, for instance, heterochromatin structure which limit the knockout generation.

To assess the role of MGG_05232 in pathogenicity, the transgenic knockout mutants as well as overexpression mutants were used for inoculation in rice compatible and incompatible cultivars. However, the disruption or overexpression of MGG_05232 did not affect its pathogenicity. Similar result was obtained when overexpressing MGG_08370. We hypothesize that the virulence function of these genes may have had a small effect, and thus a conventional assay may not be sensitive enough to detect this effect. Another possibility is that the effectors may function in redundancy, or may need to work coordinately with other effectors. Difficulty in characterizing the pathogenesis role of effectors has been reported in several studies. For example, several M. oryzae Avr effectors are isolated, but the virulent function of these Avr effectors is still unknown (Saitoh et al., 2012). The knockout mutation of BAS1-3 genes does not provide any pathogenesis phenotype (Mosquera et al., 2009). Recently, Saitoh et al. (2012) performed large-scale gene target disruption of 78 putative secreted protein genes. Only 1 gene,

MC69, shows some pathogenesis phenotype. In this study, MGG_08409 overexpression transformants showed enhanced virulence function on rice plants, suggesting a pathogenesis role of MGG_08409 in the rice-blast interactions.

5. Biochemical function of MGG_08409 in cellulose binding and cellulose degradation

MGG_08409 consists of a GH61 domain which is classified based on a weak activity in endo-1,4-B-D-glucanase (Koseki et al., 2008). It also contains a CBM1 which is predicted to bind

149 to cellulose substrate. This predicted structure of MGG_08409 is a traditional structure found in fungal CBM1-containing protein implicated in cellulose degradation (Larroque et al., 2012).

In this study, we provided evidence that a recombinant GST:MGG_08409 protein is able to bind to cellulose substrates. Also, we found that a CBM region is required to bind to the cellulose. In addition, we investigated the function of MGG_08409 in cellulose degradation, particularly in endoglucanase function. We found that a purified MGG_08409 protein showed a very weak glucanase activity to CMC substrate. In addition, MGG_08409 overexpression transformants showed an enhancing glucanase activity to CMC substrate. This result implicates the function of MGG_08409 in cellulose degradation. Previously, Koseki et al. (2008) characterized an AKCel6, a protein from Aspergillus kawachii. This protein consists of a GH61 domain and a CBM1. The treatment of a soluble CMC with the AKCel6 is able to produce small amounts of oligosaccharides such as cellobiose, cellotriose, cellotetraose, and cellopentaose, but not glucose (Koseki et al., 2008). Recently, proteins in GH61 member are implicated in promoting the cellulase activity on lignocellulosic substrate. These proteins are required divalent metal ions for their activity (Harris et al., 2010). Since the weak endoglucanase activity of

MGG_08409 toward CMC were observed in our study. Thus, it will be interesting to observe the function of MGG_08409 in enhancing of cellulase activity toward lignocellulosic substrate.

Intriguingly, lignocellulose biomass becomes a potential source for renewable energy such as ethanol. However, the cost of enzymes to degrade lignocellulose is relatively high, thus finding the enzymes that enhance lignocellulose degradation will promise for production of cheap biofuels.

150

Chapter 4

Conclusion and Future Challenges

Main conclusion of the study

In this study, we combined the results from a previous gene expression profiling in

Magnaporthe oryzae-infected rice leaves using robust-long serial analysis of gene expression

(RL-SAGE), massively parallel signature sequencing (MPSS), and sequencing by synthesis (SBS), with a protoplast functional assay system to identify in-planta expressed secreted effector proteins from M. oryzae that induce cell death in rice. By using this established approach, we successfully identified the seven M. oryzae cell death-inducing effector proteins that may play an important role facilitating colonization and fungal growth during infection. This study thus provided an effective, integrated approach for large-scale identification of cell death-inducing effector proteins from M. oryzae during infection in rice.

Using the high efficiency and feasibility of the ZeBaTA gene cloning system (Chen et al.,

2009), we cloned 57 genes in total encoding putative secreted proteins in pXUN, one of the

ZeBaTA vectors. Cloning of the effector genes into pXUN allows us to easily to transfer the cloned genes into other sets of ZeBATA plant expression vectors, such as pCXUN and pCXSN, for stable gene transformation in rice plants and to pGD, a vector used for Agrobacterium-mediated transient gene expression in plant leaves (Goodin et al, 2002), as well as to pFret (an expression

151 vector for constitutive gene expression in M. oryzae, modified by our laboratory). Thus, our available pXUN-based effector constructs will serve as a valuable M. oryzae in-planta expressed secreted effector library as well as useful fundamental materials to expedite the functional studies on M. oryzae effector proteins.

With the integrated approach described above, we identified seven effector proteins that may function in cell death induction, likely in plant apoplastic space. In addition, all these genes were found to be expressed during M. oryzae infection in rice, and thus presumably they may play important role facilitating colonization and fungal growth during infection. To our knowledge on the studies of effector proteins from M. oryzae, the seven M. oryzae genes have never been reported in cell death-inducing function in any available literature.

In addition, we have demonstrated that five novel M. oryzae effectors, MGG_03356,

MGG_05531, MGG_07986, MGG_08409, and MGG_10234, although highly diverse in their sequences, promote cell death in similar physiological manners in plants. Thus, it will be interesting to identify the mechanism of these effectors in cell death induction, which will provide us with new information about the diverse strategies of M. oryzae effectors to induce cell death in rice.

As described in chapter 3, cellulose binding modules (CBMs)-containing effectors play important roles during plant-pathogen interactions. We cloned 15 M. oryzae effector protein genes containing CBMs and tested their cell death-inducing function in rice. Indeed, two of them, MGG_05232 and MGG_08370, were found to trigger cell death in rice. Furthermore, the cell death-inducing function from the two effectors was specific in the plant apoplastic space.

152

With the results about MGG_08409’s function in chapter 2, we confirmed that three M. oryzae

CBM-containing proteins, MGG_05232, MGG_08370, and MGG_08409, induce cell death in rice.

To determine the pathogenesis function of the three CBM-containing effectors, we generated transgenic M. oryzae strains that carry out gene replacement and gene overexpression. Among three of them, we were able to demonstrate that MGG_08409 has function in pathogenicity in rice, since MGG_08409 overexpression in isolate KJ201 leads to more virulence on rice plants. In addition, MGG_08409 protein was shown to bind to cellulose, the main component of the plant cell wall, and was shown to have cellulase activity against cellulose substrate. Conclusively, it is most likely that MGG_08409 effector may act as a virulence factor through cell-wall degradation activity, and that facilitates M. oryzae in colonization and fungal growth during infection.

In summary, this study demonstrates that our integrative genomic approach is effective for the identification of in-planta expressed cell death-inducing effectors from M. oryzae that play an essential role in host fungal colonization and fungal growth during infection.

Characterization of these fungal effector proteins will provide new insights into the molecular basis of the rice and M. oryzae interaction.

153

Future Challenges

1. Role of M. oryzae cell death-inducing proteins (MoCDIPs) in plant immune response

Previously, we demonstrated that MoCDIPs display some features that are shared with other known effectors in eliciting plant defense response. However, how the MoCDIP effectors induce cell death and suppress host defense is not clear. Thus, investigation of the molecular events involved in MoCDIP-mediated cell death as well as host targets in rice will provide clues on how MoCDIP effectors function in cell death induction.

The feasibility of employing rice to investigate the molecular and morphological markers during PCD was reported. Jha et al. (2007) investigated callose deposition, a hypersensitive response (HR)-like symptom, and lignin like autofluorescence upon treatment with purified effector proteins; cellulase (ClsA), lipase/esterase (LipA), and cellobiosidase (CbsA) in rice leaf tissue. In addition, Chen et al. (2006) established a transient reporter system for defense-related gene expression analysis in rice protoplasts. It was successful in monitoring the expression activity of the rice PBZ1 and rice chitinaseIII genes involved in rice defense response upon

M. oryzae cell wall elicitor treatments. Although this approach would determine the effect of these effectors on defense gene expression, the impact of the MoCDIPs on defense signaling networks in rice cells is unknown. Recently Mase et al. (2012) has shown that AAL toxin from

Alternaria alternata f.sp. lycopersici triggers cell death in an ethylene and MAPK signaling pathway dependent manner. They have used Tobacco rattle virus-based virus-induced gene silencing approach to silence cell death related genes in Nicotiana umbratica in the presence or absence of the toxin to determine signaling pathways employed by the pathogen to trigger cell death. This approach could be employed to determine how MoCDIPs trigger cell death in rice. 154

2. Translocation of M. oryzae cell death-inducing proteins in rice

In our studies, we were able to show that some effector proteins are accumulated in specific structures of M. oryzae during rice leaf sheath infection. However, evidence on whether these effectors are translocated into the apoplastic or cytoplasmic space is still lacking. In this study, our results show that the 7 effector proteins might induce cell death specifically in plant apoplastic space because no cell death was observed in rice protoplasts without the signal peptide sequence. Recently, Khang et al. (2010) developed the robust assay for cytoplasmic effector translocation. The assay combines the use of brighter fluorescent proteins such as the tdTomato and mCherry, and the use of nuclear localization signal (NLS) to concentrate translocated-fluorescent proteins into the nucleus. With this assay, the cytoplasmic translocation of several Avr effectors such as AvrPWL2, AvrPi-ta and AvrPiz-t were confirmed

(Khang et al., 2010; Park et al., in press). We found that GFP-tagged MGG_10243 is accumulated in the biotrophic-interface complex (BIC). Therefore, it will be interesting to investigate whether

MGG_10243 is able to translocate into the cytoplasm by using Khang’s assay.

3. Identification of the interacting proteins or targets of the M. oryzae cell death-inducing proteins in rice

A major challenge for further study is to identify host targets of the effectors identified in this study. The identification of the targets is essential for understanding how effectors function in virulence and how they are recognized by host receptors. As shown in Trichodema viride, an ethylene-inducing xylanase functions as a direct elicitor of defense response by binding to a specific plant receptor (Ron and Avni, 2004). On the other hand, the actual elicitor of defense response by the xylanase from Xanthomonas oryzae pv. oryzae appear to be cell wall 155 degradation products by the action of this enzyme in rice cells (Jha et al., 2007). Several methods have been successfully used to identify target proteins of pathogen effectors. For example, the yeast two hybrid and in-planta co-immunoprecipitation methods are suitable for the direct-target identification in rice cells (Hewezi et al., 2008; Park et al., 2012; Tian et al.,

2004).

4. Function of carbohydrate binding module (CBM)-containing effectors in suppression of host defense

Recently, the role of M. oryzae Slp1, an effector protein containing LysM domains, was reported to be involved in sequestration of chitin to prevent chitin-triggered immunity in rice

(Mentlak et al., 2012). In fact, the LysM domain-containing proteins play an important role in chitin oligosaccharide binding (Kaku et al., 2006; de Jonge et al., 2010; Mentlak et al., 2012).

As discussed in chapter 3, we were able to identify 6 M. oryzae genes encoding protein- containing CBM18 (chitin binding protein). Particularly, these genes were shown to be in-planta expressed, indicating their participation in the fungal infection processes in rice cells. Although a CBM18 module and a LysM domain are characteristically different, they may share similar functions in chitin binding. Characterization chitin oligosaccharide binding activity of the 6

CBM18-containing proteins as well as the investigation of the ability of these proteins to compete with the rice chitin receptor CEBiP will provide new insight into the molecular mechanism of the CBM-containing protein-mediated suppression of PAPMs-triggered immunity in rice.

156

Bibliography

Abramovitch, R. B, Kim, Y. J., Chen, S., Dickman, M. B., and Martin, G. B. (2003). Pseudomonas

type III effector AvrPtoB induces plant disease susceptibility by inhibition of host

programmed cell death. EMBO J. 22, 60−69.

Adachi, K., Hamer, J. E. (1998). Divergent cAMP signaling pathways regulate growth and

pathogenesis in the rice blast fungus Magnaporthe grisea. Plant Cell 10, 1361–1374.

Ahn, N., Kim, S., Choi, W., Im, K. H., Lee, Y. H. (2004). Extracellular matrix protein gene, EMP1,

is required for appressorium formation and pathogenicity of the rice blast fungus,

Magnaporthe grisea. Mol . Cells. 17, 166-173.

Angot, A., Peeters, N., Lechner, E., Vailleau, F., Baud, C., Gentzbittel, L., Sartorel, E., Genschik, P.,

Boucher, C., and Genin, S. (2006). Ralstonia solanacearum requires F-box-like domain-

containing type III effectors to promote disease on several host plants.

Proc. Natl. Acad. Sci. U S A. 103, 14620-14625.

Aparna, G., Chatterjee, A., Sonti , R.V., Sankaranarayanan , R. (2009). A cell wall-degrading

esterase of Xanthomonas oryzae requires a unique substrate recognition module for

pathogenesis on rice. Plant Cell 21, 1860-1873.

157

Asai, T., Tena, G., Plotnikova, J., Willmann, M. R., Chiu, W. L., Gomez-Gomez, L., Boller, T.,

Ausubel, F. M., and Sheen, J. (2002). MAP kinase signaling cascade in Arabidopsis innate

immunity. Nature 415,977-983.

Baker, J. C., Mock, N., Glazener, J., and Orlandi, K. (1993). Physiological evidences associated

with hypersensitive response. Physiol. Mol. Plant Pathol. 43, 81-94.

Barral, P., Batanero, E., Palomares, O., Quiralte, J., Villalba, M., and Rodríguez, R. (2004).

A major allergen from pollen defines a novel family of plant proteins and shows intra-

and interspecies [correction of interspecies] cross-reactivity. J. Immunol.

172, 3644-3651.

Bhattacharjee, S., Hiller, N. L., Liolios, K., Win, J., Kannegant, I. T. D., Young, C., Kamoun, S.,

and Haldar K. (2006). The malarial host-targeting signal is conserved in the Irish potato

famine pathogen. PLoS Pathog. 2(5):e50.

Birch, P. R, Rehmany, A. P., Pritchard, L., Kamoun, S., and Beynon, J. L. (2006). Trafficking arms:

oomycete effectors enter host plant cells. Trends Microbiol. 14, 8-11.

Block, A., Li, G., Fu, Z. Q., and Alfano, J. R. (2008). Phytopathogen type III effector weaponry

and their plant targets. Curr Opin Plant Biol. 11, 396-403.

Bolam, D. N., Xie, H., Pell, G., Hogg, D., Galbraith, G., Henrissat, B., Gilbert, H. J. (2004).

X4 modules represent a new family of carbohydrate-binding modules that display novel

properties. J Biol Chem. 279, 22953-22963.

158

Bolton, M.D., and Thomma, B. P. H. J. (2008). The complexity of nitrogen metabolism and

nitrogen-regulated gene expression in plant pathogenic fungi. Physiological and

Molecular Plant Pathology 72, 104–110.

Boraston, A. B., Bolam, D. N, Gilbert, H.J., and Davies, G. J. (2004) Carbohydrate-binding

modules: fine-tuning polysaccharide recognition. Biochem J. 382, 769-781.

Bos, J. I, Armstrong, M. R, Gilroy, E. M., Boevink, P.C., Hein, I., Taylor, R.M., Zhendong, T.,

Engelhardt, S., Vetukuri, R.R., Harrower, B., Dixelius, C., Bryan, G., Sadanandom, A.,

Whisson, S. C., Kamoun, S., and Birch, P. R. (2010). Phytophthora infestans effector

AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3

Ligase CMPG1. Proc Natl Acad Sci U S A. 107, 9909-9914.

Boudsocq, M., Willmann, M. R., McCormack, M., Lee, H., Shan, L., He, P., Bush, J., Cheng, S. H.,

and Sheen, J., (2010). Differential innate immune signalling via Ca2+ sensor protein

kinases. Nature 464, 418-422.

Brenner, S., Johnson, M., Bridgham, J., Golda, G., Lloyd, D. H., Johnson, D., Luo, S., McCurdy, S.,

Foy, M., Ewan, M., Roth, R., George, D., Eletr, S., Albrecht, G., Vermaas, E., William,

S. R., Moon, K., Burcham, T., Pallas, M., DuBridge, R. B., Kirchner, J., Fearon, K.,

Mao, J., and Corcoran, K. (2000). Gene expression analysis by massively parallel

Signature sequencing (MPSS) on microbead arrays. Nat Biotechnol. 18, 630-634.

Bretz, J. R., and Hutcheson, S. W. (2004). Role of type III effector secretion during bacterial

pathogenesis in another kingdom. Infect Immun. 72, 3697-705.

159

Bruce, W. B., Christensen, A. H., Klein, T., Fromm, M., Quail. P. H. (1989). Photoregulation of a

phytochrome gene promoter from oat transferred into rice by particle bombardment.

Proc Natl Acad Sci USA. 86, 9692-9696.

Breusegem, F. V., and Dat, J. F. (2006). Reactive oxygen species in plant cell death.

Plant Physiology 141, 384-390.

Brotman, Y., Briff, E., Viterbo, A., and Chet, I. (2008). Role of swollenin, and expansin-like protein

from Trichoderma, in plant root colonization. Plant Physiol. 147, 779-789.

Burbano-Figueroa, O. Functional Characterization of Magnaporthe oryzae Effectors in

the Infective Process of Rice. Dissertation, The Ohio State University.

Columbus: OCLC/708037025, 2011.

Cannon, P.F. (1994). The newly recognized family Magnaporthaceae and its relationships.

Syst. Ascomycet. 13, 25-42.

Cantarel, B. L., Coutinho, P. M., Rancurel, C., Bernard, T., Lombard, V., and Henrissat, B. (2009).

