Phylogeny,Classification antimicrobial, antimicrobial susceptibility susceptibility and and virulence factors of Aeromonas species in virulence factors of Western Australian Western Australia

By

Max Aravena-Román BScAppSci FASM

This thesis is presented for the degree of Doctor of Philosophy

School of Pathology and Laboratory Medicine of Western Australia 2015

TABLE OF CONTENTS TABLE OF CONTENTS...... i SUMMARY...... ix DECLARATION...... xi ACKNOWLEDGEMENTS...... xiii THESIS STRUCTURE...... xv ABBREVIATIONS...... xvi LIST OF TABLETS...... xx LIST OF FIGURES...... xxiii CHAPTER 1: LITERATURE REVIEW...... 1 1.1. GENERAL INTRODUCTION...... 1 1.2. HISTORY...... 1 1.3. TAXONOMY...... 2 1.3.1. Early taxonomy...... 2 1.3.2. Current taxonomy...... 3 1.3.3. Controversial taxonomic issues...... 3 1.3.3.1. Aeromonas allosaccharophila...... 4 1.3.3.2. Aeromonas spp. HG 11...... 8 1.3.3.3. Aeromonas culicicola...... 8 1.4. LABORATORY IDENTIFICATION...... 9 1.4.1. Isolation...... 9 1.4.2. Identification by phenotypic methods...... 12 1.4.3. Identification by commercial systems...... 13 1.4.4. Additional phenotypic methods...... 15 1.4.5. Semi-automated systems...... 15 1.4.6. Identification by molecular methods...... 16 1.4.6.1. Typing methods………………………………………...... 16 1.4.6.2. Identificartion based on 16S-23S rRNA gene sequence……………17 1.4.6.3. Identification based on housekeeping gene sequence...... 18 1.4.6.4. Specific genes used as identification targets...... 18 1.4.6.5. Restriction enzyme-based methods...... 19 1.4.6.6. PCR-based methods...... 20 1.4.6.7. Disadvantages of molecular methods...... 20 1.5. SEROTYPING...... 21 1.6. ECOLOGY...... 22

-i-

1.6.1. Aquatic environments...... 22 1.6.1.1. Distribution in water...... 22 1.6.1.2. Water quality...... 23 1.6.1.3. Effects of temperature on growth and toxin production...... 24 1.6.1.4. Aeromonas in drinking water...... 25 1.6.2. Aeromonas in foods...... 28 1.6.2.1 Distribution of Aeromonas spp. in foods...... 28 1.7. EPIDEMIOLOGY AND PUBLIC HEALTH ISSUES...... 30 1.7.1. Water-associated infections...... 31 1.7.2. Foods-associated infections...... 32 1.7.3. Aeromonas and fish infections...... 32 1.8. BIOREMEDIAL AND BIODEGRADABLE PROPERTIES...... 33 1.9. VIRULENCE FACTORS...... 34 1.9.1. Adherence...... 35 1.9.2. Pili...... 36 1.9.3. Invasins...... 39 1.9.4. S-layer...... 40 1.9.4.1. Structural arrangements...... 41 1.9.4.2. Binding properties...... 41 1.9.4.3. Genes involved in S-layer synthesis...... 41 1.9.4.4. S-layer and virulence...... 42 1.9.5. The lipopolysaccharide (LPS)...... 42 1.9.5.1. Functions of the LPS...... 42 1.9.5.2. Immunological and antigenic properties of the LPS...... 43 1.9.5.3. Genes involved in LPS synthesis...... 43 1.9.6. Outer membrane proteins (OMP)...... 44 1.9.7. Flagella...... 45 1.9.7.1. Synthesis, regulation and expression of flagella...... 45 1.9.7.2. Functions associated with flagella...... 46 1.9.8. Secretion systems...... 46 1.9.8.1. Type II secretion systems (T2SS)...... 48 1.9.8.2. Type III secretion systems (T3SS)...... 48 1.9.8.3. Type IV secretion systems (T4SS)...... 49 1.9.8.4. Type VI secretion systems (T6SS)...... 50 1.9.9. Exotoxins...... 51

-ii-

1.9.9.1. Aerolysin...... 52 1.9.9.1.1. Action on host tissue...... 53 1.9.9.1.2. Molecular characteristics and prevalence...... 53 1.9.9.2. Cytotoxic enterotoxin (Act)...... 54 1.9.9.3. Haemolysins...... 55 1.9.9.4. Enterotoxins...... 56 1.10. Additional extracellular products...... 59 1.10.1. Proteases...... 59 1.10.2. Lipases...... 60 1.10.3. Nucleases (DNases)...... 61 1.10.4. Chitinases...... 62 1.11. Iron uptake...... 63 1.12. Quorum sensing (QS)...... 64 1.13. Biofilm formation...... 65 1.14. Additional virulence factors...... 66 1.15. INFECTIONS CAUSED BY AEROMONAS SPECIES...... 67 1.15.1. Gastroenteritis...... 68 1.15.1.1. Disease presentation...... 68 1.15.1.2. Evidence against Aeromonas as an enteric pathogen...... 69 1.15.1.3. Evidence supporting Aeromonas as an enteric pathogen...... 71 1.15.1.4. Species involved...... 72 1.15.2. Skin and soft-tissue infections (SSTIs)...... 72 1.15.3. Septicaemia...... 73 1.15.4 Respiratory tract infections...... 76 1.15.5. Urogenital tract infections...... 76 1.15.6. Intra-abdominal infections...... 77 1.15.7. Infections due to medicial leech therapy...... 78 1.15.8. Meningitis...... 79 1.15.9. Zoonotic infections...... 79 1.15.10. Burns...... 80 1.15.11. Eye infections...... 80 1.15.12. Osteomyelitis and suppuratives arthritis...... 81 1.16. ANTIMICROBIAL SUSCEPTIBILITIES...... 81 1.16.1. -Lactamases...... 83 1.16.2. Extended-spectrum (ESBL) -lactamas production...... 86

-iii-

1.16.3. Plasmid-mediated resistance...... 88 1.16.4. Quinolones...... 89 1.16.5. Genes encoding for antimicrobial resistance...... 89 1.16.6. Antimicrobial usage: recommendations...... 90 1.17. CONCLUSIONS...... 91 CHAPTER 2: MATERIALS AND METHODS...... 95 2.1. MATERIALS...... 95 2.1.1. Chemical and reagents...... 95 2.1.2. Solutions...... 95 2.1.2.1. DepC-treated water...... 95 2.1.2.2. Ethidium bromide (10 mg/ml)...... 95 2.1.2.3. Chemical lysis stock solution...... 95 2.1.2.4. HCCA matrix solution...... 95 2.1.3. Bacteriological media...... 95 2.1.4. Gas chromatography...... 96 2.1.5. Antimicrobials...... 96 2.1.6. Bacterial strains...... 96 2.1.7. Primers...... 96 2.2. METHODS...... 115 2.2.1. Bacterial culture methods...... 115 2.2.2. Acid production from carbohydrates...... 112 2.2.3. Hydrolysis of aesculin...... 115 2.2.4. Alkylsulfatase activity...... 115 2.2.5. Detection of a CAMP-like factor...... 116 2.2.6. Catalase activity...... 116 2.2.7. DNase activity...... 116 2.2.8. Elastase activity...... 116 2.2.9. Gas from glucose...... 117 2.2.10. Gelatin hydrolysis...... 117 2.2.11. Oxidation of potassium gluconate...... 117 2.2.12. Ability to grow on TCBS medium...... 117 2.2.13. -Haemolysis activity...... 118 2.2.14. Production of hydrohen sulphide from cysteine...... 118 2.2.15. Production of indole from tryptophan…………...... 118 2.2.15.1. Rapid spot method...... 118

-iv-

2.2.15.2. Kovacs’ method...... 118 2.2.16. Jordan’s tartrate test...... 118 2.2.17. Lipase activity...... 119 2.2.18. Utilization of malonate...... 119 2.2.19. Amino acid degradation...... 119 2.2.20. Motility...... 120 2.2.20.1. Wet mount method...... 120 2.2.20.2. Motility medium method...... 120 2.2.21. ONPG activity...... 120 2.2.22. Oxidase activity...... 120 2.2.23. Phenylalanine deaminase activity...... 121 2.2.24. Pyrazinamidase activity...... 121 2.2.25. Pyrrolidonyl--naphthylamide activity...... 121 2.2.26. Salt tolerance...... 121 2.2.27. Stapholysin activity...... 122 2.2.28. Hydrolysis of starch...... 122 2.2.29. Hydrolysis of tyrosine...... 122 2.2.30. Urease activity...... 122 2.2.31. Utilization of DL-lactate, acetate and urocanic acid...... 123 2.2.32. Utilization of citrate (Simmon’s method)...... 123 2.2.33. Voges-Proskauer test...... 123 2.3. AMPLIFICATION OF GYRB AND RPOD GENES...... 123 2.3.1 Preparation of template DNA...... 123 2.3.2. Polymerase chain reaction (PCR)...... 124 2.3.3. DNA sequencing...... 124 2.3.4. Detection of virulence gene products by Bioanalyzer...... 125 2.4. METHODS USED IN THE CHARACTERIZATION OF AEROMONAS AUSTRALIENSIS SP. NOV...... 126 2.4.1. Phenotypic characterization...... 126 2.4.2. Antimicrobial susceptibility testing...... 127 2.4.3. Fatty acid methyl ester (FAME) analysis...... 127 2.4.3.1. Inoculation of TSBA plates...... 128 2.4.3.2. Harvesting...... 128 2.4.3.3. Saponification...... 128

-v-

2.4.3.4. Methylation...... 128 2.4.3.5. Extraction...... 128 2.4.3.6. Washing...... 129 2.4.3.7. Interpretation of results...... 129 2.4.4. Protein analysis by MALDI-TOF...... 129 2.4.4.1. Sample preparation...... 129 2.4.5. Genotypic characterization...... 130 2.4.5.1. PCR and sequence analysis...... 130 2.5. ANTIMICROBIAL SUSCEPTIBILITY TESTING...... 131 2.5.1. Agar dilution...... 131 2.5.2. Disk diffusion...... 132 2.5.3. Minimum inhibitory concentration testing: E-strip method...... 132 2.6. ELECTRON MICROSCOPY ANALYSIS...... 133 2.7. STATISTICAL ANALYSIS...... 133 CHAPTER 3: PHENOTYPIC CHARACTERIZATION OF AEROMONAS SPECIES...... 136 3.1. INTRODUCTION...... 136 3.2. Bacterial strains...... 136 3.3. RESULTS...... 137 3.3.1. Biochemical characteristics of type and reference strains...... 137 3.3.2. Overall classification...... 137 3.3.3. Clinical isolates...... 137 3.3.4. Environmental isolates...... 138 3.3.5. Distribution of Aeromonas spp. in clinical samples...... 138 3.3.6. Distribution of Aeromonas spp. in environmental samples...... 138 3.3.7. General phenotypic characteristics...... 138 3.3.8. Susceptibility to colistin...... 154 3.3.9. Production of pyrrolidonyl--naphthylamide...... 154 3.3.10. Susceptibility to deferoxamine (DEF)...... 154 3.3.11. Production of a CAMP-like factor...... 154 3.3.12. Utilization of citrate: Simmon’s vs. Hänninen’s medium...... 155 3.3.13. Susceptibility to the vibriostatic agent O/129...... 155 3.3.14. Growth on thiosulfate salt sucrose agar (TCBS)...... 155 3.4. DISCUSSION...... 155

-vi-

CHAPTER 4: GENOTYPIC CHARACTERIZATION OF AEROMONAS SPECIES...... 158 4.1. INTRODUCTION...... 158 4.2. Bacterial strains...... 159 4.3. RESULTS...... 159 4.3.1. Overall distribution of species following genotypic identification...... 159 4.3.2. Distribution of Aeromonas spp. in clinical specimens...... 159 4.3.3. Distribution of Aeromonas spp. in environmental specimens...... 159 4.3.4. Phenotypic differentiation of Aeromonas dhakensis from other major Aeromonas species...... 174 4.3.5. Intra- and inter-species dissimilarities...... 174 4.4. DISCUSSION...... 174 CHAPTER 5: ANTIMICROBIAL SUSCEPTIBILITIES...... 179 5.1. INTRODUCTION...... 179 5.2. Bacterial strains...... 179 5.3. Antimicrobial agents...... 179 5.4. RESULTS...... 180 5.5. DISCUSSION...... 181 CHAPTER 6: DESCRIPTION OF AEROMONAS AUSTRALIENSIS SP. NOV...... 187 6.1. INTRODUCTION...... 187 6.2. Bacterial strains...... 187 6.3. RESULTS...... 188 6.3.1. Phenotypic characteristics...... 188 6.3.2. FAME profiles...... 189 6.3.3. Protein profile...... 189 6.3.4. Genotypic characteristics...... 189 6.3.5. Antimicrobial susceptibilities...... 190 6.4. DISCUSSION...... 213 6.4.1 Formal description of Aeromonas australiensis sp. nov……………..215 CHAPTER 7: VIRULENCE GENES PRESENT IN WESTERN AUSTRALIAN AEROMONAS SPECIES...... 217 7.1. INTRODUCTION...... 217 7.2. Bacterial strains...... 218 7.3. RESULTS...... 218

-vii-

7.3.1. Overall distribution of virulence genes...... 218 7.3.2. Distribution of virulence genes in stool specimens...... 218 7.3.3. Distribution of virulence genes in extra-intestinal specimens...... 219 7.3.4. Distribution of virulence genes among environmental specimens...... 219 7.3.5. Additional features...... 219 7.3.6. Percentage identity of nucleotide sequences of positive products from this study compared to sequences deposited in GenBank...... 220 7.4. DISCUSSION...... 220 CHAPTER 8: GENERAL DISCUSSION...... 247 REFERENCES...... 257 ATTACHED CD-ROM...... 312

-viii-

SUMMARY

Members of the genus Aeromonas are Gram-negative rods globally distributed in aquatic and soil environments. For over one hundred years they have been associated with infections in humans, other mammals and cold-blooded species. Infections in fish and snails have resulted in serious financial losses to the aquaculture and French snail farming industry.

Before the advent of molecular techniques, classification of Aeromonas was based solely on the different phenotypic characteristics associated with each individual species. However, the heterogeneous nature of motile and mesophilic Aeromonas species has led to an unreliable and unstable taxonomy and schemes designed for the identification of this group have not always been suitable for the identification of non- motile, psychrophilic species.

The aims of this research were:

1. To characterize a collection of clinical and environmental Aeromonas isolates from the state of Western Australia using phenotypic and genotypic methods in order to determine the prevalence of species in this region. 2. To investigate the taxonomic position of isolates as determined by phylogenetic trees. 3. To determine the antimicrobial susceptibility patterns of clinical and environmental Aeromonas spp. to antibacterial agents currently in use in clinical practice. 4. To assess the presence of virulence factors of Aeromonas species in order to determine the presence of pathogenic strains currently circulating within the WA community and its environment.

Aeromonas isolates were collected from rural and metropolitan areas of Western Australia, the largest state in Australia covering an area of 2.5 million km2, for a period of over 20 years. Phenotypic characterization of isolates was performed by a conventional biochemical method that included more than 35 tests and by which approximately 93% of the isolates were identified to the species level. Aeromonas hydrophila was by far the most predominant aeromonad isolated from clinical and

-ix-

environmental samples and represented more than 50% of the species. These results suggested that phenotypic identification was inadequate since 7% of the strains could not be assigned to any known taxa.

Genotypic identification was based on the molecular sequences of the gyrB and rpoD housekeeping genes by a PCR-based method. Phylogenetic trees generated from the nucleotide sequences of the isolates tested indicated that A. dhakensis and not A. hydrophila was the most frequently isolated aeromonad. Genotypic classification resulted in the assignation of 99% of the strains to a species suggesting that accurate identification of Aeromonas must involve a molecular method.

The antimicrobial susceptibility pattern of each isolate was assessed against 26 antimicrobials representing all classes currently in-use in clinical practice. Susceptibility of each isolate was determined by the agar dilution and E-strip methods. Antibiotic profiles indicated that the level of antimicrobial resistance in Western Australian aeromonads is generally very low although antimicrobial susceptibility testing should be performed in all strains isolated from human clinical material.

Phylogenetic trees derived from the nucleotide sequences of the gyrB and rpoD housekeeping genes showed that the position of strain 266 isolated from irrigation water in rural Western Australia did not cluster with any of the current validated Aeromonas species. Extensive polyphasic testing that included multilocus phylogenetic analysis, cellular fatty acid, protein profiles and DNA-DNA hybridization confirmed that strain 266 represented a novel Aeromonas species for which the name A. australiensis species novo was proposed.

The distribution and prevalence of 13 virulence genes and the activity of four extracellular enzymes was examined among 130 Aeromonas strains comprising 11 different species. Detection of virulence genes was performed by a PCR-based method while enzyme activity was evaluated by biological assays. Results indicated that clinical and environmental strains of A. hydrophila and A. dhakensis are more likely to carry multiple virulence genes compared to strains of A. veronii and A. caviae. However, the pathogenic potential of Aeromonas may be strain rather than species dependent, thus under certain conditions which include host predisposition, a range of aeromonads may be able to cause infection.

-x-

DECLARATION ______

All work presented in this thesis was performed by me and contributions made by others are duly stated. Identification of Aeromonas by phenotypic methods and antimicrobial susceptibility testing was performed entirely by me. Identification by molecular methods and detection of virulence genes was performed by me except for the preparation of gels and sequencing that was performed by staff from the PCR Laboratory at PathWest, Nedlands. Polyphasic identification of Aeromonas australiensis was 50% performed by me and 50% by Dr. R. Beaz-Hidalgo, Facultat de Cience i Medicina de la Salut, University Rovira i Virgili, Reus, Spain. Electronmicrograph of bacterial cells of A. australiensis was performed by Prof. Maria Jose Figueras, Facultat de Cience i Medicina de la Salut, University Rovira i Virgili, Reus, Spain.

This thesis contains a series of published work that has been co-authored. The following journal articles constitute the individual chapters of this thesis:

Aravena-Román, M., B. J. Chang, T. R. Riley, and T. J. J. Inglis (2011a). Phenotypic characteristics of human clinical and environmental Aeromonas in Western Australia. Pathology 43: 350-356 (Chapter 3).

Aravena-Román, M., G. B. Harnett, T. V. Riley, T. J. J. Inglis and B. J. Chang (2011b). Aeromonas aquariorum is widely distributed in clinical and environmental specimens and can be misidentified as Aeromonas hydrophila. Journal of Clinical Microbiology 49: 3006-3008 (Chapter 4).

Aravena-Román, M., T. J. J. Inglis, B. Henderson, T. V. Riley, and B. J. Chang (2012). Antimicrobial susceptibilities of Aeromonas strains isolated from clinical and environmental sources to 26 antimicrobial agents. Antimicrobial Agents and Chemotherapy 56: 1110-1112 (Chapter 5).

Aravena-Román, M., R. Beaz-Hidalgo, T. J. J. Inglis, T. V. Riley, A. J. Martínez- Murcia, B. J. Chang and M. J. Figueras (2013). Aeromonas australiensis sp. nov.

-xi-

isolated from irrigation water in Western Australia. International Journal of Evolutionary and Systematic Microbiology 63: 2270-2276 (Chapter 6)

Aravena-Román, M., T. J. J. Inglis, T. V. Riley and B. J. Chang (2014). Distribution of 13 virulence genes among clinical and environmental Aeromonas species in Western Australia European Journal of Clinical Microbiology and Infectious Diseases 33: 1889- 1895 (Chapter 7).

Except for the work performed in the description of the new species A. australiensis (50% of experimental work), all experimental work (100%) and initial manuscripts preparation (100%) was performed by me. Editorial advice and guidance for the manuscripts’ submissions and final corrected versions were provided by my supervisors Professor Barbara Chang (40% editorial), Professor Timothy Inglis (30% editorial) and Professor Thomas Riley (30% editorial). Other co-authors provided access to laboratory equipment and facilities.

Max Aravena-Román

-xii-

ACKNOWLEDGEMENTS

I am indebted to my supervisors B. Chang, T. Inglis and T. Riley for their continuous support, encouragement and guidance.

I would like to thank the staff of the Microbiology Division at PathWest, Nedlands campus who provided bacterial isolates and access to equipment and reagents. To Rod Bowman for making the necessary funds available to finance this project.

Thanks to Dr. Nicky Buller, Bacteriology Laboratory, Agriculture Department of Western Australia, South Perth; Mr. Steve Munyard, Division of Microbiology and Infectious Diseases, PathWest, Nedlands campus; Mr. Neil Stingemore, Department of Microbiology, Fremantle Hospital, PathWest, Fremantle campus; Mr. Peter Campbell, Department of Microbiology, Princess Margaret Hospital, Subiaco, Perth; Professor Peter Käempfer, Institut für Angewandte Mikrobiologie, Justus-Liebig Universität, Giessen, Germany; Professor Silvia Kirov, Department of Pathology, University of Tasmania, Hobart, Tasmania, Australia; Dr. J. Michael Janda, Microbial Diseases Laboratory, State of California, USA; and Dr. David Miñana-Galbis, Facultat de Farmacia, Unitat de Microbiologia, Universitat de Barcelona, Barcelona, Spain for kindly providing bacterial isolates.

To my colleagues, Glenys Chidlow, Gerry Harnett, Adam Merritt, Nikki Foster, Avram Levy, and Barbara Henderson for their advice, guidance and support. A special thanks to Diane Bleasdale for her excellent librarian services, to John Boehm from Excel, PathWest, for providing me with special media and reagents and to my Spanish colleagues, Professor María Jose Figueras and Dr. Roxana Beaz-Hidalgo from the Facultat de Cience and Medicina de la Salut, University of Rovira i Virgili, Reus, Spain and Dr. Antonio Martínez-Murcia from the Departamento de Produccion Vegetal y Microbiología, EPSO, Universidad Miguel Hernández, Orihuela Alicante, Spain for their invaluable training, advice and for their generosity in sharing bacterial isolates.

Thank you to Dr. Eduardo Alvarez from ICBM, Programa de Microbiología y Micología, Facultad de Medicina, University of Chile, Santiago, Chile who provided much training in sequence analysis and other computer issues and to Cati Nuñez from

-xiii-

the Facultat de Cience and Medicina de la Salut, University of Rovira i Virgili, Reus, Spain for her invaluable technical support.

Finally, thanks to my wonderful wife Naomi for her unconditional love and support.

To my beloved Mum Carmen Román Díaz (RIP)

-xiv-

THESIS STRUCTURE

The body of this research is preceded by an extensive review of the literature in Chapter 1 in which historical, taxonomical issues, antimicrobial susceptibility and the relation of Aeromonas to human disease are presented. All materials and methods described in Chapters 3 to 7 are outlined in Chapter 2. Chapters 3 to 7 of this thesis are based on material published by the candidate and peer reviewed.

Chapter 3 describes the characterization of isolates by phenotypic methods followed by classification by genotypic methods as presented in Chapter 4. The antimicrobial susceptibility pattern of 193 strains constitutes Chapter 5. The discovery and proposal of a novel Aeromonas species is described in Chapter 6. In Chapter 7, the virulence potential based on the detection and distribution of virulence genes and enzyme activity is examined in a selected group of strains. Final discussion addressing the results and conclusions obtained from all other chapters is presented in Chapter 8.

-xv-

ABBREVIATIONS ACN acetonitrile ADA ampicillin dextrin agar ADWA Agriculture Department of Western Australia AFLP amplified fragment length polymorphism AMX amoxicillin AMC amoxicillin-clavulanate AMK amikacin AMP ampicillin AnO2 anaerobic APW alkaline peptone water Aq. soln. aqueous solution ATCC American Type Culture Collection ATM aztreonam BAA blood ampicillin agar bv biovar BOC British Oxygen Company bp base pair(s) BSA bovine serum albumin cm centimetre C degrees Celsius CCUG Culture Collection of the University of Göteborg CFA cellular fatty acid CFU colony forming unit(s) CAMP Christie-Atkins-Munch-Peterson CAPD continuous ambulatory peritoneal dialysis CAZ ceftazidime CDC Center for Disease Control CECT Coleccion Española de Cultivos Tipo CEF cephalothin CFZ cefazolin CHO Chinese hamster ovary CIN cefsulodin irgasan novobiocin CIP Collection Bactérienne de l’Institute Pasteur CIP ciprofloxacin CLED cysteine lactose electrolyte deficient CLSI Clinical Laboratory Standard Institute CNA colistin nalidixic acid COL colistin CRO ceftriaxone CSF cerebral spinal fluid d day(s) Da Dalton DAA Difco ampicillin agar DEF deferoxamine DepC diethyl procarbonate DDH DNA-DNA hybridization DNA deoxyribonucleic acid DNAT deoxyribonucleic acid agar plus toluidine blue

-xvi-

DNase deoxyribonuclease dNTP deoxyribonuclease triphosphate(s) DOX doxycycline DSM Deutsche Sammlung von Mikroorganismen und Zelkuturen ERIC enterobacterial repetitive intergenic consensus ESBL extended-spectrum -lactamase FA formic acid FAME fatty acid methyl ester(s) FEP cefepime FH Fremantle hospital FOX cefoxitin g gram(s) g relative centrifugal force G + C guanine plus cytosine GC gas chromatograph GCAT glycerophospholipid-cholesterol acyltransferase GCF gelatine-cysteine-thiosulfate GEN gentamicin GMP guanosine monophosphate GSP glutamate starch phenol h hour(s) HBA horse blood agar HCCA -cyano-4-hydroxycinnamic acid HG hybridization group HIA heart infusion agar HIB heart infusion broth HPLC high performance liquid chromatography HUS haemolytic uraemic syndrome I intermediate IM intramuscular IP intraperitoneal IBB inositol bile salts brilliant green kb kilobases(s) Km2 square kilometre L litre LBA Luria Bertoni agar LDC lysine decarboxylase LMG Culture Collection of the Laboratorium voor Microbiologie Gent LPS lipopolysaccharide LT labile toxin M molar M mole(s) MALDI-TOF matrix assistedlaser-desorption/ionization mass spectrometry time-of flight MEM meropenem mg milligram(s) MHA Mueller-Hinton agar MIC minimum inhibitory concentration MIC50 MIC required to inhibit the growth of 50% of organisms MIC90 MIC required to inhibit the growth of 90% of organisms min minute(s) ml millilitre(s)

-xvii-

MLCK myosin light chain kinase MLPA multilocus phylogenetic analysis MLST multilocus sequence analysis mm millimetre(s) mM millimole(s) MTCC Microbial Type Culture Collection and GeneBank MWA Metropolitan Water Authority MW molecular weight MXF moxifloxacin NaCl sodium chloride NA nutrient agar NAL nalidixic acid N/A not applicable NaOH sodium hydroxide NCIMB National Collection of Industrial and Marine Bacteria NCTC National Collection of Type Cultures ND not detected NIT nitrofurantoin nm nanometre(s) No. number NOR norfloxacin NSW New South Wales nt nucleotide(s) O2 oxygen O/129 2,4-diamino-6,7-diisopropylpteridine ONPG o-nitrophenyl--D-galactopyranoside O/F oxidation/fermentation o/v overnight PCR polymerase chain reaction PFGE pulse field gel electrophoresis pH concentration of hydrogen ions PMH Princess Margaret Hospital PPA phenylalanine deaminase psi pounds per square inch PYR pyrrolidonyl--naphthylamide PYZ pyrazinamidase QE II Queen Elizabeth II R resistant RAPD randomly amplified polymorphic DNA RBC red blood cells RILs rabbit ileal loops RNA ribonucleic acid rpm revolutions per minute s second(s) S susceptible SAA starch ampicillin agar SBA sheep blood agar SCGH Sir Charles Gairdner Hospital SDS sodium dodecyl sulphate SDH Swan District Hospital SF summed feature SI similarity index

-xviii-

spp. species sp. nov. species novo ssp. subspecies SSSD Salmonella Shigella agar plus sodium desoxycholate ST stable toxin SXT trimethoprim-sulfamethoxazole TCBS thiosulfate citrate bile sucrose TFA trifluoroacetic acid TGC tigecycline TIM ticarcillin-clavulanate TMP trimethoprim TOB tobramycin TSA trypticase soy agar TSB trypticase soy broth TSBA trypticase soy broth agar TZP pipercillin-tazobactam U unit(s)  micron(s) g microgram(s) l microlitre(s) m micrometre(s) M micromole(s) UPW ultrapure water w/v weight to volume WA Western Australia XLDA xylose lysine desoxycholate agar XDCA sylose desoxycholate citrate agar + positive  negative

-xix-

LIST OF TABLETS

Table 1.1 Current Aeromonas species p. 5

Table 1.2 Examples of media used in the isolation of Aeromonas p. 14 from different sources

Table 1.3 Distribution of Aeromonas in water sourcesfrom different p. 26 locations

Table 1.4 Enumeration of Aeromonas in different foodstuffs p. 29

Table 1.5 Characteristics of pili described in Aeromonas species p. 37

Table 1.6 Selected effector proteins associated with different p. 47 secretion systems Table 1.7 Toxins secreted by Aeromonas p. 57

Table 1.8 Clinical characteristics of patients with HUS-associated p. 70 Aeromonas

Table 1.9 Major categories of Aeromonas septicaemia disease p. 75 presentation

Table 1.10 -lactamases produced by Aeromonas species p. 84 Table 1.11 ESBL-producing Aeromonas species p. 87 Table 2.1 Chemicals and reagents used in this project p. 97 Table 2.2 Bacteriological media used in this project p. 99 Table 2.3 Antimicrobial agents used in this project p. 101 Table 2.4 Type and reference strains used in this project p. 102 Table 2.5 Type strains used as positive and negative controls p. 105 Table 2.6 Clinical strains used in this project p. 106 Table 2.7 Environmental strains used in this project p. 109 Table 2.8 Primers used in this project p. 111 Table 2.9 Aeromonas strains used in virulence studies p. 113 Table 2.10 Interpretation of disk diffusion results p. 134 Table 2.11 Interpretation of E-strip MIC values p. 135 Table 3.1 Biochemical characteristics of type and reference p. 139 Aeromonas strains Table 3.2 Biochemical characteristics of Aeromonas isolated from p. 145 human clinical material

Table 3.3 Biochemical characteristics of Aeromonas isolated from p. 149 environmental sources

Table 3.4 Distribution of Aeromonas spp. among clinical and p. 153

-xx-

environmental samples after phenotypic characterization

Table 4.1 Type and reference strains GenBank accession numbers p. 160 Table 4.2 GenBank accession numbers of wild strains for rpoD and p. 162 gyrB gene sequences

Table 4.3 Distribution of Aeromonas spp. among clinical and p. 173 environmental samples following genotypic characterization

Table 4.4 Biochemical characteristics of Aeromonas after genotypic p. 175 identification Table 4.5 Evolutionary distances based on the percentage sequence CD-ROM dissimilarities of all current Aeromonas spp. and 60 isolates identified as A. aquariorum using Clustal_W and Mega 5 software

Table 5.1 Antimicrobial susceptibilities determined for different p. 182 Aeromonas spp. Table 5.2 Antibiotic susceptibilities of Aeromonas spp. by source of p. 184 isolation Table 6.1 Key tests for the phenotypic identification of strain 266T p. 192 from other Aeromonas spp.

Table 6.2 Key tests used to differentiate strain 266T from other D- p. 197 mannitol non-fermentative Aeromonas

Table 6.3 Cellular fatty acid profiles of strain 266T and current p. 198 Aeromonas spp.

Table 6.4 Evolutionary distances based on the percentage sequence CD-ROM dissimilarities of current Aeromonas and strain 266T using Clustal_W and Mega 4 software

Table 6.5 DNA-DNA hybridization values between strain 266T and p. 204 closely related Aeromonas spp.

Table 7.1 Distribution of virulence genes among Western Australian p. 221 Aeromonas species Table 7.2 Distribution of virulence genes in Aeromonas spp. isolated p. 223 from stools

Table 7.3 Distribution of virulence genes in Aeromonas spp. isolated p. 225 from blood

Table 7.4 Distribution of virulence genes in Aeromonas spp. isolated p. 227 from wounds

Table 7.5 Distribution of virulence genes in Aeromonas spp. isolated p. 230

-xxi-

from miscellaneous specimens

Table 7.6 Distribution of virulence genes in Aeromonas spp. isolated p. 232 from environmental sources

Table 7.7 Additional features p. 234 Table 7.8 Percentage identity of gene product sequences from this p. 235 study compared with sequences deposited in GenBank

Table 7.9 Accession numbers of sequences derived from virulence p. 237 genes and deposited in GenBank

-xxii-

LIST OF FIGURES

Figure 1.1 Unrooted neighbour-joining phylogenetic tree derived from gyrB p. 7 sequences showing subspecies and biovars

Figure 1.2 Unrooted neighbour-joining phylogenetic tree derived from gyrB p. 10 sequences showing current Aeromonas species

Figure 1.3 Unrooted neighbour-joining phylogenetic tree derived from rpoD p. 11 sequences showing current Aeromonas species

Figure 4.1 Concatenated neighbour-joining phylogenetic tree showing the p. 169 position of A. dhakensis strains derived from the rpoD and gyrB sequences

Figure 4.2 Concatenated neighbour-joining phylogenetic tree showing the p. 170 position of A. caviae strains derived from the rpoD and gyrB genes sequences

Figure 4.3 Concatenated neighbour-joining phylogenetic tree showing the p. 171 position of A. hydrophila strains derived from the rpoD and gyrB genes sequences

Figure 4.4 Concatenated neighbour-joining phylogenetic tree derived from p. 172 the rpoD and gyrB genes sequences showing the position of A. veronii bv. sobria and other species including strain 266

Figure 6.1 Electron microscopy images of strain 266T p. 191 Figure 6.2 Protein spectrum of strain 266T p. 203 Figure 6.3 Unrooted neighbour-joining phylogenetic tree derived from the p. 205 16S rRNA gene sequences showing the relationships of strain 266T with all other Aeromonas species

Figure 6.4 Unrooted neighbour-joining phylogenetic tree derived from dnaJ p. 206 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

Figure 6.5 Unrooted neighbour-joining phylogenetic tree derived from dnaX p. 207 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

Figure 6.6 Unrooted neighbour-joining phylogenetic tree derived from gyrA p. 208 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

Figure 6.7 Unrooted neighbour-joining phylogenetic tree derived from gyrB p. 209 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

-xxiii-

Figure 6.8 Unrooted neighbour-joining phylogenetic tree derived from recA p. 210 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

Figure 6.9 Unrooted neighbour-joining phylogenetic tree derived from rpoD p. 211 sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species

Figure 6.10 Unrooted neighbour-joining phylogenetic tree derived from the p. 212 MLPA of concatenated sequences of six housekeeping genes sequences showing the relationships of strain 266T with several strains of all other Aeromonas species

-xxiv-

CHAPTER 1: LITERATURE REVIEW

1.1. GENERAL INTRODUCTION

Aeromonas species are authoctonous inhabitants of aquatic environments that can be frequently isolated from human clinical material, environmental and food sources (Janda and Abbott 2010). Infections due to Aeromonas occur in amphibians, reptiles and snails, where the latter infections are a significant problem for the snail industry in France (Kodjo et al. 1997). In humans, aeromonads have been associated with serious infections in both immunocompromised and healthy individuals while infections in fish represent a serious threat to the aquaculture industry resulting in significant financial loss.

Once considered organisms of doubtful clinical significance the interest in Aeromonas has grown considerably over the past three decades as reflected by a sixfold increase in research publications (Janda and Abbott 2010). In the tsunami that devastated parts of Asia in 2004 Aeromonas species were the predominant (22.6%) Gram-negative isolated from wounds of victims (Hiransuthikul et al. 2005). This led to the recommendation that assessment of wound infections in tsunami survivors, empirical antimicrobial therapy should always include agents with activity against Aeromonas (Lim 2005). Similarly, Aeromonas was present in high concentration in water samples following the hurricane Katrina disaster that affected New Orleans (Presley et al. 2006). This review discusses current taxonomic classification and identification methods. Secondly, description of putative virulence factors and their association with Aeromonas infections is examined. Finally, the response of Aeromonas to antimicrobial agents is reviewed.

1.2. HISTORY

Infections due to Aeromonas species have been described for more than a hundred years and several reviews have credited the first reports to the work of Zimmerman and Sanarelli in the late 1880s (Abeyta et al. 1988; Altwegg and Geiss 1989; Joseph and Carnahan 1994). These cases were followed by other reports of Aeromonas-like bacteria including the water-borne bacterium, Bacillus hydrophilus, isolated from water and diseased frogs (Chester 1901) and Proteus melanovogenes implicated as the cause of black rot in eggs and also isolated from human faeces (Miles and Halnan 1937).

-- 1 --

According to Joseph and Carnahan (1994), the first report of human infection caused by aeromonads was by Hill et al. (1954) who described a case of fulminant septicaemia and metastatic myositis caused by an unknown bacterium. The microorganism that was recovered from multiple organs and in pure form from cerebral spinal fluid was considered an undescribed member of the family Pseudomonadaceae, tribe Spirilleae and genus Vibrio.

The genus Aeromonas was first proposed by Kluyver and van Niel (1936) who recommended that the species Acetobacter liquefaciens be renamed Aeromonas liquefaciens, then the only species and type species of the genus. The newly proposed genus was formally accepted in the seventh edition of Bergey’s Manual of Determinative Bacteriology (Snieszko 1957). The type species of the genus, A. hydrophila, was later proposed by Stanier (1943) based on the phenotypic characteristics of Proteus hydrophilus, a fermentative, polar flagellated bacterium. Since their discovery, Aeromonas or Aeromonas- like bacteria have been assigned to several genera including Aerobacter, Bacillus, Pseudomonas, Proteus and Vibrio (Joseph and Carnahan 1994).

1.3. TAXONOMY

Due to the heterogeneous nature of the genus the taxonomy of Aeromonas has been considered complex and confusing (Schubert 1974; Popoff and Veron 1976; Joseph and Carnahan 1994; Wahli et al. 2005). The inability to separate genospecies using biochemical methods (Altwegg et al. 1990) and the poor correlation that existed between genotypic and phenotypic methods (Austin et al. 1998; Martínez-Murcia et al. 2000) led to an unstable nomenclature (Popoff and Veron 1976; Abbot et al. 1992; Vila et al. 2002; Ørmen et al. 2005) resulting in conflicting data (de la Morena et al. 1993; Huys et al. 1997a; Valera and Esteve 2002; Huys et al. 2005).

1.3.1. Early taxonomy

Prior to the 1980s, classification of Aeromonas was based solely on differential phenotypic characteristics such as growth temperature and motility (Popoff and Veron 1976). Thus, Aeromonas was classified into two major groups: a large group that comprised the motile, mesophilic and heterogenous species that also included potential human pathogens; and a second smaller group of homogenous species represented by A. salmonicida, a non-motile, psychrophilic species primarily considered fish pathogens

-- 2 --

(McNicol et al. 1980; Janda et al. 1984; Kasai et al. 1998; Pidiyar et al. 2002; Martin- Carnahan and Joseph 2005).

In 1981, Popoff and colleagues used DNA-DNA hybridization (DDH) to classify 55 motile aeromonads. Results revealed that A. hydrophila, A. caviae and A. sobria were well differentiated but each species contained more than one hybridization group (HG), a term used to refer to DNA groups that could not be differentiated phenotypically. As a consequence, investigators began to use DDH values to determine hybridization groups (HGs), which were defined as having at least 70% DNA homology with the designated type strain (Wayne et al. 1987). The use of the term “hybridization group” dropped out of use over the last decade. The last hybridization group was DNA HG 18 assigned to A. culicicola (Pidiyar et al. 2002). Instead, the term “genomic species” or “genospecies” followed by a reference number has been recommended to describe unnamed groups (Janda and Abbott 2010).

1.3.2. Current taxonomy

The genus Aeromonas resides in the family Aeromonadaceae (Colwell et al. 1986) within the subclass Gammaproteobacteria (Saavedra et al. 2007). There are currently 27 recognized species and six subspecies (Table 1.1), and two biovars (Fig. 1.1). The complete genome of all type strains representing all species and selected reference strains have now been sequenced (Seshadri et al. 2006; Colston et al. 2014).

In recent years, the classification of Aeromonas has been based on the nucleotide sequences of housekeeping genes which have the ability to reliably discriminate between all species in the genus (Yañez et al. 2003; Soler et al. 2004; Thompson et al. 2004; Nhung et al. 2007; Adekambi et al. 2008; Miñana-Galbis et al. 2009). As a consequence, 15 new Aeromonas species have been described since 2000, with the majority recovered from environmental sources.

1.3.3. Controversial taxonomic issues

Controversial taxonomic issues discussed in previous reviews (Janda and Abbott 2010) can now be considered partly or completely resolved. Extensive genotypic and phenotypic evidence confirmed that: A. trota was identical to A. enteropelogenes (Schubert et al. 1990a; Carnahan et al. 1991a; Carnahan 1993; Collins et al. 1993; Huys et al. 1996b; 2002b) and A. ichthiosmia should be considered a junior synonym of A.

-- 3 -- veronii (Fanning et al. 1985; Schubert et al. 1990b; Collins et al. 1993; Huys et al. 1996a; 2001). The unnamed Aeromonas group 501 (Hickman-Brenner et al. 1988) has been reclassified as A. diversa sp. nov. (Miñana-Galbis et al. 2010) and A. hydrophila ssp. anaerogenes has been included in the species A. caviae (Miñana-Galbis et al. 2013).

Phylogenetic evidence indicated that strains of A. hydrophila ssp. dhakensis belonged to the species A. aquariorum (Martínez-Murcia et al. 2008; 2009). Previously, the species A. hydrophila consisted of three subspecies including ssp. hydrophila and ssp. ranae (Huys et al. 2003). Recently, Beaz-Hidalgo et al. (2013) combined A. hydrophila ssp. dhakensis (Huys et al. 2002a) and A. aquariorum (Martínez-Murcia et al. 2008) and proposed the creation of A. dhakensis sp. nov. comb. nov. Due to inconsistent genotypic and phenotypic feature, “A. sharmana” (Saha and Chakrabarti 2006) has not been included in the genus (Martínez-Murcia et al. 2007; Lamy et al. 2010).

1.3.3.1. Aeromonas allosaccharophila

This species was proposed by Martínez-Murcia et al. (1992a) based on two strains recovered from diseased elvers (Anguilla anguilla) and one from human stools. Evidence against A. allosaccharophila representing a separate species derived from discrepancies reported in the biochemical profiles of the original strains (Martínez- Murcia et al. 1992a; Esteve et al. 1995b; Huys et al. 1996a; 2001); amplified fragment length polymorphism (AFLP) and fluorescent amplified fragment length polymorphism (FAFLP) patterns identical to those of A. veronii (Huys et al. 1996b; Huys and Swings 1999); the nucleotide sequences of several housekeeping genes showed A. allosaccharophila in close proximity to A. veronii and not sufficiently distant to confidently separate the two species (Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010). Evidence supporting A. allosaccharophila as a separate species derived from i) its unique 16S rDNA sequence composition that clearly differentiated this species from most other members of the genus including A. veronii (Martínez- Murcia et al. 1992a); ii) the nucleotide sequences of the rpoD and gyrB housekeeping genes (Yañez et al. 2003; Soler et al. 2004; Saavedra et al. 2006) (Figs. 1.2 and 1.3); iii) multilocus sequence analysis showed that A. allosaccharophila and A. veronii were

-- 4 --

Table 1.1 Current Aeromonas species Species HG Source of type strain Reference A. hydrophila ssp. hydrophila 1 Tin of milk with fishy odour Stanier (1943) A. salmonicida ssp. achromogenes 3 Fish (Salmo trutta) Smith (1963) A. salmonicida ssp. salmonicida Salmon (Salmo salar) Schubert (1967b) A. salmonicida ssp. masoucida Fish blood (Oncorhynchus masou) Kimura (1969) A. sobria 7 Fish Popoff and Veron (1976) A. media 5 River water Allen et al. (1983) A. caviae 4 Guinea-pig Popoff (1984) A. veronii 8/10 Frog red leg/sputum Hickman-Brenner et al. (1987) Aeromonas ssp. 11 Ankle suture Hickman-Brenner et al. (1987) A. schubertii 12 Forehead abscess Hickman-Brenner et al. (1988) A. eucrenophila 6 Carp Schubert and Hegazi (1988) A. salmonicida ssp. smithia Fish Austin et al. (1989) A. trota 14 Human faeces Carnahan et al. (1991a) A. jandaei 9 Faeces Carnahan et al. (1991c) A. allosaccharophila 15 Diseased elvers/human faeces Martínez-Murcia et al. (1992a) A. encheleia 16 European eels Esteve et al. (1995a) A. bestiarum 2 Infected fish Ali et al. (1996)

-- 5 --

Table 1.1 Continued. Species HG Source of type strain Reference A. popoffii 17 Drinking water production plant Huys et al. (1997b) A. salmonicida ssp. pectinolytica Water from cistern Pavan et al. (2000) A. hydrophila ssp. ranae Farmed frog Huys et al. (2003) A. simiae Monkey faeces Harf-Monteil et al. (2004) A. molluscorum Wedge-shells (Donax trunculus) Miñana-Galbis et al. (2004a) A. bivalvium Cockles (Cardium spp.) Miñana-Galbis et al. (2007) A. tecta Stool of a child with diarrhoea Demarta et al. (2008) A. piscicola Diseased fish Beaz-Hidalgo et al. (2009) A. fluvialis River water Alperi et al. (2010a) A. diversaa 13 Human leg wound Miñana-Galbis et al. (2010) A. sanarellii Human wound Alperi et al. (2010b) A. taiwanenesis Burn wound Alperi et al. (2010b) A. rivuli Freshwater Figueras et al. (2011a) A. australiensis Treated effluent water Aravena-Román et al. (2013) A. dhakensisb Children with diarrhoea Beaz-Hidalgo et al. (2013) A. cavernicola Isolated from water brook Martínez-Murcia et al. (2013) a previously classified as Aeromonas group 501 (Hickman-Brenner et al. 1988); bcombined from A. hydrophila ssp. dhakensis (Huys et al. 2002a) and A. aquariorum (Martínez-Murcia et al. 2008)

-- 6 --

A. salmonicida spp. salmonicida (CECT 894T) A. salmonicida ssp. smithia (CIP 104757) A. salmonicida spp. masoucida (CECT 896) 100 A. salmonicida spp. pectinolytica (34mel) A. salmonicida ssp. achromogenes (CECT 895)

97 A. veronii bv. sobria (ATCC 9071) A. veronii bv. veronii (DSM 7386T) A. hydrophila spp. dhakensis (LMG 19562T) A. hydrophila ssp. hydrophila (ATCC 7966T) 84 A. hydrophila spp. ranae (LMG 19707T)

0.005

Figure 1.1 Unrooted neighbour-joining phylogenetic tree derived from gyrB nucleotide sequences showing subspecies and biovars. The phylogenetic tree was constructed with 530 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.005 estimated substitutions per site.

-7- located in different phylogenetic lines and exhibited a high degree of nucleotide diversity (Martino et al. 2011).

1.3.3.2. Aeromonas spp. HG 11

This unnamed Aeromonas derived from two strains that could not be included in the original description of A. veronii (Hickman-Brenner et al. 1987). Evidence that supported the inclusion of Aeromonas HG11 into A. encheleia was based on AFLP (Huys et al. 1996b) and 16S-23S rDNA-RFLP patterns (Laganowska and Kaznowski 2004); high DDH values (84-87%) between Aeromonas HG11 strains and the type strain of A. encheleia LMG 16330T (Huys et al. 1997a); and divergent values for gyrB (2.1-2.2%), rpoD (1.4-1.7%), dnaJ (1.3%), cpn60UT (0.7%) and rpoB (0.9%) (Yañez et al. 2003; Soler et al. 2004; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010). In contrast, phenotypic profiles (Valera and Esteve 2002) and different tRNA patterns suggested that these two species represent distinct taxa (Laganowska and Kaznowski 2005). Moreover, the 16S rRNA sequence of A. encheleia and Aeromonas sp. HG11 differed by eight nucleotides at hypervariable positions 457 to 476 (Martínez- Murcia 1999), a significant feature considering that in Aeromonas the 16S rRNA gene similarities range from 96.9 to 100% (Martínez-Murcia 1992a).

1.3.3.3. Aeromonas culicicola

This species originated from strains isolated from the midgut of the mosquito species Culex quinquefasciatus and Aedes aegyptii (Pidiyar et al. 2002). Evidence that A. culicicola represents a heterotypic synonym of A. veronii derived from the low interspecies nucleotide substitution rates for several housekeeping genes (Soler et al. 2004; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010); similar phenotypic and cellular fatty acid profiles (Huys et al. 2005); DDH values well above T T 70% between A. culicicola MTCC 3249 and A. veronii ATCC 35624 (Huys et al. 2005; Nhung et al. 2007) compared to 44% by the initial report (Pidiyar et al. 2002); 16S rRNA RFLP profiles similar to those of A. veronii (Lamy et al. 2010). In contrast, 16S DNA-RFLP patterns reported by two studies showed that A. culicicola differed sufficiently from all other members of the genus (Figueras et al. 2005; Kaznowski and Konecka 2005). Moreover, gyrB gene sequence placed A. culicicola in a separate line of descent where it differed from A. jandaei by 56 nucleotides (Yañez et al. 2003) compared to a single nucleotide difference using 16S rDNA (Pidiyar et al. 2003).

-8-

1.4. LABORATORY IDENTIFICATION

Aeromonas species are non-fastidious, catalase and oxidase positive, facultatively anaerobic Gram-negative fermentative bacilli (Janda 1985). The majority of the species produce -haemolysis on horse and sheep blood agar and most can produce indole from tryptophan. Although the optimal temperature for growth is 28C, aeromonads can grow at temperatures ranging from 1 to 42C (Mateos et al. 1993; Hänninen et al. 1995c) and can adapt and survive in highly acidic (pH 3.5) environments (Karem et al. 1994). Traditionally, susceptibility to the vibriostatic agent 2, 4-diamino-6, 7- diisopropylpteridine (O/129; 150 g disk) and the inability of aeromonads to grow on thiosulfate citrate bile salts sucrose agar (TCBS) and on 6% NaCl have been used as preliminary tests to differentiate Aeromonas from closely related Vibrios and Plesiomonas species. In general, the close phenotypic similarity of aeromonads and poorly equipped laboratories hampers the identification of aeromonads to species level. Thus, small laboratories should confine identification to the genus level and significant clinical or environmental strains should be sent to reference centres for further work (Abbott et al. 1992).

1.4.1. Isolation Aeromonas species can grow on most solid media including MacConkey, Hektoen enteric and xylose lysine desoxycholate (XLDA) agars, although colony size and plating efficiency differences have been observed (Desmond and Janda 1986; Janda and Abbott 1999). Plating efficiency appeared to be strain rather than species dependent (Desmond and Janda 1986). The concentration of salt is critical since Aeromonas do not usually grow in media containing greater than 3% NaCl (Abbott et al. 2003). Occasionally, strains of A. trota have been reported to withstand concentrations close to 4% (0.68 M) NaCl (Delamare et al. 2000). An optimal Aeromonas-medium should contain substrates that do not interfere with the oxidase test (Moulsdale 1983) or include lactose in its composition as this carbohydrate is highly unsatisfactory for primary isolation (Millership et al. 1983). The number of Aeromonas species recovered from different samples has been attributed to variations in technique and media employed to isolate these organisms (Nazer et al. 1986). A variety of media or variations of well- established formulae have been developed to isolate and quantify aeromonads from food, water and human faecal specimens based on biological properties such as production of amylase and starch activity or the natural tolerance of the majority of these organisms to ampicillin (Table 1.2).

-9-

T 85 A. popoffii (CIP 105493 ) A. bestiarum (ATCC 51108T) A. piscicola (CECT 7443T) 90 A. salmonicida (CECT 894T) A. molluscorum (DSM 17090T) A. eucrenophila (ATCC 23309T) A. encheleia (DSM 11577T) A. tecta (CECT 7083T) A. rivuli (CECT 7518T) A. caviae (ATCC 23212) 99 A. media (ATCC 33907T) A. bivalvium (CECT 7113T) 79 A. sanarellii (CECT 7402T) A. cavernicola (CECT 7862T) T 73 A. dhakensis (LMG 19562 ) A. hydrophila (ATCC 7966T) A. jandaei (CECT 4228T) A. fluvialis (CECT 7401T) A. sobria (CIP 7433T) A. veronii (ATCC 9071) A. australiensis (CECT 8023T) A. allosaccharophila (DSM 11576T) A. trota (ATCC 49657T) A. taiwanensis (CECT 7403T) A. simiae (DSM 16559T) T 96 A. schubertii (ATCC 43700 ) 100 A. diversa (CECT 4254T)

0.01

Figure 1.2 Unrooted neighbour-joining phylogenetic tree derived from gyrB sequences showing current Aeromonas species. The phylogenetic tree was constructed with 530 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per site.

-10-

T 90 A. taiwanensis (CECT 7403 ) 93 A. sanarellii (CECT 7402T) A. caviae (ATCC 13136T) A. dhakensis (LMG 7862T) 99 A. hydrophila (ATCC 7966T)

T 93 A. eucrenophila (ATCC 23309 ) A. tecta (CECT 7082T) A. media (ATCC 33907T) A. encheleia (DSM 11577T) 100 A. diversa (CECT 4254T)

T 100 A. simiae (DSM 16559 ) A. schubertii (CECT 4240T) A. bivalvium (CECT 7113T)

T 97 A. molluscorum (DSM 17090 ) 100 A. rivuli (CECT 7518T) A. jandaei (ATCC 49568T) A. trota (ATCC 49657T) A. australiensis (CECT 8023T) A. fluvialis (CECT 7401T) 86 A. veronii (ATCC 9071) 92 A. allosaccharophila (DSM 11576T) A. sobria (CIP 7433T) A. cavernicola (CECT 7862T) A. salmonicida (CECT 894T) A. popoffii (CIP 105493T) 93 T 98 A. bestiarum (ATCC 51108 ) A. piscicola (CECT 7443T)

0.02

Figure 1.3 Unrooted neighbour-joining phylogenetic tree derived from rpoD sequences showing all Aeromonas species. The phylogenetic tree was constructed with 653 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.02 estimated substitutions per site.

-11-

Huddleston et al. (2007) recommended that ampicillin should not be used as a selective agent in isolation medium for Aeromonas when a complete analysis of Aeromonas diversity and density is desired. These authors argued that media containing ampicillin was likely to inhibit the growth of ampicillin-susceptible strains resulting in an underestimation of densities and species diversity.

1.4.2. Identification by phenotypic methods

Identification of Aeromonas by phenotypic methods has been based on the ability of these bacteria to ferment carbohydrates with vigorous gas production (Kluyver and van Neil 1936; Stanier 1943; Schubert 1968). However, identification based on biochemical tests is often unable to accurately identify Aeromonas beyond genus level as phenotypic features are unstable and vary within the species (Davin-Regli et al. 1998; Martínez- Murcia et al. 2000; Figueras et al. 2005; Wahli et al. 2005). Moreover, biochemical analyses depend on the transcription and translation of proteins which in turn are influenced by environmental factors such as temperature or carbohydrate repression potentially affecting production of proteins (Knochel 1989; 1990).

Phenotypic identification is also influenced by the number and type of tests and testing conditions (Valera and Esteve 2002; Esteve et al. 2003; Demarta et al. 2004), geographical source (Kaznowski et al. 1989) and interpretation of data and reproducibility of results (Abbott et al. 2003; Ørmen et al. 2005). Inaccurate identification is further compromised by those species in which only a handful of strains have been described (Abbott et al. 1992), by the application of schemes designed to identify clinical isolates to classify strains isolated from environmental and fish sources (Wakabayashi et al. 1981; Kaznowski et al. 1989; Ashbolt et al. 1995; Borrell et al. 1998; Ørmen et al. 2005). Furthermore, many of the biochemical schemes used in clinical laboratories predate the description of new taxa leading some authors to question whether the efficiency of older biochemical schemes are suitable to identify more recently described species (Edberg et al. 2007).

An identification scheme, the Aerokey II (Carnahan et al. 1991b; Joseph and Carnahan 1994) based on a small subset of highly discriminatory biochemical tests and the AeroMat-1/AsalMat-1 designed exclusively for the identification of A. salmonicida to species and subspecies levels, respectively, were developed (Higgins et al. 2007).

-12-

However, Aerokey II has not been generally adopted by laboratories due to the inconsistent biochemical profiles expressed by some species, costs and long incubation times required (Abbott et al. 1992; Janda and Abbott 1998). Furthermore, Aerokey II may be unsuitable for those regions harbouring strains with unique phenotypic profiles or due to the heterogeneous character of some species (Altwegg et al. 1990) while a lack of congruence between Aerokey II and genotypic identification has been reported (Noterdaeme et al. 1996).

Other potential identifying markers proposed to differentiate Aeromonas species included susceptibility to cephalexin (Janda and Motyl 1985), induced colistin resistance (Fosse et al. 2003b), production of a CAMP-like factor (Figura and Guglielmetti 1987) and maximum growth temperature determined with a temperature- gradient incubator (Havelaar et al. 1992; Hӓnninen 1994). The production of acetic acid in glucose-containing media is a peculiar characteristic displayed by certain species whereby some aeromonads become unviable (“the suicide phenomenon”). This test was designed as an identification marker to separate A. caviae (Namdari and Cabelli 1989).

1.4.3. Identification by commercial systems

A plethora of commercial systems such as Vitek, API, MicroScan Walk/Away, BBL Crystal Enteric/Non-fermenter, Biolog and the Phoenix 100 ID/AST contain selected Aeromonas species in their databases (Hӓnninen 1994; Park et al. 2003; Soler et al. 2003b; Huddleston et al. 2006; O’Hara 2006). Unfortunately, identification of Aeromonas by these systems is inadequate resulting in major errors (Janda and Abbott 2010). Among the major identification problems encountered with these systems are: misidentification of Aeromonas species as V. cholerae and V. damsela (Abbott et al. 1998), partly attributed to the lower salt concentration (0.45% NaCl) recommended by the manufacturer in the preparation of the inoculum in the Vitek identification system (Park et al. 2003); production of acid by the API 20E is temperature-dependent resulting in false-negative results if the strip is incubated at 37C (Hӓnninen 1994); the percentage of correct identifications for MicroScan Walk/Away (14.5%) and BBL Crystal Enteric/Non-fermenter (20.3%) systems is low (Soler et al. 2003b) while the Phoenix 100 ID/AST identified only 60% of Aeromonas (O’Hara 2006).

