Insights Into the Streptomycete Conjugation Mechanism and Interstrain Inhibitor Production by the Sweet Potato Pathogen Streptom

Louisiana State University LSU Digital Commons

LSU Doctoral Dissertations Graduate School

2009 Insights into the Streptomycete conjugation mechanism and interstrain inhibitor production by the sweet potato pathogen Streptomyces ipomoeae Jing Wang Louisiana State University and Agricultural and Mechanical College, [email protected]

Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations

Recommended Citation Wang, Jing, "Insights into the Streptomycete conjugation mechanism and interstrain inhibitor production by the sweet potato pathogen Streptomyces ipomoeae" (2009). LSU Doctoral Dissertations. 2597. https://digitalcommons.lsu.edu/gradschool_dissertations/2597

This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. INSIGHTS INTO THE STREPTOMYCETE CONJUGATION MECHANISM AND INTERSTRAIN INHIBITOR PRODUCTION BY THE SWEET POTATO PATHOGEN STREPTOMYCES IPOMOEAE

A Dissertation

Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy

The Department of Biological Sciences

by Jing Wang B.S., Wuhan University, 1999 May 2009 I dedicate my dissertation work to three people who are most important in my life.

To my loving parents, Mr. Chidan Xia and Mrs. Yanqin Wang, who have been proud of me, and who have been giving their endless encouragement and patience to me.

To my wife Xue Bai, who always loves and supports me unconditionally, who shared with me many challenges and sacrifices.

ii ACKNOWLEDGEMENTS

This is a great opportunity to express my gratefulness to all those who gave me the possibility to complete this dissertation.

I would like to sincerely thank my advisor and mentor, Dr. Gregg Pettis, for guidance with his expertise, precious time and patience throughout the entire process.

I would like to thank my advisory committee members, Drs. John Battista, Tin-wein Yu,

Christopher Clark, and Ronald Thune, and former committee member Dr. Ding Shih, for agreeing to serve on my committee, for their valuable advice and accessibility, as well as Dr.

Eric Achberger for generous assistance.

I would also like to thank all of the members of the Pettis lab for their friendship and collaboration throughout my doctorate program, especially Matthew Ducote who constructed several plasmids used in these studies discussed in Charter Two, Kevin Schully who developed the antiserum against ipomicin protein and designed the ipoA primers detailed in

Charter Three and Four, and Dongli Guan for helpful discussions.

Additionally, I am grateful for the friendship of many peer graduate students in

Department of Biological Sciences over the years, especially Binbin Ren, Fang He, Dahui

You, and Steve Pollock. They were always by my side and made the completion of the dissertation work an enjoyable process.

Finally, I would like to thank my wife Xue Bai, for preparation of most figures in this dissertation.

iii TABLE OF CONTENTS

DEDICATION………………………………………………………………………….……...ii

ACKNOWLEDGEMENTS…………………………………………………………………..iii

LIST OF TABLES……………………………………………………………………………..v

LIST OF FIGURES…………………………………………………………………………...vi

ABSTRACT……………………………………………………………………...... viii

CHAPER ONE: INTRODUCTION…………………………………………………………...1

CHAPTER TWO: THE TRANSFER GENE OF A CIRCULAR STREPTOMYCES PLASMID SHOWS SPECIFICITY FOR THE CIRCULAR CONFIGURATION……...…..20

CHAPTER THREE: GROWTH-REGULATED EXPRESSION OF A BACTERIOCIN, PRODUCED BY THE SWEET POTATO PATHOGEN STREPTOMYCES IPOMOEAE, THAT EXHIBITS INTERSTRAIN INHIBITION…………………………………………...59

CHAPTER FOUR: PRELIMINARY ANALYSIS OF PRODUCTION OF IPOMICIN IN STREPTOMYCES IPOMOEAE SUSCEPTIBLE STRAINS AND EXPRESSION CHARACTERISTICS OF THE GROUP II INHIBITOR…………………..81

CHAPTER FIVE: SUMMARY AND FUTURE DIRECTIONS…………………………...101

APPENDIX A: SUPPLEMENTARY DATA………………………………………………..112

APPENDIX B: LETTER OF PERMISSION……………………………………………….119

VITA………………………………………………………………………………………...125

iv LIST OF TABLES

2.1 Bacterial strains and plasmids used in this study……………………………………….24

2.2 The mutagenic primers used in this study………………………………………………33

2.3 Transfer frequencies of 54-bp minimal clt alleles mutated in the IR region…………....37

2.4 Transfer frequencies of linker scanner mutants in the IR region of pIJ101 clt locus…………………………………………………………………………………40

2.5 Transfer frequencies of linear versus circular pQC179 and pSCON223 from S. lividans strains………………………………………………………………………..41

2.6 Transfer Frequencyies of linear pSCON335 and pSCON346 from TtrA defective strains…………………………………………………………………………………...47

2.7 Transfer frequencies of clt mutants in circular versus linear plasmids…………………48

2.8 Transfer Frequencies of linear pSCON223 and pSCON346 from pIJ101 Tra+ versus Tra- strains……………………………………………………………………….49

4.1 Inhibition groups of strains of S. ipomoeae…………………………………………….85

A.1 Transfer of plasmids harboring chromosome telomere from S. lividan TK23.42 to TK23………………………………………………………………………………..113

A.2 Transfer of linear pSCON346 from S. lividans 98-50 to TK23 containing pHYG1 versus pOS948………………………………………………………………..114

v LIST OF FIGURES

1.1 The model for circular conjugative plasmid transfer in Streptomyces…………….……..7

2.1 pIJ101 clt sequence map……………………………………………….……………….22

2.2 Physical maps of pSCON223 in circular and linear forms, and pSCON346 in linear form………………………………………………………….………………...31

2.3 Agarose gel electrophoresis analysis of total DNA in donors and transconjugants…………………………………………………………………….……42

2.4 Configuration (i.e., linear, circular, or recombination with SLP2) of pQC179 versus pSCON223 in JW1 transconjugants………………………………………………...….45

2.5 Evidence of linear pSCON346 transfer from sttrain 98-50…………………………….50

3.1 Growth-regulated appearance of ipomicin during culturing of S. ipomoeae strain 91-03 as determined by plate bioassay and Western blotting……………………68

3.2 Northern blot of the ipoA message in S. ipomoeae 91-03…………………….………...71

3.3 Temporal appearance of ipomicin protein as produced by S. coelicolor strains M600 and M600∆bldA containing the cloned ipoA gene……………….………73

3.4 Western blot of ipomicin protein and concomitant Northern blot of ipoA message for S. coelicolor M600∆bldA containing plasmid pSIP40 versus pSIP42…..………….75

3.5 Ipomicin stability assay…………………………………………………………….…...77

4.1 Representatives of all three inhibition groups of S. ipomoeae express the ipoA gene….83

4.2 Western blots of ipomicin protein………………………………………………………87

4.3 Detection of the ipoA gene in S. ipomoeae strains 91-01, 92-03 and B12321 by PCR amplification………………………………………………………………………90

4.4 Nucleotide sequence alignment of the ipoA gene in S. ipomoeae strains 91-03, 91-01, 92-03, and B12321………………………………………………………………91

4.5 Inhibition phenotypes of 92-03 determined by plate bioassays………………………...94

4.6 Temporal release of active form of S. ipomoeae group II inhibitor determined by plate bioassay…………………………………………………………………………...96

4.7 Growth-regulated appearance of active group II inhibitor during culturing of S. ipomoeae strain 88-35 as determined by plate bioassay……………………..………....98

5.1 Model for pIJ101-mediated conjugation of the linear Streptomyces chromosome……106

A.1 Growth-regulated appearance of ipomicin during culturing of S. ipomoeae strain 88-29 as determined by plate bioassay and Western blotting……………………..….115 vi A.2 Temporal appearance of ipomicin protein as produced by S. coelicolor strains M600 and M600∆bldA containing pSIP40 versus pSIP42………………………...…116

A.3 TCA-precipitated S. ipomoeae group II inhibitor still retains inhibitory activity…….117

vii ABSTRACT

Conjugation in Streptomyces invokes a unique mechanism involving few plasmid-encoded loci. Transfer of circular plasmid pIJ101 requires only a tra gene, and a cis-acting locus clt. Here, I investigated whether the transfer genes of pIJ101 could promote transfer of a linear plasmid. While pIJ101 Tra could transfer circularized versions of the linear plasmid containing clt, the linear plasmid itself could not be transferred efficiently by Tra. All plasmids isolated from transconjugants appeared to be circular regardless of the configuration of the plasmid in the initial donor cells. However the linear plasmid could be transferred in linear form from JW1, which contains the conjugative linear plasmid SLP2. Evidence that linear plasmids transferred from strains containing only SLP2 strongly suggest that TraSLP2 mediated the transfer of heterologous linear plasmid and pIJ101, and Tra is not responsible for transfer of the linear DNA molecules from JW1.These results indicate that Tra of pIJ101 shows specificity for the circular configuration and imply that efficient transfer of linear plasmids may require additional functions compared with circular plasmids. Certain strains of the bacterial sweet potato pathogen Streptomyces ipomoeae produce the bacteriocin ipomicin, which inhibits other sensitive strains of the same species. Here, I show that group III inhibitor ipomicin stably accumulates in culture supernatants of S. ipomoeae in a growth-regulated manner that does not coincide with the pattern of expression of the ipomicin structural gene ipoA. Similar growth-regulated production of ipomicin in Streptomyces coelicolor containing the cloned ipoA gene was found to be directly dependent on translation of the TTA codon in ipoA by the bldA leucyl tRNA. These results suggest that bldA-dependent translation of the S. ipomoeae ipoA gene leads to growth-regulated production of the ipomicin precursor, which upon processing to the mature form and secretion, stably accumulates in the extracellular

viii environment. An apparently inactive form of ipomicin protein is produced in most members of susceptible strains of S. ipomoeae, suggesting that further post-translational modification of ipomicin protein in the group III strains results in bacteriolytic activity.

CHAPTER ONE: INTRODUCTION

1 Streptomyces, the largest genus of Actinobacteria, is comprised of about 500 species of gram-positive spore-forming prokaryotic bacteria predominately inhabitant of soil and decaying vegetation. They are most famous for their production of thousands of biologically active secondary metabolites including about 80% of the natural antibiotics that are medically, agriculturally and industrially important. Streptomyces species have many unique features that make them quite distinctive among eubacteria.

COMPLEX LIFE CYCLE OF STREPTOMYCES

Streptomyces species display a complex life cycle comprised of three distinct stages: substrate mycelium, aerial mycelium, and spores. When nutrition is plentiful in the soil, they grow as a tangled mass of multigenomic vegetative substrate mycelia. Whereas when nutrition becomes scarce, substrate mycelia die and are scavenged by aerial hyphae which are directed vertically and grow by extension at tips. Such morphological differentiation triggers the onset of secondary metabolites, which is known as physiological differentiation.

Eventually extension ceases, and individual hyphae coil and form septa at regular intervals.

Each resulting compartment contains a single copy of the genome and eventually differentiates into a unigenomic spore (Chater 1993, Chater 1998).

Under laboratory conditions, Streptomyces spp. undergo both morphological and physiological differentiation on solid media. However, these bacteria don’t typically differentiate morphologically in liquid cultures. Instead, they grow as mycelial clumps and display a multiphase growth curve similar to that of unicellular bacteria. As the culture enters stationary phase in liquid culture, Streptomyces mycelia readily undergo secondary metabolism (Champness and Chater 1994).

2 THE STREPTOMYCES LINEAR CHROMOSOMES AND LINEAR PLASMIDS

Unlike most other bacterial genera, Streptomyces possess linear chromosomes. While initially discovered in Streptomyces lividans ZX7 (Lin et al. 1993), the linearity of chromosomes has been found to be ubiquitous in streptomycetes (Lezhava et al. 1995,

Leblond et al. 1996, Pandza et al. 1997). The chromosomes are about 8 mb in length with terminal inverted repeats (TIRs), and terminal proteins (TPs) covalently linked to the 5' ends

(Lin et al. 1993). Replication of the linear chromosomes is initiated from an internal origin and proceeds bidirectionally toward their telomeres (Musialowski et al. 1994). The

Streptomyces chromosomal DNA can also replicate in a circular mode spontaneously as a result of large deletions and rearrangements in the highly unstable terminal sequences of the molecule (Lin and Chen 1997, Chen et al. 2002, Catakli et al. 2003). Even in its linear form, an intact chromosome could show a circular-like configuration by the interaction of the two telomeres via covalently bound TPs (Wang et al. 1999, Yang and Losick 2001).

Linear plasmids which range in size from 10 kb to 1 mb, are also present in Streptomyces spp. (Hirochika and Sakaguchi 1982, Sakaguchi 1990, Chen et al. 1993, Kinashi et al. 1994).

The Streptomyces linear plasmids have many features in common with linear chromosomes, such as TIRs (Huang et al. 1998, Qin and Cohen 1998, Goshi et al. 2002) and 5’-capped TPs

(Bao and Cohen 2001, Yang et al. 2002). Also the telomeres of certain linear plasmids show high similarity to those of chromosomes (Huang et al. 1998, Qin and Cohen 1998). For example, the right end of SLP2, a 50-kb linear plasmid found in S. lividans, is identical to the first 15.4 kb of the TIR in the S. lividans chromosome (Bey et al. 2000). Linear plasmids also replicate divergently from centrally located origins of replication (Chang and Cohen 1994,

Chang et al. 1996). Furthermore, the linear replicons can also exist in a circular form when

3 their telomeres are deleted (Shiffman and Cohen 1992, Qin et al. 2003). A recent study showed that in some cases circular plasmids could replicate in a linear mode when the telomeres of a linear replicon were attached (Zhang et al. 2008).

CONJUGATION IN THE STREPTOMYCETES

Besides morphological and physiological differentiation, many Streptomyces species can exchange genetic information by plasmid-mediated conjugation, which is visible by a transfer-related “pock” structure: When plasmid-containing spores are spread onto agar plates containing a lawn of spores lacking the same plasmid, plasmid molecules transfer from the germinated donor cells to recipient cells and retard the growth of recipients, eventually forming circular inhibition zones or “pocks” (Bibb and Hopwood 1981, Kieser et al. 1982).

The Streptomyces conjugative plasmids include covalently closed circular (CCC) plasmids, linear DNA replicons, and those in chromosomally integrated forms (Hopwood and Kieser,

1993).

Bacterial conjugation, which was first elucidated for the Escherichia coli F fertility factor, generally employs a conserved mechanism, that requires about thirty functions to mobilize DNA among most bacteria examined to date, with the exception of Streptomyces related mycelial bacteria. Conjugation typically involves formation of a mating pair between the donor and the recipient cells via the plasmid-encoded pilus (Durrenberger et al. 1991). The

DNA processing event initiates with a site-specific single-stranded cleavage by a plasmid-encoded endonuclease relaxase within oriT, the cis-acting origin of transfer. The cleaved DNA is then unwound by a plasmid-encoded helicase, the nicked single strand is transferred in a 5’ to 3’ direction into the recipient cell through a transport pore (Lanka and

Wilkins 1995). In the donor cell, rolling cycle replication displaces the parental strand by

4 DNA synthesis from the 3’ hydroxyl end of the nicked strand (Furuya and Komano, 2000).

Meanwhile in the recipient cell, double-stranded DNA molecules are formed by DNA synthesis using RNA primers in the new host (Lanka and Wilkins 1995). In addition to mediating self-transmission, the conjugative plasmids are capable of promoting the transfer of chromosomal DNA by integrating into the host chromosomes (Reimmann and Haas 1993).

In contrast, conjugation in Streptomyces spp. involves a novel mechanism which requires only a few plasmid-encoded genetic functions (Hopwood and Kieser 1993). No pili structures have been detected between mating streptomycete cells (Grohmann et al. 2003), and recent evidences suggested that CCC plasmids are transferred as double-stranded intermediate and thus are not nicked during the process of conjugal transfer (Possoz et al. 2001, Ducote and

Pettis 2006).

The most characterized Streptomyces conjugative plasmid is pIJ101, an 8,830-bp CCC high copy plasmid isolated from S. lividans, which has a wide host range among actinomycetes (Kieser et al. 1982, Hopwood and Kieser 1993). Transfer of pIJ101 requires only a single protein, which is encoded by the pIJ101 tra gene (Kendall and Cohen 1987,

Pettis and Cohen 2001a), and which is a 70-kDa membrane associated protein (Pettis and

Cohen 1996). The Tra protein does not resemble any proteins required for conjugation in

E.coli and other gram-negative bacteria. However it has significant similarity to E. coli FtsK and Bacillus subtilis SpoIIIE (Begg et al. 1995, Wu et al. 1995, Pettis and Cohen 2000), which are translocators of double-stranded DNA through intracellular septa (Wu and

Errington 1994, Wu et al. 1995, Liu et al. 1998, Steiner et al. 1999, Errington et al. 2001). Tra can also promote efficient conjugation of linear chromosomal DNA, a phenotype referred to as chromosome mobilizing ability (Cma) (Kieser et al. 1982). The Cma function of Tra is

5 independent of the pIJ101 replicon as even a chromosomally inserted copy of tra gene can mediate efficient transfer of the chromosomal DNA molecule in the absence of the plasmid

(Pettis and Cohen 1994).

Besides Tra, the efficient conjugal transfer of pIJ101 also requires a cis-acting locus of transfer termed clt that resides within a 145-bp region of pIJ101 (Pettis and Cohen 1994).

Deletion of clt eliminates conjugation efficiency up to three orders of magnitude (Ducote et al.

2000). Tra and clt functions can also promote transfer of heterologous plasmids. After cloning clt locus to a transfer defective replicon and inserting tra gene into the chromosome, the replicon could be transferred as efficiently as clt+ pIJ101 derivatives (Pettis and Cohen, 1994).

The cis-acting locus may not be necessary for Tra-mediated Cma. To date, no functional analogs of the pIJ101 clt have been found in the Streptomyces chromosome. clt loci have also been identified on Streptomyces plasmids pJV1 (Servín-Gonzalez 1996) and pSG5

(Grohmann et al. 2003), and these loci resemble pIJ101 clt in fucntion, but not in sequence.

The function of clt appears to be plasmid specific since pJV1 clt can’t substitute for pIJ101 clt during conjugative plasmid transfer mediated by pIJ101 Tra (Ducote 2004). Though the pIJ101 clt was found to be intrinsically curved (Ducote et al. 2000), it is still unknown whether the curvature structure plays a role in clt function. The molecular function of clt is thus still awaiting elucidation. However, it has been demonstrated that no site-specific nicking of either strand appears to occur at the clt region during plasmid transfer (Ducote and Pettis

2006). This result suggested that clt plays a role apparently distinct from the function of cis-acting oriT locus during the process of conjugal transfer of circular plasmids from other bacteria, and together with other evidence suggests a novel conjugation mechanism that

6 involves transfer of streptomycete circular plasmids in a unique double-stranded form (Possoz et al. 2001, Grohmann et al. 2003).

The membrane Tra proteins of Streptomyces plasmids are believed to be located at the hyphal tips (Reuther et al. 2006), and it has been suggested that the donor and recipient hyphae may fuse at the tips in the presence of a Tra protein. A potential model for conjugative circular plasmid transfer, which is similar to DNA pumping mechanism of SpoIIIE (Errington et al. 2001, Sharp and Pogliano 2002), as shown in Fig. 1.1, indicates that Tra proteins forms a ring-shape pore, which interacts noncovalently with the double-stranded plasmid and pumps plasmid molecules into the recipient by using the energy of ATP hydrolysis (Grohmann et al.

2003, Reuther et al. 2006). The clt locus might represent an interaction site with Tra and the cell membrane. However, no specific binding of a linear clt-containing DNA fragment by the

Tra protein was observed (Ducote et al. 2000).

FIG. 1.1. The model for circular conjugative plasmid transfer in Streptomyces as indicated in Grohmann et al. 2003. See text for details.

7 Like circular plasmids, most natural Streptomyces linear plasmids mediate efficient conjugal transfer of themselves and the host chromosome. (Hopwood and Kieser 1993).

However, little is known about the mechanism of conjugative linear plasmid transfer.

Interestingly, some SpoIIIE homologues are also encoded by linear Streptomyces plasmids

(Grohmann et al. 2003). For example, the Tra protein of linear plasmid SLP2, TraSLP2, resembles Tra proteins from circular Streptomyces plasmids as well as SpoIIIE (Huang et al.

2003), and it can promote efficient conjugal transfer of not only linear SLP2 but also its circular derivatives (Xu et al. 2006). Together with the fact that linear chromosomal DNA can be mobilized by the Tra protein of circular plasmid pIJ101 (Pettis and Cohen 1994), this evidence indicates that the Tra function may be also sufficient for the conjugative transfer of linear replicons in Streptomyces. However some other evidence indicated that the conjugal transfer of linear plasmids versus their circular counterparts may involve distinct mechanistic differences. Several conjugation functions other than the Tra DNA translocase have been identified as being required for the efficient SLP2-mediated transfer of itself and the linear chromosome, such as the TtrA protein (a helicase-like protein encoded by a telomere-proximal gene ttrA), cell wall hydrolases, etc. (Huang et al. 2003, Xu et al. 2006).

An “end-first model” suggested that the transfer of linear streptomycete replicons may be initiated at their terminus. In this case, a single strand of the replicon, including the 5’-capped

TP, may be displaced and transferred into the recipient (Chen 1996).

STREPTOMYCETES AS PLANT PATHOGENS

In recent years, an increasing number of Streptomyces species have been identified as plant pathogens, and this group has been drawing more attention of researchers (Loria et al.

2006). A group of polyphyletic pathogenic species, such as Streptomyces acidiscabies,

8 Streptomyces scabies and Streptomyces turgidiscabies, are capable of causing scab diseases on potato (Solanum tuberosum L.) and some other vegetables of economic importance (Loria et al. 1997). Among them, S. scabies is globally distributed, the first known, the most characterized, and probably the original Streptomyces plant pathogen (Loria et al. 1997, Loria et al. 2006). Virulence factors include a family of phytotoxin known as thaxtomins, which are novel 4-nitroindol-3-yl-containing 2,5-dioxopiperazine compounds, as well as an independently functioning necrosis factor, Nec1 (Loria et al. 1997, Kers et al. 2005, Loria et al. 2006). The genes encoding such virulence factors are all contained in a large transmissible pathogenicity island (PAI) in S. turgidiscabies that appears to have been derived originally from S. scabies. Therefore the mobilization of the PAI to previously non-pathogenic species is probably responsible for the emergence of new plant pathogenic Streptomyces species (Kers et al. 2005).

Streptomyces ipomoeae is another Streptomyces plant-pathogenic species which causes soil rot, a widespread and destructive disease of sweet potato, Ipomoea batatas, (L.) Lam

(Clark and Moyer 1988). The disease causes rotting of fibrous roots and necrotic lesions on tubers and reduces the yield and marketability of sweet potatoes (Clark and Matthews 1987).

To date relatively little information is known about S. ipomoeae pathogenicity. Unlike other

Streptomyces plant pathogens such as S. scabies and S. acidiscabies, S. ipomoeae does not naturally infect potato. Also a PAI has not been found in the S. ipomoeae genome (Pettis, unpublished results). It is only known that a thaxtomin-type phytotoxin, thaxtomin C, is produced by S. ipomoeae and appears to be its major virulence factor (King et al. 1994).

However the thaxtomin biosynthetic pathway in S. ipomoeae is different from that in S.

9 scabies (King et al. 1994, King and Lawrence 1995), and Nec1 necrosis factor is absent

(Bukhalid and Loria 1997).

INTERSTRAIN INHIBITION IN S. IPOMOEAE

Control of Streptomyces soil rot relies primarily on development of high-yielding, disease-resistant cultivars. However resistant cultivars have shown some variation which may be due to undetermined environmental and genetic conditions, and/or variation in the pathogenicity of the streptomycete strains (Clark et al. 1998). Thus alternative strategies need to be developed for protection of sweet potatoes against soil rot. Strains for S. ipomoeae can inhibit the growth of one another when they are co-cultivated on agar media, a phenomenon known as interstrain inhibition (Clark et al. 1998). Thirty-six S. ipomoeae strains isolated from a variety of locations were divided into three groups based on interstrain inhibition. S. ipomoeae group I do not produce an inhibitor of group II and III strains. Group II S. ipomoeae strains produce an antagonist of group I and III, while strains of group III produce a diffusible compound inhibitory to group I and II (Clark et al. 1998). Theoretically a combination of group II and III inhibitory substances should be effective against all strains of S. ipomoeae.

Therefore the interstrain interaction phenotype provides the basis for a potentially novel biocontrol scheme for prevention of soil rot, which would be facilitated by isolation and characterization of S. ipomoeae group II and III inhibitors.

The group III inhibitor has been purified and termed ipomicin, which is a 10-kDa bacteriocin-like protein that is secreted into the environment (Zhang et al. 2003). The inhibition function of ipomicin is highly specific for only sensitive S. ipomoeae strains.