The Carbohydrate-Active EnZymes database (CAZy): an expert resource for

Glycogenomics. Nucleic Acids Res 37, 233-238.

Cao, X., and Barlowe, C. (2000). Asymmetric requirements for a Rab GTPase and SNARE

proteins in fusion of COPII vesicles with acceptor membranes. J. Cell Biol. 149, 55-56.

Carroll, A. M., Sweidard, J. A., and Valent, B. (1994). Improved vectors for selecting resistance to

hygromycin. Fungal Genet Newslett 41, 22.

160

Chen, Y. A, and Scheller, R. H. (2001). SNARE-mediated membrane fusion. Nat Rev Mol Cell Biol.

2, 98-106.

Chen, S., Tao, L., Zeng, L., Vega-Sanchez, M.E., Umemura, K., and Wang, G.L. (2006). A highly

efficient transient protoplast system for analyzing defence gene expression and protein-

protein interactions in rice. Mol Plant Pathol. 7, 417-427.

Chen, S., Songkumarn, P., Liu, J., Wang, G. L. (2009). A versatile zero background T-vector system

for gene cloning and functional genomics. Plant Physiol. 150, 1111-1121.

Chen, S., Songkumarn, P., Venu, R., Gowda, M., Bellizzi, M., Hu, J., Liu, W., Ebbole, D., Mitchell,

T., and Wang, G. L. (2012). Identification and characterizationof In-planta expressed

secreted effectors from Magnaporthe oryzae that induce cell death in rice.

Mol. Plant Microbe Interact. In press

Chivasa, S., Ndimba, B. K., Simon, W. J., Lindsey, K., and Slabas A. R. (2005). Extracellular ATP

function as an endogenous external metabolite regulating plant cell viability.

Plant Cell 17, 3019-3034.

Chrisholm, S. T., Coaker, G., Day, B., and Staskawicz, B. J. (2006). Host-microbe interaction:

Shaping the evolution of the plant immune response. Cell 124, 803-814.

Christensen, A. H., and Quail, P. H. (1996). Ubiquitin promoter-based vectors for high-level

expression of selectable and/or screenable marker genes in monocotyledonous plants.

Transgenic Res. 5, 213–218.

161

Choi, J., Park, J., Kim, D., Jung, K., Kang, S., and Lee, Y. H. (2010). Fungal secretome database:

integrated platform for annotation of fungal secretomes. BMC Genomics. 11, 11:105.

Coffeen W. C., and Wolpert, T. J., (2004) Purification and characterization of serine protease that

exhibit caspase-like activity and are associated with programmed cell death in Avena

sativa. Plant Cell 16, 857-873.

Cooper, G. M. The Cell: A Molecular Approach. 2nd edition. Sunderland (MA): Sinauer

Associates; 2000. The Endoplasmic Reticulum. Available from:

http://www.ncbi.nlm.nih.gov/books/NBK9889/

Cornelis, G. R., and Gijsegem F. V. ( 2000). Assembly and function of type III secretory systems.

Annu. Rev. Microbiol. 54, 735-774.

Dangl, J. L., Dietrich, R. A., and Richberg, M. H. (1996). Death Don’t Have No Mercy:

Cell Death Programs in Plant-Microbe Interaction. Plant Cell 8, 1793-1807.

Dangl, J. L., and Jones, J. D. G. (2001). Plant pathogens and integrated defence responses to

infection. Nature 411, 826-833.

De Jong, J. C., McCormack, B. J., Smirnoff, N., and Talbot, N.J. (1997). Glycerol generates turgor

in rice blast. Nature 389, 244 doi:10.1038/38418.

De Jonge, R., van Esse, H. P., Kombrink, A., Shinya, T., Desaki, Y., Bours, R., van der Krol, S.,

Shibuya, N., Joosten, M. H., and Thomma, B. P. (2010). Conserved fungal LysM effector

Ecp6 prevents chitin-triggered immunity in plants. Science 329, 953-955.

162

De Jonge, R., Bolton, M. D., and Thomma, B. P. (2011). How filamentous pathogens co-ptplants:

the ins and outs of fungal effectors. Curr Opin Plant Biol. 14, 400-406.

De Pinto, M. C., Tommasi, F., and De Gara, L. (2002). Changes in the antioxidant systems as part

of the signaling pathway responsible for the programmed cell death activated by nitric

oxide and reactive oxygen species in tobacco Bright-Yellow 2 cells.

Plant Physiology. 30, 698-708.

De Torres, M., Mansfield, J. W, Grabov, N., Brown, I. R., Ammouneh, H., Tsiamis, G., Forsyth, A.,

Robatzek S, Grant, M., and Boch J. (2006). Pseudomonas syringae effector AvrPtoB

suppresses basal defence in Arabidopsis. Plant J. 47, 368-382.

De Waard, M. A., Georgopoulos, S. G., Hollomon, D. W., Ishii, H., Leroux, P., Ragsdale, N. N., and

Schwinn, F. J. (1993). Chemical control of plant disease: Problem and prospects.

Annu. Rev. Phytopathol. 31, 403-421.

De Wit, P. J, Mehrabi, R., Van den Burg, H. A., Stergiopoulos, I. (2009) Fungal effector proteins:

past, present and future. Mol Plant Pathol. 10, 735-747.

Dean, R. A., Talbot, N. J., Ebbole, D. J., Farman, M. L., Mitchell, T. K., Orbach, M. J., Thon, M.,

Kulkarni, R., Xu, J. R., Pan, H., Read, N. D., Lee, Y. H., Carbone, I., Brown, D., Oh, Y.Y.,

Donofrio, N., Jeong, J. S., Soanes, D. M., Djonovic, S., Kolomiets, E., Rehmeyer, C., Li, W.,

Harding, M., Kim, S., Lebrun, M. H., Bohnert, H., Coughlan, S., Gilbert, M. J, Thornton,

C. R., Wakley, G. E., and Talbot, N. J. (2005). A P-type ATPase required for rice blast

disease and induction of host resistance. Nature 440, 535-539.

163

Decreux, A., Messiaen, J. (2005). Wall-associated kinase WAK1 interacts with cell wall pectins

in a calcium-induced conformation. Plant Cell Physiol. 46, 268-278.

Dekeyser, R. A., Claes, B., Rycke, R. M. U. D., Habets, M. E., Montagu, M. C. V., and Caplan, A. B.

(1990). Transient Gene Expression in Intact and Organized Rice Tissues. Plant Cell

2, 591-602.

Deng, J. and Dean, R. A. (2008). Characterization of adenylate cyclase interaction protein ACI1

in the rice blast fungus, Magnaporthe oryzae. The open Mycology Journal. 2, 74-81.

Desprez, T., Juraniec, M., Crowell, E. F., Jouy, H., Pochylova, Z., Parcy, F., Höfte, H., Gonneau, M.,

Vernhettes, S. (2007). Organization of cellulose synthase complexes involved in primary

cell wall synthesis in Arabidopsis thaliana. Proc Natl Acad Sci U S A. 104, 15572-15577.

Devarenne, T. P., and Martin, G. B. (2007). Manipulation of Plant Programmed Cell Death

Pathways During Plant-Pathogen Interactions. Plant Signaling&Behavior. 3, 188-189.

Dickman, M. B., Park, Y. K., Oltersdorf, T., Li, W., Clemente, T., and French, R. (2001). Abrogation

of diease development in plant expressing animal antiapoptotoc genes. Proceedings of

the National Academy of Sciences of the United States of America 98, 6957-6962.

Donofrio, N. M, Oh, Y., Lundy, R., Pan, H., Brown, D. E., Jeong, J. S., Coughlan, S., Mitchell, T. K.,

and Dean, R. A. (2006). Global gene expression during nitrogen starvation in the rice

blast fungus, Magnaporthe grisea. Fungal Genet Biol. 43, 605-517.

164

Dou, D., Kale, S. D., Wang, X., Jiang, R. H., Bruce, N. A., Arredondo, F. D., Zhang, X., and

Tyler, B. M. (2008). RXLR-mediated entry of Phytophthora sojae effector Avr1b into

soybean cells does not require pathogen-encoded machinery. Plant Cell 20, 1930-1947.

Dou, X., Wang, Q., Qi, Z., Song, W., Wang, W., Guo, M., Zhang, H., Zhang, Z., Wang, P., and

Zheng, X. (2011). MoVam7, a conserved SNARE involved in vacuole assembly,

is required for growth, endocytosis, ROS accumulation, and pathogenesis of

Magnaporthe oryzae. PLoS One. 6(1):e16439.

Ebbole, D. J. (2007). Magnaporthe as model for understanding host pathogen interactions.

Annu. Rev. Phytopathol. 45, 437-456.

Ellis, J. G., Dodds, P. N., and Lawrence, G. J. (2007). Flax rust resistance gene specificity is based

on direct resistance-avirulence protein interactions. Annu. Rev. Phytopathol. 45,

289-306.

Ellis, J. G., Rafiqi, M., Gan, P., Chakrabarti, A., and Dodds, P. N. (2009). Recent progress in

discovery and functional analysis of effector proteins of fungal and oomycete plant

pathogens. Curr Opin Plant Biol. 12, 399-405.

Espinosa, A., and Alfano, J. R. (2004). Disabling surveillance: bacterial type III secretion system

effectors that suppress innate immunity. Cell Microbiol. 6, 1027-1040.

Felix, G., Duran, J. D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system

for the most conserved domain of bacterial flagellin. Plant J. 18, 265-276.

165

Feng, F. and Zhou, J. (2011). Plant-bacterial pathogen interactions mediated by typeIII effectors.

Curr Opin Plant Biol. 15, 1-8.

Fu, Z. Q., Guo, M., Jeong, B. R., Tian, F., Elthon, T. E., Cerny, R. L., Staiger, D., and Alfano, J. R.

(2007). A type III effector ADP-ribosylates RNA-binding proteins and quells plant

Immunity. Nature 447, 284-288.

Gadjev, I., Stone, J. M., and Gechev, T. S. (2008) Programmed Cell Death In Plant: New Insights

into Redox Regulation and the Role of Hydrogen Peroxide. International Review of Cell

and Molecular Biology. 270, 87-144.

Gao, P. J., Chen, G. J., Wang, T. H., Zhang, Y. S., and Liu, J. (2001). Non-hydrolytic Disruption

of Crystalline Structure of Cellulose by Cellulose Binding Domain and Linker Sequence

of Cellobiohydrolase I from Penicillium janthinellum. Sheng Wu Hua Xue Yu Sheng

Wu Wu Li Xue Bao (Shanghai). 33, 13-18.

Gaulin, E., Jauneau, A., Villalba, F., Rickauer, M., Esquerré-Tugayé, M. T., and Bottin, A.

(2002). The CBEL glycoprotein of Phytophthora parasitica var-nicotianae is involved

in cell wall deposition and adhesion to cellulosic substrates. J. Cell. Sci. 115, 4565-4575.

Gaulin E., Drame, N., Lafitte, C., Torto-Alalibo, T., Martinez, Y., Ameline-Torregrosa, C., Khatib,

M., Villalba-Mateos, F., Kamoun, S., Mazars, C., Dumas, B., Bottin, A., Esquerre-Tugaye,

M-T., and Rickauer, M. (2006) Celluluse binding domains of a Phytophthora cell wall

protein are novel pathogen-associated molecular patterns. Plant Cell 18, 1766-1777.

166

Gechev, T. S., Gadjev, I. Z., and Hille, J. (2004). An extensive microarray analysis of AAL-toxin-

induced cell death in Arabidopsis thaliana brings new insights into the complexity of

programmed cell death in plants. Cell. Mol. Life Sci. 61, 1185-1197.

German, M. A., Pillay, M., Jeong, D. H., Hetawal, A., Luo, S., Janardhanan, P., Kannan, V.,

Rymarquis, L. A., Nobuta, K., German, R., De Paoli, E., Lu, C., Schroth, G., Meyers , B. C,

and Green, P. J. (2008). Global identification of microRNA-target RNA pairs by parallel

analysis of RNA ends. Nat Biotechnol. 26, 941-946.

Gijzen, M.,and Nurnberger, T. (2006). Nep1-like proteins from plant pathogens: recruitment

and diversification of the NPP1 domain across taxa. Phytochemistry 67, 1800-1807.

Gilbert, M. J., Thornton, C. R., Wakley, G. E., and Talbot, N. J. (2006). A P-type ATPase required

for rice blast disease and induction of host resistance. Nature 440, 535-539.

Gomez-Gomez, L., and Boller, T. (2000). Flagellin perception: a paradigm for innate immunity.

Trends Plant Sci. 7, 251-256.

Gómez-Gómez, L., Felix, G., and Boller, T. (1999). A single locus determines sensitivity to

bacterial flagellin in Arabidopsis thaliana. Plant J. 18:277–284

Gómez-Gómez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase involved in the

perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell. 5, 1003-1011.

167

González-Lamothe, R., Tsitsigiannis, D. I., Ludwig, A. A., Panicot, M., Shirasu, K., and Jones, J. D.

(2006). The U-box protein CMPG1 is required for efficient activation of defense

mechanisms triggered by multiple resistance genes in tobacco and tomato.

Plant Cell 18, 1067-1083.

Goodin , M. M., Dietzgen, R. G., Schichnes, D., Ruzin, S., Jackson, A. O. (2002). The pGD vectors:

versatile tools for the expression of green and red fluorescent protein fusions in

agroinfiltrated plant leaves. Plant J. 31, 375-383.

Gough, J., Karplus, K., Hughey, R., Chothia, C. (2001). Assignment of homology to genome

sequences using a library of hidden Markov models that represent all proteins of known

structure. J Mol Biol. 313, 903-919.

Govers, F., and Bouwmeester, K. (2008). Effector trafficking: RXLR-dEER as extra gear for delivery

into plant cells. Plant Cell 20, 1728-1730.

Gowda, M., Jantasuriyarat, C., Dean, R. A., and Wang, G. L. (2004). Robust-Long SAGE (RL-SAGE):

A substantially improved LongSAGE method for gene discovery and transcriptome

analysis. Plant Physiol. 134, 890-897.

Gowda, M., Venu, R. C., Jia, Y., Stahlberg, E., Pampanwar, V., Soderlund, C., and Wang, G. L.

(2007). Use of robust-long serial analysis of gene expression to identify novel fungal and

plant genes involved in host-pathogen interaction. Methods Mol. Biol. 354, 131-144.

Goya, Francisco. The Family of Charles IV. 1800. Museo Nacional del Prado, Madrid. Museo National del Prado. Web. 22 May 2006. 168

Greenberg, J. T. and Yao, N. (2004). The role and regulation of programmed cell death in plant-

pathogen interactions. Cellular Microbiology. 6, 201-211.

Guillén, D., Sánchez, S., and Rodríguez-Sanoja, R. (2010). Carbohydrate-binding domains:

multiplicity of biological roles. Appl Microbiol Biotechnol. 85, 1241-1249.

Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., Chu, Z., Wang, G. L., White, F. F.

and Yin, Z. (2005). R gene expression induced by a type-III effector triggers disease

resistance in rice. Nature 435, 1122-1125.

Ham, J. H., Majerczak, D., Ewert, S., Sreerekha, M. V., Mackey, D., and Coplin, D. (2008). WtsE,

an AvrE-family type III effector protein of Pantoea stewartii, causes cell death in non-

host plants. Molecular Plant Pathology 9, 633-643.

Harris, P. V., Welner, D., McFarland, K. C., Re, E., Navarro Poulsen, J. C., Brown, K., Salbo, R.,

Ding, H., Vlasenko, E., Merino, S., Xu, F., Cherry, J., Larsen, S., Lo, and Leggio, L. (2010).

Stimulation of lignocellulosic biomass hydrolysis by proteins of glycoside hydrolase

family 61: structure and function of a large, enigmatic family. Biochemistry

49, 3305-3316.

He, Z. H., Fujiki, M., and Kohorn, B. D. (1996). A cell wall-associated, receptor-like protein kinase.

J Biol Chem. 27, 19789-19793.

He, Z. H., He, D., and Kohorn, B. D. (1998). Requirement for the induced expression of a cell wall

associated receptor kinase for survival during the pathogen response. Plant J. 14, 55-63.

169

He, P., Shan, L., Lin, N. C., Martin, G. B., Kemmerling, B., Nürnberger, T., and Sheen, J. (2006).

Specific bacterial suppressors of MAMP signaling upstream of MAPKKK in Arabidopsis

innate immunity. Cell 125, 563-575.

Heath M. C. (2000). Hypersensitive response-related death. Plant Mol. Biol. 44, 321-334.

Hématy, K., Sado, P. E., Van Tuinen, A., Rochange, S., Desnos, T., Balzergue, S., Pelletier, S.,

Renou, J. P., Höfte, H. (2007). A receptor-like kinase mediates the response of

Arabidopsis cells to the inhibition of cellulose synthesis. Curr Biol. 17, 922-931.

Hewezi, T., Howe, P., Maier, T. R., Hussey, R. S., Mitchum, M. G., Davis, E. L., and Baum, T. J.

(2008). Cellulose binding protein from the parasitic nematode Heterodera schachtii

interacts with Arabidopsis pectin methylesterase: cooperative cell wall modification

during parasitism. Plant Cell 20, 3080-3093.

Hogenhout, S. A., Van der Hoorn, R A., Terauchi, R., and Kamoun S. (2009). Emerging concepts in

effector biology of plant-associated organisms. Mol Plant Microbe Interact. 22, 115-222.

Howard, R. J., Ferrari, M. A, Roach, D. H., andMoney, N. P. (1991). Penetration of hard

substrates by a fungus employing enormous turgor pressures.

Proc Natl Acad Sci U S A. 88, 11281-11284.