-13-

Table 1.2 Examples of media used in the isolation of Aeromonas from different sources

Media Source/purpose Reference

Glutamate starch phenol (GSP); Red agar (Pseudomonas- Foods of animal Ullman et al. (2005); Yucel and Aeromonas-selective agar) origin/environmental sources Erdogan (2010) Blood ampicillin agar (BAA); Oxoid Aeromonas agar; Starch Seafood Robinson et al. (1984); Palumbo et amipicillin agar (SAA) al. (1985); Pin et al. (1994); Tsai and Chen (1996) Blood agar containing p-nitrophenol glycerine Faecal samples Burke et al. (1983); Robinson et al. (1986) Cary-Blair medium Transport medium Moyer (1987)

Difco Aeromonas agar (DAA); ampicillin blood agar (ABA); Children stools/ carriage rate Wilcox et al. (1992) xylose desoxycholate citrate agar (XDCA) and alkaline peptone water (APW) Ampicillin-Dextrin Agar (ADA) Raw, processed and ready-to- Kingome et al. (2004) eat foods samples XDCA, DNA toluidine agar (DNAT); Salmonella-Shigella Faecal carriage rate Millership et al. (1983); von sodium desoxycholate (SSSD) agar Graevenitz and Zinterhofer (1970); Wauters (1973); Figura (1985) inositol-bile-salts-brilliant green (IBB) and cefsulodin-irgasan- Faecal/ability to grow on these Altorfer et al. (1985); Moyer et al. novobiocin agar (CIN); BAA media (1991)

-14-

1.4.4. Additional phenotypic methods

Many non-biochemical methods have been employed as alternatives to biochemical identification for typing or identification purposes, or both. Some, such as the use of core oligosaccharides from the endotoxins have not been readily adopted as routine identification methods (Shaw and Hodder 1978). Isoenzyme analysis has been used as both a screening method to investigate the epidemiology of hospital infections and as an identification tool (Picard and Goullet 1987; Altwegg et al. 1988). Multi-loccus enzyme electrophoresis (MLEE) has been considered useful as a sole method for species identification and shows good correlation with taxonomic groupings as determined by DDH (Altwegg et al. 1991c; Miñana-Galbis et al. 2004b). In contrast, phage typing, although specific to the genus Aeromonas, may be over-sensitive (Altwegg et al. 1988). The use of outer membrane protein (OMP) composition as a typing method is cumbersome and time consuming and OMP profiles are influenced by temperature and the air-supply available to the bacterial cultures (Küijper et al. 1989a). Methods such as radiolabelled cell proteins (radioPAGE) profiles are difficult to interpret and prone to subjective bias (Stephenson et al. 1987) while conflicting data have been reported with whole-protein fingerprinting (Millership and Want 1993; Alavandi et al. 2001; Szczuka and Kaznowski 2007).

1.4.5. Semiautomated systems

Two semi-automated systems based on the analysis of cellular fatty acid methyl esters by gas-liquid chromatography (GLC-FAMEs) and by measuring the differences in protein mass generated by the matrix-assisted laser-desorption/ionization mass spectrometry time-of flight (MALDI-MS-TOF) are widely used in identification of Aeromonas. Both methods are expensive and in the case of GLC-FAME require highly trained personnel. The systems can be used for the rapid identification of bacteria (Rahman et al. 2002) or as a typing tool (Osterhout et al. 1991; von Graevenitz et al. 1991; Huys et al. 1994, 1995; Donohue et al. 2006, 2007).

The reproducibility of the GLC-FAMEs system depends greatly on media, temperature of incubation, sets of strains, GC model used to analyse cellular fatty acid patterns and previous exposure to antibiotics (Canonica and Pisano 1988; Huys et al. 1994; Kӓempfer et al. 1994). A high identification rate of Aeromonas to species level has been reported by MALDI-TOF users making this system the most accurate for identification

-15- of these bacteria (Lamy et al. 2011). For those laboratories that can afford it, the MALDI-TOF has largely superseded most automated identification systems. Although the instrument is expensive, consumables and operational costs are lower than those incurred by the MIDI system, the most commonly used system used to detect FAME. It also requires less laboratory space than the MIDI system.

1.4.6. Identification by molecular methods

Practically every known molecular technique, each with its own strengths and weaknesess, has been used in the classification and typing of aeromonads since Popoff et al. (1981) placed them into DNA hybridization groups. In Aeromonas, the use of a single typing method to determine interrelationship between species may not be adequate as the potential for discrimination increases by combining different molecular methods (Altwegg et al. 1988; Davin-Regli et al. 1998; Soler et al. 2003a; Morandi et al. 2005). The application of these methods has been useful in establishing the epidemiological relationships between aeromonads recovered from very different sources (Villari et al. 2003). However, a situation similar to phenotypic identification exists where a lack of congruence between different molecular methods has been recognized (Hӓnninen and Siitonen 1995; Graf 1999a; Martínez-Murcia 1999; Figueras et al. 2000b; Yañez et al. 2003; Laganowska and Kasnowski 2005; Saavedra et al. 2006). Methods employed in the characterization and typing of aeromonads included those based on restriction enzymes used to digest genomic DNA [ribotyping, amplified fragment length polymorphism (AFLP), fluorescence amplified fragment length polymorphism (FAFLP), restriction fragment length polymorphism (RFLP)]; PCR- based methods [randomly amplified polymorphic DNA (RAPD), enterobacterial repetitive intergenic consensus (ERIC), repetitive extragenic palindromic (REP)] and PCR followed by DNA sequencing targeting single or multiple genes (MLST/MLSA). In the case of AFLP and FAFLP, digestion of DNA with restriction enzymes was followed by PCR. Other methods used included pulse field gel-electrophoresis (PFGE) and plasmid profiles.

1.4.6.1 Typing methods

Although some of the methods mentioned in the previous section can be used for both identification and typing purposes some are more suitable as typing methods for the determination of strain relatedness. The use of plasmid profiles was reported to be relatively unstable and not useful in genomic typing (Altwegg et al. 1988) while others

-16- are more suitable for fingerprinting at strain level (Chang and Janda 2005). The poor discriminatory patterns precluded PFGE to be used as an identification method. Instead, PFGE offers an effective alternative as a typing method (Bonadonna et al. 2001; Abdullah et al. 2003). The most satisfactory methods used in Aeromonas typing include RFLP, RAPD, ERIC and AFLP and can be applied to determine the relatedness of isolates in recurrent infections, the linkage of infections to environmental sources and pseudo-outbreaks of disease (Janda and Abbott 2010).

1.4.6.2. Identification based on 16S-23S rRNA gene sequence

The most common target used in bacterial identification in laboratories world-wide is the 16S rRNA gene (Stackebrandt and Goebels 1994; Petti et al. 2005; Boudewijns et al. 2006; Janda and Abbott 2007). In aeromonads, 16S rRNA gene sequence signature regions that differentiate some species from all other members in the genus have been described (Demarta et al. 1999; Figueras et al. 2000b; Martínez-Murcia et al. 2000). As a consequence, 16S rRNA-based probes designed to identify individual species directly from samples have been developed (Ash et al. 1993a/b; Dorsch et al. 1994; Khan and Cerniglia 1997; Demarta et al. 1999). Genus specific primers based on the 16S-23S rRNA intergenic spacer region (ISR) have been designed to confirm the identity of aeromonads following initial morphological and biochemical tests (Kong et al. 1999).

Overall, 16S rRNA sequencing has been found unsuitable to accurately differentiate Aeromonas species (Martínez-Murcia et al. 2000) as the resolution power of the 16S rRNA gene is limited when used to differentiate organisms that have identical or similar sequences (Fox et al. 1992; Martínez-Murcia et al. 1992b; Thompson et al. 2004; Morandi et al. 2005). For example, the DNA relatedness between A. caviae and A. trota is 30% although their 16S rRNA sequences differ by only three nucleotides. On the other hand, A. veronii and A. sobria differ by 14 nucleotides while they are 60 to 65% related in DNA pairing studies (Martínez-Murcia et al. 1992b).

Secondly, the intragenomic heterogeneity of most Aeromonas based on rrn operon nucleotide polymorphisms showed values ranging from 0.06 to 1.5%. The latter value reported in A. veronii, a species known to possess up to six copies of the 16S rRNA gene (Morandi et al. 2005; Alperi et al. 2008). Roger et al. (2012a) showed that aeromonads harboured 8 to 11 rrn operons with 10 operons being observed in more than 92% of the strains studied. Although the use of the 16S rRNA gene as an identification

-17- tool for aeromonads has been found useful by some (Figueras et al. 2005; Al-Benwan et al. 2007), it should not be the only gene used for Aeromonas species identification and delineation. This method has now been superseded by the use of housekeeping genes sequencing (Husslein et al. 1992; Cascón et al. 1996; Khan and Cerniglia 1997; Yañez et al. 2003; Soler et al. 2004; Nhung et al. 2007; Adekambi et al. 2008; Miñana-Galbis et al. 2009).

1.4.6.3. Identification based on housekeeping gene sequence

Housekeeping genes are universally distributed among bacterial species and are rarely predisposed to horizontal transfer as may be the case with 16S rRNA (Yañez et al. 2003; Morandi et al. 2005). The sequence divergence of housekeeping genes is usually greater than that of 16S rRNA and in some cases the mean substitution rate is four to six times higher (Yamamoto and Harayama 1996; Yañez et al. 2003; Soler et al. 2004; Küpfer et al. 2006; Saavedra et al. 2006; Nhung et al. 2007; Beaz-Hidalgo et al. 2009; Figueras et al. 2011b). Housekeeping genes provide better targets for Aeromonas delineation (Yañez et al. 2003) with the added advantage that these methods are less laborious to perform than DDH.

The sequences of the housekeeping genes recA, rpoB, dnaJ and cpn60 UT were comparable with gyrB and rpoD and superior to 16S rRNA for the differentiation of Aeromonas species (Küpfer et al. 2006; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010). The combined sequence of several housekeeping genes, multiloccus sequence typing (MLST) also known as multilocus sequence analysis (MLSA) is a powerful tool that can be used to determine the microbial diversity and classification of these organisms (Beaz-Hidalgo et al. 2009; Figueras et al. 2011a; Martino et al. 2011).

1.4.6.4. Specific genes used as identification targets

Primers designed to detect virulence genes that allow the direct identification of specific species included the aerolysin gene of A. trota (Husslein et al. 1992; Khan et al. 1999), the lip gene of A. hydrophila (Cascón et al. 1996) and a 421 bp sequence from the 3’ region of the surface array protein (vapA) gene of A. salmonicida (Gustafson et al. 1992). The latter assay doubles as a non-invasive method to monitor A. salmonicida in carrier fish and as a virulence marker (Gustafson et al. 1992). The glycerophospholipid- cholesterol acyltransferase (GCAT) gene is universally present in Aeromonas (Chacón et al. 2002) and has been used as a target to identify aeromonads to the genus level

-18-

(Puthucheary et al. 2012). Multiple-PCR (mPCR) assays capable of identifying up to 98% of Aeromonas species by detecting the presence of virulence genes have been developed (Sen 2005; Chang et al. 2008). The m-PCR assay based on oligonucleotide primers directed to the AHCYTOENT gene was designed for the rapid and specific detection of A. hydrophila in diseased fish including viable but non-culturable cells (Chu and Lu 2005a). Multiple-PCR assays are less expensive to run than RFLP and almost complete agreement with identification by biochemical methods has been reported (Sen 2005).

4 1. .6.5. Restriction enzyme-based methods

Several enzyme-based methods such as ribotyping, AFLP and restriction endonuclease analysis have been used alone, or in combination, as identification and typing tools in the classification of aeromonads. Of these, ribotyping is a useful method for species identification. It requires minimal DNA for testing and several strains can be tested simultaneously (Rautelin et al. 1995b; Martínez-Murcia et al. 2000; Soler et al. 2003a). Ribotyping has been the method of choice to demonstrate familial transmission and long-term colonization by A. caviae (Moyer et al. 1992; Rautelin et al. 1995b) and to determine routes of furunculosis in Finnish salmon caused by A. salmonicida ssp. salmonicida (Hӓnninen et al. 1995b). Ribotyping was found to be more sensitive than MLEE (Altwegg et al. 1991b) and superior to PFGE in an epidemiological study of A. salmonicida ssp. salmonicida (Hӓnninen and Hirvela-Koski 1997). PFGE patterns from mesophilic aeromonads revealed a high level of genetic heterogeneity (Talon et al. 1996; Hӓnninen and Hirvelӓ-Koski 1997; Villari et al. 2000). In contrast, PFGE patterns for A. salmonicida ssp. salmonicida confirmed the genetic homogeneity of this species (Hӓnninen and Hirvelӓ-Koski 1997; Miyata et al. 1995).

Bauab et al. (2003) suggested that ribotyping was a useful epidemiological tool suitable for the study of Aeromonas infections. However, ribotyping was found to be less discriminatory than ERIC-PCR (Soler et al. 2003a) and due to the genetically homogeneous nature of A. salmonicida (Hӓnninen et al. 1995b), unsuitable for typing these species (Altwegg and Luthi-Hottenstein 1991).

As mentioned in section 1.4.6.1 above, one of the most established molecular methods used as a typing and identification tool for Aeromonas is RFLP (East and Collins 1993; Borrell et al. 1997; Nagpal et al. 1998; Graf 1999a; Figueras et al. 2000b; Martínez- Murcia et al. 2000; Soler et al. 2003a; Laganowska and Kaznowski 2004; Kaznowski

-19- and Konecka 2005; Ghatak et al. 2007a). On the other hand, patterns generated by AFLP allow clear differentiation of strains within a given species and correlate well with DDH data suggesting that AFLP can be used for subtyping of aeromonads (Janssen et al. 1996). Both AFLP and FAFLP have been proposed for epidemiological and evolutionary studies (Huys et al. 1996b, 1997a, 2001; Janssen et al. 1996; Huys and Swings 1999).

1.4.6.6. PCR-based methods

PCR-based methods used in the study of aeromonads include RAPD, AFLP and ERIC. RAPD requires small amounts of genomic DNA (Miyata et al. 1995) while ERIC-PCR has generally been used in combination with other methods as a typing or differential tool (Davin-Regli et al. 1998; Sechi et al. 2002; Soler et al. 2003a; Szczuka and Kaznowski 2004). Both ERIC and RAPD are considered superior to REP-PCR for distinguishing Aeromonas species clones and for epidemiological investigation (Davin- Regli et al. 1998; Szczuka and Kaznowski 2004). As a sole testing method, ERIC-PCR was found more discriminatory for aeromonads than RFLP and REP (Soler et al. 2003a ).

1.4.6.7. Disadvantages of molecular methods

In general, most molecular-based methods are time consuming, expensive and labour intensive and do not always provide reliable and rapid results (Talon et al. 1996; Davin- Regli et al. 1998; Figueras et al. 2000b; Sen 2005). Some methods are limited in their applicability because they require materials not readily available in routine laboratories while others cannot reliably discriminate between strains (Moyer et al. 1992). Other methods, due to the type of results produced are more suitable for typing purposes than for species identification (Taçao et al. 2005b). In addition, ribotyping, RFLP and AFLP patterns can be difficult to interpret (Martínez-Murcia et al. 2000; Morandi et al. 2005; Sen 2005) while RFLP is highly dependent on the type and number of endonucleases used (Huys et al. 1996b; Graf 1999a; Figueras et al. 2000b; Kaznowski and Konecka 2005; Ghatak et al. 2007b). Atypical RFLP patterns have been recognized in clinical strains (Alperi et al. 2008; Puthucheary et al. 2012) more often than in environmental isolates (p < 0.01) due to microheterogeneities in the 16S rRNA gene (Alperi et al. 2008). The presence of microheterogeneities compromises accurate identification (Morandi et al. 2005). The taxonomic value of AFLP as a reliable identification tool has not yet been demonstrated (Martínez-Murcia 1999). Variations in DNA concentrations

-20- can affect reproducibility of RAPD (Davin-Regli et al. 1995). This method is also primer dependent (Oakey et al. 1995; 1996a) while interpretation of RAPD-PCR fingerprints may be affected by co-migration of DNA fragments due to electrophoretic resolution (Oakey et al. 1998). Due to a lack of standardization and with the exception of AFLP and ribotyping, results obtained from most methods are often difficult to compare (Tindall et al. 2010).

1.5. SEROTYPING

Serotyping was considered a promising tool to rapidly differentiate Aeromonas from other oxidase-positive bacteria (Joseph and Carnahan 1994; Korbsrisate et al. 2002). However, the variable typability rate of Aeromonas and antisera availability has hampered the use of serology as a routine identification method in clinical laboratories (Havelaar et al. 1992; Millership and Want 1993; Bonadonna et al. 2001). As a consequence, serotyping of Aeromonas has been confined to a few specialized laboratories.

No absolute association has been described between serotypes and certain phenotypes as Aeromonas species are serologically heterogeneous, and no serogroup has been uniquely associated with a single species (Havelaar et al. 1992; Millership and Want 1993; Bauab et al. 2003). The most dominant serogroups O:11, O:16, O:18, O:34 and O:83 have been associated with gastroenteritis and septicaemia (Kokka et al. 1991; Merino et al. 1993; Bauab et al. 2003). These serotypes can be present in up to 50% of the typable strains isolated from human clinical material (Korbsrisate et al. 2002). The loss of the O:34 antigen lipopolysaccharide due to mutation of the gne gene can affect motility despite complete flagellar biogenesis as the absence of O:34 antigen affects both swarming and swimming motilities (Canals et al. 2006a). Strains with the O:34 antigen have been found to have a high level of adhesion when grown at 20 but not at 37C. Thus, the O:34 antigen acts as an adhesion (Merino et al. 1996a).

Serotypes O:11 and O:34 have the capacity to produce a capsule when grown in glucose-rich medium (Martínez et al. 1995). Group IIA capsules have been found in A. hydrophila serotypes O:18 and O:34, while group IIB capsules are found in the O:21 and O:27 serogroups (Zhang et al. 2003). Serotype O:11 strains are known to possess an S-layer that can confer resistance to the bactericidal activity of normal serum (Kokka et al. 1991) in addition to being associated with invasive infections in an animal model

-21- system (Paula et al. 1988). S-layers have also been described in serogroups O:14 and O:81 of A. hydrophila which possessed S-layer proteins different from A. hydrophila TF7 and A. salmonicida A450 (Esteve et al. 2004). Clinical strains have been found to be less amenable to serotyping than environmental isolates (Millership and Want 1993). A differential serological test that determines the presence of A. salmonicida while ruling out A. hydrophila as the cause of furunculosis in Californian trout (Oncorhynchus Mykiss, Walbaum, 1792) was developed by Markovic et al. (2007).

1.6. ECOLOGY

The ubiquitous nature of Aeromonas is reflected by the isolation of these organisms from every environmental niche capable of sustaining bacterial growth. Although, compared to other aquatic organisms like Pseudomonas species, Aeromonas are less able to degrade simple compounds to be used as carbon sources (Schubert 1987). In earlier ecological studies, laboratory personnel were confronted with isolation procedures and identification schemes which, at the time, were based on phenotypic testing only (Schubert 1987).

1.6.1. Aquatic environments

Aeromonas species have been recovered from surface water, fish ponds, brooks, sewage in various stages of treatment, untreated and treated drinking water, rivers, lakes, groundwater, wastewater, activated sludge, seawater (estuaries), spring, and stagnant water (Freij 1984; Ørmen and Østensvik 2001). Despite the ubiquitous nature of these micro-organisms in aquatic environments, their natural reservoir is still unknown. Several possible niches have been proposed including the flora of plankton and seawater (Simidu et al. 1971); as natural inhabitans of chironomid egg masses, a feature also shared by V. cholerae (Senderovich et al. 2008); as inhabitans of duckweed, a potential reservoir for infections of humans consuming contaminated fish (Rahman et al. 2007a); and the ability to survive inside Acanthamoeba and remained viable during the encystment process while exhibiting high levels of recovery from mature cysts (Yousuf et al. 2013).

1.6.1.1. Distribution in water

The distribution of Aeromonas in water supplies varies depending on the levels of pollution, geographical region, methods and media used in the identification of aeromonads and the type of sample analysed (Araujo et al. 1991; Huys et al. 1995;

-22-

Kühn et al. 1997a/b; Sechi et al. 2002; Pablos et al. 2011). Furthermore, the diversity, density and overall composition of aeromonads vary depending on the time of the year (Kühn et al. 1997b; Rahman et al. 2007a). Aeromonads have been found to persist for prolonged periods of time in different water systems (Kühn et al. 1992, 1997c; Rahman et al. 2007a). Multiple clones have survived and multiplied in raw surface water after the treatment process (Kühn et al. 1997b) while phenotypically and genotypically stable clones could persist in treatment systems over long periods of time. As a result, clones may have spread from hospitalized children with diarrhoea to fish farmed for human consumption through the sewage water treatment system (Rahman et al. 2007a). Bacterial populations can increase from 103 to 106 CFU ml after bottling (Hunter 1993) to 2.7 x 106 CFU/ml and 1.9 x 106 CFU/ml in sediment sewage water and in duckweed aquaculture-based hospital sewage water treatment plant, respectively (Rahman et al. 2007a).

The distribution of Aeromonas species varies according to the type of water analysed. Both A. veronii bv. sobria and A. caviae have been predominant in sediment sewage water and treated sewage effluents (Ashbolt et al. 1995; Rahman et al. 2007a). The high incidence of A. caviae in sewage and wastewater suggests that this species may have a role as a potential indicator of water pollution (Araujo et al. 1991; Ramteke et al. 1993). In general, data from most studies implicate A. hydrophila as the most prominent species isolated from water samples. Minor species such as A. culicicola and A. popoffii have also been recovered from raw and treated waste water (Table 1.3) while A. eucrenophila was isolated from water and infected fish (Singh and Sanyal 1999; Figueira et al. 2011).

1.6.1.2. Water quality

The presence of Aeromonas in water depends primarily on the organic material content of the water, water temperature, the length of time in the distribution network and the presence of chlorine residues (Seidler et al. 1980; Kaper et al. 1981; Hird et al. 1983; van der Kooij and Hijnen 1988; Borrell et al. 1998; Korzeniewska et al. 2005). The survival rate of A. hydrophila in mineral water depended largely on the concentrations of dissolved solid and organic matter and not on temperature of storage (Korzeniewska et al. 2005). A significant correlation between organic matter content and total numbers of mesophilic aeromonads in waters has been reported (Araujo et al. 1989;

-23-

Korzeniewska et al. 2005). In polluted water, a correlation also exists between the numbers of aeromonads, faecal coliforms and the concentration of organic matter as measured by biological oxygen demand (Araujo et al. 1991). The isolation of Aeromonas from chlorinated water suggests a high organic loading as a result of inadequate chlorination (Abbott et al. 1992). Although polluted waters rich in nutrients readily support the growth of aeromonads, the presence of low molecular weight fatty acids, amino acids or carbohydrates in low concentrations can also promote growth of these organisms in less polluted waters (van der Kooij and Hijnen 1988). Indeed, A. hydrophila could survive for considerable periods of time in filtered-autoclaved fresh water or in filtered-autoclaved nutrient-poor water in the absence of natural microflora (Kersters et al. 1996; Korzeniewska et al. 2005). In some regions, aeromonads have been found to be more numerous than total coliforms in drinking (Schubert 1987) and fresh water, and their presence may be an indicator of water quality (Knochel and Jeppesen 1990).

1.6.1.3. Effects of temperature on growth and toxin production

The incidence of Aeromonas is usually low during winter compared to summer (Millership and Chattopadhyay 1985; Chauret et al. 2001). The ability of aeromonads to grow at low temperatures (5C) is a serious public health concern (Callister and Agger 1987; Nishikawa and Kishi 1988; Tsai and Chen 1996; Chang et al. 2008). Environmental isolates are adapted to competitive growth at lower temperatures than clinical isolates (Callister and Agger 1987). Toxin production is not necessarily inhibited at low temperatures (Eley et al. 1993) and enterotoxigenic A. hydrophila strains have been recovered from oysters stored for 18 months at 72 C (Abeyta et al. 1986). Maalej et al. (2004) demonstrated that A. hydrophila enter a viable-but-not- culturable (VBNC) state when exposed to nutritionally-deficient natural seawater at low temperatures. Changes in temperature from 5 to 23C allowed multiple biological activities such as adherence and haemolytic activity to be restored. The ability to enter this VBNC state may explain the persistence of A. hydrophila in water systems during winter (Maalej et al. 2004).

The ability of bacteria to enter a VBNC state permits the survival of microorganisms when confronted with adverse environmental conditions. In this state, bacteria fail to grow on routine microbiological media although they remain viable and retain virulence (Fakruddin et al. 2013). Ramamurthy et al. (2014) stated that the VBNC had important

-24- implication in several fields, including environmental monitoring, food technology, and infectious disease management. These authors suggested that it was important to investigate the association of bacterial pathogens under VBNC state and the water/foodborne outbreaks. Studies have shown that A. hydrophila in a VBNC state may not be as virulent to goldfish compared to normal culturable bacteria (Rahman et al. 2001). However, from the public health point of view, culture-negative food, environmental and clinical samples may not necessarily be an indication of a pathogen- free status. Moreover, low grade infections may be due to the presence of VBNC in water and food and in some instances incorrectly attributed to viruses when no bacteria have been detected (Fakkrudin et al. 2013).

1.6.1.4. Aeromonas in drinking water

The incidence of Aeromonas in drinking water from distribution systems is generally low (Le Chevalier et al. 1982). However, the affinity of A. hydrophila for low molecular weight substrates indicates that this organism can readily grow if these compounds are available in drinking water supplies (van der Kooij and Hijnen 1988). In Denmark, Aeromonas species constituted 28% of the bacterial load in drinking water with A. hydrophila as the dominant species (Knochel and Jeppesen 1990). The presence of these organisms in drinking water is undesirable because Aeromonas strains have been associated with a broad spectrum of human diseases (Gracey et al. 1982a; Burke et al.1984b; Villari et al. 2003). The relatively high presence of Aeromonas in public water systems in the USA was attributed to the inability of these systems to maintain an adequate concentration of residual chlorine throughout the distribution system (Egorov et al. 2011). The association of aeromonads in drinking water supplies with human infections and ability to grow in distribution system biofilms, led to the inclusion of Aeromonas in the first and second editions of the Contaminant Candidate List (CCL) issued by the United States Environmental Protection Agency (USEPA 1998) and also in the list of opportunistic bacterial pathogens among the major pathogens and parasites of health concern (Bitton 2014). Moreover, the presence of Aeromonas in food and water represents a vehicle for Aeromonas infections (Ottaviani et al. 2011).

-25-

Table 1.3 Distribution of Aeromonas spp. in water sources from different locations

Species (%) Location Type of water Reference

A. caviae (55%); A. hydrophila (34%); A. sobria (6%); Northern Sewage, river, sea Araujo et al. (1991) Aeromonas spp. (5%) Spain

A. hydrophila (51%);1 A. caviae (26%);1 A. veronii (11%); Finland Fresh, drinking Hänninen and Siitonen (1995) Unknown spp. (11%)

A. hydrophila (39%);1 A. caviae (23%); A. sobria (17%) Belgium Drinking, raw/treated Huys et al. (1995) surface and phreatic groundwater A. sobria (14%); A. caviae (11%); A. hydrophila (9.5%) India Metropolitan water Alavandi et al. (1999) supply, bore, drinking A. sobria (70%); A. popoffii (30%) Russia Drinking Ivanova et al. (2001)

A. hydrophila (67%); A. salmonicida (26%); A. sobria (11%) Sardinia, Coastal marine waters Sechi et al. (2002) Italy

-26-

Table 1.3 Continued.

Species (%) Location Type of water Reference

A. hydrophila2; A. veronii (both biovars)2 India River Sharma et al. (2005)

A. culicicola (45%); A. veronii (36%); A. salmonicida (8%); Spain Drinking Figueras et al. (2005) A. hydrophila (7%)

A. hydrophila (25%) India Surface Bhowmik et al. (2009)

A. media (~67%); A. caviae (33%) Leon, Spain Drinking Pablos et al. (2010)

A. dhakensis3 (55%); A. veronii bv. sobria (27%); Australia Irrigation, reservoir, Aravena-Román et al. (2011b) A. hydrophila (9%) treated, bore, chlorinated 1Identified as complex; 2Percentages not given; 3Previously classified as A. aquariorum.

-27-

1.6.2. Aeromonas in foods

Reports of Aeromonas-associated foodborne outbreaks began to appear frequently from the late-1970s reaching a peak in the 1980s (Abeyta et al. 1986; Isonhood and Drake 2002). Aeromonas species are not unusually resistant to traditional food processing techniques but are regularly isolated in variable numbers from vegetables, minced beef, pork, chicken, seafood, milk, cheese, fish, cream (Callister and Agger 1987; Nishikawa and Kishi 1988; Palumbo et al. 1989; Knochel and Jeppesen 1990; Kirov et al. 1993; Szabo et al. 2000; Villari et al. 2000; Castro-Escarpuli et al. 2003). This may explain the presence of Aeromonas in the stools of healthy humans since this represents transient colonization probably due to consumption of contaminated foods or drinking water.

The concentration of aeromonads varies depending on the food analysed and the location (Table 1.4). The incidence can vary from no aeromonads found in vegetables in Sweden (Krovacek et al. 1992) to large concentrations detected in raw food samples in Switzerland (Gobat and Jemmi 1993). Although food industries supplied with inadequately treated water may allow the spread of highly toxic strains and cause diarrhoeal illness (Abbott et al. 1992), contamination of food samples does not always originate from water (Hänninen and Siitonen 1995). A significant higher incidence of pathogenic aeromonads has been detected in raw food than in processed and ready-to- eat food samples (Kingome et al. 2004). Furthermore, the ability of aeromonads to grow in refrigerated grocery store produce, milk and meat implicates these bacteria as potential food pathogens, and these products may represent an important vehile of transmission (Kirov et al. 1993). Aeromonads harbouring virulence factors have been isolated world-wide from a variety of foods (Martins et al. 2002; Awan et al. 2006; Rodríguez-Calleja et al. 2006; Yucel and Erdogan 2010).

1.6.2.1. Distribution of Aeromonas spp. in foods

Overall, the most frequently isolated species from foods world-wide is A. hydrophila. This species has been recovered from fish, seafood, raw milk, poultry and red meats Nishikawa and Kishi 1988; Palumbo et al. 1989; Knochel and Jeppesen 1990; Hudson and De Lacy 1991; Gobat and Jemmi 1993; Tsai and Chen 1996; Kingome et al. 2004; Rodríguez-Calleja et al. 2006; Yucel and Erdogan 2010). The frequent isolation of A. hydrophila from oysters suggests that oysters may offer a better environment for growth

-28-

Table 1.4 Enumeration of Aeromonas spp. in different foodstuffs

Source Incidence Location Reference

Retail grocery store produce1 1 x 102 to 2.3 x 104/g USA Callister and Agger (1987)

Various products2 102 to 104/g New Zeland Hudson and De Lacy (1991)

Vegetables and raw milk Aeromonas no isolated Sweden Krovacek et al. (1992)

Raw food samples 6 x 106 CFU/g Switzerland Gobat and Jemmi (1993)

Lettuce 105 to 107 CFU/g Australia Szabo et al. (2000)

Various products3 104 to 105 CFU/g Italy Villari et al. (2000)

Organic vegetables Not estimated Northern Ireland McMahon and Wilson (2001)

Seafood 104 bacteria/g Germany Ullman et al. (2005)

1Initial concentration of aeromonads estimated at the time of purchase. Growth increased 10 to 1000 fold after 14 days incubation at 5C. 2Included ready to eat meat, poultry, shellfish, fish, meats, salads. Enumeration of aeromonads was determined by direct plating out. 3Products included vegetables, cheeses, meats and ice creams.

-29-

than other seafood (Tsai and Chen 1996). In Spain, A. hydrophila has been found as the predominant species in rabbit meat in addition to Y. enterocolitica, Listeria spp. and S. aureus (Rodríguez-Calleja et al. 2006). Potentially pathogenic species such as A. sobria, A. trota and A. veronii bv. veronii, occasionally associated with gastroenteritis, have been isolated from a variety of foods (Nishikawa and Kishi 1988; Granum et al 1998; Merino et al. 1995; Janda and Abbott 1998). In Northern Ireland, A. schubertii (21%) was the most common aeromonad isolated from organic vegetables (McMahon and Wilson 2001) while an investigation of frozen fish samples in Mexico reported that A. salmonicida (67.5%) and A. bestiarum (20.9%) accounted for the majority (88.3%) of the isolates (Castro-Escarpulli et al. 2003). There is evidence that species such as A. trota are able to grow in 0.68M NaCl, the concentration used as food preservative (Delamare et al. 2000).

1.7. EPIDEMIOLOGY AND PUBLIC HEALTH ISSUES

Unlike other recognized pathogens such as N. meningitidis, N. gonorrhoeae, and S. Typhi, Aeromonas is not a reportable organism. In the United Kingdom (UK) Aeromonas bacteraemia is a voluntarily reportable condition while in the state of California, USA, the practice of reporting infections with aeromonads was discontinued (Janda and Abbott 2010). The incidence of aeromonads in healthy humans has been estimated to vary between 1 and 3.5% compared to 10.8% in faeces from diarrhoeic patients (von Graevenitz and Mench 1968; Goodwin et al. 1983; Edberg et al. 2007; Rahman et al. 2007a; Suarez et al. 2008). The combined incidence of Aeromonas septicaemia in the USA and the UK has been estimated to be 1.5 per million (Janda and Abbott 2010). Colonization of humans with aeromonads begins very early in life. A survey of 52 cesarean-borne Peruvian children showed that 23% of the infants harboured Aeromonas during the first week of life without developing clinical symptons. Colonization of the infants was attributed to the hospital water (Pazzaglia et al. 1990a).

Although Aeromonas are present in most foods and aquatic environments, the global incidence of infections caused by these microbes is unknown (Hӓnninen and Siitonen 1995). Asymptomatic human carriers could serve as vectors for the organism, in particular, individuals working as food handlers (Abeyta and Wekell 1988). The presence of virulence factors in water isolates of A. hydrophila (Bondi et al. 2000) reinforces the notion that from the public health perspective, the isolation of

-30- aeromonads from water and foods is associated with intestinal and extraintestinal infections. Episodes of diarrhoea in children and adults after consumption of contaminated food and drinking water have been described (Freij 1984; Lehane & Rawlin 2000). This is particularly important in developing countries such as India where river water contaminated with aeromonads species is used for drinking and recreational activities (Sharma et al. 2005). Indeed, accidents in water-related recreational activities have resulted in serious infections with these organisms (Bossi- Küpfer et al. 2007). Less commonly, infections with aeromonads due to animal bites have been reported. These infections have been attributed to the disruption of the natural environment of animals due to expansion of urban areas into rural regions (Angel et al. 2002; Kunimoto et al. 2004).

1.7.1. Water-associated infections

The presence of multiple virulence factors in Aeromonas isolated from water including chlorinated water represents a serious public health concern (Alavandi et al. 1999; Figueras et al. 2005; Snowden et al. 2006; Rahman et al. 2007a; Bhowmik et al. 2009). The proportion of aeromonads strains carrying putative virulence factors varies from 36 to 71% (Seidler et al. 1980; Kaper et al. 1981; Kühn et al. 1997b). In humans, gastrointestinal and soft tissue infections are the result of exposure to or ingestion of contaminated water supplies (von Graevenitz and Mench 1968; Washington 1972; Joseph et al. 1979; Seidler et al. 1980). Experiments on mice have shown that the ability to cause damage by Aeromonas isolated from clinical and water sources is comparable to toxigenic V. cholerae (Bhowmik et al. 2009).

Raw waters prepared for human consumption from sewage-polluted surface waters loaded with pathogenic Aeromonas represent a potentially greater health risk to the human population than the use of underground water (Schubert 1991a). Polluted waters represent a health hazard to the human population in general but to the military, commercial divers and people involved in aquatic sports in particular (Berg et al. 2011). Several Aeromonas species possessing a variety of cytotoxins and other virulence factors have been isolated from drinking, river, sea and fresh water (Ashbolt et al. 1995; Ivanova et al. 2001; Balaji et al. 2004; Sharma et al. 2005; Khan et al. 2008; Berg et al. 2011). Evidence for the water-borne origin of infections caused by Aeromonas in humans derived from several studies (Picard and Goullet 1987; Khajanchi et al. 2010; Pablos et al. 2010; Lye 2011). In drinking and mineral water, Aeromonas can persist for

-31- a long time due to biofilm formation (Dorsh et al. 1994; Kühn et al. 1997b; Chauret et al. 2001; Villari et al. 2003). Thus, Aeromonas counts have been proposed as an additional indicator of water quality in the United States (US) and other countries (Villari et al. 2003). In addition, the US Environmental Protection Agency’s Contaminant Candidate List has included A. hydrophila as an emerging pathogen in drinking water (Borchardt et al. 2003). Surprinsingly, a 2011 study recommended that Aeromonas should not be included in further editions of the CCL concluding that these microbes do not represent a significant public health hazard (Egorov et al. 2011).

1.7.2. Food-associated infections

Like water, contaminated fish, meats and poultry also represent a health hazard to humans as these products are an integral food source of the human diet (Kirov 1993; Hӓnninen and Siitonen 1995; Rahman et al. 2007a). However, despite that most foods can be contaminated with aeromonads as described in section 1.5.2, only a few reports have implicated aeromonads as the cause of food-poisoning outbreaks (Abeyta et al. 1986; Todd et al. 1989; Kirov 1997). The most compelling evidence to date derived from the consumption of ready-to-eat shrimp cocktail by a 38 year-old man who developed gastroenteritis. Ribotyping patterns revealed that the patient’s stools and the shrimp contained identical Aeromonas spp. (Altwegg et al. 1991a). In Sweden, 24 people developed food-poisoning symptoms including severe acute diarrhoea, abdominal pain, headache, fever, and vomiting after consuming food contaminated with a highly virulent A. hydrophila strain (Krovacek et al. 1995). Consumers are regularly exposed to toxin-producing strains without registering signs of malaise although theoretically, food-poisoning could result from colonization and less likely, by intoxication due to the elaboration of preformed toxins (Knochel and Jeppesen 1990; Kirov 1993; Villari et al. 2000). In humans, food poisoning due to consumption of contaminated fish can lead to septicaemia (Ketover et al. 1973) or contact with fish can cause serious infections particularly in immunocompromised individuals (Lehane and Rawlin 2000). Thus, recommendations designed to control and limit the growth of these and other potentially pathogenic bacteria have been proposed (Szabo et al. 2000).

1.7.3. Aeromonas and fish infections

-32-

Aeromonas species are part of the normal microbial flora of fishes and other aquatic animals and plants (Simidu et al. 1971; Trust and Sparrow 1974). Among freshwater fish, Aeromonas and Vibrio species predominate (Trust and Sparrow 1974). Aeromonas-related disease in fish is of high economic significance and has become a major problem to fish aquaculture (Austin and Austin 1987; Nash et al. 2006; In- Young-and Joh 2007; Zmyslowska et al. 2009; Pridgeon et al. 2011). In order to control aeromonasis, aquaculture farmers rely primarily on the use of antimicrobials. However, this practice is expensive and a potential risk to the environment and human health (Harikhrishnan et al. 2010a). Recent studies have proposed the bacteriolytic properties of the predator bacterium Bdellovibrio and the antibacterial properties of the extracellular products of Bacillus amyloliquefaciens for the control of pathogenic A. hydrophila (Cao et al. 2011, Cao et al. 2012). The latter is considered a promising probiotic for the biocontrol of A. hydrophila infections in the eel A. anguilla (Cao et al. 2011) while Bdellovibrio strain F16 significantly reduced the cell density of A. hydrophila exhibiting 100% lysis activity against this pathogen (Cao et al. 2012). A recent method that increases the effectiveness of solar disinfection via a thin-film fixed bed reactor has been developed for the solar photocatalytic inactivation of A. hydrophila (Khan et al. 2012).

The species most often associated with fish infections are A. salmonicida, A. hydrophila and A. veronii although re-identification of a group of aeromonads isolated from diseased fish revealed that other species including A. sobria, A. salmonicida, A. bestiarum, A. hydrophila, A. piscicola and a strain of A. tecta prevailed (Beaz-Hidalgo et al. 2009). Furunculosis in fish is typically caused by A. salmonicida while A. hydrophila, the primary aetiological agent in red-sore disease (Hazen 1979), can also cause furunculosis and septicaemia in various fish species leading to severe losses in farm production (Wakabayashi et al. 1981; Nash et al. 2006). Usually, infection by these bacteria is manifested as an acute form involving septicaemia and episodes of haemorrhage at the bases of the fins, loss of appetite and melanosis. Subacute to chronic forms of the disease are usually observed in older fish accompanied by lethargy, slight exophthalmia and haemorrhaging muscle and internal organs (Joseph and Carnahan 1994; Austin and Adams 1996).

1.8. BIOREMEDIAL AND BIODEGRADABLE PROPERTIES

-33-

Aeromonas may play significant environmental roles or express unsual properties including the detoxification or removal of environmental toxins in groundwaters, industrial affluents and contaminated soils; maintaining the balance of carbon and nitrogen elements in the aquatic biosphere by virtue of their chitinolytic activity; the ability of some strains to generate electricity; the degradation of polypectate by A. salmonicida ssp. pectinolytica; the removal of pesticides (Pavan et al. 2000; Pham et al. 2003; López et al. 2005; Lan et al. 2008).

Bioremedial properties associated with Aeromonas include the removal of selenite from contaminated groundwaters (Hunter and Kuykendall 2006); assimilation of seleniferous compounds present in agricultural drainage (Rael and Frankenberger 1996); reduction of arsenate to arsenite (Anderson and Cook 2004); production of a biosurfactant (Ilori et al. 2005) and the ability to decolorize triarylmethane dyes (Ogugbue and Sawidis 2011). These properties can have a significant impact on the environment, as triarylmethane dyes can exert toxic effects in plants and their disposal on land, may have a direct impact on soil fertility and possibly agricultural productivity (Ogugbue and Sawidis 2011). Surfactants have important bioremedial properties with environmental and biotechnological applications that can be applied in the food and pharmaceutical industries (Ilori et al. 2005). On the negative side, the ability of Aeromonas to reduce sulphite to H2S, ferric to ferrous iron and oxidise cathodic hydrogen are properties strongly associated with microbial influenced corrosion, one of the most destructive modes of metal corrosion (McLeod et al. 1998).

1.9. VIRULENCE FACTORS

Assessing virulence in Aeromonas has been difficult due to the variety of hosts that different species appear to infect and differences in growth requirements (Froquet et al. 2007). Virulence in Aeromonas has been investigated primarily through animal lethality studies (Daily et al. 1981; Wong et al. 1996), using immunocompromised or septic mice (Lye et al. 2007; Khajanchi et al. 2011) and healthy animals (Janda et al. 1985). Other models proposed include the tropical fish blue gourami (Fock et al. 2001) and zebrafish (Rodríguez et al. 2008); the free-living protozoan Tetrahymena (Pang et al. 2012) and the unicellular amoebae Dictyostelium (Froquet et al. 2007). The worm Caenorhabditis elegans has also served has a model after infection with A. hydrophila and the production of toxic symptoms (Couillault and Eubank 2002). A mouse model

-34- was also developed to determine the gastrointestinal colonization rate among environmental Aeromonas isolates (Lye 2009).

However, the medicinal leech model of Graf (2000) has been recognized as a promising model to assess virulence in Aeromonas (Janda and Abbott 2010). Several genes involved in a multitude of activities have been identified in Aeromonas residing in the leech digestive tract (Silver et al. 2007a). Moreover, the potential for discovering other genes and their products makes the medicinal leech an exciting model to determine the virulence of Aeromonas strains. A recent study used comparative genomic and functional analyses of virulence genes to assess virulence of two A. hydrophila strains isolated from a human wound (Grim et al. 2013). This is probably the most promising method to date, it can be easily reproduced and a library of well-characterized Aeromonas pathotypes can be created.

1.9.1. Adherence

The attachment of bacteria to host cells allows a close interaction with tissue and body fluids and for maximal effect of any toxins that aeromonads may produce (Atkinson and Trust 1980, Atkinson et al. 1987). Adhesion may be mediated by pili, flagella, filamentous networks and possibly the lipopolysaccharide (LPS) O-antigen. Non- filamentous adhesins in the form of a polysaccharide capsule or outer membrane proteins may also be involved (Atkinson and Trust 1980; Carrello et al. 1988; Hokama and Iwanaga 1991; Merino et al. 1996a; Gryllos et al. 2001; Zhang et al. 2003; Fang et al. 2004). Adhesion to cell lines has been used as a model for intestinal infection which has been correlated with enteropathogenicity (Kirov et al. 1995a). The ability of aeromonads to adhere to cell lines may depend significantly on the temperature, source of isolation, species, and the type of cell line (Neves et al. 1994; Kirov et al. 1995a; Snowden et al. 2006). Further, probiotic bacteria inhibit the ability of Aeromonas to adhere to human epithelium and traslocate due to competition for adhesion sites (Hatje et al. 2011).

Several mechanisms that recognise different binding sites on erythrocytes, buccal epithelium and other cells have been described in A. hydrophila (Atkinson and Trust 1980; Ascensio et al. 1991). Studies have shown that A. hydrophila can bind to sialic acid-rich glycoproteins, lactoferrin, collagen and laminin via a lectin-like mechanism (Ascensio et al. 1991) while the interaction of A. caviae, A. hydrophila and A. sobria

-35- with mucins has also been investigated (Ascension et al. 1998). In A. caviae, the ability to attach to inert surfaces such as glass has been associated with hyperpiliation of the cells through the presence of type IV pili (Béchet and Blondeau 2003).

1.9.2. Pili

Pili are cell associated structures often involved in adhesion and some of which act as haemagglutinins (Carrello et al. 1988; Hokama and Iwanaga 1991; Kirov et al. 1995b). Type IV pili have been purified from A. veronii bv. sobria (Carrello et al. 1988; Hokama and Iwanaga 1991, 1992; Iwagana and Hokama 1992; Kirov and Sanderson 1996), A. hydrophila (Atkinson and Trust 1980; Carrello et al. 1988; Hokama et al. 1990; Honma and Nakasone 1990; Ho et al. 1990), A. caviae (Carrello et al. 1988; Kirov et al. 1998) and A. trota (Nakasone et al. 1996). Morphologically, pili appear as a thin, long flexible structure, usually present in small numbers (type-L) and a more numerous, shorter, thicker and straight pilus (S-pili). Occasionally, Aeromonas pili can form rope-like bundles also known as bundle-forming pili (Bfp) that are usually present in 5 to 10% of cells (Kirov and Sanderson 1996). The molecular masses of the subunit proteins range from 4 to 23 kDa and despite similar morphology pili from different strains can be biochemically and immunologically unrelated (Ho et al. 1990; Hokama and Iwanaga 1991; Iwanaga and Hokama 1992; Kirov and Sanderson 1996) (Table 1.5).

Expression of pili depends on the culture medium and temperature of incubation. Growth in liquid medium favours the production of both pilus types particularly at lower (22ºC) temperatures (Carrello et al. 1988; Hokama and Iwanaga 1991; Kirov et al. 1995b; Kirov and Sanderson 1996). The S-type pili can be expressed under different conditions of growth although in purified form the haemagglutinating function may be lost (Ho et al. 1990). Genes involved in pilus biogenesis have been characterized in A. hydrophila and A veronii bv. sobria. There are at least two distinct families of type IV pilus, Tap and Bfp (Barnett et al. 1997). In A. hydrophila, a type IV pilin subunit is encoded by the tapA gene, one of four genes comprising the tap cluster (Pepe et al. 1996). The remaining genes tapB and tapC also have a role in pilus biogenesis while the tapD gene has been associated with the production of a type IV leader peptidase/N- methyltransferase involved in extracellular secretion of aerolysin and protease. The proteins encoded by these four genes are closely related to the products of the pilABCD gene cluster described in P. aeruginosa (Pepe et al. 1996). The tap cluster is also expressed by A. veronii bv. sobria and other Aeromonas species although differences in

-36-

Table 1.5 Characteristics of pili described in Aeromonas species

Species/strain Pilus type Agglutination of Adhere to: MW Diamete Source Reference erythrocytes (kDa) r (nm) A. hydrophila A6 Not described Human Gr O Buccal   Faecal Atkinson & Trust epithelium (1980) A. hydrophila/caviae/sobria L-pili Human Gr O HEp-2 cells  2.5 Faecal, Carrello et al. (1988) (flexible) water A. hydrophila/caviae/sobria S-pili (straight) Human Gr O Hep-2 cells  5 Faecal, Carrello et al. (1988) water A. hydrophila Ae6 W W-pili Human, rabbit Human/rabbit 21.0 7 Faecal Hokama et al. (1990) (flexible) intestine A. hydrophila Ae6 R-pili No agglutination Failed to 18.0 9 Faecal Honma & Nakasone (straight) human/GP adhere (1990) A. hydrophila AH26 Straight No agglutination  17.0 7 to 9 Faecal Ho et al. (1990) human/GP A. sobria Ae1 Flexible Human/GP/ovine/  4.0 7 to 9 Faecal Ho et al. (1990) bovine/avian

-37-

Table 1.5 Continued.

Species/Strain Pilus type Agglutination of Adhere to: MW Diameter Source Reference erythrocytes (kDa) (nm)5 A. sobria Ae1 Flexible Human Gr A Human/rabbit 23.0 7 Faecal Hokama & Iwanaga /rabbit intestine (1991) A. sobria TAP13 Flexible No agglutination Rabbit intestine 23.0 7 Faecal Iwanaga & Hokama human/rabbit/sheep (1992) A. sobria Ae24 Flexible/ Human/rabbit Rabbit intestine 19.0 7 Faecal Hokama & Iwanaga wavy (1992) A. veronii bv. sobria Flexible/ No agglutination  21.0  Bloody Kirov and Sanderson bundles human Gr O stools (1996) A. trota Flexible No agglutination Rabbit intestine 20.0 7 Surface Nakasone et al. (1996) human/rabbit water A. caviae Flexible/  HEp-2 23.0  Faecal Kirov et al. (1998) bundles GP, Guinea pig; , not determined; Gr, group

-38-

the predicted N-terminal amino acid sequence between the cloned TapA pilins and purified Bfp pilin have been observed (Barnett et al. 1997; Kirov et al. 1998, 2000). Recently, a 22-kb locus comprising 17 pilus-related genes similar to the mannose- sensitive hemagglutinin of Vibrio cholerae and responsible for encoding the bundle- forming pilus was characterized in A. veronii bv. sobria (Hadi et al. 2012).

Bfp plays an important role in the pathogenesis of gastrointestinal infection caused by Aeromonas by promoting colonization and forming bacterium-to-bacterium linkages (Kirov et al. 1999). The removal of Bfp can decrease adhesion by up to 80% (Kirov et al. 1999) while mutation of the major Bfp pilin gene mshA greatly reduces the bacterium's ability to adhere and form biofilms (Hadi et al. 2012). By contrast, mutagenesis experiments showed that inactivation of tapA had no effect on bacterial adherence to Hep-2, Henle 407 and human intestinal cells suggesting that the Tap pili may not be as significant as Bfp pili for Aeromonas intestinal colonization (Kirov et al. 2000).

1.9.3. Invasins

Studies on invasins are sparse in Aeromonas considering that invasion is a recognized virulence factor (Chu and Lu 2005b). Although not as invasive as some E. coli strains which have invasion in vitro levels 200 times greater than most Aeromonas, the ability of Aeromonas to penetrate and replicate may have significant clinical implications as dysenteric symptoms have been associated with invasive species (Lawson et al. 1985; Watson et al. 1985; Gray et al. 1990; Nishikawa et al. 1994). Several studies have shown that A. hydrophila, A. caviae and A. sobria strains isolated from human and non- human sources were able to invade HEp-2 and Caco-2 cells (Lawson et al. 1985; Watson et al. 1985; Nishikawa et al. 1994; Shaw et al. 1995). On the other hand, strains of A. hydrophila and A. sobria isolated from fish and hare showed greater ability to invade HEp-2 cells compared to environmental aeromonads (Krovacek et al. 1991).

The mechanism of invasion involves components of both bacterium and host cells including bacterial outer membrane proteins, cell membrane receptors, signal transductions and cytoskeletal rearrangement (Chu and Lu 2005b). Extracellular products may play a very minor role in the morphological changes that occur during the invasion process (Leung et al. 1996). Brush border and microvilli disruption have been associated with adhesion and invasion of Caco-2 cells but no actin accumulation that is

-39- associated with the attaching and effacing process in enteropathogenic E. coli (Nishikawa et al. 1994).

The invasive ability of A. hydrophila has been investigated using different fish cell lines and virulent and avirulent isolates. Only virulent strains were able to multiply and cause cytopathic changes within the affected cells (Leung et al. 1996; Low et al. 1998). Low et al. (1998) showed that cytopathic changes occurred concomitantly with rearrangements of microfilaments (MFs) in a process involving three stages of infection. In stage I, cells detach and elongate; in stage II, cells connect to neighbouring cells by tubular cytoplasmic extensions resulting in less confluent monolayers with a satellite-like organization; in stage III, bacteria are abundantly present in cells and vacuoles resulting in eventual detachment and lysis. Moreover, the F-actin rearrangement process involves the formation of an actin cloud immediately after the bacterium becomes in contact with the cell (first phase) followed by reorganization (depolymerisation) of actin fibres (second phase).

Chu and Lu (2005b) showed that polymerization of MFs was inhibited by cytochalasin in a dose dependent manner, resulting in inhibition of invasion by A. hydrophila Ahj-1 into epithelioma papillosum cells of carp (EPC). By contrast, pretreatment of EPC cells with colchicines and nocodazole, inhibitors of microtubule (MT) formation, had no effect on the process of invasion. Thus, MFs but not MTs are required for the internalization of A. hydrophila into EPC cells (Low et al. 1998; Chu and Lu 2005b). These results indicate that actin polymerization is involved in the invasion process of Aeromonas. Invasion by Aeromonas can lead to mucosal damage similar to that produced by Shigella species as shown in a rabbit model although some strains may still invade without causing extensive destruction. This divergence has been attributed to the different routes of entry employed by bacterial cells such as Peyer’s patches of the ileum, lymphatics and passage through the mucosa via other mechanisms (Pazzaglia et al. 1990b). Gavin et al. (2003) showed that the introduction of lafA into lafA mutants enhanced invasion of HEp-2 cells and biofilm formation in vitro.

1.9.4. S-layer

In Aeromonas, the S-layer (originally called the A-layer), is considered a primary virulence factor due to its extraordinary binding capabilities (Kay et al. 1981; Trust et al. 1983; Chu et al. 1991). S-layer has been described in A. salmonicida, A. hydrophila

-40- and A. sobria. Isolates carrying the O:11 somatic antigen and a S-layer have been implicated mostly in invasive rather than localized infections in humans (Janda et al. 1987b; Paula et al. 1988; Merino et al. 1995; Kirov 1997). S-layers conferred protection to the bacterium from the serum killing activity of the host and from proteases by acting as a physical barrier to the lytic complement components (Munn et al. 1982) and by facilitating the entry into macrophages (Trust et al. 1983).

1.9.4.1. Structural arrangements

S-layers are regular, two-dimensional assemblies of protein monomers that often constitute the outermost layer of the cell envelope of many bacteria (Sletyr and Messner 1983). The spatial arrangements of the S-layer in Aeromonas vary from hexagonal, tetragonal to linear oblique arrays with a lattice constant of 12.0-12.5 nm (Dooley et al. 1989). The S-layer of A. salmonicida consists of regular, two-dimensional protein monomers with MWs between 49.0 and 52.0 kDa (Belland and Trust 1987; Chu et al. 1991). The S-layer contributes to the physical properties of the A. salmonicida cell envelope. Loss of the S-layer can lead to changes in the physical properties allowing the organism to grow at higher than usual temperature (Ishiguro et al. 1981).

1.9.4.2. Binding properties

S-layer can bind to host basement membranes molecules such as fibronectin, laminin and collagen-IV (Kay and Trust 1991). The S-layer of A. salmonicida can specifically bind to porphyrins, other heme analogues (Kay et al. 1985), and immunoglobulins (Phipps and Kay 1988) allowing the organism to survive in vivo by avoiding phagocytosis (Kay et al. 1985; Dooley and Trust 1988).

1.9.4.3. Genes involved in S-layer synthesis

At the genetic level, little or no homology exists between the S-layer gene of A. salmonicida (vapA) and that of A. hydrophila (ashA) (Belland and Trust 1987). Although the gene is always present in A. salmonicida, the failure of a strain to produce S-layer is probably due to either deletion or rearrangement of the entire gene or parts of it or alterations in the expression of vapA (Gustafson et al. 1992). Secretion of the AhsA protein in A. hydrophila (Thomas and Trust 1995b) is mediated by the spsD gene while

-41- a protein encoded by the apsE gene of A. salmonicida may provide the necessary energy to the secretory apparatus (Noonan and Trust 1995). Loss of expression of the S-layer due to growth at 30°C results in genetic rearrangement in which N-terminal sequences of the A protein are lost by gene deletion (Belland and Trust 1987).

1.9.4.4. S-layer and virulence

Because of the different types of diseases caused by A. salmonicida and A. hydrophila each organism may use its S-layer in a different manner despite morphological similarity (Dooley and Trust 1988; Murray et al. 1988). In A. hydrophila the S-layer may not be the principal virulence factor in fish as it is in A. salmonicida (Thomas et al. 1997). In contrast, mutagenesis experiments have shown that in A. salmonicida S-layer deficient mutants virulence can decrease up to >105 fold when the organism is incubated at higher than normal temperatures (Ishiguro et al. 1981) or that binding of the S-layer to IgG can only take effect when the A-protein is intact (Phipps and Kay 1988).

1.9.5. The lipopolysaccharide (LPS)

The endotoxin component of LPS produced by Aeromonas is similar to that of other Gram-negative bacteria. A combination of hexose and heptose monosaccharide residues constitutes the core region of the LPS in motile aeromonads (Shaw and Hodder 1978).

1.9.5.1. Functions of the LPS

The LPS confers protection to the bacterium against the bactericidal effects of normal serum. The loss of the O-antigenic polysaccharide chains allows access of complement components to their target producing bactericidal effects. The LPS also acts as an adhesin in human epithelial and HEp-2 cells (Gryllos et al. 2001; Vilches et al. 2007), particularly in strains from serogroup O:34 (Merino et al. 1996a). The ability of A. sobria to adhere to HEp-2 cells was found to correlate with the level of LPS expression and growth phase (Paula et al. 1988; Francki and Chang 1994). Other functions include a role in the assembly and maintenance of the S-layer of A. salmonicida and excretion of exotoxins. Strains lacking the O-antigen (rough strains) excrete less toxin than those strains with abundant O-antigen LPS (smooth strains) (Chart et al. 1984).