Ipomicin is very stable and can retain inhibitory activity when stored either at 4°C for up to one month or at −20°C for over a year (Zhang et al. 2003). The features of ipomicin such as

10 high specificity and stability make it ideal as a potentially efficient biocontrol agent against S. ipomoeae infections, if combined together with group II inhibitor. However there is still very little known about the group II inhibitory substance.

STREPTOMYCES GLOBAL TEMPORAL REGULATOR, bldA

The complex life cycle of streptomycetes allows for the isolation and characterization of mutants that define growth-phase regulators, such as bld (bald) mutants, which are a class of mutants deficient in morphological and physiological differentiation (Chater 1993). Since the

Streptomyces genome is very GC rich (approximately 73%), the codons devoid of G or C residues are very rare. Codons with an A or T at the third position are extremely rare in

Streptomyces open reading frames (Wright and Bibb 1992). bldA was the first bld mutant discovered (Hopwood 1967). bldA mutations were found to be localized to the gene that encodes the tRNA recognizing the UUA codon, which is one of the rarest in Streptomyces genomes (Wright and Bibb 1992, Li et al. 2007). bldA makes an effective growth-phase regulator for genes that have a TTA codon because it is not processed to a mature tRNA initially until late during growth, and shows a temporal pattern of accumulation, at least under certain physiological conditions (Leskiw et al. 1993, Trepanier et al. 1997). To date all

TTA-containing genes in the model organism Streptomyces coelicolor have been characterized and compared with TTA-containing genes presented in other sequenced

Streptomyces genomes (Hesketh et al. 2007, Li et al. 2007, Chandra and Chater 2008). TTA codons were selectively excluded from genes that encode essential functions so that bldA mutations have little effect on vegetative growth. However, TTA codons are often involved in gene clusters for secondary metabolism, typically present in regulatory genes for antibiotics biosynthesis (Leskiw et al. 1991, Li et al. 2007). Most TTA-containing genes are found to be

11 species-specific (Chandra and Chater 2008). However, some TTA-containing genes show only partial or no apparent dependence on bldA regulation, for example, the regulatory gene ccaR in Streptomyces clavuligerus and S. coelicolor (Trepanier et al. 2002). This phenomenon may due to mistranslation of TTA codonsby other tRNA species (Trepanier et al. 2002).

Interestingly, a single TTA codon is present in the S. ipomoeae ipomicin structural gene, ipoA, and is thus a potential target for bldA regulation (Zhang et al. 2003).

This dissertation will report the results of my studies of two aspects of Streptomyces research: conjugation mechanisms involving linear versus circular plasmids, and characterization of expression of S. ipomoeae interstrain inhibitors. In Chapter Two, I will further characterize the pIJ101 clt locus by identifying the most critical base determinants of clt through PCR-based mutagenesis. I will also compare the transfer frequencies of clt-containing circular and linear plamids promoted by pIJ101 Tra in various S. lividans strains. My data suggest that the Tra protein of circular plasmid pIJ101 shows specificity for circularly configured plasmids. In Chapter Three, I will elucidate the expression characteristics of the S. ipomoeae group III inhibitor ipomicin, and give evidence that temporal production of ipomicin is regulated by bldA-dependent translation of the rare TTA codon in the S. ipomoeae ipoA gene and that ipomicin stably accumulates in the extracellular environment. Previous studies have shown that ipoA gene is not only present but also transcribed in certain susceptible S. ipomoeae group I and II strains (Schully 2005). As reported in Chapter Four, I found that an apparently inactive form of ipomicin protein is produced in most members of susceptible strains. Mutations have been identified in ipoA gene of the few strains that don’t produce ipomicin. In Chapter Four, I will also describe the expression characteristics of of the S. ipomoeae group II inhibitor.

12 REFERENCES Bao, K., and S. N. Cohen. 2001. Terminal proteins essential for the replication of linear plasmids and chromosomes in Streptomyces. Genes. Dev. 15: 1518-1527.

Begg, K. J., S. J. Dewar, and W. D. Donachie. 1995. A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177: 6211-6222.

Bey, S. -J, M. -F. Tsou, C. -C Huang, C. -C Yang, and C. W. Chen. 2000. The homologous terminal sequence of the Streptomyces lividans chromosome and SLP2 plasmid. Microbiol. 146: 911-922.

Bibb, M. J., and D. A. Hopwood. 1981. Genetic studies of the fertility plasmid SCP2 and its SCP2* variants in Streptomyces coelicolor A3(2). J. Gen. Microbiol. 126: 427-442.

Bukhalid, R. A., and R. Loria. 1997. Cloning and expression of a gene from Streptomyces scabies encoding a putative pathogenicity factor. J. Bacteriol. 179:7766-7783.

Catakli, S., A. Andrieux, P. Leblond, B. Decaris, and A. Dary. 2003 Spontaneous chromosome circularization and amplification of a new amplifiable unit of DNA belonging to the terminal inverted repeats in Streptomyces ambofaciens ATCC 23877. Arch. Microbiol. 179: 387-393.

Champness, W. C., and K. F. Chater. 1994. Regulation and intergration of antibiotic production and morphological differentiation in Streptomyces spp., p. 61-93. In P. Piggot, J. C. P. Morgan, and P. Youngman (ed.), Regulation of bacterial differentiation. American Society for Microbiology, Washington, D.C.

Chandra, G., and K. F. Chater. 2008. Evolutionary flux of potentially bldA-dependent Streptomyces genes containing the rare leucine codon TTA. Antonie van Leeuwenhoek. 94: 111-126.

Chang, P. -C., and S. N. Cohen. 1994. Bidirectional replication from an internal origin in a linear Streptomyces plasmid. Science 265: 952-954.

Chang, P. -C., E. -S. Kim, and S. N. Cohen. 1996. Streptomyces linear plasmids that contain a phage-like, centrally located, replication origin. Mol. Microbiol. 22: 789-800.

Chater, K. F. 1993. Genetics of differentiation in Streptomyces. Annu. Rev. Microbiol. 47: 685-713.

Chater, K. F. 1998. Taking a genetic scalpel to the Streptomyces colony. Microbiol. 144: 1465-1478.

Chen, C. W. 1996. Complications and implecations of linear bacterial chromosomes. Trends. Genet. 12: 192-196.

13 Chen, C. W., C. -H. Huang, H. -H. Lee, H. -H. Tsai, and R. Kirby. 2002. Once the circle has been broken: dynamics and evolution of Streptomyces chromosomes. Trends Genet. 18: 522-529.

Chen, C. W., T. -W. Yu, Y. -S. Lin, H. M. Kieser, and D. A. Hopwood. 1993. The conjugative plasmid SLP2 of Streptomyces lividans is a 50kb linear molecule. Mol. Microbiol. 7: 925-932.

Clark, C. A., and S. W. Matthews. 1987. Histopathology of sweet potato root infection by Streptomyces ipomoeae. Phytopathology 77: 1418-1423.

Clark, C. A., and J. W. Moyer. 1988. Compendium of sweet potato diseases. The American Phytopathological Society. St. Paul, Minn.

Clark, C. A., C. Chen, N. Ward-Rainey, and G. S. Pettis. 1998. Diversity within Streptomyces ipomoeae based on inhibitory interactions, rep-PCR, and plasmid profiles. Phytopathology 88: 1179-1186.

Ducote, M. J. 2004. Transfer function of Streptomyces plasmid pIJ101: insights into a novel bacterial conjugation system. Ph.D. dissertation, Louisiana State University, Baton Rouge, LA.

Ducote, M. J., and G. S. Pettis. 2006. An in vivo assay for conjugation-mediated recombination yields novel results for Streptomyces plasmid pIJ101. Plasmid 55: 242-248.

Ducote, M. J., S. Prakash, and G. S.Pettis. 2000. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of Streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region. J. Bacteriol. 182: 6834-6841.

Durrenberger, M. B., W. Villiger, and T. Bachi. 1991. Conjugational junctions: morphology and specific contacts in conjugating Escherichia coli bacteria. J. Struct. Biol. 107: 146-156.

Errington, J., J. Bath, and L. J. Wu. 2001. DNA transport in bacteria. Nat. Rev. Mol. Cell. Biol. 2: 538-544.

Furuya, N., and T. Komano. 2000. Initiation and termination of DNA transfer during conjugation of IncI1 plasmid R64: roles of two sets of inverted repeat sequences within oriT in termination of R64 transfer. J. Bacteriol. 182: 3191-3196.

Goshi, K., T. Uchida, A. Lezhava, M. Yamasaki, K. Hiratsu, H. Shinkawa, and H. Kinashi. 2002. Cloning and analysis of the telomere and terminal inverted repeat of the linear chromosome of Streptomyces griseus. J. Bacteriol. 184: 3411-3415.

Grohmann, E., G.. Muth, and M. Espinosa. 2003. Conjugative plasmid transfer in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67: 277-301.

14 Hesketh, A., G. Bucca, E. Laing, F. Flett, G. Hotchkiss, C. P. Smith, and K. F. Chater. 2007. New pleiotropic effects of eliminating a rare tRNA from Streptomyces coelicolor, revealed by combined proteomic and transcriptomic analysis of liquid cultures. BMC Genomics 8: 261.

Hirochika, H., and K. Sakaguchi. 1982. Analysis of linear plasmids isolated from Streptomyces rochei with an inverted terminal repetition of 614 base pairs. EMBO J. 3: 761-766.

Hopwood, D. A. 1967. Genetic analysis and genome structure in Streptomyces coelicolor. Bacteriol. Rev. 31: 373-403.

Hopwood, D. A., and T. Kieser. 1993. Conjugative plasmids of Streptomyces. In Bacterial conjugation, Clewell, D.B. (ed.). New York: Plenum Press, pp. 293-311.

Huang, C. -H., C. -Y. Chen, H. -H. T, C. Chen, Y. -S. Lin, and C. W. Chen. 2003. Linear plasmid SLP2 of Streptomyces lividans is a composite replicon. Mol. Microbiol. 47: 1563-1576.

Huang, C. -H., Y. -S. Lin, Y. -L. Yang, S. –W. Huang, and C. W. Chen. 1998. The telomeres of Streptomyces chromosomes contain conserved palindromic sequences with potential to form complex secondary structures. Mol. Microbiol. 28: 905-916.

Kendall, K. J., and S. N. Cohen. 1987. Plasmid transfer in Streptomyces lividans: identification of a kil-kor system associated with the transfer region of pIJ101. J. Bacteriol. 169: 4177-4183.

Kers, J. A., K. D. Cameron, M. V. Joshi, R. A. Bukhalid, J. E. Morello, M. J. Wach, D. M. Gibson, and R. Loria. 2005. A large, mobile pathogenicity island confers plant pathogenicity on Streptomyces species. Mol. Microbiol. 55:1025–1033.

Kieser, T., D. A. Hopwood, H. M. Wright, and C. J. Thompson. 1982. pIJ101, a multi-copy broad host-range Streptomyces plasmid: functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185: 223-238.

Kinashi, H., E. Mori, A. Hatani, and O. Nimi. 1994. Isolation and characterization of linear plasmids from lankacidin-producing Streptomyces species. J. Antibiot. 47: 1447-1455.

King, R. R., and C. H. Lawrence. 1995. Characterization of 4-nitrotryptophans associated with the in vitro production of thaxtomin A by Streptomyces scabies. Phytochemistry 40: 41-43.

King, R. R., C. H. Lawrence, L. A. Calhoun, and J. B. Ristaino. 1994. Isolation and characterization of thaxtomin-type phytotoxins associated with Streptomyces ipomoeae. J. Agric. Food Chem. 42:1791-1794.

15 Leblond, P., G. Fischer, F. Francou, F. Berger, M. Guerineau, and B. Decaris. 1996. The unstable region of Streptomyces ambofaciens includes 210kb terminal inverted repeats flanking the extremities of the linear chromosomal DNA. Mol. Microbiol. 19: 261-271.

Lanka, E., and B. M. Wilkins. 1995. DNA processing reactions in bacterial conjugation. Annu. Rev. Biochem. 64: 141-169.

Leskiw, B. K., E. J. Lawlor, J. M. Fernandez-Abalos, and K. F. Chater. 1991. TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants. Proc. Natl. Acad. Sci. USA 88: 2461-2465.

Leskiw, B. K., R. Mah, E. J. Lawlor, and K. F. Chater. 1993. Accumulation of bldA-specified tRNA is temporally regulated in Streptomyces coelicolor A3(2). J. Bacteriol. 175:1995-2005.

Lezhava, A. L., T. Mizukami, T. Kajitani, D. Kameoka, M. Redenbach, H. Shinkawa, O. Nimi, and H. Kinashi. 1995. Physical map of the linear chromosome of Streptomyces griseus. J. Bacteriol. 177: 6492-6498.

Li, W., J. Wu, W. Tao, C. Zhao, Y. Wang, X. He, G. Chandra, X. Zhou, Z. Deng, K. F. Chater, and M. Tao. 2007. A genetic and bioinformatic analysis of Streptomyces coelicolor genes containing TTA codons, possible targets for regulation by a developmentally significant tRNA. FEMS Microbiol. Lett. 266:20-28.

Lin, Y. -S., and C. W. Chen. 1997. Instability of artificially circularized chromosome of Streptomyces lividans. Mol. Microbiol. 26: 709-719.

Lin, Y. -S., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The chromosomal DNA of Streptomyces lividans 66 is linear. Mol. Microbiol. 10: 923-933.

Liu, G., G. C. Fraper, and W. D. Donachie. 1998. FtsK is a bifunctional protein involved in cell division and chromosome localization in Escherichia coli. Mol. Microbiol. 29: 893-903.

Loria, R., R. A. Bukhalid, B. A. Fry, and R. R. King. 1997. Plant pathogenicity in the genus Streptomyces. Plant. Dis. 81:836-846.

Loria, R., J. A. Kers, and M. V. Joshi. 2006. Evolution of Plant Pathogenicity in Streptomyces. Annu. Rev. Phytopathology 44: 469-487.

Musialowski, M. S., F. Flett, G. B. Scott, G. Hobbs, C. P. Smith, and S. G. Oliver. 1994. Functional evidence that the principal DNA replication origin of the Streptomyces coelicolor chromosome is close to the dnaA-gyrB region. J. Bacteriol. 176: 5123-5125.

Pandza, K., G. Pfalzer, J. Cullum, and D. Hranueli. 1997. Physical mapping shows that the unstable oxytetracycline gene cluster of streptomyces rimosus lies close to one end of the linear chromosome. Microbiol. 143: 1493-1501.

16 Pettis, G. S., and S. N. Cohen. 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13: 955-964.

Pettis, G. S., and S. N. Cohen. 1996. Plasmid transfer and expression of the transfer (tra) gene product of plasmid pIJ101 are temporally regulated during the Streptomyces lividans life cycle. Mol. Microbiol. 19: 1127-1135.

Pettis, G. S., and S. N. Cohen. 2000. Mutational analysis of the tra locus of the broad-host-range Streptomyces plasmid pIJ101. J. Bacteriol. 182: 4500-4504.

Pettis, G. S., and S. N. Cohen. 2001. Unraveling the essential role in conjugation of the Tra protein of Streptomyces lividans plasmid pIJ101. Antonie van Leeuwenhoek 79: 247-250.

Possoz, C., C. Ribard, J. Gagnat, J. -L. Pernodet, and M. Guerineau. 2001. The intergrative element pSAM2 from Streptomyces: kinetics and mode of conjugal transfer. Mol. Microbiol. 42: 159-166.

Qin, Z., and S. N. Cohen. 1998. Replication at the telomeres of the Streptomyces linear plasmid pSLA2. Mol. Microbiol. 28: 893-903.

Qin, Z., M. Shen, and S. N. Cohen. 2003. Identification and characterization of a pSLA2 plasmid locus required for linear DNA replication and circular plasmid stable inheritance in Streptomyces lividans. J. Bacteriol. 185: 6575-6582.

Reimmann, C., and D. Haas. 1993. Mobilization of chromosome and nonconjugative plasmids by cointegrative mechanisms. In Bacterial conjugation (Clewell, D. B., ed.), pp. 137-188. Plenum Press, New York, N.Y.

Reuther, J., C. Gekeler, Y. Tiffert, W. Wohlleben, and G. Muth. 2006. Unique conjugation mechanism in mycelial streptomyces: a DNA-binding ATPase translocates unprocessed plasmid DNA at the hyphal tip. Mol. Microbiol. 61: 436-446.

Sakaguchi, K. 1990. Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses. Microbiol. Rev. 54: 66-74.

Schully, K. L. 2005. Regulatory intricacies that confer temporal control of conjugation and antibiotic production functions in Streptomyces: new variations on old themes. Ph.D. dissertation, Louisiana State University, Baton Rouge, LA.

17 Servin-Gonzalez, L. 1996. Identification and properties of a novel clt locus in the Streptomyces phaeochromogenes plasmid pJV1. J. Bacteriol. 178: 4323-4326.

Sharp, M. D., and K. Pogliano. 2002. Role of cell-specific SpoIIIE assembly in polarity of DNA transfer. Science 195: 137-139.

Shiffman, D., and S. N. Cohen. 1992. Reconstruction of a Streptomyces linear plasmid replicon from separately cloned DNA fragment: existence of a cryptic origin of circular replication within the linear plasmid. Proc. Natl. Acad. Sci. USA 89: 6129-6133.

Steiner, W., G. Liu, W. D. Donachie, and P. Kuempel. 1999. The cytoplasmic domain of FtsK protein is required for resolution of chromosome dimmers. Mol. Microbiol. 31: 579-583.

Trepanier, N. K., S. E. Jensen, D. C. Alexander, and B. K. Leskiw. 2002. The positive activator of cephamycin C and clavulanic acid production in Streptomyces clavuligerus is mistranslated in a bldA mutant. Microbiol. 148:643-656.

Trepanier, N. K., G. D. Nguyen, P. J. Leedell, and B. K. Leskiw. 1997. Use of polymerase chain reaction to identify a leucyl tRNA in Streptomyces coelicolor. Gene 193:59-63.

Wang, S. -J., H. -M. Chang, Y. -S. Lin, C. -H. Huang, and C. -W. Chen. 1999. Streptomyces genomes: circular genetic maps from the linear chromosomes. Microbiol. 145: 2209-2220.

Wright, F., and M. J. Bibb. 1992. Codon usage in the G+C-rich Streptomyces genome. Gene 113: 55-65.

Wu, L. J., and J. Errington. 1994. Bacillus subtilis SpoIIIE protein required for DNA segregation during asymmetric cell division. Science 264: 572-575.

Wu, L. J., P. J. Lewis, R. Allmannsberger, P. M. Hauser, and J. Errington. 1995. A conjugation-like mechanism for prespore cchromosome-partioning during sporulation in Bacillus subtilis. Genet. Dev. 9: 1316-1326.

Xu, M. -X., Y. -M. Zhu, M. -J. Shen, W. -H. Jiang, G. -P. Zhao, and Z. -J. Qin. 2006. Characterization of the essential gene components for conjugal transfer of Streptomyces lividans linear plasmid SLP2*. Prog. Biochem. Biophys. 33: 986-993.

Yang, C. -C., C. -H. Huang, C. -Y. Li, Y. -G. Tsay, S. -C. Lee, and C. W. Chen. 2002. The terminal proteins of linear Streptomyces chromosomes and plasmids: a novel class of replication priming proteins. Mol. Microbiol. 43: 297-305.

Yang, M. C., and R. Losick. 2001. Cytological evidence for association of the ends of the linear chromosome in Streptomyces coelicolor. J. Bacteriol. 183: 5180-5186.

Zhang, R., A. Zeng, P. Fang, and Z. Qin. 2008. Characterization of replication and conjugation of Streptomyces circular plasmids pFP1 and pFP11 and their ability to propagate in linear mode with artificially attached telomeres. Appl. Environ. Microbiol. 74: 3368-3376.

18 Zhang, X., C. A. Clark, and G. S. Pettis. 2003. Interstrain inhibition in the sweet potato pathogen Streptomyces ipomoeae: purification and characterization of a highly specific bacteriocin and cloning of its structural gene. Appl. Environ. Microbiol. 69: 2201-2208.

CHAPTER TWO: THE TRANSFER GENE OF A CIRCULAR STREPTOMYCES PLASMID SHOWS SPECIFICITY FOR THE CIRCULAR CONFIGURATION

20 INTRODUCTION

The morphologically differentiating gram-positive bacterial genus Streptomyces features a complex life cycle comprised of three consecutive stages. The first stage is the vegetative substrate mycelium, which occurs as tangled masses of multi-genomic hyphae. As nutrients become scarce, growth is directed upward as branching aerial mycelia, which eventually differentiate into spores. Streptomyces species produce thousands of antibiotics, which are valued in medicine, agriculture, and as unique biochemical tools (Charter 1993).

During the vegetative growth stage, Streptomyces mycelia can mobilize genetic information by plasmid-mediated conjugation. Conjugation in Streptomyces invokes a unique mechanism involving few plasmid-encoded loci by an as yet uncharacterized intercellular route (Hopwood and Kieser 1993). For example, the efficient self-transmission of the

8,830-bp circular double-stranded Streptomyces lividans plasmid pIJ101 only requires the pIJ101 tra gene, which encodes a 70-kDa membrane-associated Tra protein (Kendall and

Cohen 1987, Pettis and Cohen 1996), and a cis-acting locus of transfer termed clt, which is mapped to a 145-bp segment of pIJ101 (Pettis and Cohen 1994). The Tra protein shows significant homology to other bacterial proteins (i.e., SpoIIIE and FtsK) that function in intracellular translocation of double-stranded DNA in Bacillus subtilis (Wu et al. 1995) and

Escherichia coli (Begg et al. 1995), respectively. Unlike single-stranded DNA transfer in unicellular bacteria, Streptomyces plasmid transfer proteins appear to mediate conjugal transfer of double-stranded DNA molecules (Pozzoz et al. 2001, Ducote and Pettis 2006). The membrane Tra protein may act as a pump to transport DNA across the cell envelope

(Grohmann et al. 2003).

21 The cis-acting clt locus is also necessary for efficient conjugal transfer of pIJ101. The absence of clt results in a reduction of plasmid transfer approximately 40-fold to 700-fold

(Pettis and Cohen 1994, Pettis and Prakash 1999, Ducote et al. 2000). The role of clt in conjugation is still unclear. It may represent a binding site for Tra (Reuther et al. 2006). The minimal and contributing sequence determinants of the pIJ101 clt were identified as a 54-bp segment which contains three direct repeats (DR) and one imperfect inverted repeat (IR) as shown in Fig. 2.1 (Ducote et al. 2000). A previous deletion analysis revealed that both IR and

DR sequences are essential for clt transfer function. However, deletions of the IR portion reduced transfer significantly more than deletions of the DR portion, which suggested that the

IR is the most important functional region of clt (Ducote et al. 2000). In this chapter, to understand better the role of clt in plasmid transfer, detailed site-specific mutagenesis was done to define specific positions within the IR region that are critical for plasmid transfer.

FIG 2.1. pIJ101 clt Sequence map. The minimal clt locus is 54-bp in size. Small arrows below the sequence indicate the location and direction of one set of imperfect inverted repeats (IR), and three direct repeats (DR).

The members of Streptomyces have linear chromosomes (Lin et al. 1993), as well as linear plasmids (Sakaguchi 1990), most of which are also conjugative (Hopwood and Kieser

1993). Streptomyces linear chromosomes and plasmids both have the telomeres at the ends with terminal inverted repeats sequences, and a terminal protein, which is covalently linked to the 5' ends (Chen et al. 1993, Lin et al. 1993, Bao and Cohen 2001). To date very little is

22 known about the mechanism of conjugal transfer of linear DNA molecules in Streptomyces. A

SpoIIIE/FtsK homologue encoded by linear conjugative plasmid SLP2 functions in mediating conjugal transfer of not only linear SLP2 itself (Huang et al. 2003) but also its artificially circularized derivatives (Xu et al. 2006). On the other hand, the Tra protein of circular plasmid pIJ101 can promote the transfer of linear chromosomal DNA during conjugation, a phenomenon termed Cma for chromosome mobilizing ability (Kieser et al. 1982, Pettis and

Cohen 1994). How does the transfer of the linear chromosome proceed using the transfer system of a circular plasmid? Do they involve a similar transfer process? To address these questions, clt was cloned onto a transfer-defective derivative of linear plasmid pSLA2, pQC179 (Qin et al. 2003), which had been modified so that two chromosomal telomeres were present at the ends, in order to obtain pSCON223 (Fig. 2.2 A and B). The transfer frequencies of circular and linear forms of pQC179 and pSCON223 have been determined and compared.

In this chapter, I show that linear replicons containing clt could not be transferred in linear form by the pIJ101 Tra protein. However, the same linear DNA molecules could be transferred in linear form from strains containing SLP2. My results indicate a difference in the mechanisms of conjugation of circular versus linear DNA may exist in Streptomyces, since the

Tra protein of circular plasmid pIJ101 shows specificity for the circular configuration.