Howard, R. J., and Valent, B. (1996). Breaking and entering host penetration by the fungal rice

blast pathogen Magnaporthe grisea. Annu. Rev. Microbiol. 50, 491-512.

Houterman, P. M., Cornelissen, B. J., and Rep, M. (2008). Suppression of plant resistance

gene-based immunity by a fungal effector. PLoS Pathog. 4(5):e1000061.

170

Iakimova, E. T., Michalvzuk, L. and Woltering, E. J. (2005). Hypersensitive cell death in plants-

Its mechanisms and role in plant defence against pathogens. Journal of Fruit and

Ornamental Plant Research 13, 135-158.

Ingle, R. A., Carstens, M., and Denby, K. J. (2006). PAMP recognition and the plant-pathogen arms race. Bioessays 28, 880–889.

International Rice Genome Sequencing Project. 2005. The map-based sequence of the rice

genome. Nature 436, 793 – 800

Jelenska, J., Yao, N., Vinatzer, B. A., Wright, C. M., Brodsky, J. L., and Greenberg, J. T. (2007).

A J domain virulence effector of Pseudomonas syringae remodels host chloroplasts

and suppresses defenses. Curr Biol. 17, 499-508.

Jeong, J. S, Mitchell, T. K, and Dean, R. A. (2007). The Magnaporthe grisea snodprot1 homolog,

MSP1, is required for virulence. FEMS Microbiol Lett. 273, 157-65.

Jha, G., Rajeshwari, R., and Sonti, R. V. (2007). Functional interplay between two Xanthomonas

oryzae pv. oryzae secretion systems in modulating virulence on rice.

Mol Plant Microbe Interact. 20, 31-40.

Jia, Y., McAdams, S. A., Bryan, G.T., Hershey, H. P., and Valent, B. (2000). Direct interaction of

resistance gene and avirulence gene products confers rice blast resistance.

EMBO J. 19, 4004-4014.

Jones J. D., and Dangl, J. L. (2006) The plant immunity system. Nature 444, 323-329.

171

Jorunn, I. B. B., Armstrong, M., Whisson, S. C., Torto, T. A., Ochwo, M., Birch, P. R. J. and

Kamoun, S. (2003). Intraspecific comparative genomics to identify avirulence genes from

Phytophthora. New Phytologist. 159, 63-72

Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., and Dohmae, N., Minami, E.,

and Shibuya, N. (2006). Plant cells recognize chitin fragments for defense signaling

through a plasma membrane receptor. Proc. Natl. Acad. Sci. 103, 11086-11091.

Kale, S. D., Gu, B., Capelluto, D. G., Dou, D., Feldman, E., Rumore, A., Arredondo, F. D.,

Hanlon, R., Fudal, I., Rouxel, T., Lawrence, C. B., Shan, W., and Tyler, B. M. (2010).

External lipid PI3P mediates entry of eukaryotic pathogen effectors into plant and

animal host cells. Cell 142, 284-295.

Kang, S., Sweigard, J. A., and Valent, B. (1995). The PWL host specificity gene family in the blast

fungus Magnaporthe grisea. Mol. Plant Microbe Interact. 8, 939-948.

Kankanala, P., Czymmek, K., and Valent, B. (2007). Roles for rice membrane dynamics and

plasmodesmata during biotrophic invasion by the blast fungus. Plant Cell 19, 706-724.

Kamoun S. (2006). A catalogue of the effector scretome of plant pathogenic oomycetes.

Annu. Rev. Phytopathol. 44, 41-60.

Kawano, Y., Akamatsu, A., Hayashi, K., Housen, Y., Okuda, J., Yao, A., Nakashima, A., Takahashi,

H., Yoshida, H., Wong, H. L., Kawasaki, T., and Shimamoto, K. (2010). Acticaition of a Rac

GTPase by the NLR family disease resistance protein Pit plays a critical role in rice innate

immunity. Cell Host Microbe. 7, 362-375. 172

Khang, C. H., Berruyer, R., Giraldo, M. C., Kankanala, P., Park, S.Y., Czymmek, K., Kang, S.,

and Valent, B. (2010). Translocation of Magnaporthe oryzae effectors into rice cells and

their subsequent cell-to-cell movement. Plant Cell 22, 1388-13403.

Khatib, M., Lafitte, C., Esquerré-Tugayé, M.-T., Bottin, A., and Rickauer, M. (2004). The CBEL

elicitor of Phytophthora parasitica var. nicotianae activates defence in Arabidopsis

thaliana via three different signalling pathways. New Phytol. 162, 501–510.

Khush, G. S. (2005). What it will take to Feed 5.0 Billion Rice consumers in 2030.

Plant Molecular Biology. 59, 1-6.

Khush, G. S. K. and Jena, K. K. (2009) Current status and Future Prospects for Research on Blast

Resistance in Rice (Oryza sativa L.) In Wang, G. L. and Valent B. (Eds), Advances I

Genetics, Genomics and Control of Rice Blast Disease (pp. 1-10). New York: Springer

Science and Business Media.

Kim, S., Ahn, I. P., Rho, H.S, and Lee, Y. H. (2005). MHP1, a Magnaporthe grisea hydrophobin

gene, is required for fungal development and plant colonization. Mol Microbiol.

57, 1224-1237.

Kishimoto, K., Kouzai, Y., Kaku, H., Shibuya, N., Minami, E., and Nishizawa, Y. (2010).

Perception of the chitin oligosaccharides contributes to disease resistance to blast

fungus Magnaporthe oryzae in rice. Plant J. 64, 343-354.

Klee, P. Twittering Machine. 1922. Museum of Modern Art, New York. The Artchive. Web. 22

May 2006. 173

Kleemann, J., Rincon-Rivera, L. J., Takahara, H., Neumann, U., Ver Loren van Themaat, E.,

van der Does, H. C., Hacquard, S., Stüber, K., Will. I., Schmalenbach, W., Schmelzer, E.,

O'Connell, R. J. (2012). Sequential delivery of host-induced virulence effectors by

appressoria and intracellular hyphae of the phytopathogen Colletotrichum

higginsianum. PLoS Pathog. 8(4):e1002643. doi: 10.1371

Koizumi, S. (2007). Durability of resistance to rice blast disease. In: JIRCAS (JAPAN International

Research Center for Agricultural Sciences, Tsukuba, Japan) Working Report No. 53, 1-10

Kombrink, A., Sánchez-Vallet, A., and Thomma, B. P. (2011). The role of chitin detection in plant-

pathogen interactions. Microbes Infect. 13, 1168-1176.

Koseki. T., Mese, Y., Fushinobu, S., Masaki, K., Fujii, T., Ito, K., Shiono, Y., Murayama, T., and

Iefuji H. (2008). Biochemical characterization of a glycoside hydrolase family 61

endoglucanase from Aspergillus kawachii. Appl Microbiol Biotechnol. 77, 1279-1285.

Krüger, J., Thomas, C. M., Golstein, C., Dixon, M. S., Smoker, M., Tang, S., Mulder, L.,and

Jones, J. D. (2002). A tomato cysteine protease required for Cf-2-dependent disease

resistance and suppression of autonecrosis. Science 296, 744-747.

Kulkarni, R., D., and R. A., Dean. (2004). Identification of proteins that interact with two

regulators of appressorium development, adenylate cyclase and cAMP-dependent

protein kinase A, in the rice blast ungus Magnaporthe grisea. Mol Genet Genomics.

270, 497-508.

174

Kumar, R., Sing, S., and Singh, O.V. (2008). Bioconversion of lignocellulosic biomass:

biochemical and molecular perspectives. J Ind Microbiol Biotechnol. 35, 377-391.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus

of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.

Plant Cell 16, 3496-3507.

Lamb, C., and Dixon, R. A. (1997) The oxidative burst in plant disease resistance. Annu. Rev.

Plant Biol. 48, 251-275.

Larroque, M., Barriot, R., Bottin, A., Barre, A., Rouge, P., Dumas, B., and Gaulin, E. (2012).

The unique architecture and function of cellulose-interacting proteins in oomycetes

revealed by genomic and structural analysis. BMC Genomics. 13(1):605

Laurie G. S. (2001). Plant cell division: building walls in the right places. Nature Reviews Molecular Cell Biology 2, 33-39.

Lecourieux, D., Mazars, C. Pauly, N., Ranjeva, R., and Pugin, A. (2002). Analysis and effects of

cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia

cells. Plant cell 14, 2627-2641.

Lee, S. J., Kelley, B. S., Damasceno, C. M. B., John, B. S., Kim, B. S., Kime, B. D., and Rose, J. K. C.

(2006). A functional screen to characterize the secretomes of eukaryotic pathogens and

their hosts in planta. Mol Plant Microbe Interact. 12, 1368-1377.

175

Lev, S., and Horwitz, B. A. (2003). A mitogen-activated protein kinase pathway modulates

the expression of two cellulase genes in Cochliobolus heterostrophuscduring plant

infection. Plant Cell 15, 835-844.

Li, W., Wang, B., Wu, J, Lu, G., Hu, Y., Zhang, X., Zhang, Z., Zhao, Q., Feng, Q., Zhang, H.,

Wang, Z., Wang, G., Han, B., Wang, Z., and Zhou, B. (2009). The Magnaporthe oryzae

avirulence gene AvrPiz-t encodes a predicted secreted protein that triggers the

immunity in rice mediated by the blast resistance gene Piz-t. Mol Plant Microbe Interact.

22, 411-420.

Li, C. and Yang, J (2011). Mining Effector Proteins in Phytopathogenic Fungi, Systems and

Computational Biology - Molecular and Cellular Experimental Systems, Ning-Sun Yang

(Ed.), ISBN: 978-953-307-280-7, InTech, Available from:

http://www.intechopen.com/books/systems-and-computational-biology-molecular-

and-cellular-experimental-systems/mining-effector-proteins-in-phytopathogenic-fungi.

Lindgren, P. B, Peet, R. C., and Panopoulos, N. J. (1986). Gene cluster of Pseudomonas syringae

pv. phaseolicola controls pathogenicity of bean plants and hypersensitivity on nonhost

plants. J Bacteriol 168, 512–522.

Liu, W. ZX., Li, G., Li, L., Kong, L., and Wang, C. (2011). Multiple plant surface signals are sensed

by different mechanisms in the rice blast fungus for appressorium formation.

PLoS Pathog 7: e1001261.

176

Lodish, H., Berk, A., Zipursky, S. L. Molecular Cell Biology. 4th edition. New York: W. H. Freeman;

2000. Section 17.4, Translocation of Secretory Proteins across the ER Membrane.

Available from: http://www.ncbi.nlm.nih.gov/books/NBK21532/

Lorang, J. M., Sweat, T. A., and Wolpert, T. J. (2007) Plant disease susceptibility conferred by

a ‘resistance’ gene. Proc Natl Acad Sci USA. 104, 14861-14866.

Mackey, D., Holt, B. F., Wiig, A., and Dangl, J. L. (2002). RIN4 interacts with Pseudomonas

syringae type III effector molecules and is required for RPM1-mediated resistance in

Arabidopsis. Cell 108, 743-754.

Mackill, D., and Bonman, J. (1992). Inheritance of blast resistance in near-isogenic lines of rice.

Phytopathology 82, 746-749.

Madhani, H. D., Galitski, T., Lander, E. S., and Fink, G. R. (1999). Effectors of a developmental

mitogen-activated protein kinase cascade revealed by expression signatures of

signaling mutants. Proc Natl Acad Sci 96, 12530-12535.

Manning, V. A., and Ciuffetti, L. M. (2005). Localization of Ptr ToxA produced by

Pyrenophora tritici-repentis reveals protein import into wheat mesophyll cells.

Plant Cell 17, 3203-3212.

Manning, V. A., Hardison, L. K., and Ciuffetti, L. M. (2007). Ptr ToxA interacts with a chloroplast-

localized protein. Mol Plant Microbe Interact. 20, 168-177.

177

Marois E, Van den Ackerveken G, and Bonas, U. (2002). The Xanthomonas type III effector

protein AvrBs3 modulates plant gene expression and induces cell hypertrophy in the

susceptible host. Mol Plant Microbe Interact. 15, 637-646.

Mase, K., Mizuno, T., Ishihama, N., Fujii, T., Mori, H., Kodama, M., and Yoshioka, H. (2012).

Ethylene signaling pathway and MAPK cascades are required for AAL toxin-induced

programmed cell death. Mol Plant Microbe Interact. 25, 1015-1025.

Martín-Cuadrado, A. B, Encinar del Dedo, J., de Medina-Redondo, M., Fontaine, T., del Rey, F.,

Latgé, J. P., and Vázquez de Aldana, C. R. (2008). The Schizosaccharomyces pombe

endo-1,3-beta-glucanase Eng1 contains a novel carbohydrate binding module

required for septum localization. Mol Microbiol. J. 69, 188-200.

Matzinger P. (2002). The danger model: a renewed sense of self. Science 296, 301-305.

McLean, B. W., Bray, M. R., Boraston, A. B., Gilkes, N. R., Haynes, C. A., and Kilburn, D. G. (2000).

Analysis of binding of the family 2a carbohydrate-binding module from Cellulomonase

fimi xylanase 10A to cellulose: specificity and identification of functionally important

amino acid residue. Protein Eng. 13, 801-809.

Mentlak, T. A., Kombrink, A., Shinya, T., Ryder, L. S., Otomo, I., Saitoh, H., Terauchi, R.,

Nishizawa, Y., Shibuya, N., Thomma, B. P., and Talbot, N. J. (2012).

Effector-mediated suppression of chitin-triggered immunity by Magnaporthe oryzae

is necessary for rice blast disease. Plant Cell 24, 322-335.

178

Meyers, B. C, Vu, T. H., Tej, S. S., Ghazal, H., Matvienko, M., Agrawal, V., Ning, J., and

Haudenschild, C. D. (2004). Analysis of the transcriptional complexity of Arabidopsis

thaliana by massively parallel signature sequencing. Nat Biotechnol. 22, 1006-1011.

Mindrinos, M., Katagiri, F., Yu, G., and Ausubel, F. M. (1994). The A. thaliana disease resistance

gene RPS2 encodes a protein containing a nucleotide binding site and leucine-rich

repeats. Cell 78, 1089-1099.

Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami,

N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential

for chitin elicitor signaling in Arabidopsis. Proc Natl Acad Sci U S A. 104, 19613-19618.

Miyoshi, S. and Shinoda, S. (2000). Microbial metalloproteases and pathogenesis.

Microbes and infection. 2, 91-98.

Mosquera, G., Giraldo, M. C., Khang, C. H., Coughlan, S., and Valent, B. (2009). Interaction

transcriptome analysis identifies oryzae BAS1-4 as Biotrophy-associated secreted

proteins in rice blast disease. Plant Cell 21, 1273-1290.

Munkvold, K. R, and Martin, G. B. (2009). Advances in experimental methods for the elucidation

of Pseudomonas syringae effector function with a focus on AvrPtoB. Mol Plant Pathol

10, 777-793.

Nakajima, Y., Saitoh, K., Arie, T., Teraoka, T., and Kamakura, T. (2010). Expression specificity of

CBP1 is regulated by transcriptional repression during vegetative growth of M. oryzae.

J Gen Appl Microbiol. 56, 437-445.

179

Naumann, T. A., Wicklow, D. T., and Price, P. J. N. (2011). Identification of a chitinase-modifying

protein from Fusarium verticillioides: Truncation of a host resistance protein by a

fungalysin metalloprotease. The Journal of biological chemistry. 28, 35358-35366.

Navarre, D. A., and Wolpert, T. J. (1999). Victorin induction of an apoptotic/senescence-like

response in oat. Plant Cell 11, 237-249.

Nobuta, K., Venu, R. C., Lu, C., Beló, A., Vemaraju, K., Kulkarni, K., Wang, W., Pillay, M.,

Green, P. J., Wang, G. L., and Meyers, B. C. (2007). An expression atlas of rice mRNAs

and small RNAs. Nat Biotechnol. 25, 473-477.

Nomura, K., Debroy, S., Lee, Y. H., Pumplin, N., Jones, J., and He, S. Y. (2006) A bacterial

virulence protein suppresses host innate immunity to cause plant disease.

Science 313, 220-223.

Nuoffer, C., Jenö, P., Conzelmann, A., and Riezman, H. (1991). Determinants for

glycophospholipid anchoring of the Saccharomyces cerevisiae GAS1 protein to the

plasma membrane. Mol Cell Biol. 11, 27-37.

Obembe, O. O., Jacobsen, E., Timmers, .J, Gilbert, H., Blake, A. W., Knox, J. P., Visser, R. G,

and Vincken JP. (2007). Promiscuous, non-catalytic, tandem carbohydrate-binding

modules modulate the cell-wall structure and development of transgenic tobacco

(Nicotiana tabacum) plants. J Plant Res. 120, 605-617.

Ohl, S., Hedrick, S., Chory, J., and Lamb, C.J. (1990). Functional properties of a phenylalanine

ammonia-lyase promoter from Arabidopsis. Plant Cell 2, 837–848.

180

Okuyama, Y., Kanzaki, H., Abe, A., Yoshida, K., Tamiru, M., Saitoh, H., Fujibe, T., Matsumura, H.,

Shenton, M., Galam, D. C., Undan, J., Ito, A., Sone, T., and Terauchi, R. (2011).

A multifaceted genomics approach allows the isolation of the rice Pia-blast resistance

gene consisting of two adjacent NBS-LRR protein genes. Plant J. 66, 467-479.

Orbach, M. J., Farrall, L., Sweigard, J. A., Chumley, F. G., and Valent, B. (2000). A telomeric

avirulence gene determines efficacy for the rice blast resistance gene Pi-ta.

Plant Cell 12, 2019-2032.