-42-

Temperature plays a significant role in the production of smooth and rough LPS. Smooth LPS is produced when strains are grown at 20C which correlates with the ability of O:34 to colonize the germfree chicken gut at this temperature but not at 37C (Merino et al. 1992; 1996a/b). In addition, mutagenesis experiments revealed that smooth strains are more virulent when grown at lower temperatures (Gryllos et al. 2001). The type of LPS produced is also influenced by salt concentration. At high osmolarity, smooth LPS is produced despite incubation at 37C. By contrast, cells cultivated at low osmolarity produced rough LPS (Aguilar et al. 1997). Aguilar et al. (1997) showed that cells grown at high osmolarity were more virulent for fish and mice, had increased extracellular activities, enhanced adhesion to HEp-2 cells and were resistant to the bactericidal activity of non-immune serum.

1.9.5.2. Immunological and antigenic properties of LPS

In A. salmonicida strains, the O-polysaccharide chains are very homogeneous with respect to cell length, strongly immunogenic and antigenically cross-reactive (Chart et al. 1984). The O-polysaccharide chains can traverse the surface protein array of virulent strains of A. salmonicida becoming exposed on the cell surface. These properties and the considerable antigenic conservation of A. salmonicida have been proposed as a potential target in the design of an effective vaccine (Chart et al. 1984). Antiserum raised against A. hydrophila LPS decreased the mortality of suckling mice from 100 to 30% (Wong et al. 1996). LPS with similar properties to those described by Chart et al. (1984) for A. salmonicida were reported in two A. hydrophila strains, although A. hydrophila can produce a LPS with O-polysaccharide chains of heterogeneous as well as homogeneous lengths (Dooley et al. 1985).

1.9.5.3. Genes involved in LPS synthesis

The gaIU gene encodes GaIU, a UDP-glucose pyrophosphorylase responsible for the synthesis of UDP-glucose from glucose-1-phosphate (Vilches et al. 2007). The gaIU gene is distributed in all mesophilic aeromonads. Mutations of the gene may affect the survival of Aeromonas in serum, decrease adhesion ability and reduce virulence of O:34 strains as shown by a septicaemic model with fish and mice (Vilches et al. 2007). Mutations in the galU gene of A. hydrophila AH-3 (O:34) result in the production of two bands compared to one in the wild type which corresponds to two types of LPS

-43-

(Vilches et al. 2007). The flm cluster (consisting of five different genes flmA, flmB, flmD, neuA and nueB) of A. caviae Sch3N is involved in LPS O-antigen biosynthesis and possibly in flagellum assembly (Gryllos et al. 2001).

1.9.6. Outer membrane proteins (OMP)

Outer membrane proteins have been associated with the transport of ions and molecules across the outer membrane, cell architecture allowing the passage of toxins (Howard and Buckley 1985), and ability to act as an adhesin (Atkinson and Trust 1980). Haemagglutination has been shown to correlate with the presence of a 43 kDa OMP (Atkinson and Trust 1980) while the carbohydrate-reactive-OMP (CROMP) of A. hydrophila A6 may act as an adhesin able to attach to erythrocytes or intestinal epithelium via a fucose site (Quinn et al. 1993). The outer surface of A. hydrophila is carbohydrate-reactive and the ability to adhere to human red cells and human colonic cancer cells depends on ligands expressed on its external surfaces (Quinn et al. 1994). However, these carbohydrate-reactive proteins may not be uniformly distributed among all Aeromonas species (Küijper et al. 1989a).

The gene encoding for the 43 kDa OMP of A. hydrophila has been cloned and expressed in E. coli resulting in a recombinant adhesin with the ability to confer up to 87.5% protection in blue gourami against homologous A. hydrophila challenge (Fang et al. 2004). Results suggested that the 43 kDa OMP is a conserved protein found in A. hydrophila and A. sobria and may share similar antigenic characteristics with V. anguillarum and E. tarda (Fang et al. 2004). Jeanteur et al. (1992) showed that A. hydrophila Ah65 shares similar N-terminal sequences and channel-forming properties with other Gram-negative species particularly E. coli. Further, different porin types have been described in various A. hydrophila strains including protein VI, which shares the same molecular mass and almost identical amino terminus with the OmpW of V. cholerae (Jeanteur et al. 1992; Quinn et al. 1994).

A vaccine based on the antigenic properties of OMPs was developed to control A. hydrophila in fish. The survival of the vaccinated fish improved 50% compared to unvaccinated controls (Thangaviji et al. 2012). Another vaccine candidate, based on the recombinant A. hydrophila OMP48, increased the survival of fish immunized when challenged with virulent A. hydrophila and Edwarsiella tarda. The gene coding OMP48

-44- had high similarity to LamB porin genes of A. hydrophila, A. salmonicida and V. parahaemolyticus (Khushiramani et al. 2012).

1.9.7. Flagella

Flagella are complex bacterial organelles associated with multiple roles in bacteria-host interactions. Two distinct flagellar systems are expressed in Aeromonas, a polar flagellum (Fla) for swimming in liquid media and multiple lateral flagella (Laf) for swarming on solid surfaces or viscous conditions (Rabaan et al. 2001; Gavin et al. 2002, 2003; Kirov et al. 2004). Basically, flagella are helical propellers that consist of a filament made up of polymerized protein subunits, attached by a hook structure to the basal body (Macnab and DeRossier 1988).

1.9.7.1. Synthesis, regulation and expression of flagella

Synthesis of flagella represents a high metabolic cost for the bacterium in terms of resources and energy. Expression of both flagella is highly regulated by environmental factors and other regulators (Kirov 2003; Merino et al. 2006). Lateral flagella are usually present on 50 to 60% of the bacterial cells when the bacterium is grown in high viscosity medium but are absent in liquid medium (Kirov et al. 2002; Wilhems et al. 2011). Synthesis of lateral flagella is under the control of the polar flagellar system although mutations in the polar fla genes do not prevent expression of the lateral flagella (Gavin et al. 2002; Santos et al. 2010).

Regulation of flagellum biogenesis involves a combination of transcriptional, translational, and post-translational regulation (Aldridge and Hughes 2002; Soutourina and Bertin 2003). These genes have been divided in three categories: early genes encoding regulatory proteins, middle genes encoding structural units and the late genes involved in the chemo-sensor machinery (Aldridge and Hughes 2002). The polar and lateral flagellar systems of A. hydrophila AH-3 consist of more than 55 and 38 genes distributed in five regions, and a single chromosomal region, respectively (Canals et al. 2006a/b). In A. caviae, several polar flagella genes responsible for encoding different components of the flagella machinery have been identified (Rabaan et al. 2001; Gavin et al. 2002; Kirov et al. 2002). In A. hydrophila, expression of polar flagellum appears to be organized in four transcriptional levels (classes I to IV), where each level serves as the activator for the next transcriptional level. Thus, transcription of polar flagellum

-45- genes in this organism operates in a hierarchichal sequence similar, but not identical, to the transcriptional hierarchies of V. cholerae and P. aeruginosa (Wilhems et al. 2011). The alternative sigma factor 54 (rpoN) of AH-3 is another important flagellar regulatory protein essential for transcription of both polar and lateral flagellar gene systems (Canals et al. 2006b). The Fla genes, flaA and flab are widely distributed in mesophilic Aeromonas (Rabaan et al. 2001). The percentage of the Laf genes lafA1 and lafA2 range between 60 and 100% (Gavin et al. 2002, 2003; Kirov et al. 2004). In aeromonads associated with diarrhoeal illness, Laf genes are usually present in 50 to 60% of the strains (Kirov et al. 2002; Aguilera-Arreola et al. 2007). The flmA and flmB of the flm gene cluster also involved in lateral flagella synthesis are found in all mesophilic Aeromonas (Gryllos et al. 2001).

1.9.7.2. Functions associated with flagella

In addition to providing a means of locomotion to the bacterium, flagella have multi- functional roles in pathogenesis. Mutations of some or most of the genes encoding both flagellar types can result in complete loss of motility, LPS O-antigen and flagellin expression leading to reduction in adherence, invasion of epithelial cells and biofilm formation (Whitby et al. 1992; Merino et al. 1997; Gryllos et al. 2001; Rabaan et al. 2001; Gavin et al. 2002, 2003; Kirov et al. 2002, 2004; Canals et al. 2006ab; Santos et al. 2010). Moreover, the presence of lateral and polar flagella in combination with other virulence factors such as a T3SS-like apparatus and secretion of enterotoxins is strongly associated with virulence (Kirov 2003; Sen and Lye 2007).

1.9.8. Secretion systems

Gram-negative bacteria possess systems that secrete and inject pathogenic proteins into the cytosol of eukaryotic cells via needle-like structures disrupting cell function and arquitecture (Table 1.6) (Burr et al. 2003; Sha et al. 2005; Bingle et al. 2008). There are currently six types of secretion transport systems recognized (types I to VI) and all utilize adenosine triphosphate (ATP) as the energy source to drive transport of macromolecules (Christie 2001). Of these, types II to IV are large multi-protein complexes that can span the entire cell envelope (Bingle et al. 2008). In Aeromonas, four (II, III, IV and VI) secretion systems have been described.

-46-

Table 1.6 Selected effector proteins associated with different secretion systems

Protein Putative function Secrected References by:

Act Cytotoxic enterotoxin T2SS Chopra et al. (2000)

AexT Cytolytic enterotoxin T3SS Braun et al. (2002)

AopP Inhibits the NF-B signalling pathway T3SS Fehr et al. (2006)

AopH Aeromonas outer protein T3SS Dacanay et al. (2006)

AopO Aeromonas outer protein T3SS Dacanay et al. (2006)

AscC Outer membrane pore of T3SS T3SS Dacanay et al. (2006)

AopB Formation of the T3SS translocon T3SS Sha et al. (2005)

AexU ADP-ribosyltransferase T3SS Sha et al. (2007)

AcTra Several roles including pilus assembly T4SS Rangrez et al. (2006) and core components Hcp Inhibits phagocytosis T6SS Suarez et al. (2010a)

VgrG1 Actin ADP-ribosylating activity T6SS Suarez et al. (2010b)

-47-

1.9.8.1. Type II Secretion System (T2SS)

The T2SS of Aeromonas is highly homologous to systems found in other Gram- negative bacteria such as V. cholerae and P. aeruginosa (Schoenhofen et al. 1998). Important proteins are secreted by Aeromonas through the T2SS including the lipolytic enzyme GCAT (Brumlik et al. 1997), the cytotoxic enterotoxin Act (Chopra et al. 2000) and proaerolysin, the inactive precursor of the channel-forming toxin aerolysin (Howard and Buckley 1986; Jiang and Howard 1992). Proaerolysin concentrates in the periplasm then passess through it on its way out of the cell (Burr et al. 2001). In A. hydrophila, an 85 kDa complex containing the ExeA and ExeB proteins is involved in the secretion of aerolysin (Schoenhofen et al. 1998). The genes exeC-N and exeAB encode a T2SS in A. hydrophila (Jiang and Howard 1992; Pepe et al. 1996).

1.9.8.2. Type III Secretion System (T3SS)

The cytotoxic effect of Aeromonas towards cell lines is dependent upon a functional T3SS (Chacón et al. 2003, 2004) which plays an important role in the virulence of several species (Burr et al. 2001, 2003; Yu et al. 2004; Sha et al. 2005, 2007; Dacanay et al. 2006; Sierra et al. 2007; Du and Galan 2009). T3SSs have been identified in A. hydrophila and A. salmonicida strains isolated from clinical and fish sources, respectively (Burr et al. 2003; Sha et al. 2007) while the T3SS of a pathogenic A. sobria strain was associated with causing disease in farmed perch (Perca fluviatilis) (Wahli et al. 2005). Expression of T3SS is affected by environmental factors, particularly calcium depletion and a high Mg2+ concentration. Recent evidence suggests that a complex interconnection between the expression of the T3SS and other virulence factors such as the LPS, the PhoPQ two-component system and the ahyIR quorum sensing system exist (Vilches et al. 2009). The T3SS has been found in approximately 50% of Aeromonas strains world wide (Chacón et al. 2004) and in one study, genes encoding the T3SS were higher in clinical (56%) than in environmental (26%) strains (Vilches et al. 2004).

In A. hydrophila, the genetic organization of the T3SS shares great similarity to the T3SS of both Yersinia species and P. aeruginosa (Yu et al. 2004). T3SS-encoding genes can be located on the chromosome, as in A. hydrophila AH-1 (Yu et al. 2004) or spread on plasmids and the chromosome, as in A. salmonicida ssp. salmonicida (Burr et al. 2002; Stuber et al. 2003; Fehr et al. 2006). The distribution of T3SS-encoding genes varies within the species. In A. caviae the incidence is usually low compared to the high

-48- frequency found in extraintestinal isolates of A. veronii and A. hydrophila (Chacón et al. 2004).

T3SS mediates translocation of cytotoxins to host cells affecting several biological functions (Burr et al. 2003; Sierra et al. 2007). Deletions or mutations of T3SS genes encoding effector proteins result in reduction of cytotoxicity (Burr et al. 2003; Vilches et al. 2004; Yu et al. 2004), inflammatory cytokines and chemokines levels (Fadl et al. 2006) and phagocytosis (Vilches et al. 2004; Yu et al. 2004). Many effector and putative proteins with diverse biological activities have been associated with T3SSs (Vilches et al. 2004). The most common and well-characterized T3SS effector proteins included AexT, AopP, AopH and AopO of A. salmonicida (Burr et al. 2002, Dacanay et al. 2006, Fehr et al. 2006) and the AexU protein of A. hydrophila (Sha et al. 2007) (Table 1.6). Most effector proteins present in aeromonads are the equivalent of effector proteins found in other pathogenic bacteria. The AexT toxin, an extracellular ADP- ribosyltransferase found in A. salmonicida ssp. salmonicida is highly similar to the ExoS and ExoT toxins secreted by the T3SS of P. aeruginosa (Braun et al. 2002). The AopP potein found equally in typical and atypical A. salmonicida strains, shares sequence homology with the YopJ protein of Y. enterocolitica (Fehr et al. 2006).

Although the biological activity of most effector proteins may differ, the final outcome usually results in cell changes and lysis. Morphological changes and cell lysis caused by the AexT toxin of A. salmonicida ssp. salmonicida requires contact with host cells (Braun et al. 2002); AopP inhibits the NF-B signalling pathway blocking cytokine production promoting apoptosis in host cells (Fehr et al. 2006); the full-length and NH2- terminal domain of the protein AexU causes changes in cell morphology due to actin filament organization (Sierra et al. 2007). Sha et al. (2005) reported a positive correlation between T3SS, the cytotoxic enterotoxin (Act) and quorum sensing (QS).

1.9.8.3. Type IV Secretion System (T4SS)

T4SSs are macromolecular transfer systems present in Gram negative and Gram positive bacteria that translocate proteins and nucleoprotein complexes (Cao and Saier 2001; Schröder and Lanka 2005). The T4SS of Agrobacterium tumefaciens has been used as a model to predict the structure and function of this secretory system (Cao and Saier 2001; Christie and Cascales 2005). Moreover, the sequences and structure of T4SSs are homologous to those of conjugative transfer systems of naturally occurring

-49- plasmids (Ding et al. 2003). The structural constituent of the secretory apparatus is provided by VirB2-VirB11, a group of proteins which may also play a direct role in translocation (Cao and Saier 2001; Schröder and Lanka 2005). T4SS has been described in A. culicicola (Rangrez et al. 2006) and in an A. caviae strain isolated from a hospital effluent (Rhodes et al. 2004). The T4SS of A. culicicola resembles that of plasmids RP721, pAc3249A and pKM101 of E. coli, the VirB-D4 systems of A. tumefaciens, B. henselae, A. caviae and the Ptl system of B. pertussis. Furthermore, the high homology observed between the A. culicicola and pAc3249A suggests that A. culicicola may have acquired the plasmid through lateral transfer while residing in the mosquito gut, the site of isolation of A. culicicola (Rangrez et al. 2006). The plasmid pRA1 was found in an A. hydrophila strain pathogenic to fish. The sequence of pRA1, a member of the IncA/C family, featured a T4-like conjugative plasmid transfer system that carried multidrug resistance genes and a hipAB- related gene cluster. In addition to drug resistance, hipAB a toxin-antitoxin module may be involved in biofilm formation (Fricke et al. 2009). Rangrez et al. (2010) described three ATPases from a new T4SS of Aeromonas veronii plasmid pAC3249A and showed that these ATPases could bind and hydrolyze ATP.

1.9.8.4. Type VI Secretion System (T6SS)

The T6SS is widely spread in nature and has been reported in many pathogenic and non-pathogenic bacteria where it is involved in a variety of roles (Williams et al. 1996; Suarez et al. 2008; Bingle et al. 2008; Pukatzki et al. 2009). The T6SS is independent of the T3SS and the flagellar secretion system (Suarez et al. 2008). In A. hydrophila SSU the T6SS gene cluster is located in the chromosome which is regulated by the σ54 activator encoded by the vasH gene (Suarez et al. 2008). Two main classes of proteins are secreted by T6SS, the haemolysin coregulated protein (Hcp) and the valine-glycine repeat G (VgrG). Hcp is secreted by all bacteria with a functional T6SS, plays a role in the transport of proteins out of the bacterial cell and into the cytosol of infected host cells or into the extracellular space (Pukatzki et al. 2009). Hcp binds to macrophages inducing the production of IL-10 and transforming growth factor (TGF)-, affecting the activation and maturation of macrophages and recruitment of other cellular immune components. Expression and translocation of the hcp gene are associated with the vasH and vasK genes (Suarez et al. 2008; 2010a). Deletion of vasH in A. hydrophila SSU impaired expression of hcp while deletion of vasK allowed expression and translocation of Hcp, but not its secretion into the extracellular milieu (Suarez et al. 2008). As a

-50- consequence, SSU mutants were readily phagocytosed by murine macrophages suggesting that the secreted form of Hcp played a role in the evasion of the host immune system by inhibiting phagocytosis and promoting the spread of the bacterium in the host (Suarez et al. 2010a).

VgrG shares structural features with the cell-puncturing device of T4 bacteriophage (Kanamaru et al. 2002). In addition, the C-terminal extensions of some VgrG carry functional domains that may serve as effector-domains or “evolved VgrGs” (Pukatzki et al. 2007). Pathogenic bacteria may have up to 10 VgrGs of which three paralogues are present in A. hydrophila (Pukatzki et al. 2009). The T6SS-associated proteins have been implicated in a variety of biological functions including cross-linking of host actin, degradation of the peptidoglycan layer, ADP-ribosylation of host proteins inducing apoptosis and inhibiting phagocytic activity in macrophages (Pukatzki et al. 2009; Suarez et al. 2010b). Both, Hcp and VgrG play dual roles as structural components and effector proteins of T6SS (Cascales 2008). Recently, mutagenesis experiments showed that paralogues of Hcp and VgrG also influenced bacterial motility, protease production and biofilm formation. Moreover, these paralogues were required for optimal bacterial virulence and dissemination to mouse peripheral organs (Sha et al. 2013).

1.9.9. Exotoxins

Aeromonas species produce a wide range of extracellular toxins and enzymes that are associated with cytotoxicity, haemolytic and enterotoxic effects in host tissue (Wadström et al. 1976; Janda 1985; Shotts et al. 1985; Vadivelu et al. 1991; Mateos et al. 1993; Pemberton et al. 1997; Chopra et al. 2000; Kirov et al. 2002; Krzyminska et al. 2006). Many distinct and unrelated exotoxins have been described in these bacteria over the years reflecting the diversity that exists among Aeromonas strains (Table 1.7) (Notermans et al. 1986; Todd et al. 1989; Vadivelu et al. 1991; Granum et al. 1998). The production of exotoxins in vitro is influenced by the type of media, culture conditions, growth temperature and variations in osmotic stress (Ljungh and Kronevi 1982; Asao et al. 1986; Mateos et al. 1993; Granum et al. 1998).

Under iron limitation, there is a pronounced increase in toxin production which is repressed in the presence of glucose (Thornley et al. 1997). Although production of exotoxins has been reported equally in both, non-enteric and enteric isolates, the production of enterotoxin and a cholera-toxin factor have been more prominent among

-51- enteric isolates (Vadivelu et al. 1991). Thus, enterotoxins appear to play an essential role in Aeromonas-associated gastroenteritis (Krzyminska et al. 2006). Exotoxins can induce cytoplasmic vacuolation and cell death in different cell lines including those derived from the intestinal mucosa (Barer et al. 1986; Vadivelu et al. 1991; Di Pietro et al. 2005; Ghatak et al. 2006). However, the use of tissue cultures as a rapid assay has not always been found suitable as a screening test (Chakraborty et al. 1984).

1.9.9.1. Aerolysin

Aerolysin is one of the most studied toxins produced by Aeromonas. Also referred to as -haemolysin, cytotoxic enterotoxin or cytolytic enterotoxin, aerolysin has generated enormous interest for the last 40 years (Bernheimer and Avigad 1974). Intially purified by Buckley et al. (1982), the action of aerolysin on various cell lines and rabbit ileal loop test to demonstrate cytotoxic and enterotoxic activity, respectively, is well documented (Asao et al. 1986; Chopra et al. 1993; Ljungh and Wadström 1983; Scheffer et al. 1988; Ferguson et al. 1997). Although aerolysin can be expressed in E. coli differences in the mechanisms involved in secretion and excretion between E. coli and A. trota have been observed (Khan et al. 1998). Various mechanisms involved in the secretion of aerolysin have been described. The notion that a 23 kDa peptide signal sequence was involved in the translocation of the pro-aerolysin followed by proteolytic cleavage activation by serine protease was proposed but not universally accepted (Howard and Buckley 1986; Husslein et al. 1991; Chopra et al. 1993). Pepe et al. (1996) showed that the tapD gene of A. hydrophila encodes a type IV leader peptidase/N-methyltransferase essential for extracellular secretion of aerolysin and protease. Another mechanism of secretion involved the binding of pro-aerolysin to glycosylphosphatidylinositol-anchored proteins on target cells to integrate into the plasma membrane (Brodsky et al. 1999).

Salient features of aerolysin include resistance to proteases, lack of inhibition by lipids or inactivation by gangliosides and reducing agents. The toxin readily binds to erythrocytes at 37, but not at 4C (Ferguson et al. 1997). Variation in haemolytic activity has been associated with different receptor affinities of the aerolysin molecule for a particular erythrocyte type (Husslein et al. 1991; Ferguson et al. 1997). Similarities between the physical and biological properties of aerolysin with the exotoxin of P. aeruginosa and a haemolysin secreted by V. parahaemolyticus, respectively, have been reported (Ljungh et al. 1981; Ljungh and Wadström 1983).

-52-

1.9.9.1.1. Action on host tissue

Aerolysin can form weakly ion-permeable channels similar to those produced by the α- toxin of S. aureus (Chakraborty et al. 1990). Aerolysin causes changes in the membrane permeability leading to osmotic lysis in erythrocytes (Bernheimer and Avigad 1974; Di Pietro et al. 2005) and cross-reacts with cholera toxin (Chopra et al. 1993; Thornley et al. 1997). The toxin can be lethal to mice at low (0.1 μg) concentrations (Bernheimer & Avigad 1974; Chakraborty et al. 1987; Chopra et al. 1993). The action of aerolysin on the epithelial barrier has been described in several studies using a variety of cell lines (Abrami et al. 2003; Epple et al. 2004; Bücker et al. 2011). Bücker et al. (2011) used human colonic epithelial cells (HT-29/B6 cells) to describe the mechanisms involved in epithelial barrier dysfunction caused by aerolysin during Aeromonas infection. The action of aerolysin on HT-29/B6 cells resulted in transcellular and paracellular resistance by inducing chloride secretion and tight junction redistribution, respectively. Therefore, diarrhoea caused by aeromonads appears to be mediated by two mechanisms, transcellular secretion and paracellular leak flux (Bücker et al. 2011). The impairement of epithelial integrity may also affect wound closure contributing to the necrotizing process observed in wound infections and intestinal epithelial lesions.

1.9.9.1.2. Molecular characteristics and prevalence

The complete nucleotide sequences of the aerolysin toxin in A. hydrophila and A. trota have been described. In the case of A. hydrophila the sequences were independently described revealing inconsistent results (Chakraborty et al. 1986; Howard et al. 1987; Husslein et al. 1988; Khan et al. 1998). Similarly, a phylogenetic tree based on the deduced amino acid sequences of the aerolysin genes from several Aeromonas species revealed the presence of three groups of genes (Khan et al. 1998). Aerolysin shares sequence similarities with the α-toxin of S. aureus. Both are very hydrophilic and contain an almost identical string of 10 amino acids (Howard et al. 1987; Murray et al. 1988). Although aerolysin is unique to the genus Aeromonas and it is present in most species (Husslein et al. 1991, 1992; Ørmen and Østensvik 2001; Ottaviani et al. 2011) the prevalence of the encoding gene varies greatly depending on the geographical region and source of isolation (Chacón et al. 2003).

-53-

1.9.9.2. Cytotoxic enterotoxin (Act)

The differentiation of the cytotoxic enterotoxin Act as a separate protein from aerolysin has been controversial. Aerolysin and Act share similar amino acid sequence and most biological properties (Buckley and Howard 1999). Despite the degree of homology (93% amino acid identity) that exists between these two proteins (Chopra et al. 1993), Act can now be distinguished from aerolysin by monoclonal antibodies neutralization and receptor specificity (Ferguson et al. 1997; Chopra and Houston 1999a). In order to avoid further confusion, Act is here described as a different toxin from aerolysin.

The properties of Act have been the source of many studies and a multitude of biological activities have been described for this protein (Chopra et al. 2000; Ribardo et al. 2002; Galindo et al. 2004). Basically, the Act protein acts as an early signaling molecule by rapidly releasing calcium from intracellular stores leading to the production of prostaglandin (PGE2) and tumor necrosis factor alpha (TNFα) while at the same time down-regulating activation transcription factor NF-κB (Chopra et al. 2000; Ribardo et al. 2002). In murine macrophages and human intestinal epithelial cells, Act activates the kinase cascade increasing reduction/oxidative stress factors and production of reactive oxygen species. Act can lyse erythrocytes, destroy tissue culture cell lines, induce a fluid secretory response in ligated intestinal loop models and is lethal to mice (Chopra and Houston 1999b; Chopra et al. 2000). These effects can lead to an extensive inflammatory response and intestinal tissue damage including Act-induced apoptosis leading to cell death (Xu et al. 1998; Chopra et al. 2000; Ribardo et al. 2002; Galindo et al. 2004). Act is an essential contributor to Aeromonas- mediated gastroenteritis followed by Alt and Ast, respectively (Xu et al. 1998; Sha et al. 2002).

At the genetic level, the multiple biological activities of the Act toxin may be the function of different molecular regions. The Act protein is encoded by the act gene (Albert et al. 2000) which in A. hydrophila is optimally expressed at 37C and at a pH 7.0. The act promoter is repressed by glucose and in A. hydrophila the activity of the act gene increases in the presence of Ca2+ while expression of the act gene is regulated by iron (Sha et al. 2001). Microarray analyses show that Act can induce many genes including those involved in apoptosis of T84 cells, caspase-3-cleavage, immune-related genes, transcription factors, phosphorylation or activation of signaling molecules, adhesion molecules, Ca2+ mobilization and cytokines (Galindo et al. 2003; 2005). The functional domain of the cytolytic enterotoxin produced by A. hydrophila SSU shared

-54- some amino acid homology with Clostridium perfringens type A enterotoxin and the listeriolysin produced by Listeria monocytogenes suggesting that the genes may have derived from a common ancestor (Chopra et al. 1993).

1.9.9.3. Haemolysins

The haemolysin toxin is different from the aerolysin protein and although both toxins are activated by trypsin, the export pathway and haemolytic activity of these two proteins are different (Asao et al. 1986; Hirono and Aoki 1991; Hirono et al. 1992). The term hlyA was proposed to differentiate the haemolysin gene from aerA to denote aerolysin (Wong et al. 1998). The haemolytic activity of Aeromonas has been closely related to cytotoxicity (Honda et al. 1985; Kozaki et al. 1987; Wang et al. 1996, 2003) and haemolysins are considered one of the important virulence factors produced by Aeromonas. In A. hydrophila, the interaction of haemolysin with erythrocyte membranes is influenced by temperature and growth (Ljungh et al. 1981; Asao et al. 1984, 1986; Titball and Munn 1985; Kosazi et al. 1987; Knochel 1989). Many haemolysins with different MWs and biological functions have been purified and characterized in Aeromonas (Table 1.7). The haemolysin protein is probably bound intracellularly as an inactive precursor that is formed during the late logarithmic phase of growth and released by lysis. Haemolysin can cause diarrhoea by induction of HCO ion via the cystic fibrosis transmembrane conductance regulator (Takahashi et al. 2006).

The gene hlyA is widely dispersed among Aeromonas species (Hirono and Aoki 1991) and it is possible that haemolysin genes evolved from a single ancestral gene (Hirono et al. 1992). The amino acid composition of haemolysins produced by some strains varies compared to the amino acid composition of aerolysin (Wong et al. 1998) suggesting that the origin of the haemolysin genes may be different from that of aerolysin (Hirono and Aoki 1991, 1993). Aeromonas haemolysins have been reported to contain regions homologous to the Vibrio vulnificus and Vibrio cholerae cytolysin-haemolysin (Hirono and Aoki 1993) while a high level of homology (96%) has been reported between different aeromonad strains (Erova et al. 2007). Among the major Aeromonas species, hlyA has been detected in A. caviae (Wang et al. 1996; Heuzenroeder et al. 1999; Pablos et al. 2010) and it is practically ubiquitous in A. hydrophila (Heuzenroeder et al. 1999; Wu et al. 2007). In A. veronii the prevalence of hlyA ranges from 0 to 77% (Wang et al. 1996; 2003; Wu et al. 2007; Pablos et al. 2010). Recently, a diarrhogenic strain of A. trota 701 was found to produce both haemolysin and protease (Takahashi et al. 2014).

-55-

1.9.9.4. Enterotoxins

Enterotoxins may play significant roles in the pathology of Aeromonas-induced gastrointestinal disease. The two more frequently studied cytotonic enterotoxins are the heat-labile (Alt) and the heat-stable (Ast) toxins although other enterotoxins have been described in Aeromonas (Table 1.7). These enterotoxins are biologically and genetically unrelated to the LT and ST of E. coli and the cholera-toxin (CT) (Kaper et al. 1981) although using synthetic oligonucleotide DNA probes, Schultz and McCardell (1988) demonstrated that regions of A. hydrophila DNA were homologous with the CT probes. Most cytotonic enterotoxins share common mechanisms of action including elongation of Chinese hampster ovarian (CHO) cells, increasing levels of cAMP or PGE2 in tissue culture cells, changes in adrenal YI cells, fluid accumulation in the rabbit ligated intestinal loops without mucosal injury and accumulation of intestinal fluid in infant mice (Ljungh and Wadström 1979, 1983; Chakraborty et al. 1984, 1987; Chopra et al. 1992b, 1996; McCardell et al. 1995).

Alt and Ast are encoded by the alt and ast gene, respectively (James et al. 1982; Chopra et al. 1996; Albert et al. 2000; Krzyminska et al. 2003). Mutagenesis experiments showed that Alt and Ast in combination with Act can induce gastroenteritis in a mouse model (Sha et al. 2002). In gastrointestinal infection, production of more than one toxin appears to correlate with the type of stools and severity of the diarrhoeal episode. The presence of both alt and ast has been associated with severe watery diarrhoea in A. hydrophila-induced infection while isolates positive for alt have only been associated with loose stools (Albet et al. 2000). Unlike the cytotoxic enterotoxin that causes extensive damage to epithelium, the cytotonic enterotoxins do not cause degeneration of crypts and villi of the small intestine (Chopra and Houston 1999b). The alt and ast genes have been detected in clinical and environmental isolates world-wide. However, the prevalence of these genes varies considerably depending on the source, species, geographical location and the number of isolates tested (Potomski et al. 1987b; Borrell et al. 1998; Trower et al. 2000; Sen and Rodgers 2004; Aguilera-Arreola et al. 2007; Wu et al. 2007; Pablos et al. 2010).

-56-

Table 1.7 Toxins secreted by Aeromonas Gene/protein Organism (source) MW % Identity with Reference (kDa) other proteins

Haemolysin A. hydrophila B3646   Wretlind and Heden (1973) Aerolysin A. hydrophila 38 (human isolate?) 50-53  Bernheimer & Avigad (1974) -Haemolysin (aerolysin) A. hydrophila K140/K144 (human diarrhoeal isolates) 65  Ljungh et al. (1981) -Haemolysin A. hydrophila K140/K144 (human diarrhoeal isolates) 50  Ljungh et al. (1981) Enterotoxin A. hydrophila K140/K144 (human diarrhoeal isolates) 15  Ljungh et al. (1981) Enterotoxin A. hydrophila AH2 and AH1133 (human diarrhoeal   Chakraborty et al. (1984) isolates) Haemolysin A. hydrophila AH-1 (human diarrhoeal isolate) 48-50  Asao et al. (1984) CT-toxin related factor A. hydrophila/A. sobria (human diarrhoeal isolates)   Honda et al. (1985) Haemolysin (H-lysin) A. salmonicida (fish isolate) 25.9  Titball & Munn (1985) Haemolysin A. hydrophila (human and drinking water isolates)   Notermans et al. (1986) Haemolysin A. hydrophila CA-11 (environmental isolate) 50  Asao et al. (1986) Aerolysin A. hydrophila (rainbow trout) 53.8 Original aerolysin Howard et al. (1987) aerA A. trota AB3 (human diarrhoeal isolate) 54.4 77% with aerolysin Husslein et al. (1988)

-57-

Table 1.7 Continued. Gene/protein Organism (source) MW % Identity with other Reference (kDa) proteins

Haemolysin A. sobria 33 (human isolate) 49  Kozaki et al. (1989) AHH1 A. hydrophila ATCC 7966 (tinned milk isolate) 63.6 50% with V. cholerae HlyA Hirono & Aoki (1991) AHH3 A. hydrophila 28SA (eel isolate) 54.7 94% with aerolysin Hirono et al. (1992) AHH5 A. hydrophila AH-1 (human isolate) 53.7 92% with aerolysin Hirono et al. (1992) ASA1 A. sobria 33 (human isolate) 53.9 66% with aerolysin Hirono et al. (1992) ASH3 A. salmonicida 17-2 (fish isolate) 54.2 66% with aerolysin Hirono & Aoki (1993) ASH4 A. salmonicida 17-2 (fish isolate) 63.4 45% with V. cholerae HlyA Hirono & Aoki (1993) Cytolytic enterotoxin (Act) A. hydrophila SSU (human diarrhoeal isolate) 54.5 93% with aerolysin Chopra et al. (1993) Cytotonic enterotoxin (Ast) A. hydrophila SSU (human diarrhoeal isolate) 35  Chopra et al. (1994) Cytotonic enterotoxin (Alt) A. hydrophila SSU (human diarrhoeal isolate) 44 45-51% with Chopra et al. (1996) phospholipase/lipase HlyA A. hydrophila A6 (human diarrhoeal isolate) 69 51% with V. cholerae HlyA Wong et al. (1998) Cytotoxic enterotoxin A. veronii bv. sobria (isolated from lamb kidney) 40  Trower et al. (2000) hlyA A. hydrophila SSU (human diarrhoeal isolate) 49 96% with A. hydrophila Erova et al. (2007) ATCC 7966 haemolysin

-58-

1.10. Additional extracellular products

Aeromonas species can secrete a plethora of degradative enzymes with the ability to hydrolyse a wide range of substrates (Shotts et al. 1985). In the past, the characterization of extracellular products (ECP) was based on the purification of individual proteins from selected Aeromonas strains. The new approach involves the construction of extracellular proteome maps which determine the major extracellular products involved in the virulence of A. hydrophila AH-1 (Yu et al. 2007).

1.10.1. Proteases

Proteases may play a critical role in the early stages of infection by protecting the bacterial cell against complement-mediated killing, causing tissue damage and by protecting the bacterium from host defences while providing nutrients for cell proliferation (Shieh 1987; Leung and Stevenson 1988a/b; Pemberton et al. 1997; Khan et al. 2008). Protease production is temperature-dependent as production can decrease significantly at 37C (Mateos et al. 1993; Swift et al. 1999b; Yu et al. 2007). In A. sobria, the concentration of salt was found to influence the production of serine protease into the milieu (Khan et al. 2007).

The genes encoding for serine protease are highly conserved in Aeromonas species (Chacón et al. 2003). Extracellular secretion of protease has been linked with the tapD gene (Pepe et al. 1996). Despite the competitive advantage that production of serine proteases confers to aeromonads, deletion mutation has shown that in A. salmonicida and A. hydrophila proteases are not essential for the virulence of these species in the models used (Vipond et al. 1998; Cascón et al. 2000a). However, Liu et al. (2010) showed that a purified protease was lethal to rainbow trout while the combined effects of proteases and haemolysins have been detrimental to fish (Fyfe et al. 1988; Rodríguez et al. 1992).

The most common proteases are serine and metallopreoteases. Serine proteases with different MWs have been described in A. hydrophila (Cho et al. 2003), A. sobria (Kobayashi et al. 2006), A. trota (Husslein et al. 1991), A. caviae (Nakasone et al. 2004) and A. salmonicida (Gudmundsdottir et al. 2003). Serine proteases participate in the activation of aerolysin (Abrami et al. 1998), the extracellular toxin GCAT, haemolysin and possibly other ECPs (Lee and Ellis 1990; Eggset et al. 1994; Vipond et

-59- al. 1998; Yu et al. 2007). The metallo-protease TagA identified in A. hydrophila SSU is widely distributed in Aeromonas species and has been reported in isolates from patients with wound infections and gastroenteritis (Pillai et al. 2006). TagA has been associated with haemolytic-uraemic syndrome where it potentiates the activity of C1-INH inhibiting the classical complement-mediated lysis of erythrocytes and increasing serum resistance (Pillai et al. 2006).

Proteases with affinity for specific substrates such as elastin, casein and gelatin have been identified (Cascón et al. 2000ab; Esteve and Birkbeck 2004; Han et al. 2008; Meng et al. 2009; Zacaria et al. 2010). Others proteases can induce intense vacuolation in Vero cells including cellular death by apoptosis (Martins et al. 2007). A kexin-like serine protease in A. sobria 288 (ASP) possesses a unique occluding region which may serve as a potential target for antisepsis drugs (Kobayashi et al. 2009a/b). ASP acts by enhancing vascular permeability in rat skin supporting the notion that a correlation between ASP production and soft-tissue lesions exists (Yokoyama et al. 2002). Other features associated with ASP include reduction of blood pressure by activating the kallikrein/kinin system (Imamura et al. 2006), promoting human plasma coagulation through activation of prothrombin (Nitta et al. 2007) and the formation of pus and oedema through the action of anaphylatoxin C5a (Nitta et al. 2008). All these observations have led to the conclusion that ASP mediates the induction of disseminated intravascular coagulation through -thrombin production, a common and lethal consequence of sepsis (Nitta et al. 2007).

1.10.2. Lipases

Lipases, like proteases, are important for bacterial nutrition (Pemberton et al. 1997) and several roles in microbe metabolism have been associated with these compounds (Anguita et al. 1993). The most studied lipase to date is GCAT which is present in all members of the Vibrionaceae with the exception of Plesiomonas shigelloides (MacIntyre et al. 1979). GCAT can use cholesterol as an acyl acceptor, has a molecular mass of approximately 25 kDa and possesses haemolysin, leukocytolysin and cytotoxic activities (Eggset et al. 1994; Nerland 1996; Vipond et al. 1998). GCAT shares many properties with the mammalian lecithin:cholesterol acyltransferase enzyme (Thorton et al. 1988). When combined with the LPS (the GCAT-LPS complex, MW = 2000 kDa), the specific haemolytic activity and lethal toxicity of GCAT-LPS is stronger than the native GCAT resulting in complete lysis of erythrocytes (Lee and Ellis 1990; Hirono

-60- and Aoki 1993; Eggset et al. 1994; Nerland 1996; Bricknell et al. 1997; Thornley et al. 1997). Differences in MWs between GCAT produced by A. hydrophila and A. salmonicida have been reported (Thornton et al. 1988), while polyclonal antibody prepared against A. salmonicida GCAT does not cross-react with A. hydrophila GCAT despite the similar amino acid termini of these proteins. Norwhistanding the pathology associated with GCAT, its role as a virulence factor in humans is still controversial (Chopra and Houston 1999b). The virulence of GCAT and serine protease mutants was shown to be similar to the effects caused by wild strains of A. salmonicida after IP injection of Atlantic salmon smots (Vipond et al. (1998).

Although some similarities exist between other lipases produced by A. hydrophila, they are not identical. Some lipases are membrane-bound while others are present in the periplasmic space (Anguita et al. 1993; Chuang et al. 1997). The characteristics of some lipases depend on the encoding genes which are distributed in all Aeromonas species (Chacón et al. 2003). Those encoded by the lip and lipH3 genes have esterase but not phospholipase activities (Anguita et al. 1993; Chuang et al. 1997); the apl-1 gene encode a non-haemolytic lipase with phospholipase C activity (Ingham and Pemberton 1995) while the pla gene encodes a non-haemolytic, non-cytotoxic and non-enterotoxic lipoprotein with phospholipase A1 activity (Merino et al. 1999). Other significant differences include the number of amino acid residues, optimal temperature and pH, thermal stability and substrate specificity (Anguita et al. 1993; Ingham and Pemberton 1995; Chuang et al. 1997; Merino et al. 1999). At the amino acid level, sequence similarities have been reported between the lip, lipH3, apl-1, pla and alt gene products (Chopra et al. 1996; Merino et al. 1999) while the putative lipase substrate-binding domain V-H-F-L-G-H-S-L-G-A is shared by several species particularly those belonging to serogroups O:11, O:16 and O:34 (Watanabe et al. 2004). Lipases may act by altering the plasma membrane of host cells affecting permeability and raising accessibility to toxins (Soler et al. 2002; Mendes-Marquez et al. 2012).

1.10.3. Nucleases

The role of extracellular nucleases as a virulence factor contributing to disease has not been supported by experimental work. The most probable roles of nucleases are primarily nutritional, due to their ability to degrade nucleic acids, and protective, as nucleases provide a barrier to the entry of foreign DNA into the host (Pemberton et al. 1997). Few genes encoding these enzymes have been cloned (Dodd and Pemberton

-61-

1996; Pemberton et al. 1997; Nam et al. 2004) and, of those examined, DNAse genes have been found more frequently in clinical than in environmental isolates (Chacón et al. 2003). Genes encoding DNases with different MWs have been identified in various A. hydrophila strains. The dns gene of strain CHC-1 encodes a 25 kDa protein (Chang et al. 1992) while dnsH and nucH present in strain JMP636 encode proteins of approximately 27.4 and 114 kDa, respectively (Dodd and Pemberton 1996, 1999).

The deduced amino acid sequence of Dns is highly homologous with the DNase produced by V. cholerae (Chang et al. 1992). By contrast, the NucH has no known homologue on the basis of its nucleotide or predicted protein sequence (Dodd and Pemberton 1996). DnsH and Dns are identical in size (210 amino acids) and contain 92% similarity and 89% amino acid identity, respectively (Dodd and Pemberton 1999). Dns is an extracellular enzyme (Chang et al. 1992) that accumulates equally in both the periplamic and cytoplasmic space suggesting that DnsH is not secreted (Dodd and Pemberton 1999). A 25 kDa protein with endo- and exonuclease activity was identified in A. hydrophila ATCC 14715. The nuclease was capable of complete (100%) degradation of double-stranded DNA but only partial (70%) degradation of single- stranded DNA. The ability to possess endo- and exonuclease activity by an intracellular nuclease is considered rare among prokaryotes (Nam et al. 2004).

1.10.4. Chitinases

Chitin is one of the most abundant biopolymers present in the aquatic biosphere. It is found in the exoskeleton of insects, molluscs, crustaceans and the cell wall of fungi. Chitin is a source of food for Aeromonas and provides access to carbon, nitrogen and energy supplies (Pemberton et al. 1997), thus, contributing to the survival of chitin- hydrolyzing organisms (Roffey and Pemberton 1990). The degradation of chitin occurs in two successive steps mediated by different chitinolytic enzymes (Lan et al. 2004). More specifically, chitinases catalize the hydrolysis of the -1-4 linkage of N-acetyl-D- glucosamine polymers of chitin (Chen et al. 1991). Several genes encoding for -N- acetylglucosaminidases have been identified in A. hydrophila resulting in the expression of proteins with different MWs and distinct biological and kinetic properties (Lan et al. 2004, 2006, 2008). Chitin-degrading enzymes with distinct MWs and biological properties have also been described in other Aeromonas species (Yabuki et al. 1986; Roffey and Pemberton 1990; Ueda and Arain 1992; Sitrit et al. 1995; Ueda et al. 1995;

-62-

Hiraga et al. 1997; Lin et al. 1997; Wu et al. 2001; Lan et al. 2004 ). Mehmood et al. (2010) described four chitinases from A. caviae CB101 which were encoded by a single gene chi1. The location of the enzyme in the cell, whether present in the periplasmic or cytoplasmic space, appears to influence its role in chitin metabolism (Lan et al. 2008).

1.11. Iron uptake

Siderophores, a virulence factor in pathogenic bacteria, provide bacteria with iron from the host during infection (Byers et al. 1991; Chopra and Houston 1999b). Two types of siderophores are produced by Aeromonas, enterobactins and amonabactins. Aeromonas- producing amonabactins can obtain iron from host transferrin and lactoferrin (Barghouthi et al. 1989, 1991; Byers et al. 1991; Stintzi and Raymond 2000). In contrast, enterobactin producers do not utilise transferrin in serum but rely exclusively on host heme iron (Byers et al. 1991). Statistically, amonabactin producers are more resistant to complement lysis than enterobactin-producing strains (Massad et al. 1991). Two biologically active forms of amonobactin were described in A. hydrophila 495A2, amonabactin T which contains lysine, glycine or tryptophan, and amonabactin P which contains phenylalanine (Barghouthi et al. 1989).

In A. hydrophila, amonobactin is encoded by the amo gene which resembles the entC gene of E. coli. The nucleotide sequences of amoA and entC suggest that these genes may share a common ancestor. The biosynthesis of enterobactin involves several genes, aebA, B, C and E, also functionally related to the E. coli genes. In Aeromonas, synthesis of 2, 3-dihydroxybenzoic acid (2, 3-DHB) is encoded by the gene amo, in the aminobactin-producers and by aeb, found among enterobactin-producers (Massad et al. 1994). Suppression of the amoA gene impaired excretion of 2, 3-DHB and amonabactin resulting in mutants that were more sensitive to growth inhibition by iron restriction compared to the wild strain (Barghouthi et al. 1991). The iron siderophore receptor gene fstA of A. salmonicida is homologous with the fstA of other pathogenic Gram-negative species suggesting that this gene is widely dispersed in these bacteria (Pemberton et al. 1997). Although siderophore production is a common trait in Aeromonas not all strains are able to produce siderophores (Barghouthi et al. 1989; Zywno et al. 1992; Santos et al. 1999). Through a siderophore-independent process, most isolates can also use various heme compounds as sole iron sources (Massad et al. 1991). The combination of siderophores and phenotypic characteristics was proposed as a taxonomic criterion to

-63- separate between different genospecies and to evaluate the pathogenic potential of some species (Zywno et al. 1992).

1.12. Quorum Sensing (QS)

Quorum sensing (QS) is a chemical signalling system that regulates gene expression when bacteria reach a critical cell population density (Swift et al. 1997). Many Gram- negative bacteria utilize acyl-homoserine lactone (AHL) which are low-molecular-mass signalling molecules of different chain-lengths (Swift et al. 1999b; Jangid et al. 2007). A-layer, protease, lipase and pigment production, cytotoxicity of ECP cells and a low

LD50 in A. salmonicida are regulated by quorum sensing (Rasch et al. 2007; Schwenteit et al. 2010). However, production of virulence factors does not always correlate with the production and accumulation of AHLs which are encoded by the luxRI (AI-1system) genes that are universally present in Aeromonas (Jangid et al. 2007). From the taxonomic view point, sequence analysis of luxRI shows that the genus Aeromonas forms a distinct lineage from other genera in the class Proteobacteria (Jangid et al. 2007). The close homology of luxRI with the iciA gene of E. coli suggests that in Aeromonas an association between QS and cell division may exist as iciA is involved in chromosomal replication (Swift et al. 1997; Chopra and Houston 1999b). Mutations of these genes can lead to alteration or inactivation of several activities including exoenzyme activity (Swift et al. 1999a; Bi et al. 2007), biofilm formation (Lynch et al. 2002), changes in the OMP profiles and biochemical characteristics, reduction of butanediol fermentation, protease activity, adherence, attenuation of cytotoxicity on epithelial carp cells and LD50 and inability to produce a detectable S-layer (Swift et al. 1999b; Vivas et al. 2004; Bi et al. 2007; Van Houdt et al. 2007). Mutation in the luxS gene in SSU impaired the secretion of effector proteins of the T6SS but not of T3SS (Khajanchi et al. 2009). However, mutations in the ahyI and ahyR genes have not always resulted in alterations in the virulence potential of aeromonads (Defoirdt et al. 2005).

Two other quorum sensing systems including a LuxS-based (AI-2) and the QseBC (AI- 3) two-component system have been described in A. hydrophila SSU (Kozlova et al. 2008; Khajanchi et al. 2009; 2012). The AI-1 and AI-2 QS sytems are positive and negative regulators of virulence, respectively, while deletion of A1-3 in SSU was shown to affect attenuation of A. hydrophila in a septicaemic mouse model of infection,

-64- bacterial motility and biofilm formation (Khajanchi et al. 2012; Kozlova and Pekala 2012). It is also possible that the QseBC (A1-3) system may be linked to AI-1 and AI-2 QS systems in modulating bacterial virulence possibly through the cyclic diguanosine monophosphate (Khajanchi et al. 2012).

Sulphur-containing AHLs act as QS inhibitors reducing protease production. Interference with AHL-mediated quorum sensing is considered a promising target for the development of a new generation of antimicrobial therapeutics and may represent an important tool as a bacterial disease control measure in the aquaculture industry (Defoirdt et al. 2005; Rasch et al. 2007; Khajanchi et al. 2009; Schwenteit et al. 2010). Recently, a thermostable N-acyl homoserine lactonase derived from Bacillus strain AI96 successufully attenuated A. hydrophila infection reducing zebrafish mortality (Cao et al. 2012).

1.14. Biofilm formation

Aeromonas are efficient colonisers of surfaces and are an important constituent of bacterial biofilms in both water distribution systems and food processing environments (Chauret et al. 2001). The control of biofilm formation is of significant interest to the industrial, public health and medical sectors. The ability of Aeromonas to form biofilms may contribute to the persistence of these organisms in environmental reservoirs where they exhibit increased resistance to normal bactericidal treatments (Lynch et al. 2002; Rahman et al. 2007b). This is particularly significant in the food industry and individuals residing along rivers where the presence of biofilm producing Aeromonas spp. poses a serious danger to public health (Van Houdt and Michiels 2010; Odeyemi et al. 2012). Biofilm formation in food-processing environments has the potential to act as a persistent source of microbial contamination leading to food spoilage or transmission of disease (Chavant et al. 2007; Van Houdt and Michiels 2010). As a result, some studies have been designed to demonstrate biofilm formation by Aeromonas on food produce (Elhariry 2011) while others aimed to find products that can eliminate microbial biofilms and their effective control in food industries (Farias Millezi et al. 2013). Furthermore, the biofilm forming potential of these bacteria may pose a challenge during treatment of infections associated with antimicrobial-resistant Aeromonas species (Igbinosa et al. 2014).

-65-

As mentioned in Section 1.13, biofilm formation is one of several virulence factors regulated by quorum sensing in particular by the C4-HSL QS molecules (Lynch et al. 2002; Defoirdt et al. 2005). In addition to quorum sensing, biofilm formation has been associated with hyperpiliation of the cells involving the type IV pili in A. caviae (Bechet and Blodeau 2003), with the bundle-forming pilus in A. veronii bv. sobria (Hadi et al. 2012) and with the presence of both polar and lateral (the flaA+/lafA+ genotype) flagella (Kirov 2003; Santos et al. 2010). Rahman et al. (2007b) showed that in A. veronii bv. sobria the signalling molecule c-di-GMP is influenced by the GGDEF and EAL domain proteins AdrA and YhjH, respectively. The GGDEF domain protein AdrA also influenced the level of the C4-HSL QS molecule. Alterations in the c-di-GMP levels by the GGDEF domain protein AdrA regulate the multicellular behaviour, biofilm formation and adherence to plant and animal surfaces. Overproduction of c-di-GMP was shown to modulate transcriptional levels of genes involved in biofilm formation and motility phenotype in A. hydrophila SSU in a QS-dependent manner, involving both AI- 1 and AI-2 systems (Kozlova et al. 2012). A recent finding suggests that the T6SS effector protein VgrG, discussed in section 1.8.8.4, is essential for biofilm formation in A. hydrophila (Sha et al. 2013).

1.14. Additional virulence factors

A plethora of other virulence factors which may or may not contribute to the pathogenesis of Aeromonas have been described in these organisms. Immunophilin-like proteins encoded by the ilpA and fkpA genes in A. hydrophila have no known functions and express proteins with no obvious virulent effects as shown in an animal model (Wong et al. 1997). By contrast, over-expression of the dam gene in A. hydrophila SSU influences the virulence of this organism by altering the expression of T3SS and T2SS- associated Act protein, as well as affecting motility and proteinase production (Erova et al. 2006). The sodA and sodB genes in A. hydrophila ATCC 7966T code for a Mn-SOD (superoxide dismutase) and a Fe-SOD, respectively. Fe-SOD is essential for the aerobic viability of the organism and prevents damage to DNA while Mn-SOD protects the bacterial cells against environmental superoxide (Leclère et al. 2004). The collagenase gene acg enhances the adhesive, invasive and cytotoxic ability of A. veronii RY001 on ECP cells (Han et al. 2008). The glycolytic enzyme enolase identified in the diarrhoeal strain A. hydrophila SSU was associated with its surface expression and its ability to bind plasminogen. Moreover, the enolase gene could play a potentially important role in

-66- the viability of SSU (Sha et al. 2003, 2009). The synthesis of heat shock proteins is a mechanism by which Aeromonas respond to thermal stress and confers protection to aeromonads present in foods and food processing environments (Osman et al. 2011).

Although Aeromonas are generally considered non-capsulated organisms, the presence of a capsule has been demonstrated in A. salmonicida and A. hydrophila serotypes O:11 and O:34 when grown in a glucose-rich medium (Martínez et al. 1995) and a capsule gene cluster was identified in the whole genome of A. hydrophila PPD134/91 (Yu et al. 2005). The presence of group II capsules in A. hydrophila strongly correlates with the serum and phagocytic survival activities of the organism in a fish model of infection (Zhang et al. 2003). Finally, the role of cathepsin K in goldfish following A. hydrophila infections has yet to be elucidated (Harikrishnan et al. 2010).

1.15. INFECTIONS CAUSED BY AEROMONAS SPP.

Human infections caused by Aeromonas species have been reported with increasing frequency for the past 40 years although the exact prevalence of Aeromonas infections on a global scale is unknown (Figueras 2005; Senderovich et al. 2012). The presence of Aeromonas in the midgut of mosquitoes and the common housefly (Musca domestica) represents a possible source of infection in cases where there is no exposure to contaminated water, soil or foods (Nayduch 2001, 2002; Pidiyar et al. 2002). Although gastroenteritis is the main condition associated with these organisms, many cases of extraintestinal infections involving aeromonads have been described (Figueras 2005; Parker and Shaw 2011). The rate of monomicrobial infections involving aeromonads varies from 16 to 50% (Kelly et al. 1993; Tena et al. 2007). However, it has been difficult to assess the role played by aeromonads in polymicrobial infections particularly in cases where other recognized pathogens are concomitantly isolated.

Infections caused by Aeromonas can be serious and occasionally fatal in immunocompromised patients (Harris et al. 1985; González-Barca et al. 1997). Aeromonas- induced infections have been divided into four categories: (i) cellulitis or wound infections associated with exposure to water or soil; (ii) septicaemia, usually associated with hepatic, biliary or pancreatic disease or with malignancy; (iii) acute- onset diarrheal disease of short duration; (iv) miscellaneous infections not associated with any discernible physiological condition or environmental event (von Graevenitz and Mensch 1968). The most important form of Aeromonas infection is sepsis as

-67- reflected by the large number of publications compiled on Aeromonas septicaemia (Janda and Abbott 2010).

1.15.1. Gastroenteritis

The most common infection associated with Aeromonas species in humans is gastroenteritis. The isolation rate for Aeromonas varies from <2 to 6.9% (von Graevenitz and Mensch 1968; Rautelin et al. 1995b; Chan and Ng 2004; Pokhrel and Thapa 2004). In tropical environments, the intestinal carriage can reach up to 30% (Pitarangsi et al. 1982). During diarrhoeal disease the intestinal tract may be colonised simultaneously with different Aeromonas strains (Kuijper et al. 1989b; Moyer et al. 1992).

After surviving the acid environment of the stomach and the small intestine (Karem et al. 1994) Aeromonas must compete with the normal flora and survive the by-products of metabolism and other compounds (Janda and Abbott 2010). Attachment to intestinal epithelium is essential and bacterial flagella and pili play important roles in this step. After attachment, the pathology involved depends on the elaboration of enterotoxins causing enteritis, and dysentery or colitis if invasion of the gastrointestinal epithelium has occurred (Janda and Abbott 2010). The diarrhoeal episode that follows is due to exposure to the enterotoxins produced by Aeromonas, described in Section 1.9.9.4.

1.15.1.1. Disease presentation

The most common presentation observed in Aeromonas- induced intestinal infection is watery diarrhoea (Figueras 2005). Patients experience fever, vomiting, abdominal cramps/pain, dehydration and blood in the stools (Janda et al. 1983a). In 50% of the cases, diarrhoea persists for more than 10 days and up to 30% require hospitalization. Rarely, the clinical presentation is suggestive of ulcerative colitis (Gracey et al. 1982ab). Dysentery-like syndrome associated with Aeromonas has been sporadically reported and often requires hospitalization (Rahman and Willoughby 1980; Vila et al. 2003). Abdominal cramps and pain, mucus and blood in the stools are common symptoms of dysentery-like enteritis (Janda and Duffey 1988).