MATERIALS AND METHODS

Bacterial Strains, Plasmids, and General Methods

E. coli and S. lividans strains, and plasmids used in this study are listed in Table 2.1. To create S. lividans JW1, pSCON331, a derivative of integrative vector pSET152 (Bierman et al.

1992) with the pIJ101 korA and tra genes, was introduced into the S. lividans wild-type strain1326 by transformation so that korA and tra would be integrated into the chromosome.

23 TABLE 2.1. Bacterial strains and plasmids used in this study. Source/ Strain/plasmid Relevant genotype or descriptiona references E. coli strains BRL2288 Host for cloning; recA56 derivative of MC1061 [F- GIBCO BRL araD139 ∆(ara-leu)7679 ∆lacX74 galU galK hsdR2 (rk-mk-) mcrB1 rpsL]

S. lividans strains 1326 Wild type, SLP2+, SLP3+ Hopwood et al. 1983 98-10 Derivative of ZX7(SLP2) (Zhou et al. 1988, Chen et al. Huang et al. 1993) containing SLP2 (Chen et al. 1993) with the ttrA 2003; kindly gene on the chromosome disrupted by tsr provided by Chen, C. W. 98-11 Derivative of ZX7(SLP2) (Zhou et al. 1988, Chen et al. Huang et al. 1993) with the ttrA gene on both the chromosome and 2003; kindly SLP2 disrupted by tsr provided by Chen, C. W. 98-50 Derivative of TK64 (Hopwood et al. 1983) containing Huang et al. SLP2 on which the ttrA gene on SLP2 was disrupted by 2003; kindly tsr provided by Chen, C. W. JW1 Derivative of 1326 with the chromosomal copy of pIJ101 This study tra and korA genes JW10 Derivative of 98-10 with the chromosomal copy of pIJ101 This study tra and korA genes JW11 Derivative of 98-11 with the chromosomal copy of pIJ101 This study tra and korA genes JW50 Derivative of 98-50 with the chromosomal copy of pIJ101 This study tra and korA genes TK23 Spc-1 Kieser et al. 2000 TK23.42 Derivative of TK23 with the chromosomal copy of pIJ101 Pettis and tra and korA genes Cohen 1994

Plasmids pGSP149 Derivative of pIJ350 with pSP72 at the PstI site (bla gene Pettis and transcribed in same direction as rep gene of pIJ101) Cohen 1994 pGSP238 pBluescript II SK+ (Stratagene, La Jolla, CA) with the Ducote et al. 3.3-kb fspI region of pIJ101 containing korA and tra 2006 cloned as a BamHI fragment at this site in the vector pGSP260-∆60 pSP72 with the 54-bp minimal clt region Ducote et al. R∆30L 2000 24 TABLE 2.1 continued pGSP354 Clt+ derivative of pGSP149 Ducote et al. 2000 pIJ350 Conjugally deficient TsrR deletion derivative of pIJ101 Kieser et al. lacking all known transfer functions 1982 pHYG1 Conjugally deficient HygR deletion derivative of pIJ101 Kendall and lacking all known transfer functions Cohen 1987 pOJ260 AmR E. coli- Streptomyces shuttle vector Bierman et al. 1992 pQC179 TsR derivative of pSLA2 with two copies of chromosomal Qin et al. telomeres of S. lividans 2003; kindly provided by Qin, Z. pSCON75 Derivative of pSP72 with the aadA gene Schully, 2005 (spectinomycin/streptomycin adenyltransferase) pSCON114 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with TT pSCON115 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with GG pSCON116 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with AA pSCON117 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with AC pSCON118 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with CT pSCON119 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with TC pSCON120 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with CT pSCON121 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with GA pSCON122 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with TA pSCON123 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with AT pSCON124 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with CG pSCON125 pGSP260∆60R∆30L with nt 6936-6937 of pIJ101 GC This study substituted with CA pSCON126 pSCON114 with pIJ350 at the PstI site This study pSCON127 pSCON115 with pIJ350 at the PstI site This study pSCON128 pSCON116 with pIJ350 at the PstI site This study pSCON129 pSCON117 with pIJ350 at the PstI site This study pSCON130 pSCON118 with pIJ350 at the PstI site This study pSCON131 pSCON119 with pIJ350 at the PstI site This study 25 TABLE 2.1 continued pSCON132 pSCON120 with pIJ350 at the PstI site This study pSCON133 pSCON121 with pIJ350 at the PstI site This study pSCON134 pSCON122 with pIJ350 at the PstI site This study pSCON135 pSCON123 with pIJ350 at the PstI site This study pSCON136 pSCON124 with pIJ350 at the PstI site This study pSCON137 pSCON125 with pIJ350 at the PstI site This study pSCON146 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with GG pSCON147 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with AT pSCON148 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with CC pSCON149 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with TT pSCON150 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with GT pSCON158 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with CG pSCON159 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with CT pSCON160 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with TA pSCON161 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with AG pSCON162 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with AC pSCON163 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with TG pSCON164 pGSP260∆60R∆30L with nt 6944-6945 of pIJ101 GC This study substituted with TC pSCON165 pSCON146 with pIJ350 at the PstI site This study pSCON166 pSCON147 with pIJ350 at the PstI site This study pSCON167 pSCON148 with pIJ350 at the PstI site This study pSCON168 pSCON149 with pIJ350 at the PstI site This study pSCON169 pSCON150 with pIJ350 at the PstI site This study pSCON171 pSCON158 with pIJ350 at the PstI site This study pSCON172 pSCON159 with pIJ350 at the PstI site This study pSCON173 pSCON160 with pIJ350 at the PstI site This study pSCON174 pSCON161 with pIJ350 at the PstI site This study pSCON175 pSCON162 with pIJ350 at the PstI site This study pSCON176 pSCON163 with pIJ350 at the PstI site This study pSCON177 pSCON164 with pIJ350 at the PstI site This study pSCON178 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with CG

26 TABLE 2.1 continued pSCON179 pGSP260∆60∆30 with nt 6940-6941 of pIJ101 GC This study substituted with GT pSCON180 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with CT pSCON181 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with TC pSCON182 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with AG pSCON183 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with GG pSCON184 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with AC pSCON185 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with GA pSCON186 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with AA pSCON187 pGSP260∆60R∆30L with nt 6940-6941 of pIJ101 GC This study substituted with AT pSCON188 pSCON178 with pIJ350 at the PstI site This study pSCON189 pSCON179 with pIJ350 at the PstI site This study pSCON190 pSCON180 with pIJ350 at the PstI site This study pSCON191 pSCON181 with pIJ350 at the PstI site This study pSCON192 pSCON182 with pIJ350 at the PstI site This study pSCON193 pSCON183 with pIJ350 at the PstI site This study pSCON194 pSCON184 with pIJ350 at the PstI site This study pSCON195 pSCON185 with pIJ350 at the PstI site This study pSCON196 pSCON186 with pIJ350 at the PstI site This study pSCON197 pSCON187 with pIJ350 at the PstI site This study pSCON222 pOJ260 with the ~125-bp EcoRI-PvuII fragment of This study pGSP∆60R∆30L containing pIJ101 clt region cloned as an EcoRI cassette at the EcoRI site pSCON223 Clt+ derivative of pQC179 with the clt region as the This study EcoRI fragment of pSCON222 at the EcoRI site (Fig. 2.2 A and B) pSCON229 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with CA pSCON230 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with TA pSCON231 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with GT pSCON232 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with CT pSCON233 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with AA

27 TABLE 2.1 continued pSCON234 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with AG pSCON235 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with GC pSCON236 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with AC pSCON237 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with GG pSCON238 pGSP260∆60R∆30L with nt 6950-6951 of pIJ101 CC This study substituted with AT pSCON239 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with GA pSCON240 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with CG pSCON241 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with CT pSCON242 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with TT pSCON243 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with AG pSCON244 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with GC pSCON245 pGSP260∆60R∆30L with nt 6931-6932 of pIJ101 GG This study substituted with GT pSCON250 pSCON229 with pIJ350 at the PstI site This study pSCON251 pSCON230 with pIJ350 at the PstI site This study pSCON252 pSCON231 with pIJ350 at the PstI site This study pSCON253 pSCON232 with pIJ350 at the PstI site This study pSCON254 pSCON233 with pIJ350 at the PstI site This study pSCON255 pSCON234 with pIJ350 at the PstI site This study pSCON256 pSCON235 with pIJ350 at the PstI site This study pSCON257 pSCON236 with pIJ350 at the PstI site This study pSCON258 pSCON237 with pIJ350 at the PstI site This study pSCON259 pSCON238 with pIJ350 at the PstI site This study pSCON268 pSCON239 with pIJ350 at the PstI site This study pSCON269 pSCON240 with pIJ350 at the PstI site This study pSCON270 pSCON241 with pIJ350 at the PstI site This study pSCON271 pSCON242 with pIJ350 at the PstI site This study pSCON272 pSCON243 with pIJ350 at the PstI site This study pSCON273 pSCON244 with pIJ350 at the PstI site This study pSCON274 pSCON245 with pIJ350 at the PstI site This study pSCON295 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6944-6945 of pIJ101 pSCON296 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6942-6943 of pIJ101 28 TABLE 2.1 continued pSCON297 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6940-6941 of pIJ101 pSCON298 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6938-6939 of pIJ101 pSCON299 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6936-6937 of pIJ101 pSCON300 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6934-6935 of pIJ101 pSCON301 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6932-6933 of pIJ101 pSCON302 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6930-6931 of pIJ101 pSCON303 pGSP260∆60R∆30L with ATGCAT (NsiI) linker insert This study between nt 6928-6929 of pIJ101 pSCON304 pSCON295 with pIJ350 at the PstI site This study pSCON305 pSCON296 with pIJ350 at the PstI site This study pSCON306 pSCON297 with pIJ350 at the PstI site This study pSCON307 pSCON298 with pIJ350 at the PstI site This study pSCON308 pSCON299 with pIJ350 at the PstI site This study pSCON309 pSCON300 with pIJ350 at the PstI site This study pSCON310 pSCON301 with pIJ350 at the PstI site This study pSCON311 pSCON302 with pIJ350 at the PstI site This study pSCON312 pSCON303 with pIJ350 at the PstI site This study pSCON318 pSCON123 with nt 6944-6945 of pIJ101 GC substituted This study with AT pSCON319 pSCON124 with nt 6944-6945 of pIJ101 GC substituted This study with CG pSCON320 pSCON121 with nt 6944-6945 of pIJ101 GC substituted This study with TC pSCON321 pSCON119 with nt 6944-6945 of pIJ101 GC substituted This study with GA pSCON322 pSCON318 with pIJ350 at the PstI site This study pSCON323 pSCON319 with pIJ350 at the PstI site This study pSCON324 pSCON320 with pIJ350 at the PstI site This study pSCON325 pSCON321 with pIJ350 at the PstI site This study pSCON331 pSET152 with the 3-kb XbaI fragment of pGSP238 This study containing pIJ101 korA and tra genes cloned at the XbaI site pSCON334 pQC179 with the 6.2-kb MluI pSLA2 replicon region and This study the 1.8-kb EcoRI-MluI tsr region replaced by the PCR amplified aadA gene at the EcoRI-MluI sites b pSCON335 SpcR StrR derivative of pQC179; pSCON334 with the This study 6.2-kb MluI region of pQC179 cloned at the MluI site (MluI region in the same orientation as pQC179)

29 TABLE 2.1 continued pSCON337 pOJ260 with ~150-bp BglII-PvuII fragment of This study pSCON124 at the BamHI-EcoRV sites pSCON338 pOJ260 with ~150-bp BglII-PvuII fragment of This study pSCON136 at the BamHI-EcoRV sites pSCON339 pOJ260 with ~150-bp BglII-PvuII fragment of This study pSCON158 at the BamHI-EcoRV sites pSCON340 pOJ260 with ~150-bp BglII-PvuII fragment of This study pSCON171 at the BamHI-EcoRV sites pSCON342 pQC179 with ~150-bp EcoRI fragment of pSCON337 at This study the EcoRI site. pSCON343 pQC179 with ~150-bp EcoRI fragment of pSCON338 at This study the EcoRI site. pSCON344 pQC179 with ~150-bp EcoRI fragment of pSCON339 at This study the EcoRI site. pSCON345 pQC179 with ~150-bp EcoRI fragment of pSCON340 at This study the EcoRI site. pSCON346 Clt+ derivative of pSCON335 with the clt region as the This study EcoRI fragment of pSCON222 at the EcoRI site (Fig. 2.2 C) pSET152 AmR, replicative in E. coli, C31-derived integration Bierman et vector al.1992 pSP72 ApR E. coli plasmid cloning vector Promega Corp., Madison, WI a. AmR, ApR, HygR, TsR, SpcR, StrR designate apramycin-, ampicillin-, hygromycin-, thiostrepton-, spectinomycin-, and streptomycin-resistance, respectively. b. DNA fragment containing the aadA gene was PCR amplified as described in Materials and Methods.

S. lividans JW10, JW11, and JW50 were created with the same method by introduction of pSCON331 into the S. lividans strains 98-10, 98-11, and 98-50 (Huang et al. 2003), respectively. The strains were confirmed by western blotting of KorA (Tai and Cohen 1994) and Tra (Pettis and Cohen 1996) in cell extracts as previously described.

Cloning was performed according to the standard procedures described (Sambrook et al.

1989). All restriction enzymes and T4 ligase were purchased from New England Biolabs

30 A

FIG. 2.2. Physical maps of pSCON223 in (A) circular and (B) linear forms, and (C) pSCON346 in linear form. Telomere ends are derived from the S. lividans chromosome (Chr) and are indicated by unfilled arrowheads and TPs are indicated by solid balls. tsr, thiostrepton-resistance gene; aadA, spectinomycin-streptomycin adenytransferase gene; melC, melanin gene.

31 except Asp718 (Roche Applied Science, Indianapolis, IN). A GeneClean Spin Kit (MP

Biomedicals, Solon, OH) was used to clean and purify DNA fragments after enzymatic reactions or PCRs according to the manufacturer's instructions. All PCR was performed as described previously (Pettis et al. 2001), along with the relevant primers and templates as described below. Primers were designed by using the Primer Design, version2 program

(Scientific and Educational Software. Cary, NC), and were synthesized by Sigma-Genosys

(The Woodlands, TX).

In order to construct the spectinomycin/streptomycin-resistant (SpcR/StrR) derivative of pQC179, PCR was performed to amplify a 1-kb fragment containing the aadA gene by using the primers 5aadARI (5’-TTTTTGAATTCCGAACGCAGCGGTGGTA-3’), and aadAMluI

(5’-TTTTTACGC GTTATGTGCTTAGTGCATC-3’), along with plasmid pSCON75 (Schully

2005) as template. The product was digested with EcoRI and MluI, and ligated to the 4.8-kb

EcoRI-MluI fragment of pQC179 to create pSCON334. Then the 6.2-kb MluI fragment of pQC179 was ligated to pSCON334 at the MluI site to create pSCON335. Single or double base clt mutations and linker scanner clt mutations were constructed by PCR target mutagenesis. The mutagenic primers used are listed in Table 2.2. A 154-bp DNA fragment containing various mutated versions of clt was generated by using a single mutagenic primer, along with universal Sp6 primer (New England Biolabs, Ipswich, MA) and template pGSP260∆60R∆30L. The PCR products were digested with Asp718 and PstI, and then ligated to pSP72 at these sites. Individual clt mutations were identified by DNA sequencing.

The resulting plasmids containing mutated clt were cloned onto the transfer-defective streptomycete vector pIJ350 (Kieser et al. 1982) at the PstI site.

32 Table 2.2. The mutagenic primers used in this study to construct single or double base clt mutation, and linker scanner clt mutation clones. The mutated positions are indicated as bold.

Plasmid Sequence cltmut1 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACNNGTA GGGCCCCCTC-3’ cltmut2 5’-GAGCTCGGTACCCGGGGATCCCCTCGCNNGCGCACGCGTA GGGCCCCCTC-3’ cltmut3 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCNNACGCGTA GGGCCCCCTC-3’ cltmut4 5’-GAGCTCGGTACCCGGGGATCCNNTCGCGCGCGCACGCGTA GGGCCCCCTC-3’ cltmut5 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGCGTAN NGCCCCCTC-3’ cltmut6 5’-GAGCTCGGTACCCGGGGATCCCCTCGCATGCGCACATGTAG GGCCCCCTC-3’ cltmut7 5’-GAGCTCGGTACCCGGGGATCCCCTCGCCGGCGCACCGGTA GGGCCCCCTC-3’ cltmut8 5’-GAGCTCGGTACCCGGGGATCCCCTCGCTCGCGCACGAGTAG GGCCCCCTC-3’ cltmut9 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGAGCGCACTCGTAG GGCCCCCTC-3’ cltLS1 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGATGCATCGCGCA CGAGTAGGGCCCCCTC-3’ cltLS2 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGATGCATCGCA CGAGTAGGGCCCCCTC-3’ cltLS3 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGATGCATCA CGAGTAGGGCCCCCTC-3’ cltLS4 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCAATGCAT CGAGTAGGGCCCCCTC-3’ cltLS5 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGATGC ATAGTAGGGCCCCCTC-3’ cltLS6 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGAGAT GCATTAGGGCCCCCTC-3’ cltLS7 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGAGTAA TGCATGGGCCCCCTC-3’ cltLS8 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGAGTA GGATGCATGCCCCCTC-3’ cltLS9 5’-GAGCTCGGTACCCGGGGATCCCCTCGCGCGCGCACGAGTA GGGCATGCATCCCCTC-3’

33 Chemical transformation of E. coli was performed as described (Sambrook et al. 1989).

E. coli strains were cultured on Luria-Bertani (LB) agar or grown in LB broth (Sambrook et al.

1989). Ampicillin was used at 50 µg per ml-1, and apramycin was used at 200 µg per ml-1 to select for plasmids in E. coli. Protoplast transformation of S. lividans was performed using R5 agar according to the method described by Kieser et al. 2000. Transformants colonies of S. lividans were excised and patched onto Streptomyces ipomoeae growth agar (SIGA) (Clark et al. 1998) as previously described (Pettis et al. 2001). Liquid cultures of S. lividans were grown in yeast extract-malt extract (YEME) media (Kieser et al. 2000) at 30°C. Antibiotics used for appropriate selection of strains or plasmids in S. lividans were included at the following concentrations: thiostrepton, 50 µg per ml-1 in solid media or 5 µg per ml-1 in liquid media; hygromycin, 200 µg per ml-1 in solid media or 20 µg per ml-1 in liquid media; spectinomycin, 400 µg per ml-1; streptomycin, 30 µg per ml-1; and apramycin, 50 µg per ml-1 in both solid and liquid media (Kieser et al. 2000). Mating assays were performed and quantified as described previously (Pettis and Cohen 1994). All mating assays consisted of at least 4 independent trials.

DNA Manipulations

Plasmid DNA from S. lividans was isolated using the QIAprep Spin Miniprep Kit

(Qiagen, Valencia, CA) using the modifications for gram-positives suggested by the manufacturer. Total DNA preparation from S. lividans was performed based on Qin et al. 1998 with modifications. Briefly, cells were collected from 10 ml liquid cultures, and following resuspension and lysozyme treatment, proteinase K and SDS were added as described and incubated at 37°C until lysis was complete. Following phenol/chloroform extraction in the original method, RnaseA was added to 50µg/ml and the mixture was incubated at 37°C for 30

34 min to remove RNA contamination. Phenol/chloroform extraction was repeated several times until no more interphase appeared. A 0.1 volume aliquot of 3M sodium acetate (pH 5.2) and

0.6 volumes of isopropanol were added. After gentle mixing, the visible wad of DNA was removed using a bent pastour pipette, washed with 70% ethanol and finally dissolved in 500

µl of TE. The configuration (linear or circular) of plasmid in total DNA was confirmed with digestions of exonuclease III and λ exonuclease (New England Biolabs) as described (Qin et al. 2003).

DNA Sequencing

To check the double or single base substitution clt mutations, relevant DNA fragments were cloned within the polylinker of pSP72 as described above, and used as templates.

Universal Sp6 or T7 (New England Biolabs) was used as primer. To verify the circularity of pSCON223 plasmid recovered from transconjugants in matings involving TK23.42 donors, primer tsr1 (5’-GCGGATGGCTGCCCTGAC-3’), which is complementary to the tsr gene at its 3’ end was utilized, and mini-preparations of plasmid DNA from transconjugants were used as templates. PCR sequencing reactions were performed by using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) as described (Qin and

Cohen 1998).

Pulsed-Field Gel Electrophoresis

Pulsed-field gel electrophoresis (PFGE) was performed in a CHEF DR® III system

(Bio-Rad, Hercules, CA). Preparation of mycelial plugs of S. lividans, and PFGE of the intact genomic DNA in plugs were performed as described (Kers et al. 2005) except using a 6V/cm voltage gradient and switch times ramped from 1-12 s at 12°C for 15 hours. The low range

PFG marker (New England Biolabs) was used as size marker. Southern blot analysis was

35 performed as described previously (Grau et al. 2008), except that templates specific for tsr and aadA genes were generated by digestion and isolation of the EcoI-MluI fragments of pQC179 and pSCON335 respectively. Autoradiography of the finished radioactive blots was performed with Hyperfilm MP (Amersham Pharmacia Biotech, Piscataway, NJ) at -70°C.

RESULTS

Identifying the Most Critical Base Determinants of clt Function

Previous deletions of the clt locus suggested that the IR region appears to be the most important functional unit (Ducote et al. 2000) and raised a question as to whether the dyad symmetry of the IR region per se is essential for clt transfer function. To characterize the clt locus more precisely, single or double base pair IR mutations were generated by PCR using the mutagenic primers described in the Materials and Methods, and the transfer frequencies of the resulting clones were examined by mating assay. As shown in Table 2.3, a number of base alterations in the right arm of the IR appeared to severely reduce or effectively eliminate clt transfer function. Single base mutations in the right arm reduced clt function by up to

100-fold (Table 2.3, pSCON133), while double base substitutions reduced clt function by as much as 1000-fold (Table 2.3, pSCON136). Meanwhile, most of the mutations in the left arm and between the two arms of the IR or within the IR did not appear to affect transfer frequency as much. A notable exception was clone pSCON188 (Table 2.3), which has a GC to

CG change between the two arms of the IR that resulted in an approximate 150-fold reduction in transfer function. If clt functions as a binding site for Tra protein prior to plasmid transfer, then the exceedingly low transfer frequencies of certain clones (i.e., pSCON136, pSCON137, and pSCON188 all transferred at frequencies well below that of pGSP149) may be the result of specific though unproductive interaction of Tra with these clt alleles.

36 TABLE 2.3. Transfer frequencies of 54-bp minimal clt alleles mutated in the IR region. The clt IR region sequence is shown with the specific inverted repeat sequence indicated by the arrows. For each clt mutant clone the mutated alleles are indicated (bold and underlined). The clones were constructed through PCR-based mutagenesis as described in Materials and Methods. Transfer frequencies were determined as described in Materials and Methods.