Orlandi, E. W., Hutcheson, S. W., and Baker, C. J. (1992). Early physiological response associated

with race-specific recognition in Soybean leaf tissue and cell suspensions treated with

P. syringae pv. glycinea. Physiol. And Mol. Plant Pathol 40, 173-180.

Ottmann, C., Luberacki, B., Küfner, I., Koch, W., Brunner, F., Weyand, M., Mattinen, L., Pirhonen,

M., Anderluh, G., Seitz, H. U., Nürnberger, T., and Oecking, C. (2009).

A common toxin fold mediates microbial attack and plant defense.

Proc Natl Acad Sci U S A. 106, 10359-10364

Ou, S. H. (1985). Rice Diseases, 2nd ed. Commonweath Mycological Institute, Kew, England.

Panstruga, R., and Dodds, P. N. (2009). Terrific protein traffic: the mystery of effector protein

delivery by filamentous plant pathogens. Science 324, 748-750.

181

Park, C. H., Chen, S., Shirsekar, G., Zhou, B., Khang, C. H., Songkumarn, P., Ning, Y., Wang, R.,

Bellizzi, M., Valent, B., and Wang, G. L. (2012). The Magnaporthe oryzae effector AvrPiz-t

targets the RING E3 ligase APIP6 for suppression of PAMP-triggered immunity in rice.

Plant cell. 24(11):4748-62.

Popolo, L., Gilardelli, D., Bonfante, P., Vai, M. (1997). Increase in chitin as an essential response

to defects in assembly of cell wall polymers in the ggp1delta mutant of

Saccharomyces cerevisiae. J Bacteriol. 179, 463-469.

Popolo, L., Ragni, E., Carotti, C., Palomares, O., Aardema, R., Back, J. W., Dekker, H. L., de Koning,

L. J., de Jong, L., and de Koster, C. G. (2008) Disulfide bond structure and domain

organization of yeast beta (1.3)-glucanosyltransferases involved in cell wall biogenesis.

J Biol Chem. 283, 18553-18565.

Qutob, D., Kamoun, S., and Gijzen, M. (2002). Expression of a Phytophthora sojae necrosis-

inducing protein occurs during transition from biotrophy to necrotrophy. Plant J. 32,

361–373.

Reinartz, J., Bruyns, E., Lin, J. Z., Burcham, T., Brenne, S., Bowen, B., Kramer, M., Woychik, R.

(2002). Massively parallel signature sequencing (MPSS) as a tool for in-depth

quantitative gene expression profiling in all organisms. Brief Funct Genomic Proteomic.

1, 95-104.

Ribot, C., Hirsch, J., Balzergus, S., Tharreau, D., Notteghem, J. L., Lebrun, M. H., and Morel, J. B.

(2008). Susceptibility of rice to the blast fungus, Magnaporthe grisea. Plant Physiol.

165, 114-24.

182

Roberts, C. J., Nelson, B., Marton, M. J., Stoughton, R., Meyer, M. R., Bennett, H. A., He, Y. D.,

Dai, H., Walker, W. L., and Hughes, T. R. (2000). Signaling and circuitry of multiple MAPK

pathways revealed by a matrix of global gene expression profiles. Science 287, 873-880.

Rooney, H. C. Vant Klooster, J. W., van der Hoorn, R. A., Joosten, M. H., Jones, J. D., and de Wit,

P. J. (2005). Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2-

dependent disease resistance. Science 308, 1783-1786.

Roncero, C., and Durán, A. (1985). Effect of Calcofluor white and Congo red on fungal cell wall

morphogenesis: in vivo activation of chitin polymerization. J Bacteriol. 163, 1180-1185.

Rose, J. K., Ham, K. S., Darvill, A. G., and Albersheim, P. (2002). Molecular cloning and

characterization of glucanase inhibitor proteins: coevolution of a counterdefense

mechanism by plant pathogens. Plant Cell 14, 1329-1345.

Rosebrock, T. R,, Zeng, L., Brady, J. J., Abramovitch, R. B., Xiao, F., and Martin, G. B. (2007).

A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity.

Nature 448, 370-374.

Saitoh, H., Fujisawa, S., Mitsuoka, C., Ito, A., Hirabuchi, A., Ikeda, K., Irieda, H., Yoshino, K.,

Yoshida, K., Matsumura, H., Tosa, Y., Win, J., Kamoun, S., Takano, Y., and Terauchi, R.

(2012). Large-scale gene disruption in Magnaporthe oryzae identifies MC69,

a secreted protein required for infection by monocot and dicot fungal pathogens.

PLoS Pathog. 8(5):e1002711.

183

Saloheimo, M., Paloheimo, M., Hakola, S., Pere, J., Swanson, B., Nyyssönen, E., Bhatia, A.,

Ward, M., and Penttilä, M. (2002). Swollenin, a Trichoderma reesei protein with

sequence similarity to the plant expansins, exhibits disruption activity on cellulosic

materials. Eur J Biochem. 269, 4202-4211.

Saporito-Irwin, S. M., Brise, C. E., Sypherd, P. S., and Fonzi, W. A. (1995). PHR1, a pH-regulated

gene of Candida albicans, is required for morphogesis. Mol Cell Biol. 15, 601-613.

Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998). SMART, a simple modular architecture

research tool: Identification of signaling domains. Proc. Natl. Acad. Sci. USA 95,

5857-5864.

Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll protoplasts.

Plant Physiol. 127: 1466-1475.

Simpson, C., Thomas, C., Findlay, K., Bayer, E., and Maule, A. J. (2009). An Arabidopsis GPI-

anchor plasmodesmal neck protein with callose binding activity and poteintial to

regulate cell-to-cell trafficking. Plant cell 21, 581-594

Soanes, D. M., Chakrabarti, A., Paszkiewicz, K. H., Dawe, A. L., and Talbot, N. J. (2012).

Genome-wide transcriptional profiling of appressorium development by the rice blast

fungus Magnaporthe oryzae. PLoS Pathog. 8(2): e1002514.

Song, W., Dou, X., Qi, Z., Wang, Q., Zhang, X., Zhang, H., Guo, M., Dong, S., Zhang, Z., Wang, P.,

and Zheng, X. (2010). R-SNARE homolog MoSec22 is required for conidiogenesis,

cell wall integrity, and pathogenesis of Magnaporthe oryzae. PLoS One. 6;5(10):e13193.

184

Soonok, K., II-Pyung, A., and Yong-Hwan, L. (2001). Analysis of genes expressed during rice-

Magnaporthe oryzae interactions. Mol. Plant Microbe Interact. 14, 1340-1346.

Spassieve, S. D., Markham, J. E., and Hille, J. (2002). The plant disease resistance gene Asc-1

prevents disruption of sphingolipid metabolism during AAL-toxin-induced programmed

cell death. Plant J. 32, 561-72.

Stergiopoulos, I., and de Wit, P. J. G. M. (2009). Fungal effector proteins. Annu Rev. Phytopathol.

47, 233-263.

Sweat, T. A., and Wolpert, T. J. (2007). Thioredoxin h5 is required for victorin sensitivity

mediated by a CC-NBS-LRR gene in Arabidopsis. Plant Cell 19, 673-687.

Sweigard, J. A., Carroll, A. M., Kang, S., Farrall, L., Chumley, F. G., and Valent, B. (1995).

Identification, cloning, and characterization of PWL2, a gene for host species specificity

in the rice blast fungus. Plant Cell 7, 1221–1233.

Talbot, N. J. (2003). On the trail of a cereal killer: Exploring the biology of Magnaporthe grisea.

Annu. Rev. Microbiol. 57, 177-202.

Tao, L., Cheung, A. and Wu, H. (2002). Plant rac-like GTPases are activated by auxin and

mediate auxin-responsive gene expression. Plant Cell 14, 2745–2760.

TeBeest, D. O., Guerber, C., and Ditmore, M. (2007). Rice blast. The Plant Health Instructor.

DOI: 10.1094/PHI-I-2007-0313-07

185

Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun , S. (2004). A Kazal-like

extracellular serine protease inhibitor from Phytophthora infestans targets the tomato

pathogenesis-related protease. J Biol Chem. 279, 26370-26377.

Thaminy, S., Miller, J., and Stagljar, I. (2004). The split-ubiquitin membrane-based yeast two-

hybrid system. Methods Mol Biol. 261, 297-312.

The Cereal Knowledge Bank. Symptoms-Rice Blast. 2009. International Rice Research Institute

(IRRI) and International Maize and Wheat Improvement Center (CIMMYT), Philippines.

Knowledgebank.irri. Web. 31 October 2012.

Valent, B. (1990). Rice blast as a model system for plant pathology. Phytopathol. 80, 33-36.

Van den Burg, H. A., Harrison, S. J., Joosten, M. H., Vervoort, J.,and de Wit, P. J. (2006).

Cladosporium fulvum Avr4 protects fungal cell walls against hydrolysis by plant

chitinases accumulating during infection. Mol Plant Microbe Interact. 19, 1420-1430.

Van der Hoorn, R. A., and Kamoun, S. (2008). From Guard to Decoy: a new model for perception

of plant pathogen effectors. Plant Cell 20, 2009-2017.

Van Esse, H. P., Bolton, M. D., Stergiopoulos, I., de Wit, P. J., and Thomma, B. P. (2007).

The chitin-binding Cladosporium fulvum effector protein Avr4 is a virulence factor.

Mol Plant Microbe Interact. 20, 1092-1101.

186

Venu, R. C., Zhang, Y., Weaver, B., Carswell, P., Mitchell, T. K., Meyers, B. C., Boehm, M. J, and

Wang, G. L. (2011). Large scale identification of genes involved in plant-fungal

interactions using Illumina's sequencing-by-synthesis technology.

Methods Mol Biol. 722, 167-78.

Wang, Y., Wang, D., Deng, X., Liu, J., Sun, P., Liu, Y., Huang, H., Jiang, N., Kang, H., Ning, Y.,

Wang, Z., Xiao, Y., Liu, X., Liu, E., Dai, L., and Wang, G. L. (2012). Molecular mapping

of the blast resistance genes Pi2-1 and Pi51(t) in the durably resistant rice

'Tianjingyeshengdao'. Phytopathology 102, 779-86.

Wagner, T. A., and Kohorn, B. D. (2001). Wall-associated kinases are expressed throughout plant

development and are required for cell expansion. Plant Cell 13, 303-318.

Watanabe, N., and Lam, N. (2009). Bax inhibitor-1, a conserved cell death suppressor, is a key

molecular switch downstream from a variety of biotic and abiotic stress signals in plants.

International Journal of Molecular Sciences 10, 3149-3167.

Whisson, S. C., Boevink, P. C., Moleleki, L., Avrova, A. O., Morales, J. G., Gilroy, E. M., Armstrong,

M. R., Grouffaud, S., van West, P., Chapman, S., Hein, I., Toth, I. K., Pritchard, L., and

Birch, P. R. (2007). A translocation signal delivery of oomycete effector proteins into

host plant cells. Nature 450, 115-118.

Xu, J. R, and Hamer. J. E. (1996). MAP kinase and cAMP signaling regulate infection structure

formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes

Dev. 10, 2696–2706.

187

Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J.,

and Zhou, J. M. (2008). Pseudomonas syringae effector AvrPto blocks innate immunity

by targeting receptor kinases. Curr Biol. 18, 74-80.

Yadav, P. K., Singh, V. K., Yadav, S., Yadav, K. D., Yadav D. (2009). In sillico analysis of pectin lyase

and pectinase sequences. Biochemistry (Mosc). 74, 1049-1055.

Yakoby, N., Beno-Moualem, D., Keen, N. T., Dinoor, A., Pines, O., and Prusky, D. (2001).

Colletotrichum gloeosporioides pelB is an important virulence factor in avocado

fruit–fungus interaction. Mol Plant Microbe Interact. 14, 988-995.

Yang, B., Sugio, A., and White, F. F. (2006). Os8N3 is a host disease-susceptibility gene for

bacterial blight of rice. Proc Natl Acad Sci U S A. 103, 10503-10508.

Yi, M., Chi, M. H., Khang, C. H., Park, S. Y., Kang, S., Valent, B., and Lee, Y. H. (2009).

The ER chaperone LHS1 is involved in asexual development and rice infection by

the blast fungus Magnaporthe oryzae. Plant Cell 21, 681-695.

Yoshida, K., Saitoh, H., Fujisawa, S., Kanzaki, H., Matsumura, H.,Yoshida, K., Tosa, Y., Chuma, I.,

Takano, Y., Win, J., Kamoun, S. and Terauchia, R. (2009). Association genetics reveals

three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae.

Plant Cell 21, 1573–1591.

Yu, J.W., and Lemmon, M. A. (2001). All phox homology (PX) domains from Saccharomyces

cerevisiae specifically recognize phosphatidylinositol 3-phosphate.

J. Biol. Chem. 276, 44179-44184.

188

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E., Jones, J.D.G., Felix, G.,and Boller, T. (2004).

Bacterial disease resistance in Arabidopsis through flagellin perception.

Nature 428, 764–767.

Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., Chen, S.,

Tang, X., and Zhou, J. M. (2007). A Pseudomonas syringae effector inactivates MAPKs

to suppress PAMP-induced immunity in plants. Cell Host Microbe. 1, 175-185.

Zhang J., and Zhou, J. M. (2010). Plant immunity triggered by microbial molecular signatures.

Mol Plant. 3(5):783-93.

Zhang, Y., Su, J., Duan, S., Ao, Y., Dai, J., Liu, J., Wang, P., Li, Y., Liu, B., Feng, D., Wang, J., and

Wang, H. (2012) A highly efficient rice green tissue protoplast system for transient gene

expression and studying light/chloroplast-related processes. Plant Methods.

doi: 10.1186/1746-4811-7-30.

Zhao, X., Kim, Y., Park, G., and Xu, J. R. (2005). A mitogen activated protein kinase cascade

regulating infection-related morphogenesis in Magnaporthe grisea. Plant Cell 17,

1317-1329.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E. J., Jones, J. D., and Felix, G. (2004). Bacterial

disease resistance in Arabidopsis through flagellin perception. Nature 428, 764−767.

24(11):4748-62. doi: 10.1105/tpc.112.105429.

189

Zipfel , C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J. D. G. (2006). Perception of the bacterial

PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation.

Cell 125, 749–760

190

Appendix A : List of 851 putative expressed M. oryzae secreted protein genes

Table A.1. List of putative expressed M. oryzae secretory protein genes identified using RL-SAGE, MPSS, and SBS technologies

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_00043 hypothetical protein (363 nt) MGG_00046 hypothetical protein (2835 nt) MGG_00047 hypothetical protein (207 nt) MGG_00052 hypothetical protein (672 nt) MGG_00066 hypothetical protein (615 nt) MGG_00081 conserved hypothetical protein (1021 nt) MGG_00083 hypothetical protein (873 nt) MGG_00095 hypothetical protein (1311 nt) MGG_00110 hypothetical protein (1071 nt) MGG_00113 signal peptidase complex catalytic subunit SEC11 (946 nt) MGG_00120 hypothetical protein (585 nt) MGG_00140 hypothetical protein (1051 nt) MGG_00148 hypothetical protein (366 nt) MGG_00163 hypothetical protein (978 nt) MGG_00171 mannan polymerase complex MNN9 subunit (1119 nt) MGG_00194 conserved hypothetical protein (1407 nt) MGG_00202 hypothetical protein (1080 nt) MGG_00210 hypothetical protein (822 nt) MGG_00215 fungal cellulose binding protein ((928 nt) MGG_00225 hypothetical protein (534 nt) MGG_00227 chitin binding protein (1248 nt) MGG_00230 hypothetical protein (489 nt) MGG_00238 ent-kaurene oxidase (1527 nt) MGG_00245 hypothetical protein (549 nt) MGG_00257 conserved hypothetical protein (1044 nt) MGG_00276 putative FAD-dependent oxygenase (1248) MGG_00282 subtilisin-like serine protease PR1C (2606 nt) MGG_00283 hypothetical protein (839 nt) MGG_00296 hypothetical protein (2481 nt) MGG_00310 hypothetical protein (1626 nt) MGG_00314 lipase4 (1794 nt) MGG_00319 endoglucanase EG-II (1787 nt) MGG_00333 conserved hypothetical protein (2170 nt) MGG_00438 hypothetical protein (1308 nt) MGG_00505 septation protein SUN4 (2003 nt) MGG_00527 hypothetical protein (1416 nt) Continued 191