Much rarer is a cholera-like disease linked to Aeromonas (Shimada et al. 1984; Sawle et al. 1986; Janda and Duffey 1988). The most compelling case of a cholera-like disease involving aeromonads was described by Champsaur et al. (1982) in a Thai woman

-68- admitted to a Paris hospital. Among the clinical features observed included lethargy, thirst, vomiting, dry mucous membranes, muscle cramps and rice-water diarrhoea. The culpable organism, a strain of A. sobria (possibly A. veronii according to current taxonomy), produced enterotoxin, cytolysin, proteolysin, haemolysin, and a cell- rounding factor (Champsaur et al. 1982). Recently, A. caviae was recovered from the stools of a 2 year old girl with a cholera-like illness in India (Jagadish Kumar and Vijaya Kumar 2013).

Aeromonas is one of several micro-organisms implicated in travellers’ diarrhoea (TD), a common health problem affecting travellers after visiting developing countries (Vila et al. 2003; Gascón 2006). TD occurs globally and affects children as well as adults (Gracey et al. 1984; Gascón et al. 1993; Hӓnninen et al. 1995 a; Rautelin et al. 1995a; Vila et al. 2003). In rare occasions, TD can be fatal (Sawle et al. 1986). Symptoms associated with TD include watery and inflammatory diarrhoea, abdominal cramps and fever (Vila et al. 2003). Severe atypical presentations following Aeromonas-induced infection have been described including ulcerative and segmental colitis, ileal ulceration, intra-mural intestinal haemorrhage with small bowel obstruction and refractory inflammatory disease (Janda and Abbott 2010).

Haemolytic uraemic syndrome (HUS), a serious disease characterized by haemolytic anaemia, acute kidney failure and thrombocytopaenia has been associated with Aeromonas- induced enteritis (Bogdanović et al. 1991; Figueras et al. 2007a). Only a few cases have been reported to date (Table 1.8). Clinical evidence indicates that Aeromonas-related HUS is more responsive to treatment with antimicrobials compared to HUS induced by enterohaemorrhagic E. coli EHEC (Fang et al. 1999). There are reports that Aeromonas may contain Shiga toxin genes, typical of EHEC (Haque et al. 1996; Alperi and Figueras 2010).

1.15.1.2. Evidence against Aeromonas as an enteric pathogen

Despite the overwhelming data accumulated in the last 40 years, Aeromonas has yet to be universally accepted as a bona fide enteric pathogen (Chu et al. 2006). The evidence associating aeromonads with diarrhoea is circumstantial (Nishikawa and Kishi 1988; Szabo et al. 2000). Aeromonas can be isolated from human faecal material in the absence of diarrhoeal symptoms unlike other enteric pathogens (Küijper et al. 1987);

-69-

Table 1.8 Clinical characteristics of patients with HUS-associated Aeromonas Age/Sex Diarrhoea Species Site of Source of Treatment Outcome References prodrome/blood isolation isolation

NS NS A. sobria Faeces NS NS Survival San Joaquin and Pickett (1988)

23 m/F 6d/yesa A. hydrophila Faeces NS Peritoneal dialysis, Survival Bogdanovic et al. antihypertensive drugs, packed (1991) red cell transfusions NS NS A. hydrophila Faeces NS NS NS Robson et al. (1992)

6 m/F 7 d/yesb A. sobria Faeces aquarium Haemodialysis, renal transplant Survival Filler et al. (2000) water

36 y/M 2 mths/yesb A. hydrophila Blood seafood Regular haemodialysis, Survival Fang et al. (1999) antihypertensive drugs, ceftizoxime 40 y/F 8 d/no A. veronii bv. Faeces NS Corticosteroids, fresh frozen Survival Figueras et al. (2007a) sobria plasma, ciprofloxacin

Modified from Figueras et al. (2007a); a Watery diarrhoea became bloody on day 7; b Watery diarrhoea finally became bloody; NS, not specified.

-70- there is no animal model for Aeromonas gastroenteritis and attempts to induce diarrhoea in human volunteers and primates have, so far, been unsuccessful or inconclusive (Pitarangsi et al. 1982; Morgan et al. 1985; Kirov 1993); the Henle-Koch postulates have not been fulfilled including molecular postulates (Evans 1976; Falkow 2004); in one study, no significant difference in the prevalence of virulence factors between strains from diarrhoeic patients and controls were observed (Figura et al. 1986).

1.15.1.3. Evidence supporting Aeromonas as an enteric pathogen

Epidemiological evidence is strongly indicative that aeromonads are capable of causing gastroenteritis. Aeromonas species have been recovered from diarrhoeal stools more frequently than from control subjects (Holmberg and Farmer 1984; Agger et al. 1985; Nishikawa and Kishi 1988; Deodhar et al. 1991; Rautelin et al. 1995b; Bravo et al. 2012). Enterotoxigenic strains have been isolated from children with diarrhoea (10.2%) more often than those without (0.6%) diarrhoeal symptoms (Gracey et al. 1982b). Isolation rates for aeromonads from diarrhoeic patients have been reported to be similar to those of Salmonella enterica (Senderovich et al. 2012).

Despite assertions often made that there are no documented outbreaks due to aeromonads (Nishikawa and Kishi 1988; Szabo et al. 2000), outbreaks involving Aeromonas have been reported from several locations including enteritis due to A. hydrophila in a neonatal intensive care unit in Germany (cited in Agger 1986), in a pediatric hematology-oncology unit in Northen India involving A. sobria (Taneja et al. 2004), several Aeromonas species were associated with diarrhoeal disease in two Brazilian studies (Guerra et al. 2007; Mendez-Marquez et al. 2012), a food poisoning outbreak due to A. hydrophila in Sweden (Krovacek et al. 1995) and a small outbreak of diarrhoeal infections occurred in Scotland (Nathwani et al. 1991) plus two outbreaks in day care centres in the USA (de la Morena et al. 1993).

An immunological response from a healthy patient after severe Aeromonas-induced diarrhoea strongly suggests that Aeromonas can behave as an enteric pathogen (Palfreeman et al. 1983). The minimum inoculum necessary to induce diarrhoea by Aeromonas was estimated at 104 cells ranking third behind Shigella (10-100) and Campylobacter species (500-1000), respectively (Gascón 2006). The most likely

-71- scenario to date is that acute enteritis caused by aeromonads is strain-dependent (von Graevenitz 2007).

1.15.1.4. Species involved

The most frequently isolated species from human faecal material are A. hydrophila, A. caviae, and A. veronii (both biovars). Of these, A. caviae has been the most predominant species reported by a number of studies (Altwegg 1985; Travis and Washington 1985; Mégraud 1986; Kuijper et al. 1987; Wilcox et al. 1992; de la Morena et al. 1993; Rautelin et al. 1995b; Bravo et al. 2012; Senderovich et al. 2012). Other species including A. bestiarum, A. jandaei, A. media, A. schubertii, A. taiwanensis and A. trota are sporadically isolated (Hӓnninen and Siitonen 1995; Pablos et al. 2010; Bravo et al. 2012; Senderovich et al. 2012). However, the enterotoxigenic potential of Aeromonas is not species-specific (Singh and Sanyal 1992a) and Aeromonas- induced gastroenteritis is not confined to a single genomospecies or biotype/genotype within a single taxon (Albert et al. 2000).

1.15.2. Skin and soft-tissue infections (SSTIs)

Skin, soft tissue, muscle, and bone infections represent the second most common type of infections caused by Aeromonas species (Janda and Abbott 2010). A high percentage (60%) of infections involving aeromonads is polymicrobial (McCraken and Barkley 1972; Smith 1980a; Gold and Salit 1993) and although rare, infections involving more than one Aeromonas species have been documented (Joseph et al. 1979, 1991). In many cases, A. hydrophila is usually the most prevalent species (Gold and Salit 1993; Wu et al. 2011; Chao et al. 2013). A recent study found that the clinical presentation between patients with monomicrobial infection differed markedly from those with polymicrobial SSTIs (Chao et al. 2013). Previously, Harris et al. (1985) reported no significant differences between the clinical presentation, severity of disease, or outcome of patients with either monomicrobial or polymicrobial infections. Usually, SSTIs are the result of exposure to contaminated water or soil (von Gravenitz and Mensch 1968; Vally et al. 2004) and can affect both immunocompromised and healthy individuals (McCraken and Barkley 1972; Smith 1980a; Lynch et al. 1981; Heckerling et al. 1983). Most documented cases are the result of community-acquired infection, but nosocomially- acquired infections particularly after surgery do occur (Lynch et al. 1981; Gold and Salit 1993).

-72-

Gold and Salit (1993) reported 11 cases of SSTIs caused by A. hydrophila and reviewed the literature covering a period of 20 years (1973-1993). The clinical spectrum of infections due to this organism included several forms of cellulitis, myonecrosis, ecthyma gangrenosum, furunculosis, localized soft-tissue abscesses and skin nodules suggesting that SSTIs involving Aeromonas can manifest in a wide range of clinical presentations. Although wound infections caused by Aeromonas are not always fatal (Gold and Salit 1993), in some cases, infection has resulted in serious complications including death or amputation of affected limbs (Blatz 1979; Vally et al. 2004; Abuhammour et al. 2006). Necrotizing fasciitis due to Aeromonas is rarely seen in healthy individuals but has been reported in individuals with liver disease or malignancy (Cui et al. 2007; Lee et al. 2008) and in patients with no prior contact with aquatic animals or contaminated water (Ko et al. 2000).

1.15.3. Septicaemia

The most important form of Aeromonas infection is sepsis (Davis et al. 1978). Although most infections caused by aeromonads are the result of exposure or ingestion of contaminated soil, water, or food, in many cases the source of infection is unknown (Harris et al. 1985; Roberts et al. 2006; Morinaga et al. 2011). A rare and severe case of sepsis caused by A. hydrophila was reported in a patient with arthritis being treated with the anti-arthritic agent tocilizumab (Okumura et al. 2011). The clinical manifestations of Aeromonas septicaemia are similar to other Gram-negative bacilli including Vibrios (Sirinavin et al. 1984; Park et al. 2011). Ko et al. (2005) compared the pathogenicity of two bactaraemic isolates and showed that a strain of A. hydrophila Ah-2743 was more pathogenic than Klebsiella pneumoniae p-129. The occurrence and 30-d fatality rate of Aeromonas in patients with severe underlying conditions resembled those of P. aeruginosa (Llopis et al. 2004). The mortality rate associated with Aeromonas septicaemia in children and adults with and without underlying malignancies varied from 55 to 75% (Ketover et al. 1973; Sirinavin et al. 1984; Janda and Duffy 1988). Polymicrobial infections can range from 24 to 56% (Ko and Chuang 1995; Llopis et al. 2004; Tsai et al. 2006).

Janda and Abott (2010) categorized Aeromonas septicaemia into four groups (Table 1.9). Invariably in the majority of the cases patients have an underlying condition involving the hepatobiliary system or malignancy (Janda and Brenden 1987; Ko and

-73-

Chuang 1995; Janda and Abbott 1998; Llopis et al. 2004). In a retrospective study involving 41 Taiwanese patients, the predominant haematological malignancies associated with Aeromonas bacteraemia were acute myelogenous leukaemia (37.8%), myelodysplastic syndrome (26.7%) and non-Hodgkin lymphoma (17.8%). Most patients experienced fever (88.9%), septic shock (40%) and altered consciousness (26.7%). On average, a fatal outcome was observed less than four days between the collection of blood samples and death (Tsai et al. 2006).

Community-acquired Aeromonas septicaemia constitutes the majority of the cases compared to nosocomial infection (Ko et al. 2000). Nosocomial infections can occur in patients with no history of water exposure or cross-contamination by hospital environment and health care workers (Ko et al. 2000). In most cases, the suspected source is the patient’s own gastrointestinal tract (Harris et al. 1985; Roberts et al. 2006), probably from injury due to antineoplastic chemotherapies or gastrointestinal colonization (Sherlock et al. 1987; DePauw and Verweij 2005). In patients with cirrhosis of the liver, spontaneous bacterial peritonitis, hypotension, diabetes mellitus and high Pugh scores usually predict a fatal outcome (Ko and Chuang 1995). Patients with a concomitant infectious focus and a high severity score at onset tend to perform poorly and have a worse prognosis (Ko et al. 2000). In general, males tend to be more affected than females and children (Sirinavin et al. 1984; Janda and Brenden 1987; Ko et al. 2000; Llopis et al. 2004; Chuang et al. 2011).

The most predominant species recovered from blood are A. hydrophila, A. veronii bv. sobria and A. caviae (Ketover et al. 1973; Sirinavin et al. 1984; Janda and Brenden 1987; Ko and Chuang 1995; Ko et al. 2000; Llopis et al. 2004). This is consistent with a seven year retrospective Taiwanese study were 56% of the isolates belonged to A. hydrophila, 29% to A. veronii bv. sobria and 14% to A. caviae. Furthermore, mortality rates and acute physiology and chronic health evaluation II (APACHE II) scores suggested that A. veronii bv. sobria and A. hydrophila bacteraemia was more severe than bacteraemia due to A. caviae (Chuang et al. 2011).

-74-

Table 1.9 Major categories of Aeromonas septicaemia disease presentation

Category Group Underlying risk Precipitating events Portal of entry Mortality factors (%)

I Immunocompromised Hepatobiliary Recent antineoplastic Gastrointestinal tract, soft 32-55 persons disease, malignancy chemotherapy, neutropoenia tissue, intra-abdominal route, contaminanted indwelling devices II Trauma patients Can vary from none Crush injury, penetrating Cutaneous-subcutaneous 60 to multiple injuries, near-drowning tissues, respiratory tract conditions, including events, burns diabetes III Healthy persons None apparent at None noted Unknown <20 time of presentation

IV Reconstruction Malignancy, Medicinal leech therapy Tissue flap <5 surgery patients traumatic injury resulting in amputation Modified from Janda and Abbott (2010).

-75-

1.15.4. Respiratory tract infections

Respiratory infections caused by Aeromonas are rare and the isolation of these bacteria from the respiratory tract is usually considered a transient occurrence (Gonçalves et al. 1992; Takano et al. 1996; Janda and Abbott 1998; Bravo et al. 2003; Kao et al. 2003). As in most infections associated with aeromonads, there is often a predisposing underlying condition (Reines and Cook 1981; Baddour and Baselski 1988; Takano et al. 1996; Bravo et al. 2003). However, although rare, fulminant pneumonia has been reported in healthy individuals as young as five-years old with no history of exposure or consumption of water (Scott et al. 1978; Gonçalves et al. 1992; Kao et al. 2003; Nagata et al. 2011). Haemoptysis is present in one half of cases (Scott et al. 1978; Reines and Cook 1981; Gonçalves et al. 1992; Takano et al. 1996; Miyake et al. 2000). Infections can be monomicrobial or polymicrobial and may be community or nosocomially- acquired (Baddour and Baselski 1988). The mortality rate associated with aeromonads has been estimated between 50 to 83% (Takano et al. 1996; Janda and Abbott 2010).

Many cases of Aeromonas-induced pneumonia were preceded by near-drowning events (Reines and Cook 1981; Ender and Dolan 1997; Miyake et al. 2000; Mukhopadyay et al. 2003; Bossi-Küpfer et al. 2007). Mortality rates as high as 60% have been reported for aeromonad-related pneumonia in these cases (Ender and Dolan 1997). Both A. veronii bv. sobria and A. hydrophila have been isolated from fatal cases (Mellersh et al. 1984; Miyake et al. 2000; Bossi-Küpfer et al. 2007). The latter species was isolated from 19 specimens including 14 respiratory tract specimens at a hospital in Sheffield, England (Mellersh et al. 1984) and also in pure culture from the pharyngeal exudate of a 59 year-old diabetic female with anaemia and pharyngitis (Tena et al. 2007). More recently, a multiresistant strain of A. caviae was thought to be the caused of severe pneumonia in a cancer patient (Yu et al. 2010).

1.15.5. Urogenital tract infections

Aeromonas species are rarely associated with urinary tract infections (UTIs) and very few cases have been described (Filler et al. 2000; Hua et al. 2004; Al-Benwan et al. 2007; Figueras et al. 2007a). To date, the most cited cases of Aeromonas-induced UTIs have involved young children. Both A. hydrophila and A. popoffii were isolated from a neonate (Bartolome et al. 1989) and a 13 year-old boy suffering from spina bifida, respectively (Hua et al. 2004). A serious case was described in a six-month old girl with

-76- diarrhoea who developed acute renal failure requiring dialysis and subsequently a renal transplant. The source of the culpable bacterium, a haemolytic and cytotoxic A. sobria strain was probably aquarium water or the bathtub (Filler et al. 2000). In adults, A. caviae was isolated at 105 cells/ ml of urine in a 39 year-old male with symptoms of cystitis and a history of frequency, dysuria, haematuria, and weight loss (Al-Benwan et al. 2007). A 69 year-old diabetic male with chronic hepatitis and an indwelling device developed UTI with A. veronii bv. sobria and bacteraemia with A. veronii bv. veronii. After successful treatment with IV ceftriaxone the patient was discharged but re- admitted a few weeks later with necrotizing fasciitis due to A. veronii bv. veronii (Hsueh et al. 1998).

1.15.6. Intra-abdominal infections

Intra-abdominal infection is a broad term used to describe many different types of infections such as peritonitis, pancreatitis, acute cholangitis and hepatic abscesses (Janda and Abbott 2010). The majority of cases are community-acquired and males are usually more affected than females (2:1 ratio) (Clark and Chenoweth 2003). In serious Aeromonas infections such as liver abscesses the prognosis is usually poor in immunocompromised individuals as a result of the underlying conditions (Colaco 1982; Clark and Chenoweth 2003).

Peritonitis in adults is not uncommon and many cases have been reported for the last 30 years (Freij 1985; Khardori and Fainstein 1988; Muñoz et al. 1994; Ruíz de González et al. 1994; Elcuaz et al. 1995; Ko and Chuang 1995). Peritonitis is usually a secondary sequela to primary Aeromonas infection and in 75% of the cases has been associated with bacteraemia (Muñoz et al. 1994; Ruíz de González et al. 1994; Elcuaz et al. 1995; Ko and Chuang 1995). Cases of peritonitis have been described in children including those with ruptured appendixes (Freij 1985; Khardori and Fainstein 1988) and in patients undergoing continuous ambulatory peritoneal dialysis (Solaro and Michael 1986; Chang et al. 2005; Yang et al. 2008). The presence of Aeromonas as a cause of peritonitis or liver abscess should alert clinicians to the potential presence of underlying malignancies that may otherwise not been detected, a situation similar to the isolation of Streptococcus bovis group and Clostridium septicum from blood as these organisms are strongly associated with bowel malignancy (Bailey and Scott 1994).

-77-

Huang et al. (2006) reviewed 49 cases of primary and secondary Aeromonas peritonitis in a nine year period. Data from this study indicated that primary peritonitis occurred more often in individuals (97%) with liver disease in which half of the cases were accompanied by bacteraemia. In secondary peritonitis, 44% of the cases were health- care associated infections. Most peritoneal cultures (85%) were polymicrobial in nature usually involving members of the Enterobacteriaceae (Huang et al. 2006). The mortality rates attributed to primary and secondary peritonitis in this series were 23 and 15%, respectively (Huang et al. 2006). These values differed from the 60% overall mortality rate for aeromonad peritonitis reported by Muñoz et al. (1994). The gross mortality rate for spontaneous bacterial peritonitis caused by A. hydrophila or A. veronii was estimated at 56% (Wu et al. 2009).

A review of 39 cases indicated that hepatobiliary infections occurred in 71% of the patients with cholangitis and 22% with cholecystitis. Complications in the latter group included empyema or gangrene of the gallbladder while nine (22%) patients developed liver abscesses (Clark and Chenoweth 2003). The overall mortality (24%) of this series was higher than the 10% overall mortality reported by others (Chan et al. 2000).

Immunosuppression, malignancy and bile duct stones are the major predisposing underlying conditions of intra-abodominal infections (Chan et al. 2000; Clark and Chenoweth 2003). The consumption of freshwater fish and transmural migration from the gastrointestinal tract has been identified as possible sources of infection (Solaro and Michael 1986; Yang et al. 2008). The three major species A. hydrophila, A. caviae and A. veronii have been frequently isolated while A. salmonicida was identified in a patient with peritonitis undergoing continuous ambulatory peritoneal dialysis (Yang et al. 2008).

1.15.7. Infections due to medicinal leech therapy

Medicinal leeches (Hirudo medicinalis) are used to relieve venous congestion after plastic and reconstructive surgery. Wound discharge is a common feature and most infections respond to either antimicrobial therapy and/or debridement (Mercer et al. 1987). A retrospective study of 47 cases in Belgium showed that soft-tissue infections after medicinal leech therapy were largely polymicrobial (Bauters et al. 2007). Aeromonas hydrophila has frequently been isolated from wound samples following leech therapy (Whitlock et al. 1983; Dickson et al. 1984; Mercer et al. 1987; Snower et al. 1989; Fenollar et al. 1999), although cases involving A. caviae (Bauters et al. 2007)

-78- and A. sobria (Fenollar et al. 1999) have been described. Graf (1999b) used biochemical and molecular methods to characterize Aeromonas isolated from the gut of the leech revealing that A. veronii bv. sobria was the main bacterium present in the digestive tract of the parasite. In a recent study, Laufer et al. (2008) isolated two distinct Aeromonas species in Hirudo orientalis, namely, A. veronii and A. jandaei. The study also revealed that these species could colonize the species Hirudo verbena.

The presence of bacteria other than aeromonas has been attributed to the leech being fed contaminated blood or the failure to properly decontaminate the surface of the parasite (Graf 1999b). Prophylactic therapy with an appropriate antimicrobial to protect patients from infections caused by Aeromonas should be considered for individuals undergoing medicinal leech treatment, in particular, immunocompromised patients (Bauters et al. 2007).

1.15.8. Meningitis

Cases of meningitis caused by Aeromonas species are very rare (Seetha et al. 2004). Although most patients have a predisposing condition, meninigitis due to cranial surgery (Qadri et al. 1976), as complication of medicinal leech therapy (Ouderkirk et al. 2004) and cranial injury have been described (Pampín et al. 2012). However, in some meninigits cases no obvious predisposing condition has been reported (Sirinavin et al. 1984; Seetha et al. 2004). Most cases have been attributed to A. hydrophila followed by A. veronii bv. sobria and in the majority of cases the organism was recovered in cerebral spinal fluid. A fatal outcome was observed in 33% of the patients (Parras et al. 1993).

1.15.9. Zoonotic infections

Aeromonas infections due to animal bites are an infrequent event. Most infections are polymicrobial in nature and the contribution of aeromonads to these infections is not totally clear (Janda and Abbott 2010). Aeromonas form part of the oropharyngeal flora of reptiles and have been recovered from the mouth, fangs and venom of snakes (Jorge et al. 1998; Janda and Abbott 2010). To date, A. hydrophila has been the species most commonly isolated alone or in combination with other bacteria, from animal-related infections including snake bites (Jorge et al. 1998), bear attack (Kunimoto et al. 2004),

-79- catfish (Murphy et al. 1992), alligator and crocodile bites (Raynor et al. 1983, Flandry et al. 1989, Mekisic and Wardill 1992) and infections after shark attacks (Royle et al. 1997). Unusual cases of zoonotic infection include the isolation of A. hydrophila and Peptostreptococcus species from a wound on the foot of an 11 year-old boy after stepping on a stingray in a muddy river in Argentina (Pollack et al. 1998); abundant growth of A. hydrophila was recovered from the wound of a 17 year old boy with cyclic neutropoenia after being bitten by his pet piranha (Revord et al. 1988).

1.15.10. Burns

Aeromonas species are occasionally the cause of bacteraemia in burn patients and more than 20 cases of Aeromonas infection following burn accidents have been recorded since the 1980s including monomicrobial and polymicrobial infections (Ampel and Peter 1981; Barillo et al. 1996; Purdue and Hunt 1996; Kienzle et al. 2000; Wilcox et al. 2000; Chim and Song 2007; Lai et al. 2007). Burn injury may predispose to immunosuppression making the host more susceptible to Aeromonas infections (Barillo et al. 1996). Possible sources of contamination include extinction of a fire with dirty water or by rolling on dirt (Purdue and Hunt 1996) and by immersion in water immediately post burn (Kienzle et al. 2000). Exposure to water, however, has not always been the source of these infections (Barillo et al. 1996). Infection with Aeromonas following an electrical burn was described by Wilcox et al. (2000). All three major species, A. hydrophila, A. caviae and A. veronii bv. sobria have been recovered from burn patients. Infections harbouring more than one Aeromonas species have been described (Kienzle et al. 2000). Irrespective of the species isolated, the mortality rate associated with Aeromonas bacteraemia in burn patients is high (Lai et al. 2007).

1.15.11. Eye infections

Eye infections are extremely rare and usually occur as a result of injury or trauma (Smith 1980ab, Cohen et al. 1983; Washington 1972, 1973) and to a lesser extent, by wearing contaminated soft contact lenses (Pinna et al. 2004; Hondur et al. 2008). The clinical manifestations associated with these infections include corneal ulceration, endophthalmitis, conjunctivitis and keratitis (Feaster et al. 1978; Cohen et al. 1983; Puri et al. 2003; Pinna et al. 2004; Khan et al. 2007; Sohn et al. 2007). Although Aeromonas species have been involved in serious eye infections, the isolation of these organisms

-80- from eye specimens does not always indicate infection and may represent colonization. Conjunctival colonization with A. hydrophila and H. influenzae without any evidence of infection was reported in a 7 year-old boy after sustaining a penetrating injury to his eye with a safety pin (Smith 1980ab). To date, all cases of endophthalmitis involving aeromonads have been polymicrobial. Both A. hydrophila and P. shigelloides were isolated from the anterior chamber fluid of an 8 year-old boy following a penetrating injury by a fish hook (Cohen et al. 1983). In another case, A. hydrophila was isolated with C. perfringens, Bacillus species, and coryneform bacteria after perforation of the eye as a result of a dynamite explosion (Washington 1972).

1.15.12. Osteomyelitis and suppurative arthritis

Although rare, oesteomyelitis and suppurative arthritis involving Aeromonas have been reported in both immunocompromised (López et al. 1968; Chmel and Armstrong 1976) and healthy individuals (Blatz 1979; Karam et al. 1983). In immunocompromised patients, the outcome of these infections can be fatal despite appropriate antimicrobial therapy (Dean and Post 1967).

1.16. ANTIMICROBIAL SUSCEPTIBILITIES

Data on the antimicrobial susceptibility of Aeromonas has derived primarily from A. hydrophila, A. caviae and A. veronii isolates (Ko et al. 1996; González-Barca et al. 1997). More recently, the antimicrobial susceptibility of less frequently isolated species such as0 A. allosaccharophila, A. jandaei, A. schubertii, A. trota, A. popoffii and A. veronii bv. veronii has been determined (Overman and Janda 1999; Soler et al. 2002; Fosse et al. 2003a; Girlich et al. 2010). The agar dilution test has been the preferred method and a good correlation between agar dilution and disk diffusion has been reported (Koehler and Ashdown 1993). Previously, interpretative criteria for Aeromonas were based on guidelines established for Pseudomonas, Acinetobacter or Enterobacteriaceae (Koehler and Ashdown 1993; Overman and Janda 1999; Lupiola- Gomez et al. 2003). New guidelines and interpretative criteria for Aeromonas are now available for a handful of species (CLSI 2006; Jorgensen and Hindler 2007).

The antimicrobial susceptibility of Aeromonas species is predictable in most parts of the world (Jones and Wilcox 1995). However, assessing the susceptibility patterns of clinically significant isolates is highly recommended. Antimicrobial resistance may be

-81- strain-dependent and fatal outcomes have been associated with resistant strains (González-Barca et al. 1997). Moreover, antimicrobials to which aeromonads are intrinsically resistant have been administered in up to 20% of infections involving these bacteria (Scott et al. 1978; Vila et al. 2002; Bravo et al. 2003; Figueras 2005). Consequently, empirical antimicrobial therapy is usually inappropriate and recrudescence of infections due to ineffective early treatment compromises or delays patient’s recovery (Mellersh et al. 1984; Revord et al. 1988; Kelly et al. 1993; Al- Benwan et al. 2007).

The isolation of multi-resistant strains from food, aquaculture, and other environs is of clinical concern since these are potential sources of Aeromonas- induced infections (Goñi-Urriza et al. 2000; Rhodes et al. 2000; Nawaz et al. 2010). Resistance patterns have been reported in Aeromonas isolated from intestinal specimens, vegetables and water sources (Pokhrel and Thapa 2004; Palu et al. 2006). Resistance observed in environmental aeromonads may be related to the amount of pollution associated with these environments since heavily polluted waters may contain multiple resistance plasmids (Huddleston et al. 2006). In clinical isolates, antibiotic resistance has been associated with heavily populated areas probably reflecting local antibiotic usage (Goñi- Urriza et al. 2002).

Aeromonas can rapidly become resistant to multiple antibiotics, particularly to - lactams, when exposed to substrates that allow for selection of mutant strains (Bakken et al. 1988). With the exception of Asian isolates, world-wide resistance to tetracycline and chloramphenicol in clinical isolates has been consistently low (Reinhard and George 1985; Gosling 1986; Burgos et al. 1990; Koehler and Ashdown 1993). Asian strains also tend to be less susceptible to cefamandole, cotrimoxazole, pipercillin, imipenem and third generation cephalosporins (Chang and Bolton 1987; Ko and Chuang 1995; Ko et al. 1996, 2000; Chan et al. 2000).

Aeromonas are universally resistant to penicillin, carbenicillin, erythromycin, streptomycin and clindamycin (Jones and Wilcox 1995). Except for A. trota, Aeromonas are intrinsically resistant to ampicillin although ampicillin-susceptible strains belonging to species other than A. trota have been reported (Carnahan et al. 1991a; Abbott et al. 2003; Chan and Ng 2004; Huddleston et al. 2007; Figueira et al. 2011; Aravena-Román et al. 2012). Resistance to the aminoglycosides is low and while most isolates are susceptible to gentamicin and amikacin tolerance to tobramycin has

-82- been increasingly recognized (Singh and Sanyal 1992a; Koehler and Ashdown 1993; Kirov et al. 1995a; Ko et al. 1996; Overman and Janda 1999; Goñi-Urriza et al. 2000; Vila et al. 2002; Aravena-Román et al. 2012).

1.16.1. -lactamases

Production of -lactamases is the most common mechanism of antimicrobial resistance in Aeromonas. The secretion of multiple -lactamases by some strains is not unusual (Zemelman et al. 1984; Bakken et al. 1988; Iaconis and Sanders 1990; Walsh et al. 1997; Fosse et al. 2004). Inducible chromosomally-mediated -lactamases with action against penicillins, cephalosporins and carbapenems (Ambler class B, C and D) are produced by Aeromonas (Table 1.10) (Iaconis and Sanders 1990; Segatore et al. 1993; Rasmussen et al. 1994; Walsh et al. 1996; Yang and Bush 1996; Zhiyong et al. 2002; Fosse et al. 2003a). For the most part, the biochemical, genetic and enzymatic properties of Aeromonas-induced -lactamases derived from cloning experiments using E. coli as a recipient (Hedges et al. 1985; Rasmussen et al. 1994; Rossolini et al. 1996; Marchandin et al. 2003; Neuwirth et al. 2007). Significantly, conventional in vitro susceptibility tests may sometimes fail to detect these β-lactamases compromising therapeutic challenge (Chen et al. 2012).

-lactamases produced by Aeromonas can be susceptible to potassium clavulanate although the combination of this inhibitor and ampicillin does not always result in lower MICs to ampicillin. This is probably due to the intrinsic resistance of aeromonads to ampicillin (Zemelman et al. 1984; Bakken et al. 1988). Further, exposure to ampicillin- clavulanate has been associated with overproduction of chromosomal cephalosporinase and imipenem resistance suggesting that the combination may induce multiresistance (Sánchez-Céspedes et al. 2009). Changes in peptidoglycan composition (Tayler et al. 2010) and single point mutations alter -lactamase expression or induction in A. hydrophila while derepression can lead to overexpression of multiple enzymes (Walsh et al. 1997). Aeromonas species are considered the natural reservoir of class C cephalosporinases and transposition genes that could be readily transfered to members of the Enterobacteriaceae (Fosse et al. 2003c). Metallo--lactamases (MBLs) are -lactamases active against carbapenems (Rasmussen and Bush 1997). The first carbapenemase was detected in A. hydrophila (Shannon et al. 1986) and later found in A. veronii (both biovars) (Bakken et al. 1988).

-83-

Table 1.10 -lactamases produced by Aeromonas species

Group Classification1 Family Name Location Species Reference

SBL A Carbenicillase AER-1 C A. hydrophila Hedges et al. (1985)

C Cephalosporinase A1 C A. hydrophila, A. sobria Iaconis and Sanders (1990)

C AmpC AsbA1 C A. jandaei2 Rasmussen et al. (1994)

D OXA AsbB1 C A. jandaei2 Rasmussen et al. (1994)

D Penicillinase AmpH, AmpS C A. caviae, A. veronii bv. sobria, Fosse et al. (2003a) A. hydrophila C AmpC (FOX-1) CAV1 C A. caviae Fosse et al. (2003c)

C AmpC CepS, CepH C A. caviae, A. veronii bv. sobria, Fosse et al. (2003a) A. hydrophila A TEM TEM-1-like, P A. hydrophila, A. caviae Fosse et al. (2004) TEM-24 Marchandin et al. (2003) A C/P A. hydrophila, A. caviae Wu et al. (2011)

-84-

Table 1.10 Continued.

Group Classification1 Family Name Location Species Reference

MBL B Carbapenamases A2h, A2s C A. hydrophila, A. sobria Iaconis and Sanders (1990)

B Carbapenamases AsbM1 C A. jandaei Rasmussen et al. (1994)

B Carbapenamases CphA C A. hydrophila, A. veronii (both Fosse et al. (2003a) biovars), A. jandaei B Carbapenamases ImiS C A. veronii bv. sobria Walsh et al. (1998)

B IMP IMP-19 P A. caviae Neuwirth et al. (2007)

B VIM VIM I A. hydrophila Libisch et al. (2008)

1Ambler class; 2 Previously named as A. sobria; C, chromosomal; P, plasmid; I, integron; Asb, Aeromonas sobria -lactamases; CAV, found in A. caviae; Cep, chromosomal cephalosporinase; CphA, carbapenem hydrolyzing A. hydrophila; ImiS, imipenemase from A. veronii bv. sobria; IMP, active on imipenem; TEM, named for patient Temoneira; VIM, verona integron-encoded metallo--lactamase; SBL, Serine -lactamases; MBL, Metallo--lactamases; Modified from Janda and Abbott (2010).

-85-

MBLs have now been described in A. dhakensis, A. caviae, A. hydrophila, A. jandaei, A. sobria and A. salmonicida (Rasmussen and Bush 1997; Wu et al. 2012). The most common MBL found in aeromonads is CphA (Wu et al. 2012). Production of MBLs in A. caviae is rare even in derepressed mutants suggesting that imipenem, aztreonam and ceftazidime can be administered as an alternative therapy for infections caused by this species (Walsh et al. 1997; Lupiola-Gómez et al. 2003). Imipenem resistance has been reported in several Aeromonas species (González-Barca et al. 1997; Tena et al. 2007; Wu et al. 2012) particularly A. jandaei and A. veronii (Overman and Janda 1999; Sánchez-Céspedes et al. 2009; Figueira et al. 2011). Carbapenemase-producing strains can only be detected when the inoculum size is increased since most isolates will be susceptible to imipenem if a conventional inoculum is used (Shannon et al. 1986: Rossolini et al. 1995; Wu et al. 2012). Although meropenem is largely more active than imipenem against aeromonads (Clark 1992), the latter is recommended against infections caused by strains overexpressing group-1 -lactamases (Lupiola-Gómez et al. 2003).

1.16.2. Extended-spectrum -lactamase (ESBL) production

The incidence of ESBLs in Aeromonas species is low. The first ESBL was described in an A. caviae strain isolated from the diarrhoeaic stools of a 76 year-old man with intestinal ischaemia in France (Marchandin et al. 2003). Fosse et al. (2004) described the isolation of A. hydrophila recovered from the wound of an 87 year-old female with necrotizing fasciitis that simultaneously produced class A, B, C and D -lactamases. Surprinsingly, in both cases, the aeromonads were concomitantly isolated with an E. aerogenes strain that harboured a 180 kb TEM-24 plasmid. ESBLs were also detected in A. hydrophila isolated from the blood of a three year-old boy with bacteraemia and diarrhoea (Rodríguez et al. 2005) and from A. caviae recovered from the sputum of a 68 year-old male with oesophageal cancer (Ye et al. 2010).

ESBL-producing aeromonads have been recovered from clinical, environmental and mussel isolates with one fatal case reported among those isolated from human clinical material. Nosocomially-acquired infection was diagnosed in four patients, two from the community while the source of the remaining two was unknown. The majority of the patients had an underlying malignancy (Table 1.11). The isolation of ESBL-producer aeromonads from blood represents a serious clinical concern and the presence of these

-86-

Table 1.11 ESBL-producing Aeromonas species Clinical Species Specimen Gender/age (years) Clinical diagnosis Reference

A. caviae Stool M/78 Intestinal ischaemia Marchandin et al. (2003) A. hydrophila Wound F/87 Necrtizing fasciitis Fosse et al. (2004) A. hydrophila Blood M/3 Bacteraemia, pneumonia Rodriguez et al. (2005) A. caviae Sputum M/68 Oesophageal cancer Ye et al. (2010) A. hydrophila Blood F/70 Bacteraemia, hand phlebitis Wu et al. (2011) A. caviae Blood M/55 Primary bacteraemia Wu et al. (2011) A. caviae Blood M/52 Primary bacteraemia Wu et al. (2011) A. caviae Blood F/65 Bacteraemia, hand phlebitis Wu et al. (2011) Environmental/Other A. media Active sludge Found in: Switzerland Picäo et al. (2008) A. allosaccharophila River water France Girlich et al. (2010) A. hydrophila River sediment China Lu et al. (2010) A. hydrophila/A. caviae Mussel Croatia Maravić et al. (2013) Modified from Wu et al. (2011); M, male; F, female.

-87-

enzymes should be excluded from isolates with a cefotaxime-resistant profile (Wu et al. 2011). ESBL-encoding genes were recently detected in 21 (14%) (13 A. caviae and eight A. hydrophila) isolates, with bla (CTX-M-15) identified in 19 and bla (SHV-12) in 12 isolates in Aeromonas isolated from wild-growing Mediterranean mussel (Mytilus galloprovincialis) in the eastern coast of the Adriatic Sea, Croatia. Of these, bla (CTX- M-15) was located on conjugative IncFIB-type plasmids in A. caviae isolates (Maravić et al. 2013).

The detection of ESBLs in Aeromonas prompted examination of environmental sources resulting in the screening for multi-drug resistance bacteria in different water environments. These findings suggest that Aeromonas can act as either recipient or vectors of resistant elements from other Gram-negative bacteria particularly from the Enterobacteriaceae (Fosse et al. 2003c). The current procedure used to detect the presence ESBLs is based on the clavulanate-based synergy (double-disk) technique usually applied to the Enterobacteriaceae (Fosse et al. 2004; Rodríguez et al. 2005). Genotypic confirmation of the presence of ESBLs can also be determined by PCR or ESBL sequencing (Maravić et al. 2013).

1.16.3. Plasmid-mediated resistance

Although antimicrobial resistance in Aeromonas is largely chromosomally mediated (Ianconis and Sanders 1990; Lupiola-Gomez et al. 2003), plasmids harbouring resistance genes have been described in several species (Rhodes et al. 2000, 2004; Cattoir et al. 2008). Plasmids of variable MWs with the ability to confer resistance to both antimicrobials and metals have been recovered from Aeromonas isolated from water, food and human sources (Huddlestone et al. 2006; Palu et al. 2006). Plasmids encoding resistance genes can be disseminated between different bacterial species under natural conditions (Rhodes et al. 2000). Class I and 2 integrons have been reported in strains associated with beef cattle in Australia. Thus, it is possible that the environment is likely to act as reservoir and disseminator of integron-containing bacteria in beef (Barlow and Gobiuos 2009). Class I integrons have been detected in A. veronii isolated from catfish suggesting that this species may act as the reservoir for integrons and putative pathogenic genes (Nawaz et al. 2010). Class 1 integrons have also been detected in environmental members of the Enterobacteriaceae. Quinolone resistance due to plasmid-mediated genes found in the Enterobacteriaceae have been identified in

-88-

Aeromonas isolated from environmental and clinical sources (Cattoir et al. 2008; Sánchez-Céspedes et al. 2008).

1.16.4. Quinolones

Quinolones are among the most effective antimicrobial agents used against Aeromonas infections and fluoroquinolones have shown excellent in vitro activity against most species (Reinhard and George 1985; Ko et al. 1996, 2003). Among the fluoroquinolones, ciprofloxacin proved to be the most effective against murine A. hydrophila infections (Ko et al. 2003). Resistance to quinolones has been linked with mutations of the gyrA gene and is associated with reduced susceptibility to nalidixic acid (Chang and Bolton 1987; Goñi-Urriza et al. 2002; Vila et al. 2002). Rhodes et al. (2000) showed that resistance to nalidixic acid was source-dependent. Human-derived strains were more resistant than aquaculture strains while in waste water isolates resistance was nearly five times more prevalent than surface water isolates. Ozonation of water may reduce quinolone resistance and increase production of metallo-- lactamase (Figueira et al. 2011).

Elevated MIC values due to quinolone resistance in A. hydrophila, A. caviae and A. sobria have been associated with mutations in type II toposisomerases of gyrA, gyrB, parC and parE genes which contain a quinolone resistance-determining region (Goñi- Urriza et al. 2002; Sinha et al. 2004). Mutations in these genes are attributed to double- or single-amino acid substitutions conferring a high resistance to fluoroquinolones (Sinha et al. 2004). Other quinolone-resistant mechanisms described in Aeromonas include a reduction on the level of uptake or an active efflux system (Poole 2000).

1.16.5. Genes encoding for antimicrobial resistance

The distribution of resistance genes in Aeromonas varies among the species. The cepS gene is almost universally present in A. veronii, A. hydrophila and A. caviae while the frequency of the amps gene appears to be strain-dependent (Walsh et al. 1997). The asbA1 and asbB1 genes which encode class C and D -lactamases, respectively, have been detected in A. jandaei (Rasmussen et al. 1994). CphA is encoded by cphA and has been detected in A. dhakensis, A. veronii (both biovars), A. hydrophila, A. jandaei and A. salmonicida (ssp. salmonicida and achromogenes) but not in A. caviae, A. trota or A. schubertii (Rossolini et al. 1996; Walsh et al. 1997; Wu et al. 2012). Despite

-89- harbouring the cphA gene, some species are unable to express MBL activity suggesting that genetic modifications capable of silencing the gene exist (Rossolini et al. 1995; Wu et al. 2012). Two integron-borne MBLs have been identified in Aeromonas isolated from stools in France and Hungary. The genes blaIMP-19 gene and blaVIM-4 encoding for IMP-19 and VIM were detected in A. caviae and A. hydrophila, respectively (Neuwirth et al. 2007; Libisch et al. 2008). VIM which confers resistance to all -lactam antibiotics except aztreonam could not be detected by the MBL Etest and only disks with and without EDTA or PCR would demonstrate the presence of the enzyme and gene respectively (Libisch et al. 2008).

ESBLs encoded by the blaTEM , blaPER , blaCTX-M, and blaSHV genes can be found in both chromosomes or plasmids. Of these, blaPER-3, which is rarely described in Aeromonas, has been detected in three strains (Picȁo et al. 2008; Girlich et al. 2010; Wu et al. 2011) and in a single isolate also harbouring the blaCTX-M-15 gene in mussel (Maravić et al. 2013). Quinolone resistance is mediated by the qnrS2 gene and has been detected in A. punctata (A. caviae) and A. veronii strains isolated from water and clinical sources, respectively (Cattoir et al. 2008; Sánchez-Céspedes et al. 2008). QnrS2 can be transferred from Aeromonas species to E. coli TPO10 with the consequent increase of MICs of quinolones and fluoroquinolones (Cattoir et al. 2008).

1.16.6. Antimicrobial usage: recommendations

Several recommendations regarding the usage or testing of antimicrobials directed against aeromonads have been proposed. Fluoroquinolones should not be used in treating paediatrics patients (Overman and Janda 1999) or in infections caused by Aeromonas resistant to nalidixic acid (Vila et al. 2002). Tobramycin, imipenem and cefoxitin should be omitted as alternative therapies due to the high resistance shown by certain species to these antimicrobials (Overman and Janda 1999). A lack of clinical usefulness precludes testing susceptibility to ampicillin, carbenicillin and cephalothin (Overman and Seabolt 1983). Aeromonas species carrying carbapenemase-encoding genes should be considered resistant to this antimicrobial class until confirmation is performed (Rossolini et al. 1996; Wu et al. 2012). Multi-resistant A. hydrophila strains isolated from children with acute diarrhoea were reported from India. However, these results were misleading as some antibiotics tested (vancomycin, bacitracin, methicillin and novobiocin) are not those usually used to treat Aeromonas in routine clinical

-90- settings (Subashkumar et al. 2006). Finally, resistance to quinolones is possibly due to over-prescription of this antimicrobial class in some locations (Sinha et al. 2004).

1.17. CONCLUSIONS

With the advent of molecular methods, the taxonomy of aeromonads has progressed considerably in the last two decades. The nomenclature issues, a conflict that has besieged bacteriologists for some time, could be simply resolved by acknowledging both senior and junior nomenclature in final reports. For example, any isolate identified as A. caviae or A. trota should be reported as A. punctata (jun. syn. A. caviae), and A. enteropelogenes (jun. syn. A. trota), respectively. In this way, all nomenclatures would be simultaneously recognized without compromising clinical information. More than 100 cases of Aeromonas infections involving both immunocompromised and immunocompetent individuals of all age groups have been published since 1999 (Chopra and Houston 1999b; Figueras 2005). This continuously growing evidence supports the notion that Aeromonas can no longer be considered merely opportunistic pathogens despite the failure to reproduce disease in an animal model.

Despite these drawbacks, evidence strongly suggests that infections caused by Aeromonas may be strain dependent and that some species may contain more virulent strains than others. This is perhaps the most important concept associated with Aeromonas pathogenicity in the long history of the genus. Thus, unlike other recognized and well-established pathogens such as S. pyogenes or S. Typhi where every strain can cause infection and a disease state, in Aeromonas only certain strains appear to do so. This is particularly evident in A. caviae and its association with infant gastroenteritis, which suggests that this species should be considered a human pathogen. Figueras (2005) stated that the use of commercial identification systems incorrectly contributed to the establishment of A. hydrophila as the cause of most cases of infections involving Aeromonas. This is consistent with data from recent studies which reveal that A. hydrophila is not one of the most predominant species when identification of isolates is based on molecular methods, and that the prevalence of other species is beginning to emerge (Aravena-Román et al. 2011b; Puthucheary et al. 2012). Data from future surveys will determine more accurately the real prevalence of pathogenic species, and Aeromonas species in general, if genotypic methods are used in the identification of these organisms. In contrast, in the aquaculture industry, Aeromonas species are

-91- recognized bona fide pathogens of many fish species, as supported by the blue gourami and zebrafish models of infection and every effort is made to prevent or decrease the impact of these organisms by the fish industry.

Definitive identification of these organisms should be confined to those isolates deemed to be significant or the source of an outbreak, while isolates not fitting these criteria should be reported to genus level only (Abbott et al. 2003; Figueras 2005). Genotypic identification allows detection of infrequently isolated Aeromonas species and molecular sequences of several housekeeping genes of strains representing all type and many reference strains have been deposited in GenBank. The case described by Fontes et al. (2010) provided the perfect example of how an Aeromonas species that had not been isolated since its original description was found within five years of its discovery. In 2004, Harf-Monteil et al. proposed A. simiae based on two strains isolated from the faeces of healthy monkeys. Fontes et al. (2010) isolated this species from a pig sample while determining the prevalence of Aeromonas in pig slaughterhouses in Portugal. The isolate was identified on the basis of 16s rRNA, gyrB and rpoD sequencing.

Janda and Duffey (1988) recommended that identification of mesophilic aeromonads must become more standardised before meaningful comparisons can be made between studies carried out at a various locations throughout the world. This remains an important recommendation and ideally, a set of guidelines that include selected phenotypic and genotypic tests, standard incubation conditions and media should be globally adopted. Moreover, primers and testing conditions should be adhered to eliminate or keep laboratory variations to a minimum (Ørmen et al. 2005).

Thornley et al. (1997) stated that from a diagnostic point of view, it would be highly desirable to be able to recognize pathogenic strains of Aeromonas from non-pathogenic ones, an idealistic concept that, at the present time, is not yet feasible. This statement is supported by a recommendation to establish a collection of well-defined strains representing all known clinically relevant Aeromonas species including strains of known pathogenicity in different animal models (Janda and Abbott 2010). This recommendation merits consideration and should be supported.

Finally, the ubiquitous nature of aeromonads, the widespread presence of virulence factors and antimicrobial resistance genes, and the potential for severe symptoms to occur, reinforce the notion that aeromonads recovered from human clinical material

-92- should be treated as potential pathogens. This is particularly relevant in immunocompromised individuals and those at extreme ages. At the present time, the significance of Aeromonas species isolated from human specimens can only be assessed on clinical grounds.

-93-

-94-

CHAPTER 2: MATERIALS AND METHODS

2.1. MATERIALS 2.1.1. Chemicals and reagents All standard laboratory chemicals and reagents and their suppliers are listed in Table 2.1. 2.1.2. Solutions Sterile distilled water and physiological saline (0.85% NaCl) solutions were obtained from Excel (Perth, Australia). Ultrapure distilled water used in the preparation of PCR master mixtures was obtained from Fisher-Biotec (Perth, Australia). Deionized water was prepared in-house by the Hepatitis Laboratory, PathWest, Nedlands, using a MilliQ filter system (Millipore ®, Australia).

2.1.2.1. DepC-treated water Four hundred microlitres of a 0.1 % (v/v) diethyl pyrocarbonate (depC) solution was added to 400 ml high purity water, stirred and incubated o/v at 37C. The mixture was then autoclaved at 15 psi for 60 min.

2.1.2.2. Ethidium bromide (10 mg/ml) One gram of ethidium bromide was added to 100 ml of water and stir for several hours until dissolved. The bottle containing the solution was wrapped in aluminium foil and kept in stored at 2 to 8C.

2.1.2.3. Chemical lysis stock solution This solution was used to extract DNA and was prepared in-house by staff from the PCR Laboratory (PathWest, Nedlands). The solution consisted of 50 ml 0.5M NaOH; 12.5 ml 10% SDS and 437.5 ml high pure water and was stored in 50 l aliquots at room temperature.

2.1.2.4. HCCA matrix solution The HCCA solution was prepared fresh by mixing 475 l of UPW, 500 l ACN and 25 l of 100% TFA in an Eppendorf tube and thoroughly vortex to produce a volume of 1 ml. 2.1.3. Bacteriological media

-95-

Bacteriological media used in this study were manufactured by Excel, Perth (Australia) and are listed in Table 2.2.

2.1.4. Gas chromatography All gases used in the detection of FAMEs were obtained from BOC (Victoria, Australia) and included instrumental air, and ultra high purity (99.999% purity) hydrogen and nitrogen.

2.1.5. Antimicrobials Antimicrobial used in this study and their suppliers are listed in Table 2.3.

2.1.6. Bacterial strains Reference and type strains including culture collection designation and provider are listed in Table 2.4. Strains used as positive and negative controls in biochemical tests are listed in Table 2.5. Clinical and environmental isolates used in this research including location and source of isolation are listed in Tables 2.6 and 2.7, respectively. Clinical isolates were collected from 1988 to 2008 while environmental isolates were collected from 1998 to 2008 from rural and metropolitan regions of Western Australia, the largest state in Australia covering an area of 2.5 Km2.

Isolates used in virulence studies were collected between 2002 and 2008 and were isolated from rural and metropolitan areas of Western Australia. Clinical isolates were collected from 46 males and 43 females while the gender of 9 patients was not available. The age of the patients ranged from 5 months to 89 years. Isolates used in virulence studies were randomly selected which were previously identified by extensive conventional biochemical testing and a selection of genotypic targets namely 16S rRNA and housekeeping genes sequences.

2.1.7. Primers Primers used in this research are listed in Table 2.8. All primers were manufactured by Fisher Biotec (Perth, Australia).

-96-

Table 2.1 Chemicals and reagents used in this project

Chemical/Reagent Supplier

Acetonitrile Bruker Daltonik Adonitol Sigma Agarose Scientifix Amygdalin Sigma Andrade’s indicator Sigma L-arabinose Sigma Bovine serum albumin Sigma PE buffer II Applied Biosystems Cellobiose Sigma Clinitest tablet Bayer Diagnostics p- dimethylaminocinnamaldehyde Sigma-Aldrich Deoxynucleoside triphosphate Applied Biosystems Diethyl pyrocarbonate Sigma Ethanol (HPLC grade) BDH Ethidium bromide Sigma-Aldrich 10% Ferric chloride aq. soln. Excel Ferrous ammonium sulphate (1% w/v aq. soln.) Excel Formic acid Bruker Glucose Sigma Glucose-1-phosphate Sigma Glucose-6-phosphate Sigma Glycerol Sigma Hydrochloric acid (HCl) (6N) Mallinkrodt Hexane (HPLC grade) Merck Hydrogen peroxide Ajax Finechem m-Inositol Sigma Indole (Spot) Excel Indole (Kovacs’) Excel DL-lactate Excel Lactose Sigma Lactulose Sigma

-97-

Table 2.1 Continued.

Chemical/Reagent Supplier

Lugol’s iodine Amber Scientific

Magnesium chloride (MgCl2) Applied Biosystems Maltose Sigma D-mannitol Sigma D-mannose Sigma Melibiose Sigma Methanol (HPLC grade) Merck -Methyl-D-glucoside Sigma Methyl-tert butyl ether (HPLC grade) Mallinkrodt -Nitrophenyl--D-galactopyranoside Rosco Pyrrolidonyl--naphthalimadase Remel Raffinose Sigma L-rhamnose Sigma Salicin Sigma Sodium dodecyl sulfate Bio-Rad Sodium hydroxide pellets (NaOH) (ACS grade) Merck Sodium hydroxide (bacterial lysis solution) Thermal Fisher D-sorbitol Sigma Sucrose Sigma Taq polymerase Applied Biosystems Tetramethyl-p-phenylenediamine dihydrochloride Becton Dickinson Trifluoroacetic acid Bruker Daltonik Voges-Proskauer reagent1 Excel Voges-Proskauer reagent2 Excel

-98-

Table 2.2 Bacteriological media used in this project

Media Supplier acetate slant Excel aesculin Excel arginine broth Excel citrate (Simmon’s) Excel citrate (Hänninen’s) Excel CLED agar Excel CNA agar Excel enriched lauryl sulphate agar (50 mm) Excel DNA agar Excel gelatine cysteine thiosulfate Excel gelatine Excel gluconate Excel heart infusion agar Excel heart infusion broth Excel horse blood agar Excel Jordan’s tartrate Excel DL-lactate Excel lipase Excel lysine broth Excel malonate Excel motility medium Excel Mueller-Hinton agar Excel nutrient agar Excel nutrient agar plus heat-killed S. aureus cells Excel nutrient agar plus 0.2 % NaCl and 0.1% SDS Excel nutrient agar plus 0.33% w/v elastin Excel NaCl broth (0 and 3%) Excel ornithine broth Excel peptone water Excel peptone water (¼ strength) Excel

-99-

Table 2.2 Continued.

Media Supplier

phenylalanine deaminase Excel pyrazinamidase slants Excel sheep blood agar Excel sterile distilled water Excel sterile saline (0.85% NaCl) Excel starch agar Excel trypicase soy broth Excel TSBA agar Excel tyrosine Excel urea (Christensen’s) Excel urocanic acid Excel VP medium Excel

-100-

Table 2.3 Antimicrobial agents used in this project Antimicrobial Supplier amikacin Sigma amoxicillin GlaxoSmithKline amoxicillin-clavulanate GlaxoSmithKline ampicillin (E-strip) BioMérieux aztreonam Bristol-Myers Squibb cefazolin Sigma cefepime OmegaPharm cefoxitin Sigma ceftazidime Sigma ceftriaxone Sigma cephalothin Sigma ciprofloxacin MP Biomedicals colistin sulphate (polymyxin E) Fluka colistin sulphate (polymyxin E) (E-strip) BioMérieux deferoxamine Rosco 2,4-diamino-6,7-diisopropylpteridine Oxoid doxycycline AB Biodisk gentamicin Pfizer meropenem (E-strip) BioMérieux meropenem AstraZeneca moxifloxacin Bayer nalidixic acid Fluka nitrofurantoin Sigma norfloxacin Sigma pipercillin-tazobactam Sigma tetracycline MP Biomedicals ticarcillin-clavulanate GlaxoSmithKline tigecycline (E-strip) BioMérieux tobramycin MP Biomedicals trimethoprim MP Biomedicals sulfamethoxazole Sigma

-101-

Table 2.4 Type and reference strains used in this project

Species Strain no. Other designation(s)

A. allosaccharophila ATCC 51208T CECT 4199T, LMG 14059T, CCUG 31218T A. dhakensis* CECT 7289T DSM 18362T A. australiensis CECT 8023T LMG 26707T A. bestiarum ATCC 51108T CDC 9533-76T, CECT 4227T, LMG 13444T, Popoff 218T A. bivalvium CECT 7113T LMG 23376T A. caviae ATCC 15468T CECT 838T, LMG 3775T, Popoff 545T A. caviae ATCC 13136T CECT 4226T, Popoff 267T A. culicicola CECT 5761T MTCC 3249T, DSM 17676T, CIP 107763T A. diversa CECT 4254T ATCC 43946T, CDC 2478-85T; LMG 17321T A. encheleia DSM 11577T CECT 4342T, ATCC 51929T, NCIMB 13442T, LMG 16330T A. eucrenophila ATCC 23309T CECT 4224T, LMG 3774T, NCIMB 74T, Popoff 546T A. fluvialis CECT 7401T LMG 24681T *Previously classified as A. aquariorum

-102-

Table 2.4 Continued.