IR region sequence Transfer Plasmid CCTCGCGCGCGCACGCGTAGG Frequency (%)

pGSP354 (WT) CCTCGCGCGCGCACGCGTAGG 18.3 ± 7.17 pGSP149 No clt 0.342 ± 0.392 pSCON133 CCTCGCGCGCGCACGAGTAGG 0.214 ± 0.0280 pSCON127 CCTCGCGCGCGCACCCGTAGG 2.19 ± 0.255 pSCON131 CCTCGCGCGCGCACTCGTAGG 0.402 ± 0.0982 pSCON129 CCTCGCGCGCGCACACGTAGG 1.32 ± 0.380 pSCON126 CCTCGCGCGCGCACTTGTAGG 0.651 ± 0.401 pSCON128 CCTCGCGCGCGCACAAGTAGG 0.515 ± 0.130 pSCON130 CCTCGCGCGCGCACCTGTAGG 0.873 ± 0.519 pSCON132 CCTCGCGCGCGCACAGGTAGG 0.268 ± 0.0179 pSCON134 CCTCGCGCGCGCACTAGTAGG 0.683 ± 0.317 pSCON135 CCTCGCGCGCGCACATGTAGG 0.635 ± 0.135 pSCON136 CCTCGCGCGCGCACCGGTAGG 0.0181 ± 0.0180 pSCON137 CCTCGCGCGCGCACTGGTAGG 0.0484 ± 0.0373 pSCON165 CCTCGCGGGCGCACGCGTAGG 6.23 ± 1.46 pSCON167 CCTCGCCCGCGCACGCGTAGG 3.93 ± 1.07 pSCON169 CCTCGCGTGCGCACGCGTAGG 4.42 ± 1.42 pSCON175 CCTCGCACGCGCACGCGTAGG 1.48 ± 0.0545 pSCON177 CCTCGCTCGCGCACGCGTAGG 1.05 ± 0.239 pSCON166 CCTCGCATGCGCACGCGTAGG 1.59 ± 0.409 pSCON168 CCTCGCTTGCGCACGCGTAGG 0.394 ± 0.167 pSCON171 CCTCGCCGGCGCACGCGTAGG 1.19 ± 0.202 pSCON172 CCTCGCCTGCGCACGCGTAGG 1.56 ± 0.269 pSCON173 CCTCGCTAGCGCACGCGTAGG 1.03 ± 0.0983 pSCON174 CCTCGCAGGCGCACGCGTAGG 3.53 ± 1.13 pSCON176 CCTCGCTGGCGCACGCGTAGG 1.03 ± 0.110 37 TABLE 2.3 continued pSCON189 CCTCGCGCGCGTACGCGTAGG 3.00 ± 1.40 pSCON193 CCTCGCGCGCGGACGCGTAGG 1.604 ± 0.271 pSCON195 CCTCGCGCGCGAACGCGTAGG 1.92 ± 0.444 pSCON191 CCTCGCGCGCTCACGCGTAGG 6.79 ± 0.596 pSCON194 CCTCGCGCGCACACGCGTAGG 9.71 ± 0.0865 pSCON188 CCTCGCGCGCCGACGCGTAGG 0.128 ± 0.0576 pSCON190 CCTCGCGCGCCTACGCGTAGG 9.71 ± 0.748 pSCON192 CCTCGCGCGCAGACGCGTAGG 1.79 ± 0.156 pSCON196 CCTCGCGCGCAAACGCGTAGG 0.830 ± 0.0795 pSCON197 CCTCGCGCGCATACGCGTAGG 1.86 ± 0.375 pSCON250 CATCGCGCGCGCACGCGTAGG 6.65 ± 5.22 pSCON256 GCTCGCGCGCGCACGCGTAGG 3.33 ± 1.30 pSCON257 ACTCGCGCGCGCACGCGTAGG 5.00 ± 1.73 pSCON251 TATCGCGCGCGCACGCGTAGG 26.42 ± 5.17 pSCON252 GTTCGCGCGCGCACGCGTAGG 0.442 ± 0.129

pSCON254 AATCGCGCGCGCACGCGTAGG 2.16 ± 1.58 pSCON255 AGTCGCGCGCGCACGCGTAGG 11.0 ± 6.24 pSCON258 GGTCGCGCGCGCACGCGTAGG 2.07 ± 0.874 pSCON259 ATTCGCGCGCGCACGCGTAGG 28.0 ± 1.13 pSCON268 CCTCGCGCGCGCACGCGTAGA 11.7 ± 5.65 pSCON273 CCTCGCGCGCGCACGCGTAGC 6.43 ± 0.102 pSCON274 CCTCGCGCGCGCACGCGTAGT 32.6 ± 6.40 pSCON269 CCTCGCGCGCGCACGCGTACG 12.4 ± 1.49 pSCON272 CCTCGCGCGCGCACGCGTAAG 13.5 ± 1.00 pSCON270 CCTCGCGCGCGCACGCGTACT 0.909 ± 0.159 pSCON271 CCTCGCGCGCGCACGCGTATT 7.10 ± 1.47

pSCON322 CCTCGCATGCGCACATGTAGG 0.533 ± 0.133 pSCON323 CCTCGCCGGCGCACCGGTAGG 0.339 ± 0.0220 pSCON324 CCTCGCTCGCGCACGAGTAGG 0.743 ± 0.0347 pSCON325 CCTCGCGAGCGCACTCGTAGG 4.34 ± 0.992

38 As a further test of whether the dyad symmetry per se of the IR region is important for the clt function, mutations were generated in the left arm of the IR that were complementory to those already present in the right arm (i.e., in pSCON131, pSCON133, pSCON135 and pSCON136) in order to determine if restoration of dyad symmetry improved clt function. Of the four resulting clones (pSCON322, pSCON323, pSCON324, pSCON325), only pSCON325 appeared to show obvious increase in transfer function. Additionally, mutagenesis of the IR region was performed by inserting a NsiI linker at a number of positions and then determining the resulting affect on clt function. As shown in Table 2.4, the insertions at the positions in the middle of two arms and in the right arm reduced clt transfer function most

(e.g., pSCON306, pSCON309, and pSCON310). Taken together, these results suggest that sequences within the right arm and extending to within the two arms are the most important region for clt transfer function.

Linear DNA Molecules Not Transferred in Linear Form from TK23.42

To investigate whether the pIJ101 Tra protein can mediate efficient conjugal transfer of a linear replicon containing the pIJ101 minimal clt locus, we inserted clt into pQC179 (Qin et al.

2003) to obtain pSCON223, which could replicate in either circular or linear mode in S. lividans as shown in Fig.2.2 A and B. The transfer frequencies of circular and linear forms of pQC179 and pSCON223 were determined by a previously described mating assay (Pettis and

Cohen 1994, Pettis and Cohen 1996). The donor strain TK23.42 contains a chromosomally inserted copy of the pIJ101 tra gene and its regulation gene korA (Stein et al. 1989), and the

TK23 recipient strain contains a hygromycin-resistant selective marker in the form of the transfer defective plasmid pHYG1 (Kendall and Cohen 1987). When covalently closed circular (CCC) pQC179 or pSCON223, both carrying a thiostrepton-resistant selective marker, were introduced into S. lividans TK23.42 by transformation using this method, we found that

39 TABLE 2.4. Transfer frequencies of linker scanner mutants in the IR region of pIJ101 clt locus. The clt IR region sequence is shown and the IR is indicated (arrow) below. For each clt linker scanner mutant clone, the insertion positions of Nsi I linker (ATGCAT) are indicated by arrows. From left to Right: pSCON304, pSCON305, pSCON306, pSCON307, pSCON308, pSCON309, pSCON310, pSCON311, pSCON312. The clones were constructed through PCR-based mutagenesis as described in Materials and Methods. Transfer frequencies were determined as described in Materials and Methods.

Nsi I site (ATGCAT)

CCTCGCGCGCGCACGCGTAGGGCCCCCTC IR

Plasmid Transfer Frequency (%) pGSP354 (WT) 15.6 ± 1.08 pGSP149 (no clt) 0.0369 ± 0.0151 pSCON304 0.801 ± 0.0201

pSCON305 0.906 ± 0.121

pSCON306 0.0140 ± 0.00403

pSCON307 0.619 ± 0.313 pSCON308 1.10 ± 0.0533

pSCON309 0.0768 ± 0.0380 pSCON310 0.570 ± 0.0300

pSCON311 1.64 ± 0.211 pSCON312 1.09 ± 0.0578

either circular or linear DNA molecules could be recovered from transformants (Fig. 2.3 A).

Donor spores harboring circular or linear pQC179 or pSCON223 and recipient spores were mixed and spread onto nonselective MY (malt extract-yeast extract) agar (Pettis and Cohen

1994). For each mating, the resulting spores were collected after one cycle of growth, and plasmid transfer frequencies were quantified as described previously (Pettis and Cohen 1994).

40 Surprisingly, as shown in Table 2.5, circular pQC179, thought to be a transfer-defective clone, transferred at a frequency (10.55%) not obviously lower than that seen for its Clt+ derivative pSCON223 (10.49%). This result suggests that some component of pQC179 can complement pIJ101 clt transfer function. However, the transfer frequencies of their linear counterparts occurred at frequencies approximately 3 orders of magnitude lower (linear pQC179 at 0.011%; pSCON223 at 0.013%). Thus, it appeared that the pIJ101 tra and clt functions could not promote efficient DNA transfer of the linear plasmids.

TABLE 2.5. Transfer frequencies of linear versus circular pQC179 and pSCON223 from S. lividans strains.a

Donors Donor Transfer Recipient Plasmidsb Strains Frequency (%)c pQC179 C TK23.42 TK23(pHYG1) 10.55d pSCON223 TK23.42 TK23(pHYG1) 10.49d C pQC179 L TK23.42 TK23(pHYG1) 0.011d pSCON223 L TK23.42 TK23(pHYG1) 0.013d

pQC179 L JW1 TK23(pHYG1) 1.13e

pSCON223 L JW1 TK23(pHYG1) 78.27e pQC179 C TK23 TK23(pHYG1) 0f pSCON223 TK23(pHYG1) TK23 0f C a. Matings were performed and quantified as described in Pettis and Cohen 1994, Pettis and Cohen 1996. b. Plasmids in circular (C) or linear (L) form in the donors were confirmed by agarose gel electrophoresis analysis of total DNA isolated from the donor cells as shown in Fig. 2.3 A. c. Transfer frequency was determined as the ratio of transconjugants to donors multiplied by 100%. d. Numbers are the average obtained from 16 independent matings. e. Numbers are the average obtained from 6 independent matings. f. Numbers are the average obtained from 4 independent matings.

FIG. 2.3. Agarose gel electrophoresis analysis of total DNA in donors and transconjugants. Mating assays were as described for Table 2.3. Total DNA was isolated from each individual transconjugant. Two µg of either undigested DNA (U), DNA treated with exonuclease III (III), or DNA treated with λ exonuclease (λ) were electrophoresed on a 0.7% agarose gel containing ethidium bromide at 45V for 4 h, visualized under UV light and a digital image was recorded using an Eagle Eye II still video system (Stratagene, La Jolla, CA). (A) The donor strain was TK23.42. The gel picture shows an example of pSCON223 observed as circular in transconjugants (CT). Linear donor (LD) and circular donor (CD) were loaded as controls. pHYG1 isolate from TK23 was loaded as the other control. A 1-kb plus DNA ladder (Invitrogen, Carlsbad, CA) was used as a size marker (M). (B) The donor strain was JW1. Sample 1, pQC179-L1; sample 2, pQC179-L2; sample 3, pSCON223-L3; and sample 4, pSCON223-L4. pHYG1 isolate from TK23 was loaded as a control. A 1-kb plus DNA ladder was used as a size marker (M).

42 To determine whether pQC179 or pSCON223 in the few transconjugants obtained were still linear DNA molecules, plasmid DNA was isolated from individual transconjugants, and examined by sequencing of the telomere region of the plasmids using a primer located at the

3’ end of the tsr gene (See Materials and Methods for details). Of all fifteen individual transconjugants checked (i.e., twelve clones from nine independent linear pQC179 or pSCON223 matings; three clones from three independent circular pQC179 or pSCON223 matings), DNA sequencing extended into the melC gene (data not shown), thus showing that molecules examined were all circular (Fig. 2.2). Interestingly, of the twelve transconjugants from linear donors, only one retained intact telomeres, seven others retained a partial telomere region ranging from ~50-bp to ~150-bp, while the remaining four lost their entire telomere sequences. Total loss of telomere region was also observed in two out of the three transconjugants from circular donors, while the other one was intact. These results indicated that the linear replicons had circularized probably in the donor at low frequencies, and then transferred as circular DNA molecules. We also examined various transconjugants by isolation of total DNA and treatment with exonuclease III and λ exonuclease followed by agarose gel electrophoresis analysis. pQC179 or pSCON223 were observed as circular DNA molecules in all transconjugants (Fig. 2.3 A). The results strongly suggest that these linear

DNA molecules could not be transferred in linear form by the pIJ01 tra and clt functions, however, they may be circularized and transferred in circular form at low frequencies.

Linear DNA Molecules Do Transfer in Linear Form from JW1

The mating results for linear pQC179 and pSCON223 from donor TK23.42 contrasted dramatically with those involving donor from S. lividans JW1, which is a derivative of wild-type S. lividans strain 1326, which contains the pIJ101 tra and korA genes inserted into

43 the chromosome, as well as the autonomous linear plasmid SLP2. As shown in Table 2.5, both pQC179 and pSCON223 transferred at much greater frequencies from JW1 as compared to

TK23.42, and the transfer frequency of linear pSCON223 (78.27%) was about 70-fold greater than that of linear pQC179 (1.13%).

Transconjugants from independent matings were examined by isolation of total DNA, and treatment with exonuclease III and λ exonuclease, followed by agarose gel electrophoresis (Fig. 2.3 B). For the linear pQC179 matings, two out of eight tranconjugants examined were observed as circular DNA molecules (e.g., pQC179-L2). Neither circular nor linear pQC179 replicon was observed in the other 6 transconjugants (e.g., pQC179-L1). This latter result was probably because of recombination occurring between pQC179 and SLP2 before or during the transfer process since both molecules contain identical terminal sequences (Huang et al. 2003, Qin et al. 2003). For the linear pSCON223 matings, six out of eight clones were found to be linear (e.g., pSCON223-L3 and pSCON223-L4), and the other two appeared to be circular. To investigate further the linear versus circular configuration of these transconjugant plasmid molecules, pulse-field gel electrophoresis of intact transconjugant plasmid molecules was performed (Fig. 2.4 A); subsequent Southern blotting analysis using a tsr gene specific probe was then used to identify pQC179/pSCON223-related molecules in the transconjugants. Donor cells containing linear pQC179 or pSCON223 were included as controls. As expected, SLP2 and linear pQC179 or pSCON223 were present in the donors (Fig. 2.4 A), and no recombination was detected between them (Fig. 2.4 B, LD lanes).

For the representative transconjugants, SLP2 appeared to have transferred in every case (Fig.

2.4 A). Meanwhile evidence in Fig. 2.4 B suggested that pQC179-L1 had recombined into

SLP2 either during or after transfer, while pQC179-L2 was confirmed to be present in

44 transconjugants in a circular form, plasmid pSCON223-L3 appears to have transferred as a linear molecule with no recombination with SLP2 being observed, and in the pSCON223-L4 transconjugant, both SLP2-recombined and linear version of pSCON223L4 were observed.

The results taken together show that linear DNA molecules appear to be transferred in linear form from JW1, while they may also recombine with SLP2 as an alternative way to transfer.

FIG. 2.4. Configuration (i.e., linear, circular, or recombination with SLP2) of pQC179 versus pSCON223 in JW1 transconjugants. (A) Pulsed-field gel electrophoresis (PFGE) of genomic DNA from transconjugants. PFGE was performed as described in Materials and Methods. Samples 1, 2, 3, and 4 are the same as indicated for Fig. 2.3B. Linear donors (LD) of pQC179 and pSCON223 were included as controls. A low range PFG marker (New England Biolab) was used as a size marker (M). (B) Southern blotting analysis of the pulsed-field gel to detect recombination. The gel in part A was subjected to Southern blotting using a 32P-labeled tsr gene probe. The positions of some bands of the size marker are as shown.

45 SLP2 ttrA Gene Not Required for Transfer of Linear pSCON346 and pSCON335

Based on the data so far, a possible scenario for transfer of pSCON223 (and possibly pQC179) as a linear molecule from strain JW1 was that transfer was mediated by tra and clt of pIJ101 in conjunction with one or more essential functions provided by SLP2. It was previously reported that the telomeric ends of SLP2 and the S. lividans chromosome share

15.4 kb of identical sequence including the ttrA gene (Bey et al. 2000, Huang et al. 2003), and that the SLP2 copy of ttrA is required for transfer of SLP2, while both copies are necessary for transfer of the chromosome during SLP2-mediated conjugation (Huang et al. 2003). To investigate whether the ttrA gene is necessary for transfer of pQC179/pSCON223 plasmids from strain JW1, pIJ101 tra and korA were inserted into the chromosomes of TtrA-defective strains 98-10 (ttrA on the chromosome is defective), 98-11 (both the chromosomal and SLP2 copies of ttrA are defective), and 98-50 (SLP2 ttrA is defective) (Huang et al. 2003) to obtain

JW10, JW11, and JW50. Because these strains are all thiostrepton-resistant, the tsr gene on pQC179 and pSCON223 was replaced with the aadA gene to create pSCON335 and pSCON346 (Fig. 2.2 C), so that they confer spectinomycin and streptomycin resistance. pSCON335 and pSCON346 were introduced into JW10, JW11, JW50, and JW1 (TtrA+ control) by transformation respectively, and linear replicons were identified in transformants as described above. Matings were performed to determine the transfer frequencies of linear pSCON335 and pSCON346 from the TtrA-defective strains to TK23 (pHYG1). As shown in

Table 2.6, the linear plasmids appeared to transfer efficiently from all strains, including JW11 and JW50, in which ttrA on SLP2 is defective (Huang et al. 2003). Since linear pSCON335 and pSCON346 appeared to transfer as well as or greater from TtrA-defective strains (JW10,

46 Table 2.6. Transfer frequencies of linear pSCON335 and pSCON346 from TtrA defective strains.a

Donor Donor Transfer Recipient Plasmidsb Strains Frequency (%)c pSCON335 JW1 TK23(pHYG1) 1.99

pSCON346 JW1 TK23(pHYG1) 20.91

pSCON335 JW10 TK23(pHYG1) 52.78

pSCON346 JW10 TK23(pHYG1) 47.14

pSCON335 JW11 TK23(pHYG1) 56.06

pSCON346 JW11 TK23(pHYG1) 41.25

pSCON335 JW50 TK23(pHYG1) 19.02 pSCON346 JW50 TK23(pHYG1) 47.95 a. Matings were performed and quantified as described for Table 2.3. b. Plasmids in linear form in the donors were confirmed as described for Table 2.3. c. Transfer frequency was determined as the ratio of transconjugants to donors multiplied by 100%. All numbers are the average obtained from 4 independent matings.

JW11, and JW50) than from the TtrA+ strain JW1. The results strongly suggested that the ttrA gene was not required for conjugation of these linear replicons. pIJ101 Transfer Genes Are Not Responsible for Transfer of DNA Molecules in Linear Form from JW1 As noted above, an approximate 70-fold difference was observed between the transfer frequencies of pQC179 (clt-) and pSCON223 (clt+) in linear form when the donor strain was

JW1 (Table 2.5). However, though transfer frequency of linear pSCON346 was over 10-fold greater than that of linear pSCON335 (clt-) from JW1, there was no obvious difference between transfer frequencies of these two linear replicons from JW10, JW11 and JW50 (Table

2.6). The inconsistent results led us to test directly whether pIJ101 transfer components, tra and clt, were responsible for transfer of linear DNA molecules in linear form from JW1.To address this question, the clt regions of 4 IR mutants with reduced transfer function of 47 approximately 1000-, 100-, 10-, and 2-fold (i.e., as shown in Table 2.3, these are the relative transfer frequencies of pSCON136, pSCON188, pSCON171, and pSCON190, respectively), were cloned onto pQC179. Matings of the linear replicons containing such clt mutations from

JW1 donors to TK23 (pHYG1) were performed, and independent matings of pQC179 and pSCON223 in linear form were performed side by side as controls. As shown in Table 2.7, transfer frequencies of the linear plasmids containing these clt mutations from JW1 ranged

TABLE 2.7. Transfer frequencies of clt mutants in circular versus linear plasmids.a

Transfer Transfer Circular Linear IR region sequenceb Frequency Frequency Plasmids Plasmidsd (%)c (%)e CCTCGCGCGCGCACGCGTAGG pGSP354 20.00 pSCON223 55.01

No clt pGSP149 0.56 pQC179 1.08

CCTCGCGCGCGCACCGGTAGG pSCON136 0.018 pSCON342 33.78

CCTCGCCGGCGCACGCGTAGG pSCON171 1.18 pSCON343 26.04

CCTCGCGCGCCGACGCGTAGG pSCON188 0.13 pSCON344 14.32

CCTCGCGCGCCTACGCGTAGG pSCON190 9.70 pSCON345 6.05 a. Matings were performed and quantified as described for Table 2.3. b. The IR region of the pIJ101 clt sequence is shown. The positions of double-base substitutions of the circular or linear plasmids containing such clt mutations are indicated as underlined. The double-base substitutions were constructed by PCR targeted mutagenesis as described in Materials and Methods. c. The donor strain was TK23.42. The donor plasmids were circular plasmids as indicated in the table. The recipient is TK23 containing pHYG1. Transfer frequency was determined as the ratio of transconjugants to donors multiplied by 100%. Numbers are the average obtained from 4 independent matings. d. Plasmids in linear form in the donors were confirmed as described for Table 2.3. e. The donor strain was JW1. The donor plasmids were linear plasmids as indicated in the table. The recipient was TK23 containing pHYG1. Transfer frequency was determined as the ratio of transconjugants to donors multiplied by 100%. Numbers are the average obtained from 4 independent matings.

48 from about 6% to 34%, but these differences did not correlate at all with the transfer frequencies for circular plasmids containing these same clt mutations, when these latter plasmids were transferred by the pIJ101 tra gene present in TK23.42 donor cells. These results suggested that clt and tra were probably not involved in the observed transfer of DNA molecules in linear form from JW1.

Linear DNA Molecules Do Transfer in Linear Form from Strains Containing Only SLP2

If pIJ101 transfer components were not responsible for the transfer of linear pSCON223 or pQC179 from strain JW1, then maybe these linear DNA molecules were being transferred bythe SLP2 transfer function. To test this notion, transfer frequencies of linear pSCON223 from strain 1326 and linear pSCON346 from 98-50 were determined. Both strain 1326 and

98-50 do not have Tra of pIJ101, but do have SLP2 and thus TraSLP2. As shown in Table 2.8, the transfer frequency of linear pSCON346 from 98-50 (37.42%), did not show obvious difference from that of pSCON346 from JW50 (40.75%). To determine whether the transfer

TABLE 2.8. Transfer Frequencies of linear pSCON223 and pSCON346 from pIJ101 Tra+ versus Tra- strains.a

Donor Donor Transfer Recipient Plasmidsb Strains Frequency (%)c pSCON223 1326 TK23 (pHYG1) 12.18

pSCON223 JW1 TK23 (pHYG1) 87.26

pSCON346 98-50 TK23 (pHYG1) 37.42 pSCON346 JW50 TK23 (pHYG1) 40.75 a. Matings were performed and quantified as described for Table 1. b. Plasmids in linear form in the donors were confirmed as described for Table 1. c. Transfer frequency was determined as the ratio of transconjugants to donors multiplied by 100%. All numbers are the average obtained from 4 independent matings.

49 of linear pSCON346 occurred as linear DNA molecules, total intact DNA from one 98-50 transcojugant, was analyzed by pulsed-field gel electrophoresis (Fig. 2.5 A) and Southern blotting (Fig. 2.5 B). While PFGE showed evidence that both SLP2 and linear pSCON346 were present in the transconjugant, linear pSCON346 was detected in Southern blots using an aadA probe, thus, no recombination between SLP2 and pSCON346 had occurred. I conclude from this result that linear DNA molecules do transfer in linear form from strains containing

FIG. 2.5. Evidence of linear pSCON346 transfer from strain 98-50. (A) Pulsed-field gel electrophoresis. Mating assays were as described for Table 2.3. The donor strain was 98-50. PFGE was performed as described in Materials and Methods. DNA in lane 1 is genomic DNA isolated from a tranconjugant. Lane 2 is DNA isolate from the recipient TK23 (pHYG1), which is a control. A low range PFG marker (New England Biolab) was used as a size marker (M). (B) Southern blotting analysis of the pulsed-field gel to detect linear pSCON346. The gel in part A was subjected to Southern blotting using a 32P-labeled aadA gene probe. The position of the 9.42kb band of the size marker is as shown.

50 only SLP2. Once again, it demonstrated that pIJ101 transfer components were not responsible for transfer of DNA molecules in linear form, and suggested that TraSLP2 mediated the transfer of pSCON223 or pSCON346 as linear DNA molecules from strains 1326 or 98-50.

DISCUSSION

Streptomyces circular conjugative plasmids such as pIJ101 can mobilize linear chromosomal DNA during mating between streptomycete cells. Tra is the only pIJ101-encoded factor required for chromosomal gene transfer (Kieser et al. 1982).

Additionally, pIJ101 Tra and clt functions can promote transfer of heterologous plasmids

(Pettis and Cohen 1994). So we hypothesized that the transfer components, including Tra and clt, could also mediate transfer of linear plasmids. However my research shows that the Tra- clt system of pIJ101 does not efficiently mediate the transfer of plasmids when they are in a linear form.

How can Tra and clt transfer circular heterologous plasmids, as well as linear chromosomal DNA molecules? For linear chromosomes, strong interactions between the TPs cause the chromosomal DNA molecules to exhibit a circular-like configuration spontaneously

(Wang et al. 1999, Yang and Losick 2001). Because of this configuration, the original genetic map of the Streptomyces coelicolor genome was first established to be circular based on linkage analysis (Hopwood 1965, 1966). This circular-like configuration for linear chromosomes, perhaps even during conjugal transfers, may explain how circular plasmids can mobilize linear chromosomes. Possibly, the smaller linear plasmids used in this study were unable to show such circularity and, for reasons undetermined, the transfer genes of circular plasmid pIJ101 could not promote transfer of these linear DNA molecules.

51 For the transfer of circular plasmids, for example pIJ101, the membrane Tra protein forms a ring-shaped pore and translocates the donor plasmid DNA into the recipient

(Reviewed by Grohmann et al. 2003). Could transfer of linear and circular DNA replicons involve different mechanisms? Chen 1996 predicted the “End First” model which proposed that conjugal transfer of linear Streptomyces plasmids and chromosomes is initiated at the telomere and one 5’ TP-capped strand is then displaced and transferred into recipient.