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_00539 hypothetical protein (1304 nt) MGG_00565 hypothetical protein (558 nt) MGG_00570 putative endo-1,4-beta-xylanase (585 nt) MGG_00575 hypothetical protein (1650 nt) MGG_00592 cell wall glucanosyltransferase Mwg1 (1951 nt) MGG_00618 pectin esterase(975 nt) MGG_00659 glucan-1,3-beta-glucosidase (2307 nt) MGG_00677 endoglucansae1 (771 nt) MGG_00683 endoplasmic oxidoreductin-1 (2482 nt) MGG_00659 glucan-1,3-beta-glucosidase (2307 nt) MGG_00677 endoglucansae1 (771 nt) MGG_00683 endoplasmic oxidoreductin-1 (2482 nt) MGG_00703 MAS3 protein (1053 nt) MGG_00734 hypothetical protein (1215 nt) MGG_00742 hypothetical protein (288 nt) MGG_00752 hypothetical protein (591 nt) MGG_00775 carboxypeptidase KEX1 precursor (2100 nt) MGG_00777 hypothetical protein (795 nt) MGG_00779 choline dehydrogenase (1941 nt) MGG_00815 hypothetical protein (735 nt) MGG_00922 vacuolar protease A (1871 nt) MGG_00994 manno endo-1,6-alpha-mannosidase (1593 nt) MGG_01009 conserved hypothetical protein (812 nt) MGG_01064 hypothetical protein (294 nt) MGG_01085 ThiJ/Pfpl family protein(747 nt) MGG_01099 peptidyl-tRNA hydrolase 2 (825 nt) MGG_01104 acetolactate synthase small subunit (1175 nt) MGG_01122 hypothetical protein (447 nt) MGG_01134 UTR2 protein (2622 nt) MGG_01146 acetylxylan esterase (903 nt) MGG_01147 alpha-N-arabinofuranosidase A(2001 nt) MGG_01149 hypothetical protein (444 nt) MGG_01173 hydrophobin (387 nt) MGG_01195 acetylesterase (842 nt) MGG_01261 trehalase precursor (1199 nt) MGG_01275 predicted protein (2481 nt) MGG_01326 NIMA-interacting protein TinC (2601 nt) MGG_01336 bacteriodes thetaiotaomic (1674 nt) MGG_01358 hypothetical protein (522 nt) MGG_01370 vacuolar protein sorting-associated protein (2181 nt) MGG_01384 hypothetical protein (660 nt) MGG_01396 Periplasmic beta-glucosidase (2343 nt) MGG_01402 exo-arabinanase (241 nt) MGG_01403 Fungal cellulose binding protein (848 nt) MGG_01444 hypothetical protein (1733 nt) MGG_01453 hypothetical protein (1584 nt) MGG_01455 hypothetical protein (564nt) MGG_01456 hypothetical protein (1101 nt) Continued

192

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_01466 hypothetical protein (984 nt) MGG_01530 hypothetical protein (756 nt) MGG_01530 hypothetical protein (756 nt) MGG_01532 hypothetical protein (489 nt) MGG_01542 endo-1,4-beta-xylanase (1564 nt) MGG_01557 phosphatidylglycerol/phosphatidylinositol transfer protein (1022 nt) MGG_01575 hypothetical protein (1425 nt) MGG_01603 hypothetical protein (822 nt) MGG_01607 calnexin (2268 nt) MGG_01609 hypothetical protein (1136 nt) MGG_01655 hypothetical protein (1190 nt) MGG_01675 hypothetical protein (630 nt) MGG_01692 hypothetical protein (1203 nt) MGG_01706 hypothetical protein (228 nt) MGG_01732 3-carboxymuconate cyclase (1572 nt) MGG_01861 hypothetical protein (519 nt) MGG_01863 aminopeptidase Y (1515 nt) MGG_01872 hypothetical protein (857 nt) MGG_01876 chitinase 3(1148 nt) MGG_01885 beta-glucosidase 2 (2919 nt) MGG_01912 Beta-glucosideas 1 (2430 nt) MGG_01941 FAD binding domain-containing protein(1560 nt) MGG_01943 cutinase (684 nt) MGG_01944 hypothetical protein (690 nt) MGG_01952 conserved hypothetical protein (1380 nt) MGG_01956 hypothetical protein (1065 nt) MGG_01970 acetylornithine deacetylase(1308 nt) MGG_01986 hypothetical protein (996 nt) MGG_01993 hypothetical protein (303 nt) MGG_01994 hypothetical protein (801 nt) MGG_02112 predicted protein (498 nt) MGG_02130 lipase 2 (1701 nt) MGG_02134 gamma-glutamyltransferase(1698 nt) MGG_02188 glutamyl-tRNA (Gln) amidotransferase subnit A (1677 nt) MGG_02212 hypothetical protein (495 nt) MGG_02234 hypothetical protein (534 nt) MGG_02239 conserved hypothetical protein (631 nt) MGG_02243 amidohydrolase family protein (1654 nt) MGG_02245 endo-1,4-beta-xylanase (1891 nt) MGG_02253 cell surface protein (999 nt) MGG_02255 hypothetical protein (642 nt) MGG_02268 hypothetical protein (1548 nt) MGG_02273 hypothetical protein (558 nt) MGG_02275 endoprotease (1587 nt) MGG_02295 hypothetical protein (1401 nt) MGG_02296 hypothetical protein (492 nt) MGG_02309 carboxypeptidase S1 (2098 nt) MGG_02340 cell wall glycosyl hydrolase YteR (1235 nt) Continued

193

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_02368 galactose oxidase (2010 nt) MGG_02373 arabinan endo-1,5-alpha-L-arabinosidase A (1191 nt) MGG_02373 arabinan endo-1,5-alpha-L-arabinosidase A (1191 nt) MGG_02386 autophagy protein Atg27 (1854 nt) MGG_02391 hypothetical protein (1230 nt) MGG_02393 cutinase (861 nt) MGG_02420 hypothetical protein (1521 nt) MGG_02502 conserved hypothetical protein (919 nt) MGG_02503 glucose-regulated protein precursor (2487 nt) MGG_02529 conserved hypothetical protein (1968 nt) MGG_02531 minor extracellular protease vpr (3099 nt) MGG_02540 isovaleryl-CoA dehydrogenase2 (1410 nt) MGG_02544 D-arabinitol dehydrogenase (1089 nt) MGG_02546 hypothetical protein (441 nt) MGG_02557 hypothetical protein (963 nt) MGG_02582 hypothetical protein (1884 nt) MGG_02602 hypothetical protein (1367 nt) MGG_02630 hypothetical protein (219 nt) MGG_02638 hypothetical protein (492 nt) MGG_02647 conserved hypothetical protein (1234 nt) MGG_02708 conserved hypothetical protein (1735 nt) MGG_02715 hypothetical protein (441 nt) MGG_02756 hypothetical protein (825 nt) MGG_02778 hypothetical protein (540 nt) MGG_02801 hypothetical protein (1392 nt) MGG_02814 hypothetical protein (1143 nt) MGG_02819 ser/Thr protein phosphatase family (1983 nt) MGG_02821 dolichyl-di-phosphooligosaccharide-protein glycotransferase (1957 nt) MGG_02848 hypothetical protein (1168 nt) MGG_02851 conserved hypothetical protein (2014 nt) MGG_02859 Initiation-specific alpha-1,6-mannosyltransferase (1146 nt) MGG_02863 oryzin (1203 nt) MGG_02867 conserved hypothetical protein (3029 nt) MGG_02884 Beta-lg-H3/Fasciclin (1047 nt) MGG_02898 aspergillopepsin-F (1224 nt) MGG_02926 hypothetical protein (1120 nt) MGG_02987 Para-nitrobenzyl esterase (1605 nt) MGG_02990 hypothetical protein (420 nt) MGG_03000 conserved hypothetical protein (1776 nt) MGG_03014 acid protease (1999 nt) MGG_03029 metalloproteinase (1071 nt) MGG_03072 TFIIS-like small Pol III subunit (330 nt) MGG_03149 dihydrolipoamide succinyltransferase (1839 nt) MGG_03200 zinc metalloprotease mde10 precursor (2672 nt) MGG_03203 54S ribosomal protein L16 (1099 nt) MGG_03245 aldose 1-epimerase (1397 nt) MGG_03257 plasma alpha-L-fucosidase (1806 nt) MGG_03316 Serine endopeptidase (2721 nt) Continued

194

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_03326 conserved hypothetical protein (805 nt) MGG_03331 hypothetical protein (684 nt) MGG_03337 endoprotease Endo-Pro-Aspergillus niger (1790 nt) MGG_03338 cellulose-binding protein (693 nt) MGG_03346 aspartylglucosaminidase (1065 nt) MGG_03347 hypothetical protein (822 nt) MGG_03353 hypothetical protein (699 nt) MGG_03354 hypothetical protein (860 nt) MGG_03356 ricin B lectin:Parallel beta-helix (1065 nt) MGG_03369 hypothetical protein (588 nt) MGG_03374 beta-1,6-galactanase (1269 nt) MGG_03394 hypothetical protein (1302 nt) MGG_03407 hypothetical protein (2886 nt) MGG_03457 hypothetical protein (840 nt) MGG_03461 chitin deacetylase (771 nt) MGG_03475 hypothetical protein (487 nt) MGG_03484 acyl carrier protein (435 nt) MGG_03495 hypothetical protein (525 nt) MGG_03502 feruloyl esterase B (1626 nt) MGG_03508 beta-glucosidase 1 precursor (2686 nt) MGG_03565 DnaJ and TPR domain-containing protein (1587 nt) MGG_03585 hypothetical protein (417 nt) MGG_03593 conserved hypothetical protein (1452 nt) MGG_03599 acidic endochitinase (1266 nt) MGG_03609 hypothetical protein (567 nt) MGG_03621 predicted protein (1286 nt) MGG_03634 zinc- and cadmium resistance protein (502 nt) MGG_03635 hypothetical protein (477 nt) MGG_03670 cerevisin (2314 nt) MGG_03671 hypothetical protein (375 nt) MGG_03687 hypothetical protein (1478 nt) MGG_03691 hypothetical protein (582 nt) MGG_03746 hypothetical protein (1056 nt) MGG_03760 hypothetical protein (855 nt) MGG_03817 metalloprotease1 (900 nt) MGG_03826 hypothetical protein (1083 nt) MGG_03844 glucosyl hydrolase family 43 protein (1374 nt) MGG_03858 hypothetical protein (1653 nt) MGG_03865 hypothetical protein (1119 nt) MGG_03867 hypothetical protein (993 nt) MGG_03870 minor extracellular protease vpr (2751 nt) MGG_03882 gamma-glutanyltransferase (1776 nt) MGG_03890 hypothetical protein (1818 nt) MGG_03891 conserved hypothetical protein (1125 nt) MGG_03919 HET-C protein (2346 nt) MGG_03946 hypothetical protein (594 nt) MGG_03968 conserved hypothetical protein (1348 nt) MGG_04015 mannan endo-1,6-alpha (1386 nt) Continued

195

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_04022 conserved hypothetical protein (920 nt) MGG_04023 conserved hypothetical protein (1092 nt) MGG_04023 conserved hypothetical protein (1092 nt) MGG_04118 hypothetical protein (1623 nt) MGG_04183 conserved hypothetical protein (1629 nt) MGG_04202 MAS3 protein (870 nt) MGG_04206 hypothetical protein (1557 nt) MGG_04237 hypothetical protein (1110 nt) MGG_04252 conserved hypothetical protein (1890 nt) MGG_04253 carboxypeptidase A4 (1454 nt) MGG_04257 hypothetical protein (1338 nt) MGG_04301 hypothetical protein (435 nt) MGG_04311 3’,5’-bisphosphate nucleotidase (1221 nt) MGG_04316 hypothetical protein (1614 nt) MGG_04343 extradiol ring-cleavage dioxygenase (1023 nt) MGG_04345 cytochrome P450 17A1 (1590 nt) MGG_04348 pectate lyase (1228 nt) MGG_04580 hypothetical protein (378 nt) MGG_04582 conserved hypothetical protein (1626 nt) MGG_04603 hypothetical protein (933 nt) MGG_04689 glucan 1,3-beta-glucosidase (1722 nt) MGG_04715 hypothetical protein (264 nt) MGG_04732 acidic mammalian chitinase (1377 nt) MGG_04756 glutamyl-tRNA(Gln) amidase (1665 nt) MGG_04757 hypothetical protein (1482 nt) MGG_04765 mannan endo-1,6-alpha-mannosidase DCW1 (1904 nt) MGG_04776 predicted protein (519 nt) MGG_04778 hypothetical protein (1464 nt) MGG_04795 predicted protein (348 nt) MGG_04804 hypothetical protein (1485 nt) MGG_04825 endopolyphosphatase (2043 nt) MGG_04841 hypothetical protein (723 nt) MGG_04847 peptidase M14 (1486 nt) MGG_04870 conserved hypothetical protein (1911 nt) MGG_04889 conserved hypothetical protein (579 nt) MGG_04900 alkaline phosphatase (2004 nt) MGG_04922 alpha-N-arabinofuranosidase (1080 nt) MGG_04925 hypothetical protein (594 nt) MGG_04928 hypothetical protein (522 nt) MGG_04944 hypothetical protein (801 nt) MGG_04948 magnesium-dependent phosphatase1 (873 nt) MGG_04963 hypothetical protein (165 nt) MGG_04973 carbonate dehydratase (816 nt) MGG_04986 conserved hypothetical protein (582 nt) MGG_05018 conserved hypothetical protein (897 nt) MGG_05020 N-acetylglucosamyl-phosphatidylinositol de-N-acetylase (855 nt) MGG_05037 hypothetical protein (981 nt) MGG_05038 endonuclease/exonucelase/phosphatase family protein (876 nt) Continued

196

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_05054 hypothetical protein (555 nt) MGG_05075 hypothetical protein (663 nt) MGG_05083 hypothetical protein (438 nt) MGG_05092 hypothetical protein (1155 nt) MGG_05109 hypothetical protein (1161 nt) MGG_05164 hypothetical protein (1626 nt) MGG_05165 hypothetical protein (1530 nt) MGG_05232 hypothetical protein (732 nt) MGG_05270 hypothetical protein (648 nt) MGG_05302 hypothetical protein (2673 nt) MGG_05324 mitochondrial nuclease (1125 nt) MGG_05338 hypothetical protein (1173 nt) MGG_05344 conserved hypothetical protein (759 nt) MGG_05354 hypothetical protein (1062 nt) MGG_05366 feruloyl esterase B (1893 nt) MGG_05381 beta-1,6-galactanase (1551 nt) MGG_05389 hypothetical protein (330 nt) MGG_05406 hypothetical protein (660 nt) MGG_05416 hypothetical protein (441 nt) MGG_05456 hypothetical protein (1009 nt) MGG_05479 xylosidase/arabinosidase (1716 nt) MGG_05518 hypothetical protein (348 nt) MGG_05520 exoglucanase 2 (2152 nt) MGG_05529 feruloyl esterase B (1648 nt) MGG_05531 hypothetical protein (519 nt) MGG_05539 carboxypeptidase 2 (1650 nt) MGG_05564 predicted protein (856 nt) MGG_05599 beta-glucosidase 1 (2409 nt) MGG_05608 conserved hypothetical protein (1000 nt) MGG_05620 alpha-galactosidase1 (1566 nt) MGG_05635 alpha-galactosidase1 (741 nt) MGG_05638 hypothetical protein (1252 nt) MGG_05663 carboxypeptidase Y (2291 nt) MGG_05685 conserved hypothetical protein (1793 nt) MGG_05688 hypothetical protein (1197 nt) MGG_05705 hypothetical protein (498 nt) MGG_05716 hypothetical protein (525 nt) MGG_05717 hypothetical protein (1398 nt) MGG_05751 conserved hypothetical protein (590 nt) MGG_05753 disulfide-isomerase (2097 nt) MGG_05785 levanase (1977 nt) MGG_05805 hypothetical protein (735 nt) MGG_05844 mannan endo-1,4-beta-mannosidase 1 precursor (1348 nt) MGG_05874 hypothetical protein (1110 nt) MGG_05875 pectate lyase (1133 nt) MGG_05887 hypothetical protein (741 nt) MGG_05896 predicted protein (309 nt) MGG_05912 N-acel-L-amino acid amihohydrolase (1422 nt) Continued

197

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_05913 hypothetical protein (654 nt) MGG_05954 conserved hypothetical protein (1785 nt) MGG_05978 hypothetical protein (561 nt) MGG_05982 hypothetical protein (414 nt) MGG_05989 dipeptidyl aminopeptidase B (2337 nt) MGG_06004 prohibitin-1 (1208 nt) MGG_06009 alpha-N-arabinofuranosidase (1503 nt) MGG_06023 464 GPI-anchored cell wall beta-1,3-endoflucanse EgIC (1392 nt) MGG_06041 rhamnogalacturonan lyase (1977 nt) MGG_06057 transmembrane 9 superfamily member 4 (2157 nt) MGG_06069 endoglucanase (1809 nt) MGG_06097 mitochondrial import receptor subunit tom-20 (1097 nt) MGG_06166 hypothetical protein (1413 nt) MGG_06175 hypothetical protein (2166 nt) MGG_06189 conserved hypothetical protein (2512 nt) MGG_06191 mannan polymerase II complexANP1 subunit (1212 nt) MGG_06216 hypothetical protein (1413 nt) MGG_06224 hypothetical protein (402 nt) MGG_06302 DNA polymerase epsilon subunitC (282 nt) MGG_06327 candidapepsin-3 precursor (1463 nt) MGG_06367 vesicular integral-membrane (966 nt) MGG_06402 cellulase (1233 nt) MGG_06412 conserved hypothetical protein (1771 nt) MGG_06434 hypothetical protein (987 nt) MGG_06478 hypothetical protein (654 nt) MGG_06493 beta-glucanase (1161 nt) MGG_06523 hypothetical protein (666 nt) MGG_06587 bacterial leucyl aminopeptidase (1629 nt) MGG_06593 endo-1,4-beta-xylanase 2 (768 nt) MGG_06594 chitinase 18-11 (1760 nt) MGG_06601 conserved hypothetical protein (1173 nt) MGG_06610 Lipase (1200 nt) MGG_06614 conserved hypothetical protein (2370 nt) MGG_06621 hypothetical protein (702 nt) MGG_06631 hypothetical protein (1284 nt) MGG_06653 conserved hypothetical protein (1019 nt) MGG_06662 FAD binding domain-containing protein (1592 nt) MGG_06665 predicted protein (432 nt) MGG_06667 hypothetical protein (639 nt) MGG_06714 hypothetical protein (2058 nt) MGG_06722 1,3-beta-glucanosyltransferase gel2 (2246 nt)" MGG_06771 hypothetical protein (672 nt) MGG_06780 alpha-L-fucosidase1 (1557 nt) MGG_06786 disuldide-isomerase A6 precursor(1413 nt) MGG_06798 hypothetical protein (1320 nt) MGG_06834 1,4-beta-D-glucan cellobiohydrolase B (1359 nt) MGG_06835 hypothetical protein (759 nt) MGG_06840 alkaline foam protein B (456 nt) Continued