Species Strain no. Other designation(s)

A. hydrophila subsp. hydrophila ATCC7966T CECT 839T, DSM 30187T, Popoff 543T A. hydrophila subsp. dhakensis LMG 19562T CCUG 45377T, DSM 17689T A. hydrophila subsp. ranae LMG 19707T CCUG 46211T, DSM 17695T A. jandaei ATCC 49568T CECT 4228T, A1642T, LMG 12221T A. media ATCC 33907T CECT 4232T, LMG 9073T, NCIMB 2237T A. molluscorum DSM 17090T CECT 5864T, LMG 22214T A. piscicola CECT 7443T LMG 24783T A. popoffii CIP 105493T CECT 5176T, LMG 17541T, CCUG 39350T, ATCC BAA-243 A. rivuli CECT 7518T DSM 22539T A. salmonicida spp. salmonicida CECT 894T ATCC 33658T, CIP 103209T, LMG 3780T A. salmonicida ssp. achromogenes CECT 895T ATCC 33659T, LMG 14900T, NCIMB 1110T A. salmonicida ssp. masoucida CECT 896T ATCC 27013T, CIP 103210T, LMG 3782T A. salmonicida ssp. pectinolytica DSM 12609T 34 melT

-103-

Table 2.4 Continued.

Species Strain no. Other designation(s)

A. salmonicida ssp. smithia CIP 104757NCIMT ATCC 49393T, CECT 5179T A. sanarellii CECT 7402T CIP 110203T, LMG 24682T A. schubertii ATCC 43700T CECT 4240T, LMG 9074T, CDC 2446-81T A. simiae DSM 16559T CIP 107798T, CCUG 47378T A. sobria CIP 7433T CECT 4245T, Popoff 208T, ATCC 43979T, LMG 3783T, CDC 9538-76T A. sobria CDC 9540-76 LMG 13469 A. taiwanensis CECT 7403T LMG 24683T A. tecta CECT 7082T DSM 17300T A. trota ATCC 49657T CECT 4255T, A1646T, LMG 12223T A. veronii biovar sobria ATCC 9071 CECT 4246, NCIMB 37, LMG 3785 A. veronii biovar veronii DSM 7386T ATCC 35624T, CECT 4257T Aeromonas spp. HG11 CECT 4253 ATCC 35941, NCIMB 13014

-104-

Table 2.5 Type and reference strains used as positive and negative controls

Species Designation

Aeromonas hydrophila ATCC 7966T Bacillus subtilis ATCC 6633 Moraxella catarrhalis ATCC 25238T Corynebacterium xerosis ATCC 9016 Enterococcus faecalis ATCC 29212 Escherichia coli ATCC 25922 Escherichia coli K12 Klebsiella pneumoniae ATCC 700603 Proteus mirabilis ATCC 12453 Proteus vulgaris NCTC 4635 Pseudomonas aeruginosa PA01 Pseudomonas aeruginosa ATCC 27853 Salmonella paratyphi ATCC 9150 Staphylococcus aureus ATCC 25923 Streptococcus agalactiae ATCC 12386 Vibrio parahaemolyticus ATCC 43996 Yersinia enterocolitica ATCC 27729

-105-

Table 2.6 Clinical strains used in this project

Strain Source Location Strain Source Location Strain Source Location

21 Unknown PMH 75 Blood SCGH 102 Stool SCGH 23 Wound PMH 77 Wound Rockingham 103 Stool Carnarvon 24 Wound PMH 78 CAPD fluid SCGH 104 Wound Derby 25 Shunt PMH 79 Wound Albany 105 Stool SCGH 26 Unknown PMH 80 Blood Rockingham 106 Blood SDH 27 Appendix PMH 81 Blood SCGH 107 Wound Carnarvon 28 Stool SCHG 83 Sputum SCGH 108 Stool Armadale 47 Sputum SCHG 84 Blood SDH 109 Blood Armadale 56 Bone chips Mandurah 85 Blood SCGH 110 Blood SCGH 57 Blood SCGH 86 Wound Pinjarra 111 Blood SCGH 58 Blood SCGH 87 Blood Kalgoorlie 112 Wound SCGH 59 Blood SCGH 88 Wound SCGH 113 Drain fluid SCGH 60 Blood SDH 89 Bile SCGH 114 Stool Armadale 61 Biliary stent SCGH 90 Wound SCGH 115 Stool Albany 62 T-tube tip SCGH 91 Wound Geraldton 116 Wound Armadale 65 Blood SCGH 92 Cyst SCGH 117 Wound Armadale 66 Wound SCGH 93 Urine Newman 118 Sputum SCGH 67 Wound Armadale 94 Stool Narrogin 120 Stool Armadale 68 Blood SCGH 95 Wound SDH 121 Wound SDH

-106-

Table 2.6 Continue.

Strain Source Location Strain Source Location Strain Source Location

69 Wound Busselton 96 Blood SCGH 123 Abscess SCGH 70 Blood Armadale 97 Stool SCGH 124 Wound Geraldton 71 Wound Collie 98 Pus Armadale 125 Blood Port Hedland 72 Blood Bunbury 99 Stool SCGH 126 Wound Kununurra 73 Wound SCGH 100 Stool SDH 127 Wound Collie 74 Wound SCGH 101 Ulcer Collie 128 Wound Byford 129 Wound Geraldton 156 Stool PMH 187 Stool Margaret River 130 Wound Armadale 158 Stool Denmark 188 Bile SCGH 131 Blood Armadale 159 Wound Exmouth 189 Stool Halls Creek 133 Mortuary SCGH 163 Wound Busselton 190 Wound Manjimup 134 Ear Newman 164 Sputum SCGH 200 Blood PMH 135 Blood Carnarvon 165 Unknown Norseman 211 Ear Bridgetown 136 Stool Busselton 166 Stool Bassendean 212 Wound Newman 137 Stool SCGH 167 Wound Busselton 213 Wound Boddington 138 Trachea SCGH 168 Wound SCGH 214 Faeces Northam 139 Stool SDH 169 Stool Stirling 215 Faeces Swan View

-107-

Table 2.6 Continued.

Strain Source Location Strain Source Location Strain Source Location

140 Peritoneal fluid SCGH 171 Sputum SCGH 216 Faeces Katanning 141 Toe nail Exmouth 172 Urine Newman 217 Faeces Osborne Park 142 Stool PMH 174 Wound Exmouth 218 Blood PMH 143 Burn PMH 175 Stool Armadale 219 Faeces Watheroo 144 Blister FH 176 Wound SCGH 220 Wound P. Hedland 145 Blood FH 177 Wound SCGH 221 Blood SCGH 146 Wound FH 178 Bile SCGH 269 Blood SCGH 147 Burn PMH 179 Stool Unknown 270 Wound Tom Price 148 Ulcer FH 180 Stool Manjimup 278 Wound Derby 149 Blood FH 181 Stool SCGH 279 Wound Derby 150 Tissue FH 182 Wound Collie 151 Blood FH 183 Stool Boddington 152 Blood FH 184 Stool SDH 153 Stool Collie 185 Wound SCGH 154 Blood Collie 186 Wound Derby

-108-

Table 2.7 Environmental strains used in this project

Strain Source Location Strain Source Location

29 Mullet fish PathWest 241 Water Unknown 30 Barramundi ADWA 242 Water Unknown 31 Gourami ADWA 243 Water Unknown 32 Fish ADWA 244 Water Unknown 33 Koi ADWA 245 Water Unknown 34 Fish ADWA 246 Water Unknown 35 Fish lesion ADWA 247 Water Unknown 199 Crab Carnarvon 250 Water Unknown 222 Chorinated water Serpentine supply MWA 251 Water Unknown 223 Water Unknown 252 Water Unknown 224 Borewater Wanneroo 253 Water Unknown 225 Reservoir raw South Dandalup 254 Water Unknown 226 Water Nollamusa 255 Water Unknown 227 Reservoir raw North Dandalup 256 Water Unknown

-109-

Table 2.7 Continued.

Strain Source Location Strain Source Location

228 Treated water Salter Point 257 Water Unknown 229 Treated water Applecross 258 Irrigation water Unknown 230 Water MWA John Walliston 259 Water Unknown 231 Scheme water City of Melville 260 Water Unknown 232 Water Thompson reservoir 261 Irrigation water Unknown 233 Water Unknown 262 Water Unknown 234 Reticulation Mundijong 263 Irrigation water Unknown 235 Water Unknown 264 Irrigation water Unknown 236 Water Unknown 265 Irrigation water Unknown 237 Water Unknown 266 Irrigation water Dalwallinu 238 Water Unknown 267 Irrigation Water Unknown 239 Water Unknown 268 Irrigation water Unknown 240 Water Unknown

-110-

Table 2.8 Primers used in this project Gene Primer sequence (5’ → 3’) Product size Reference (bp)

gyrB 7F: GGGGTCTACTGCTTCACCAA 960 - 1100 Yañez et al. (2003) 14R: TTGTCCGGGTTGTACTCGTC

rpoD 70Fs: ACGACTGACCCGGTACGCATGTA 820 Soler et al. (2004) 70Rs: ATAGAAATAACCAGACGTAAGTT

aerA/haem F: CCTATGGCCTGAGCGAGAAG 431 Soler et al. (2002) R: CCAGTTCCAGTCCCACCACT

aexT F: GGCGCTTGGGCTCTACAC 535 Braun et al. (2002) R: GAGCCCGCGCATCTTCAG

alt F: AAAGCGTCTGACAGCGAAGT 320 Aguilera-Arreola et al. (2005) R: AGCGCATAGGCGTTCTCTT

ascV F: ATGGACGGCGCCATGAAGTT 710 Chacón et al. (2004) R: TATTCGCCTTCACCCATCCC

aspA F: CACCGAAGTATTGGGTCAGG 350 Soler et al. (2002) R: GGCTCATGCGTAACTCTGGT

ast F: ATCGTCAGCGACAGCTTCTT 504 Aguilera-Arreola et al. (2005) R: CTCATCCCTTGGCTTGTTGT

-111-

Table 2.8 Continued. Gene Primer sequence (5’ → 3’) Product size Reference (bp)

BfpA F: CCGCAGGTGTGATGTTTTAC 251 Sechi et al. (2002) R: TGCGGTGTTATTGTTTGCT

BfpG F: ATGCCAAAGCTGACTGGTCT 233 Sechi et al. (2002) R: GACATGATTCCCGTTATAAA

flaA F: TCCAACCGTYTGACCTC 608 Sen and Rodgers (2004) R: GMYTGGTTGCGRATGGT

lafA F: CCAACTT(T/C)GC(C/T)TC(T/C)(C/A)TGACC 737 Aguilera-Arreola et al. R: TCTTGGTCAT(G/A)TTGGTGCT(C/T) (2005)

stx-1 F: ATAAATTGCCATTCGTTGACTAC 180 Paton and Paton (1998) R: AGAACGCCCACTGAGATCATC

stx-2 F: GGCACTGCTTGAAACTGCTCC 255 Paton and Paton (1998) R: TCGCCAGTTATCTGACATTCTG

vasH F: CTCTAGACCGGTGAACCCATCAAGCGCGTCCACT 1652 Suarez et al. (2008) R: TCCCCCCGGGCTGGTGGCCAGCAGCAGAGGCAATA

-112-

Table 2.9 Aeromonas strains used in virulence studies

Species No. of Source Strain number strains A. allosaccharophila 1 Stool 100 A. dhakensis 31 Wound 67, 71, 73, 79, 91, 95, 104, 107, 141, 176, 220, 279 Blood 60, 70, 154 Stool 169, 180, 183, Sputum 47 Fish 31, 32 Bone chips 56 Urine 93 Water 223, 229, 230, 235, 241, 242, 256, 257 A. australiensis 1 Irrigation water 266 A. bestiarum 1 Blood 68 A. caviae 27 Wound 143, 163, 270 Blood 57, 58, 65, 75, 80, 96, 106, 109, 110, 200 T-tube tip 62 Stool 94, 102, 103, 156, 158, 187, 216 CAPD fluid 78 Bile 178, 188 Peritoneal fluid 140 Water 264 Fish 30 A. hydrophila 29 Wound 23, 69, 90, 98, 101, 112, 117, 126, 128, 148 Blood 59, 84, 149, 151, 152 Stool 133 Biliary stent 61 Fish 34 Sputum 83, 118 Drain fluid 113 Bile 89 Tissue 150 Water 231, 243, 245, 260, 261, Pancreas cyst 92 A. jandaei 3 Fish 35 Water 253, 262

- 113 -

Table 2.9 Continued.

Species No. of Source Strain number strains A. media 2 Blood 85 Stool 179

A. salmonicida 2 Wound 190 Crab 199 A. schubertii 1 Wound 186 A. veronii bv. sobria 31 Wound 24, 66, 129, 147, 174, Blood 72, 81, 111, 125, 131, 218, 221, 269 Stool 99, 137, 166, 184, 189, 215, 219 Shunt 25 Appendix 27 Sputum 171 Fish 33 Water 224, 237, 247, 254, 259, 265, 268 Total 129

-- 114 --

2.2. METHODS

2.2.1. Bacterial culture methods

All isolates were stored at 70C in 5% serum-glycerol medium. Working cultures for identification purposes were subcultured onto HBA and incubated at 35C in air. Isolates were subcultured three times before they were used for biochemical testing. Working cultures for antimicrobial susceptibility testing and detection of virulence genes were subcultured onto HBA only once and incubated at 35C. Broth cultures were prepared by inoculating one single colony into a 10 ml TSB or HIB tube followed by o/v at 35C without shaking.

2.2.2. Acid production from carbohydrates

Carbohydrates used in this project are listed in Table 2.1. Carbohydrate fermentation reactions were performed in a peptone water base (Oxoid, Basingstoke, UK) containing 1% (w/v) of the desired sugar and 1% (v/v) Andrade’s indicator. Sugars were obtained from Sigma (St. Louis, Mo. USA). Carbohydrate-containing broths were inoculated with a drop from an overnight culture and incubated at 35C in air for up to seven days. A change in the colour of the broth from blue to yellow denoted acid production (Abbott et al. 2003).

2.2.3. Hydrolysis of aesculin

Aesculin hydrolysis was determined by inoculating a broth containing aesculin that was incubated at 35C for up to seven days in air. A blackening of the broth was considered a positive reaction (Cowan and Steel 1993). Positive control: Enterococcus faecalis ATCC 29212 Negative control: Streptococcus agalactiae ATCC 12386

2.2.4. Alkylsulfatase activity

Alkylsulfatase activity was determined by spot inoculating a nutrient agar plate containing 0.2% NaCl and 0.1% SDS with an overnight culture. The plate was incubated in air at 35ºC for up to seven days. A turbid halo surrounding the growth was indicative of alkylsulfatase activity (Abbott et al. 2003).

-- 115 --

2.2.5. Detection of a CAMP-like factor

Detection of a CAMP-like factor was determined by inoculating two sheep blood agar plates with a single, diametric streak of S. aureus ATCC 25923 (-toxin-producing strain). Tests strains were streak-inoculated at right-angles to but not touching the staphylococcal inoculum. The plates were incubated aerobically and anaerobically at 35C overnight. A positive result was indicated by production and diffusion of a completely clear area shaped like an arrow head in the zone of discolouration caused by the -toxin (Figura and Guglielmetti 1987). Positive control: Streptococcus agalactiae ATCC 12386 Negative control: Enterococcus faecalis ATCC 29212

2.2.6. Catalase activity

Catalase activity was determined by emulsifying a 24 colony grown in nutrient agar, in 3% hydrogen peroxide on a glass slide and observing for gas production (MacFaddin 1976). Immediate bubbling was considered a positive reaction (Cowan and Steel 1993). Positive control: Staphylococcus aureus ATCC 25923 Negative control: Streptococcus pyogenes ATCC 19615

2.2.7. DNase activity

DNase activity was determined by inoculating a plate containing 0.2% DNA and 0.01% Toluidine Blue O with an overnight culture that was incubated at 35ºC for up to 7 days. A clear pink zone around the inoculum indicated the production of extracellular deoxyribonuclease (Schreier 1969). Positive control: Moraxella catarrhalis ATCC 25238 Negative control: Escherichia coli ATCC 25922

2.2.8. Elastase activity

Elastase activity was determined by spot inoculating a plate containing 0.33% (w/v) elastin with an overnight culture that was incubated in air at 35ºC for two days. If no clear zone was detected after 48 h incubation which indicated a positive reaction, the

-- 116 -- plates were further incubated at room temperature for up to seven days (Rust et al. 1994). Negative Control: Escherichia coli K12 Positive Control: Pseudomonas aeruginosa PAO1

2.2.9. Gas from glucose

A broth containing 1% glucose and fitted with a Durham tube was inoculated with a drop from an overnight broth culture and incubated in air at 35ºC for 24 h. When gas was produced it was trapped at the top of the Durham tube forming a bubble. Glucose was fermented when the broth turned from green to yellow after overnight incubation (Abbott et al. 2003).

2.2.10. Gelatin hydrolysis

Gelatin hydrolysis was determined by inoculating tubes containing gelatin with a heavy inoculum from an overnight culture. Tubes were incubated at 35C in air for up to seven days. Gelatin hydrolysis was indicated by the development of a pink to red colour (Pickett et al. 1991).

2.2.11. Oxidation of potassium gluconate

Oxidation of potassium gluconate was determined by inoculating a tube containing gluconic acid with a drop from an overnight culture. Tubes were incubated at 35C for 48 h. After the incubation period a Clinitest tablet (Bayer Diagnostics, Bridgend, UK) was added. A positive reaction was denoted by a light-green to rusty-yellow colour. A negative reaction was indicated by a deep blue colour (Pickett and Pedersen 1970).

2.2.12. Ability to grow on TCBS medium

A TCBS plate was inoculated with a drop from a HIB broth and incubated in air at 35C for 24 h (Bailey and Scott’s 1994). Any growth was considered a positive result. Positive control: V. parahaemolyticus ATCC 43996 Negative control: Escherichia coli ATCC 25922

-- 117 --

2.2.13. -Haemolysis activity

-haemolytic activity was determined by streaking a portion of a 5% (v/v) sheep blood agar plate and incubating at 35ºC overnight in air. Clearing around the inoculum was evidence of red cell haemolysis (Bailey and Scott’s 1994).

2.2.14. Production of hydrogen sulfide from cysteine

The medium designed by Veron and Gasser (1963) was used to detect the production of hydrogen sulfide from cysteine. Tubes were inoculated from an 18-24 h TSA culture and then incubate at 35ºC for up to seven days in air. A positive reaction was indicated by a diffuse blackening of the medium radiating from the stab line.

2.2.15. Production of indole from tryptophan

2.2.15.1. Rapid spot indole method A portion of a colony was spread onto a filter impregnated with p- dimethylaminocinnamaldehyde and incubated at room temperature for 2 min. A blue colour indicated a positive result (MacFaddin 1976).

2.2.15.2. Kovacs’method A peptone water broth was inoculated with a drop from an overnight culture and incubated at 35C for 48 h. A drop of Kovacs’ reagent was added and the tube shaked slightly. The development of a red colour denoted a positive reaction (Cowan and Steel 1993). Positive control: Escherichia coli ATCC 25922 Negative control: Klebsiella pneumoniae ATCC 700603

2.2.16. Jordan’s Tartrate test

A well-isolated colony from a pure, 18-24 h culture growing on HBA was stabbed deeply to about one-fourth inch from the bottom of the tube. Tubes were incubated aerobically, with caps loosened, at 35ºC for up to 72 h in air (Edwards and Ewing 1972). A positive result occurred when a yellow colour developed in the lower portion

-- 118 -- of the tube while the surface zone remained red. Negative test: no colour change; the medium remained alkaline with a red colour throughout the tube. Positive Control: Escherichia coli ATCC 25922 Negative Control: Salmonella paratyphi ATCC 9150

2.2.17. Lipase activity

Lipase activity was determined by using corn oil as substrate based on the recipe by Hugo and Beveridge (1962). Using a young agar HIA slant culture as a source of inoculum, a line of inoculation was made from the bottom to the top of the slant. The tubes were incubated at 35ºC in air and observed daily for seven days. Positive reactions were indicated by the development of a dark blue colour in the medium, in the growth or both.

2.2.18. Utilization of malonate

Utilization of malonate was determined by inoculating a broth containing malonate with an overnight culture that was incubated at 35C in air for up to two days. A blue colour indicated a positive reaction (Cowan and Steel 1993). Negative control: Escherichia coli ATCC 25922 Positive control: Klebsiella pneumoniae ATCC 700603

2.2.19. Amino acid degradation

The Moeller’s method was used to determine lysine and ornithine decarboxylase and arginine dehydrolase activity. Tubes containing these amino acids and a control tube without any amino acid were inoculated with an overnight broth culture grown at 35C without shaking, sealed with paraffin oil and incubated for up to four days before discarding. The media first became yellow due to acid production from the glucose; later, if decarboxylation or dehydroxylation occurred, the medium became purple indicating a positive reaction. The control tube remained yellow (Cowan and Steel 1993). Negative control: Proteus vulgaris NCTC 4635 Positive control: Aeromonas hydrophila ATCC 7699

-- 119 --

2.2.20. Motility

2.2.20.1. Wet mount method A drop from a trypticase soy broth incubated o/v at 35C was placed onto a clean glass slide, covered and observed under phase contrast. Displacement of the bacterial cells in the medium was considered a positive reaction (Cowan and Steel 1993).

2.2.20.2. Motility medium method Motility was determined by inoculating motility medium by slightly stabbing the surface of the agar to a depth no greater than 5 –7 mm. The tube was incubated for up to seven days before discarding. Growth radiating away from the site of inoculum and spreading throughout the tube was indicative of motility (Cowan and Steel 1993). Positive control: Pseudomonas aeruginosa ATCC 27853 Negative control: Klebsiella pneumoniae ATCC 700603

2.2.21. ONPG activity

Detection of the enzyme -nitrophenyl--D-galactopyranoside was determined by preparing a dense bacterial suspension (4 MacFarland) in 0.25 ml sterile saline. A tablet containing the substrate (Rosco Diagnostics, Taastrup, Denmark) was added and the tube sealed. After 4 h incubation at 35C in air, a positive reaction was indicated by the development of a deep yellow colour as per manufacturer’s instructions (Rosco, Taastrup, Denmark). Positive control: Escherichia coli ATCC 25922 Negative control: Proteus mirabilis ATCC 12453

2.2.22. Oxidase activity

Oxidase activity was determined by rubbing a 24 colony onto the surface of a filter paper impregnated with fresh tetramethyl-p-phenylenediamine dihydrochloride. The appearance of a purple colour within 5 seconds denoted a positive reaction (Isenberg 1992). Positive control: Pseudomonas aeruginosa ATCC 27853 Negative control: Escherichia coli ATCC 25922

-- 120 --

2.2.23. Phenylalanine deaminase activity

A slant containing the amino acid phenylalanine was inoculated with a colony from an overnight culture and incubated at 35C for 24 h in air. After o/v incubation a few drops of 0.2 ml 10% (aq. soln.) ferric chloride were added. A strong green colour that developed within one minute was considered a positive reaction (Cowan and Steel 1993). Negative control: Escherichia coli ATCC 25922 Positive control: Proteus mirabilis ATCC 12453

2.2.24. Pyrazinamidase activity

Tubes containing pyrazinamide were inoculated from an overnight culture and incubated at 35ºC for two days in air. The slopes were flooded with freshly made 1% (w/v) aqueous ferrous ammonium sulfate and examined for the presence of pyrazoic acid. Positive pyrazinamidase activity was indicated by a pinkish rusty colour. Lack of activity resulted in a colourless reaction after 15 minutes (Carnahan et al. 1990). Negative control: Yersinia enterocolitica ATCC 27729 Positive control: Corynebacterium xerosis ATCC 9016

2.2.25. Pyrrolidonyl--naphthylamide activity

Commercially obtained filter paper discs were impregnated with L-pyrrolidonyl-- naphthylamide (Remel, Lenexa, KS, USA) which served as a substrate for the detection of pyrrolidonyl arylamidase. A large colony from an 18-24 h culture was rubbed onto a moisten disk with a sterile loop and allowed to incubate at room temperature for 2 min before one drop of colour developer was added. A positive result was indicated by the development of a pink to red colour within one minute of adding the colour developer. Negative result showed cream, yellow, or no colour within one minute of adding colour developer (Facklam et al. 1982). Negative control: Streptococcus agalactiae ATCC 12386 Positive control: Enterococcus faecalis ATCC 29212

2.2.26. Salt tolerance

-- 121 --

Growth in 0 and 3% NaCl broths was determined by inoculating the tubes with a drop from an o/v culture followed by incubation at 35ºC in air for up to seven days. A change from clear to turbid indicated growth (Abbott et al. 2003).

2.2.27. Stapholysin activity

Bacteriolytic activity was determined by spot inoculating a plate containing heat-killed cells of S. aureus ATCC 25923 with tests strains that were incubated for five days at 35ºC. A positive reaction was denoted as a clearing (lysis) of the opaque medium around the inoculated aeromonads (Satta et al. 1977).

2.2.28. Hydrolysis of starch

Starch agar plates were spot inoculated with an o/v culture and incubated at 30C for five days. Plates were flooded with Lugol’s iodine solution at the end of the incubation period. A clear colourless zone around the inoculum indicated that starch was hydrolysed (Cowan and Steel 1993). Positive control: Bacillus subtilis ATCC 6633 Negative control: Escherichia coli ATCC 25922

2.2.29. Hydrolysis of tyrosine

Hydrolysis of tyrosine was determined by spot inoculating a plate containing 0.5% L- tyrosine crystals in brain heart infusion agar. Plates were incubated at 35ºC in air for up to seven days. Clearing around the zone of inoculum indicated that tyrosine was hydrolysed (Abbott et al. 2003).

2.2.30. Urease activity

A urea agar slant (Christensen’s medium) was heavily inoculated with an overnight culture and incubated at 35C for up to 7 days. Hydrolysis of urea was indicated by the development of a pink to red colour (Cowan and Steel 1993). Positive control: Proteus mirabilis ATCC 12453 Negative control: Escherichia coli ATCC 25922

-- 122 --

2.2.31. Utilization of DL-lactate, acetate and urocanic acid

The slants of tubes containing the appropriate substrate were inoculated with a heavy inoculum from an o/v HBA with sterile loop. Growth and a bright blue colour indicated a positive reaction. Tubes were incubated for four days before discarding (Hänninen 1994).

2.2.32. Utilization of citrate (Simmon’s method)

A plate containing citrate was spot inoculated from an o/v culture and incubated at 35C in air and examined daily for seven days for growth and colour change. Growth and a bright blue colour indicated a positive reaction (Cowan and Steel 1993). Negative control: Escherichia coli ATCC 25922 Positive control: Klebsiella pneumoniae ATCC 700603

2.2.33. Voges-Proskauer test

Acetylmethylcarbinol production (VP test) was determined by inoculating a semi-solid medium with an o/v culture and incubated for three days at 35C in air. A positive reaction indicating production of acetylmethylcarbinol was denoted by the development of a red colour after addition of VP1 and VP2 reagents (Cowan and Steel 1993). Negative control: Escherichia coli ATCC 25922 Positive control: Klebsiella pneumoniae ATCC 700603

2.3. AMPLIFICATION OF gyrB AND rpoD GENES

2.3.1. Preparation of template DNA

DNA was extracted by the method of Coenye and LiPuma (2002) and used to amplify genes involved in identification and virulence. Three to four large isolated colonies grown from an overnight culture on HBA were suspended in 50 l of bacterial lysing solution prepared in-house by the PCR Laboratory, PathWest (Nedlands) and heated at 100C for 15 min in a dry heating block. The suspension was then diluted with 950 l of depC water and vortex followed by centrifugation for 5 min at 15000 g to pellet solid material. This stock solution was kept at 70 C. Working solution was prepared by

-- 123 --

diluting 20 l of the stock solution with 180 l of UPW (1:10) and kept at 4C during testing.

2.3.2. Polymerase chain reaction (PCR)

Primers were diluted to a concentration of 500 M with UPW. Amplification of DNA was performed by using 20 l of a PCR mixture containing 8 l of template DNA, 2 l of 10x PE buffer II (Applied Biosystems, Calif. USA), 0.1 l of 2% BSA (0.01% final concentration; Sigma, NSW, Australia), 2 l of a 25 mM MgCl2 solution (2.5 mM final concentration; Applied Biosystems, California. USA), 0.16 l deoxynucleoside triphosphate at 25 mM each (0.2 mM final concentration; (Applied Biosystems, Calif. USA), 0.1 l of PE TaqGold at 5 U/l (0.75 U final concentration; Applied Biosystems, Calif. USA); 0.008 l of a 500 mM solution of each primer (0.2 mM final concentration; Fisher Biotec, Australia) and 7.624 l of UPW to make the final volume of 12 l. The PCR mixture was prepared in a large volume to produce 200 tubes (virulence genes) and 400 (gyrB and rpoD genes) tubes of 12 l each under a sterile, class II bio-safety cabinet. Tubes containing all of the ingredients except the template DNA were stored at 20C.

Amplification was carried out on a Gene Amp® PCR System 2720 thermal cycler (Applied Biosystems). The protocol used for the gyrB and rpoD genes consisted of 1 cycle at 95C for 10 min (denaturation); 45 cycles of 94C for 30 s (melting); 55C for 30 s (annealing) and 72C for 1 min (elongation) and a final extension round at 72C for 7 min followed by cooling at 4C. The protocol for amplication of virulence genes was similar except that the annealing temperature ranged from 50 to 65C appropriate for each primer pair as reported by other researchers (Table 2.8) and a shorter elongation time (72C for 45 s). Separation of amplicons and sequencing of the gyrB and rpoD genes was performed by the staff of the PCR Laboratory (PathWest Nedlands). The PCR amplicons were separated by electrophoresis using 2% agarose and visualized using ethidium bromide.

2.3.3. DNA Sequencing

Purification of the PCR product preceded sequencing and was performed using ExoSAP-IT (USB Corporation, Cleveland, USA) according to the manufacturer’s

-- 124 -- instructions, to remove excess dNTPs and oligonucleotide primers. The nucleotide sequences on both strands of the DNA were determined with template-specific primers using fluorescence-based cycle sequencing reactions (BigDye Terminator v3.1 Cycle Sequencing Kit, AB, Foster City, USA). Cost-saving modifications to the manufacturer’s protocol included reducing the reaction premix volume by 25% and adding extra BigDye sequencing buffer to maintain volume. All incubation steps were completed in thermal cyclers (AB2720 thermal cycler, AB, Foster City, USA). Unincorporated dye terminators were removed from sequencing reactions using gel- filtration following the manufacturer’s protocol (DyeEx 2.0 Spin Kit, Qiagen, GmbH, Germany). The final product was heated for 5 mins at 94°C with 2× volume of formamide (Hi-Di formamide, AB, Foster City, USA). Capillary electrophoresis was performed on a 16-capillary genetic analyzer (3130xl Genetic Analyzer, AB, Foster City, USA) using POP-6 separation matrix (AB, Foster City, USA).

The ChromasPro V1.41 was used to edit the sequence data. Forward and reverse sequences of gyrB and rpoD genes were independently aligned using the Clustal_X version 1.8 as described by Thompson et al. (1997) and accessed via BioEdit Sequence Aligment Editor V7.0.5.2. Genetic distances were obtained using Kimura’s (1980) two- parameter model and concatenated trees were constructed by the neighbour-joining method of Saitou and Nei (1987) with the MEGA version 2 program devised by Kumar et al. (2001). The Basic Local Alignment Search Tool (BLAST) was used to analyze DNA homologies via the National Center for Biotechnology Information (NCBI) server at the National Library of Medicine (Bethesda, MD, USA).

Evolutionary distances and sequence dissimilarity percentages were calculated using the Clustal_W (Thompson et al. 1994) and MEGA version 5.05 software (Tamura et al. 2011). The rpoD and gyrB nucleotide sequences of type, reference and wild strains were deposited in GenBank and accession numbers are listed in Tables 4.1 and 4.2, respectively.

2.3.4. Detection of virulence gene products by Bioanalyzer

Following amplification, the PCR amplicons were separated by loading the tubes containing the 20 l mixture in a QIAxcel analyzer (Qiagen, Hilden, Germany) using a DNA Screening cartridge (Qiagen). A 4 l of an appropriate molecular size marker (QX

-- 125 --

Size Markers 50-800 bp or 15 to 2.5 kb, Qiagen) diluted with six l of QX DNA dilution buffer (Qiagen) and a row of 12 tubes containing 15 l of a 15bp to 1Kb alignment marker (Qiagen) sealed with one drop of paraffin oil was included in each run. Detection of positive products was visualized as per the Qiagen program and manual (Qiagen). Selected strains showing a product with a size expected for each gene were sequenced as described in 2.3.3 and their sequences compared with those deposited in GenBank using the Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1990).

2.4. METHODS USED IN THE CHARACTERIZATION OF AEROMONAS AUSTRALIENSIS SP. NOV.

Strain 266T was isolated from an enriched lauryl sulphate agar (50 mm) plate after water from a treated effluent used for irrigation at a sports-ground in the South-West of WA was tested for total coliform count by membrane filtration. Initial phenotypic and genotypic (rpoD and gyrB gene sequences) analyses, CFA profiles and MALDI-TOF spectra determined from strain 266 were performed by the author. Cell size, morphology and the presence of flagella were determined by electron microscopy following procedures described previously (Collado et al. 2009). Electron micrographs for strain 266 were prepared by Professor M. J. Figueras (Unitat de Microbilogia, Department de Ciènces Mèdiques Básiques, Facultat de Medicina i Ciènces de la Salut, IISPV, Universitat Rovira i Virgili, Reus Spain).

2.4.1. Phenotypic characterization

Biochemical and physiological tests used for the characterization of strain 266T were performed at 30 and 35C. All strains of type species belonging to the genus Aeromonas were tested in parallel under identical conditions in laboratories in Australia by the author and in Spain by Dr. R. Beaz-Hidalgo (Unitat de Microbilogia, Department de Ciènces Mèdiques Básiques, Facultat de Medicina i Ciènces de la Salut, IISPV, Universitat Rovira i Virgili, Reus Spain). A total of 36 phenotypic tests were selected from those performed by Abbott et al. (2003) outlined in section 2.2 following the procedure described by Alperi et al. (2010b). Strain 266T was tested for citrate utilization by the method of Hänninen (1994) and Simmon’s (Cowan and Steel 1993); oxidation of potassium gluconate, production of lipase, urease, Jordan’s tartrate,

-- 126 -- malonate utilization, phenylalanine deaminase (PPA) activity, nitrate reduction (MacFaddin 1976) and bacteriolytic activity (expression of stapholysin) (Satta et al. 1977).

Acid production from carbohydrate was performed in broth at a final concentration of 1% (w/v) of the desired sugar and 1% (v/v) Andrade’s indicator (Excel, Perth, Australia) as well as by the method described in Alperi et al. (2010b). The following carbohydrates were used: adonitol, amygdalin, L-arabinose, cellobiose, dulcitol, fructose, galactose, glucose, glucose-1-phosphate, glucose-6-phosphate, glycerol, myo- inositol, lactose, lactulose, maltose, mannose, D-mannitol, melibiose, -methyl-D- glucoside, raffinose, L-rhamnose, ribose, salicin, D-sorbitol, saccharose (sucrose), and trehalose. Additional carbohydrate fermentation was investigated with the API 20E and API CH50 systems (bioMérieux, Marcy l’Etoile, France).

Ability to grow at different temperatures was assayed on TSA supplemented with sheep blood at 4, 25, 30, 35 and 44C. Acid production from carbohydrates, hydrolysis of aesculin, urea, DNA and production of hydrogen sulphide from cysteine were observed for seven days. Other tests were read as described by Abbott et al. (2003). Appropriate positive and negative controls were included.

2.4.2. Antimicrobial susceptibility testing

The antimicrobial susceptibility of strain 266T was determined by the agar dilution method according to CLSI standards (CLSI 2011). Antimicrobial agents used in this project included the following: amikacin, amoxicillin, amoxicillin-clavulanate, aztreonam, cephalothin, cefazolin, cefepime, cefoxitin, ceftazidime, ceftriaxone, ciprofloxacin, colistin, gentamicin, meropenem, moxifloxacin, nalidixic acid, nitrofurantoin, norfloxacin, pipercillin-tazobactam, tetracycline, ticarcillin-clavulanate, tobramycin, trimethoprim, and trimethoprim-sulfamethozaxole. Interpretative criteria were in accordance with the CLSI (CLSI 2006).

2.4.3 Fatty acid methyl ester (FAME) analysis

Determination and identification of CFA composition was performed by the protocol described in the Sherlock® version 6.0 Microbial Identification System software

-- 127 -- package (MIDI-Inc, Newark, Delaware). Bacterial cultures, preparation of reagents and extraction procedures were according to the MIDI-Inc instructions manual (Paisley 1999). CFAs were analysed by fine capillary column GC chromatography using a Hewett-Packard GC model 6890 as described by Osterhout et al. (1991).

2.4.3.1. Inoculation of TSBA plates

TSBA plates were prepared by Excel (Perth, WA) according to the guidelines provided by the MIDI-Inc manual. Inoculation was performed by streaking the plates into four quadrants with a sterile loop from an HBA from an o/v culture. Plates were incubated at 28C for 48h. 2.4.3.2. Harvesting

A bacterial mass of approximately 20 mg was harvested from the third quadrant of the TSBA plate with a sterile, disposable bacteriology loop and smeared around the lower 2 cm of a borosilicate Wheaton tube (MIDI-Inc, Del. USA). All cultures had similar physiological age when they were harvested and CFA analyses were performed in triplicate. 2.4.3.3. Saponification

Bacteria were saponified by adding 1 ml of Reagent 1 at 100C, vortex after 5 min for 20s followed by further 25 min incubation in a waterbath (Grant Instruments, Cambridge, UK). Reagent 1 consisted of 45 g of NaOH (ACS grade) dissolved in 150 ml methanol (HPLC grade) and 150 ml of sterile distilled water.

2.4.3.4. Methylation

Methylation was performed by adding 2 ml of Reagent 2 to each tube, vortex for 5 to 10s and transferring the tubes to an 80C waterbath (Grant Instruments, Cambridge, UK) for 10 min, followed by rapid cooling. Reagent 2 was prepared by mixing 275 ml of ethanol (HPLC grade) with 325 6N HCl.

2.4.3.5. Extraction

-- 128 --

1.5 ml of Reagent 3 were added to each suspension and inverted for 10 min followed by removal of the bottom phase. Reagent 3 consisted of 200 ml hexane (HPLC grade) and 200 ml methyl-tert butyl ether (HPLC grade).

2.4.3.6. Washing

Three ml of Reagent 4 were added to each suspension and mixed by inversion for five min. The top third of the organic phase was removed and place in a testing vial. Reagent 4 consisted of 10.8 g NaOH pellets (ACS grade) dissolved in 900 ml of sterile distilled water. Extracted FAME preparations were run in batches with a calibration control immediately after extraction.

2.4.3.7. Interpretation of results

FAMEs analyses were interpreted according to Huys et al. (1994). Results were automatically issued by the system and included a chromatograph with the identification of the organism associated with a similarity index (SI). Any SI value > 0.500 indicated a good identification provided the difference with a second organism was > 0.100; SI values of 0.300 and 0.500 suggested that if the difference between the organism named first was > 0.100 from the second organism, the identification was good but it represented an atypical strain; SI values < 0.300 indicated that the organism may not be in the database (Paisley 1999).

2.4.4. Protein analysis by MALDI-TOF

The protein analysis of strain 266T was performed using a Bruker Microflex LT MALDI-TOF mass spectrometer (Bruker Daltonik, GmhH, Germany). Sample preparation using formic acid extraction method was performed as per manufacturer’s instructions (Eisentraut, TechNote FormicAcidMethod.doc, version 1.0; 2009 Bruker Daltonik). All strains were tested six times.

2.4.4.1. Sample preparation

The contents of a 1l loopful from an HBA o/v culture were transfered into an Eppendorf tube containing 300 l deionized water. The mixture was vortex for one

-- 129 --

minute to generate a homogeneous suspension. To this suspension, 900 l of pure ethanol were added and vortex for one min. The suspension was twice centrifuged for 2 min at 13000 rpm and the supernatant discarded to completely remove all residual ethanol. To the pellet, 50 l of 70% aqueous FA (prepared by mixing 30 l water and 70 l 100% FA) were added and vigorously mixed by pipetting up and down followed by vortexing. A further 50 l ACN were added and mixed as before followed by centrifugation for 2 min at 13000 rpm. One l of the microorganism extract supernatant was placed on a clean MALDI target, dried in a laminar airflow cabinet followed by addition of 1 l HCCA matrix solution. The MALDI target was then inserted into the MALDI-TOF mass specetrometer. Identification of isolates and interpretation of spectral patterns were as per manufacturer’s instructions (Bruker Daltonik).

2.4.5. Genotypic characterization

The initial taxonomic position of strain 266T was determined from the nucleotide sequences of the gyrB and rpoD genes by the author. Further multilococcus phylogenetic analysis based on the molecular sequences of the 16S rRNA, gyrB, rpoD, recA, dnaJ, gyrA and dnaX genes and DDH studies were performed by Dr. R. Beaz- Hidalgo (Unitat de Microbilogia, Department de Ciènces Mèdiques Básiques, Facultat de Medicina i Ciènces de la Salut, IISPV, Universitat Rovira i Virgili, Reus Spain).

2.4.5.1. PCR and sequence analysis

DNA extraction and conditions for amplifying the 16S rRNA, gyrB, rpoD, recA, dnaJ, gyrA and dnaX genes were performed as described by Martínez-Murcia et al. (1992b, 2011). DNA extraction for PCR and DDH studies was performed using the Easy DNA (Invitrogen) kit. Purified PCR products were prepared for sequencing by using the BigDye Terminator V.1.1 cycle sequencing kit (Applied Biosystems) and sequencing was performed with an ABI PRISM 310 and ABI 3130XL genetic analyser (Applied Biosystems). Using the Clustal_X program, version 1.8 (Thompson et al. 1997), the sequences obtained were independently aligned with sequences of the type and reference strains of all members of the genus Aeromonas taken from in-house data base (Martínez-Murcia et al. 2011) and some 16S rRNA sequences retrieved from the GenBank.

-- 130 --

Genetic distance and clustering were determined using Kimura’s two parameter model method (Kimura 1980) and evolutionary trees were constructed by the neighbour- joining method (Saitou and Nei 1987) using the Mega4 program (Tamura et al. 2007). Stability of the relationship was assessed by the bootstrap method (1000 replications).

DDH experiments were conducted using the methods described by Ziemke et al. (1998) and Urdiain et al. (2008). Re-association was performed under optimal conditions at 70C, single- and double-stranded DNA molecules were separated by the use of hydroxyapatite. Colour development was measured at 405 nm using a Biotek Power Wave XS2 microplate reader (Biotek® Instrument Inc.). Reported mean DNA-DNA relatedness values (%) and standard deviations were based on a minimum of three hybridizations for both, direct and reciprocal reactions. DDH studies were performed between strain 266T and the type strains of A. veronii (CECT 4257T), A. allosaccharophila (CECT 4199T) and A. fluvialis (CECT 7401T) as these were the phylogenetically closest species both in the 16S rRNA gene and the MLPA.

2.5. ANTIMICROBIAL SUSCEPTIBILITY TESTING

Antimicrobial susceptibility testing was performed by the agar dilution breakpoint and disk diffusion methods as described by the CLSI (2006). The E-strip method was used to determine the MIC for ampicillin, colistin, doxycycline and tigecycline.

2.5.1. Agar dilution

Plates used in agar dilution testing were obtained from Excel (Perth, WA). Plates containing amoxicillin-clavulanate, timentin and pipercillin-tazobactam were used within 24 h after preparation. All plates were pre-dried with lids off for 30 min at 35ºC before inoculation. A TSB tube was inoculated with three to four individual colonies from a HBA plate incubated o/v at 35 ºC and shaken for 2 h at the same temperature to achieve log phase. Each log phase broth was standardised to the equivalent of 0.5 McFarland with sterile saline. This suspension was further diluted 1 in 10 with ¼ strength peptone water (Excel, Perth) which was used to inoculate wells in the replica tray (Mast Laboratories Ltd. England). Plates were inoculated within 15 min of filling the wells and incubated in air at 35ºC for 24 h.

-- 131 --

A CLED and CNA plates were included at the beginning and at the end of each run to check for Gram-positive contaminants and cross contamination of wells. The following reference strains were included in each run Klebsiella pneumoniae ATCC 700603, Escherichia coli ATCC 25922, Escherichia coli ATCC 35218, Pseudomonas aeruginosa ATCC 27853, and Enterococcus faecalis ATCC 29212. Susceptibility was defined as absence of growth on solid medium after 24 h incubation. Presence of growth indicated non-susceptibility.

2.5.2. Disk diffusion

A 0.5 McFarland suspension was prepared in sterile saline from bacteria cultured on HBA after incubation o/v at 35ºC. Mueller-Hinton plates were lawn-inoculated with this suspension and appropriate antimicrobial disks placed on the surface of the agar. Plates with AMP, CEF and O/129 disks were incubated at 35ºC those with DEF disks were incubated at 30ºC. After 24 h incubation, zone sizes were measured and interpreted according to the following; values for O129 were obtained from the Oxoid Manual (1998); DEF values as per coagulase negative staphylococci from the Rosco Manual (2000); AMP and CEF from CLSI (2006). Interpretation of results is given in Table 2.10. 2.5.3. Minimum inhibitory concentration testing: E-strip method

E-strips stored at 20C were allowed to equilibrate to room temperature for 20 min before opening. A 0.5 McFarland suspension was prepared in sterile saline from bacteria cultured on HBA after incubation o/v at 35ºC. The suspension was dispensed with a sterile pipette to cover the entire surface of a Mueller-Hinton plate and allowed to dry for 10 min. An E-strip containing a gradient of the appropriate antimicrobial was placed onto the plate and incubated at 35C for 24 h.

MICs were read and recorded independently by two individuals. Interpretative criteria for tigecycline and ampicillin were derived from those described for the Enterobacteriaceae by the Food and Drug Administration (bioMérieux 2010) and those for doxycycline were derived from the CLSI (2011) document as outlined in Table 1 of the E-strip pacakage insert. MIC values for colistin were obtained from Fosse et al. (2003b) and shown in Table 2.11. Escherichia coli ATCC 25922 was used as a quality control.

-- 132 --

2.6. ELECTRON MICROSCOPY ANALYSIS

Cell size, morphology and the presence of flagella were determined by electron microscopy following procedures previously described by Collado et al. (2009).

2.7. STATISTICAL ANALYSIS

Chapters 3, 5 and 7 Statistical analyses were conducted with Fisher’s exact method of contingency table analysis using statistical software (Prism version 5.0; GraphPad, Inc., San Diego, CA). Chapter 6 2 Statistical analyses were based on the  Yc with Yates Corrections for relative small numbers (Yates 1934).

-- 133 --

Table 2.10 Interpretation of disk diffusion results (zones sizes in mm)

Category Antimicrobials (concentration in g)

O/129 (150) AMP (10) CEF (30) DEF (250)

R No Zone  13 > 18  14

I  14-16 15-17 

S Any zone  17  14  16

R, resistant; I, intermediate; S, susceptible; AMP, ampicillin; CEF, cephalexin; DEF, deferoxamine.

-- 134 --

Table 2.11 Interpretation of E-strip MIC values

Category MIC (concentration in g/ml)

AMP COL DOX TGC

R  32  2  16  8

I 16  8 4

S  8 < 2  4  2

R, resistant; I, intermediate; S, susceptible; AMP, ampicillin; COL, colistin; DOX, doxycycline; TGC, tigercillin.

-- 135 --

CHAPTER 3: PHENOTYPIC CHARACTERIZATION OF

AEROMONAS SPECIES

3.1. INTRODUCTION

The genus Aeromonas comprises facultatively anaerobic, glucose fermenting, oxidase positive, Gram-negative rods found globally in water and soil environments (Janda and Abbott 1998). The need for accurately identifying Aeromonas is based on the notion that only a few species are considered pathogenic to humans (Carnahan et al. 1991b). However, the taxonomy of Aeromonas has been described as difficult and confusing (Harris et al. 1985). This has been partly due to a lack of definitive phenotypic markers, different testing methodologies and an increasing number of new species (Miñana- Galbis et al. 2002). Indeed, several new species have been proposed in the last decade in addition to the 17 DNA hybridization groups described in the most recent edition of Bergey’s Manual of Systematic Bacteriology (Martin-Carnahan and Joseph 2005).

Previously, classification of Aeromonas species was primarily based on two characteristics: motility and growth temperature. Psychrophylic and non-motile species were represented by A. salmonicida while mesophilic and motile species included all the remaining aeromonads. The vigorous metabolic activity of most Aeromonas species particularly those of the mesophilic group, formed the basis for the classification of these organisms (Schubert 1968). The ability to ferment many carbohydrates and other substrates has been utilized by several authors in the quest to find suitable differential characteristics (George et al. 1986; Käempfer and Altwegg 1992; Valera and Esteve 2002).

The aim of this Chapter was to characterize a collection of clinical and environmental Aeromonas based on the scheme designed by Abbott et al. (2003). Minor modifications from the original scheme included the omission of production of pectinase and ability to grow in potassium cyanide medium. The former test allowed differentiation between subsets of A. salmonicida, a species that was not considered in the study while the latter was omitted due to the hazardous nature of the substrate. Furthermore, to complement Abbott’s scheme, several novel tests were introduced while previously described phenotypic tests were revisited in order to find new phenotypic markers.

3.2. Bacterial strains

-- 136 --

Bacterial isolates used in this study are listed in Tables 2.4, 2.6 and 2.7. Organisms used as positive and negative control are listed in Table 2.5. Clinical isolates were collected from intestinal and extra-intestinal sites over a period of 20 years (1988 to 2008). Of these, 46 (32%) were recovered from human clinical material from patients residing outside the Perth metropolitan area. Environmental and animal isolates were collected over a 10 year period (1998 to 2008) from all regions of Western Australia, the largest state of Australia covering an area of approximately 2.5 million square kilometres. All isolates were considered mesophilic in nature.

3.3. RESULTS

3.3.1. Biochemical characteristics of type and reference strains

The biochemical characteristics of 15 reference strains were in agreement with those described by Abbott et al. (2003). In contrast to the original descriptions, biochemical differences were observed for the following type strains; A. bivalvium CECT 7113T produced acid from salicin (Miñana-Galbis et al. 2007); A. molluscorum DSM 17090T produced acid from D-lactose and hydrolysed aesculin (Miñana-Galbis et al. 2004a); A. simiae DSM 16559T produced gas from glucose, -haemolysis on SBA and acid from D-lactose and salicin (Harf-Monteil et al. 2004) (Table 3.1).

3.3.2. Overall classification

Overall, 185 (92.9%) isolates were identified to species level. Of these, eight (4%) resembled members of the A. hydrophila complex and six (3%) could not be assigned to any taxon due to conflicting biochemical profiles. Members of the A. hydrophila complex included A. hydrophila, A.bestiarum and A. salmonicida.

3.3.3. Clinical isolates

Eighty (54.8%) isolates were identified as A. hydrophila; 36 (24.7%) as A. caviae and 18 (12.3%) as A. veronii bv. sobria. Three isolates were identified as A. eucrenophila A. jandaei and A. schubertii each constituting 0.7% of the total respectively. Four isolates (2.7%) could not be assigned to any taxon and five (3.4%) were identified as members of the A. hydrophila complex (Table 3.2).

-- 137 --

3.3.4. Environmental isolates

Twenty-four isolates (45.27%) were identified as A. hydrophila; 13 (24.5%) as A. veronii bv. sobria; seven (13.2%) as A. bestiarum; two (3.7%) as A. caviae; two (3.7%) as A.jandaei and one (1.9%) strain each as A. salmonicida and A. schubertii. In addition, two (3.7%) could not be identified to species level and three (5.6%) were classified as members of the A. hydrophila complex (Table 3.3).

3.3.5. Distribution of Aeromonas spp. in clinical samples

Aeromonas hydrophila was the most prevalent aeromonad in wound (69.0%), sterile sites (45.5%), blood (45.5%) and stool specimens (41.2%) followed by A. caviae wound (12.1%), sterile sites (36.4%), blood (36.4) and stools (35.3%). Isolates identified as A. veronii bv. sobria were present in wound (10.3%), sterile sites (18.1%), blood (12.1%) and stool specimens (11.8%). Aeromonas hydrophila (60%) and A. veronii bv. sobria (40%) were the only species isolated from sputum samples (Table 3.4).

3.3.6. Distribution of Aeromonas spp. in environmental samples

In water samples, A. hydrophila (46.7%) was the most frequently recovered species followed by A. veronii bv. sobria (22.2%) and A. bestiarum (15.6%), respectively. Other species isolated from water included, A. hydrophila complex (6.7%) and single (2.2%) strains were identified as A. jandaei and A. schubertii. Aeromonas hydrophila (42.9%) and A. caviae (28.6%) were predominant in fish samples followed by one strain (14.3%) each of A. jandaei and A. veronii bv. sobria. Two (4.4%) unidentified isolates were isolated from water and a single isolate from crab was identified as A. salmonicida (Table 3.4).

3.3.7. General phenotypic characteristics

Overall, the majority of the strains were positive for the following tests: motility, oxidase, catalase, ONPG, arginine dehydrolase, gelatinase, DNase and lipase activity, acid production from glycerol, maltose, D-mannitol, mannose glucose-1-phosphate and glucose-6-phosphate, hydrogen sulphide from cysteine, growth in 0 and 3% NaCl broth.

-- 138 --

Table 3.1 Biochemical characteristics of type and reference Aeromonas strains Character A. allosaccharophila A. bestiarum A. bivalvium A. caviae A. culicicola A. encheleia ATCC 51208T ATCC 14715T CECT 7113T ATCC 15468T CECT 5761T DSM 1577T Indole + + + + + + Citrate   + + +  Acetate   +    Malonate       VP  +   +  LDC + + +  +  PPA   +  +  Gas from glucose + +   +  Acid production from: L-arabinose + + + +   Cellobiose +   +   Lactose    +   Melibiose       -methyl-D-glucoside       L-rhamnose + +    + Salicin + +     Sucrose + + + + + + Aesculin hydrolysis + + + +   H2S from cysteine + + +  + +

- 139 -

Table 3.1 Continued. Character A. allosaccharophila A. bestiarum A. bivalvium A. caviae A. culicicola A. encheleia ATCC 51208T ATCC 14715T CECT 7113T ATCC 15468T CECT 5761T DSM 1577T Gluconate     +  DL-lactate   +    Urocanic acid + + + +   Jordan’s tartrate   +    PZA +  + +  + -haemolysis  +   +  Alkylsulfatase   +    Elastase  +     Tyrosine +  +    AmpicillinR R R R R R R CephalothinR S R S R S S Starch  + + +   PYR +  +    DeferoxamineR S R R R R R O/129R R R R R R R Growth in TCBS     +  CAMP (aerobic)  +  +  + CAMP (anaerobic)  +     ColistinR S R S R R S

-- 140 --

Table 3.1 Continued. Character A. eucrenophila A. hydrophila A. jandaei A. media A. molluscorum A. popoffii ATCC 23309T ATCC 7966T ATCC 49568T ATCC 33907T DSM 17090T CIP 105493T Indole + + + +   Citrate   +   + Acetate       Malonate      + VP  + +   + LDC  + +    PPA +  +  +  Gas from glucose  + +   + Acid production from: L-arabinose + +  + + + Cellobiose +   + +  Lactose +   +   Melibiose   +    -methyl-D-glucoside  +    + L-rhamnose       Salicin +      Sucrose + +  + +  Aesculin hydrolysis + +  +   H2S from cysteine  +    +

-- 141 --

Table 3.1 Continued. Character A. eucrenophila A. hydrophila A. jandaei A. media A. molluscorum A. popoffii ATCC 23309T ATCC 7966T ATCC 49568T ATCC 33907T DSM 17090T CIP 105493T Gluconate  +     DL-lactate +      Urocanic acid   + +   Jordan’s tartrate +   +   PYZ + +  + +  -haemolysis   + +   Alkylsulfatase +  +    Elastase  +     Tyrosine +   + +  AmpicillinR R R R S R R CephalothinR R R I R S R Starch + + +    PYR   +    DeferoxamineR R R R R R R O/129R R R R R R S Growth in TCBS  + +    CAMP (aerobic) +  + +   CAMP (anaerobic) + + +  +  ColistinR S S R S S S

-- 142 --

Table 3.1 Continued. Character A. schubertii A. simiae A. sobria A. trota A. veronii A. veronii ATCC 43700T DSM 16559T CIP 7433T ATCC 49657T bv. sobria bv. veronii ATCC 9071T DSM 7386T Indole   + + + + Citrate   +   + Acetate +    +  Malonate       VP +    + + LDC  + + + + + PPA       Gas from glucose  +  + + + Acid production from: L-arabinose   +  +  Cellobiose  + + +  + Lactose  +    + Melibiose       -methyl-D-glucoside   +   + L-rhamnose       Salicin  +    + Sucrose  + +  + + Aesculin hydrolysis  +  +  + H2S from cysteine     + +

-- 143 --

Table 3.1 Continued. Character A. schubertii A. simiae A. sobria A. trota A. veronii A. veronii ATCC 43700T DSM 16559T CIP 7433T ATCC 49657T bv. sobria bv. veronii ATCC 9071T DSM 7386T Gluconate     + + DL-lactate +   +   Urocanic acid +    + + Jordan’s tartrate     + + PYZ       -haemolysis + +  + + + Alkylsulfatase    +  + Elastase       Tyrosine       AmpicillinR R R S S R R CephalothinR R S S R S S Starch + + +    PYR   +    DeferoxamineR R R S R R R O/129R S R R S R R Growth in TCBS + +   + + CAMP (aerobic)     +  CAMP (anaerobic)       ColistinR S S S S R R

-- 144 --

Table 3.2 Biochemical characteristics of Aeromonas isolated from human clinical material (% positive) Character A. hydrophila complex A. hydrophila A. caviae A. bestiarum A. veronii bv. sobria n = 8 n = 104 n = 38 n = 7 n = 29 Indole 75 99 95 86 100 Citrate 63 72 77 57 93 Acetate 100 90 79 29 93 Malonate 38 36 16 14 45 VP 75 97 0 71 90 LDC 88 98 0 100 100 PPA 13 22 21 29 41 Gas from glucose 75 93 0 86 90 Acid production from: L-arabinose 38 37 100 43 0 Cellobiose 38 15 87 0 24 Lactose 25 12 95 0 41 Melibiose 13 1 0 0 10 -methyl-D-glucoside 88 85 0 71 17 Raffinose 0 1 24 0 7 L-rhamnose 0 6 0 0 0 Salicin 88 88 97 86 3 D-sorbitol 25 0 3 0 0 Sucrose 100 93 100 100 97 Aesculin hydrolysis 100 98 97 100 0

H2S from cysteine 100 96 21 71 97

- 145 -

Table 3.2 Continued. Character A. hydrophila complex A. hydrophila A. caviae A. bestiarum A. veronii bv. sobria n = 8 n = 104 n = 38 n = 7 n = 29 Gluconate 38 73 0 14 93 DL-lactate 63 69 74 0 0 Urocanic acid 100 83 79 86 76 Jordan’s tartrate 13 19 34 29 21 PYZ 50 37 89 29 41 -haemolysis 88 85 24 57 86 Stapholysin 38 75 0 43 0 Alkylsulfatase 38 42 3 14 24 Elastase 75 85 0 42 0 Tyrosine 88 61 18 0 28 AmpicillinR 100 100 100 86 97 CephalothinR 63 82 97 29 14 Starch 50 16 84 57 38 PYR 13 0 0 0 0 DeferoxamineR 88 99 100 100 97 O/129R 88 95 100 86 86 Growth in TCBS 50 51 84 29 66 CAMP (aerobic) 50 66 0 71 34 CAMP (anaerobic) 63 75 0 71 17 ColistinR 50 75 13 0 59

-- 146 --

Table 3.2 Continued.