Interestingly, however, Xu et al. 2006 showed that TraSLP2 promoted efficient transfer of

SLP2-derived circular plasmids. This latter result suggested transfer of linear and circular derivatives of SLP2 may occur by the same or a similar mechanism. Whether conjugation of linear and circular DNA replicons involve different mechanisms remains to be explored. In this study, we observed that linear plasmids are not mobilized by transfer components of circular plasmid pIJ101. These results suggest that either transfer of linear plasmids differs significantly from that of circular plasmids, or that the two mechanisms are similar but transfer of linear DNA molecules may require additional genetic functions.

Several distinct conjugation functions other than the Tra DNA translocase have been identified as being required for efficient conjugal transfer of SLP2 and SLP2-mediated mobilization of the chromosome, such as TtrA, cell wall hydrolase, etc. (Huang et al. 2003,

Xu et al. 2006). The ttrA gene is terminally located in linear plasmid SLP2 and the S. lividans chromosome. It encodes a helicase which appears to be necessary for transfer of both SLP2 and the chromosome (Huang et al. 2003). However, our results showed that the ttrA gene was not necessary for the transfer of the smaller linear plasmid pSCON346. Interestingly, Xu et al.

2006 also observed that a SLP2-derived linear plasmid lacking the ttrA still transferred efficiently.

52 The minimal clt locus is comprised of one imperfect inverted repeat and three direct repeats. Previous deletion analysis indicated that the inverted-repeat sequence appears to be the single most important functional region for plasmid transfer (Ducote et al. 2000). My results revealed that certain mutations particularly in the right arm of the IR or between the arms reduced clt transfer function significantly. Single base mutations in the right arm reduced clt function by up to 100-fold, while double base substitutions reduced clt function by up to 1000-fold, which suggests that sequences within the right arm are critical for clt activity.

These data are consistent with preliminary insertion analysis of the clt region described previously (Pettis and Cohen 1994). Here, the base substitutions in the right arm eliminated the clt function significantly more than those in the left arm and most of those located between the arms, which contrasts with the notion that the dyad symmetry of the IR region is critical for the clt function. Further, only one set of compensatory mutations that restored dyad symmetry (i.e., the C to A alteration in the left arm of pSCON325 as shown in Table 2.3 improved clt activity relative to the original mutant (pSCON131). The pIJ101 clt locus may interact specifically with its cognate Tra protein or with an unidentified chromosomal factor during productive plasmid transfer. The clt region was also previously found to be intrinsically bent or curved, and this DNA curvature may play an important role in ensuring the potential Tra-clt interaction (Ducote et al. 2000). It seems certain that secondary structuring of clt DNA relies on specific sequence components. So certain substitutions of critical base determinants may have reduced the clt transfer function by altering the secondary structure including curvature. Interestingly, the GC to CG change between the two arms

(Table 2.3, pSCON188) reduced the transfer efficiency significantly more than other base alterations at the same position, and the linker insertion between G and C in the middle of IR

53 eliminated clt activity. These results also indicate that sequences extending to within the arms of the IR may also be important for potential Tra/clt interaction and/or secondary structure of clt.

Circular pQC179 was thought to be a transfer defective plasmid with respect to pIJ101 tra mobilization because it does not possess clt. clt is a cis-acting locus that could be a putative binding site of the Tra protein (Grohmann et al. 2003). Surprisingly, our results of mating assays showed that pQC179 transferred as efficiently as its Clt+ derivative pSCON223, suggesting that some sequences on pQC179 are complementing the clt transfer function. Our preliminary evidence indicates that it may be the telomere sequence (See Table A.1 in

Appendix A) that is complementing clt. To date no sequences entirely homologous to the pIJ101 clt locus have been found on the linear Streptomyces chromosome, though pIJ101 Tra can mediate efficient transfer of the chromosome. However, the telomeric end of the chromosome contains numerous IRs and palindromic sequences, and it was predicted to form complex secondary structures (Huang et al. 1998). So it is an interesting possibility to be explored whether the telomeres contain functional analogs of the pIJ101 clt locus that substitute for clt transfer function during conjugal transfer of the chromosomal DNA mediated by pIJ101 Tra protein. Furthermore, the telomeres could play an important role in linear-plasmid-mediated conjugation, since our results showed that TraSLP2 alone could mediate efficient transfer of a linear derivative of pSLA2 with telomeres of SLP2. It is in agreement in one sense with Chen’s model that the ends of linear plasmids are essential for conjugal transfer. But the telomeres might function as a potential interaction site with Tra of linear plasmids, which resembles the role of clt in circular-plasmid-mediated conjugation. The

54 putative significance and exact function of the telomeric ends of linear plasmids and chromosomes in conjugation remains to be explored.

REFERENCES Bao, K., and S. N. Cohen. 2001. Terminal proteins essential for the replication of linear plasmids and chromosomes in Streptomyces. Genet. Dev. 15: 1518-1527.

Begg, K. J., S. J. Dewar, and W. D. Donachie. 1995. A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177: 6211-6222.

Bey, S. -J, M. -F. Tsou, C. -C Huang, C. -C Yang, and C. W. Chen. 2000. The homologous terminal sequence of the Streptomyces lividans chromosome and SLP2 plasmid. Microbiol. 146: 911-922.

Bierman, M., R. Logan, K. O’Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116: 43-69.

Chater, K. F. 1993. Genetics of differentiation in Streptomyces. Annu. Rev. Microbiol. 47: 685-713.

Chen, C. W. 1996. Complications and implecations of linear bacterial chromosomes. Trends. Genet. 12: 192-196.

Chen, C. W., T. -W. Yu, Y. -S. Lin, H. M. Kieser, and D. A. Hopwood. 1993. The conjugative plasmid SLP2 of Streptomyces lividans is a 50kb linear molecule. Mol. Microbiol. 7: 925-932.

Clark, C. A., C. Chen, N. Ward-Rainey, and G. S. Pettis. 1998. Diversity within Streptomyces ipomoeae based on inhibitory interactions, rep-PCR, and plasmid profiles. Phytopathology 88: 1179-1186.

Ducote, M. J., and G. S. Pettis. 2006. An in vivo assay for conjugation-mediated recombination yields novel results for Streptomyces plasmid pIJ101. Plasmid 55: 242-248.

Grau, B. L., M. C. Henk, K. L. Garrison, B. J. Olivier, R. M. Schulz, K. L. O’Reilly, and G. S. Pettis. 2008. Further characterization of Vibrio vulnificus rugose variants and identification of a capsular and rugose exopolysaccharide gene cluster. Infection and Immunity 76: 1485-1497.

Grohmann, E., G.. Muth, and M. Espinosa. 2003. Conjugative plasmid transfer in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67: 277-301. 55 Hopwood, D. A. 1965. A circular linkage map in the actinomycete Streptomyces coelicolor. J. Mol. Biol. 12: 514-516.

Hopwood, D. A. 1966. Lack of constant genome ends in Strepomyces coelicolor. Bacteriol. Rev. 31: 373-403.

Hopwood, D. A., and T. Kieser. 1993. Conjugative plasmids of Streptomyces. In Bacterial conjugation, Clewell, D.B. (ed.). New York: Plenum Press, pp. 293-311.

Hopwood, D. A., T. Kieser, H. M. Wright, and M. J. Bibb. 1983. Plasmids, recombination and chromosome mapping in Streptomyces lividans 66. J. Gen. Microbiol. 129: 2257-2269.

Huang, C. -H., C. -Y. Chen, H. -H. T, C. Chen, Y. -S. Lin, and C. W. Chen. 2003. Linear plasmid SLP2 of Streptomyces lividans is a composite replicon. Mol. Microbiol. 47: 1563-1576.

Huang, C. -H., Y. -S. Lin, Y. -L. Yang, S. -W. Huang, and C. W. Chen. 1998. The telomeres of Streptomyces chromosomes contain conserved palindromic sequences with potential to form complex secondary structures. Mol. Microbiol. 28: 905-916.

Kendall, K. J., and S. N. Cohen. 1987 Plasmid transfer in Streptomyces lividans: identification of a kil-kor system associated with the transfer region of pIJ101. J. Bacteriol. 169: 4177-4183.

Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces Genetics. Norwich, England: The John Innes Foundation.

Lin, Y. -S., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The chromosomal DNA of Streptomyces lividans 66 is linear. Mol. Microbiol. 10: 923-933.

Pettis, G. S., and S. N. Cohen. 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13: 955-964.

56 Pettis, G. S., and S. Prakash. 1999. Complementation of conjugation functions of Streptomyces lividans plasmid pIJ101 by the related Streptomyces plasmid pSB24.2. J. Bacteriol. 181: 4680-4685.

Possoz, C., C. Ribard, J. Gagnat, J. -L. Pernodet, and M. Guerineau. 2001. The intergrative element pSAM2 from Streptomyces: kinetics and mode of conjugal transfer. Mol. Microbiol. 42: 159-166.

Qin, Z., and S. N. Cohen. 1998. Replication at the telomeres of the Streptomyces linear plasmid pSLA2. Mol. Microbiol. 28: 893-903.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.

Stein, D. S., K. J. Kendall, and S. N. Cohen. 1989. Identification and analysis of transcriptional regulatory signals for the kil and kor loci of Streptomyces plasmid pIJ101. J. Bacteriol. 171: 5768-5775.

Tai, J. T. -N., and S. N. Cohen. 1994. Mutations that effect regulation of the KorB gene of Streptomyces lividans plasmid pIJ101 alter plasmid transmission. Mol. Microbiol. 12: 31-39.

Wang, S. -J., H. -M. Chang, Y. -S. Lin, C. -H. Huang, and C. -W. Chen. 1999. Streptomyces genomes: circular genetic maps from the linear chromosomes. Microbiol. 145: 2209-2220.

57 Wu, L. J., P. J. Lewis, R. Allmannsberger, P. M. Hauser, and J. Errington. 1995. A conjugation-like mechanism for prespore cchromosome-partioning during sporulation in Bacillus subtilis. Genet. Dev. 9: 1316-1326.

Yang, M.C., and R. Losick. 2001. Cytological evidence for association of the ends of the linear chromosome in Streptomyces coelicolor. J. Bacteriol. 183: 5180-5186.

Zhou, X., Z. Deng, J. L. Firmin, D. A. Hopwood, and T. Kieser. 1988. Site-specific degradation of Streptomyces lividans DNA during electrophoresis in buffers contaminated with ferrous iron. Nucleic Acid Res. 16: 4341-4354.

CHAPTER THREE: GROWTH-REGULATED EXPRESSION OF A BACTERIOCIN, PRODUCED BY THE SWEET POTATO PATHOGEN STREPTOMYCES IPOMOEAE, THAT EXHIBITS INTERSTRAIN INHIBITION*

* Reprinted with permission of the Applied and Environmental Microbiology

59 INTRODUCTION

Streptomyces bacteria are gram-positive spore-forming soil bacteria which display a complex life cycle (Chater 1993, Chater 1998). Spore germination leads to vegetative growth as tangled masses of substrate mycelia on solid surfaces. Nutrient limitation triggers production of secondary metabolites as well as growth of vertically extending aerial hyphae, which are morphologically distinct filaments that derive nutrients from the dying substrate cell layer. Eventually, individual aerial hyphae differentiate into chains of spores.

Streptomyces mycelia growing in liquid media display a multiphasic growth curve similar to that of unicellular bacteria. As the culture enters stationary phase, Streptomyces bacteria produce secondary metabolites, but do not typically differentiate morphologically

(Champness and Chater 1994).

Streptomyces ipomoeae is the causative agent of soil rot, the widespread and destructive disease of sweet potatoes. The disease results in decay of fibrous feeder roots and development of necrotic lesions on the edible storage roots (Clark and Moyer 1988).

Prevention of soil rot currently relies solely on development of resistant sweet potato cultivars; however, alternative approaches, including the use of biocontrol methods, are now beginning to be investigated.

Previously, thirty-six strains of S. ipomoeae were divided into three groups based on interstrain inhibition during their co-cultivation on agar plates (Clark et al. 1998). The group

III strains were found to produce a diffusible 10-kDa bacteriocin-like protein (ipomicin), which is inhibitory to group I and II members and which is stable in culture supernatants for at least 1 h at 40°C (in a pH range of 6-10) (Zhang et al. 2003). Sequence analyses of the

60 ipomicin structural gene (ipoA) and its protein product revealed that ipomicin is initially expressed in precursor form, which upon processing of an N-terminal signal sequence becomes the 10-kDa mature form (Zhang et al. 2003).

Given its potential as a biocontrol agent, we were interested in elucidating the expression characteristics of ipomicin. It was noted previously that TTA, the rarest codon found within the GC-rich Streptomyces genus, is present once in ipoA within the region that designates the ipomicin signal sequence (Zhang et al. 2003). TTA codons in Streptomyces bacteria are recognized by a single leucyl tRNA species encoded by the gene bldA, which is required for normal morphological and physiological differentiation in these organisms (Chater 2006,

Leskiw et al. 1991). The latter effect is due in part to the fact that regulatory genes of antibiotic clusters and aerial hyphae development also contain TTA codons (Chater 2006).

In the model streptomycete, Streptomyces coelicolor, bldA has been shown to be an effective growth-phase regulator because it is expressed initially in liquid and surface cultures as an inactive precursor, and upon processing, begins to temporally accumulate as a mature tRNA, at least under certain physiological conditions (Leskiw et al. 1993, Trepanier et al. 1997).

Interestingly, TTA-containing genes show variation in their dependence on bldA for expression with some genes demonstrating strong dependence, while others showing only partial or no apparent dependence (Leskiw et al. 1991, Trepanier et al. 2002).

Here, stable ipomicin protein is shown to be temporally produced during S. ipomoeae growth in a manner inconsistent with ipoA mRNA levels. Similar contrary results for ipomicin protein and ipoA mRNA concentrations were observed during growth of the heterologous host

S. coelicolor expressing a cloned version of the S. ipomoeae ipoA gene, and this effect was shown to be directly dependent on translation of the ipoA TTA codon by the bldA leucyl

61 tRNA. The data here suggest regulation by bldA leads to temporal production of the ipomicin precursor, which when processed to the mature form is secreted to the external environment where it accumulates.

MATERIALS AND METHODS

Bacterial Strains and Plasmids and Molecular Biology Methods

S. ipomoeae strains 91-01 (group I), 88-35 (group II), 91-03 and 88-29 (group III) have been described (Clark et al. 1998). S. ipomoeae spores were preserved long term on silica gel crystals at -20°C (Perkins 1962), or short term on S. ipomoeae growth agar (SIGA) (Clark et al. 1998, Clark and Lawrence 1981), while mycelia were grown in Tryptic Soy Broth (TSB,

Difco, Detroit, MI). S. coelicolor strains M600 and M600∆bldA (Hesketh et al. 2007) and

Streptomyces lividans strain TK23 (Kieser et al. 2000) were cultured on SIGA or in yeast extract-malt extract (YEME) medium (Kieser et al. 2000). In order to obtain absorbance (600 nm) readings that accurately reflect cell mass, aliquots of Streptomyces broth cultures were vortexed vigorously to disperse mycelial clumps as much as possible and optical densities were immediately determined in a spectrophotometer. The E coli host for cloning was

BRL2288 (Pettis et al. 2001), while E. coli strain BL21 (DE3) (Studier et al. 1986) was used to induce expression of recombinant ipomicin protein.

All PCR was performed using the conditions described previously (Pettis et al. 2001) along with the specific primers and templates noted below. Primers were designed by using the Primer Design, version 2 program (Scientific and Educational Software, Cary, NC) and were synthesized by Sigma-Genosys (The Woodlands, TX). Molecular cloning was performed according to standard methods as previously described (Sambrook et al. 1989). Chemical transformation of E. coli (Sambrook et al. 1989), and protoplast transformation of S.

62 coelicolor (Kieser et al. 2000) were performed as described, while electroporation of E. coli

BL21(DE3) was done by using a Gene Pulser II (Bio-Rad, Hercules, CA) following the manufacturer’s instructions. Ampicillin at 50 µg per ml-1 or kanamycin at 25 µg per ml-1 was used where appropriate to select for plasmids in E. coli, while thiostrepton, at 50 µg per ml-1 in agar and 5 µg per ml-1 in liquid medium, respectively, was used for selection of plasmids in

S. coelicolor.

Plasmid pSIP34 was created by first amplifying a 308-bp ipoA DNA fragment using primers ipoA-mut5´ (5´-GACGCGC CCGGCCACCCGGGC-3´), and ipoA-3´ (5´

-AAAAAGATCTCTGTCGCTCAGACGCGCAGG-3´) and the plasmid template pSIP8

(Zhang et al. 2003). The resulting fragment was digested with XbaI and XhoI, blunt ends were generated by using the reagents in a Perfectly Blunt cloning kit (EMD Chemicals, Inc.,

Gibbstown, NJ), and the blunt-ended fragment was then ligated to EcoRV-digested pET30a+ vector (EMD Chemicals, Inc.). The resulting clone, pSIP34, contains the portion of the ipoA

ORF that encodes the mature form of ipomicin cloned in frame with the pET30a+ His-Tag leader sequence. To construct plasmid pSIP40, pSIP8 was partially digested with PstI, and the linearized full-length 3.3kb fragment was cloned into the streptomycete vector pIJ350 (Kieser et al. 1982) at this same site.

The TTA codon in the ipoA gene was converted to CTC by a modification of the two-stage PCR overlap extension method described previously (Ho et al. 1989). Briefly, in the first stage the template was pSIP8 in both PCR reactions, and, in one reaction, a 0.6-kb fragment was amplified with universal SP6 primer (New England Biolabs, Ipswich, MA), and a mutagenic primer containing the desired mutation, ipo-leu-CTC

(5´-GCCTCCGCCCTCCGCGCCGT-3´), while in the other reaction, a 0.4-kb overlapping

63 fragment was amplified by using universal T7 primer (New England Biolabs) and primer ipo-2cycle-2 (5´-TGCCCGGGTGGCCGGGCGCG-3´). The two PCR products were combined, denatured and allowed to re-anneal; Pfu Polymerase (Stratagene, La Jolla, CA) and nucleotides were added, and 6 cycles of PCR were performed in order to fill in the available recessed 3´ ends. The resulting double-stranded DNA was then used as a template in a

15-cycle PCR reaction using the universal SP6 and T7 primers. The resulting 0.9-kb product was digested with XhoI and EcoRI, ligated to the E. coli cloning vector pSP72 (Promega

Corp., Madison, WI) at these sites, and the resulting recombinant clones were sequenced to identify those which contained the TTA to CTC codon change. One of these was digested with

XbaI and EcoRI and the 0.9-kb fragment generated was used to replace the same-sized fragment containing the wild type ipoA gene in pSIP40, with the resulting clone being designated pSIP42. Plasmid pGSP149 has been described previously (Pettis and Cohen 1994).

Plate Bioassays

Aliquots of S. ipomoeae TSB cultures shaking at 30°C were harvested by centrifugation.

The resulting supernatants were filtered through a 0.2 µM filter to remove remaining mycelia and stored at –20°C. Plate bioassays were performed by modification of a previously described method (Zhang et al. 2003). Briefly, for each time point 5 µl of undiluted culture supernatant and 5 µl of a 10-fold dilution of supernatant in 20 mM sodium phosphate buffer

(pH 7.0) were spotted onto SIGA, which had been freshly inoculated with a dense spore suspension of strain 91-01 or strain 88-35. Following incubation at 30°C for 3 days, the resulting zones of inhibition were measured. The diameter of the inhibition zone of undiluted supernatant was the measurement used when a 10-fold dilution of the supernatant did not produce inhibition of at least 4 mm in diameter. When a 10-fold dilution did produce a zone

64 of at least 4 mm, then the measurement used was that diameter multiplied by 10 (i.e., the

“adjusted diameter”). Thus, inhibition zone diameters of greater than or equal to ~40 mm given in the text were the adjusted diameters for those time points. Dilutions of 100 fold were also initially tested but were never found to produce zones of at least 4 mm. The 4-mm diameter cut-off was chosen because inhibition zones smaller than this could not always be accurately distinguished within the lawns of test strains.

Ipomicin Stability Assay

To measure the stability of ipomicin, a 25-ml culture of strain 91-03 was grown to stationary phase, and the supernatant was purified by centrifugation and filtration as described above. The cell-free supernatant was then incubated at 30°C with shaking at 300 rpm, and aliquots were removed at every 24-hour time point up to 7 days; following storage at –20°C where necessary till the end of the assay, all aliquots were then examined for inhibition activity against strain 91-01 by plate bioassay.

RNA Methods

RNA was isolated by using modified Kirby mixture, phenol-chloroform extraction and treatment with DNaseI as described previously (Kieser et al. 2000). For Northern blot analysis,

10-µg (or for some experiments 30-µg) samples of total RNA, along with ssRNA ladder (New

England Biolabs), were electrophoresed overnight at 20 V on 1% agarose gels containing formaldehyde (Sambrook et al. 1989), and were then blotted to Hybond N nylon membrane

(Amersham Pharmacia Biotech, Piscataway, NJ) using the VacuGene XL vacuum blotting system (Amersham Pharmacia Biotech). RNA was cross-linked to membranes by using ultraviolet light. Radiolabeled probes were generated by random priming (Schully and Pettis,

2003) using the 0.9-kb HindIII-BglII fragment of pSIP8 as template for the ipoA probe, or a

65 16S rRNA fragment, which had been generated by PCR using relevant genomic DNA and primers described previously (Wawrik et al. 2005), as a template for the 16S rRNA probe.

Hybridizations were performed as previously described (Brasch et al. 1993).

Generation of Ipomicin Antiserum and Western Blot Analysis

Induction of an ipomicin fusion protein in E. coli BL21 containing plasmid pSIP34, followed by cell fractionation and preparative SDS-PAGE were all performed as described previously (Pettis et al. 2001). A fusion protein band with a molecular mass of ~16 kDa was excised from the gel, and was used as antigen to raise antibodies in a rabbit (as performed by

Animal Pharm Services, Inc. [Healdburg, CA]).

To prepare protein samples for Western blotting, secreted ipomicin proteins were precipitated from cell-free supernatants of relevant S. ipomoeae or S. coelicolor cultures with trichloroacetic acid (TCA). To a 1-ml aliquot of supernatant, bovine serum albumin was added to 0.1 mg per ml-1, TCA was then added to 10% (w/v), and the mixtures were incubated on ice for 30 min, followed by centrifugation at 13,200 rpm for 15 min at 4°C. Pellets were washed with 1 ml acetone, incubated at room temperature for 10 min, and the protein precipitates were then pelleted by centrifugation as described above, dried on ice, and resuspended in 50 µl dH2O. The protein concentration of each sample was determined by using a BIO-RAD Protein Assay according to the manufacturer’s protocol. Western blotting was performed as previously described (Pettis et al. 2001), except that 10-µg protein samples were electrophoresed on 18% SDS-PAGE gels and upon blotting were probed with a 1:1000 dilution of the primary antiserum. The intensity of bands on digital images of Western or

Northern blots was analyzed by using ImageJ (http://rsb.info.nih.gov/ij/index.html). A given

66 band intensity was calculated as the product of the selected pixel area and the mean gray value for those pixels, and the average band intensity from 3 such measurements, along with the associated standard deviation, was reported for each band.

RESULTS AND DISCUSSION

Growth-Regulated Ipomicin Production in S. ipomoeae

The kinetics of ipomicin inhibitor production during growth of S. ipomoeae strain 91-03 were examined by using a plate bioassay (see Methods and Materials for more details).

Initially, as shown in Fig. 3.1 A, the diameter of inhibition zones seen in plate bioassays changed very little during the first four time points despite the fact that the absorbance (600 nm) of the culture increased over 4-fold from 0.13 at the first time point to 0.58 by the fourth time point. By the fifth time point, however, inhibition zone size began to increase significantly by over 4-fold from the previous level (i.e., from 10.7 mm in diameter to 43.3 mm [adjusted diameter]), while the culture density only increased from 0.58 to 0.71. For the remainder of exponential phase, inhibition zones showed a fairly steady increase in adjusted diameter, whereupon their sizes appeared to level off upon entrance of the culture into stationary phase.