198

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_06842 hypothetical protein (3051 nt) MGG_06843 alpha-N-arabinofuranosidase (1458 nt) MGG_06861 hypothetical protein (489 nt) MGG_06906 conserved hypothetical protein (2231 nt) MGG_06953 conserved hypothetical protein (975 nt) MGG_06955 hypothetical protein (1635 nt) MGG_06994 predicted protein (270 nt) MGG_07005 hypothetical protein (1774 nt) MGG_07016 conserved hypothetical protein (1047 nt) MGG_07067 FAD binding domain-containing protein (1524 nt) MGG_07153 hypothetical protein (1002 nt) MGG_07179 rhizopuspepsin-3 precursor (1643 nt) MGG_07184 hypothetical protein (336 nt) MGG_07194 hypothetical protein (792 nt) MGG_07209 signal sequence receptor alpha chain (801 nt) MGG_07220 Iron transporter protein (1626 nt) MGG_07225 hypothetical protein (390 nt) MGG_07234 FK506-binding protein 2 (1460 nt) MGG_07287 lysophospholipase 3 (2514 nt) MGG_07292 hypothetical protein (846 nt) MGG_07294 feruloyl esterase B (876 nt) MGG_07295 hypothetical protein (1140 nt) MGG_07300 cellulose-growth-specific protein (820 nt) MGG_07324 hypothetical protein (699 nt) MGG_07331 1,3-beta-glucanosyltransferase gel1 (1762 nt) MGG_07348 predicted protein (1058 nt) MGG_07355 hypothetical protein (648 nt) MGG_07356 predicted protein (1833 nt) MGG_07390 coagulation factor 5/8 type domain-containing protein (894 nt) MGG_07404 tripeptidyl-peptidase1 (1803 nt) MGG_07419 hypothetical protein (1218 nt) MGG_07502 chaperone dnaJ2 (1248 nt) MGG_07521 hypothetical protein (1575 nt) MGG_07559 tripeptidyl-peptidase 1 (1785 nt) MGG_07560 conserved hypothetical protein (1350 nt) MGG_07566 hypothetical protein (1050 nt) MGG_07569 cellobiose dehydrogenase (1870 nt) MGG_07574 conserved hypothetical protein (873 nt) MGG_07575 endoglucanase-4 (978 nt) MGG_07577 conserved hypothetical protein (1973 nt) MGG_07580 glucose oxidase (1758 nt) MGG_07607 hypothetical protein (615 nt) MGG_07609 hypothetical protein (762 nt) MGG_07621 endoribonuclease-L-PSP (441 nt) MGG_07625 predicted protein (773 nt) MGG_07630 hypothetical protein (782 nt) MGG_07631 Fungal cellulose binding domain-containing protein (1005 nt) MGG_07632 endonuclease/exonuclease/phosphatase family protein (930 nt) Continued

199

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_07644 conserved hypothetical protein (954 nt) MGG_07645 carboxylpeptidase A (1452 nt) MGG_07646 alpha-glucuronidase (2592 nt) MGG_07677 rhamnogalacturonan acetylesterase (833 nt) MGG_07686 endoglucanase II (726 nt) MGG_07704 carboxypeptidase A (1329 nt) MGG_07716 DnaJ domain-containing protein (1284 nt) MGG_07748 hypothetical protein (534 nt) MGG_07763 hypothetical protein (1521 nt) MGG_07775 hypothetical protein (639 nt) MGG_07789 3-phytase (2259 nt) MGG_07790 ligninase H2 (1422 nt) MGG_07791 surface protein 1 (402 nt) MGG_07809 exoglucanase 1 (1344 nt) MGG_07810 hypothetical protein (345 nt) MGG_07816 hypothetical protein (483 nt) MGG_07854 hypothetical protein (684 nt) MGG_07856 pisatin demethylase (1527 nt) MGG_07868 glucosyl hydrolase family 10 (1086 nt) MGG_07869 hypothetical protein (387 nt) MGG_07871 hypothetical protein (723 nt) MGG_07877 dipeptidyl-peptidase V (2591 nt) MGG_07880 predicted protein (764 nt) MGG_07908 endoglucanase-6B (1152 nt) MGG_07919 hypothetical protein (555 nt) MGG_07927 endochitinase 1 precursor (1371 nt) MGG_07955 endo-1,4-beta-xylanase1 (699 nt) MGG_07959 hypothetical protein (840 nt) MGG_07965 alkaline proteinase (1197 nt) MGG_07969 hypothetical protein (303 nt) MGG_07972 hypothetical protein (873 nt) MGG_07986 hypothetical protein (333 nt) MGG_08011 D-amino-acid oxidase (1089 nt) MGG_08020 endoglucanase-4 (823 nt) MGG_08024 hypothetical protein (306 nt) MGG_08041 metalloprotease1 (849 nt) MGG_08045 hypothetical protein (1605 nt) MGG_08046 bilirubin oxidase (1860 nt) MGG_08047 glycerophosphoryl diester phosphodiesterase family protein (1346 nt) MGG_08052 hypothetical protein (1869 nt) MGG_08054 chitinase 1 (1191 nt) MGG_08057 beta-glucuronidase (1785 nt) MGG_08062 conserved hypothetical protein (879 nt) MGG_08080 hypothetical protein (855 nt) MGG_08096 Transmembrane emp24 domain-containing protien(657 nt) MGG_08117 DRAP deaminase (1461 nt) MGG_08158 predicted protein (1296 nt) MGG_08164 disulfide-isomerase erp38 (1441 nt) Continued

200

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_08182 glycolipid 2-alpha-mannosyltransferase (1972 nt) MGG_08194 hypothetical protein (384 nt) MGG_08210 endoplasmic reticulum vesicle protein 25 (1372 nt) MGG_08230 hypothetical protein (399 nt) MGG_08231 hypothetical protein (1186 nt) MGG_08232 conserved hypothetical protein (1312 nt) MGG_08253 hypothetical protein (462 nt) MGG_08254 hypothetical protein (687 nt) MGG_08265 hypothetical protein (1869 nt) MGG_08275 hypothetical protein (606 nt) MGG_08276 hypothetical protein (1053 nt) MGG_08291 hypothetical protein (459 nt) MGG_08300 conserved hypothetical protein (498 nt) MGG_08319 hypothetical protein (1320 nt) MGG_08331 endo-1,4-beta-xylanase B (796 nt) MGG_08334 hypothetical protein (876 nt) MGG_08342 phosphorylcholine pohophastase (1083 nt) MGG_08348 predicted protein (320 nt) MGG_08350 hypothetical protein (552 nt) MGG_08351 hypothetical protein (741 nt) MGG_08354 hypothetical protein (774 nt) MGG_08355 hypothetical protein (333 nt) MGG_08370 1,3-beta-glucanosyltransferase gel3 (2124 nt) MGG_08373 conserved hypothetical protein (738 nt) MGG_08407 hypothetical protein (318 nt) MGG_08408 hypothetical protein (1032 nt) MGG_08409 cellulose growth specific protein (888 nt) MGG_08411 predicted protein (594 nt) MGG_08416 lipase 1 (1704 nt) MGG_08424 endo-1,4-beta-xylanase I (777 nt) MGG_08428 hypothetical protein (333 nt) MGG_08431 conserved hypothetical protein (1329 nt) MGG_08435 hypothetical protein (324 nt) MGG_08436 minor extracellular protease (2757 nt) MGG_08454 25 kDa protein elicitor (787 nt) MGG_08455 conserved hypothetical protein (1556 nt) MGG_08469 hypothetical protein (414 nt) MGG_08480 alpha beta hydrolase (873 nt) MGG_08486 beta-lactamase (1818 nt) MGG_08487 cellobiose dehydrogenase (1754 nt) MGG_08496 endo-1,4-beta-xylanase D (1371 nt) MGG_08499 manganese lipoxygenase (1764 nt) MGG_08501 conserved hypothetical protein (1558 nt) MGG_08515 hypothetical protein (579 nt) MGG_08543 hypothetical protein (318 nt) MGG_08546 predicted protein (497 nt) MGG_08550 lipotylic enzyme(1080 nt) MGG_08559 hypothetical protein (603 nt) Continued

201

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_08577 conserved hypothetical protein (1656 nt) MGG_08591 hypothetical protein (1776 nt) MGG_08593 conserved hypothetical protein (1346 nt) MGG_08607 hypothetical protein (402 nt) MGG_08624 C-8 sterol isomerase (1010 nt) MGG_08644 DNaseI protein (585 nt) MGG_08647 hypothetical protein (1155 nt) MGG_08657 hypothetical protein (621 nt) MGG_08692 alpha-1,2 mannosyltransferase KTR1 (2211 nt) MGG_08696 conserved hypothetical protein (1215 nt MGG_08698 candidapepsin-8 (1491 nt) MGG_08711 carboxypeptidase A2 (1485 nt) MGG_08715 hypothetical protein (411 nt) MGG_08729 hypothetical protein (828 nt) MGG_08736 carboxypeptidase 2 (2058 nt) MGG_08748 conserved hypothetical protein (2392 nt) MGG_08750 conserved hypothetical protein (981 nt) MGG_08752 exopolygalacturonase (1392 nt) MGG_08758 aminopeptidase Y (2018 nt) MGG_08772 conserved hypothetical protein (1008 nt) MGG_08787 hypothetical protein (420 nt) MGG_08799 hypothetical protein (348 nt) MGG_08823 hypothetical protein (1209 nt) MGG_08824 hypothetical protein (615 nt) MGG_08830 hypothetical protein (1728 nt) MGG_08938 hypothetical protein (1092 nt) MGG_08940 hypothetical protein (720 nt) MGG_08944 hypothetical protein (426 nt) MGG_08957 hypothetical protein (378 nt) MGG_08966 cuticle-degradation protease (1140 nt) MGG_08971 conserved hypothetical protein (734 nt) MGG_08973 hypothetical protein (1806 nt) MGG_09019 hypothetical protein (579 nt) MGG_09021 hypothetical protein (984 nt) MGG_09030 conserved hypothetical protein (1961 nt) MGG_09036 conserved hypothetical protein (1498 nt) MGG_09055 hypothetical protein (618 nt) MGG_09079 conserved hypothetical protein (1063 nt) MGG_09095 alpha-L-arabinofuranosidase ashA-2 (1047nt) MGG_09098 endo-1,4-beta-xylanase (3153 nt) MGG_09100 cutinase (214 nt) MGG_09109 hypothetical protein (1062 nt) MGG_09115 hypothetical protein (1546 nt) MGG_09134 hypothetical protein (830 nt) MGG_09147 conserved hypothetical protein (1047 nt) MGG_09148 glycosyl hydrolase family 43 protein (1293 nt) MGG_09162 cytochrome b2 (1298 nt) MGG_09180 hypothetical protein (1329 nt) Continued

202

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_09188 malate dehydrogenase (789 nt) MGG_09199 repressible acid phosphatase (1419 nt) MGG_09212 nitroreductase (876 nt) MGG_09246 oryzin (1687 nt) MGG_09268 hypothetical protein (1047 nt) MGG_09272 beta-glucosidase 1 (2619 nt) MGG_09287 oligosaccharyltransferase alpha subunit (1776 nt) MGG_09314 lipolytic enzyme (1564 nt) MGG_09321 conserved hypothetical protein (1613 nt) MGG_09322 hypothetical protein (1851 nt) MGG_09351 aspergillopepsis-F (1290 nt) MGG_09353 beta-glucosidase1 (2178 nt) MGG_09357 aspergillopepsin-F (1370 nt) MGG_09372 fasciclin domain family protein (1739 nt) MGG_09374 hypothetical protein (764 nt) MGG_09377 hypothetical protein (585 nt) MGG_09379 hypothetical protein (354 nt) MGG_09380 hypothetical protein (1029 nt) MGG_09383 NIMA-interacting protein TinC (3117 nt) MGG_09398 conserved hypothetical protein (1656 nt) MGG_09402 conserved hypothetical protein (826 nt) MGG_09404 feruloyl esterase B (1626 nt) MGG_09412 hypothetical protein (464 nt) MGG_09419 LysM-domain-containing protein (1311 nt) MGG_09420 hypothetical protein (900 nt) MGG_09428 hypothetical protein (969 nt) MGG_09460 cell wall protein (771 nt) MGG_09465 hypothetical protein (1221 nt) MGG_09468 conserved hypothetical protein (1275 nt) MGG_09469 conserved hypothetical protein (1837 nt) MGG_09503 hypothetical protein (1386 nt) MGG_09527 conserved hypothetical protein (2237 nt) MGG_09530 dipeptidase 1 (1606 nt) MGG_09538 carboxypeptidase cpdS precursor (1707 nt) MGG_09570 hypothetical protein (963 nt) MGG_09602 membrane copper amine oxidase (2133 nt) MGG_09614 hypothetical protein (1161 nt) MGG_09629 conserved hypothetical protein (570 nt) MGG_09640 alpha-amylase 1 (1825 nt) MGG_09641 conserved hypothetical protein (1381 nt) MGG_09650 hypothetical protein (423 nt) MGG_09657 conserved hypothetical protein (330 nt) MGG_09668 gus esterase1 (1602 nt) MGG_09692 aminopeptidase Y (1630 nt) MGG_09716 carboxypeptidase A2 (1272 nt) MGG_09726 arabinogalactan endo-1,4-beta-galactosidase (1147 nt) MGG_09732 feruloyl esterase (1581 nt) MGG_09733 secreted glucosidase (966 nt) Continued

203

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_09736 hypothetical protein (1053 nt) MGG_09772 hypothetical protein (544 nt) MGG_09782 hypothetical protein (1293 nt) MGG_09804 hypothetical protein (543nt) MGG_09805 alpha-galactosidase (1506 nt) MGG_09826 hypothetical protein (912 nt) MGG_09834 peroxidase/catalase 2 (4300 nt) MGG_09839 hypothetical protein (912 nt) MGG_09840 acetylxylan esterase 2 (1192 nt) MGG_09842 hypothetical protein (510 nt) MGG_09844 hypothetical protein (561 nt) MGG_09848 conserved hypothetical protein (555 nt) MGG_09849 predicted protein (1443 nt) MGG_09875 CAS1 domain-containing protein 1 (925 nt) MGG_09918 hypothetical protein (1071 nt) MGG_09922 beta-hexosaminidase beta chain (2019 nt) MGG_09934 dUTPase (1728 nt) MGG_09988 Glycosyl hydrolase family 4 (1680 nt) MGG_09998 hypothetical protein (279 nt) MGG_10004 hypothetical protein (405 nt) MGG_10024 hypothetical protein (561 nt ) MGG_10040 ferulic acid esterase A (708 nt) MGG_10065 hypothetical protein (504 nt ) MGG_10080 hypothetical protein (741 nt ) MGG_10083 endoglucanase3 (1128 nt) MGG_10171 bacterial leucyl aminopeptidase (1560 nt) MGG_10206 hypothetical protein (336 nt ) MGG_10234 conserved hypothetical protein (540 nt) MGG_10244 hypothetical protein (381 nt ) MGG_10247 hypothetical protein (1146 nt ) MGG_10252 oxalate decarboxylase oxdC (1835 nt) MGG_10259 hypothetical protein (267 nt ) MGG_10275 hypothetical protein (1989 nt ) MGG_10276 conserved hypothetical protein (597 nt) MGG_10278 monoxydenase (1410 nt) MGG_10315 hydrophobin (851 nt) MGG_10317 hypothetical protein (1482 nt ) MGG_10318 hypothetical protein (531 nt ) MGG_10330 glutamate carboxypeptidase2 (2169 nt) MGG_10337 conserved hypothetical protein (1720 nt) MGG_10394 hypothetical protein (609 nt ) MGG_10400 glucan 1,3-beta-glucosidase (1327 nt) MGG_10408 FAD binding domain-containing protein (1687 nt) MGG_10414 cholinesterase (1953 nt) MGG_10425 hypothetical protein (618 nt ) MGG_10456 hypothetical protein (838 nt) MGG_10479 oxidoreductase (1938) MGG_10484 conserved hypothetical protein (831 nt) Continued

204

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_10494 chitobiosyldiphosphodolichol beta-mannosyltrasferase (1368 nt) MGG_10510 Ribonuclease T2 (972 nt) MGG_10515 conserved hypothetical protein (1131 nt) MGG_10533 agmatinase (1677 nt) MGG_10559 hypothetical protein (426 nt ) MGG_10586 conserved hypothetical protein (792 nt) MGG_10621 xylosidase/arabinosidase (1530 nt) MGG_10669 endonuclease/exonuclease/phosphatase family protein (1970 nt) MGG_10712 exoglucanase 1 (1724 nt) MGG_10720 guanyl-specific ribonuclease F1 (675 nt) MGG_10742 conserved hypothetical protein (1298 nt) MGG_10748 hypothetical protein (2019 nt ) MGG_10781 hypothetical protein (585 nt ) MGG_10798 hypothetical protein (600 nt ) MGG_10799 acid phosphatase PHO1 (1581 nt) MGG_10824 hypothetical protein (1076 nt) MGG_10843 nucleotide exchange factor SIL1 precursor (1576 nt) MGG_10865 hypothetical protein (2109 nt ) MGG_10878 galactose oxidase (1833 nt) MGG_10926 conserved hypothetical protein (777 nt) MGG_10927 metallo-endopeptidase (1041 nt) MGG_10972 endoglucanase (927 nt) MGG_10995 hypothetical protein (666 nt ) MGG_11036 cellobiose dehydrogenase (3474 nt) MGG_11072 hypothetical protein (378 nt ) MGG_11091 hypothetical protein (699 nt ) MGG_11224 conserved hypothetical protein (1431 nt) MGG_11280 hypothetical protein (867 nt ) MGG_11304 hypothetical protein (534 nt ) MGG_11335 hypothetical protein (1827 nt ) MGG_11486 conserved hypothetical protein (1845 nt) MGG_11535 neutral ceramidase (2310 nt) MGG_11553 xyloglucanase (2232 nt) MGG_11599 endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase (1857 nt) MGG_11605 predicted protein (2523 nt) MGG_11608 laccase-2 (2226 nt) MGG_11610 hypothetical protein (339 nt ) MGG_11613 alkaline phosphatase D (1887 nt) MGG_11627 hypothetical protein (492 nt ) MGG_11650 hypothetical protein (471 nt ) MGG_11651 hypothetical protein (1686 nt ) MGG_11657 conserved hypothetical protein (1206 nt) MGG_11676 choline dehydrogenase (1966 nt) MGG_11691 streptogrisin-C precursor (1137 nt) MGG_11710 predicted protein (761 nt) MGG_11750 conserved hypothetical protein (1605 nt) MGG_11774 endoglucanase (1281 nt) MGG_11861 1,3-beta-glucanosyltransferase gel4 (2295 nt) Continued