Character Aeromonas spp. A. jandaei A. eucrenophila A. salmonicida A. schubertii n = 6 n = 3 n = 1 n = 1 n = 2 Indole 33 100 100 100 100 Citrate 0 100 0 100 0 Acetate 66 100 100 100 100 Malonate 0 33 0 0 50 VP 16 100 0 100 100 LDC 66 100 0 0 100 PPA 50 66 0 100 0 Gas from glucose 83 100 0 100 0 Acid production from: L-arabinose 50 0 100 100 0 Cellobiose 66 0 100 100 0 Lactose 33 0 100 100 0 Melibiose 33 66 0 0 0 -methyl-D-glucoside 33 33 0 100 0 Raffinose 50 0 0 0 0 L-rhamnose 16 0 0 0 0 Salicin 33 0 100 100 0 D-sorbitol 0 0 0 100 0 Sucrose 100 0 100 100 0 Aesculin hydrolysis 50 0 100 100 0

H2S from cysteine 66 100 100 100 50

-- 147 --

Table 3.2 Continued. Character Aeromonas spp. A. jandaei A. eucrenophila A. salmonicida A. schubertii n = 6 n = 3 n = 1 n = 1 n = 2 Gluconate 50 100 0 100 50 DL-lactate 16 0 0 0 50 Urocanic acid 66 100 0 0 100 Jordan’s tartrate 16 33 100 0 0 PYZ 50 0 100 0 0 -haemolysis 50 100 100 100 100 Stapholysin 0 0 0 100 0 Alkylsulfatase 33 33 0 0 50 Elastase 0 0 0 100 0 Tyrosine 16 66 0 0 0 AmpicillinR 100 100 100 100 100 CephalothinR 0 66 100 100 0 Starch 50 33 0 0 50 PYR 50 66 0 0 0 DeferoxamineR 83 100 100 100 100 O129R 83 100 100 100 50 Growth in TCBS 50 33 0 100 50 CAMP (aerobic) 0 0 0 0 50 CAMP (anaerobic) 0 33 0 100 0 ColistinR 50 100 0 0 50

-- 148 --

Table 3.3 Biochemical characteristics of Aeromonas isolated from environmental sources (% positive) Characteristics A. hydrophila A. veronii bv. sobria A. bestiarum A. caviae A. jandaei n = 24 n = 11 n = 7 n = 2 n = 2 Indole 96 100 86 100 100 Citrate 92 91 57 50 100 Acetate 96 82 29 100 100 Malonate 4 0 14 0 0 VP 92 91 71 0 100 LDC 96 100 100 0 100 PPA 33 36 28 0 50 Gas from glucose 88 73 86 0 100 Acid production from: L-Arabinose 13 0 43 100 0 Cellobiose 0 18 0 100 0 Lactose 0 27 0 100 0 Melibiose 0 9 0 0 100 -Methyl-D-glucoside 88 18 71 0 50 Raffinose 0 0 0 0 0 L-Rhamnose 4 0 0 0 0 Salicin 88 0 86 100 0 D-Sorbitol 0 0 0 0 0 Sucrose 100 92 100 100 0 Aesculin hydrolysis 96 0 100 100 0

-- 149 --

Table 3.3 Continued. Characteristics A. hydrophila A. veronii bv. sobria A. bestiarum A. caviae A. jandaei n = 24 n = 11 n = 7 n = 2 n = 2

H2S from cysteine 96 100 71 100 100 Gluconate 25 91 14 0 100 DL-Lactate 75 0 0 0 0 Jordan’s tartrate 25 36 29 0 50 PYZ 54 9 29 100 0 -Haemolysis 96 91 57 0 100 Stapholysin 79 0 43 0 0 Alkylsulfatase 63 45 14 0 0 Elastase 100 0 43 0 0 Tyrosine 13 27 0 0 50 AmpicillinR 100 91 86 100 100 CephalothinR 71 27 29 100 50 Starch 17 64 57 100 50 PYR 0 0 0 0 100 DeferoxamineR 100 100 100 100 100 O129R 100 54 86 100 100 Growth in TCBS 21 45 29 0 0 CAMP O 88 18 71 0 0 CAMP AnO 96 18 71 0 0 ColistinR 63 33 0 100 100

-- 150 --

Table 3.3 Continued. Characteristics Aeromonas spp. A. hydrophila complex A. salmonicida A. schubertii n=2 n=3 n=1 n=1 Indole 0 33 100 100 Citrate 0 100 100 0 Acetate 50 100 100 100 Malonate 0 0 0 0 VP 0 33 100 100 LDC 100 100 0 100 PPA 100 0 100 0 Gas from glucose 100 100 100 0 Acid production from: L-Arabinose 0 33 100 0 Cellobiose 50 0 100 0 Lactose 0 0 100 0 Melibiose 50 0 0 0 -Methyl-D-glucoside 100 67 100 0 Raffinose 50 0 0 0 L-Rhamnose 100 0 0 0 Salicin 0 100 100 0 D-Sorbitol 0 0 100 0 Sucrose 100 100 100 100 Aesculin hydrolysis 0 100 100 0

-- 151 --

Table 3.3 Continued. Characteristics Aeromonas spp. A. hydrophila complex A. salmonicida A. schubertii n=2 n=3 n=1 n=1

H2S from cysteine 100 100 100 0 Gluconate 100 33 100 100 DL-Lactate 0 100 0 0 Urocanic acid 50 100 0 100 Jordan’s tartrate 50 0 0 0 PYZ 50 33 0 0 -Haemolysis 100 100 100 100 Stapholysin 0 67 100 0 Alkylsulfatase 50 67 0 0 Elastase 0 100 100 0 Tyrosine 50 100 0 0 AmpicillinR 100 100 100 100 CephalothinR 0 67 100 0 Starch 100 67 0 100 PYR 50 0 0 0 DeferoxamineR 100 100 100 100 O129R 100 100 100 0 Growth in TCBS 50 33 100 100 CAMP O 0 100 0 0 CAMP AnO 0 100 100 0 ColistinR 50 67 0 0

-- 152 --

Table 3.4 Distribution of Aeromonas spp. among clinical and environmental samples after phenotypic characterization

Clinical Environmental

Species No. isolated Wound Sputum Sterile Blood Urine Stool Unknown Water Fish Crab / (%) site Aeromonas spp. 6 (3.0) 1 (1.7) 2 (5.9) 1 (33.3) 2 (4.4) A. bestiarum 7 (3.5) 7 (15.6) A. caviae 38 (19.0) 7 (12.1) 4 (36.4) 12 (36.4) 12 (35.3) 1 (33.3) 2 (28.6) A. eucrenophila 1 (0.5) 1 (2.9) A. hydrophila 104 (52.2) 40 (69.0) 3 (60.0) 5 (45.5) 15 (45.5) 2 14 (41.2) 1 (33.3) 21 (46.7) 3 (42.9) A. hydrophila 8 (4.0) 3 (5.2) 1 (3.0) 1 (2.9) 3 (6.7) complex A. jandaei 3 (1.5) 1 (3.0) 1 (2.2) 1 (14.3) A. salmonicida 1 (0.5) 1 A. schubertii 2 (1.0) 1 (1.7) 1 (2.2) A. veronii bv. 29 (14.5) 6 (10.3) 2 (40.0) 2 (18.1) 4 (12.1) 4 (11.8) 10 (22.2) 1 (14.3) sobria Total 199 58 5 11 33 2 34 3 45 7 1

- 153 -

Most strains were uniformly negative for ornithine decarboxylase, acid production from adonitol, amygdalin and m-inositol and production of a diffusible brown pigment. Weak urease activity was detected in three clinical isolates only identified as A. hydrophila, A. caviae and A. veronii bv. sobria. The remaining isolates were negative for this test.

3.3.8. Susceptibility to colistin

Resistance to colistin was observed in A. hydrophila (75%), A. veronii bv. sobria (59%); A. hydrophila complex (50%) and A. jandaei (100%) and less frequently in A. caviae (13.9%). Among the colistin resistant species, strains identified as A. jandaei produced much higher MIC values than the other resistant species (results not shown).

3.3.9. Production of pyrrolidonyl--naphthylamide

PYR activity was detected in seven (3.5%) strains comprising four (2.7%) clinical and three (5.7%) environmental isolates and in the type strains of A. sobria CIP 7433T, A. bivalvium CECT 7113T, A. allosaccharophila ATCC 51208T and A. jandaei ATCC 49568T. No PYR activity was detected on the remaining isolates. Clinical isolates showing PYR activity were identified as A. hydrophila complex (strain 221), Aeromonas spp. (strains 100 and 114) and A. hydrophila (strain 189). PYR+ environmental strains belonged to A. jandaei (strains 35 and 262) and Aeromonas spp. (strain 265).

3.3.10. Susceptibility to deferoxamine (DEF)

Most isolates were resistant to DEF except for four (2.7%) clinical isolates and the type strains of A. allosaccharophila ATCC 51208T and A. sobria CIP 7433T. Isolates susceptible to DEF were identified as A. hydrophila complex (strain 221), A. hydrophila (strain 184), A. veronii bv. sobria (strain 211) and Aeromonas spp. (strain 100).

3.3.11. Production of a CAMP-like factor

The production of a CAMP-like factor, under aerobic and anaerobic conditions was observed in the following species: A. bestiarum (71% O2; 71% AnO2); A. hydrophila

(66% O2; 75% AnO2); A. hydrophila complex (50% O2; 63% AnO2) and A. veronii bv. - 154 -

sobria (34% O2; 17% AnO2). CAMP-like factor was detected under aerobic conditions in one strain (50%) of A. schubertii and under anaerobic conditions in single strains of A. jandaei (33%) and A. salmonicida (100%).

3.3.12. Utilization of citrate: Simmon’s vs Hänninen’s medium

Fifty-seven (28.6%) strains were able to utilize citrate using Simmon’s medium but not Hänninen’s. Seven (4.6%) were positive in Hänninen’s medium alone; 52 (26.1%) produced a positive result in both media, while 36 (23.7%) strains failed to utilized this substrate.

3.3.13. Susceptibility to the vibriostatic agent O/129

Susceptibility to O/129 was observed in 16 (8%) strains from different species and included eight (5.5%) clinical and eight (15.1%) environmental strains.

3.3.14. Growth on thiosulfate salt bile sucrose agar (TCBS)

The ability to grow on TCBS agar was observed in 116 (58.3%) strains which included 16 (30.2%) environmental and 100 (68.5%) clinical isolates.

3.4. DISCUSSION

A conventional biochemical scheme was employed to identify a collection of Aeromonas strains recovered from clinical and environmental sources in Western Australia. Data from this study showed that A. hydrophila, A. caviae and A. veronii bv. sobria were the most frequently isolated species (92.9%) a result consistent with previous studies (Altwegg and Geiss 1989; Hänninen and Siitonen 1995; Abbott et al. 2003). In contrast to other reports, no significant differences between the biochemical profiles of clinical and environmental Aeromonas were found (Aguilera-Arreola et al. 2005; Ørmen et al. 2005). This may be partly attributed to the low number of environmental strains tested. However, phenotypic differences were observed between strains examined in this study with those reported elsewhere (Hänninen 1994; Valera and Esteve 2002; Abbott et al. 2003).

-- 155 --

Biochemically, strains of A. hydrophila were less likely to produce acid from L- arabinose (37%) compared to previous reports where >80% of strains were positive for this test (Käempfer and Altwegg 1992; Abbott et al. 2003). Utilization of urocanic acid and hydrolysis of tyrosine was observed in 83 and 61% of A. hydrophila strains, respectively. In contrast, Abbott et al. (2003) reported that only a handful of strains (12%) utilized urocanic acid while no strain hydrolysed tyrosine. These results concurred with previous observations which highlight the heterogeneity of A. hydrophila (Kirov 1993; Hänninen 1994; Abbott et al. 2003), probably reflecting geographical differences between the strains (Altwegg et al. 1990). Other differences were observed in A. caviae strains were the majority were able to produce acid from salicin (98.5%) and lactose (95.0%). In contrast, Valera and Esteve (2002) reported that only 33% of the A. caviae strains produced acid from salicin while Käempfer and Altwegg (1992) found that 64% of A. caviae strains produced acid from lactose.

The ability of A. veronii bv. sobria to produce a CAMP-like factor under aerobic and anaerobic conditions was consistent with the observations by Carnahan et al. (1991b) and Altwegg et al. (1990) but not with those of Figura and Guglielmetti (1987). The biochemical profiles of A. veronii bv. sobria were consistent with the study by Ashbolt et al. (1995). Phenotypically, this species appeared more stable than A. hydrophila and A. caviae, although Esteve et al. (2003) suggested that A. veronii bv. sobria constituted a heterogenous taxon that required further revision. Variations in phenotype may have clinical significance as an association between biotype and enterotoxin production has been suggested (Turnbull et al. 1984) but not universally supported (George et al. 1986). Traditionally, Aeromonas are considered resistant to the vibriostatic agent O/129 and should not grow on TCBS agar, characteristics that allow members of this genus to be differentiated from Plesiomonas and Vibrios (Cowan and Steel 1993; Esteve et al. 2003). However, results from the present study indicate that these tests are no longer reliable suggesting that the ability to grow on this selective medium and resistance to O/129 is strain dependent.

Assigning strains to a particularly taxon proved to be difficult in cases where: (i) the range allocated for a positive result varied from 16 to 84%; (ii) the percentage positive for a test was no greater than 60 or 70%; (iii) the end points for positive reactions could not be reliably determined for tests such as Jordan’s tartrate, production of phenylalanine deaminase and pyrazinamidase, despite the use of positive and negative controls. The inclusion of tests with a positive rate of nearly 100% [-galactoside

-- 156 --

production (ONPG), gelatin hydrolysis or nearly 100% negative (hydrolysis of urea, inability to produce acid from m-inositol, adonitol and amygdalin) did not contribute to the overall differentiation of aeromonads.

The choice of media and methods used to determine phenotypic traits can affect the biochemical identification of Aeromonas (Carnahan et al. 1991b; Esteve et al. 2003). For example, significantly (p = 0.0004) more strains were able to utilize citrate as a carbon source when Simmons’ medium was used than with the medium described by Hänninen (1994). Similarly, the use of Kovacs medium to determine indole production was significantly (p = 0.0001) more sensitive than the spot indole test. The quest to find new phenotypic markers to reliably identify Aeromonas to species level continues to be a difficult task. Previously described and novel tests introduced in this study did not improve the discriminatory power of the scheme and did not contribute to the phenotypic classification of these organisms. The PYR+ activity detected in less frequently isolated species such as A. allosaccharophila, A. bivalvium, A. jandaei and A. sobria is a promising phenotypic marker that can be used to rapidly and reliably differentiate these organims from PYR species but more strains need to be tested to confirm the validity of this test.

In this Chapter we have described the phenotypic characteristics of 199 Aeromonas isolates and determined the current distribution of species among clinical and environmental sources in Western Australia. Despite the unreliable nature of phenotypic identification, biochemical differentiation is still the only identification method available in some laboratories. Furthermore, biochemical differentiation remains a requisite when describing novel species. Janda and Duffey (1988) suggested that identification of mesophilic Aeromonas species must become more standardised before more meaningful comparisons can be made between studies carried out at various regions throughout the world, a suggestion supported by this study. Results from this study indicate that accurate identification of Aeromonas must involve the use of molecular methods and the nucleotide sequences of several housekeeping genes have been proposed for this purpose (Soler et al. 2004; Nhung et al. 2007) and this is presented in the next chapter.

-- 157 --

CHAPTER 4: GENOTYPIC CHARACTERIZATION OF AEROMONAS SPECIES

4.1. INTRODUCTION

The genus Aeromonas has long been recognized to contain strains that are difficult to differentiate from one another, particularly when identification is based on phenotypic methods alone (Abbott et al. 2003). However, advances in molecular methods and the development of novel molecular targets have significantly improved the discrimination of bacteria not usually amenable to identification by conventional biochemical methods (Yamamoto and Harayama 1996).

In the last decade, the nucleotide sequences of several housekeeping genes have been used to characterize members of the genus Aeromonas (Yañez et al. 2003; Soler et al. 2004; Küpfer et al. 2006; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010). Housekeeping genes perform essential functions in bacteria and, unlike the 16S rRNA gene, are single-copy genes where horizontal transfer seldom occurs (Yañez et al. 2003; Soler et al. 2004).

The primary aim of this Chapter was to re-classify Aeromonas strains previously characterized by phenotypic methods as described in Chapter 3, inferred by the rpoD and gyrB genes. The rpoD gene encodes one of the sigma (σ70) factors that confer promoter-specific transcription initiation on RNA polymerase while gyrB encodes the B-subunit of the DNA gyrase, a type II DNA topoisomerase (Yañez et al. 2003; Soler et al. 2004). Both genes have similar substitution rates (<2%) and a similar number of variable positions (34% for rpoD and 32% for gyrB). These genes have, individually or simultaneously, been used for the analysis of Aeromonas (Yañez et al. 2003; Soler et al. 2004). When combined, rpoD and gyrB have shown to be a reliable tool in the differentiation of these bacteria. Individually, gyrB allows the differentiation of closely related taxa such as Aeromonas sp. HG 11/A. encheleia and A. veronii/A. culicicola/A. allosaccharophila whereas rpoD differentiates A. salmonicida from A. bestiarum (Soler et al. 2004).

A second aim was to show how classification by a molecular method affects the distribution of species within clinical and environmental sources.

-- 158 --

4.2. Bacterial strains

Bacterial strains used in this Chapter are listed in Tables 2.4, 2.6 and 2.7. Clinical samples were isolated from wound (54 samples), stool (33 samples), blood (33 samples), and 23 from miscellaneous specimens. Environmental specimens were collected from water (44 samples), fish (7 samples), and crab (1 sample). The nucleotide sequences of the gyrB and rpoD genes obtained from wild and reference strains used in this study were deposited in GenBank/EMBL and accession numbers are listed in Tables 4.1 and 4.2.

4.3. RESULTS

4.3.1 Overall distribution of species following genetic identification Sixty (30.7%) isolates clustered around the type strain of A. dhakensis LMG 19562T (Fig. 4.1), 36 (18.4%) around A. caviae ATCC 13136T (Fig. 4.2), 38 (19.4%) around A. hydrophila ATCC 7966T (Fig. 4.3) and 49 (25.1%) around A. veronii bv. sobria ATCC 9071T (Fig. 4.4).

4.3.2. Distribution of Aeromonas spp. in clinical specimens The most prevalent species was A. veronii bv. sobria (25.1%) followed by A. dhakensis and A. caviae (both at 23.8%) and A. hydrophila (23.0%). The prevalence of A. dhakensis was wounds (40.7%), faeces (12.1%) and blood (9.0%). Most isolates recovered from blood samples were identified as A. caviae (32.2%) and A. veronii bv. sobria (30.3%) followed by A. hydrophila (21.2%). Other species isolated from human clinical material included: A. allosaccharophila (strain 100 from stool); A. bestiarum (strain 68 from blood); A. media (strains 85 from blood and 179 from stool); A. salmonicida (strain 190 from wound) and A. schubertii (strain 186 from wound) (Table 4.3). 4.3.3. Distribution of Aeromonas spp. in environmental specimens Overall, A. dhakensis (50.0%) was the most frequently identified species followed by A. veronii bv. sobria (25.0%). Both species were the most frequently identified Aeromonas in water samples 54.5 and 27.2%, respectively while six different species were identified in fish samples (Table 4.3).

-- 159 --

Table 4.1 Type and reference strains Genbank accession numbers Species Culture collection no. rpoD gyrB

A. allosaccharophila DSM 11576 FN773342 FN813470 A. aquariorum (reclassified as A. dhakensis) CECT 7289 FN773316 FN691767 A. australiensis CECT 8023 FN773335 FN691773 A. bestiarum ATCC 51108 FN773317 FN706556 A. bivalvium CECT 7113 FN773318 FN691768 A. cavernicola CECT 7862 HQ442702 A. caviae ATCC 13136 FN773319 FN691769 A. culicicola CECT 5761 FR872757 FN691769 A. diversa CECT 4254 AY169345 AY101806 A. encheleia DSM 11577 FN773320 FN796740 A. eucrenophila ATCC 23309 FN773321 FN706557 A. fluvialis CECT 7401 FJ603453 FJ603455 A. hydrophila ssp. hydrophila ATCC 7966 FN773322 FN706558 A. hydrophila ssp. dhakensis LMG 19562 HQ442800 HQ442711 A. hydrophila ssp. ranae LMG 19707 HE965669 A. jandaei ATCC 49568 FN773323 FN706559 A. media ATCC 33907 FN773324 FN706560 A. molluscorum DSM 7090 FN773325 FN706561

-160-

Table 4.1 Continued. Species Culture collection no. rpoD gyrB

A. piscicola CECT 7443 FM999969 FM999963 A. popoffii CIP 105493 FN773336 FN706562 A. rivuli CECT 7518 FJ969433 FJ969434 A. salmonicida ssp. salmonicida CECT 894 AY169327 AY101773 A. salmonicida ssp. achromogenes CECT 895 AY169329 AY101784 A. salmonicida ssp. masoucida CECT 896 AY169330 AY101790 A. salmonicida ssp. pectinolytica DSM 12609 AY169324 AY101785 A. salmonicida ssp. smithia CIP 104757 AM262159 A. sanarelli CECT 7402 FJ472929 FJ607277 A. schubertii CECT 4240 AY169336 AY101772 A. simiae DSM 16559 DQ41159 FN706563 A. sobria CDC 9540-76 FN773345 FN706564 A. taiwanensis CECT 7403 FJ474928 FJ807272 A. tecta CECT 7082 FN773337 FN796745 A. trota ATCC 49657 FN773339 FN796746 A. veronii bv. sobria ATCC 9071 FN773340 FN796747 A. veronii bv. veronii DSM 7386 FN773341 FN796748 Aeromonas spp. HG11 CECT 4253 AY169343 AJ964951

-161-

Table 4.2 GenBank accession numbers of wild strains for rpoD and gyrB gene sequences A. dhakensis (previously classified as A. aquariorum)

Strain no. Source rpoD gyrB Strain no. Source rpoD gyrB 31 Fish FN773334 FN691766 107 Wound FR675838 FR675869 32 Fish FN796726 FN706555 121 Wound FR675839 FR675870 47 Sputum FR675826 FR865966 123 Wound FR675841 FR675871 56 Bone chips FN773333 FN796734 124 Wound FR675840 FR675872 60 Blood FR675827 FR675858 139 Stool FR675842 FR676941 67 Wound FR675828 FR675859 141 Wound FR675843 FR676942 70 Blood FN796724 FN796735 154 Blood FR675844 FN796752 71 Wound FR675829 FR675860 165 Unknown FR675845 FR676943 73 Wound FR675830 FR675861 168 Wound FR675846 FR676944 74 Wound FR675831 FR675862 169 Stool FR675847 FR676945 79 Wound FR675832 FR675863 172 Urine FR675886 FR676946 88 Wound FR675833 FR675864 176 Wound FR675887 FR676947 91 Wound FR675834 FR675865 180 Stool FR675888 FR676948 93 Urine FR675835 FR675866 182 Wound FR675889 FR676949 95 Wound FR675836 FR675867 183 Stool FR675890 FR676950 104 Wound FR675837 FR675868 212 Wound FR675891 FR676951

-162-

Table 4.2 Continued. A. dhakensis (previously classified as A. aquariorum)

Strain no. Source rpoD gyrB Strain no. Source rpoD gyrB 213 Wound FR675892 FR676952 240 Water FR675853 FR681577 220 Wound FN808215 FR676953 241 Water FR675854 FR681578 222 Water FR682782 FR676954 242 Water FR675855 FR681579 223 Water FN808216 FR676955 244 Water FR675856 FR681580 226 Water FR675893 FR676956 246 Water FR681589 FR681581 227 Water FR675894 FR676957 250 Water FR681590 FR681582 228 Water FR675848 FR676958 251 Water FR681591 FR681583 229 Water FN796725 FN796736 255 Water FR681592 FR681584 230 Water FN808217 FR676959 256 Water FN796728 FN796738 232 Water FR675849 FR676960 257 Water FN796733 FN796739 234 Water FR675850 FR681574 258 Water FR681593 FR681585 235 Water FN796727 FN796737 263 Water FR681594 FR681586 236 Water FR675851 FR681575 278 Wound FR681595 FR681587 239 Water FR675852 FR681576 279 Wound FR681596 FR681588

- 163 -

Table 4.2 Continued. A. hydrophila

Strain No. Source rpoD gyrB Strain No. Source rpoD gyrB 23 Wound FR681805 FR681597 118 Sputum FR681875 FR681744 34 Fish FR681806 FR681598 126 Wound FR681876 FR681745 59 Blood FR681807 FR681599 127 Wound FR681877 FR681746 61 Biliary stent FN795730 FN796741 128 Wound FR681878 FR681747 69 Wound FR681808 FR681600 130 Wound FR681879 FR681748 77 Wound FR681809 FR681601 133 Mortuary FR681880 FR681749 83 Sputum FR681810 FR681602 144 Wound FR681881 FR681750 84 Blood FR681811 FR681603 145 Blood FR681882 FR681751 89 Bile FR681865 FR681605 148 Wound FR681883 FR681752 90 Wound FR681866 FR681606 149 Blood FR681884 FR681753 98 Blood FR681867 FR681736 150 Tissue FR681885 FR681754 101 Wound FR681868 FR681737 151 Blood FR681886 FR681755 105 Stool FR681869 FR681738 152 Blood FR681887 FR681756 112 Wound FR681870 FR681739 185 Wound FR681888 FR681757 113 Drain fluid FR681871 FR681740 231 Water FR681889 FR681758 115 Stool FR681872 FR681741 243 Water FR681890 FR681759 116 Wound FR681873 FR681742 245 Water FR681891 FR681760 117 Wound FR681874 FR681743 260 Water FR681892 FR681761

-- 164 --

Table 4.2 Continued. A. caviae

Strain No. Source rpoD gyrB Strain No. Source rpoD gyrB 21 Unknown FR681906 FR682025 109 Blood FR681923 FR682039 26 Unknown FR681907 FR682026 110 Blood FR681924 FR682132 30 Fish FR681908 FR682027 140 Peritoneal fluid FR681925 FR682133 57 Blood FR681909 FR682028 142 Stool FR682022 FR682040 58 Blood FR681910 FR682029 143 Wound FR682023 FR682041 62 T-tube tip FR681911 FR682030 153 Stool FR682011 FR682043 65 Blood FR681912 FR682031 156 Stool FR682012 FR682044 75 Blood FR681913 FR865963 158 Stool FR682013 FR682134 78 CAPD fluid FR681914 FR682032 163 Wound FR682014 FR865964 80 Blood FR681915 FR682033 167 Wound FR682015 FR682135 87 Blood FR681916 FR682034 178 Bile FR682016 FR682136 94 Stool FR681917 FR682035 187 Stool FR682017 FR682137 96 Blood FR681918 FR682504 188 Bile FR682018 FR682138 102 Stool FR681919 FR682036 200 Blood FR682019 FR682139 103 Stool FR681920 FR682037 216 Stool FR682020 FR682140 106 Blood FR681921 FR682038 217 Stool FN796729 FR682505 108 Stool FR681922 FR682131 270 Wound FR682021 FR682507

-- 165 --

Table 4.2 Continued. A. veronii bv. sobria

Strain No. Source rpoD gyrB Strain No. Source rpoD gyrB 24 Wound FR682024 FR682508 131 Blood FR682765 FR682522 25 Wound FR682572 FR682509 134 Wound FR682766 FR682523 27 Appendix FR682573 FN796749 135 Blood FR682767 FR682524 28 Stool FR682574 FR682510 136 Stool FR682768 FR682525 33 Fish FR682575 FR682511 147 Wound FR682769 FR682527 66 Blood FN796731 FR682512 159 Wound FR682770 FR682528 72 Blood FR682576 FR682513 164 Sputum FR682771 FR682529 81 Blood FR682577 FR682514 166 Stool FR682772 FR682530 97 Stool FR682578 FR682515 171 Sputum FR682773 FR682531 99 Stool FR682579 FR682516 174 Wound FR682774 FR682532 111 Blood FR682580 FR682517 175 Stool FR682775 FR682533 114 Stool FR682581 FR682518 177 Wound FR682776 FR682534 120 Stool FR682762 FR682519 184 Stool FR682777 FR682535 125 Blood FR682763 FR682520 211 Wound FR682778 FR682537 129 Wound FR682764 FR682521 214 Stool FR682779 FR682538

-- 166 --

Table 4.2 Continued. A. veronii bv. sobria

Strain No. Source rpoD gyrB Strain No. Source rpoD gyrB 215 Stool FR682780 FR682539 247 Water FR682790 FR682548 218 Blood FR682781 FR682540 252 Water FR682791 FR682549 219 Stool FR682783 FR682541 254 Water FR682792 FR682550 221 Blood FR682784 FR682542 259 Water FR682793 FR682551 224 Water FR682785 FR682543 265 Water FR682794 FR682552 225 Water FR682786 FR682544 267 Water FN796732 FN796750 233 Water FR682787 FR682545 268 Water FR682796 FR682553 237 Water FR682788 FR682546 269 Blood FR682797 FR682554 238 Water FR682789 FR682547

-- 167 --

Table 4.2 Continued. Miscellaneous species Species Strain no. Source rpoD gyrB A. jandaei 35 Fish lesion FR682798 FN796742 253 Water FN773326 FR682555 262 Water FN773327 FN796743 A. salmonicida 190 Wound FN773330 FR682801 199 Crab FN773331 FN796744 A. media 29 Fish FN773332 FN691772 85 Blood FR682799 FR682802 179 Stool FR682800 FR682803 A, schubertii 186 Wound FR865967 FN691774 A. bestiarum 68 Blood FN773343 FN691771 A. allosaccharophila 100 Stool FN773344 FN691770 A. australiensis strain 266T Isolated from water dnaJ HE611954 dnaX HE611951 gyrA HE611952 gyrB FN691773 recA HE611953 rpoD FN773335 16S rRNA HE611955

-- 168 --

Isolates (93 172) Isolates (222 257) Isolate 213 Isolate 258 Isolate 226 Isolates (235 250) Isolate 71 Isolate 107 Isolate 31 Isolate 227 Isolate 228 Isolate 241 Isolate 255 Isolate 141 Isolate 67 Isolates (73 74) Isolate 176 Isolate 256 Isolate 242 Isolate 279 Isolates (47 95 139 165) Isolate 183 Isolate 32 Isolates (230 236 249) Isolate 263 Isolate 121 A. dhakensis (LMG 19562T)) Isolates (223 232 240) 85 Isolate 168 71 Isolate 278 Isolate 182 Isolate 180 100 Isolate 104 Isolates (56 220) 85 Isolate 239 72 Isolate 60 Isolate 79 Isolate 91 Isolates (123 124) Isolates (229 234) 100 Isolate 251 Isolate 154 Isolate 212 70 78 Isolate 70 Isolate 88 Isolate 169 Isolate 244 A. hydrophila (ATCC 7966T) A. caviae (ATCC 13136) T 96 A. taiwanensis (CECT 7403 ) A. sanarellii (CECT 7402T) A. jandaei (ATCC 49568T) A. trota (ATCC 49657T) A. sobria (CDC 9540-76) T 88 A. fluvialis (CECT 7401 ) T 97 A. allosaccharophila (DSM 11576 ) 99 A. veronii bv. sobria (ATCC 9071) A. bestiarum (ATCC 51108T) 75 A. popoffii (CIP 105493T)) 99 A. piscicola (CECT 7443T) A. salmonicida (CECT 894T) T 100 A. molluscorum (DSM 17090 ) 98 A. rivuli (CECT 7518T) A. bivalvium (CECT 7113T) A. media (ATCC 39907T) A. eucrenophila (ATCC 23309T) 75 A. tecta (CECT 7082T) A. encheleia (DSM 11577T) 100 Aeromonas spp. HG 11 (CECT 4253) A. simiae (DSM 16559T) T 100 A. diversa (CECT 4254 ) 100 A. schubertii (ATCC 43700T) 0.02

Figure 4.1 Concatenated neighbour-joining phylogenetic tree showing the position of A. dhakensis strains derived from the rpoD and gyrB sequences (1339 nt).

- 169 -

Isolate 58 Isolate 156 Isolate 80 Isolate 87 Isolate 75 Isolate 110 80 Isolate 108 Isolates (146 163 167) Isolate 62 Isolate 103 Isolate 102 Isolate 158 Isolate 78 Isolate 216 Isolate 21 Isolate 30 Isolate 142 98 Isolate 140 Isolate 96 Isolates (57 270) Isolate 153 Isolate 106 A. caviae (ATCC 13136) Isolate 65 Isolate 26 99 Isolate 264 Isolate 188 Isolate 143 Isolate 178 Isolate 109 99 Isolate 217 Isolate 94 99 97 Isolate 187 Isolate 200 T A. taiwanensis (CECT 7403 ) A. sanarellii (CECT 7402T) A. media (ATCC 39907T) A. dhakensis (CECT 7289T) 99 A. hydrophila (ATCC 7966T) A. trota (ATCC 49657T) A. jandaei (ATCC 49568T) A. sobria (CDC 9540-76) 73 T 94 A. fluvialis (CECT 7401 )) T 86 A. allosaccharophila (DSM 11576 ) 98 A. veronii bv. sobria (ATCC 9071) T 99 A. encheleia (DSM 11577 ) 81 Aeromonas spp. HG11 (CECT 4253) A. eucrenophila (ATCC 23309T) A. tecta (CECT 7082T) T 99 A. molluscorum (DSM 17090 ) 87 A. rivuli (CECT 7518T) A. bivalvium (CECT 7113T) A. salmonicida (CECT 894T) T 99 A. piscicola (CECT 7443 ) T 97 A. bestiarum (ATCC 51108 ) A. popoffii (CIP 105493T) A. simiae (DSM 16559T) T 99 A. diversa (CECT 4254 ) 99 A. schubertii (ATCC 43700T) 0.02

Figure 4.2 Concatenated neighbour-joining phylogenetic tree showing the position of A. caviae strains derived from the rpoD and gyrB genes sequences (1330 nt).

-- 170 --

Isolate 34 Isolate 77 Isolate 59 Isolate 146 Isolates (90 115) Isolate 130 Isolate 89 Isolate 127 99 Isolate 86 Isolate 116 Isolates (117 118 260) Isolate 83 Isolate 61 Isolate 113 Isolate 98 Isolate 185 Isolate 23 Isolate 84 Isolate 243 Isolate 69 Isolate 133 Isolates (144 145 148 150 151 152) 84 T 99 A. hydrophila (ATCC 7966 Isolate 112 Isolate 101 72 Isolates (126 245) 99 99 Isolate 128 Isolate 105 Isolate 231 Isolate 261 A. dhakensis (CECT 7289T) A. salmonicida (CECT 894T) A. piscicola (CECT 7443T) 99 T 92 A. bestiarum (ATCC 51108 ) A. popoffii (CIP 105493T) A. trota (ATCC 49657T) A. jandaei (ATCC 49568T) A. sobria (CDC 9540-76) A. fluvialis (CECT 7401T) 71 T 96 A. allosaccharophila (DSM 11576 ) 93 A. veronii bv. sobria (ATCC 9071) A. taiwanensis (CECT 7403T) 98 A. sanarellii (CECT 7402T) A. caviae (ATCC 13136) T 99 A. molluscorum (DSM 17090 ) 97 A. rivuli (CECT 7518T) A. bivalvium (CECT 7113T) A. media (ATCC 39907T) T 99 A. encheleia (DSM 11577 ) Aeromonas spp. HG11 (CECT 4253) A. eucrenophila (ATCC 23309T) T A. tecta (CECT 7082 ) A. simiae (DSM 16559T)

T 99 A. diversa (CECT 4254 ) 99 A. schubertii (ATCC 43700T) 0.02

Figure 4.3 Concatenated neighbour-joining phylogenetic tree showing the position of A. hydrophila strains derived from the rpoD and gyrB genes sequences (1331 nt).

-- 171 --

Isolate 111 Isolate 114 Isolate 159 97 Isolate 174 Isolate 177 Isolate 259 Isolate 269 Isolates (28 166) Isolate 211 Isolate 125 Isolate 134 Isolates (224 225) Isolates (164 171) Isolates (24 25) Isolate 136 Isolate 268 Isolates (131 135) Isolates (247 252) Isolate 265 Isolate 129 Isolate 33 Isolate 97 92 Isolates (99 120) Isolate 72 Isolates (175 233) Isolate 184 Isolate 237 99 Isolate 238 Isolate 254 A. veronii bv. sobria (ATCC 9071) Isolate 27 Isolate 66 Isolate 218 79 Isolate 147 Isolate 214 99 Isolate 215 79 Isolates (81 219) Isolate 221 Isolate 267 Isolate 100 79 A. allosaccharophila (DSM 11576T) Isolate 266 A. fluvialis (CECT 7401T) A. sobria (CDC 9540-76) Isolate 253

96 99 Isolate 262 Isolate 35 83 A. jandaei (ATCC 49568T) A. trota (ATCC 49657T) Isolate 199 99 A. salmonicida (CECT 894T) Isolate 190 99 A. popoffii (CIP 105493T) T 98 A. piscicola (CECT 7443 ) Isolate 68 99 A. bestiarum (ATCC 51108T) A. dhakensis (CECT 7289T) 99 A. hydrophila (ATCC 7966T) 99 Isolate 85 Isolate 179 99 Isolate 29 A. media (ATCC 39907T) T 99 A. encheleia (DSM 11577 ) Aeromonas spp.HG 11 (CECT 4253) 74 A. eucrenophila (ATCC 23309T) 70 A. tecta (CECT 7082T) A. taiwanensis (CECT 7403T) 99 A. caviae (ATCC 13136) A. sanarellii (CECT 7402T) A. bivalvium (CECT 7113T) T 99 A. molluscorum (DSM 17090 ) 99 A. rivuli (CECT 7518T) A. simiae (DSM 16559T) T 99 A. diversa (CECT 4254 ) 99 Isolate 186

99 A. schubertii (ATCC 43700T) 0.02

Figure 4.4 Concatenated neighbour-joining phylogenetic tree derived from the rpoD and gyrB genes sequences (1341 nt) showing the position of A. veronii bv. sobria and other species including strain 266.

-- 172 --

Table 4.3 Distribution of Aeromonas spp. among clinical and environmental samples following genotypic characterization Clinical Environmental

Species No. isolated Wound Stool Blood Miscellaneous Total Water Fish Crab Total (%) A. allosaccharophila 1 (0.5) 1 (3.0) 1 (0.6) A. dhakensis 60 (30.7) 22 (40.7) 4 (12.1) 3 (9.0) 5 (27.1) 34 (23.8) 24 (54.5) 2 (28.5) 26 (50.0) A. bestiarum 1 (0.5) 1 (3.0) 1 (0.6) A. caviae 36 (18.4) 5 (9.2) 11 (33.3) 11 (32.2) 7 (30.4) 34 (23.8) 1 (2.2) 1 (14.2) 2 (3.8) A. hydrophila 38 (19.4) 16 (29.6) 2 (6.0) 7 (21.2) 8 (34.7) 33 (23.0) 4 (9.0) 1 (14.2) 5 (9.6) A. jandaei 3 (1.5) 2 (4.5) 1 (14.2) 3 (5.7) A. media 3 (1.5) 1 (3.0) 1 (3.0) 2 (1.3) 1 (14.2) 1 (1.9) A. salmonicida 2 (1.0) 1 (1.8) 1 (0.6) 1 1(1.9) A. schubertii 1 (0.5) 1 (1.8) 1 (0.6) A. veronii bv. sobria 49 (25.1) 9 (16.7) 14 (42.4) 10 (30.3) 3 (13.0) 36 (25.1) 12 (27.2) 1 (14.2) 13 (25.0) Aeromonas spp. 1 (0.5) 1 (2.2) 1 (1.9) Total 195 54 33 33 23 143 44 7 1 52

- 173 -

4.3.4. Phenotypic differentiation of Aeromonas dhakensis from other major spp.

Biochemically, A. dhakensis could be differentiated from A. hydrophila by its inability to produce acid from L-arabinose, ability to utilize citrate (93%) and produce alkylsulfatase (73%). In contrast, all A. hydrophila strains produced acid from L- arabinose but were less likely to utilize citrate (26%) as a carbon source or produced alkylsulfatase (3%); from A. caviae by a positive Vogues-Proskauer reaction (95% positive), production of elastase (93%), stapholysin (82%) and LDC (95%) while A. caviae was usually negative in all these tests; from A. veronii bv. sobria by its ability to utilize DL-lactate (78 versus 2%) and production of stapholysin (82 versus 0%) (Table 4.4).

4.3.5. Intra- and inter-species dissimilarities

The intra-species dissimilarity derived from the combination of the rpoD and gyrB (approximately 1,294 bp) ranged from 0.4 to 3.5% between the type species and the wild strains identified as A. dhakensis. Interspecies dissimilarity ranged from 19.1% between A. molluscorum and A. diversa to 1.4% between A. encheleia and Aeromonas spp. HG11 (Table 4.5 in the CD ROM attached).

4.4. DISCUSSION

The distribution of A. dhakensis strains in clinical and water samples found in the present study contradicts the long-standing notion that A. caviae, A. hydrophila, and A. veronii bv. sobria represent the most frequently isolated aeromonads (Altwegg and Geiss 1989; Janda and Abbott 1998; Ørmen et al. 2005). The number of A. hydrophila strains reclassified into several different species after genotypic characterization indicates that accurate identification of aeromonads requires molecular methods. Furthermore, these results concurred with those of Soler et al. (2004) who suggested that the combined analysis of more than one target improved the resolving power and the ability to differentiate between closely related species.

- 174 -

Table 4.4 Biochemical characteristics of Aeromonas after genotypic identification (% positive)

Adh Ahy Aca Avs Ame Aja Asa Aal Abe Asc No. of strains

Characteristics 60 38 36 49 3 3 2 1 1 1 Indole 95 100 92 96 100 100 100 + +  Citrate 93 26 78 84 0 100 100    VP 95 100 0 90 0 67 100   + LDC 95 100 3 100 0 100 50 + + + Gas from glucose 90 95 3 88 0 100 50 + +  Acid from: L-Arabinose 0 100 100 4 100 0 100  +  Cellobiose 0 13 81 40 100 0 100 +   Lactose 3 16 92 30 100 0 100    Mannitol 100 100 100 98 100 100 100 + +  -M-D-glucoside 93 82 0 38 0 33 100    Salicin 95 95 97 20 100 0 100    Sucrose 100 82 100 98 100 0 100 + +  G-1-P/G-6-P 98 100 8 100 100 100 100 + + + Aesculin hydrolysis 97 100 97 42 100 0 100 + +  Gluconate 60 74 0 75 0 100 50    -Haemolysis 95 66 31 92 33 100 100  + +

- 175 -

Table 4.4 Continued.

Adh Ahy Aca Avs Ame Aja Asa Aal Abe Asc No. of strains

Characteristics 60 38 36 49 3 3 2 1 1 1 Utilization of: DL Lactate 78 76 72 0 0 0 0   + Urocanic 83 87 78 78 33 100 50 +  + PZA 43 32 94 16 67 0 0    Stapholysin 82 89 0 2 0 0 50    Alkylsulfatase 73 3 3 26 0 33 0 +  + Elastase 93 100 0 0 0 0 100  +  Tyrosine 53 66 19 40 33 67 50   + CephalothinR 93 95 92 86 100 67 100 R S R PYR 0 0 0 8 0 67 0 +   DeferoxamineR 100 100 100 94 100 100 100 S R R O129R 98 92 100 78 100 100 100 + + + Growth in TCBS 57 39 89 62 0 33 50    CAMP aerobic 88 55 0 22 0 0 50   + CAMP anaerobic 90 68 0 24 0 0 100    ColistinR 77 76 17 64 0 100 100 R S S Adh, A. dhakensis; Ahy, A. hydrophila; Aca, A. caviae; Avs, A. veronii bv. sobria; Ame, A. media; Aja, A. jandaei; Asa, A. salmonicida; Aal, A. allosaccharophila; Abe, A. bestiarum; Asc, A. schubertii; PZA, pyrazinamidase activity; PYR, pyrrolidonyl--naphthylamide activity; TCBS, thiosulphate citrate bile sucrose agar.

-- 176 --

The results presented in this chapter revealed that, when used independently, sequences of both genes led to comparable identification, suggesting that gyrB and rpoD were equivalent markers for the taxonomic discrimination of Aeromonas spp. Phylogenetic trees generated from the rpoD and gyrB sequences (Figs. 4.1 to 4.4) were comparable to the one derived from a partial rpoB gene sequence (Lamy et al. 2010) except that the former sequences consistently placed A. molluscorum well within the centre of the trees, while it was placed in a more distant position when the tree was constructed from the rpoB sequences alone.

Data presented here may also help to explain the biochemical and genotypic heterogeneity previously observed in A. hydrophila (Miyata et al. 1995; Janda and Abbott 1998). Results from this study suggest that a lack of congruence between phenotypic and genotypic identification exists consistent with a previous study (Beaz- Hidalgo et al. 2010). Correct identification occurred in only 35 (33.6%) out of 104 strains phenotypically identified as A. hydrophila, while the remaining strains were re- identified as A. dhakensis (54 strains, 51.9%), A. veronii bv. sobria (14, 13.4%), and A. bestiarum (one strain, 1.2%) by molecular analysis.

There are several reasons for this to occur. Firstly, the usefulness of many tests used in here and also observed by others (Abbott et al. 2003) reveals that Aeromonas lack reliable biochemical markers. Secondly, the discriminatory value of some tests ranging from 16 to 75% is not optimal. Thirdly, the true phenotypic profiles of the minor or less frequently isolated species remains unknown. This situation may eventually be resolved, at least for the major species, by determining the phenotypic characteristics of genotypically identified strains. For example, production of elastase was observed only in strains of A. hydrophila (100%), A. salmonicida (100%) and A. dhakensis (93%). Similarly, DL lactate was utilized by A. hydrophila (76%), A. dhakensis (78%) and A. caviae (72%) while stapholysin production was observed mainly in A. hydrophila (89%), A. salmonicida (50%) and A. dhakensis (82%). Also among the major species, acid from L-arabinose was produced by all A. hydrophila, A. caviae and A. salmonicida but not by A. dhakensis (0%) strains. Similarly, acid production from cellobiose was observed in the majority of A. caviae (81%) and all A. salmonicida (100%) but not in A. dhakensis (0%) and rarely in A. hydrophila (4%) strains. These results suggest that these phenotypic characteristics may be considered validated in genetically identified aeromonads.

-177-

The interspecies dissimilarity values obtained between A. encheleia and Aeromonas sp. HG11, confirms the close relationship that exists between these species (Table 4.5 CD- ROM). The sequence divergence of specific isolates ranged from 0.4% for strains 223, 232 and 240 to 3.5% for strain 213. This result is consistent with the positions of these isolates as shown in Fig. 4.1 suggesting also that the taxonomic position of strain 213 requires further investigation. Similarly, the position of isolate 266 indicates that this strain forms a separate line of descent from other species in the genus with A. allosaccharophila DSM 11576T and A. fluvialis CECT 7401T as its closest relatives and requires further investigation (Fig. 4.4).

In this chapter, WA clinical and environmental Aeromonas isolates previously classified by a phenotypic scheme were re-identified by determining the sequences of the gyrB and rpoD housesekeeping genes. Thus, results in this chapter revealed that accurate identification of these bacteria is compromised when only a phenotypic method is used. Hence, distribution of the species is also compromised and in the case of A. dhakensis (formerly A. aquariorum) the study shows that this species is globally distributed and can be misidentified as A. hydrophila consistent with previous observations (Figueras et al. 2009).

-178-

CHAPTER 5: ANTIMICROBIAL SUSCEPTIBILITIES

5.1. INTRODUCTION

Antimicrobial resistance in these organisms is usually chromosomally mediated, but - lactamases produced by aeromonads may occasionally be encoded by plasmids (Fosse et al. 2004; Sánchez-Céspedes et al. 2008) or integrons (Barlow and Gobius 2009). These enzymes have activity against most -lactam antimicrobial agents, including cefepime and other extended-spectrum cephalosporins. Antimicrobial susceptibility reporting for Aeromonas generally followed guidelines for the Enterobacteriaceae until the Clinical and Laboratory Standards Institute (CLSI) recently published recommendations (CLSI 2011).

The objective of this chapter was to determine the antimicrobial susceptibility profiles of a collection of Aeromonas strains against 26 antimicrobial agents by the agar dilution breakpoint and E-strip methods. The strains were previously characterized by extensive phenotypic and genotypic methods and were isolated from clinical, fish, and environmental sources.

5.2. Bacterial strains

Bacterial strains used in this project are listed in Tables 2.6 and 2.7. A total of 193 strains were examined, of these 144 were isolated from clinical specimens including 54 from wound, 33 from blood, 34 from stools and 23 from miscellaneous sources (Table 2.6). Environmental isolates included a total of 49 strains comprising 43 from water, five from fish and one from crab meat (Table 2.7). All strains were previously characterized by extensive biochemical testing (Aravena-Román et al. 2011a) and their identities confirmed genotypically from their gyrB and rpoD gene sequences (Aravena- Román et al. 2011b). Ten Aeromonas spp. were represented including A. dhakensis (58 strains); A. veronii bv. sobria (49 strains); A. hydrophila (39 strains); A. caviae (36 strains); A. jandaei (three strains); A. media (three strains); A. salmonicida (two strains), and one strain each of A. allosaccharophila, A. bestiarum and A. schubertii.

5.3. Antimicrobial agents

-179-

Antimicrobial agents tested included amikacin, amoxicillin, amoxicillin-clavulanate, cephalothin, cefazolin, cefepime, cefoxitin, ceftadizime, ceftriaxone, ciprofloxacin, gentamicin, meropenem, moxifloxacin, nalidixic acid, nitrofurantoin, norfloxacin, pipercillin-tazobactam, tetracycline, ticarcillin-clavulanate, tobramycin, trimethoprim, and trimethoprim-sulfamethoxazole. E-strips containing doxycycline (AB Biodisk, Solna, Sweden), ampicillin, tigecycline, meropenem and colistin (BioMérieux, Marcyl’Etoile, France) were used to determine MICs.

Interpretative criteria for tigecycline, meropenem and ampicillin were derived from those described for the Enterobacteriaceae by the Food and Drug Administration (BioMérieux 2010), and those for doxycycline were derived from guidelines described by the CLSI (2011), as outlined in Table 1 of the E-strip package insert. Interpretative criteria for colistin were from Fosse et al. (2003b) (Table 2.9). Interpretative criteria for the reminding antimicrobials were in accordance with the CLSI (CLSI 2006).

5.4. RESULTS

All isolates were inhibited by amikacin, cefepime (8 g/ml), ciprofloxacin, meropenem, norfloxacin, and tigecycline. Three (1.6%) strains were inhibited by amoxicillin as shown by the agar dilution and confirmed by the E-strip method. The MIC values were 8 g/ml for all three isolates which included one clinical and one environmental A. veronii bv. sobria and one environmental A. dhakensis isolate (Table 5.1). Thirty-two isolates (16.5%) failed to grow in the presence of amoxicillin-clavulanate, while 17 (8.8%) were non-susceptible to ticarcillin-clavulanate (16/2 g/ml). Of these, eight (4.4%) were also non-susceptible to the higher concentration of ticarcillin-clavulanate (64/2 g/ml).

Susceptibility to cephalothin and cefazolin was observed in 53 (27.4%) and 40 (20.7%) isolates, respectively. A moderate level of susceptibility was detected with cefoxitin (126 isolates, 65.2%) and colistin (86 isolates, 44.5%). The majority of the isolates were susceptible to the remaining antimicrobial agents. The MICs for doxycycline ranged from 0.064 to 24.0 g/ml, those for tigecycline ranged from 0.064 to 3.0 g/ml, and those for colistin ranged from 0.094 to >256 g/ml. Susceptibility to doxycycline and tigecycline was high in clinical strains, at 97.2 and 100%, respectively.

-180-

There was no statistically significant difference in antimicrobial susceptibility between clinical and environmental isolates of A. dhakensis. In contrast, clinical isolates of A. veronii bv. sobria were less susceptible than environmental strains (p = 0.0226). Other statistically significant differences were observed for amoxicillin-clavulanate between A. dhakensis and A. hydrophila (p = 0.0036) (A. dhakensis was less susceptible than A. hydrophila) and between A. dhakensis and A. veronii bv. sobria (p = 0.0053) (A. veronii bv. sobria was less susceptible than A. dhakensis) but not between A. dhakensis and A. caviae. Further, susceptibility to cephalothin was significantly higher in A. veronii bv. sobria than in A. dhakensis, A. caviae, and A. hydrophila (p = 0.0001) (Table 5.1).

Nine clinical isolates (6.2%) were able to grow in agar plates containing 4 g/ml of tobramycin, including seven (14.2%) A. veronii bv. sobria, one (2.7%) A. caviae, and one (33.3%) A. media isolate. Multidrug non-susceptible patterns were observed in three (1.5%) isolates. Of these, A. caviae strain 138 was less susceptible to most - lactams, including aztreonam. A. veronii bv. sobria strain 189 was the only isolate to grow in the presence of both gentamicin and tobramycin. Among the minor species, the single A. allosaccharophila strain exhibited a multidrug resistance profile including resistance to both fluoroquinolones and trimethoprim/sulfamethoxazole (Table 5.1).

Susceptibility to colistin was recorded in 57 (39.05%) clinical and 29 (59.1%) environmental isolates. Aeromonas caviae was the most susceptible species (83.7%), next to A. dhakensis (31.0%). Most environmental isolates were susceptible to tetracycline (81.6%) and nalidixic acid (93.8%). Moderate susceptibility was observed with amoxicillin-clavulanate (46.9%), cephalothin (46.9%), and cefoxitin (63.2%), while only five (10.2%) isolates were susceptible to cefazolin (Table 5.2).

5.5. DISCUSSION

In general, growth of Aeromonas was inhibited by most antimicrobial agents, with few isolates showing a multidrug non-susceptible profile. Susceptibility to tetracycline was high (94.3%), consistent with previous reports from Australia and the United States (Koehler and Ashdown 1993). In contrast, tetracycline resistance in up to 49% of isolates has been reported in studies from the Asian region (Chang and Bolton 1987; Ko et al. 1996).

-181-

Table 5.1 Antimicrobial susceptibilities determined for different Aeromonas spp. (percentage/number of strains susceptible)

g/ml) (n = 3) (n = 3) (n = 2) (n = 1) (n = 1) (n = 1)  (

Antimicrobial agent (n = 36) (n = 58) (n = 38) (n = 49) A. media A. caviae A. caviae monicida l bv. sobria A. jandaei A. dhakensis A. bestiarum A. schubertii A. hydrophila Breakpoint(s) Breakpoint(s) A. sa allosaccharophila A. veronii A.