To correlate bioassay results with the presence of the 10-kDa ipomicin protein, culture supernatant at the identical time points used for bioassays was analyzed by Western blotting using an antiserum specific for ipomicin protein (Fig. 3.1 B and see Materials and Methods for details). There was good correlation between the size of inhibition zones seen in plate bioassays (Fig. 3.1 A) and the temporal appearance of the 10-kDa ipomicin protein in culture supernatants (Fig. 3.1 B). Measurement of band intensities in Western blots using ImageJ

(http://rsb.info.nih.gov/ij/index.html), for example, revealed that ipomicin concentration

FIG. 3.1. Growth-regulated appearance of ipomicin during culturing of S. ipomoeae strain 91-03 as determined by plate bioassay and Western blotting. (A) Growth curve of strain 91-03 and measurement of bioassay inhibition zones. Spores of S. ipomoeae strain 91-03 (group III) were inoculated into TSB and incubated at 30°C while shaking. At time points throughout growth, aliquots were used either to measure the culture absorbance at 600nm (■) or to test for inhibitor function present in the culture supernatant by the plate bioassay method (□) as described in the Materials and Methods. The data presented is one of six biological replicates that were performed with approximately the same results occurring in each case. Within the one biological replicate shown, there were three independent experimental trials for measurement of ipomicin activity at each time point; the activity results presented are the average diameter or average adjusted diameter of inhibition zones seen in plate bioassays for those three replicates, with the error bars representing the associated standard deviation. The lack of a discernible error bar for a particular time point indicates that there was little or no deviation in diameter or adjusted diameter among the three replicates; (B) Western blots of ipomicin protein. At the same time points used in part A, proteins were precipitated from cell-free supernatant, and 10-µg aliquots were analyzed by Western blotting. The negative control (i.e., lane marked with a minus) was the cell-free supernatant of a culture of S. lividans strain TK23 grown to stationary phase, while the positive control (i.e., lane marked with a plus) was ipomicin protein as contained in purification fraction IV (Zhang et al. 2003). The data presented is one of three biological replicates with approximately the same results obtained in each case; (C) ImageJ analysis of the Western blot shown in part B. Band intensities (in gray values [g.v.]) on the digital image of the Western blot were determined in triplicate with the average intensity being reported for each band along with the associated standard deviation (error bars). The lack of a discernible error bar for a particular time point indicates that there was little or no deviation among the three determinations.

68 A

69 increased approximately 4.3-fold from the fourth to the fifth time point (Fig. 3.1 C), which was in agreement with the change in size of plate bioassay inhibition zones observed over that same time frame.

To address the possibility that growth-regulated ipomicin production was somehow unique to strain 91-03, we performed the same plate bioassay and Western blot analyses on another group III strain (88-29), which was isolated from a separate geographic location from

91-03 and which showed other significant phenotypic and genotypic differences Clark et al.

1998). Congruent temporal patterns of ipomicin inhibition as determined by plate bioassay and ipomicin protein expression were also observed for strain 88-29, with the only significant difference from 91-03 being that relatively more ipomicin inhibitor appeared to be present at each corresponding time point during growth of 88-29 (See Fig. A.1 in Appendix A). Overall, these results suggest that a common mechanism of growth-regulated ipomicin production and/or accumulation exists in S. ipomoeae group III strains.

Evidence of a Post-Transcriptional Control Mechanism

To investigate whether the growth-regulated appearance of ipomicin was controlled at the transcriptional level, the expression pattern of ipoA mRNA was examined by Northern blotting at select identical time points used for bioassays and Western blotting (i.e., time points 2, 5, 9, and 11 from Fig. 3.1). A hybridized band of approximately 500 nucleotides was detected for the S. ipomoeae 91-03 samples (Fig. 3.2 A), which, based on its size, represents a single monocistronic mRNA species for the 393-bp ipoA ORF (Zhang et al. 2003). As expected, the probe did not hybridize to S. lividans strain TK23 total RNA (Fig. 3.2 A).

Unlike the results for ipomicin function and expression, ipoA message did not increase in a temporally-regulated manner (Fig. 3.2 A and 3.2 B). At the earliest time point analyzed by

70 A

600000 ipoA 500000 400000 300000 16S rRNA 200000 100000 0 Band Intensity (g.v.) 012

Absorbance at 600nm

FIG. 3.2. Northern blot of the ipoA message in S. ipomoeae 91-03. (A) For some of the identical time points used in Fig. 3.1, (i.e., time points 2, 5, 9, and 11), total RNA was harvested from mycelia of S. ipomoeae strain 91-03, as well as S. lividans TK23 grown to stationary phase, and approximately equivalent amounts were subjected to Northern blotting analysis using a 32P-labeled probe specific for the ipoA or 16S rRNA gene. Finished blots were visualized by autoradiography. Three biological replicates of the ipoA experiment were performed with similar results in each case; (B) ImageJ analysis of the Northern blots shown in part A. ImageJ analysis was performed as described in the legend to Fig. 3.1.

Northern blotting (absorbance [600 nm] equal to 0.22), the concentration of ipoA mRNA was greater than or equal to the amount seen at the next time point analyzed (absorbance [600 nm] equal to 0.71). As seen in Fig. 3.1, not only was ipomicin at or near its lowest observed concentration when the culture density measured 0.22, but the protein also did not begin to

71 increase in amount until more than 6.5 hours later (i.e., after the fourth time when the culture density measured 0.58). The lack of correlation between intracellular ipoA mRNA concentration and active ipomicin protein in culture supernatants suggested that ipomicin production is regulated post-transcriptionally, and raised the possibility that bldA regulation dictates temporal production of ipomicin. Ipomicin Production in the Heterologous Host S. coelicolor Is Growth Regulated and Dependent on bldA As further analysis of bldA control of ipomicin production in S. ipomoeae was not practical due to a current lack of a system for genetic manipulation in this organism, it was next determined whether the 10-kDa ipomicin protein shows growth-regulated expression in the heterologous host S. coelicolor, which was previously shown to be ipomicin-resistant

(Zhang et al. 2003). Supernatant from culture time points (Fig. 3.3 A) of the wild-type strain

M600 containing plasmid pSIP40, a thiostrepton-resistant plasmid containing a cloned version of the S. ipomoeae ipoA gene, was examined as before by Western blotting (Fig. 3.3

B), and the results were consistent with the notion that ipomicin production in S. coelicolor

M600 (pSIP40) is growth-regulated with the overall pattern appearing very reminiscent of that seen in S. ipomoeae. An analysis of ipoA mRNA concentration in strain M600 containing pSIP40 at the identical time points used for Western blotting showed constitutive expression of the ~500 nucleotide ipoA message (data not shown), a result which confirmed that temporal production of ipomicin is also post-transcriptionally controlled in the heterologous host S. coelicolor.

When the isogenic S. coelicolor bldA null mutant M600∆bldA containing pSIP40 was grown similarly (Fig. 3.3 A) and then analyzed by Western blotting, ipomicin appeared in the culture supernatant in a weak yet temporal manner (Fig. 3.3 B). As equivalent amounts of

72 A

1.6

1.4 1.2 1 0.8 0.6 0.4 0.2

Absorbance at 600nm 0 0 10 20 30 40 50 60 70 Time (h)

FIG. 3.3. Temporal appearance of ipomicin protein as produced by S. coelicolor strains M600 and M600∆bldA containing the cloned ipoA gene. (A) Growth curves of S. coelicolor M600 (■) and M600∆bldA (□) each containing plasmid pSIP40. Spores of M600(pSIP40) or mycelia of M600∆bldA(pSIP40) were inoculated into YEME containing thiostrepton, and these cultures were then incubated at 30°C while shaking. At time points throughout growth, aliquots were used to determine the culture absorbance at 600 nm. (B) Western blots of the 10-kDa ipomicin products as produced by pSIP40-containing M600 versus M600∆bldA. At several of the same time points used in part A, proteins were precipitated from aliquots of cell-free supernatant and analyzed by Western blotting. Precipitated protein from the supernatants of M600(pGSP149) and M600∆bldA(pGSP149) cultures grown similarly to stationary phase were included as negative controls. The data shown in parts A and B are one of three biological replicates for each strain with similar results being obtained in each case.

73 total protein were analyzed in the Western blots for M600(pSIP40) and M600∆bldA(pSIP40), the results demonstrated a strong dependence on bldA for ipomicin production, though relatively weak mistranslation of the ipoA message was also apparently occurring. The temporal appearance of ipomicin in strain M600∆bldA(pSIP40) also suggested that an additional post-transcriptional mechanism(s) was contributing to growth-regulated production and/or accumulation of ipomicin.

To determine whether the reduced yield of ipomicin protein produced by the S. coelicolor bldA mutant was due specifically to the inability to properly translate the TTA codon in ipoA, this codon position in the gene was changed to CTC, an alternate leucine codon whose cognate tRNA appears constitutively throughout Streptomyces growth in contrast to the temporal appearance of the bldA tRNA (Trepanier et al. 1997). A comparison by Western blotting and subsequent ImageJ analysis at single exponential and stationary time points for strain M600∆bldA containing either pSIP40 (wild type ipoA gene) or pSIP42 (ipoA with TTA to CTC codon change) showed increased concentrations of ipomicin in the culture supernatant during both exponential (9-fold more) and stationary (4.5-fold more) phases for

M600∆bldA (pSIP42) as compared to the control (Fig. 3.4 A). Moreover, the amount of ipomicin protein released by pSIP42-containing cells at the exponential time point actually appeared to exceed the amount released by cells containing pSIP40 during stationary phase.

These results contrasted dramatically with concomitant Northern blotting of ipoA where, for reasons undetermined, the concentration of ipoA in M600∆bldA (pSIP40) far exceeded that for M600∆bldA (pSIP42) (Fig. 3.4 B). Taken together, these data thus support a mechanism by which bldA is needed for efficient translation of the TTA codon of the cloned ipoA gene in

S. coelicolor. Given the observation of post-transcriptional control for ipomicin production in

74 A

FIG. 3.4. Western blot of ipomicin protein and concomitant Northern blot of ipoA message for S. coelicolor M600∆bldA containing plasmid pSIP40 versus pSIP42. (A) Western blot of ipomicin protein. Mycelia of M600∆bldA(pSIP40) and M600∆bldA(pSIP42) were inoculated into YEME containing thiostrepton, incubated at 30°C with shaking, and at single time points indicative of exponential and stationary phase growth, proteins were precipitated from aliquots of cell-free supernatant and analyzed by Western blotting. Precipitated protein from the supernatant of a M600∆bldA(pGSP149) culture grown similarly to stationary phase was included as a negative control. The experiment shown was one of three biological replicates with approximately the same results being obtained in each case; (B) Northern blot of ipoA message. At the identical timepoints used in part A, total RNA was isolated and subjected to Northern blotting as described in the legend to Fig. 2. The ipoA data is derived from a single blot; however, the M600∆bldA(pSIP40) side was subjected to autoradiography for 1 h versus 4 h for the M600∆bldA(pSIP42) portion.

both S. ipomoeae and S. coelicolor along with evidence of a conserved mechanism of bldA regulation throughout the Streptomyces genus (i.e., non-random distribution of TTA codons, similarity of bldA mutant phenotypes among species) (Chandra and Chater 2008), it seems

75 likely that bldA control similarly regulates production of ipomicin in the natural S. ipomoeae host. Confirmation of this assertion awaits development of a system for the genetic manipulation of S. ipomoeae.

Stability of Ipomicin under Extended Incubation Conditions

Given the temporal appearance of ipomicin even in the S. coelicolor bldA null mutant containing plasmid pSIP40 (or pSIP42), it was next determined whether the apparent stability of ipomicin noted previously (Zhang et al. 2003), may contribute to its pattern of appearance seen here. Filtered supernatant from a stationary phase culture of S. ipomoeae strain 91-03 was subjected to extended incubation at 30°C with daily assessment of ipomicin inhibition function by the plate bioassay method. No significant difference in inhibition zone size was observed after 24 h of incubation, while an approximate 50% reduction in adjusted diameter occurred after 48 h (Fig. 3.5 A). At 72 h and beyond, inhibition zones were greatly diminished in size or were absent indicating that little or no ipomicin inhibitory activity remained. An analysis of the ipomicin protein at these same time points by Western blotting showed no change in concentration of the protein during the 7-day incubation of the supernatant (Fig. 3.5

B); this finding indicated that inactivation rather than degradation of ipomicin was responsible for the loss of activity observed in the assay. Although the results here may not be entirely representative of the pattern of ipomicin inactivation/degradation in an actively growing culture, they are nevertheless consistent with the notion that active ipomicin protein stably accumulates during growth of S. ipomoeae and that such an effect is likely to contribute to the temporal appearance of ipomicin in culture supernatants. This stability data may also have important implications for the potential use of ipomicin as a biological agent for preventing infection of sweet potatoes by S. ipomoeae.

76 A

FIG. 3.5. Ipomicin stability assay. (A) Plate bioassay of stability assay time points. Cell-free supernatant from a S. ipomoeae strain 91-03 stationary phase culture was incubated at 30ºC while shaking for a total of 7 days. At every 24 h time point, an aliquot was removed, stored at -20 ºC days until the 7-day incubation period was completed, and the aliquots were then tested for inhibitory activity by the plate bioassay as described in Materials and Methods. The data presented is one of three biological replicates that were performed with approximately the same results occurring in each case. Within the one biological replicate shown, three independent experimental trials for determination of ipomicin activity at each time point were performed; the activity results presented are the average diameter or average adjusted diameter of inhibition zones seen in plate bioassays for those three replicates, with the error bars indicating standard deviation. The lack of a discernible error bar for a particular time point indicates that there was little or no deviation in diameter or adjusted diameter among the three replicates. (B) Western blot of stability assay time points. At the same time points used in part A, proteins were precipitated and analyzed by Western blotting. The negative control was the cell-free supernatant of a culture of S. lividans strain TK23 grown to stationary phase.

TTA-containing Streptomyces genes are typically species specific, apparently non-essential in function, and often show evidence of relatively recent lateral transmission

(Chandra and Chater 2008, Li et al. 2007). The possible origin of the ipomicin structural gene

77 ipoA in S. ipomoeae and mechanism of action of ipomicin currently remain unknown, and no homologs exist for either in the databases. Nevertheless, bldA translational control of the single TTA codon in ipoA was shown here to contribute greatly to the temporal pattern of ipomicin production seen in S. coelicolor and it was very likely the basis for the analogous pattern of production seen in the native host S. ipomoeae. To our knowledge, ipomicin is the first Streptomyces bacteriocin shown to be dependent on bldA for its expression. Moreover, the results with S. coelicolor showed that bldA regulation of ipomicin expression occurs upon introduction of the single TTA-containing ipoA gene into a heterologous host. This situation, which has implications for potential lateral transmission of ipoA, thus contrasts with typical bldA control of antibiotic production in Streptomyces spp. where TTA codons reside in key regulatory genes (Chater 2006).

REFERENCES Brasch, M. A., G. S. Pettis, S. C. Lee, and S. N. Cohen. 1993. Localization and nucleotide sequences of genes mediating site-specific recombination of the SLP1 element in Streptomyces lividans. J. Bacteriol. 175:3067-3074.

Champness, W. C., and K. F. Chater. 1994. Regulation and integration of antibiotic production and morphological differentiation in Streptomyces spp., p. 61-93. In P. Piggot, J. C.P. Moran, and P. Youngman (ed.), Regulation of Bacterial Differentiation. American Society for Microbiology, Washington, D.C.

Chandra, G., and K. F. Chater. 2008. Evolutionary flux of potentially bldA-dependent Streptomyces genes containing the rare leucine codon TTA. Antonie Van Leeuwenhoek 94:111-126.

Chater, K. F. 1993. Genetics of differentiation in Streptomyces. Annu. Rev. Microbiol. 47:685-713.

Chater, K. F. 2006. Streptomyces inside-out: a new perspective on the bacteria that provide us with antibiotics. Phil. Trans. R. Soc. B 361:761-768.

Chater, K. F. 1998. Taking a genetic scalpel to the Streptomyces colony. Microbiol. 144:1465-1478.

78 Clark, C. A., C. Chen, N. Ward-Rainey, and G. S. Pettis. 1998. Diversity within Streptomyces ipomoeae based on inhibitory interactions, rep-PCR, and plasmid profiles. Phytopathology 88:1179-1186.

Clark, C. A., and A. Lawrence. 1981. Morphology of spore-bearing structures in Streptomyces ipomoea. Can. J. Microbiol. 27:575-579.

Clark, C. A., and J. W. Moyer. 1988. Compendium of sweet potato diseases. The American Phytopathological Society, St. Paul, MN.

Hesketh, A., G. Bucca, E. Laing, F. Flett, G. Hotchkiss, C. P. Smith, and K. F. Chater. 2007. New pleiotropic effects of eliminating a rare tRNA from Streptomyces coelicolor, revealed by combined proteomic and transcriptomic analysis of liquid cultures. BMC Genomics 8:261.

Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59.

Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, England.

Leskiw, B. K., R. Mah, E. J. Lawlor, and K. F. Chater. 1993. Accumulation of bldA-specified tRNA is temporally regulated in Streptomyces coelicolor A3(2). J. Bacteriol. 175:1995-2005.

Perkins, D. D. 1962. Preservation of Neurospora stock cultures with anhydrous silica gel. Can. J. Microbiol. 8:591-594.

Pettis, G. S., and S. N. Cohen. 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13:955-964.

Pettis, G. S., N. Ward, and K. L. Schully. 2001. Expression characteristics of the transfer-related kilB gene product of Streptomyces plasmid pIJ101: implications for the plasmid spread function. J. Bacteriol. 183:1339-1345. 79 Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.

Schully, K. L., and G. S. Pettis. 2003. Separate and coordinate transcriptional control mechanisms link expression of the potentially lethal kilB spread locus to the upstream transmission operon on Streptomyces plasmid pIJ101. J. Mol. Biol. 334:875-884.

Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130.

Trepanier, N. K., G. D. Nguyen, P. J. Leedell, and B. K. Leskiw. 1997. Use of polymerase chain reaction to identify a leucyl tRNA in Streptomyces coelicolor. Gene 193:59-63.

Wawrik, B., L. Kerkhof, G. J. Zylstra, and J. J. Kukor. 2005. Identification of unique type II polyketide synthase genes in soil. Appl. Environ. Microbiol. 71:2232-2238.

Zhang, X., C. A. Clark, and G. S. Pettis. 2003. Interstrain inhibition in the sweet potato pathogen Streptomyces ipomoeae: purification and characterization of a highly specific bacteriocin and cloning of its structural gene. Appl. Environ. Microbiol. 69:2201-2208.

CHAPTER FOUR: PRELIMINARY ANALYSIS OF PRODUCTION OF IPOMICIN IN STREPTOMYCES IPOMOEAE SUSCEPTIBLE STRAINS AND EXPRESSION CHARACTERISTICS OF THE GROUP II INHIBITOR

81 INTRODUCTION

Bacteriocins are antimicrobial proteinaceous substances produced by some strains of bacteria that inhibit growth of closely related species (Jack et al. 1995). The relatively narrow inhibitory spectra and few side effects of bacteriocins provide a potential strategy to develop effective and safe bio-agents for plant disease control (Montesinos 2007). However, very little is known about bacteriocin production in plant pathogenic bacteria, especially gram-positive pathogens. The first bacteriocin characterized from the latter group was the Streptomyces ipomoeae group III inhibitor ipomicin (Zhang et al. 2003). The other reported highly specific bacteriocin is a 14-kDa antimicrobial protein produced by the tomato pathogen Clavibacter michiganensis ssp. Michiganensis (Holtsmark et al. 2007).

Ipomicin is a 10-kDa protein which kills susceptible S. ipomoeae strains, but has no effect on the growth of a variety of bacterial genera examined, including several other streptomycete species (Zhang et al. 2003). The structural gene that encodes ipomicin is designated ipoA. Nucleotide sequence of the ipoA gene and deduced amino acid sequence of ipomicin have been determined. Protein sequencing showed that ipomicin is expressed as a

131-amino-acid precursor, which is processed to a 10-kDa mature protein by cleavage of the

N-terminal 35-amino-acid signal sequence (Zhang et al. 2003).

Surprisingly, the ipoA gene was not only identified in representative ipomicin-sensitive strains of S. ipomoeae inhibition group I and II (i.e., strain 78-61 for group I, strain 88-35 for group II, Fig. 4.1 A), but it was also found to be transcribed in these strains (Fig. 4.1 B) and there were no mutations found in either the ipoA ORF or promoter region in these group I and

II representatives (Schully 2005). Since the susceptible strains can not release the active

82 ipomicin, it is interesting to investigate whether the group I and II strains lack the functions to translate the ipoA message, or perhaps lack the putative ability to post-translationally modify or transport the ipomicin protein.

FIG. 4.1. Representatives of all three inhibition groups of S. ipomoeae express the ipoA gene. (A) PCR amplification of the ipoA ORF. Plasmid pSIP7 containing the ipoA ORF (lane 1), genomic DNA of S. coelicolor strain M145 (lane2), S. ipomoeae group I strain 78-61 (lane 3), group II strain 88-35 (lane 4), and group III strain 91-03 (lane 5) were used as the template for PCR to amplify the ipoA ORF. The resulting products were analyzed by agarose gel. (B) Northern blot analysis of the ipoA mRNA. RNA from S. ipomoeae strains 78-61 (lane 1), 88-35 (lane 2), and 91-03 (lane 3) was analyzed by Northern blot using a probe specific for the ipoA gene. (Reproduced from Schully 2005). 83 In this study, I examined the appearance of ipomicin in culture supernatants of thirty-six

S. ipomoeae strains, and revealed that most members of group I and II produce and secrete some form of ipomicin. In the few strains that did not appear to produce ipomicin, mutations were identified within the ipoA gene and its promoter region.

Another putative bacteriolytic substance produced by S. ipomoeae inhibition group II strains is inhibitory to group I and III strains (Clark et al. 1998). The study of the inhibitor from group II strains has lagged far behind the group III inhibitor ipomicin because the group

II inhibitor was thought to be cell-associated and thus difficult to isolate. In this chapter, I gave evidence that this inhibitory substance is also released into the supernatant of group II broth cultures. I also examined the kinetics of production of this inhibitor during growth of a representative group II strain, and found that the active form of the inhibitor was only observed during exponential growth.

MATERIALS AND METHODS

Bacterial Strains and Bacteriological Biology Methods

The thirty-six S. ipomoeae strains analyzed are listed in table 4.1. S. ipomoeae spores were preserved on S. ipomoeae growth agar (SIGA) (Clark et al. 1998, Clark and Lawrence

1981), and liquid cultures were grown in Tryptic Soy Broth (TSB, Difco, Detroit, MI). S. coelicolor strain M145 (Bentley et al. 2002) spores were maintained on SIGA while mycelia were grown in yeast extract-malt extract (YEME) medium (Kieser et al. 2000). Absorbance

(600nm) readings of Streptomyces cell mass were measured as described (Wang et al. 2009).

Molecular Biology Methods

Genomic DNA was isolated and purified as described (Qin et al. 1998). PCR was performed as described (Pettis et al. 2001) by using Pfu polymerase (Stratagene, La Jolla, CA)

84 Table 4.1 Inhibition groups of strains of S. ipomoeae determined in Clark et al. 1998.

Group I 78-49, 78-51, 78-57, 78-60, 78-61, 78-62, 88-06, 91-01, B-16470, La-1 Group II 88-33, 88-34, 88-35, 88-36, 90-01, 90-02, 90-03, 90-04, 90-05, B-16480, B-16482, B-16483, B-16485, B-16488, B-16489

Group III 81-44, 81-45, 88-03, 88-04, 88-07, 88-08, 88-16, 88-29, 91-03, 92-03 Not Grouped B12321

for cloning-related amplification, and AmpliTaq DNA Polymerase (Applied Biosystems Inc.,

Foster City, CA) for identification of ipoA with the genomic DNA of appropriate Streptomyces strains as templates and the primers: recDxtn (5’-GCCCCTCCCGACTGACCATG-3’) ipoA3’ (5’-AAAAAGATCTCTGTCGCTCAGACGCGCAGG-3’) (Schully 2005). DNA sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Kit

(Applied Biosystems Inc., Foster City, CA) as described (Qin and Cohen, 1998), along with primer recDxtn or ipoA3’, and the PCR amplified ipoA fragments as templates.

Plate Bioassays and Inhibition Assays

Plate bioassays were performed according to the methods described previously (Wang et

al. 2009), except that interstrain inhibition phenotypes of S. ipomoeae strains 91-03, 92-03,

and 91-01 were also determined against strain B16480 by using the inhibition assay method

described (Clark et al. 1998). Briefly, a 5-µl drop of spore suspension of liquid culture grown

to stationary phase was spotted onto a lawn of the test strain which was freshly spread over

the surface of dried SIGA medium (Clark et al. 1998, Clark and Lawrence 1981). After

incubation at 30°C for 3 days, the resulting zones of inhibition were then measured.

85 Western Blot Analysis

Generation of ipomicin antiserum, preparation of protein samples and Western blot analysis were all performed as described previously (Wang et al. 2009). Cell extracts of relevant strains were prepared as described (Ingram et al. 1989).

RESULTS AND DISCUSSION

Most Group I and II Strains Produce a Form of Ipomicin Protein

To examine the production of the 10-kDa ipomicin protein in susceptible (group I and II) and resistant (group III) strains, culture supernatant of each of the thirty-six S. ipomoeae strains was analyzed by Western blotting using an antiserum against the ipomicin protein

(Wang et al. 2009). The appearance of the 10-kDa ipomicin protein was detected in the culture supernatants of thirty-three strains. Only 91-01 (group I), B12321 (ungrouped) and, unexpectedly, group III strain 92-03 were the exceptions (Fig. 4.2 A). To test the possibility that strains lacking ipomicin in their culture supernatant actually produce the protein but do not secrete it, the presence of the 10-kDa ipomicin protein in cell extracts of 92-03 and

B12321 was probed by Western blotting. The results showed no evidence of ipomicin in cell extracts (Fig. 4.2 B) for these two strains. Overall, these initial results indicated that most susceptible strains produce and transport an apparently inactive form of 10-kDa ipomicin protein.