205

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_11913 conserved hypothetical protein (1415 nt) MGG_11945 candidapepsin (1488 nt) MGG_11948 endoglucanase-4 (874 nt) MGG_11999 mannan endo-1,4-beta-mannosidase 3 (1392 nt) MGG_12016 conserved hypothetical protein (823 nt) MGG_12025 aldose1-epimerase (1149 nt) MGG_12043 hypothetical protein (312 nt ) MGG_12068 conserved hypothetical protein (1587 nt) MGG_12128 calcium influx-promoting protein ehs1 (1824 nt) MGG_12129 hypothetical protein (851 nt) MGG_12272 Trm-112 (381 nt) MGG_12275 conserved hypothetical protein (1951 nt) MGG_12291 conserved hypothetical protein (2371 nt) MGG_12313 hypothetical protein (894 nt ) MGG_12337 MAS3 protein (1490 nt) MGG_12354 hypothetical protein (1346 nt) MGG_12426 hypothetical protein (348 nt ) MGG_12467 hypothetical protein (825 nt) MGG_12468 hypothetical protein (2084 nt) MGG_12474 5'-nucleotidase (1671 nt) MGG_12484 hypothetical protein (1569nt ) MGG_12489 beta-xylosidase (1551 nt) MGG_12521 hypothetical protein (555 nt ) MGG_12606 hypothetical protein (1781 nt) MGG_12611 hypothetical protein (1680 nt ) MGG_12647 Ser/Thr protein phosphatase family protein (1623 nt) MGG_12652 Extracellular cell wall glucanase Crf1 (1548 nt) MGG_12655 hypothetical protein (273 nt ) MGG_12696 cellulose-growth-specific protein (717 nt) MGG_12715 hypothetical protein (669 nt ) MGG_12773 aminopeptidase Y (1479 nt) MGG_12798 para-nitrobenzyl esterase (1671 nt) MGG_12813 hypothetical protein (1542 nt ) MGG_12847 conserved hypothetical protein (1286 nt) MGG_12858 conserved hypothetical protein (762 nt) MGG_12906 hypothetical protein (1323 nt ) MGG_13009 hypothetical protein (1253 nt) MGG_13012 leucine aminopeptidase 2 (1458 nt) MGG_13049 hypothetical protein (966 nt ) MGG_13063 predicted protein (972 nt) MGG_13132 hypothetical protein (468 nt ) MGG_13177 cytosolic Cu/Zn superoxide dismutase (1576 nt) MGG_13198 hypothetical protein (267 nt ) MGG_13241 endoglucanase IV (1008 nt) MGG_13252 extracellular elastinolytic metalloproteinase (1905 nt) MGG_13261 hypothetical protein (909 nt ) MGG_13262 FAD binding domain-containing protein (1563 nt) MGG_13275 hypothetical protein (1173 nt ) Continued

206

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_13283 hypothetical protein (864 nt ) MGG_13292 hypothetical protein (1914 nt ) MGG_13325 hypothetical protein (453 nt ) MGG_13376 conserved hypothetical protein (2110 nt) MGG_13455 hypothetical protein (1404 nt ) MGG_13471 hypothetical protein (1431 nt ) MGG_13508 ubiquitin-protein ligase Sel1/Ubx2 (2523 nt) MGG_13549 conserved hypothetical protein (1296 nt) MGG_13578 sulphydryl oxidase (1356 nt) MGG_13598 endothiapeosin (1362 nt) MGG_13610 hydrolase (2107 nt) MGG_13622 fungal cellulose binding domain-containing protein (1107 nt) MGG_13654 conserved hypothetical protein (880 nt) MGG_13719 hypothetical protein (1089 nt ) MGG_13764 bilirubin oxidase (1887 nt) MGG_13777 beta-glucanase (934 nt) MGG_13809 cellobiose dehydrogenase precursor (2890 nt) MGG_13863 hypothetical protein (435 nt ) MGG_13868 hypothetical protein (345 nt ) MGG_13872 hypothetical protein (483 nt ) MGG_13907 hypothetical protein (1425 nt ) MGG_13944 hypothetical protein (582 nt) MGG_13977 alkaline proteinase (2889 nt) MGG_13993 hypothetical protein (906 nt ) MGG_14052 hypothetical protein (690 nt ) MGG_14055 conserved hypothetical protein (1732 nt) MGG_14061 oxalate decarboxylase oxdC (1982 nt) MGG_14095 hypothetical protein (843 nt ) MGG_14129 hypothetical protein (942 nt ) MGG_14134 hypothetical protein (1980 nt ) MGG_14141 hypothetical protein (261 nt ) MGG_14156 predicted protein (530 nt) MGG_14157 conserved hypothetical protein (1515 nt) MGG_14243 endo-1,4-beta-xylanase precursor (1481 nt) MGG_14244 conserved hypothetical protein MGG_14269 predicted protein MGG_14270 hypothetical protein (1095 nt ) MGG_14307 L-ascorbate oxidase MGG_14344 predicted protein (530 nt) MGG_14371 hypothetical protein (870 nt) MGG_14465 predicted protein (2302 nt) MGG_14628 secretory lipase (1413 nt) MGG_14641 hypothetical protein (336 nt) MGG_14652 hypothetical protein (438 nt ) MGG_14715 hypothetical protein (582 nt ) MGG_14725 hypothetical protein (399 nt ) MGG_14726 alpha-L-arabinofuranosidase (1518 nt) MGG_14727 conserved hypothetical protein (1182 nt) Continued

207

Table A.1. continued

ID Gene Annotation from M. oryzae database of Broad Institute of MIT and Harvard MGG_14830 predicted protein (1230 nt) MGG_14834 hypothetical protein (513 nt ) MGG_14849 hypothetical protein (300 nt ) MGG_14851 hypothetical protein (237 nt ) MGG_14854 fmp52-2 (729 nt) MGG_14858 54S ribosomal protein L24 (251 nt) MGG_14954 endoglucanase1 (1287 nt) MGG_14965 hypothetical protein (624 nt ) MGG_14966 hypothetical protein (1179 nt ) MGG_15022 hypothetical protein (627 nt) MGG_15046 hypothetical protein (501 nt ) MGG_15094 acetylcholinesterase (1701 nt) MGG_15106 hypothetical protein (447 nt ) MGG_15142 hypothetical protein (843 nt ) MGG_15185 agglutinin isolectin1 (1194 nt ) MGG_15212 metalloproteinase (429 nt) MGG_15227 hypothetical protein (180 nt ) MGG_15267 hypothetical protein (276 nt ) MGG_15340 hypothetical protein (981 nt ) MGG_15347 choline dehydrogenase (1827 nt) MGG_15375 hypothetical protein (363 nt ) MGG_15383 glutamyl-tRNA(Gln) amidotansferase (1944 nt) MGG_15394 hypothetical protein (378 nt ) MGG_15403 hypothetical protein (777 nt ) MGG_15410 hypothetical protein (387 nt ) MGG_15430 endo-1,4-beta-xylanase A (1472 nt MGG_15433 conserved hypothetical protein (348 nt)

208

Appendix B: The List of 29 M. oryzae CBM-containing protein genes

Table B.1 The list of 29 M. oryzae CBM-containing protein genes identified using RL-SAGE, MPSS and SBS technologies

No. Gene ID CDS size Gene Annotation from M. oryzae database CBM family (bp) of Broad Institute of MIT and Harvard 1 MGG_00227 846 Conserved hypothetical protein CBM18 2 MGG_01336 1677 Bacteriodes thetaiotaomicron symbiotic chitinase CBM18 3 MGG_02245 1140 Endo-1,4-beta-xylanase CBM1 4 MGG_03599 1269 Acidic endochitinase SE2 CBM18 5 MGG_03746 996 Acetylxylan esterase1 CBM1 6 MGG_03844 1482 Glycosyl hydrolase family 43 protein CBM35 7 MGG_05232 729 Conserved hypothetical protein CBM52 8 MGG_05520 1446 Exoglucanase2 CBM1 9 MGG_05620 1569 Alpha-galactosidase1 CBM35 10 MGG_06009 1503 Alpha-N-arabinofuranosidase CBM42 11 MGG_06069 209 Conserved hypothetical protein CBM18 12 MGG_06594 1588 Chitinase 18-11 CBM18 13 MGG_06771 886 Conserved hypothetical protein CBM18 14 MGG_08231 590 Conserved hypothetical protein CBM1 15 MGG_08370 1602 1,3-beta-glucanosyltransgerase gel3 CBM43 16 MGG_08408 1137 Conserved hypothetical protein CBM1 17 MGG_08409 888 Cellulose-growth-specific protein CBM1 18 MGG_08496 1368 Endo1-,4-beta-xylanase CBM6 19 MGG_08729 831 Conserved hypothetical protein CBM18 20 MGG_09036 1235 Alpha-L-arabinofuranosidase CBM1 21 MGG_10040 1023 Ferulic acid esterase A CBM1 22 MGG_10083 1131 Endoglucanase3 CBM1 23 MGG_10333 1227 Chitinase CBM1 24 MGG_10621 1533 Xylosidase/arabinosidase CBM6 25 MGG_10972 891 Endoglucanase1 CBM1 26 MGG_11036 2526 Conserved hypothetical protein CBM1 27 MGG_13241 1011 Endoglucanase4 CBM1 28 MGG_14726 1173 Alpha-L-arabinofuranosidase CBM1 29 MGG_15430 1296 Endo-1,4-beta-xylanaseA CBM1

209

Appendix C: Primers used in this study

Table C.1. the list of primers used in this study

Primers Sequence 5’3’ Comments 00194-F ATGGCTCCCAGAAGCACACTTC Forward primer to amplify Full-length (FL-) Magnaporth oryzeagene MGG_00194 00194-NS-F AGATATCATGCCTTATGTTTCCG Forward primer to amplify truncated non-signal peptide version(NS-) MGG_00194 00194-R TAGGATCCTCAGCGGCCAATTC Reverse primer to amplify MGG_00194 00505-F CACCATGAAGGGACTCGCCCATC Forward primer to amplify FL-MGG_00505 00505-NS-F AATGCAGCATGCCAACCATCAC Forward primer to amplify NS-MGG_00505 00505-R TCAGCTGCCCTTGCTGAAAAC Reverse primer to amplify MGG_00505 00539-F CACCATGCTCGCTTCAAGCCTG Forward primer to amplify FL-MGG_00539 00539-NS-F AATGCAGACCACCGAAGGGCTC Forward primer to amplify NS-MGG_00539 00539-R CTGAGATCTTTATGCCAGGATG Reverse primer to amplify MGG_00539 02368-F ATATGTCTCTCACATCCTTGAGG Forward primer to amplify FL-MGG_02368 02368-NS-F AATGACCACGACGCTCCCCCCG Forward primer to amplify NS-MGG_02368 02368-R TCTTAAGCACCCCAGATACCAGC Reverse primer to amplify MGG_02368 02546-F ATGCAACCCGGCACCTTTCTC Forward primer to amplify FL-MGG_02546 02546-NS-F ACCCGGGATGGCCACACCTCC Forward primer to amplify NS-MGG_02546 02546-R TAGGATCCTCAACGTGGAGCTG Reverse primer to amplify MGG_02546 03326-F CACCATGAAGTTCTCCATCGC Forward primer to amplify FL-MGG_03326 03326-NS-F AATGGCCACGGTTGAGACCCC Forward primer to amplify NS-MGG_03326 03326-R TAGTCTTGCTCGGCGGCGAC Reverse primer to amplify MGG_03326 03356-F ATGGCTCGCTTCACCTCGCTC Forward primer to amplify FL-MGG_03356 03356-NS-F AATGCAGTGCGGAGCTGGCAAC Forward primer to amplify NS-MGG_03356 03356-R CTGAGATCTCTAGCAAAGGGCTC Reverse primer to amplify MGG_03356 03369-F AATGCCTTCAACCAAAACCATC Forward primer to amplify FL-MGG_03369 03369-NS-F AATGAAGAATGACACTTCCTCC Forward primer to amplify NS-MGG_03369 03369-R TTCACGTAAAGGAGCAGTTTGTC Reverse primer to amplify MGG_03369 03593-F CACCATGTCTTCCACCAAGGC Forward primer to amplify FL-MGG_03593 03593-NS-F AATGCGCTTCAACCAGGAGCAG Forward primer to amplify NS-MGG_03593 03593-R TTAGAAGCCGAGAAGGCTGTTG Reverse primer to amplify MGG_03593 03746-F AATGCGCTTCAGCCATCTCATG Forward primer to amplify FL-MGG_03746 03746-NS-F AATGCAGGAAAGCCAGCTCATC Forward primer to amplify NS-MGG_03746 03746-R ATTAGATGCACTGAGAGTACCAG Reverse primer to amplify MGG_03746 03968-F ATGCCTTCCATTTCTTTCCTGG Forward primer to amplify FL-MGG_03968 03968-NS-F AATGGGCGTGACGGTCCGCAAG Forward primer to amplify NS-MGG_03968 03968-R CTGAGATCTCTAATCCTTCACAC Reverse primer to amplify MGG_03968 04202-F ATGAAGTACACCAGCGCCATC Forward primer to amplify FL-MGG_04202 04202-NS-F AATGCACGGCGTCGTCACCGAG Forward primer to amplify NS-MGG_04202 04202-R CTGAGATCTCTACTCGTCATCC Reverse primer to amplify MGG_04202 Continued 210

Table C.1. continued

Primers Sequence 5’3’ Comments 04582-F ATGAAGGGCTTCACTGTCGCC Forward primer to amplify FL-MGG_04582 04582-NS-F AATGCACCGCCAGCACCGCCAG Forward primer to amplify NS-MGG_04582 04582-R TAGGATCCTCAAGACGAGAAGAG Reverse primer to amplify MGG_04582 04795-F ATGCACGTTTTCAACTTCGCCG Forward primer to amplify FL-MGG_04795 04795-NS-F AATGGCCGACCAAGGTTCTAACAC Forward primer to amplify NS-MGG_04795 04795-R TAGGATCCTTACGGGTAATAATTC Reverse primer to amplify MGG_04795 04841-F ATGCGTTCCTCATCCATCATCC Forward primer to amplify FL-MGG_04841 04841-NS-F AATGACGGAGCTCAGGATCGAC Forward primer to amplify NS-MGG_04841 04841-R TAGGATCCTCAGGGGACGTAGG Reverse primer to amplify MGG_04841 05092-F ATGAAGTTCTTCGTCACCTCCG Forward primer to amplify FL-MGG_05092 05092-NS-F AATGGAGGTCCCCCAGGAGCAC Forward primer to amplify NS-MGG_05091 05092-R CTGAGATCTCTAGCGGCGGG Reverse primer to amplify MGG_05092 05344-F CACCATGCAGTTCTCCAACATC Forward primer to amplify FL-MGG_05344 05344-NS-F AATGGTCAGCGTCTCATACGAC Forward primer to amplify NS-MGG_05344 05344-R TTACAGGCCGCAGGCGTTGAG Reverse primer to amplify MGG_05344 05456-F CACCATGAAGTACACCGCCGTTC Forward primer to amplify FL-MGG_05456 05456-NS-F GCAATGCAGAGCATCAACGATG Forward primer to amplify NS-MGG_05456 05456-R TTACAGAGCGAGGGCACCGAG Reverse primer to amplify MGG_05456 05529-F ATGGACTCGTCAATCATTCACTG Forward primer to amplify FL-MGG_05529 05529-NS-F AGATATCATGTCCCCGCTGGC Forward primer to amplify NS-MGG_05529 05529-R TAGGATCCTTATGCTCCATCGG Reverse primer to amplify MGG_05529 05531-F ATGAAGTTCAACAGTGGTCTCC Forward primer to amplify FL-MGG_05531 05531-NS-F ATGCAGGACTGCATCAGCGTC Forward primer to amplify NS-MGG_05531 05531-R TTAGGTTGGGTCTTGACTAATTA Reverse primer to amplify MGG_05531 06478-F CACCATGTTACCCACCCTCCTG Forward primer to amplify FL-MGG_06478 06478-NS-F AATGGCCCCCCACGGAGCTTTTG Forward primer to amplify NS-MGG_06478 06478-R CTGAGATCTTCAATGCGGTGCG Reverse primer to amplify MGG_06478 07607-F ATGAAACTCCTCCTGACAGCAC Forward primer to amplify FL-MGG_07607 07607-NS-F AGATATCATGCACCTCCCACAGC Forward primer to amplify NS-MGG_07607 07607-R TAGGATCCTTAAACACAAATGCC Reverse primer to amplify MGG_07607 07686-F CACCATGAAGACCACCATCCTC Forward primer to amplify FL-MGG_07686 07686-NS-F AATGCACACCATCTTCTCGTCG Forward primer to amplify NS-MGG_07686 07686-R TTAGCAGGTGAAGACAGGAGG Reverse primer to amplify MGG_07686 07955-F AATGGTCTCCTTCACCTCCATC Forward primer to amplify FL-MGG_07955 07955-NS-F AATGATCCCCGCTCCCGATGG Forward primer to amplify NS-MGG_07955 07955-R TTCACGCCGGAGTCTGAACGTTG Reverse primer to amplify MGG_07955 07986-F CACCATGCACCCCAACACCATC Forward primer to amplify FL-MGG_07986 07986-NS-F ATATGTTTAGGTGCGCCATCGG Forward primer to amplify NS-MGG_07986 07986-R CTAGTGGATCCCCCTCGAGTG Reverse primer to amplify MGG_07986 08096-F AATGAGGCCATTCCTGCCATTG Forward primer to amplify FL-MGG_08096 08096-NS-F AATGCTGTACTTTTACATTGACG Forward primer to amplify NS-MGG_08096 08096-R ACTATGTGAGCTTTTGCTTGATG Reverse primer to amplify MGG_08096 08409-F ATGAAGTCGACAACCTTCCTCAG Forward primer to amplify FL-MGG_08409 08409-NS-F AGATATCATGCACTACATCTTCAG Forward primer to amplify NS-MGG_08409 08409-R TAGGATCCCTACAAGCACTGGC Reverse primer to amplify MGG_08409 08416-F ATGTGGATAGCAACATCTCCG Forward primer to amplify FL-MGG_08416 08416-NS-F ACCCGGGATGGTGGATACCTTG Forward primer to amplify NS-MGG_08416 08416-R CTGAGATCTCTATGCCTTGCC Reverse primer to amplify MGG_08416 08957-F ATGCTTGCGAAACACCTGATATTC Forward primer to amplify FL-MGG_08957 Continued 211