Amoxicillin 8 0 1.7 (1) 0 4.0 (2) 0 0 0 R R R Amoxicillin-clavulanate 8/4 13.9 (5) 24.1 (14) 2.6 (1) 16.3 (8) 66.7 (2) 0 0 R S S Norfloxacin 4 100 100 100 100 100 100 100 R S S Ciprofloxacin 1 100 100 100 100 100 100 100 R S S Nitrofurantoin 32 97.2 (35) 100 100 100 100 100 100 S S S Trimethoprim 8 86.1 (31) 96.5 (56) 94.7 (36) 97.9 (1) 100 100 100 R S S Cephalothin 8 8.3 (3) 22.4 (13) 5.2 (2) 77.5 (38) 0 0 0 R R S Meropenem 0.25 97.2 (35) 100 97.3 (37) 95.9 (47) 100 100 100 R S S 1 97.2 (35) 100 97.3 (37) 100 100 100 100 S S S 4 100 100 97.3 (37) 100 100 100 100 S S S Gentamicin 4 100 100 100 97.9 (48) 100 100 100 S S S Tobramycin 4 94.4 (34) 100 100 87.7 (43) 100 66.7 (2) 100 S S S Amikacin 16 100 100 100 100 100 100 100 S S S Ceftriaxone 1 97.2 (35) 96.5 (56) 94.7 (36) 100 100 100 100 S S S Ceftazidime 0.5 94.4 (34) 98.2 (57) 94.7 (36) 100 100 66.7 (2) 100 R S S 4 97.2 (35) 100 100 100 100 100 100 S S S Aztreonam 4 100 100 100 100 100 100 100 S S S

-182-

Table 5.1 Continued.

g/ml) (n = 3) (n = 3) (n = 2) (n = 1) (n = 1) (n = 1)  ( (n = 36) (n = 58) (n = 38) (n = 49)

Antimicrobial agent A. media A. caviae A. caviae bv. sobria A. jandaei samonicida A. dhakensis A. bestiarum A. schubertii

A. hydrophila Breakpoint(s) A. A. veronii A. allosaccharophila

Ticarcillin-clavulanate 16/2 94.4 (34) 96.5 (56) 86.8 (33) 87.7 (43) 100 33.3 (1) 100 R S S 64/2 100 98.2 (57) 97.3 (37) 93.8 (46) 100 66.7 (2) 100 S S S Trimeth/sulfamethoxazole 2/38 94.4 (34) 100 100 100 100 100 100 R S S Cefepime 0.5 97.2 (35) 98.2 (57) 100 100 100 100 100 S S S 8 100 100 100 100 100 100 100 S S S Nalidixic acid 16 97.2 (35) 94.2 (55) 100 95.9 (47) 100 100 100 R S S Cefoxitin 8 69.4 (25) 20.6 (12) 86.8 (33) 97.9 (48) 100 66.7 (2) 100 R R S Pipercillin-tazobactam 16/4 97.2 (35) 98.2 (57) 97.3 (37) 95.9 (47) 100 100 100 S S S 64/4 97.2 (35) 100 100 95.9 (47) 100 100 100 S S S Moxifloxacin 1 97.2 (35) 98.2 (57) 100 100 100 100 100 S S S Tetracycline 4 91.6 (33) 93.1 (54) 97.3 (37) 97.9 (48) 100 100 100 R S S Cefazolin 2 0* 0 3.2 (1)** 5.5 (2)^ 0 0# 0 R NT R Doxycycline S, 4; I, 8; R,16 86.1 (31) 93.1 (54) 94.7 (36) 97.9 (48) 100 100 100 S S S Tigecycline S, 2; I, 4; R,8 100 100 100 100 100 100 100 S S S Colistin S, <2 91.6 (33) 24.1 (14) 28.9 (11) 87.7 (43) 0 100 100 S R S *15 strains tested; **31 strains tested; ^36 strains tested; #only one strain tested; NT, not tested; R, resistant; S, susceptible; I, intermediate

-183-

Table 5.2 Antimicrobial susceptibilities of Aeromonas spp. by source of isolation

MIC Percentage (no. of strains susceptible)

Antimicrobial agent Breakpoint(s) All isolates Clinical Environmental (g/ml) (n = 193) (n = 144) (n = 49)

Amoxicillin 8 1.6 (3) 0.7 (1) 4.0 (2) Amoxicillin-clavulanate 8/4 16.5 (32) 6.25 (9) 46.9 (23) Norfloxacin 4 100 100 100 Ciprofloxacin 1 100 100 100 Nitrofurantoin 32 99.5 (192) 99.3 (143) 100 Trimethoprim 8 92.7 (179) 91.0 (131) 97.9 (48) Cephalothin 8 27.4 (53) 20.8 (30) 46.9 (23) Meropenem 0.25 100 100 100 1 100 100 100 4 100 100 100 Gentamicin 4 99.5 (192) 99.3 (143) 100 Tobramycin 4 95.3 (184) 93.8 (135) 100 Amikacin 16 100 100 100 Ceftriaxone 1 96.9 (187) 95.8 (138) 100 Ceftazidime 0.5 97.4 (188) 96.5 (139) 100 4 99.5 (192) 99.3 (143) 100 Aztreonam 4 99.5 (192) 99.3 (143) 100 Ticarcillin-clavulanate 16/2 91.2 (176) 88.9 (128) 97.9 (48) 64/2 95.9 (185) 95.1 (137) 97.9 (48) Trimethoprim- 2/38 98.9 (191) 98.6 (142) 100 sulfamethoxazole Cefepime 0.5 98.9 (191) 98.6 (142) 100 8 100 100 100 Nalidixic acid 16 96.9 (187) 97.9 (141) 93.8 (46) Cefoxitin 8 65.2 (126) 65.9 (95) 63.2 (31) Pipercillin-tazobactam 16/4 97.4 (188) 96.5 (139) 100 64/4 98.9 (191) 98.6 (142) 100 Moxifloxacin 1 98.9 (191) 99.3 (143) 97.9 (48) Tetracycline 4 94.3 (182) 95.1 (137) 81.6 (40) Cefazolin 2 20.7 (40) 8.2 (9)a 10.2 (5) Doxycycline S, 4; I, 8; R,16 97.9 (189) 97.2 (140) 100 Tigecycline S, 2; I, 4; R,8 100 100 100 Colistin S, <2 44.5 (86) 39.5 (57) 59.1 (29) a109 strains tested; MIC, minimum inhibitory concentration; S, susceptible; R, resistant; I, intermediate

-184-

The three amoxicillin-susceptible isolates described here confirm that amoxicillin- susceptible strains other than A. trota (Carnahan et al. 1991a) occur, as previously reported (Abbott et al. 2003; Huddlestone et al. 2007), and that their growth may be suppressed by amoxicillin-containing media. Susceptibility to cepalothin was high in A. veronii bv. sobria, a feature that has been reported by others and used as a phenotypic marker to differentiate this species from other aeromonads (Koehler and Ashdown 1993). Similarly, susceptibility to colistin was proposed as an identifying marker for Aeromonas (Fosse et al. 2003b). Results for colistin were consistent with those obtained by Fosse et al. (2003b) for A. hydrophila (61.7% resistance in this research, versus 85.8%) and A. jandaei (100% resistance in both studies). However, MIC results presented here differed from the previous study for A. veronii bv. sobria (61.7% versus 2.5%) and for A. caviae (16.2% versus 2.1%).

The number of isolates susceptible to pipercillin-tazobactam (97.4 and 98.9%) and ticarcillin-clavulanate (91.2 and 95.9%) were much higher than those susceptible to amoxicillin-clavulanate (16.5%), suggesting that the former two antimicrobials could be considered for the treatment of infections caused by Aeromonas. Zemelman et al. (1984) reported that, depending on the strain, the MIC to amoxicillin decreased from two to eight fold in combination with clavulanate, thus increasing the activity of this agent. However, prolonged use of amoxicillin-clavulanate to treat infections caused by A. veronii bv. sobria has resulted in overexpression of carbapenemases and cephalosporinases (Sánchez-Céspedes et al. 2009).

All isolates were susceptible to meropenem. A single A. hydrophila isolate that grew in all three agar dilution concentrations was susceptible by the E-strip method using two different inocula, 1.5 x 108 CFU/ml and 3.0 x 108 CFU/ml. A large inoculum (3.0 x 108 CFU/ml) has been recommended to detect carbapenemase production before antibiotic therapy using carbapenems is considered as conventional in vitro susceptibility testing may fail to detect the presence of carbapenemases in otherwise carbapenemase- susceptible phenotypes (Rossolini et al. 1996).

Differences in antimicrobial susceptibility between clinical and environmental strains have been previously described. The resistance observed in environmental aeromonads has been associated with heavily polluted waters as the source of multiple resistance plasmids (Huddlestone et al. 2006). In contrast, data from this study suggest that (i) environmental strains are not the principal source of resistance but that antibiotic

-185- resistance in clinical isolates may be due to the selective pressure to which these organisms may have been exposed, (ii) water sources are less polluted in Western Australia than other regions, and (iii) environmental strains may have acquired resistance determinants from clinical strains.

Empirical treatment in some cases does not include cover for Aeromonas species particularly in infections where the antimicrobials employed are directed toward microorganims such as staphylococci and streptococci. Inappropriate antimicrobial therapy has been administered in 20% of infections involving aeromonads (Scott et al. 1978; Vila et al. 2002; Bravo et al. 2003; Figueras 2005) with the potential to increase morbidity and mortality of affected individuals.

No visible resistance patterns were detected among the major species with the exception of a few tobramycin-resistant A. caviae and A. veronii bv. sobria strains while most isolates were highly susceptible to the fluoroquinolones, aminoglycosides, trimethoprim/sulfamethoxazole, meropenem and third and fourth generation cephalosporins.

In this chapter, the antimicrobial susceptibility patterns of 193 WA clinical and environmental Aeromonas isolates were tested against 26 antimicrobial agents. Results showed that the number of multidrug non-susceptible Aeromonas species in WA remains low thus, providing clinicians with a wide choice of antimicrobial agents to treat infections with these bacteria, consistent with other reports (Ko et al. 1996; Zhiyong et al. 2002). However, antimicrobial susceptibility testing for clinically significant strains is highly recommended, as resistance to antibacterial agents may be strain dependent.

-186-

CHAPTER 6: DESCRIPTION OF AEROMONAS AUSTRALIENSIS SP. NOV.

6.1. INTRODUCTION

Currently, the genus Aeromonas consists of 27 validated species, seven subspecies and two biovars. However, some represent synonyms of other species as is the case for A. trota (Carnahan et al. 1991a), junior synonym of A. enteropelogenes while A. ichthiosmia (Schubert et al. 1990a) is a junior synonym of A. veronii (Huys et al. 2001). The position of Aeromonas group HG11 is still uncertain while A. aquariorum and A. hydrophila ssp. dhakensis have been combined to form A. dhakensis comb. nov. sp. nov (Beaz-Hidalgo et al. 2013). Further, A. hydrophila ssp. anaerogenes has been reclassified as A. caviae (Miñana-Galbis et al. 2013) while the validity of A. culicicola (Pidiyar et al. 2002) and the recognition of A. punctata (Schubert 1967ab) as a senior synonym of A. caviae have been a source of controversy among microbiologists.

In recent years, the use of 16S rRNA gene sequence to differentiate between Aeromonas species has been superseded by the use of single-copy genes (Yañez et al. 2003; Soler et al. 2004; Küpfer et al. 2006; Nhung et al. 2007; Sepe et al. 2008; Miñana-Galbis et al. 2009). Sequences derived from rpoD and gyrB were used for the first time in the definition of the species A. tecta and A. dhakensis (previously A. aquariorum) by Demarta et al. 2008 and Martínez-Murcia et al. 2008, respectively, while four housekeeping genes were used in the description of A. piscicola and A. diversa (Beaz- Hidalgo et al. 2009; Miñana-Galbis et al. 2010).

During the course of this study, a Gram-negative, facultatively anaerobic bacillus, designated strain 266T was isolated from an irrigation water sample collected in the South-West of Western Australia. Initial phenotypic and genotypic testing suggested that strain 266 may represent a novel Aeromonas spp. The purpose of this chapter was to use a polyphasic approach to investigate the true taxonomic position of strain 266T.

6.2. Bacterial strains

Bacterial strains used here are listed in Table 2.4. GenBank accession numbers deposited for strain 266T are listed in Table 4.2.

-187-

6.3. RESULTS

6.3.1. Phenotypic characteristics

Strain 266T consisted of motile rods with the presence of a polar flagellum. Cells stained Gram-negative, showing straight, non-spore forming and non-encapsulated rods, 0.6-0.9 m wide and 1.8-2.7 m long (Fig. 6.1), oxidase and catalase positive, reduced nitrate to nitrite and were susceptible to O/129 (150 g). Colonies on TSA plus sheep blood were 1.5 to 2.0 mm in diameter, glossy, circular and beige in colour after 24 h at 35C.

No brown diffusible pigment was produced on TSA at 35C. Growth occurred at 25, 30 and 35C, but not at 4 or 44C after 24 h on TSA plus sheep blood. -haemolysis was observed on sheep (5%) blood agar. Strain 266T grew on MacConkey and TCBS agars and on nutrient broth in 0 and 3% NaCl but not in 6% NaCl broth. Indole was produced from tryptophan. The ONPG reaction was positive when tested by disk (Rosco, Taastrup, Denmark) but not with the API 20E strip (BioMérieux).

Strain 266T did not utilize citrate (Simmon’s and Hänninen’s methods), malonate or produced gas from glucose but a positive citrate reaction was observed with the API 20E strip. DL-lactate was utilized at 30 but not at 35C. Hydrogen sulphide, urease and elastase were not produced and aesculin was not hydrolysed. Clearing of tyrosine- containing medium was not observed but starch was hydrolysed after five days incubation. DNase and lipase activity were detected and potassium gluconate was oxidised. Strain 266T utilized acetate, and arginine was dehydrolased, lysine was decarboxylated but not ornithine. A positive reaction was observed for VP, gelatin and urocanic acid. No activity was detected for stapholysin, phenylalanine deaminase, alkylsulfatase, pyrazynamidase and Jordan’s tartrate was negative.

Acid was produced from the following carbohydrates: fructose, galactose, glucose, glycerol, glucose-1-phosphate, glucose-6-phosphate, maltose, mannose, N-acetyl- glucosamine, ribose, saccharose and trehalose but not from adonitol, amygdalin, L- arabinose, cellobiose, dulcitol, myo-inositol, lactose, lactulose, D-mannitol, melibiose, -methyl-D-glucoside, raffinose, L-rhamnose, salicin and D-sorbitol. Acid production was observed for the following carbohydrates with the API 50C strip (BioMérieux): glycerol, D-ribose, D-galactose, D-glucose, D-fructose, D-mannose, N-acetyl- glucosamine, D-maltose, D-saccharose, D-trehalose, starch, glycogen and potassium

-188- gluconate was oxidized. Key biochemical characteristics used to differentiate strain 266T from all other Aeromonas spp.are presented in Table 6.1. Phenotypically, Strain 266T can be differentiated from other D-mannitol negative species by several biochemical and physiological tests (Table 6.2).

6.3.2. FAME profile

T The CFA composition of strain 266 contained 28.7% sum in Feature 3 (C16:1 w7c or C16:1 w6c), 11.4% sum in Feature 8 (C18:1 w7c or C18:1 w6c), 11.3% C16:0, 7.2% C16:1 w7c alcohol,

6.0% C12:0, 5.6% sum in Feature 2 (C12:0 aldehyde? or C16:1 iso I or C14:0 3OH), 3.7% sum in

Feature 9 (C16:0 10 methyl or C17:1 iso w9c), 3.5% iso-C15:0, 3.3% C17:1 w8c, 3.2% iso-C17:0,

2.5% C14:0 and 1.7% C16:0 N alcohol (Table 6.3).

6.3.3. Protein profile

The mass spectra of strain 266T ranged from 2000 to 11300 Da and differed from the closes related species A. allosaccharophila, A. fluvialis and A. veronii (Fig. 6.2).

6.3.4. Genotypic characteristics

Analysis of the 16S rRNA gene (1503 bp) confirmed that strain 266T belonged to the genus Aeromonas and showed the highest 16S rRNA gene sequence similarity with the type strains of A. fluvialis (99.6%) followed by A. allosaccharophila and A. veronii both with a similarity of 99.5%, these also being the closest neighbours in the phylogenetic tree (Fig. 6.3). Strain 266T showed the minimum interspecies similarity with A. veronii (3.2%), which was higher than those obtained between A. piscicola and A. bestiarum (approximately 2.1%) or A. allosacchorophila and A. veronii (approximately 2.9%) as reported by Martínez-Murcia et al. (2011) and shown in Table 6.4 in the CD ROM attached. The DDH results between strain 266T and the type strains of A. allosacccharophila, A. veronii and A. fluvialis were 65.3, 63.7 and 52.2%, respectively, all below the 70% limit for species delineation (Wayne et al. 1987; Stackebrandt and Goebel 1994) (Table 6.5). Analysis of gyrB and rpoD genes suggested that strain 266T formed a phylogenetic line independent of other species in the genus. The sequences of six housekeeping genes (gyrB, rpoD, recA, danJ, gyrA, and dnaX) were aligned with those of strain 266 culminating with a concatenated tree (MLPA) derived from all six

-189- genes confiming that genetically, strain 266 formed a separate line of descent and that A. veronii and A. allosaccharophila were the nearest relatives (Figs 6.4 to 6.10).

6.3.5. Antimicrobial susceptibilities

Strain 266T was resistant to amoxicillin and cefazolin and was susceptible to amikacin, amoxicillin-clavulanate, aztreonam, cephalothin, cefepime, cefoxitin, ceftazidime, ceftriaxone, ciprofloxacin, colistin, gentamicin, meropenem, moxifloxacin, nalidixic acid, nitrofurantoin, norfloxacin, pipercillin-tazobactam, tetracycline, ticarcillin- clavulanate, tobramycin, trimethoprim and trimethoprim-sulfamethoxazole.

-190-

A

B

Figure 6.1 Electron microscopy images of strain 266T. A. Scanning electron microscope (Bar 4 μm). B. Transmission electron microscope, negative stain (Bar 500 nm).

-191-

Table 6.1 Key tests for the phenotypic identification of strain 266T from other Aeromonas spp.

§ ‡

T Φ

Characteristics dhakensis

Strain 266 A. allosaccharophila A. A. bestiarum A. bivalvium A. caviae A. diversa A. encheleia -haemolysis + V() n(+) +(+)  () V() +(+) V(+) Vogues Proskauer reaction +  () +(+) V(+)  ()  () V(+)  () LDC + +(+) +(+) V(+) +(+)  ()  ()  () Glucose (gas)  +(+) +(+) V(+)  ()  ()  () V(+) Aesculin hydrolysis  V(+) +(+) V(+) +(+) V(+)  () V(+) Acid from: L-arabinose  V(+)  () +(+) +(+) +(+)  ()  () Salicin   () +(+) V(+) +(+) V(+)  ()  (+) D-mannitol  +(+) +(+) +(+) +(+) +(+)  () +(+) Utilization of: Citrate  V() nd(+)  () +(+) +(+) nd()  () DL-lactate ++  ()  ()  () +(+) +() nd()  ()

-192-

Table 6.1 Continued.

†

# T

Characteristics Strain 266 A. eucrenophila A. fluvialis A. hydrophila A. jandaei A. media A. molluscorum -haemolysis + +(+)  () +(+) +(+) V() V() Vogues Proskauer reaction +  ()  () +(+) +(+)  ()  () LDC +  ()  () +(+) +(+)  ()  () Glucose (gas)  V(+) +(+) +(+) +(+)  ()  () Aesculin hydrolysis  V(+)  () +(+)  () V(+) +(+) Acid from: L-arabinose  V(+)  () V(+)  () +(+) +(+) Salicin  V() +(+) V()  () V(+) nd(+) D-mannitol  +(+) n(+) +(+) +(+) +(+) +(+) Utilization of: Citrate   () +(+) +(+) +(+) V(+) +(+) DL-lactate ++  () nd() V()  () V(+) V()

-193-

Table 6.1 Continued.

¥

¦ T

* Ø

Characteristics Strain 266 A. popoffii A. piscicola A. rivuli A. salmonicida A. sanarellii A. schubertii A. simiae -haemolysis +  () +(+) +(+) V(+)  () V(+)  () Vogues Proskauer reaction + +(+) +(+) V(+) V()  () V(+)  () LDC +  () +(+)  () V(+)  () V(+) +(+) Glucose (gas)  +(+) +(+)  () V()  ()  ()  () Aesculin hydrolysis   () +(+)  () +(+) +(+)  () V() Acid from: L-arabinose  V(+)  ()  () +(+) +(+)  ()  () Salicin   () +(+)  () V() +(+)  ()  () D-mannitol  +(+) +(+)  () +(+) +(+)  ()  () Utilization of: Citrate  +(+) nd nd() +()  () V(+) nd() DL-lactate ++ V(+)  () nd()  () nd(+) V(++) nd(++)

-194-

Table 6.1 Continued.

¥

T bv. bv.

¶

Characteristics Strain 266 A. sobria A. taiwanensis A. tecta A. trota A. veronii sobria A. veronii veronii -haemolysis + V(+)  () +(+) V(+) +(+) +(+) Vogues Proskauer reaction + +()  () V(+)  () +(+) V() LDC + +(+)  () V(+) +(+)  () +(+) Glucose (gas)  +()  () +(+) V(+) +(+) +(+) Aesculin hydrolysis  V() +(+) V(+)  ()  () +(+) Acid from: L-arabinose  V() +(+)  ()  ()  (+)  () Salicin  V() +(+) V()  ()  () +(+) D-mannitol  +(+) +(+) +(+) +(+) +(+) +(+) Utilization of: Citrate  +(+) +(+)  (+) +(+) V() +(+) DL-lactate ++  () nd(+)  () +(+)  (+)  (+)

-195-

Abbreviations: +, 85-100% of strains positive; , 0 to 15% of strains positive; V, 16-84% of strains positive. All tests have been performed for type strains of the different species and results are expressed as in brackets as (+) or (); nd, no data available. Tests for strain 266T were performed at 30 and 35ºC. Data from species 1-15 were obtained from Abbott et al. (2003) with the exception of tests indicated as nd, these authors performed tests at 35ºC with the exception of A. popoffii and A. sobria which were tested at 25ºC. Other tests were performed as follows: *Harf-Monteil et al. (2004) (30ºC); †Miñana-Galbis et al. (2004a) (25ºC); ‡Miñana-Galbis et al. (2007) (30ºC); §Martínez Murcia et al. (2008) ( 25ºC); ¶Demarta et al. (2008) (30ºC); #Alperi et al. (2010a) (30ºC); ¦Beaz-Hidalgo et al. (2009) (25ºC); ¥Alperi et al. (2010b) ( 30ºC); ØFigueras et al. (2011a) (30ºC); ΦMiñana-Galbis et al. (2010) (30ºC). +Positive at 30C but not at 35C.

-196-

Table 6.2 Key tests used to differentiate strain 266T from other D-mannitol non-fermentative Aeromonas spp. Test Strain 266T A. schubertii A. simiae A. diversa

-haemolysis + +  +

Indole +   +

VP + +  +

LDC + + + 

Glucose (gas)     Hydrolysis of: Aesculin   +  Starch* + + + + Acid from:

D-saccharose +  + 

L-arabinose     salicin     Utilization of: citrate  +  

DL-lactate * + + +  *Starch hydrolysis and utilization of DL-lactate tube were incubated at 30C. All other tests were performed at 35C

-197-

T Table 6.3 Cellular fatty acid profiles of strain 266 and current Aeromonas spp. Cellular fatty acid (%) Species 12:0 13:0 i 13:0 14:0 SF1 15:0 i 16:1 w7c SF2 16:0 N alcohol alcohol Strain 266T 8.88 1.28 t 3.01 t 3.38 5.80 9.44 1.03 A. allosaccharophila DSM 11576T 5.77 t t 2.72 t 1.53 5.18 8.14 1.21 A. dhakensis CECT 7289T 5.72 t t 6.30 1.09 1.53 3.91 12.35 1.04 A. bestiarum ATCC 51108T 6.62 t t 4.11 t 1.25 6.52 9.05 1.11 A. bivalvium CECT 7113T 7.41 1.20 t 2.79 ND 1.88 ND 10.90 ND A. caviae ATCC 13136T 7.48 t t 4.18 ND 1.59 4.99 9.81 1.31 A. culicicola CECT 5761T 6.56 1.67 t 3.94 ND 2.84 6.18 8.30 t A. diversa CECT 4254T 7.07 1.21 t 4.71 t 1.34 5.81 9.14 2.42 A. encheleia DSM 11577T 6.81 t ND 3.08 ND 2.34 ND 9.67 ND A. eucrenophila ATCC 23309T 7.61 2.11 t 3.05 ND 6.38 ND 8.54 ND A. fluvialis CECT 7401T 7.37 2.66 t 3.21 ND 3.06 2.56 9.29 1.94 A. hydrophila ATCC 7966T 6.67 t t 5.60 ND 1.58 5.02 9.74 1.67 A. jandaei ATCC 49658T 4.90 t 1.09 5.63 t 2.64 4.52 5.69 2.65 A. media ATCC 33907T 6.84 1.09 ND 2.34 ND 1.94 ND 7.87 ND A. molluscorum DSM 17090T 6.50 t t 3.39 t 1.27 t 12.21 t

- 198 -

Table 6.3 Continued. Cellular fatty acid (%) Species 12:0 13:0 i 13:0 14:0 SF1 15:0 i 16:1 w7c SF2 16:0 N alcohol alcohol Strain 266T 8.88 1.28 t 3.01 t 3.38 5.80 9.44 1.03 A. piscicola CECT 7443T 7.34 1.04 t 3.17 ND 2.98 4.10 9.03 t A. popoffii CIP 105493T 7.46 1.18 t 3.51 ND 1.99 6.28 10.46 1.62 A. rivuli CECT 7518T 8.55 t t 3.36 ND 1.84 t 13.34 ND A. salmonicida CECT 894T 11.64 ND 1.14 1.70 2.51 ND t 19.80 t A. sanarellii CECT 7402T 8.33 2.09 t 2.62 ND 2.95 ND 10.14 ND A. schubertii ATCC 43700T 8.33 2.10 1.90 4.26 1.43 2.63 1.43 9.76 3.02 A. simiae DSM 16559T 4.98 t t 4.33 ND 2.89 ND 10.08 ND A. sobria CIP 7433T 5.66 1.10 3.60 4.44 3.16 2.49 2.45 8.23 2.16 A. taiwanensis CECT 7403T 10.39 1.57 t 3.44 ND 2.80 ND 12.06 ND A. tecta CECT 7082T 8.60 1.13 t 3.23 ND 3.29 ND 16.68 ND A. trota ATCC 49657T 5.52 1.55 t 3.91 ND 3.40 1.44 7.43 1.00 A. veronii bv. sobria ATCC 9071T 6.57 2.09 t 3.80 t 3.85 5.54 8.35 1.11 A. veronii bv. veronii DSM 7386T 5.16 t t 3,32 t 1.52 6.00 7.69 1.02

-- 199 --

Table 6.3 Continued. Cellular fatty acid (%) Species 16:0 i SF3 16:0 15:0 i SF9 17:0 i 17:1 17:0 SF8 3OH 8wc Strain 266T t 32.37 7.55 4.82 3.55 1.68 1.98 t 7.70 A. allosaccharophila DSM 11576T t 38.11 17.34 2.34 2.35 1.91 t t 8.25 A. dhakensis CECT 7289T t 32.76 15.33 2.14 1.26 1.05 1.49 t 7.59 A. bestiarum ATCC 51108T t 39.20 14.96 1.33 1.13 t 1.17 t 7.58 A. bivalvium CECT 7113T t 36.80 16.99 3.20 2.57 2.49 1.15 t 8.47 A. caviae ATCC 13136T t 40.67 16.25 1.99 1.72 1.09 t t 8.49 A. culicicola CECT 5761T t 34.02 12.06 3.46 3.06 1.86 1.23 t 8.69 A. diversa CECT 4254T t 34.28 16.64 1.73 1.35 t t t 8.19 A. encheleia DSM 11577T t 43.99 17.28 3.04 2.28 2.17 t t 6.85 A. eucrenophila ATCC 23309T t 37.94 13.51 5.21 5.13 2.83 t t 5.45 A. fluvialis CECT 7401T 1.15 27.30 9.66 6.95 3.67 4.08 1.45 t 10.34 A. hydrophila ATCC 7966T t 36.55 18.28 1.10 1.40 t t t 7.61 A. jandaei ATCC 49658T t 27.29 10.99 1.69 2.75 1.45 2.76 1.36 7.95 A. media ATCC 33907T t 38.42 17.36 2.67 4.55 4.22 t t 10.61 A. molluscorum DSM 17090T t 37.83 13.80 3.43 2.05 2.30 1.27 t 8.40

-- 200 --

Table 6.3 Continued. Cellular fatty acid (%) Species 16:0 i SF3 16:0 15:0 i SF9 17:0 i 17:1 17:0 SF8 3OH 8wc Strain 266T t 32.37 7.55 4.82 3.55 1.68 1.98 t 7.70 A. piscicola CECT 7443T 3.16 36.44 13.94 3.04 3.48 2.84 t t 4.35 A. popoffii CIP 105493T t 40.55 13.68 3.40 2.10 1.75 t t 5.10 A. rivuli CECT 7518T t 39.04 17.14 2.80 1.28 1.84 t t 4.58 A. salmonicida CECT 894T t 31.31 14.51 t t t 2.88 2.14 7.14 A. sanarellii CECT 7402T t 32.93 16.93 4.48 3.33 3.05 t t 9.61 A. schubertii ATCC 43700T t 29.19 10.78 3.38 2.11 1.25 1.86 t 5.72 A. simiae DSM 16559T t 33.50 17.04 2.52 5.16 4.27 t t 12.74 A. sobria CIP 7433T t 31.19 10.75 2.68 2.09 1.78 5.95 2.77 6.02 A. taiwanensis CECT 7403T t 35.50 16.09 3.48 2.17 1.31 t t 8.60 A. tecta CECT 7082T ND 38.80 11.22 7.98 2.29 1.48 t ND 4.01 A. trota ATCC 49657T t 33.92 15.45 3.80 4.83 3.16 1.06 t 9.16 A. veronii bv. sobria ATCC 9071T t 29.90 12.28 4.40 5.97 3.65 1.42 t 6.54 A. veronii bv. veronii DSM 7386T t 34.20 14.29 2.10 2.39 1.53 2.54 1.22 11.29

-- 201 --

Abbreviations. *Sum in Features (SF) contained cellular fatty acids that cannot be separated by this system;

SF1 (C15:1 iso H/13:0 3OH or C13:0 3OH/15:1 iso H);

SF2 (C12:0 aldehyde? or C16:1 iso I or C14:0 3OH);

SF3 (C16:1 w7c or C16:1 w6c);

SF8 (C18:1 w7c or C18:1 w6c);

SF 9 (C16:0 10-methyl or C17:1 iso w9c);

SF7 (C19:1w7c or 19:1 w6c) detected in A. rivuli (2.4%); 14:0 iso 3OH was detected in A. piscicola (1.25%); 15:0 3OH (1.20%) and 17:1 w6c (1.02%) were detected in A. sobria ND, not detected; i, iso; t, trace (values < 1% not shown)

-- 202 --

Figure 6.2 Protein spectrum for strain 266T (Bruker microflex LT MALDI-TOF mass spectrometer, Bruker Daltonik, GmbH, Germany).

-- 203 --

Table 6.5 DNA-DNA hybridization values between strain 266T and closely related Aeromonas species (Results are expressed as the mean of three determinations. Standard deviations are included in parenthesis)

Labelled DNA

Strain 266T A. fluvialis A. veronii A. allosaccharophila CECT 7401T CECT 4257T CECT 4199T

T 100 56.8 (9.2) 47.6 (9.2) 65.0 (0.5) 266 A. fluvialis CECT 7401T 62.6 (3.2) 100   A. veronii CECT 4257T 65.8 (3.2)  100  A. allosaccharophila CECT 4199T 65.5 (0.5)   100

-- 204 -- A

A. salmonicida NCIMB1102T (X60405) 92 70 A. bestiarum CECT 4227T (NR 026089) A. piscicola CECT7 443T (FM999971) A. molluscorum CECT 5864T (AY532691) A. encheleia CECT 4342T (AJ224309) A. tecta CECT 7082T (AJ458403)

T 59 A.eucrenophila ATCC 23309 (X74675) A. bivalvium CECT7113T (DQ504429) 39 T 66 A. popoffii LMG 317541 (AJ224308) A. rivuli DSM 22539T (FJ976900) A. sobria NCIMB 12065T (X60412)

T 98 A. media ATCC 33907 (X74679) A. hydrophila ATCC 7966T (X60404) A. sanarellii CECT 7402T (FJ230076) 43 A. taiwanensis CECT 7403T (A2-50) (FJ230077)

99 T 63 A. aquariorum CECT 7289 (MDC47T) (EU085557) 47 A. hydrophila dhakensis LMG 19562T (AJ508765)

T 58 A. trota ATCC 49657 (X60415)

T 62 A. caviae NCIMB 13016 (X60408) A. allosaccharophila CECT 4199T (S39232) A. fluvialis CECT 7401T (FJ230078) 48 85 266T A. jandaei ATCC 49568T (X60413) A. veronii ATCC 35624T (X60414) A. simiae IBSS6874T (AJ536821) A. diversa CECT 4254T (GQ365710) 94 T 88 A. schubertii ATCC 43700 (X60416)

0.002

Figure 6.3 Unrooted neighbour-joining phylogenetic tree derived from the 16S rRNA gene sequences showing the relationships of strain 266T with all other Aeromonas species. The phylogenetic tree was constructed with 1322 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.002 estimated substitutions per site.

- 205 -

T 45 A. allosaccharophila CECT 4199 (HQ443058) 97 A. veronii CECT 4257 T (HQ443060) 51 266T (HE611954) 70 A. fluvialis 717T (FJ603454) 90 A. jandaei CECT 4228T (HQ443074) 55 A. sobria CECT 4245T (HQ443076) A. hydrophila CECT 839T (HQ443048) T 68 76 A. dhakensis CECT 7289 (HQ443050) 84 A. trota CECT 4255T (HQ443038) A. bivalvium CECT 7113T (HQ443036) A. salmonicida CECT 894T (HQ442979) 64 67 T 93 A. popoffii CECT 5176 (HQ442995) T 85 A. piscicola CECT 7443 (HQ442992) 95 A. bestiarum CECT 4227T (HQ442988) 64 A. molluscorum CECT 5864T (HQ443000) 99 A. rivuli DSM 22539T (FJ969432) A. media CECT 4232T (HQ443012) T 49 A. encheleia CECT 4342 (HQ443025) T 88 A. eucrenophila CECT 4224 (HQ443015) 75 A. tecta CECT 7082T (HQ443020) A. taiwanensis A2-50T (FJ807270) T 56 A. caviae CECT 838 (HQ443008) 77 A. sanarellii A2-67T (FJ807279) A. simiae CIP 107798T (HQ443081) T 100 A. schubertii CECT 4240 (HQ443088) 99 A. diversa CECT 4254T (HQ443084)

0.02

Figure 6.4 Unrooted neighbour-joining phylogenetic tree derived from dnaJ sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 596 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.02 estimated substitutions per site.

-- 206 --

T 53 A. veronii CECT 4257 (HQ442469) 48 A. fluvialis CECT 7401T (HQ442464) 266T (HE611951) T 74 A. allosaccharophila CECT 4199 (HQ442457) 31 A. sobria CECT 4245T (HQ442447) A. jandaei CECT 4228T (HQ442455) A. hydrophila CECT 839T (HQ442472) 61 56 A. dhakensis CECT 7289T (HQ442483) A. trota CECT 4255T (HQ442490) 53 92 A. taiwanensis CECT 7403T (HQ442491) A. salmonicida CECT 894T (HQ442441) A. popoffii CECT 5176T (HQ442437) 73 T 85 A. piscicola CECT 7443 (HQ442434) 54 A. bestiarum CECT 4227T (HQ442429) T 95 A. molluscorum CECT 5864 (HQ442519) 92 A. rivuli DSM 22539T (HQ442524) A. bivalvium CECT 7113T (HQ442527) A. eucrenophila CECT 4224T (HQ442509) A. tecta CECT 7082T (HQ442502) 44 A. encheleia CECT 4342T (HQ442495) A. caviae CECT 838T (HQ442422 A. sanarellii CECT 7402T (HQ442508) 25 A. media CECT 4232T (HQ442507) A. simiae CIP 107798T (HQ442528) A. schubertii CECT 4240T (HQ442533) 99 A. diversa CECT 4254T (HQ442534)

0.01

Figure 6.5 Unrooted neighbour-joining phylogenetic tree derived from dnaX sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 493 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per site.

-- 207 --

T 99 A. veronii CECT 4257 (HQ443160) 66 266T (HE611952) 45 A. jandaei CECT 4228T (HQ443185) A. fluvialis 717T (FJ603456) A. allosaccharophila CECT 4199T (HQ443156) 58 A. sobria CECT 4245T (HQ443148) A. trota CECT 4255T (HQ443187) A. hydrophila CECT 839T (HQ443174) 85 A. dhakensis CECT 7289T (HQ443166) T 86 A. eucrenophila CECT 4224 (HQ443115) A. tecta CECT 7082T (HQ443122) T 98 A. molluscorum CECT 5864 (HQ443110) 35 A. rivuli DSM 22539T (FJ969436) T 99 43 A. salmonicida CECT 894 (HQ443089) A. popoffii CECT 5176T (HQ443108) 97 T 87 A. piscicola CECT 7443 (HQ443100) 99 A. bestiarum CECT 4227T (HQ443097) T 44 A. media CECT 4232 (HQ443134) A. encheleia CECT 4342T (HQ443139) T 42 A. bivalvium CECT 7113 (HQ443141) A. sanarellii A2-67T (FJ807276) 38 T 95 A. taiwanensis A2-50 (FJ807274) 82 A. caviae CECT 838T (HQ443146) A. simiae CIP 107798T (HQ443191) A. diversa CECT 4254T (HQ443194) 99 A. schubertii CECT 4240T (HQ443198)

0.01

Figure 6.6 Unrooted neighbour-joining phylogenetic tree derived from gyrA sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 707 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per site.

-- 208 --

A. piscicola CECT 7443T (HQ442690) 33 A. bestiarum CECT 4227T (HQ442683) 86 A. salmonicida CECT 894T (HQ442680) T 48 A. popoffii CECT 5176 (HQ442693) A. eucrenophila CECT 4224T (HQ442657) T 72 43 A. tecta CECT 7082 (HQ442662) 44 A. encheleia CECT 4342T (HQ442655) A. molluscorum CECT 5864T (HQ442671) 40 A. rivuli DSM 22539T (FJ969434) 38 A. media CECT 4232T (HQ442709) A. bivalvium CECT 7113T (HQ442703) T 85 A. caviae CECT 838 (HQ442748) 31 99 A. sanarellii A2-67T (FJ807277) T 38 A. hydrophila CECT 839 (HQ442746) A. dhakensis CECT 7289T (HQ442712) T 26 A. jandaei CECT 4228 (HQ442736) T 47 61 A. allosaccharophila CECT 4199 (HQ442733) 266T (FN691773) T 59 A. veronii CECT 4257 (HQ442728) T 25 A. sobria CECT 4245 (HQ442698) A. fluvialis 717T (FJ603455) A. trota CECT 4255T (HQ442718) A. taiwanensis A2-50T (FJ807272) A. simiae CIP 107798T (HQ442758) T 92 A. diversa CECT 4254 (HQ442756) 99 A. schubertii CECT 4240T (HQ442755)

0.01

Figure 6.7 Unrooted neighbour-joining phylogenetic tree derived from gyrB sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 545 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per site.

-- 209 --

T 96 A. piscicola CECT 7443 (HQ442954) 57 A. bestiarum CECT 4227T (HQ442949) 56 A. salmonicida CECT 894T (HQ442955) A. popoffii CECT 5176T (HQ442941 80 66 A. sobria CECT 4245T (HQ442940) A. allosaccharophila CECT 4199T (HQ442961) T 55 A. fluvialis 717 (FJ603457) T 42 A. veronii CECT 4257 (HQ442970) 47 266T (HE611953) A. hydrophila CECT 839T (HQ442926) A. trota CECT 4255T (HQ442933) T 36 A. caviae CECT 838 (HQ442921) T 53 A. jandaei CECT 4228 (HQ442915) 71 A. dhakensis CECT 7289T (HQ442908) A. media CECT 4232T (HQ442972) A. tecta CECT 7082T (HQ442895) T 36 A. eucrenophila CECT 4224 (HQ442892) 90 A. encheleia CECT 4342T (HQ442884) A. sanarellii A2-67T (FJ807278) 65 A. taiwanensis A2-50T (FJ807273) T 99 A. molluscorum CECT 5864 (HQ442877) 79 A. rivuli DSM 22539T (FJ969435) A. bivalvium CECT 7113T (HQ442882) A. simiae CIP 107798T (HQ442869) T 93 A. diversa CECT 4254 (HQ442872) 75 A. schubertii CECT 4240T (HQ442876)

0.01

Figure 6.8 Unrooted neighbour-joining phylogenetic tree derived from recA sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 598 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per site.

-- 210 --

T 94 A. allosaccharophila CECT 4199 (HQ442825) 60 A. veronii CECT 4257T (HQ442833) 86 A. fluvialis 717T (FJ603453) 54 266T (FN773335) A. sobria CECT 4245T (HQ442867) 48 T A. trota CECT 4255 (HQ442822) A. jandaei CECT 4228T (HQ442840) T 100 A. hydrophila CECT 839 (HQ442791) A. dhakensis CECT 7289T (HQ442798) A. salmonicida CECT 894T (HQ442843) T 98 A. bestiarum CECT 4227 (HQ442854) T 33 99 A. piscicola CECT 7443 (HQ442859) 45 A. popoffii CECT 5176T (HQ442853) T 92 A. sanarellii A2-67 (FJ807275) 91 A. taiwanensis A2-50T (FJ807271) A. caviae CECT 838T (HQ442790) T 40 35 A. media CECT 4232 (HQ442785) A. encheleia CECT 4342T (HQ442778) 51 A. eucrenophila CECT 4224T (HQ442770) 96 A. tecta CECT 7082T (HQ442762) A. bivalvium CECT 7113T (HQ442817) T 99 A. molluscorum CECT 5864 (HQ442812) 100 A. rivuli DSM 22539T (FJ969433) A. simiae CIP 107798T (HQ442811) T 100 A. diversa CECT 4254 (HQ442805) 100 A. schubertii CECT 4240T (HQ442809)

0.02

Figure 6.9 Unrooted neighbour-joining phylogenetic tree derived from rpoD sequences showing the relationships of strain 266T with the type strains of all other Aeromonas species. The phylogenetic tree was constructed with 667 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.02 estimated substitutions per site.

-- 211 --

T 81 A. veronii CECT 5761 T 89 A. australiensis 266 98 A. allosaccharophila CECT 4199T 99 T A. fluvialis CECT 7401 69 A. sobria CECT 5254T A. jandaei CECT 4228T A. hydrophila CECT 839T 59 100 A. dhakensis CECT 7289T A. trota CECT 4255T A. taiwanensis CECT 7402T T 100 A. caviae CECT 838 71 A. sanarellii CECT 7403T T 95 A. eucrenophila CECT 4224 93 A. tecta CECT 7082T 85 A. encheleia CECT 4342T A. media CECT 4232T T 100 A. molluscorum CECT 5864 99 A. rivuli DSM 22539T A. bivalvium CECT 7113T A. salmonicida CECT 894T A. popoffii CECT 5176T 100 T 100 A. piscicola CECT 7443 99 A. bestiarum CECT 4227T A. simiae CIP 107798T T 100 A. diversa CECT 4254 100 A. schubertii CECT 4240T

0.01

Figure 6.10 Unrooted neighbour-joining phylogenetic tree derived from the MLPA of concatenated sequences of six housekeeping genes (gyrB, rpoD, recA, dnaJ, gyrA and dnaX) sequences showing the relationships of strain 266T with several strains of all other Aeromonas species. The phylogenetic tree was constructed with 4204 nt. Numbers at the nodes indicate bootstrap values. Accession numbers for all Aeromonas strains are provided in Martínez-Murcia et al. (2011). Bar, 0.01 estimated substitutions per site.

-- 212 --

6.4. DISCUSSION

The phenotypic and genotypic characteristics of strain 266T were investigated using a polyphasic approach in order to determine its taxonomic position as initial classification inferred by the nucleotide sequences of the rpoD and gyrB genes suggested that strain 266T occupied a phylogenetic branch separate from all current Aeromonas species. A small zone of inhibition (~10.8 mm in diameter) with a 150 g disk containing the vibriostatic agent O/129 was observed after o/v incubation on blood agar. Susceptibility to O/129 is uncommon in the genus and was previously reported for two strains of A. eucrenophila and one of A. veronii by Abbott et al. (2003), and recently for the newly proposed species A. cavernicola (Martínez-Murcia et al. 2013).

The inability of strain 266T to produce acid from D-mannitol is a significant phenotypic marker as the majority of the species in the genus can produce acid from this carbohydrate with the exception of A. schubertii, A. simiae, A. diversa, and some strains of A. trota. Strain 266T can be differentiated from A. schubertii by producing indole from tryptophan and acid from D-saccharose; from A. simiae by being haemolytic (strain 266T exhibited -haemolysis while A. simiae did not) and positive for VP and indole reactions; from A. diversa by its ability to decarboxylate lysine and produce acid from D-saccharose and from A. trota by being positive for VP but negative for the utilization of citrate.

The CFA composition of strain 266T suggested that subtle differences exist between strain 266T and other D-mannitol negative Aeromonas (Table 6.2). Moreover, based on CFAs profiles, Aeromonas species can be divided into two groups, those that produce

C16:1 w7c alcohol and C16:0 N alcohols, and those that do not. However, identification of bacteria by analysis of their FAMEs is more suitable for slow-growing bacteria such as non-fermenters (Osterhout et al. 1991) and, in agreement with the comments by Käempfer et al. (1994), fatty acid patterns show a limited resolution to split Aeromonas species. The Similarity Index (SI) values obtained for strain 266T varied between 0.200 and <0.300 and in most instances, named A. schubertii as a possible match. According to this system, SI values of <0.300 may represent an atypical strain of the species named first in the chromatogram. This identification was consistent with the fact that A. schubertii shared similar biochemical features with strain 266T. The FAME compositions of the Aeromonas strains analysed in this project differed significantly from previous reports (Lambert et al. 1983; Huys et al. 1994; Käempfer et al. 1994).

-213-

Consistent with previous observations, variations in FAME data can be attributed to differences in culture conditions, sets of strains used, the type of media and equipment employed to analyse results (Huys et al. 1994).

At the genotypic level, strain 266T showed a separate line of descent from all other Aeromonas species as depicted in phylogenetic trees constructed with nucleotide sequences of six individual housekeeping genes (Figs. 6.4 to 6.9) and the concatenated tree derived from the MLPA (Fig. 6.10). According to the ad hoc committee for the re- evaluation of the species definition in bacteriology, a minimum of five housekeeping genes are recommended to define a species (Stackebrandt et al. 2002). The species A. fluvialis, A. taiwanensis, A. sanarellii and A. rivuli have all been defined with the concatenated sequences of five genes (rpoD, gyrB, dnaJ, recA and gyrA) (Alperi et al. 2010a/b; Figueras et al. 2011a).

Recently, a MLPA of the genus Aeromonas based on the information derived from seven concatenated genes (rpoD, gyrB, dnaJ, recA, gyrA, dnaX, and atpD) demonstrated concordance with the species delineation based on the DDH results (Martínez-Murcia et al. 2011). Almost the same phylogenetic conclusions were recently inferred by Roger et al. (2012b) using MLPA based also on seven housekeeping genes (dnaK, gltA, gyrB, radA, rpoB, tsf and zipA) of which six were different from the ones employed by Martínez-Murcia et al. (2011).

According to Käempfer and Glaeser (2012) and Martínez-Murcia et al. (2011), a critical comparison of the different tree topologies based on single genes is important to determine genes that may be affected by lateral gene transfer or subsequent recombination events. The trees constructed with the six individual genes showed that in all of them strain 266T formed a clear distinctive branch but always clustered near the species A. veronii, A. fluvialis and A. allosaccharophila. This finding is further supported by the DNA relatedness values below the 70% limit for species delineation determined between strain 266T and the type strains of A. allosacccharophila, A. veronii and A. fluvialis (Wayne et al. 1987; Stackebrandt and Goebel 1994). The MLPA showed once more a perfect agreement with DDH results, because both demonstrated that strain 266T represents a new Aeromonas species.

-214-

6.4.1. Formal description of Aeromonas australiensis sp. nov.

Motile rods with polar flagella (Figure 6.1b). Cells are Gram-negative, straight, non- spore-forming and non-encapsulated rods, 0.6-0.9 μm wide and 1.8-2.7 μm long, oxidase- and catalase-positive, reduce nitrate to nitrite and are susceptible to the vibriostatic agent O/129 (150 μg). Colonies on TSA plus sheep blood are 1.5-2.0 mm in diameter, glossy, circular and beige in clolour after 24 h at 35C. No brown diffusible pigment is produced on TSA at 35C. Growth occurs at 25, 30 and 35C, but not at 4 or 44C after 24 h on TSA plus sheep blood. -Haemolysis is observed on sheep (5%) blood agar. Grows on MacConkey (Difco) and thiosulfate-citrate-bile-sucrose agar (Difco) and in nutrient broth in 0 and 3% NaCl, but not at 6% NaCl. Indole is produced from tryptophan. The ONPG reaction is positive when tested by disc (Rosco) but not in the API 20E strip. Does not utilize citrate (Simmon’s and Hänninen’s methods) or malonate or produce gas from glucose, but a positive citrate reaction is observed with the API 20E strip. DL-Lactate is utilized at 30C but not at 35C.

Hydrogen sulphide, urease and elastase are not produced and it does not hydrolyse aesculin. No clearing of tyrosine-containing medium, but starch hydrolysis is positive after 5 days. Produces DNase and lipase and oxidizes potassium gluconate. Dehydrolyses arginine and lysine is decarboxylated, but not ornithine. Utilizes acetate and urocanic acid and it is positive for the Voges-Proskauer reaction and hydrolysis of gelatin. No bacteriolytic activity (stapholysin) is detected. Negative for phenylalanine deaminase, alkylsulfatase, pyrazinamidase and Jordan’s tartrate.

Acid is produced from the following carbohydrates: fructose, galactose, glucose, glycerol, glycogen, glucose-1-phosphate, glucose-6-phosphate, maltose, mannose, N- acetylglucosamine, ribose, sucrose and trehalose, but not from adonitol, amygdalin, L- arabinose, cellobiose, dulcitol, myo-inositol, lactose, lactulose, D-mannitol, melibiose, methyl--D-glucoside, raffinose, L-rhamnose, salicin or D-sorbitol. Acid production is observed for the following carbohydrates with the API 50CH strip: glycerol, D-ribose, D-galactose, D-glucose, D-fructose, D-mannose, N-acetylglucosamine, maltose, sucrose, trehalose, starch, glycogen and potassium gluconate. The type strain is 266T (=CECT 8023T = LMG 26707T), isolated from treated effluent in the south-west region of Western Australia.

-215-

In this chapter, the taxonomic position of a previously unknown Aeromonas isolate has been determined using extensive phenotypic and genotypic testing which confirmed that strain 266T represents a novel Aeromonas species for which the name Aeromonas australiensis (aus.tra.li.en’sis. N. L. fem. Adj. australiensis, of or belonging to Australia) sp. nov. has been proposed.

-216-

CHAPTER 7: VIRULENCE GENES PRESENT IN

WESTERN AUSTRALIAN AEROMONAS SPP.

7.1. INTRODUCTION

Aeromonas species are ubiquitous Gram-negative bacilli found in aquatic environments, many types of foods and in vertebrate and invertebrate organisms. In humans, Aeromonas species have been isolated practically from every body site and are the aetiological agents of serious human infections including bacteraemia and meningitis. Aeromonas sepsis, frequently fatal in humans, is usually associated with malignancies or other chronic underlying illnesses although infections are occasionally reported in immunocompetent individuals (Janda and Abbott 2010). Although the genus Aeromonas currently comprises 27 species only a few are considered pathogenic to humans. Of these, A. hydrophila, A. veronii bv. sobria and A. caviae are of clinical significance (Janda and Abbott 2010). However, by virtue of its previous isolation from human clinical material either as A. aquariorum or A. hydrophila ssp. dhakensis, the newly combined species A. dhakensis sp. nov. comb. nov. (Beaz-Hidalgo et al. 2013; Puah et al. 2013) should be considered one of the major Aeromonas species.

Many putative virulence factors have been identified in these organisms including exotoxins, surface structures and secretory systems (Yu et al. 2004; Sen and Lye 2007; Chopra et al. 2009). The detection of virulence genes is considered a practical method of screening a large number of Aeromonas isolates for potential virulence (Sen and Rodgers 2004). Attempts to reproduce disease with aeromonads in laboratory animals and human volunteers have failed to build a robust case for causality based on Koch’s postulates (Janda and Abbott 2010). As a consequence, a plethora of alternative models of infection including the unicellular amoeba Dictyostelium and the medicinal leech Hirudo medicinalis among others have been proposed to assess the virulence potential of aeromonads (Janda and Abbott 2010). One of the drawbacks of these models is that the complex patho-physiology of the in-vivo infection may not be fully reproducible in non-mammalian models.

The aim of this chapter was to determine the presence of 13 virulence genes among genotypically-characterized clinical and environmental strains as described in Chapter 4. A PCR-based method was used to detect the genes coding for aerolysin/haemolysin (aerA/haem), serine protease (aspA), heat-labile (alt) and heat-stable (ast) cytotoxins,

-217- components of the type 3 (aexT and ascV) and type 6 (vasH) secretion systems, lateral (lafA) and polar (flaA) flagella, bundle-forming pilus (BfpA and BfpG) and a Shiga-like toxin (stx-1 and stx-2). This is the first study of this kind in Australia.

7.2. Bacterial strains

Bacterial strains used in this investigation and their source of isolation are listed in Table 2.9. Primers used in this study are listed in Table 2.8.

7.3. RESULTS

7.3.1. Overall distribution of virulence genes

The overall distribution of nine virulence genes in all Aeromonas isolates tested is shown in Table 7.1. The most prevalent genes were aerA/haem 77% (100/129), alt 53% (69/129) and lafA 51% (67/129) while ascV 16% (16/129) and aexT 13% (13/129) were the least frequently detected. The genes coding for a bundle-forming pilus (BfpA and BfpG) and a Shiga-like toxin (stx-1 and stx-2) could not be detected in any isolate (results not shown). Virulence genes more prevalent in environmental than in clinical isolates were aexT (26 vs. 9%); (p = 0.0295), ascV (39 vs. 8%) (p = 0.0004), aspA (61 vs. 19%) (p = 0.0001), and vasH (48 vs. 19%) (p = 0.0023), respectively. By contrast, lafA (59 vs. 29%) (p < 0.0040) was present more often in clinical than in environmental strains. Among the major species, the most prevalent virulence genes were: A. caviae, lafA 55% (15/27) and aerA/haem 52% (14/27); A. dhakensis, alt 81% (25/31), aerA/haem 74% (23/31), flaA and lafA both 64% (20/31) and vasH 61% (19/31); A. hydrophila, ast 93% (27/29), alt 86% (25/29), aerA/haem 79% (23/29), lafA 69% (20/29) and aspA 52% (15/31); A. veronii bv. sobria, aerA/haem 100% (31/31), ascV 32% (10/31) and 26% (8/31) for both alt and aexT.

7. 3.2. Distribution of virulence genes in stool isolates

The prevalence of virulence genes in stool specimens is shown in Table 7.2. The aerA/haem and lafA genes were equally distributed in 55% (11/20) of the total isolates followed by ast 45% (9/20) and alt 40% (8/20). The flaA+/lafA+ genotype was present in 20% (4/20) of total isolates while 35% (7/35) had both alt and ast. Ten% (2/20) of the strains harboured more than five virulence genes.

-218-

7.3.3. Distribution of virulence genes in extra-intestinal isolates

The prevalence of virulence genes in extra-intestinal specimens is shown in Table 7.3 (blood), Table 7.4 (wounds) and Table 7.5 (miscellaneous specimens). Overall, aerA/haem, lafA and alt were the most prevalent genes in these specimens. The distribution of these genes in blood was 86% (24/28), 46% (13/28), 46% (13/28); in wounds 91% (29/32), 69% (22/32) and 56% (18/32), and in miscellaneous specimens 83% (15/18), 67% (12/18) and 56% (10/18), respectively. Five or more virulence genes were detected in 28% (9/32) wound isolates, 25% (7/28) in blood, and 22% (4/18) miscellaneous specimens. The flaA+/lafA+ genotype was present in 28% (9/32) wound, 17% (3/18) miscellaneous specimen and 7% (2/28) blood isolates. Both alt and ast were present in 33% (6/18) miscellaneous specimens, 29% (8/28) blood and 25% (8/32) wound isolates.

7.3.4. Distribution of virulence genes among environmental isolates

The prevalence of virulence genes in Aeromonas isolated from environmental samples is shown in Table 7.6. The most prevalent genes were aerA/haem 68% (21/31), alt 61% (19/31), aspA 61% (19/31) and vasH 48% (15/31). The flaA+/lafA+ genotype was present in 9.6% (3/31) of total isolates while 29% (9/31) harboured both alt and ast genes. Individually, flaA was distributed in 39% (12/31); lafA in 29% (9/31), alt in 61% (19/31) and ast in 39% (12/31) of total isolates.

7.3.5. Additional features

Overall, 27% (35/129) of the total isolates harboured five or more virulence genes including 22% (22/98) in clinical and 42% (13/31) in environmental isolates. Five or more virulence genes were detected in 100% (3/3) A. jandaei, 48% (14/29) A. hydrophila, 42% (13/31), A. dhakensis, 19% (6/31) A. veronii bv. sobria and the single strains of A. allosaccharophila and A. australiensis but not in A. bestiarum, A. caviae, A. media, A. salmonicida and A. schubertii. Among the major species, the average number of virulence genes detected was: A. dhakensis 4.3, A. hydrophila 4.3, A. veronii bv. sobria 2.7 and A. caviae 1.7. The flaA+lafA+ genotype was present in 39% (12/31) A.

-219- dhakensis, 21% (6/29) A. hydrophila, 4% (1/25) A. caviae, 3% (1/31) A. veronii bv. sobria and in both A. media isolates (Tables 7.7).

7.3.6. Percentage identity of nucleotide sequences of positive products from this study compared to sequences deposited in GenBank

The nucleotide sequences of gene products from selected strains were compared with sequences deposited in GenBank and shown in Table 7.8. Accesion numbers for these sequences are shown in Table 7.9. Unspecific amplification products were detected for the vasH gene. The percentage of nucleotide identity for aerA/haem ranged from 71.2 to 96.5% over a 323 bp length; alt 90.9 to 93.8% over 244 bp; ast 94.7% over 265 bp; aexT 88.0 to 94.1% over 510 bp; ascV 83.8% over 500 bp; aspA 71.2 to 93.7% over 306 bp; flaA 71.0 to 90.5% over 326 to 328 bp; lafA 69.3 to 83.0% over 555 to 580 bp and vasH 86.0% over 572 bp. These results were not included in the original publication.

7.4. DISCUSSION

The distribution of 13 virulence genes assayed among 129 Aeromonas isolates was determined in order to evaluate the pathogenic potential of these bacteria. The majority (96%; 124/129) of the strains contained at least one virulence gene. The frequency of alt and ast in stool isolates was 40% and 45%, respectively. In other studies, the frequency for alt ranged from 16 to 35% and for ast 6 to 97% (Albert et al. 2000; Aguilera- Arreola et al. 2005, 2007; Senderovich et al. 2012). In A. hydrophila, ast has been detected between 30 and 91% of the isolates tested while has been absent in A. caviae and A. veronii (Sen and Rodgers 2004; Aguilera-Arreola et al. 2007). In another study, alt was almost exclusively detected in diarrhoeic isolates (Aguilera-Arreola et al. 2005). The wide variations in the distribution of enterotoxin genes lend support to the observations by Chopra et al. (2009) who stated that the prevalence of virulence genes may depend on the strains examined at the time of testing.

The aerA/haem gene was detected in 77% of the total isolates consistent with other reports where the prevalence of this gene ranged from 72 to 89% (Aguilera-Arreola et al. 2007; Chacón et al. 2003; Puthucheary et al. 2012).