The appearance of ipomicin protein in culture supernatants of most members of the ipomicin-sensitive S. ipomoeae group I and II strains is surprising since ipomicin is toxic to these strains. It seems logical that ipomicin released by these susceptible strains represents some inactive forms that differ from the active inhibitor in structural or chemical features.

FIG. 4.2. Western blots of ipomicin protein. (A) Analysis of culture supernatants for the thirty-six S. ipomoeae strains. Spores of thirty-six S. ipomoeae strains were inoculated individually into TSB and incubated at 30°C while shaking until stationary phase. Proteins were precipitated from cell-free supernatant of the cultures and 10-µg aliquots were analyzed by Western blotting. The negative control was the cell-free supernatant of a culture of S. lividans strain TK23 grown to stationary phase. Western blots in 91-01, 92-03, B12321 were repeated in two biological replicates with the same results obtained in each case. (B) No ipomicin protein in equivalent amounts of cell-free supernatants and cell extracts of strains 92-03 and B12321. Lane 1, 91-03 supernatant (positive control); Lane 2, B12321 supernatant; Lane 3 92-03 supernatant; Lane 4, B12321 cell extract; Lane 5, 92-03 cell extract.

87 A

88 Post-translational modifications of bacteriocins produced by gram-positive bacteria and microcins from gram-negative have been well documented (Jack et al. 1995, Jack and Jung

2000). My results strongly suggest that ipomicin produced in group III strain undergoes post-translational modification to generate bacteriolytic activities, a possibility which awaits demonstration by Mass Spectrometry.

Mutations within the ipoA Gene of S. ipomoeae Strains 91-01, B12321, and 92-03

Unlike all other S. ipomoeae strains tested, ipomicin protein wasn’t detected in culture supernatants of 91-01, B12321, and 92-03, and it was also not found in cell extracts of 92-03 and B12321 by Western blotting (Fig 4.2 A and B). Therefore PCR was performed to determine whether these three strains lack the ipoA gene or its promoter region. The primers were specific for the 3’ end of the ipoA ORF and the 5’ end of the adjacent recD gene such that both the ipoA ORF and the promoter region could be amplified. The results revealed the ipoA gene is present in the genomic DNA of all three strains (Fig. 4.3). Moreover, the

PCR-amplified fragments of 91-01, B12321, and 92-03 migrated to the same position as that of the positive control 91-03 and 88-35. No significant difference in size indicated that there is no obvious deletion or insertion of DNA in the ipoA gene in these strains (Fig. 4.3).

Then sequencing of these fragments revealed there are some mutations within both the ipoA structural gene and the promoter region in all three strains, most of which are single base substitutions. Surprisingly the mutations displayed in group I strain 91-01 and group III strain

92-03 are exactly the same but different from those in B12321 (Fig. 4.4). All mutations within the ipoA ORF are silent mutations. For example, the 7th codon GCA in the wild-type ipoA gene and GCG in the mutated versions both designate alanine (Fig. 4.4). Because mutations

FIG. 4.3. Detection of the ipoA gene in S. ipomoeae strains 91-01, 92-03 and B12321 by PCR amplification. Genomic DNA of S. ipomoeae strain 91-01 (group I, lane1), strain B12321 (ungrouped, lane 2), strain 92-03 (group III, lane 3), strain 88-35 (group II, lane 4), strain 91-03 (group III, lane 5), and S. coelicolor strain M145 (lane 6) were used as the template for PCR involving primers recDxtn and ipoA3’, which specifically amplifies the ipoA ORF and its promoter region. The resulting products were electrophoresed on a 1% agarose gel containing ethidium bromide, visualized under UV light and a digital image was recorded using an Engle Eye II still video system (Stratagene, La Jolla, CA). A 1-kb plus DNA ladder (Invitrogen, Carlsbad, CA) was used as a size marker (lane M).

within the structural gene do not result in amino acid change in the ipomicin protein, such mutations are unlikely to result in defective production of ipomicin. However, there is a T to

C change within the putative -10 promoter element in the three strains, and a C to T change within the putative -35 element of the ipoA gene in 90-01 and 92-03 (Fig 4.4). It is possible that such mutations within the putative promoter region negatively affect transcription initiation. Expression of the ipoA in 90-01, 92-03 and B12321 could be determined by

Northern blot and compared to the wild-type strain 91-03 to examine this possibility.

Inhibition Phenotypes of S. ipomoeae Strain 92-03

The failure to detect ipomicin in either culture supernatant or cell-extracts of S. ipomoeae group III strain 92-03 by Western blot (Fig. 4.2 B) was unexpected. To test whether our stock of strain 92-03 produces results consistent with the inhibition phenotype as determined previously (Clark et al. 1998), inhibitory activity of strain 92-03 was determined. My results confirmed the group III inhibition phenotype of 92-03 since upon incubation significant

FIG. 4.4. Nucleotide sequence alignment of the ipoA gene in S. ipomoeae strains 91-03, 91-01, 92-03, and B12321. Amino acids are indicated by their one-letter designations below the nucleotide sequence. The mutations in 91-01, 92-03, and B12321 are indicated in bold. Putative -10 and -35 elements of promoter of the ipoA gene in 91-03 (Schully 2005) are indicated and underlined.

91 91-03 1 GATCCGACGGTACCGCCCGGGTCGGACAACGGGAGCGAGTCGGCGTACGC 91-01 1 GATCCGACGGTACCGCCAGGGTCGGACAACGGGAGCGACTCGGCGTATGC 92-03 1 GATCCGACGGTACCGCCAGGGTCGGACAACGGGAGCGACTCGGCGTATGC B12321 1 GATCCGACGGTACCGCCCGGGTCGGACAACGGGAGCGAGTCGGCGTACGC

91-03 51 GACCTGCTCGAAAGCGACCGCTCAGTAAAACCACAGGGTAATCCTTCTTC 91-01 51 GACCTGCTCGAAAGCGACCGCTCAGTAAAACCACAGGGTAATCCTTCTTC 92-03 51 GACCTGCTCGAAAGCGACCGCTCAGTAAAACCACAGGGTAATCCTTCTTC B12321 51 GACCTGCTCGAAAGCGACCGCTCAGTAAAACCACAGGGTAATCCTTCTTC

91-03 101 ACCTTTCAATCACAAGAAGAGACCGAACTTTACACTTCAAGCATCATCTG 91-01 101 ACCTTTCAATCACAAGAAGAGACCGAACTTTACACTTCAAGCATCACCTG 92-03 101 ACCTTTCAATCACAAGAAGAGACCGAACTTTACACTTCAAGCATCACCTG B12321 101 ACCTTTCAATCACAAGAAGAGACCGAACTTTACACTTCAAGCATCACCTG

-35 -10 91-03 151 GAATGCGGTTGTCCATTTCCTCCATGGTAAGATGAAAAGGCCGCCCCCCA 91-01 151 GAATGCGGTTGTTCATTTCCTCCGTGGCAAGATGAAAAGGCCGCCCCCCA 92-03 151 GAATGCGGTTGTTCATTTCCTCCGTGGCAAGATGAAAAGGCCGCCCCCCA B12321 151 GAATGCGGTTGTCCATTTCCTCCGTGGCAAGATGAAAAGGCCGCCCCCCA

91-03 201 CACAAGGTCGGCTCCCAGTGAGAAACTTTTGAAGGAGCTCCTGAATGCGA 91-01 201 CACAAGGTCGGCTCCCCAGTGAGAAACTTTTGAAGGAGCTCCTGAATGCGA 92-03 201 CACAAGGTCGGCTCCCCAGTGAGAAACTTTTGAAGGAGCTCCTGAATGCGA B12321 201 CACAAGGTCGGCTCCCAGCGAGAAACTTTTGAAGGAGCTCCTGAATGCGA ipoA > M R

91-03 251 TTCGGAAAGCCCGCACGGAAAGCCTCCGCCTTACGCGCCGTCGGCGCCCT 91-01 251 TTCGGAAAGCCCGCGCGGAAAGCCTCCGCCTTACGCGCCGTCGGCGCCCT 92-03 251 TTCGGAAAGCCCGCGCGGAAAGCCTCCGCCTTACGCGCCGTCGGCGCCCT B12321 251 TTCGGAAAGCCCGCGCGGAAAGCCTCCGCCTTACGCGCCGTCGGCGCCCT F G K P A R K A S A L R A V G A L

91-03 301 TTGCCTGGCCGCCGCCGTGACCGGCGCCATCGCGGCCCCCGCCCAGGCCG 91-01 301 TTGCCTGGCCGCCGCCGTGACCGGCGCCATCGCGGCCCCCGCCCAGGCCG 92-03 301 TTGCCTGGCCGCCGCCGTGACCGGCGCCATCGCGGCCCCCGCCCAGGCCG B12321 301 TTGCCTGGCCGCCGCCGTGACCGGCGCCATCGCGGCCCCCGCCCAGGCCG C L A A A V T G A I A A P A Q A D

91-03 351 ACGCGCCCGGCCACCCGGGCAAGCACTATCTGCAGGTGAACGTGCCATCG 91-01 351 ACGCGCCCGGCCACCCGGGCAAGCACTATCTGCAGGTGAACGTGCCATCG 92-03 351 ACGCGCCCGGCCACCCGGGCAAGCACTATCTGCAGGTGAACGTGCCATCG B12321 351 ACGCGCCCGGCCACCCGGGCAAGCACTATCTGCAGGTGAACGTGCCTTCG A P G H P G K H Y L Q V N V P S

92 FIG. 4.4 continued

91-03 401 GACGTCCGCACCATCGGGGTCGCCGGTGGCGGTGTGCAGCAGTGTTTCCG 91-01 401 GACGTCCGCACCATCGGGGTCGCCGGTGGCGGCGTGCAGCAGTGTTTCCG 92-03 401 GACGTCCGCACCATCGGGGTCGCCGGTGGCGGCGTGCAGCAGTGTTTCCG B12321 401 GACGTCCGCACCATCGGGGTCGCCGGTGGCGGTGTGCAGCAGTGTTTCCG D V R T I G V A G G G V Q Q C F R

91-03 451GGTCACACCGGGTGCGTGGAACGACACCAGGGCACTCGTCAGCAACGGCG 91-01 451GGTCACACCGGGTGCGTGGAACGACACCAGGGCACTCGTCAGCAACGGCG 92-03 451GGTCACACCGGGTGCGTGGAACGACACCAGGGCACTCGTCAGCAACGGCG B12321 451GGTCACACCGGGTGCGTGGAACGACACCAGGGCACTCGTCAGCAACGGCG V T P G A W N D T R A L V S N G A

91-03 501 CCCAGGTCGAGGTCTGGGGATACACCGTGGCCGACTGCGCCAACCGCACC 91-01 501 CCCAGGTCGAGGTCTGGGGATACACCGTGGCCGACTGCGCCAACCGCACC 92-03 501 CCCAGGTCGAGGTCTGGGGATACACCGTGGCCGACTGCGCCAACCGCACC B12321 501 CCCAGGTCGAGGTCTGGGGATACACCGTGGCCGACTGCGCCAACCGCACC Q V E V W G Y T V A D C A N R T

91-03 551 ACGGCAAACCAGAAGTACTACGACAAGGCCGCCGCCCCCTCGGACTCCTC 91-01 551 ACGGCAAACCAGAAGTACTACGACAAGGCCGCCGCCCCCTCGGACTCCTC 92-03 551 ACGGCAAACCAGAAGTACTACGACAAGGCCGCCGCCCCCTCGGACTCCTC B12321 551 ACAGCAAACCAGAAGTACTACGACAAGGCCGCCGCCCCCTCGGACTCCTC T A N Q K Y Y D K A A A P S D S S

91-03 601 CACCTATTTCTGGTTCACGCTGAAGAACCTGCGCGTCTGA 91-01 601 CACCTATTTCTGGTTCACACTGAAGAACCTGCGCGTCTGA 92-03 601 CACCTATTTCTGGTTCACACTGAAGAACCTGCGCGTCTGA B12321 601 CACCTATTTCTGGTTCACACTGAAGAACCTGCGCGTCTGA T Y F W F T L K N L R V *

inhibition nearly the size of that for strain 91-03 resulted when 92-03 spores were spotted on a lawn of group II strain B16480 (Fig 4.5). Interestingly, a relatively very small inhibition zone was also observed when cell-free supernatant of 92-03 was used. It is possible that production of ipomicin in strain 92-03 is greatly reduced (e.g. due to the putative promoter mutations noted earlier) so that ipomicin protein is too low to be detected by Western blot, whereas

92-03 cells nevertheless still retain measurable inhibitory activity in plate bioassays using two

93 A

Inhibition Zone(mm) 5

0 91-01 92-03 91-03

FIG. 4.5. Inhibition phenotypes of 92-03 determined by plate bioassays. (A) Examples of plate bioassays. 5 µl aliquot of cell suspensions (C) and cell-free supernatants (S) of S. ipomoeae strains 91-01, 92-03, and 91-03 were inoculated side by side onto each lawn of spores of S. ipomoeae strains B16480 on S. ipomoeae growth agar (SIGA) and plates were incubated for 3 days until sporulation. The data presented is one of three biological replicates. Either a very small inhibition zone (as shown) or no zone was observed in 92-03 supernatants. (B) Within the one biological replicate shown in (A), there were three independent experimental trials for measurement of inhibitory activity in cell suspensions (solid bar) and cell-free supernatants (open bar) of 91-01, 92-03, and 91-03. The activity results presented are the average diameter of inhibition zones seen in plate bioassays for those three replicates, with the error bars representing the associated standard deviation.

94 variations of the plate bioassay method: inoculating test lawns of a susceptible strain with either 92-03 culture supernatant as described previously (Wang et al. 2009), or with a 92-03 spore suspension as described (Clark et al. 1998).

Growth-Regulated Production of Group II Inhibitor in S. ipomoeae

While the group III inhibitor ipomicin has been purified (Zhang et al. 2003) and its expression has been studied in Chapter Three and Four here, no information is currently available regarding the group II inhibitor. To begin analysis of this inhibitor, spores of S. ipomoeae group II strains 90-01, B16480, and 88-35 were inoculated separately into liquid

TSB and incubated at 30°C while shaking, and cell-free supernatants were isolated at one time point during the exponential phase, and at another time point during the stationary phase.

The inhibitory activity of the two samples was examined by using a plate bioassay. As shown in Fig. 4.6, at the first time point, the inhibition zone was apparent; while at the second time point, no inhibition zone was found to be produced. This result suggested that the group II inhibitor is produced and released into culture supernatant only during exponential phase in liquid culture. The temporal production pattern of the group II inhibitor during growth of

88-35 was further examined again by the plate bioassay. Inhibitory activity was determined by measuring the diameter of the inhibition zones. As shown in Fig. 4.7, the activity became evident about 28 h post inoculation. By mid-exponential phase, the inhibitor reached its highest activity where subsequently it began to lose activity dramatically. As the culture transitioned into stationary phase, no inhibitory activity could be detected.

The temporal pattern of production of the group II inhibitor for 88-35 contrasts greatly with the pattern of the ipomicin inhibitor production in the group III strain 91-03 (Fig. 3.1 A,

Chapter 3). The inhibitory activity is detected only during the exponential phase of growth,

FIG. 4.6. Temporal release of active form of S. ipomoeae group II inhibitor determined by plate bioassay. Spores of S. ipomoeae group II strains 90-01, B16480, 88-35, were inoculated into liquid TSB and incubated at 30°C while shaking. 1 ml aliquots were harvested at two time-points during growth (one time-point during the exponential phase, and the other one time-point during the stationary phase), and culture supernatants were then filtered. 5 µl of each sample were spotted onto SIGA inoculated with a lawn of S. ipomoeae spores. From top to bottom, the lawns are of 91-01 (group I), B16480 (group II), 91-03 (group III). Plates incubated at 30°C for 3 days.

97 3 60

2.5 50

2 40

1.5 30

1 20 Inhibition Zone(mm) Inhibition Absorbance @ 600nm Absorbance 0.5 10

0 0 20 30 40 50 60 Time (h)

FIG. 4.7. Growth-regulated appearance of active group II inhibitor during culturing of S. ipomoeae strain 88-35 as determined by plate bioassay. Growth curve of strain 88-35 and measurement of bioassay inhibition zones. Spores of S. ipomoeae strain 88-35 (group II) were inoculated into TSB and incubated at 30°C while shaking. At time points throughout growth, aliquots were used either to measure the culture absorbance at 600nm (■) or to test for inhibitor function present in the culture supernatant by the plate bioassay method (□) as described in Wang et al. 2009. The data presented is one of three biological replicates that were performed with approximately the same results occurring in each case.

suggesting that production of the group II inhibitory substance is growth-phase dependent.

Interestingly, the similar growth-regulated pattern was observed in the production of active microcin E492, a low molecular weight channel-forming bacteriocin in K. pneumoniae

RYV492 (Corsini et al. 2002). Active microcin E492 is expressed only in the exponential phase of growth. An inactive form was found to be produced in stationary phase and may be caused by the absence of transcription of the maturation genes (Corsini et al. 2002). So the other possibility is that the S. ipomoeae group II inhibitor is made in an active form in the exponential phase whereas an inactive form is produced in the stationary phase during growth.

98 Studies of the group II inhibitor await purification of the inhibitory substance and identification of its putative structural gene, results that will ultimately improve our knowledge of inhibition production in S. ipomoeae and may also lead to the development of a potentially highly efficient biocontrol agent.

REFERENCES Bentley, S. D., K. F. Chater, A. -M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quall, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. -H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. -A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417: 141-147.

Clark, C. A., C. Chen, N. Ward-Rainey, and G. S. Pettis. 1998. Diversity within Streptomyces ipomoeae based on inhibitory interactions, rep-PCR, and plasmid profiles. Phytopathology 88:1179-1186.

Clark, C. A., and A. Lawrence. 1981. Morphology of spore-bearing structures in Streptomyces ipomoea. Can. J. Microbiol. 27:575-579.

Corsini, G., M. Baeza, O. Monasterio, and R. Lagos. 2002. The expression of genes involved in microcin maturation regulates the production of active microcin E492. Biochimie 84: 539-544.

Holtsmark, I., D. Mantzilas, V. G. Eijsink, and M. B. Brurberg. 2007. The tomato pathogen Clavibacter michiganensis ssp. michiganensis: producer of several antimicrobial substances. J. Appl. Microbiol. 102: 416-423.

Ingram, C., M. Brawner, P. Youngman, and J. Westpheling. 1989. xylE functions as an efficient reporter gene in Streptomyces spp.: use for the study of galP1, a catabolite-controlled promoter. J. Bacteriol. 171: 6617-6624.

Jack, R. W., and Jung, G. 2000. Lantibiotics and microcins: polypeptided with unusual chemical diversity. Curr. Opin. Chem. Biol. 4: 310-317.

Jack, R. W., J. R. Tagg, and B. Ray. 1995. Bacteriocins of gram-positive bacteria. Mibrobiol. Rev. 59: 171-200.

Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, England. 99 Montesinos, E. 2007. Antimicrobial peptides and plant disease control. FEMS Microbiol. Lett. 270: 1-11.

Qin, Z., and S. N. Cohen. 1998. Replication at the telomeres of the Streptomyces linear plasmid pSLA2. Mol. Microbiol. 28: 893-903.

Wang, J., K. L. Schully, and G. S. Pettis. 2009. Growth-regulated expression of a bacteriocin, produced by the sweet potato pathogen Streptomyces ipomoeae, that exhibits interstrain inhibition. Appl. Environ. Microbiol. 75: 1236-1242.

Zhang, X. C. A. Clark, and G. S. Pettis. 2003. Interstrain inhibition in the sweet potato pathogen Streptomyces ipomoeae: purification and characterization of a highly specific bacteriocin and cloning of its structural gene. Appl. Environ. Microbiol. 69: 2201-2208.

100

CHAPTER FIVE: SUMMARY AND FUTURE DIRECTIONS

101 The Gram-positive bacterial genus Streptomyces spp. produce thousands of antibiotics, which are valued in medicine, agriculture, and as unique biochemical tools (Kieser et al.

2000). Many Streptomyces species are capable of transferring genetic material via the transfer functions encoded by conjugative plasmids, and evidence now suggests that the conjugation process in Streptomyces is novel. A better understanding of this unique mechanism will allow for greater genetic manipulation of streptomycetes, which should improve our ability to construct strains that produce new forms of antibiotics. My stories span two areas of

Streptomyces biology. The first has concentrated on the molecular mechanisms that govern

Streptomyces conjugation using the circular plasmid pIJ101 as a model. In addition to conjugation, my work concerns Streptomyces ipomoeae, which causes the destructive disease soil rot in sweet potato. I examined the expression and regulation of bacteriocins that show interstrain inhibition in an effort to better understand their production and ultimately benefit the development of a novel highly-efficient bio-control agent for prevention of Streptomyces soil rot.

Connjugation in Streptomyces bacteria remains a poorly understood process. Compared to the conserved conjugation mechanism that has been elucidated across most other microorganisms, conjugative transfer in Streptomyces involves few plasmid-encoded loci

(Hopwood and Kieser 1993) and the transfer of double-stranded DNA (Ducote and Pettis

2006, Possoz et al. 2001). Transfer of Streptomyces lividans plasmid pIJ101 requires only the pIJ101 tra gene, which encodes Tra protein, as well as a cis-acting plasmid function known as clt (Pettis and Cohen 1994, Pettis and Cohen 1996). The membrane Tra protein may form a ring-shape pore and pump double-stranded DNA molecules from donor to recipient cells

(Grohmann et al. 2003). The absence of clt results in a drastic reduction of plasmid transfer

(Pettis and Cohen 1994). However, the actual genetic function of clt locus is still unknown.

The minimal clt locus was found to be a 54-bp segment of pIJ101 that contains a single imperfect inverted-repeat (IR) sequence along with three direct repeats (DR). The IR appears

102 to be the most important functional region of clt (Ducote et al. 2000). Better characterization of IR was attempted in Chapter Two, specifically by defining positions within the IR that are critical for plasmid transfer. As shown in Chapter Two, certain mutations in the right arm of the IR or between the arms appeared to eliminate clt transfer function. These results suggest that the dyad symmetry of the IR region per se is not important. It is possible that the critical base positions identified here alter the specific secondary structure of clt and/or represent the binding motif for Tra or some other essential transfer component(s) during conjugative transfer process. So, to understand the precise role of clt in conjugation, future work should involve two directions: investigating further the secondary structure of clt IR sequence; and probing for potential clt-Tra interaction. The possibility of specific interaction between clt and

Tra can be examined by purification of Tra and/or by isolating tra suppressors of the clt mutant alleles described in Chapter Two, using purified Tra, techniques to probe DNA-protein interaction such as EMSA, and immunoprecipitation can then be performed.

The Tra protein of pIJ101 can also promote efficient transfer of chromosomal DNA in

Streptomyces ((Kieser et al. 1982, Pettis and Cohen 1994). However, to date, neither chromosomal genes required for conjugation nor functional analogs of the pIJ101 clt locus have been identified in the linear Streptomyces chromosome (Zhang and Pettis, unpublished results). In Chapter Two and Appendix A, I gave preliminary evidence that the telomeric end of the S. lividans chromosome could substitute for clt transfer function. The telomeres at the ends of the Streptomyces linear chromosome are predicted to form secondary structures that are important for the process of chromosome replication (Huang et al. 1998). It is hypothesized that the chromosomal telomere, which contains numerous IRs reminiscent of the pIJ101 clt IR, can replace the functional role of clt in plasmid transfer. My preliminary results showed that Streptomyces transfer-defective vector pIJ101 with one copy of the chromosome telomere can be transferred efficiently by pIJ101 Tra (See Table A.2 in Appendix A). To further support the hypothesis, the chromosomal telomere could be cloned to various vectors

103 and tested to determine if it can consistently restore transfer function to the plasmids lacking clt. Circularized chromosomes either containing or lacking telomeres could also be tested for chromosome mobilization as mediated by pIJ350 tra gene. Further investigations may focus on localization of the precise sequences within the chromosomal telomere that can complement clt transfer function, and examination of the secondary structure of these sequences.