Table C.1. continued

Primers Sequence 5’3’ Comments 08957-NS-F AATGGTGCCGATCGTCGAAACAAG Forward primer to amplify NS-MGG_08957 08957-R CTGAGATCTTCAAGATTGACGC Reverse primer to amplify MGG_08957 09134-F CACCATGCAGATCAAGGCCCTC Forward primer to amplify FL-MGG_09134 09134-NS-F ATGATGCCCACCGACCCGCCC Forward primer to amplify NS-MGG_09134 09134-R TTAATGGCCGATGGGTGCCTG Reverse primer to amplify MGG_09134 09147-F ATGCTTGTCCGTGCGATTG Forward primer to amplify FL-MGG_09147 09147-NS-F AATGGCCCCTAAGCCGGCCGC Forward primer to amplify NS-MGG_09247 09147-R CTATGCACCGTATGCCTGC Reverse primer to amplify MGG_09147 09398-F TGAGGACGACGACAATAGC Forward primer to amplify FL-MGG_09398 09398-NS-F AGATATCATGGCAGACCCCGTGG Forward primer to amplify NS-MGG_09398 09398-R CTAGTTTGGACAGCTATTTGAC Reverse primer to amplify MGG_09398 09465-F CACCATGCAGTCTCCGGTGCTC Forward primer to amplify FL-MGG_09465 09465-NS-F AATGCAATTCGGCGGCTTCTTC Forward primer to amplify NS-MGG_09465 09465-R TTAGAGAAGACCCTTCCTCGC Reverse primer to amplify MGG_09465 09842-F AATGCAGTTTCTCAGCACCATG Forward primer to amplify FL-MGG_09842 09842-NS-F AATGATCCCGGCCGAGCTCAA Forward primer to amplify NS-MGG_09842 09842-R ATTACCAGTCCCAGCACTGGTAG Reverse primer to amplify MGG_09842 09998-F AATGAAGGCATCAAGCATCCTC Forward primer to amplify FL-MGG_09998 09998-NS-F ATATGGCGCCCGGGACCCC Forward primer to amplify NS-MGG_09998 09998-R ATCAGATGCAGTAAGCACCACC Reverse primer to amplify MGG_09998 10004-F ATGCACTTCCAAACCATCCTC Forward primer to amplify FL-MGG_10004 10004-NS-F ATGCGCCGAGTAATGGTTCTC Forward primer to amplify NS-MGG_10004 10004-R CATTGCGAACGCTAGAACCT Reverse primer to amplify MGG_10004 10234-F ATGCAGCTCACCACCATCC Forward primer to amplify FL-MGG_10234 10234-NS-F ATGGCGCTCAACTGGTCGCTC Forward primer to amplify NS-MGG_10234 10234-R TCAGCGGCCAATTCCATCCTG Reverse primer to amplify MGG_10234 10679-F ATGAAGACAGCTACCGCAACC Forward primer to amplify FL-MGG_10679 10679-NS-F AATGTCAACAACCAGCAACGACG Forward primer to amplify NS-MGG_10679 10679-R TAGGATCCTCAAGCCAACCAC Reverse primer to amplify MGG_10679 10824-F AATGTTGAGCAATTTCGCAATC Forward primer to amplify FL-MGG_10824 10824-NS-F AATGCAGCTCCCCCCTCTGCC Forward primer to amplify NS-MGG_10824 10824-R TTCACAGAGCAAAGGCACCCATG Reverse primer to amplify MGG_10824 02245-F TATGCGTACTCCCGCTATCGTC Forward primer to amplify FL-MGG_02245 02245-DS-F TATGGCTCTTTGGGGCCAATGT Forward primer to amplify NS-MGG_02245 02245-R CTACAAAGCGTTCATGATGG Reverse primer to amplify MGG_02245 05232-F ATGAAGTCCCTCTTCCTCAC Forward primer to amplify FL-MGG_05232 05232-NS-F TATGGAAAAGTGCGGCGATGCCAA Forward primer to amplify NS-MGG_05232 05232-R TTAAATGTATTGCCAAGCCG Reverse primer to amplify MGG_05232 05620-F AGATCTGAATTCATGTCACGCCTCCTCGCCCTCGC Forward primer to amplify FL-MGG_05620 05620-NS-F GATCTGAATTCATGACGCCGCCGATGGGCTGGAA Forward primer to amplify NS-MGG_05620 05620-R CTCGAGTTACTCATATACTTCGATTCCAAC Reverse primer to amplify MGG_05620 06009-F ATGCCTCTCACTCGTTCCGC Forward primer to amplify FL-MGG_06009 06009-NS-F TATGGGGCCATGCGACATCTACGC Forward primer to amplify NS-MGG_06009 06009-R TCAAACAAAGCCCGTCTTCA Reverse primer to amplify MGG_06009 08370-F ATGAGTTTCATTAAACTCGC Forward primer to amplify FL-MGG_08370 08370-NS-F TATGACCGAGCCCGTCACGGCCAAA Forward primer to amplify NS-MGG_08370 08370-R CTACATCAAAACAGCCGCAG Reverse primer to amplify MGG_08370 08408-F TGAATTCAAGCTTATGAGGCTGTCCATCTGC Forward primer to amplify FL-MGG_08408 Continued

212

Table C.1. continued

Primers Sequence 5’3’ Comments 08408-NS-F TGAATTCAAGCTTAATGGGCACCGTGATCTGGGAT Forward primer to amplify NS-MGG_08408 08408-R AGTCGACTCAAAAGTTTCCCCTGG Reverse primer to amplify MGG_08408 08496-F ATGTCCGCTCTCCACGCCAT Forward primer to amplify FL-MGG_08496 08496-NS-F TATGGACAATCCCTTTGTGCAGACT Forward primer to amplify NS-MGG_08496 08496-R TCATGCAAACTCCCAAGAGT Reverse primer to amplify MGG_08496 10083-F TATGAAGTCTATTTTTGCCCTCG Forward primer to amplify FL-MGG_10083 10083-NS-F TATGCAGTGCGGTGGAAACGGC Forward primer to amplify NS-MGG_10083 10083-R AGCGGCCGCTCACAGGTACGTCTTCAACAG Reverse primer to amplify MGG_10083 10333-F AGATCTGAATTCATGCTTCGCCGCGCATCAGTACT Forward primer to amplify FL-MGG_10333 10333-NS-F AGATCTGAATTCATGGGCTTCAATCCGAGCATGCA Forward primer to amplify NS-MGG_10333 10333-R AAGCTTGTCGACTTATGCGCACACCGACCACAAGG Reverse primer to amplify MGG_10333 10621-F TATGGTCCCAAAGATGCTTCC Forward primer to amplify FL-MGG_10621 10621-NS-F TATGGACAATCCATTCGTGCAGAC Forward primer to amplify NS-MGG_10621 10621-R AGCGGCCGCTCACAAGCACTGCGAATACCA Reverse primer to amplify MGG_10621 10972-F TATGATCAAGACCCTTACAGCCG Forward primer to amplify FL-MGG_10972 10972-NS-F TATGGTGCCTCACCCCGTCGCTAA Forward primer to amplify NS-MGG_10972 10972-R AGCGGCCGCTTATGAGCACTGAGAGTACCA Reverse primer to amplify MGG_10972 11036-F TATGCGGACTCTTGCGCCCTTTA Forward primer to amplify FL-MGG_11036 11036-NS-F TATGCAGGGTCCGTTGCCGCAG Forward primer to amplify NS-MGG_11036 11036-R TTAGAGGCACTGAGAGTAGTATTC Reverse primer to amplify MGG_11036 13241-F ATGAAATCCGCAGCCCTCCT Forward primer to amplify FL-MGG_13241 13241-NS-F AAGATCTGAATTCATGCACGGCCAC Forward primer to amplify NS-MGG_13241 13241-R TCAAGGAAGACACTGCGAGT Reverse primer to amplify MGG_13241 14726F1 TCTCGAGTTATGCTGGGAAACATCAAGACC Forward primer to amplify FL-MGG_14726 14726F1-NS-F GCTGATTGCTGACAGCACCACCATGTACCTGTTCT Forward primer to amplify NS-MGG_14726 14726R2 CTAGACGCATTGAGAGTACCACTGGTTCGA Reverse primer to amplify MGG_14726 15430-F AGATCTGAATTCATGCGTTCCGCGTCCTTTCT Forward primer to amplify FL-MGG_15430 15430-NS-F AGATCTGAATTCATGCAGGCATGCGGCCTCAATCA Forward primer to amplify NS-MGG_15430 15430_R AAGCTTGCGGCCGCTCACGCCAGACATTGATAATA Reverse primer to amplify MGG_15430 YS03356-F ACGAATTCATGGCTCGCTTCAC Forward primer for cloning FL-MGG_03356 for yeast secretion assay YS03356-NS-F ACGAATTCATGCAGTGCGGAG Forward primer for cloning NS-MGG_03356 for yeast secretion assay YS03356-R TAGCGGCCGCAAGCAAAGGGC Reverse primer for cloning MGG_03356 for yeast secretion assay YS05531-F ACGAATTCATGAAGTTCAACAGTGG Forward primer for cloning FL-MGG_05531 for yeast secretion assay YS05531-NS-F ACGAATTCATGCAGGACTGCATCAG Forward primer for cloning NS-MGG_05531 for yeast secretion assay YS05531-R TAGCGGCCGCAACAGCCCAAGGG Reverse primer for cloning MGG_05531 for yeast secretion assay YS07986-F ACGAATTCATGCACCCCAACAC Forward primer for cloning FL-MGG_7986 for yeast secretion assay YS07986-NS-F ACGAATTCATGTTTAGGTGCGC Forward primer for cloning NS-MGG_07986 for yeast secretion assay YS07986-R TAGCGGCCGCAAGTGGATCCC Reverse primer for cloning MGG_07986 for yeast secretion assay Continued

213

Table C.1. continued

Primers Sequence 5’3’ Comments YS08409-F ACGAATTCATGAAGTCGACAAC Forward primer for cloning FL- MGG_08409 for yeast secretion assay YS08409-NS-F ACGAATTCATGCACTACATCTTC Forward primer for cloning NS- MGG_08409 for yeast secretion assay YS08409-R TAGCGGCCGCAACAAGCACTGG Reverse primer for cloning MGG_08409 for yeast secretion assay YS10234-F ACGAATTCATGCAGCTCACCACC Forward primer for cloning FL- MGG_10234 for yeast secretion assay YS10234-NS-F ACGAATTCATGGCGCTCAACTGGTC Forward primer for cloning NS- MGG_10234 for yeast secretion assay YS10234-R TAGCGGCCGCAAGCGGCCAATTC Reverse primer for cloning MGG_10234 for yeast secretion assay YS05232-F ACGAATTCATGAAGTCCCTCTTCC Forward primer for cloning FL- MGG_05232 for yeast secretion assay YS05232-NS-F ACGAATTCATGGAAAAGTGCGGCGA Forward primer for cloning NS- MGG_05232 for yeast secretion assay YS05232-R TAGCGGCCGCAAATGTATTGCCAAGC Reverse primer for cloning MGG_05232 for yeast secretion assay YS08370-F ACGAATTCATGAGTTTCATTAAACTCGC Forward primer for cloning FL- MGG_08370 for yeast secretion assay YS08370-NS-F ACGAATTCATGACCGAGCCCGTCACGG Forward primer for cloning NS- MGG_08370 for yeast secretion assay YS08370-R TAGCGGCCGCAAATCAAAACAGCCGCA Reverse primer for cloning MGG_08370 for yeast secretion assay 05232-NativeP-F GTCATCCCGTTGCCTTTTTA Forward primer for cloning native promoter of MGG_05232 for GFP fusion construct 05232Rfus CAATGTATTGC CAAGCCGAA Reverse primer for cloning native promoter of MGG_05232 for GFP fusion construct 08370-NativeP-F GCTGCCAAGATTCTTTCGTC Forward primer for cloning native promoter of MGG_08370 for GFP fusion construct 08370Rfus CCATCAAAACAGCCGCAGCA Reverse primer for cloning native promoter of MGG_08370for GFP fusion construct 08409-NativeP-F ATAATTCTGCCCTGTAACAC Forward primer for cloning native promoter of MGG_8409 for GFP fusion construct 08409Rfus CCAAGCACTGGCTGTAGTAC Reverse primer for cloning native promoter of MGG_08409 for GFP fusion construct 05232LB-F GTCATCCCGTTGCCTTTTTA Forward primer for amplification left- border of MGG_05232 for gene deletion 05232Lad-R GTCAGCGGCCGCATCCCTGCGGTTACTTTGGCGGTGTGAT Reverse primer for amplification left- border of MGG_05232 for gene deletion Continued

214

Table C.1. continued

Primers Sequence 5’3’ Comments 05232Rad-F CACGGCGCGCCTAGCAGCGGTGTGTGGTTGTGGGACCTAA Forward primer for amplification right-border of MGG_05232 for gene deletion 05232RB-R GTCGTGTGCGACACCATCT Reverse primer for amplification right-border of MGG_05232 for gene deletion YGAS GCAGGGATGCGGCCGCTGACGGTCGGCATCTACTCTATTCCTTTG Forward primer for amplification of the ½ Hygromycin resistance gene from C-terminus YG2 TGCAAGACCTGCCTGAAACC Reverse primer for amplification of the ½ Hygromycin resistance gene from C-terminus HYS3 CCGCTGCTAGGCGCGCCGTGGCTGGAGCTAGTGGAGGTCAAC Forward primer for amplification of the ½ Hygromycin resistance gene from N-terminus Hy3 ATGCCTCCGCTCGAAGTAGC Reverse primer for amplification of the ½ Hygromycin resistance gene from N-terminus Mo28S-F GAGAGGAACCGCTCATTCAGATAATTA Forward primer to amplify 28S rRNA of M. oryzae Mo28S-R TCAGCAGATCGTAACGATAAAGCTACTC Reverse primer to amplify 28S rRNA of M. oryzae PBZ1-F ACGCCGCAAGTCATGTCCTAAAGTCG Forward primer for RT-PCR of rice PBZ1 gene PBZ1-R AGAAAGGCACATAAACACAACCACAAAC Reverse primer for RT-PCR of rice PBZ1 gene UBQ-F AAGAAGCTGAAGCATCCAGC Forward primer for RT-PCR of rice ubiquitin gene UBQ-R CCAGGACAAGATGATCTGCC Reverse primer for RT-PCR of rice ubiquitin gene NbACT-F ATGGCAGACGGTGAGGATATTCA Forward primer for RT-PCR of actin gene of N. benthamiana NbACT-R GCCTTTGCAATCCACATCTGTTG Reverse primer for RT-PCR of actin gene of N. benthamiana MoBeta-tublin- TCGACAGCAATGGGATTTACAA Forward primer for RT-PCR of M. F oryzae B-tubulin gene MoBeta-tublin- AGCACCAGACTGACCGAAGAC Reverse primer for RT-PCR of M. R oryzae B-tubulin gene SP6F ACGACCCGTCTTTACTTATTTGG Forward primer for amplification of the repetitive element Pot2 for quantitative PCR to determine fungal biomass SP6R AAGTACGCTTGGTTTTGTTGGAT Reverse primer for amplification of the repetitive element Pot2 for quantitative PCR to determine fungal biomass Continued

215

Table C.1. continued

Primers Sequence 5’3’ Comments OSUBQ-GQF TTCTGGTCCTTCCACTTTCAG Forward primer for amplification of the rice ubiquitin gene for quantitative PCR to OSUBQ-GQR ACGATTGATTTAACCAGTCCATGA Reverse primer for amplification of the rice ubiquitin gene for quantitative PCR to

216