Many linear Streptomyces plasmids also mediate efficient transfer of themselves and of their host chromosome (Hopwood and Kieser, 1993). However our knowledge of conjugation mechanism of linear plasmids lags behind that of their circular counterparts. As detailed in

Chapter Two, I attempted to investigate whether the tra-clt transfer components of circular plasmid pIJ101 can promote the transfer of a linear plasmid. The conjugation mechanism of linear plasmids may be distinct from that of circular plasmids, as my research shows that while the pIJ101 Tra could promote the transfer of circularized versions of the linear plasmid pSCON223 (Fig. 2.2 A), the linear plasmid itself could not be transferred efficiently using this system in S. lividans strain TK23.42. Consistent with this interpretation was my observation that all plasmids isolated from transconjugants appeared to be circular regardless of the configuration of the plasmid (i.e., linear versus circular) in the initial donor cells. My results here demonstrate that the pIJ101 Tra can not transfer linear plasmids when they are in a linear form in TK23.42. This was the first evidence that the Tra protein of a circular plasmid shows specificity for the circular configuration. Further study may involve elucidating why the Tra protein of pIJ101 can not transfer linear plasmids containing clt. It is possible that the specific secondary structure of clt in circular plasmids is important for the transfer mediated by pIJ101

Tra, and that in linear DNA molecules this structure may somehow be different. A better understanding of conjugation awaits further investigation of the secondary structure within clt

(or telomeres of linear plasmids or chromosomes) in circular versus linear DNA molecules.

So, how does the transfer of the linear chromosomal DNA proceed using the transfer system

104 of a circular plasmid? It was documented that the Streptromyces chromosomes may become circularized spontaneously (Lin et al. 1993), or the two TPs interact strongly with each other so that the linear chromosome behaves as if it was in a circular configuration (Wang et al.

1999, Yang and Losick 2001). One model then for pIJ101-mediated transfer of the linear

Streptomyces chromosome is that it is circularized or shows circular configuration before or during the transfer process, with the telomeres acting as the role of clt, so that the linear chromosome is transferred as a circular DNA molecule (Fig. 5.1).

In Chapter Two, I also revealed that the linear pSCON223 and pSCON346 plasmids (Fig

2.2 B and C) could be transferred in linear form from SLP2-containing strains, which strongly suggested that when SLP2 is present, Tra of SLP2 mediates transfer of the linear plasmids that can not be transferred by the pIJ101 Tra . It provides another line of evidence that conjugative transfer of linear plasmids appears to be different from that of circular plasmids. Whether the mechanism of conjugation of linear DNA molecules in Streptomyces is inherently different from that of circular molecules remains to be elucidated. It was previously reported that the S. lividans linear plasmid SLP2 encodes a Tra protein that shares homology with pIJ101 Tra.

And efficient transfer of linear SLP2 requires a ttrA gene encoding a helicase-like protein

(Huang et al. 2003), as well as six co-transcribed SLP2 genes (Xu et al. 2006). These observations indicate that conjugative transfer of linear plasmids may involve a similar process as that of circular plasmids, but require additional genetic functions. To test the notion, an experiment which is based on the method for studying double-stranded transfer of conjugative element pSAM2 (Possoz et al. 2001) could be conducted to examine whether linear plasmids transfer as double-stranded DNA molecules or not. Interestingly, my preliminary results showed that the transfer frequency of linear plasmid pSCON346 (Fig 2.2

C) was reduced two orders of magnitude when using a recipient strain with the double-stranded DNA-specific SalI restriction-modification system (SalI R/SalI M), compared with a recipient lacking the SalI R/SalI M (Appendix A), which suggested that

105

FIG. 5.1. Model for pIJ101-mediated conjugation of the linear Streptomyces chromosome. In the donor, before transfer, the linear chromosome is either (A) circularized spontaneously; or (B) shows circular configuration due to strong interaction between the TPs. (C) The pIJ101 Tra protein interacts with the chromosome at the telomeres. (D) The Tra pumps the chromosomal DNA from the donor cell across the cell membrane and the cell wall. Abbreviations: TP, Terminal protein; chr, chromosome. transfer of linear plasmids also involve double-stranded DNA. More reliable data could be obtained by including both a positive control (the transfer of double-stranded molecules when the donor is a Streptomyces strain harboring a circular plasmid), and a negative control (the transfer of single-stranded plasmid DNA when the donor strain is E. coli) in this assay, as described in Possoz et al. 2001. To understand the precise conjugation mechanism of linear

106 plasmids, further study may involve characterization of the exact functions of each gene required for the transfer of linear plasmids, and probing for the binding site of TraSLP2 in the linear SLP2 molecule, for example, the telomere ends.

The second story of mine concerns S. ipomoeae, which causes the destructive disease soil rot in sweet potato. Numerous strains of S. ipomoeae have been divided into three groups based on their antagonistic characteristics during co-cultivation on agar media. Group I strains are not antagonistic to group II or group III strains, group II strains inhibit both group I and III members, and group III strains inhibit group I and II strains (Clark et al. 1998). The group III inhibitor, designated ipomicin, consists of a 10-kDa secreted protein with bacteriocin properties (Zhang et al. 2003). Within the signal sequence encoding portion of the ipomicin structural gene ipoA exists a single rare TTA codon, which is recognized in the GC-rich

Streptomyces bacteria by the temporally accumulating bldA leucyl tRNA, whose activation has been shown to occur later during growth (Leskiw et al. 1991). In Chapter Three, using functional bioassays and Western blotting, I showed that ipomicin stably accumulates in culture supernatants of S. ipomoeae in a growth-regulated manner which does not coincide with the pattern of ipoA expression as determined in Northern blots. Using S. coelicolor isogenic wild type and bldA mutant strains M600 and M600∆bldA containing the cloned ipoA gene, similar growth-regulated production of ipomicin was demonstrated to be directly dependent on translation of the rare TTA codon in ipoA by the bldA leucyl tRNA. A stability assay revealed that ipomicin lost little activity after 24 h at 30°C under mock culture conditions and retained approximately 50% activity after 48 h. The results suggest that bldA-dependent translation of the S. ipomoeae ipoA gene leads to growth-regulated production of the ipomicin precursor, which upon processing to the mature form and secretion, stably accumulates in the extracellular environment. To date, this is the first example of bldA regulation of a bacteriocin in the streptomycetes. With the recent development of a method to introduce foreign DNA into S. ipomoeae by conjugation from E. coli, genetic manipulation of

107 S. ipomoeae has become available (Guan and Pettis, 2009). A S. ipomoeae bldA mutant could be isolated one day. Then it is conceivable that bldA regulation of ipomicin production could be confirmed in its natural host.

Previous studies showed that the ipoA gene is also present and transcribed in the group I and II S. ipomoeae strains which are sensitive to ipomicin (Schully 2005). In Chapter Four, I showed that most S. ipomoeae strains produce and release ipomicin protein, including most susceptible strains. It is clear that active inhibitor is not produced in these latter strains. Most likely, further post-translational modification of ipomicin protein in the group III strains results in bacteriolytic activity. Further investigation of ipomicin may focus on detecting potential additional modification of ipomicin produced by group III strains using mass spectrometry, as compared with the inactive form of ipomicin protein produced in susceptible strains.

Some recent studies showed several examples of bacteriocins and antibiotics that have functions other than competition, such as signaling, virulence, and sporulation (Holtsmark et al. 2007). For example, soil microbe Streptomyces tendae secretes a bacteriocin-like peptide,

SapT, which is involved in aerial hyphae formation, and may play a role in signaling morphogenesis (Kodani et al. 2005). It is possible that the inactive form of ipomicin produced by group I and II strains as well as active ipomicin produced by group III strains, also has another function. Actually, recent preliminary evidence suggests that ipomicin might be involved in pathogenicity (Guan and Pettis, unpublished results). It will therefore be interesting to continue to investigate whether ipomicin is multifunctional.

In Chapter Four, I showed that production of the S. ipomoeae group II inhibitor is also growth-phase dependent, however in a manner different from production of ipomicin in group

III strain 91-03 as described in Chapter Three. The group II inhibitory activity in cell-free supernatant of group II strain 88-35 culture was only detected during mid-exponential phase using plate bioassays. Thus the group II strains may cease to produce the inhibitor at the

108 beginning of stationary phase. It is also possible that the inhibitory substance itself could be unstable. Stability assays such as that described in Chapter Three and in Zhang et al. 2003 could be performed to examine further the stability of the group II inhibitor in culture supernatants. Additionally, specificity of group II inhibitor could be determined by plate bioassays as described in Zhang et al. 2003. These results may generate important data regarding the use of active ipomicin and group II inhibitor as a potential biocontrol agent.

The discovery of S. ipomoeae group II inhibitory activity in cell-free supernatant sheds light on purification of this inhibitory substance, which is released into the culture medium during exponential growth. Based on its properties, group II inhibitor may represent a novel proteinaceous bacteriocin (can be confirmed with proteinase K treatment). So purification schemes may be based on the protocols employed to purify numerous bacteriocins from other bacteria (Jack et al. 1995). Further work may involve construction of genomic libraries, and cloning and characterization of genes responsible for production of inhibitor from S. ipomoeae group II strains.

BAGEL is a web-based bacteriocin genome mining tool which is powerful in annotating putative bacteriocin genes. It is freely accessible at: http://bioinformatics.biol.rug.nl/websoftware/bagel. (de Jong et al. 2006). A number of predicted bacteriocins have been reported in twenty-two sequenced plant pathogen genomes using BAGEL (Holtsmark et al. 2008). At present the S. ipomoeae genome sequencing project is in progress. Upon completion of genome sequences, identification of putative bacterioncin gene clusters in S. ipomoeae could be examined by the BAGEL program, which may improve our knowledge of bacteriocins in S. ipomoeae, including the group II inhibitor.

REFERENCES Clark, C. A., C. Chen, N. Ward-Rainey, and G. S. Pettis. 1998. Diversity within Streptomyces ipomoeae based on inhibitory interactions, rep-PCR, and plasmid profiles. Phytopathology 88:1179-1186.

109 de Jong, A., S. A. F. T. van Hijum, J. J. E. Bijlsma, J. Kok, and O. P. Kuipers. 2006. BAGEL: a web-based bacteriocin genome mining tool. Nucleic Acids Res. 34: W273-W279.

Ducote, M. J., and G. S. Pettis. 2006. An in vivo assay for conjugation-mediated recombination yields novel results for Streptomyces plasmid pIJ101. Plasmid 55: 242-248.

Grohmann, E., G.. Muth, and M. Espinosa. 2003. Conjugative plasmid transfer in gram-positive bacteria. Microbiol. Mol. Biol. Rev 67: 277-301.

Guan, D., and G. S. Pettis. 2009. Intergeneric conjugal gene transfer from Escherichia coli to the sweet potato pathogen Streptomyces ipomoeae. Lett. Appl. Microbiol. In press.

Holtsmark, I., V. G. H. Eijsink, and M. B. Brurberg. 2008. Bacteriocins from plant pathogenic bacteria. FEMS Microbiol. Lett. 280: 1-7.

Hopwood, D. A., and T. Kieser. 1993. Conjugative plasmids of Streptomyces. In Bacterial conjugation, Clewell, D.B. (ed.). New York: Plenum Press, pp. 293-311.

Huang, C. -H., C. -Y. Chen, H. -H. T, C. Chen, Y. -S. Lin, and C. W. Chen. 2003. Linear plasmid SLP2 of Streptomyces lividans is a composite replicon. Mol. Microbiol. 47: 1563-1576.

Jack, R. W., J. R. Tagg, and B. Ray. 1995. Bacteriocins of gram-positive bacteria. Mibrobiol. Rev. 59: 171-200.

Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces Genetics. Norwich, England: The John Innes Foundation.

Kieser, T., D. A. Hopwood, H. M. Wright, and C. J. Thompson 1982. pIJ101, a multi-copy broad host-range Streptomyces plasmid: functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185: 223-238.

Kodani S., M. A. Lodato, M. C. Durrant, F. Picart, and J. M. Willey. 2005. SapT, a lanthionine-containing peptide involved in aerial hyphae formation in the streptomycetes. Mol. Microbiol. 58: 1368-1380.

110 Leskiw, B. K., E. J. Lawlor, J. M. Fernandez-Abalos, and K. F. Chater. 1991. TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants. Proc. Natl. Acad. Sci. USA 88:2461-2465.

Lin, Y. -S., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The chromosomal DNA of Streptomyces lividans 66 is linear. Mol. Microbiol. 10: 923-933.

Pettis, G. S., and S. N. Cohen. 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13: 955-964.

Possoz, C., C. Ribard, J. Gagnat, J. -L. Pernodet, and M. Guerineau. 2001. The intergrative element pSAM2 from Streptomyces: kinetics and mode of conjugal transfer. Mol. Microbiol. 42: 159-166.

Wang, S. -J., H. -M. Chang, Y. -S. Lin, C. -H. Huang, and C. -W. Chen. 1999. Streptomyces genomes: circular genetic maps from the linear chromosomes. Microbiol. 145: 2209-2220.

Yang, M. C., and R. Losick. 2001. Cytological evidence for association of the ends of the linear chromosome in Streptomyces coelicolor. J. Bacteriol. 183: 5180-5186.

111

APPENDIX A: SUPPLEMENTARY DATA

112

TABLE A.1. Transfer of plasmids harboring chromosome telomere from S. lividans TK23.42 to TK23. pSCON314: one copy of telomere cloned to transfer-defective Streptomyces vector pIJ350 (Kieser et al. 1982). pSCON315: two copies of telomeres cloned to pIJ350. Transfer frequencies are reported relative to pGSP354, determined as described (Pettis and Cohen 1994, Pettis and Cohen 1996).

Plasmid Number of telomeres pIJ101 clt Transfer Frequency (%) pSCON354 0 + 12.08 pSCON149 0 - 0.51 pSCON314 1 - 7.55 pSCON315 2 - 0.53

113

TABLE A.2. Transfer of linear pSCON346 from S. lividans 98-50 (Huang et al. 2003) to TK23 containing pHYG1 (Kendall and Cohen 1987) versus pOS948 (carrying the Sal I restriction-modification system; Possoz et al. 2001).

Plasmid Donor Recipient Transfer frequency (%) pSCON346 Linear 98-50 TK23 (pHYG1) 50.62 pSCON346 Linear 98-50 TK23 (pOS948) 0.67

114

3 180

2.5 150

2 120

1.5 90

1 60 Inhibition Zone(mm) Inhibition Absorbance @ 600nm @ Absorbance 0.5 30

0 0 0 10203040506070 . Time (h)

FIG. A.1. Growth-regulated appearance of ipomicin during culturing of S. ipomoeae strain 88-29 as determined by plate bioassay and Western blotting. (A) Growth curve of strain 88-29 and measurement of bioassay inhibition zones as described in Chapter Three for 91-03 (B) Western blots of ipomicin protein as described in Chapter Three.

115

FIG. A.2. Temporal appearance of ipomicin protein as produced by S. coelicolor strains M600 and M600∆bldA containing pSIP40 versus pSIP42 determined by Western blotting as described in Chapter Three.

116

FIG. A.3. TCA-precipitated S. ipomoeae group II inhibitor still retains inhibitory activity. Spores of S. ipomoeae group II strains B16470 (group I), 88-35 (group II), and 91-03 (group III) were inoculated into liquid TSB and incubated at 30°C while shaking. 1 ml aliquots were harvested at two time-points during growth (one time-point during the exponential phase, and the other one time-point during the stationary phase), and culture supernatants were then filtered, and proteins were TCA-precipitated (Wang et al. 2009). 5 µl of each protein sample were spotted onto SIGA inoculated with a lawn of S. ipomoeae spores. From top to bottom, the lawns are of B16480 (group II), and B16470 (group I). Plates incubated at 30°C for 3 days.

117 REFERENCES Huang, C. -H., C. -Y. Chen, H. -H. T, C. Chen, Y. -S. Lin, and C. W. Chen. 2003. Linear plasmid SLP2 of Streptomyces lividans is a composite replicon. Mol. Microbiol. 47: 1563-1576.

Kendall, K. J., and S. N. Cohen. 1987 Plasmid transfer in Streptomyces lividans: identification of a kil-kor system associated with the transfer region of pIJ101. J. Bacteriol. 169: 4177-4183.

Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces Genetics. Norwich, England: The John Innes Foundation.

Pettis, G. S., and S. N. Cohen. 1994. Transfer of the pIJ101 plasmid in Streptomyces lividans requires a cis-acting function dispensable for chromosomal gene transfer. Mol. Microbiol. 13: 955-964.

Possoz, C., C. Ribard, J. Gagnat, J. -L. Pernodet, and M. Guerineau. 2001. The intergrative element pSAM2 from Streptomyces: kinetics and mode of conjugal transfer. Mol. Microbiol. 42: 159-166.

118

APPENDIX B: LETTER OF PERMISSION

119 AMERICAN SOCIETY FOR MICROBIOLOGY LICENSE TERMS AND CONDITIONS

Mar 03, 2009

This is a License Agreement between Jing Wang ("You") and American Society for Microbiology ("American Society for Microbiology") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by American Society for Microbiology, and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.

License Number 2136030497436

License date Feb 25, 2009

Licensed content publisher American Society for Microbiology

Licensed content publication Applied and Environmental Microbiology

Licensed content title Growth-Regulated Expression of a Bacteriocin, Produced by the Sweet Potato Pathogen Streptomyces ipomoeae, That Exhibits Interstrain Inhibition

Licensed content author

Licensed content date Mar 1, 2009

Volume 75

Issue 5

Start page 1236

End page 1242

Type of Use Dissertation/Thesis

Format Print and electronic

Portion Full article

Order reference number

Title of your thesis / INSIGHTS INTO THE STREPTOMYCETE CONJUGATION MECHANISM dissertation AND INTERSTRAIN INHIBITOR PRODUCTION BY THE SWEET POTATO PATHOGEN STREPTOMYCES IPOMOEAE

Expected completion date Apr 2009

Estimated size(pages) 120

Total 0.00 USD

120 Terms and Conditions

Publisher Terms and Conditions

The publisher for this copyrighted material is the American Society for Microbiology (ASM). By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the Billing and Payment terms and conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you opened your Rightslink account and that are available at any time at http://myaccount.copyright.com).

1. ASM hereby grants to you a non-exclusive license to use this material. Licenses are for one-time use only with a maximum distribution equal to the number that you identified in the licensing process; any form of republication must be completed within 1 year from the date hereof (although copies prepared before then may be distributed thereafter); any permission for electronic format posting is limited to the edition/volume of that online publication. The copyright of all material specified remains with ASM, and permission for reproduction is limited to the formats and products indicated in your license. The text may not be altered in any way without the express permission of the copyright owners.

2. The licenses may be exercised anywhere in the world.

3. You must include the copyright and permission notice in connection with any reproduction of the licensed material, i.e. Journal name, year, volume, page numbers, DOI and reproduced/amended with permission from American Society for Microbiology.

4. The following conditions apply to photocopies: a. The copies must be of high quality and match the standard of the original article. b. The copies must be a true reproduction word for word. c. No proprietary/trade names may be substituted. d. No additional text, tables or figures may be added to the original text. e. The integrity of the article should be preserved, i.e., no advertisements will be printed on the article. f. The above permission does NOT include rights for any electronic reproduction - CD ROM, diskette or in any other format.

5. The following conditions apply to translations: a. The translation must be of high quality and match the standard of the original article. b. The translation must be a true reproduction word for word. c. All drug names must be generic; no proprietary/trade names may be substituted. d. No additional text, tables or figures may be added to the translated text. e. The integrity of the article should be preserved, i.e., no advertisements will be printed on the article. f. The permission does NOT include rights for any electronic reproduction - CD - ROM, diskette or in any other format. g. The translated version of ASM material must also carry a disclaimer in English and in the

121 language of the translation. The two versions (English and other language) of the disclaimer MUST appear on the inside front cover or at the beginning of the translated material as follows:

The American Society for Microbiology takes no responsibility for the accuracy of the translation from the published English original and is not liable for any errors which may occur. No responsibility is assumed, and responsibility is hereby disclaimed, by the American Society for Microbiology for any injury and/or damage to persons or property as a matter of product liability, negligence or otherwise, or from any use or operation of methods, products, instructions or ideas presented in the Journal. Independent verification of diagnosis and drug dosages should be made. Discussions, views, and recommendations as to medical procedures, choice of drugs and drug dosages are the responsibility of the authors.

h. This license does NOT apply to translations made of manuscripts published ahead of print as "[ASM Journal] Accepts" papers. Translation permission is granted only for the final published version of the ASM article. Furthermore, articles translated in their entirety must honor the ASM embargo period, and thus may not appear in print or online until 6 months after the official publication date in the original ASM journal.

6. E-Books must be password protected. E-Book permission is only granted for those requests that meet ASM's definition of an E-Book, as follows: An E-Book is the electronic version of a textbook that can be ordered on-line and used instead of the printed text. Students are given a pass-code and they are allowed to download it once to their desktop. Restricted access means that students are not permitted to share an account. No other electronic book uses are permitted.

7. While you may exercise the rights licensed immediately upon issuance of the license at the end of the licensing process for the transaction, provided that you have disclosed complete and accurate details of your proposed use, no license is finally effective unless and until full payment is received from you (either by ASM or by CCC) as provided in CCC's Billing and Payment terms and conditions. If full payment is not received on a timely basis, then any license preliminarily granted shall be deemed automatically revoked and shall be void as if never granted. In addition, permission granted is contingent upon author permission, which you MUST obtain, and appropriate credit (see item number 3 for details). If you fail to comply with any material provision of this license, ASM shall be entitled to revoke this license immediately and retain fees paid for the grant of the license. Further, in the event that you breach any of these terms and conditions or any of CCC's Billing and Payment terms and conditions, the license is automatically revoked and shall be void as if never granted. Use of materials as described in a revoked license, as well as any use of the materials beyond the scope of an unrevoked license, may constitute copyright infringement and ASM reserves the right to take any and all action to protect its copyright in the materials.

8. ASM reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

122 9. ASM makes no representations or warranties with respect to the licensed material and adopts on its own behalf the limitations and disclaimers established by CCC on its behalf in its Billing and Payment terms and conditions for this licensing transaction.

10. You hereby indemnify and agree to hold harmless ASM and CCC, and their respective officers, directors, employees and agents, from and against any and all claims arising out of your use of the licensed material other than as specifically authorized pursuant to this license.

11. This license is personal to you, but may be assigned or transferred by you to a business associate (or to your employer) if you give prompt written notice of the assignment or transfer to the publisher. No such assignment or transfer shall relieve you of the obligation to pay the designated license fee on a timely basis (although payment by the identified assignee can fulfill your obligation).

12. This license may not be amended except in a writing signed by both parties (or, in the case of ASM, by CCC on ASM 's behalf).

13. Objection to Contrary terms: ASM hereby objects to any terms contained in any purchase order, acknowledgment, check endorsement or other writing prepared by you, which terms are inconsistent with these terms and conditions or CCC's Billing and Payment terms and conditions. These terms and conditions, together with CCC's Billing and Payment terms and conditions (which are incorporated herein), comprise the entire agreement between you and ASM (and CCC) concerning this licensing transaction. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall control.

14. The following terms and conditions apply to Commercial Photocopy and Commercial Reprint requests and should be considered by requestors to be additional terms. All other ASM terms and conditions indicating how the content may and may not be used also apply.

Limitations of Use:

The Materials you have requested permission to reuse in a commercial reprint or commercial photocopy are only for the use that you have indicated in your request, and they MAY NOT be used for either resale to others or republication to the public. Further, you may not decompile, reverse engineer, disassemble, rent, lease, loan, sell, sublicense, or create derivative works from the Materials without ASM's prior written permission.

15. Revocation: This license transaction shall be governed by and construed in accordance with the laws of Washington, DC. You hereby agree to submit to the jurisdiction of the federal and state courts located in Washington, DC for purposes of resolving any disputes that may arise in connection with this licensing transaction. ASM or Copyright Clearance Center may, within 30 days of issuance of this License, deny the permissions described in this License at their sole discretion, for any reason or no reason, with a full refund payable to you. Notice of such denial will be made using the contact information provided by you. Failure to receive such notice will

123 not alter or invalidate the denial. In no event will ASM or Copyright Clearance Center be responsible or liable for any costs, expenses or damage incurred by you as a result of a denial of your permission request, other than a refund of the amount(s) paid by you to ASM and/or Copyright Clearance Center for denied permissions. v1.4

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.

If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 30 days of the license date. Payment should be in the form of a check or money order referencing your account number and this license number 2136030497436. If you would prefer to pay for this license by credit card, please go to http://www.copyright.com/creditcard to download our credit card payment authorization form.

Make Payment To: Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006

If you find copyrighted material related to this license will not be used and wish to cancel, please contact us referencing this license number 2136030497436 and noting the reason for cancellation.

Questions? [email protected] or +1-877-622-5543 (toll free in the US) or +1-978-646-2777.

124 VITA

Jing Wang was born in February, 1977. He was the only child of his parents Chidan Xia and Yanqin Wang. He was raised in Wuhan, Hubei, China, and graduated from Wuhan

Number Two High School in 1995. Jing attended Wuhan University where he received a

Bachelor of Science degree in biology in 1999. Jing entered into a graduate program at

Louisiana State University under the guidance of Dr. Gregg S. Pettis in the Department of

Biological Sciences in 2002. He will earn the degree of Doctor of Philosophy in biological sciences in May of 2009. Jing has been married to his wife, Xue Bai, since December of

2006.

125