-220-

Table 7.1 Distribution of virulence genes among Western Australian Aeromonas species Gene frequency (%) Species No. tested aerA/haem aexT alt ascV aspA ast flaA lafA vasH

A. allosaccharophila 1c +   + + +  +  A. australiensis 1e +  + + +     A. bestiarum 1c +  +  +     A. caviae 25c 14 (56) 1(4) 4 (16)   5 (20) 3 (12) 15 (60) 2 (8) 2e   1 (50)  1 (50)     Total 27 14 (52) 1 (4) 5 (18)  1 (4) 5 (18) 3 (11) 15 (55) 2 (7) A. dhakensis 21c 17 (81) 1 (5) 15 (71) 2 (9) 3 (14) 5 (34) 13 (62) 17 (81) 11 (52) 10e 6 (60) 5 (50) 10 (100) 3 (30) 6 (60) 4 (40) 7 (70) 3 (30) 8 (80) Total 31 23 (74) 6 (19) 25 (81) 5 (16) 9 (29) 9 (29) 20 (64) 20 (64) 19 (61) A. hydrophila 23c 20 (87) 1 (4) 20 (87)  10 (43) 21 (91) 6 (26) 16 (69) 3 (13) 6e 3 (50  5 (83)  5 (83) 6 (100) 3 (50) 4 (67) 2 (33) Total 29 23 (79) 1 (3) 25 (86)  15 (52) 27 (93) 9 (31) 20 (69) 5 (17) A. jandaei 3e 2 (67  2 (67) 2 (67) 2 (67) 1 (33)  2 (67) 2 (67)

-221-

Table 7.1 Continued. Gene frequency (%) Species No. tested aerA/haem aexT alt ascV aspA ast flaA lafA vasH

A. media 2c 1 (50) 1 (50) 1 (50)   1 (50) 2 (100) 2 (100) 

A. salmonicida 1c +  +  +  +   1e +   + +  +   A. schubertii 1c +       +  A. veronii bv. sobria 23c 23 (100) 5 (22) 7 (30) 6 (26) 3 (13) 5 (22) 3 (13) 6 (26) 3 (13) 8e 8 (100) 3 (37) 1 (12) 4 (50) 2 (25) 1 (12) 1 (12)  3 (37) Total 31 31 (100) 8 (26) 8 (26) 10 (32) 5 (16) 6 (19) 4 (13) 6 (19) 6 (19) Total clinical 98 79 (81)a 9 (9)b 49 (50)c 9 (9)d 19 (19)e 38 (39)f 29 (29)g 58 (59)h 19 (19)i Total environmental 31 21 (68)a 8 (26)b 20 (64)c 12 (39)d 19 (61)e 12 (39)f 12 (39)g 9 (29)h 15 (48)i Grand total 129 100 (77) 17 (13) 69 (53) 21 (16) 38 (29) 50 (39) 41 (32) 67 (51) 34 (26) , not detected; +, detected; c, clinical; e, environmental; ap = 0.1453; b p = 0.0295; cp = 0.2152; d p = 0.0004; ep < 0.0001; f p = 1.0000; g p = 0.3797; hp = 0.0040; ip = 0.0023

-222-

Table 7.2 Distribution of virulence genes in Aeromonas spp. isolated from stools (n = 20) Genes detected

Species Strain a/h alt ast lafA flaA ascV aexT aspA vasH 1 Clinical data

no. Age

Stool Gender

A. allosaccharophila 100 + + + + + 74 F Campylobacter jejuni also isolated2 A. dhakensis 169 + + + + L 35 M Infected Chrons2 180 + + + + W 80 F Persistent diarrhoea; diverticulitis 183 + + + + L 63 F Diarrhoea A. caviae 94 + + L 74 M N/D 102 + W 71 F Diarrhoea post chemotherapy2 103 + + + + L 57 F Diarrhoea for 2 weeks 156 + + + + L 5 m F Recent travel 158 + W 63 M Recent travel 187 + + L 44 F Prem menopause 216 + + + SF 74 F N/D N/D, no data; 1Stool consistency, A. allosaccharophila was isolated from a colostomy specimen; L, loose, W, watery, SF, semi-formed; 2leucocytes detected in stools; a/h, aerA/haem; M, male; F, female.

-223-

Table 7.2 Continued. Genes detected

Species Strain a/h alt ast lafA flaA ascV aexT aspA vasH Clinical data 1 no. Age Stool Gender

A. hydrophila 133 + + + + + 31 M Post/mortem specimen A. media 179 + + + + L 74 M Prolonged intravenous antibiotics A. veronii bv sobria 99 + W 78 F N/D2 137 + + W 33 M N/D 166 + + + L 70 F Diarrhoea 184 + W 78 M N/D2 189 + + W 67 F Diarrhoea, maelena, Trichomonas hominis + 215 + + + SF 89 F N/D 219 + W 61 F Diarrhoea for 1 week2 Total no. 11 8 9 11 7 1 1 3 5 % 55 40 45 55 35 5 5 15 25

-224-

Table 7.3 Distribution of virulence genes in Aeromonas spp. isolated from blood (n = 28) Genes detected

Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data

no. Age Gender

A. dhakensis 60 + + + 75 M Acute renal failure 70 + + 70 M Abdominal sepsis 154 + + + + + N/D N/D N/D A. bestiarum 68 + + + + 46 F N/D; polymicrobial A. caviae 57 + + 48 M N/D 58 83 F N/D 65 + 82 M Cholangeo carcinoma; polymicrobial 75 + 53 F Hickman catheter collected blood; N/D 80 + 80 F N/D 96 + + 72 M N/D 106 72 M Septic 109 + + 70 F Epigastric pain; polymicrobial 110 + + 50 M N/D; polymicrobial 200 + + N/D N/D N/D

-225-

Table 7.3 Continued. Genes detected Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data

no. Age Gender

A. hydrophila 59 + + + + + 65 M Febrile neutropenic 84 + + + + + 81 F N/D; Staphylococcus aureus also isolated 149 + + + + + 68 M N/D 151 + + + + 73 M N/D 152 + + + 73 M N/D A. media 85 + + + + 17 F Prolonged viral-like illness; polymicrobial A. veronii bv sobria 72 + 56 M Cancer/pancreas; polymicrobial 81 + + 89 F Septic shock 111 + + + 88 F Liver cancer; polymicrobial 125 + + + + + 88 F Vomiting 131 + + + 69 M Leukaemia; On chemotherapy 218 + + + + + <1 N/D N/D 5 221 + + 47 F Fever; breast cancer; polymicrobial 269 + + + + + + 81 M Fever; AML Total no. 24 13 8 7 13 5 5 3 2 % 86 46 29 25 46 18 18 11 7 a/h, aerA/haem; AML, acute myeloblastic leukaemia; N/D, no data; M, male; F, female

-226-

Table 7.4 Distribution of virulence genes in Aeromonas spp. isolated from wounds (n = 32)

Genes detected

Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data

no. Age

Gender

A. dhakensis 67 + + + + + 20 M Cellulitis 71 + + + + + + 16 F Infected laceration of foot (river water) 73 + + + + 28 M Appendicitis 79 + + + 60 M Infected finger 91 + + + 78 F Leg wound 95 + + + + + 50 M Wound infected post elbow surgery; on keflex 104 + + + + 60 F Non-healing shin; on flucloxicillin 107 + + + + + 39 M Septic wound right-hand; on flucoxicillin 141 + + + + N/D U N/D 176 + + + + 26 M Purulent wound ooze right-leg 220 + + + + + + N/D U Ulcer 279 + + + 14 M Osteomyelitis left thumb; Staphylococcus aureus also isolated.

-227-

Table 7.4 Continued.

Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data

no. Age

Gender

A. caviae 143 + + + N/D U N/D 163 50 M Hand wound 270 + + + 37 F Infected wound; Staphylococcus aureus also isolated A. hydrophila 23 + + N/D U N/D 69 + + + + + 18 M Infected subungual haematoma; polymicrobial 90 + + + 36 F Ulcer; Staphylococcus aureus and anaerobes also isolated 98 + + + + 35 M Infected left hand 101 + + + + 76 F Multiple ulcers 112 + + + + + + 66 F Post/laparatomy and wound breakdown; polymicrobial 117 + + + + + 54 F N/D; polymicrobial 126 + 22 M Dirty purulent aquatic wound 128 + + + + 13 M Staphylococcus aureus also isolated 148 + + + 73 M N/D

-228-

Table 7.4 Continued. Genes detected

Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data

no. Age

Gender

A. salmonicida 190 + + + + 65 M Offensive smelly purulent discharge of left-point finger A. schubertii 186 + + 42 M Pus from infected wound in foot A. veronii bv. sobria 24 + <15 U N/D 66 + + + + + 47 F Right-lower leg 129 + + + 48 M Infected wound right-ankle 147 + + + <15 M N/D 174 + + 71 M Infected thumb nail; Mixed anaerobes also isolated Total no. 29 18 13 10 22 6 3 3 11 % 91 56 41 31 69 19 9 9 34 N/D, no data; M, male, F, female, U, unknown; a/h, aerA/haem.

-229-

Table 7.5 Distribution of virulence genes in Aeromonas spp. isolated from miscellaneous specimens (n = 18) Genes detected Species Strain a/h alt ast flaA lafA aspA ascV vasH Age Gender Source Clinica data no. A. dhakensis 47 + + + 81 M sputum Leu 3+;Abundant growth; N/D 56 + + + 35 M bone chips Infected fracture 93 + + + 35 M urine Urinary tract infection A. caviae 62 + + 47 M catheters Liver transplant; polymicrobial 78 + 75 M dialysis Peritonitis fluid 140 57 F dialysis Peritoneal dialysis; fluid polymicrobial 178 + + 34 F bile Biliary obstruction; polymicrobial 188 + + 68 F bile Acute cholecystitis; polymicrobial A. hydrophila 61 + + + + 62 M catheters Biliary sepsis; polymicrobial 83 + + + + 53 F sputum Leu 3+; N/D; 89 + + + + 46 F bile Cholangitis; polymicrobial

-230-

Table 7.5 Continued. Genes detected Species Strain a/h alt ast flaA lafA aspA ascV vasH Age Gender Source Clinical data no. A. hydrophila 92 + + + + + 66 F tissue Pancreatic necrosis; polymicrobial 113 + + + + + + + 35 M drain fluid N/D; polymicrobial 118 + + + + + 30 F sputum Exacerbation of CF; polymicrobial; 150 + + + 73 M tissue Foot infection A. veronii bv sobria 25 + <15 N/D catheters N/D 27 + + + + + <15 N/D tissue N/D 171 + 83 F sputum Aspiration pneumonia; polymicrobial Total no. 15 10 7 3 12 5 2 1 % 83 56 39 17 67 28 11 6 M, male; F, female; N/D, no data; a/h, aerA/haem; CF, cytisc fibrosis; Leu 3+, many leucocytes seen on microscopy.

-231-

Table 7.6 Distribution of virulence genes among Aeromonas spp. isolated from environmental sources (n = 31) Genes detected Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Source Location no.

A. australiensis 266 + + + + + IW Rural A. dhakensis 31 + + + Fish ADWA 32 + + + + Fish ADWA 223 + + + + + + + Unknown Unknown 229 + + + + + + TW Unknown 230 + + + + Water Metropolitan 235 + + + + + Water Unknown 241 + + + + + Water Unknown 242 + + + + Water Unknown 256 + + + + + + Water Unknown 257 + + + + + + + Water Unknown A. caviae 30 Fish ADWA 264 + + IW Unknown A. hydrophila 34 + + + + Fish ADWA 231 + + + + SW Metropolitan 243 + + + + + Water Unknown

-232-

Table 7.6 Continued. Genes detected Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Source Location no. A. hydrophila 245 + + + + Water Unknown 260 + + + + Water Unknown 261 + + + + + + IW Unknown A. jandaei 35 + + + + + Fish lesion ADWA 253 + + + + + Water Unknown 262 + + + + + Water Unknown A. salmonicida 199 + + + + Crab Rural A. veronii bv. sobria 33 + + + + Fish ADWA 224 + + BW Metropolitan 237 + + + + + Water Unknown 247 + + + Water Unknown 254 + Water Unknown 259 + + + + Water Unknown 265 + + IW Unknown 268 + + IW Unknown Total no. 21 19 12 12 9 19 8 12 15 % 68 61 39 39 29 61 26 39 48 a/h, aerA/haem; IW, irrigation water; TW, treated water; BW, bore water; ADWA, Agriculture Department of Western Australia

-233-

Table 7.7 Additional features Species (no. strains) Average no. genes per strain flaA+lafA+ genotype (%) >5 virulence genes (%) Clin Env Total Clin Env Total Clin Env Total A. caviae (27) 1.8 1.0 1.7 4 0 ~4 0 0 0 A. dhakensis (31) 4.0 5.1 4.3 48a 20a 39 33c 60c 42 A. hydrophila (29) 4.2 4.6 4.3 22b 17b 21 48d 50d 48 A. veronii bv. sobria (31) 2.6 2.8 2.7 3 0 4 22e 12e 19 Total 3.1 3.4 3.2 19 9 17 26 30 27 A. allosaccharophila (1) 5 0 100 A. australiensis (1) 4 0 100 A. bestiarum (1) 4 0 0 A. jandaei (3) 5 0 100 A. media (2) 4 100 0 A. salmonicida (2) 4 4 4 0 0 0 0 0 0 A. schubertii (1) 2 0 0 aPercentage differences are statistically significant (p < 0.0001); bPercentage differences are not statistically significant (p = 0.475); cPercentage differences are statistically significant (p = 0.0002); d Percentage differences are not statistically significant (p = 0.887); ePercentage differences are not statistically significant (p = 0.8892); Clin, clinical isolates; Env, environmental isolates.

-234-

Table 7.8 Percentage identity of gene product sequences from this study compared with sequences deposited in GenBank Gene Species/strain no. % Length (bp) Species Accesion no.

aerA/haem A. dhakensis 60,73, 256, 257, 279 71.2 323 A. australiensis 266 90.4 323 A. veronii bv. sobria AB109093 A. bestiarum 68 78.3 323 A. hydrophila AY611033 A. caviae 270 96.5 323 A. hydrophila AF410466 A. jandaei 35 90.4 323 A. veronii bv. sobria 125, 215, 221, 237, 259, 269 93.4 323 A. veronii bv. sobria 125, 215, 221, 237, 259, 269 93.1 323 A. salmonicida X65048 alt A. dhakensis 31, 32, 60, 67, 180, 183, 223, 229, 235, 241, 242, 256 90.9 244 A. australiensis 266 96.3 244 A. hydrophila JBN1302 A. caviae 103, 188, 200, 264 93.0 244 A. hydrophila JQ003197 A. hydrophila 34, 59, 61 94.2 244 A. hydrophila L77573 A. jandaei 253, 262 94.7 244 A. hydrophila JX489379 A. veronii bv. sobria 111, 218, 247, 269 93.8 244 ast A. dhakensis 154, 169, 183 A. caviae 103, 143, 156 94.7 265 A. hydrophila JQ003211 A. hydrophila 23, 34, 59, 83, 113, 117, 243, 261 A. media 179; A. veronii bv. sobria 27, 66, 125, 269 aexT A. dhakensis 31, 32, 220, 230; A.media 85 94.1 510 A. veronii EF026079

- 235 -

Table 7.8 Continued. Gene Species/strain no. % Length (bp) Species Accesion no. aexT A. veronii bv. sobria 33, 66, 218, 224, 269; A. dhakensis 31, 32, 220, 230; A.media 85 88.0 510 A. salmonicida AF288366 A. veronii bv. sobria 33, 66, 218, 224, 269; ascV A. allosaccharophila 100; A. dhakensis 47, 220; 83.8 500 A. veronii bv. veronii HM584587 A. australiensis 266; A. veronii bv. sobria 66, 218, 221, 269 aspA A. australiensis 266 85.6 306 A. hydrophila AF126213 A. australiensis 266 86.2 306 A. sobria AF253471 A. hydrophila 34, 69, 84, 92, 149, 261 71.2 306 A. hydrophila AF126213 A. jandaei 262 92.4 306 A. sobria AF253471 A. veroniii bv. sobria 27 93.7 306 A. sobria AF253471 A. salmonicida 199 90.1 306 A. salmonicida X67043 flaA A. dhakensis 60, 67, 176, 183, 229 84.6 326 A. hydrophila JQ003217 A. dhakensis 60, 67, 176, 183, 229 90.5 327 A. hydrophila AY424358 A. hydrophila 92, 151, 261 78.8 327 A. salmonicida EU410342 A. bestiarum 68 71.0 328 A. salmonicida EU410342 lafA A. hydrophila 133 83.0 555 A. hydrophila DQ124694 A. hydrophila 260 78.9 580 A. hydrophila DQ124694 A. media 179 72.7 580 A. punctata AF348135 A. dhakensis 95 74.3 580 A. punctata AF348135 A. dhakensis 95 69.3 580 A. jandaei AY228331 vasH A. dhakensis 31 86.0 572 A. hydrophila GQ359779

-- 236 --

Table 7.9 Accession numbers of sequences derived from virulence genes and deposited in GenBank

Gene Species Strain no. Accession no. Species Strain no. Accession no. aerA/haem A. australiensis 266 HG977017 A. bestiarum 68 HG977018 A. dhakensis 73 HG977019 A. dhakensis 279 HG977020 A. hydrophila 59 HG977021 A. hydrophila 148 HG977022 A. jandaei 35 HG977023 A. veronii bv. sobria 215 HG977024 A. veronii bv. sobria 237 HG977025 A. veronii bv. sobria 125 HG977026 A. veronii bv. sobria 221 HG977027 A. veronii bv. sobria 269 HG977028 A. caviae 270 HG977029 A. jandaei 253 HG977030 A. hydrophila 151 HG977031 A. dhakensis 60 HG977032 A. dhakensis 256 HG977033 A. dhakensis 257 HG977034 A. veronii bv. sobria 259 HG977035 aexT A. dhakensis 220 HG977036 A. veronii bv. sobria 269 HG977037 A. veronii bv. sobria 33 HG977038 A. veronii bv. sobria 66 HG977039 A. veronii bv. sobria 131 HG977040 A. veronii bv. sobria 218 HG977041

-- 237 --

Table 7.9 Continued.

Gene Species Strain no. Accession no. Species Strain no. Accession no. aexT A. veronii bv. sobria 224 HG977042 A. dhakensis 31 HG977043 A. dhakensis 230 HG977044 A. dhakensis 32 HG977045 A. media 85 HG977046 A. veronii bv. sobria 237 HG977047 alt A. australiensis 266 HG977048 A. caviae 103 HG977049 A. caviae 188 HG977050 A. caviae 264 HG977051 A. caviae 200 HG977052 A. dhakensis 31 HG977053 A. dhakensis 67 HG977054 A. dhakensis 60 HG977055 A. dhakensis 183 HG977056 A. dhakensis 180 HG977057 A. dhakensis 32 HG977058 A. dhakensis 256 HG977059 A. dhakensis 223 HG977060 A. dhakensis 229 HG977061 A. dhakensis 235 HG977062 A. dhakensis 241 HG977063 A. dhakensis 242 HG977064 A. hydrophila 34 HG977065 A. hydrophila 61 HG977066 A. hydrophila 59 HG977067

-- 238 --

Table 7.9 Continued.

Gene Species Strain no. Accession no. Species Strain no. Accession no. alt A. jandaei 253 HG977068 A. jandaei 262 HG977069 A. veronii bv. sobria 269 HG977070 A. veronii bv. sobria 247 HG977071 A. veronii bv. sobria 111 HG977072 A. veronii bv. sobria 218 HG977073 ascV A. allosaccharophila 100 HG977074 A. australiensis 266 HG977075 A. dhakensis 256 HG977076 A. dhakensis 223 HG977077 A. dhakensis 220 HG977078 A. veronii bv. sobria 27 HG977079 A. veronii bv. sobria 247 HG977080 A. veronii bv. sobria 131 HG977081 ast A. hydrophila 23 HG977082 A. hydrophila 149 HG977083 A. hydrophila 243 HG977084 A. veronii bv. sobria 27 HG977085 A. caviae 103 HG977086 A. caviae 216 HG977087 A. caviae 270 HG977088 A. media 179 HG977089 A. jandaei 262 HG977090 A. veronii bv. sobria 269 HG977091 A. veronii bv. sobria 125 HG977092

-- 239 --

Table 7.9 Continued.

Gene Species Strain no. Accession no. Species Strain no. Accession no. flaA A. bestiarum 68 HG977093 A. dhakensis 60 HG977094 A. dhakensis 67 HG977095 A. dhakensis 183 HG977096 A. dhakensis 176 HG977097 A. dhakensis 229 HG977098 A. hydrophila 92 HG977099 A. hydrophila 69 HG977100 A. hydrophila 261 HG977101 A. hydrophila 151 HG977102 A. hydrophila 231 HG977103 A. caviae 96 HG977104 A. veronii bv. sobria 237 HG977105 A. veronii bv. sobria 215 HG977106 lafA A. dhakensis 95 HG977107 A. dhakensis 104 HG977108 A. dhakensis 220 HG977109 A. media 179 HG977110 A. veronii bv. sobria 269 HG977111 A. veronii bv. sobria 125 HG977112 A. veronii bv. sobria 66 HG977113 A. caviae 158 HG977114 A. caviae 109 HG977115 A. caviae 143 HG977116

-- 240 --

Table 7.9 Continued.

Gene Species Strain no. Accession no. Species Strain no. Accession no. lafA A. hydrophila 101 HG977117 A. hydrophila 34 HG977118 A. hydrophila 260 HG977119 A. hydrophila 133 HG977120 aspA A. australiensis 266 HG977121 A. dhakensis 56 HG977122 A. dhakensis 230 HG977123 A. dhakensis 107 HG977124 A. hydrophila 34 HG977125 A. hydrophila 261 HG977126 A. hydrophila 69 HG977127 A. hydrophila 84 HG977128 A. hydrophila 149 HG977129 A. hydrophila 92 HG977130 A. jandaei 262 HG977131 A. salmonicida 199 HG977132 A. veronii bv. sobria 27 HG977133 A. veronii bv. sobria 259 HG977134 A. veronii bv. sobria 218 HG977135 vasH A. dhakensis 31 HG977136 A. dhakensis 154 HG977137 A. dhakensis 70 HG977138 A. dhakensis 67 HG977139 A. jandaei 35 HG977140 A. jandaei 253 HG977141

-- 241 --

The primers used in the detection of aerA/haem can amplify several related genes which encode toxins with a variety of names including aerolysin, aerolysin-haemolysin, haemolysin-aerolysin, haemolysin, and cytolytic enterotoxin, hence the generic term aerolysin-haemolysin genes (Soler et al. 2002). The prevalence of aerA/haem in A. veronii bv. sobria detected in all (100%) isolates tested was also reported by Aguilera- Arreola et al. (2007).

The prevalence of the ascV (16%) and aexT (13%) genes was low, consistent with other reports (Aguilera-Arreola et al. 2005; Puthucheary et al. 2012; Senderovich et al. 2012). In this study, these genes were more often detected in environmental than in clinical isolates (ascV (39 vs. 8%; p < 0.0004; aexT 26 vs. 9%; p < 0.0295). Braun et al. (2002), exclusively detected aexT in A. salmonicida ssp. salmonicida but not in other Aeromonas spp. while Chacón et al. (2004) detected ascV and aexT in all intestinal and extra-intestinal A. hydrophila and A. veronii isolates but only in a few extra-intestinal A. caviae isolates. Based on these results, it appears that the distribution patterns of the T3SS genes are strain and source dependent. The prevalence of the aspA gene (29%) was low compared with the high frequency (75 to 77%), reported by Chacón et al. (2003) and Puthucheary et al. (2012) who evaluated the distribution of virulence genes and molecular characterization of Aeromonas species from Spain and Malaysia, respectively. However, the prevalence of aspA in A. hydrophila (52%) isolates was similar (58%) to the study by Aguilera-Arreola et al. (2005).

Lateral flagella (lafA) play an important role in cell adherence, invasion and biofilm formation (Gavin et al. 2003). The presence of both genes (the flaA+lafA+ genotype) has been associated with intense biofilm formation (Santos et al. 2010), a characteristic feature of persistent infections. The frequency of the lafA gene (51%) was similar to the overall frequency (60%) reported in mesophilic aeromonads by Gavin et al. (2003). In other studies (Aguilera-Arreola et al. 2005, 2007; Senderovich et al. 2012), the frequency of the lafA gene ranged from 37 to 41% although in one study (Aguilera- Arreola et al. 2005), lafA was detected in 84% of A. hydrophila isolates. On the other hand, the prevalence of the flaA (32%) gene was low compared to the range 59 to 74% reported by others (Sen and Rodgers 2004; Puthucheary et al. 2012; Senderovich et al. 2012). In a recent study, flaA (94%) and lafA (71%) were highly prevalent in A. caviae isolated from water, food and human faeces (Santos et al. 2010).

- 242 -

No amplification products were detected for the virulence genes BfpA, BfpG, stx-1, and stx-2. These virulence genes are rarely investigated and their prevalence among Aeromonas from other locations needs to be evaluated. Sechi et al. (2002) detected the BfpG gene in four out of 46 A. hydrophila isolates collected from water samples in Sardinia, Italy. By contrast, BfpA was not detected in any isolate, consistent with results from this study. There have been few reports of Aeromonas strains producing a Shiga- like toxin or carrying the encoding genes (Haque et al. 1996; Alperi and Figueras 2010). One such gene, stx-l, is plasmid-mediated and it is possible that in this study, strains carrying the stx-1 may have been lost during storage. It is also possible that due to the fact that primer design is based on the nucleotide sequence of one species, species- specific variations in the gene sequences of the species evaluated resulted in failure to amplify providing false negative results.

The vasH (Sigma 54-dependent transcriptional regulator) gene is a relatively recent addition to the arsenal of virulence factors described in Aeromonas spp. Together with vasK the gene is a component and/or is essential for expression of the T6SS. These genes were found in the T6SS of the diarrhoeal isolate A. hydrophila SSU and in A. hydrophila ATCC 7966T (Suarez et al. 2008). In the present study, vasH was detected primarily among environmental (48%, 15/31) rather than in clinical (19%, 19/98) strains.

Results from this study reveal that among the major species, A. hydrophila and A. dhakensis contain more strains that possess multiple virulence genes compared to other clinically relevant species like A. caviae and A. veronii bv. sobria. On the other hand, strains from A. allosaccharophila and A. jandaei also harbour many virulence genes suggesting that in Aeromonas the pathogenic potential may be strain rather than species related. In the present study not many virulence genes were detected in A. caviae. However, other studies suggest that this species should be considered an enteric pathogen capable of harbouring several virulence determinants including the production of a cholera-like and a Shiga-like toxin (Haque et al. 1996; Mokracka et al. 2001; Alperi and Figueras 2010). It is also possible that variations in gene sequences are responsible for lack of amplification in A. caviae.

This raises the question of how many and what virulence genes are essential for an Aeromonas strain to cause infection. In general, pathogens should possess the necessary virulence genes to gain entry, adhere, colonize, causing damage in host tissue while

-- 243 -- evading the host defence mechanisms, and in some cases spread, leading to systemic infection. In Aeromonas, multiple virulence factors most likely work in concert (Yu et al. 2005) where the product of one gene may facilitate the action of other genes or act synergistically (Albert et al. 2000). Some authors observed that combinations or subsets of virulence factors can be found among different isolates responsible for a wide range of infections (Sen and Rodgers 2004; Puthucheary et al. 2012). Virulence genes such as aerA, hlyA, alt, ast, act are thought to contribute to enteritis-related virulence (Janda and Abbott 2010) while the severity of the diarrhoea has been associated with the number and type of enterotoxin genes present (Albert et al. 2000; Chopra et al. 2009).

Enterotoxigenic aeromonads possessing both the alt and ast genes may represent true diarrhoeal pathogens (Albert et al. 2000) although this hypothesis has not been supported by others (Aguilera-Arreola et al. 2007) who suggested that aerolysin- haemolysin may be sufficient to cause diarrhoea particularly in patients colonized with A. caviae or A. veronii. The latter would explain the production of diarrhoea found among patients from the present study infected with these species and lacking either alt or ast. Moreover, aerA/haem and lafA are among the most predominant virulence genes present in isolates from intestinal specimens suggesting that these genes may play an essential role in the pathogenesis of aeromonads isolated from these sites. In this study, with the exception of two cases, Aeromonas was the only recognized enteric pathogen and no parasitic or mixed infections were recorded (Table 7.2).

The variable percentage identity found between the sequences of selected strains compared to sequences deposited in GenBank for the nine genes has been previously reported by others. The ASA1 protein secreted by the A. sobria 33, a human isolate and the ASH3 produced by the fish isolate A. salmonicida 17-2 were found to be 66% identical with aerolysin (Table 1.8) (Hirono et al. 1992; Hirono & Aoki 1993). On the other hand, the cytotonic enterotoxin (Alt) produced by the human diarrhoeal isolate A. hydrophila SSU showed 45 to 51% identity with phospholipase/lipase (Chopra et al. 1996). These results suggest that Aeromonas can produce a variety of extracellular products that may be unique to specific strains. This is not surprinsing considering that some Aeromonas strains can produce several enzymes with different biological properties (Wretlind and Heden 1973; Honda et al. 1985; Howard and Buckley 1985; Kozaki et al. 1987).

-- 244 --

The virulence genes investigated in this study represent a subset of the many virulence factors described in Aeromonas, and the roles of only some of these genes have been defined in the pathogenesis of aeromonads (Chopra et al. 2009). In this study, the only gene found to be significantly more common in clinical than in environmental isolates was lafA. Recently, Grim et al. (2013) used a combination of whole genome-sequence and phenotypic assays to compare the virulence potential between two A. hydrophila strains isolated from a patient with a polymicrobial wound infection. The more virulent isolate harboured genes encoding for act, T3SS, flagella, haemolysins, capsule and a homolog of exotoxin A found in Pseudomonas aeruginosa. The isolate was also lethal to mice injected with a dose of 1 x 107 CFU. Thus a virulent pathotype of A. hydrophila has now been identified and further genomic analysis is likely to reveal more distinct pathotypes within the genus.

In this Chapter, 129 genotypically-characterized WA Aeromonas isolates of clinical and environmental origin were examined for 13 putative virulence determinants to add to the current body of knowledge on virulence-associated characteristics of Aeromonas. This is the first study of this kind in Australia. Results from this study showed that the distribution of these genes varies from strain to strain irrespective of the species and source of isolation. Furthermore, this study reinforces the clinical relevance previously attributed to A. dhakensis (as A. aquariorum or A. hydrophila ssp. dhakensis), a species known to possess many virulence genes (Figueras et al. 2009; Sedláček, et al. 2012; Puthucheary et al. 2012). Moreover, although clinical isolates belonging to A. hydrophila and A. dhakensis can harbour many virulence genes, not all strains do so. Genomic comparisons combined with phenotypic studies appear to be a suitable and practical approach for the identification of virulent pathotypes in Aeromonas.

-- 245 --

-- 246 --

CHAPTER 8: GENERAL DISCUSSION

This thesis consists of several peer-reviewed publications in which the phenotypic, genotypic, antimicrobial susceptibility profiles and the presence of several virulence factors were investigated in a collection of Aeromonas isolated from human clinical material, various water sources and fish samples. In addition, the taxonomic position of an isolate recovered from irrigation water was investigated by extensive phenotypic and genotypic testing leading to the proposal of a novel Aeromonas species.

Despite the ubiquitous nature of Aeromonas, a genus that has been associated with infections in warm and cold-blooded animals including humans for more than a hundred years, the lack of an animal model of infection has undermined the significance of this genus as a true human pathogen. The failure of aeromonads to fulfil Koch’s postulates has led bacteriologists to consider these bacteria opportunistic microorganisms rather than recognized bona fide pathogens. This is highly surprising considering the devastating impact that infection with these bacteria has caused to the aquaculture and other related industries resulting in enormous financial loss (Kodjo et al. 1997; Nash et al. 2006). In the past, the complex taxonomy of the genus undermined an understanding of the potential pathogenic significance of Aeromonas, and their distribution. However, the introduction of molecular methods has facilitated a more accurate differentiation of the species. As a consequence, the real distribution of Aeromonas in all environments is starting to emerge.

Therefore, the aims of this thesis were:

1. To determine the identity and distribution of local clinical and environmental Aeromonas isolates by phenotypic and genotypic methods. 2. To introduce novel phenotypic methods and revisit older ones with the aim to find new biochemical markers. 3. To examine the antimicrobial susceptibilities of local clinical and environmental isolates. 4. To identify isolates with uncertain taxonomic positions 5. To investigate the presence of selected virulence genes among local clinical and environmental isolates.

-- 247 --

Classification of Aeromonas isolates

This study began with the phenotypic classification of 199 Aeromonas isolates from various clinical and environmental sources. Identification was based on a scheme comprising more than 60 biochemical and physiological assays (Abbott et al. 2003). Novel tests were introduced to find additional biochemical markers for an improved identification. Overall, most isolates (93%) were identified to species level. Among the clinical isolates, A. hydrophila (52.2%), A. caviae (19.0%) and A. veronii bv. sobria (14.5%) accounted for 92% of the total isolates. This is in accordance with other studies where together these species usually account for > 85% of the clinical isolates for this genus (Altwegg and Geiss 1989; Abbott et al. 2003). Among water isolates, A. hydrophila (46%) was the most common species followed by A. veronii bv. sobria (22%). The high frequency of isolation of A. hydrophila supports the notion that the frequency with which various species occur in clinical and environmental specimens, are probably due to differences in the virulence potential of the strains (Janda et al. 1984; Barer et al. 1986; Kuijper et al. 1989b). It may also explain the reason why this species has been the most studied aeromonad (Figueras 2005).

Earlier studies used numerical taxonomic techniques in combination with a large number of biochemical characters to identify Aeromonas. However, no study was able to characterize every isolate tested (Bryant et al. 1986a; Renaud et al. 1988; Kaznowski et al. 1989; Käempfer and Altwegg 1992) reflecting the phenotypic homogeneity within the genus. Nevertheless, in some studies, phenotypic identification in combination with numerical taxonomy was able to produce discrete phenotypic clusters allowing the recognition of two novel species (Miñana-Galbis et al. 2004, 2007). In this study, identification of Aeromonas to the species level using biochemical methods was fraught with difficulties including the low positivity rate of some tests, interpretation of end- points, and the low number of strains representing environmental and infrequently isolated species. Moreover, the introduction of novel tests in this study failed to provide useful phenotypic markers further confirming that the identification of Aeromonas by phenotypic methods is unreliable and some isolates are likely to be misidentified or cannot be assigned to any definitive taxon (Figueras et al. 2007b; Ghatak et al. 2007b).

Following phenotypic classification, the genetic relationships of all isolates were determined from gyrB and rpoD gene sequences. As a result, 99.5% of the strains re- identified were placed in a taxon compared to 93% by the previous method. The new

-- 248 -- distribution indicated that in WA A. caviae, A. dhakensis, A. hydrophila and A. veronii bv. sobria were the most prevalent species in clinical specimens accounting for 96% of the total isolates. Moreover, the frequency of these species among human clinical material was very similar with A. veronii bv. sobria (25%) slightly more prevalent than A. caviae and A. dhakensis (both at 23.8%) and A. hydrophila (23%), respectively. Thus, the difference in the frequency of isolation of A. hydrophila from clinical and environmental specimens fell significantly from 52 to 19% (p < 0.0001) after genotypic identification. These results provide strong evidence that the distribution of Aeromonas species largely correlates with the identification method employed. The high prevalence of A. dhakensis in this study has been reported in recent studies suggesting that this species is globally distributed in clinical specimens (Figueras 2005; Puthucheary et al. 2012; Wu et al. 2012).

Misidentification of isolates may also explain the phenotypic heterogeneity previously associated with A. hydrophila, A. caviae and A. veronii (Miyata et al. 1995; Graf 1999a; Korbsrisate et al. 2002; Abbott et al. 2003). It is also possible that among Aeromonas species different ecotypes capable of exploiting a specific ecological niche exist. Ecotypes have been described among strain that exhibit higher than 99% average nucleotide identity (ANI) although the gene content of strains of the same species can vary up to 30%. This difference begs the question of whether these strains should belong to the same species (Konstantinidis and Tiedje 2005). Future studies designed to compare the gene content between clinical and environmental isolates using ANI as a tool may be forthcoming. Thus, this study contributes to an important knowledge about the frequency of Aeromonas species in WA indicating that a more accurate distribution of the genus is beginning to emerge.

The description of Aeromonas australiensis sp. nov.

In Chapter 4, the position of strain 266 inferred from the gyrB and rpoD gene sequences showed that this isolate formed a separate line of descent from all other species in the genus. Furthermore, the inability of the strain to produce acid from D-mannitol was significant as most species in the genus do so. Subsequent extensive phenotypic and genotypic testing confirmed that strain 266T indeed represented a novel Aeromonas species (Aravena-Román et al. 2013). Proposing new species based on a single strain has been a source of controversy among bacteriologists. This situation has led some authors to recommend that the Bacteriological Code be revised and that a minimum

-- 249 -- number of standard tests and strains should be included in the description of new species (Christensen et al. 2001; Janda and Abbott 2002) of which genotypic methods should be mandatory (Figueras et al. 2006). However, there are a few drawbacks with these recommendations. Firstly, it may take a very long time to collect the minimum number of strains recommended from geographically and epidemiologically unrelated areas. Secondly, strains may be lost in storage or simply forgotten in culture collections. Thirdly, sequences from nearly every bacterial species have been placed on GenBank and are readily available for comparison. The latter point is reinforced by the recent isolation of A. simiae following a survey to determine the prevalence of Aeromonas in slaughterhouses in northern Portugal. The strain was isolated among 703 isolates and was identified on the basis of 16S rDNA, gyrB and rpoD sequencing (Fontes et al. 2010). Aeromonas simiae was first described on the basis of two strains isolated from faeces of healthy monkeys (M. fascicularis) from Mauritius (Harf-Monteil et al. 2004). A second study recently reported that A. taiwanensis constituted 6% of the Aeromonas species isolated from diarrhoeal stools in Israel. In this study, identification of the isolates was based on the sequences of the rpoD gene (Senderovich et al. 2012). The original description of A. taiwanensis was based in a single strain recovered from an infected burn wound of a 40 year-old male from Taiwan (Alperi et al. 2010b).

These findings suggest that A. australiensis may be isolated by others in future studies. Isolation of A. australiensis outside Australia would indicate a global distribution of the species while isolation within Australia would suggest that the species is indigenous to this region only. The discovery of A. australiensis from irrigation water is a significant contribution to the understanding of the global distribution of this genus and adds to the list of new aeromonads described in the last 14 years. This increasing number of new Aeromonas species also coincided with the rapid increase of new bacterial species described over the same period of time (Janda and Abbott 2010). Furthermore, the recognition of a novel species reinforces the notion that accurate identification of these bacteria must include a molecular approach.

Antimicrobial susceptibility

The antimicrobial susceptibility patterns of Aeromonas determined in this study indicate that the number of multi-drug resistance strains found locally is extremely low. In contrast to other reports, no Aeromonas strain isolated in WA was found to carry resistance mechanisms such as ESBLs or the presence of MBLs (Rasmussen and Bush

-- 250 --

1997; Neuwirth et al. 2007; Libisch et al. 2008; Wu et al. 2012). All isolates tested in this study were exquisitely susceptible to the fluoroquinolones ciprofloxacin and norfloxacin (100%) while resistance to nalidixic acid was very low (3.1%). The latter result is in sharp contrast with the high rates of resistance to nalidixic acid reported by Rhodes et al. (2000) who observed resistance to nalidixic acid in 94% of human derived and 52% of aquaculture aeromonads. Similarly, Figueira et al. (2011) reported resistance to this antimicrobial agent in 90.6% of waste water and 17.6% of surface water isolates. In Taiwan, resistant to fluoroquinolones is emerging where up to 14% of Aeromonas showed tolerance to this antimicrobial class (Wu et al. 2007). On the other hand, resistance to tetracycline in WA aeromonads is low (<6%) whereas reports from Asia suggest that up to 49% of the isolates can be resistant to this antimicrobial class (Chang and Bolton 1987; Ko et al. 1996).

Based on the low antimicrobial resistance exhibited by environmental aeromonads consisting primarily of strains isolated from water samples it is safe to suggest that water is not an ecological niche for resistance mechanisms in WA. By contrast, reports from several locations reveal that multi-resistant Aeromonas strains can be found among water and foods sources (Goñi-Urriza et al. 2000; Rhodes et al. 2000; Nawaz et al. 2010; Esteve et al. 2012). In one study, consumption of contaminated water was implicated in serious infections caused by ESBL-producing Aeromonas (Rodríguez et al. 2005). Furthermore, the high susceptibility nature of environmental strains to most antimicrobial classes reported in this study suggests that clinical strains may act as a potential reservoir for resistance mechanisms. This is consistent with previous observations that suggested that resistant strains isolated from clinical samples may release compounds into the environment and provide a source of constant selection that maintains pressure for populations of resistant strains (Davies and Davies 2010). Thus, results from this and other studies confirm that variations in the antimicrobial profiles exist in Aeromonas strains isolated from different locations.

From the clinical point of view, the presence of aeromonads in human clinical material may impact patient management as incorrect empirically therapy has been administered in a significant number of cases involving Aeromonas (Scott et al. 1978; Vila et al. 2002; Bravo et al. 2003; Figueras 2005). The overall susceptibility profile of Aeromonas was deemed to be stable during the decade mid-1980s to mid-1990s (Janda

-- 251 -- and Abbott 2010), a trend that appears to continue in this region as indicated by this study.

There were 11 isolates with a multi-resistant profile. One was isolated from water, two from diseased fish and the rest from human clinical material. Of these, only one exhibited resistance to the aminoglycosides, 3rd generation chephalosporins, lower concentration cefepime but was susceptible to meropenem, fluoroquinolones, amikacin and high concentration of cefepime. The remaining resistant isolates were invariably susceptible to the fluoroquinolones while the majority were also susceptible to the aminoglycosides, meropenem and 3rd and 4th generation cephalosporins. From the clinical point of view, clinicians still have more than one choice of antimicrobials at their disposal to treat these resistant isolates. In conclusion, this research provides significant information about the antimicrobial resistance patterns of local clinical Aeromonas species and may guide clinicians to implement correct antimicrobial therapy. That is, if Aeromonas spp. are suspected or proven, then antimicrobials such as fluoroquinolones, aminoglycosides, carbapenems, 3rd and 4th generation cephalosporins can be safely administered.

Distribution and significance of virulence genes

In this study, the pathogenic potential of 129 genotypically-characterized isolates comprising 11 Aeromonas species was evaluated by detecting the presence of 13 virulence genes using a PCR-based method. Of these, 98 isolates were of clinical origin and 31 derived primarily from water and fish samples. Aeromonas was the sole aetiological agent in 60% of the cases while the remining 40% were isolated with another pathogen or as part of a polymicrobial bacterial population. The majority (17, 85%) of the isolates recovered from stools were from symptomatic patients who had watery diarrhoea or loose faeces and in some cases blood and leucocytes were present in the specimen. These parameters are usually associated with gastroenteritis. Although no clinical data was obtained in 31% of the clinical cases, Aeromonas was the only microorganism isolated in most (26, 84%) while 5 (16%) cases were polymicrobial. Strains isolated from fish derived mainly from diseased animals.

Overall, the majority of the isolates (96%) harboured at least one virulence gene compared to 65% of the total isolates from another study (Kingome et al. 1999). The number of virulence genes found in multidrug resistant isolates ranged from 1 to 4 with

-- 252 -- one isolate not included in the virulence study. These isolates were no more pathogenic, in terms of virulence genes detected, than others in the study. Therefore, there was not a relation between the most virulent strains and their antibiotic profile found. Results from this and other studies from locations as diverse as Mexico, Spain, Bangladesh, Italy, USA and Israel (Albert et al. 2000; Sechi et al. 2002; Sen and Rodgers 2004; Aguilera-Arreola et al. 2007; Senderovich et al. 2012) indicate that the distribution of virulence genes among the species is highly variable. Comparison between studies is difficult due to the number of isolates tested, source of isolation, identification method used to characterize isolates and choice of virulence genes (Sechi et al. 2002; Chacón et al. 2003; Wu et al. 2007). Some studies were designed to evaluate the virulence potential of different strains of the same species (Soler et al. 2002; Yu et al. 2005) while others targeted the detection of a single virulence gene from several species (Chacón et al. 2003; Yu et al. 2004). A recent study from Malaysia evaluated the pathogenic potential of 94 genotypically-characterized clinical isolates comprising five species by detecting the prevalence of 10 virulence genes (Puthucheary et al. 2012). Of these, only six (aerA, alt, ast, flaA, aspA and aexT) virulence genes were common with those used in this study. The prevalence of aerA and alt within the major species was remarkable similar with the present study while the prevalence of the remaining four genes differed significantly depending on the gene and the species.

In this study, aerA/haem was highly prevalent in WA isolates while the remaining virulence genes were randomly distributed among the species. And although many isolates harboured multiple virulence genes, not a single strain carried the full complement of the 13 virulence genes. Several virulence genes including alt, aspA, vasH, ascV and aexT were more prevalent in environmental rather than in clinical isolates. These differences were statistically significant and suggested that environmental isolates may represent a reservoir of potentially pathogenic strains. Any discernible virulence pattern present is tenuous and evidence from this study does not support that each species carried distinct sets of genes as reported by others (Kirov et al. 2002; Aguilera-Arreola et al. 2007; Puthucheary et al. 2012). In addition to A. dhakensis and A. hydrophila, strains from A. allosaccharophila and A. jandaei also harboured multiple virulence genes. The presence of multiple virulence genes or other virulence factors in less frequently isolated species suggest that strains from these species are potentially pathogen (Soler et al. 2002; Chacón et al. 2003; Senderovich et al. 2012).

-- 253 --

Although no single or combination of virulence factors has been unequivocally correlated to virulence in Aeromonas (Aguilera-Arreola et al. 2007), the presence of T3SS and toxin genes in clinical strains would elevate Aeromonas to the same category as the primary pathogens Y. enterocolitica, Salmonella enterica, enteropathogenic E. coli and Shigella flexnery (Chacón et al. 2004). The high prevalence of aerA/haem (81%) in clinical isolates suggests that strains possessing this virulence gene are potentially pathogenic and may be diarrhoeagenic in vivo (Janda and Abbott 2010) as both aerA and hlyA are considered virulence markers for Aeromonas (Heuzenroeder et al. 1999; González-Serrano et al. 2002). Thus, despite the low number of virulence genes detected among A. veronii bv. sobria isolates, the pathogenic potential previously attributed to this species (Daily et al. 1981; Janda et al. 1985; Janda and Kokka 1991; Kirov and Hayward 1993; Lye et al. 2007) should be maintained as every strain (100%) harboured the aerA/haem gene. It is also possible that the action of this toxin alone may account for the infectious process associated with strains harbouring aerA/haem in this study. Similarly, while the frequency of isolation and clinical relevance previously attributed to A. hydrophila has been overestimated (Figueras et al. 2009), isolation of this species from serious human infections continuous to grow. In a recent report, A. hydrophila was recovered from a posttraumatic brain abscess following a head injury and was described as an aggressive pathogen (Mahabeer et al. 2014). Unfortunately, the isolate was identified by a commercial system without further confirmation by a molecular method. Nevertheless, this case reinforces the pathogenic potential attributed to this species in particular and to Aeromonas in general.

The low number of virulence genes detected in A. caviae was consistent with previous reports and has been one of the main reasons to consider this species less pathogenic than A. veronii and A. hydrophila (Honda et al. 1985; Kirov et al. 1986; Majeed et al. 1990; Eley et al 1993; Martins et al. 2002). A lack of virulence genes is contrary to the notion that the presence of high number of virulence genes is associated with a high pathogenic potential among Aeromonas strains (Nawaz et al. 2010). However, growing evidence suggests that A. caviae should be considered a bona fide pathogen. Firstly, A. caviae strains can possess virulence factors considered to be significant in the pathogenesis of Aeromonas-associated infections (Callister and Agger 1987; Gray et al. 1990; Namdari and Bottone 1990b; Deodhar et al. 1991; Singh and Sanyal 1992b; Kirov and Hayward 1993; Shaw et al. 1995; Wang et al. 1996; Mokracka et al. 2001; Ghatak et al. 2006; Krzymińska et al. 2003, 2011). Secondly, the pathogenic potential

-- 254 -- of A. caviae is enhanced by animal passage suggesting that expression of virulence genes may be reactivated in genes that were previously repressed (Singh and Sanyal 1992c; Krzymińska et al. 2003). Thirdly, the predominance of A. caviae in diarrhoeal stools from neonates and children with gastroenteritis is further evidence that A. caviae should be considered a true enteric pathogen (Altwegg and Geiss 1989; Namdari and Bottone 1990b; Pazzaglia et al. 1990a; Moyer et al. 1991; Wilcox et al. 1992; Albert et al. 2000; Rabaan et al. 2001; Bravo et al. 2012; Senderovich et al. 2012). Evidence now exists for water-to-human transmission by members of the A. caviae-A. media group (Khajanchi et al. 2010). Fourthly, A. caviae has been implicated in serious human infections affecting immunocompetent individuals (Kumar et al. 2012). This would also support the notion that to date, there is no consensus as to which virulence factor(s) is the most critical for human infections (Chakraborty et al. 1987) and that a hierarchical classification of virulence factors for Aeromonas does not exist or cannot, at this stage, be established (Aguilera-Arreola et al. 2007).

Predicting virulence of Aeromonas isolates based on changes in transcription of c-jun and c-fos in human tissue culture cells has been recently proposed (Hayes et al. 2009) and although detection of virulence genes can be used to determine the pathogenic potential of Aeromonas, this method only demonstrates that some virulence genes are present in some strains but not in others. Instead, the study by Grim et al. (2013) demonstrated that genotypic differences correlated with functional virulence factor assays and allowed to identify a virulent pathotype of A. hydrophila capable of causing wound infections in humans. This study offers several advantages over the detection of virulence genes or the detection of virulence products by bioassays alone. Taken together, these observations suggest that the combinations of methods used by Grim et al. (2013) should be considered the standard method to evaluate the pathogenic potential of Aeromonas species and that a library of truly pathogenic strains should be created as previously proposed (Janda and Abbott et al. 2010).

CONCLUSIONS

The characterization of a large collection of clinical and environmental isolates indicate that in Western Australia the species A. veronii bv. sobria, A. dhakensis, A. caviae and A. hydrophila are the most prevalent. Characterization of isolates by genotypic methods is also likely to identify less frequently isolated species including A. allosaccharophila,

-- 255 --

A. salmonicida, A. bestiarum, A. jandaei, A.media, A. schubertii and uncover potentially novel species. From the clinical point of view, the antimicrobial susceptibilities determined in this study provide clinicians with several choices of antimicrobials to empirically initiate therapy if Aeromonas are suspected to be present. The detection of clinical and environmental isolates harbouring multiple virulence genes among several Aeromonas species contributes to the current knowledge on the virulence of these bacteria. Finally, data from this and other studies suggest that the pathogenic potential in Aeromonas is probably strain- rather than species-dependent.

-- 256 --

REFERENCES

Abbott, S. L., W. K. W. Cheung and J. M. Janda (2003). "The genus Aeromonas: biochemical characteristics, atypical reactions, and phenotypic identification schemes." Journal of Clinical Microbiology 41(6): 2348-2357. Abbott, S. L., W. K. W. Cheung, S. Kroske-Bystrom, et al. (1992). "Identification of Aeromonas strains to the genospecies level in the clinical laboratory." Journal of Clinical Microbiology 30(5): 1262-1266. Abbott, S. L., L. S. Seli, M. Catino Jr, et al. (1998). "Misidentification of unusual Aeromonas species as members of the genus Vibrio: a continuing problem." Journal of Clinical Microbiology 36(4): 1103-1104. Abdullah, A., C. A. Hart and C. Winstanley (2003). "Molecular characterization and distribution of virulence-associated genes amongst Aeromonas isolated from Libya." Journal of Applied Microbiology 95: 1001-1007. Abeyta Jr., C. and M. M. Wekell (1988). "Potential sources of Aeromonas hydrophila." Journal of Food Safety 9: 11-22. Abeyta Jr., C., C. A. Kaysner, M. M. Wekell, et al. (1986). "Recovery of Aeromonas hydrophila from oysters implicated in an outbreak of foodborne illness." Journal of Food Protection 49(8): 643-646. Abrami, L., M. Fivaz, E. Decroly, et al. (1998). "The pore forming toxin aerolysin is activated by furin." Journal of Biological Chemistry 271: 32656-32661. Abrami, L., M. Fivaz, P. E. Glauser, et al. (2003). "Sensitivity of polarized epithelial cells to the pore-forming toxin aerolysin." Infection and Immunity 71: 739-746. Abuhammour, W., R. A. Hasan and D. Rogers (2006). "Necrotizing fasciitis caused by Aeromonas hydrophila in an immnucompetent child." Pediatrics and Emergency Care 22(1): 48-51. Adekambi, T., T. M. Shinnick, D. Raoult, et al. (2008). "Ccomplete rpoB gene sequencing as a suitable supplement to DNA-DNA hybridization for bacterial species and genus delineation." International Journal of Systematic and Evolutionary Microbiology 58: 1807-1814. Agger, W. A. (1986). "Diarrhoea associated with Aeromonas hydrophila." Pediatric Infectious Disease 5(1): S106-S108. Agger, W. A., J. D. McCormick and M. J. Gurwith (1985). "Clinical and microbiological features of Aeromonas hydrophila-associated diarrhoea." Journal of Clinical Microbiology 21(6): 909-913. Aguilar, A., S. Merino, X. Rubires, et al. (1997). "Influence of osmolarity on lipopolyaccharides and virulence of Aeromonas hydrophila serotype O:34 strains grown at 37C." Infection and Immunity 65(4): 1245-1250. Aguilera-Arreola, M. G., G. Hernandez-Rodríguez, G. Zuñiga, et al. (2005). "Aeromonas hydrophila clinical and environmental ecotypes as revealed by genetic diversity and virulence genes." FEMS Microbiology Letters 242: 231- 240. Aguilera-Arreola, M. G., C. Hernadez-Rodríguez, G. Zuñiga, et al. (2007). "Virulence potential and genetic diversity of Aeromonas caviae, Aeromonas veronii, and Aeromonas hydrophila clinical isolates from Mexico and Spain: a comparative study." Canadian Journal of Microbiology 53: 877-887. Alavandi, S. V., M. S. Subashini and S. Ananthan (1999). "Occurrence of haemolytic and cytotoxic Aeromonas species in domestic water supplies in Chennai." Indian Journal of Medical Research 110: 50-55. Alavandi, S. V., S. Ananthan and N. P. Pramod (2001). "Typing of Aeromonas isolates from children with diarrhoea and water samples by randomly amplified

-- 257 --

polymorphic DNA polymerase chain reaction and whole cell protein fingerprinting." Indian Journal of Medical Research 113: 85-97. Al-Benwan, K., A. Abbott, J. M. Janda, et al. (2007). "Cystitis caused by Aeromonas caviae." Journal of Clinical Microbiology 45(7): 2348-2350. Albert, M. J., M. Ansaruzzaman, K. A. Talukder, et al. (2000). "Prevalence of enterotoxin genes in Aeromonas spp. isolated from children with diarrhea, healthy controls, and the environment." Journal of Clinical Microbiology 8(10): 3785-3790. Aldridge, P. and K. T. Hughes (2002). "Regulation of flagellar assembly." Current Opinions in Microbiology 5: 160-165. Ali, A., A. M. Carnahan, M. Altwegg, et al. (1996). “Aeromonas bestiarum sp. nov. (formerly genomospecies DNA group 2 A. hydrophila), a new species isolated from non-human sources.” Medical Microbiology Letters 5: 156-165. Allen, D. A., B. Austin and R. R. Colwell (1983). "Aeromonas media, a new species isolated from river water." International Journal of Systematic Bacteriology 33(3): 599-604. Alperi, A., A. J. Martínez-Murcia, A. Monera, et al. (2010a). "Aeromonas fluvialis sp. nov., isolated from a Spanish river." International Journal of Systematic and Evolutionary Microbiology 60: 72-77. Alperi, A., A. J. Martínez-Murcia, W. C. Ko, et al. (2010b). "Aeromonas taiwanensis sp. nov. and Aeromonas sanarelli sp. nov. two new clinical species from Taiwan." International Journal of Systematic and Evolutionary Microbiology 60(9): 2048-2055. Alperi, A., M. J. Figueras, I. Inza, et al. (2008). "Analysis of 16S rRNA gene mutations in a subset of Aeromonas strains and their impact in species delineation." International Microbiology 11: 185-194. Alperi, A. and M. J. Figueras (2010).“Human isolates of Aeromonas possess Shiga toxin genes (stx1 and stx2) highly similar to the most virulent gene variants of Escherichia coli.” Clinical Microbiology Infections 16: 1563-1567. Altorfer, R., M. Altwegg, J. Zollinger-Iten, et al. (1985). "Growth of Aeromonas spp. on cefsulodin-irgasan-novobiocin agar selective for Yersinia enterocolitica." Journal of Clinical Microbiology 22(4): 478-480. Altschul, S. F., W. Gish, W. Miller, et al. (1990). "Basic local alignment search tool." Journal of Molecular Biology 215: 403-410. Altwegg, M. (1985). "Aeromonas caviae: an enteric pathogen?." Infection 13(5): 228- 230. Altwegg, M. and J. Luthi-Hottesntein (1991). "Methods for the identification of DNA hybridization groups in the genus Aeromonas." Experientia 47: 403-406. Altwegg, M. and and H. K. Geiss (1989). "Aeromonas as a human pathogen." Critical Reviews in Microbiology 16(4): 253-286. Altwegg, M., G. Martinetti-Lucchini, J. Luthy-Hottenstein, et al. (1991a). "Aeromonas- associated gastroenteritis after consumption of contaminated shrimp." European Journal of Clinical Microbiology and Infectious Diseases 10(1): 44- 45. Altwegg, M., M. W. Reeves, R. Altwegg-Bissig, et al. (1991b). "Multilocus enzyme analysis of the genus Aeromonas and its use for species identification." Zentralblatt Bakteriologie und Hygiene 275: 28-45. Altwegg, M., R. Altwegg-Bissig, A. Demarta, et al. (1988). "Comparison of four typing methods for Aeromonas species " Journal of Diarrhoeal Disease Research 6(2): 88-94.

-- 258 --

Altwegg, M., A. G. Steigerwalt, R. Altwegg-Bissig, et al. (1990). "Biochemical identification of Aeromonas genospecies isolated from humans." Journal of Clinical Microbiology 28(2): 258-264. Ampel, N. and G. Peter (1981). "Aeromonas bacteraemia in a burn patient." Lancet 318: 987. Anderson, C. R. and G. M. Cook (2004). "Isolation and characterization of arsenate- reducing bacteria from arsenic-contaminated sites in New Zealand." Current Microbiology 48: 341-347. Angel, M. F., F. Zhang, M. Jones, et al. (2002). "Necrotizing fasciitis of the upper extremity resulting from a water moccasin bite." Southern Medical Journal 95: 1090-1094. Anguita, J., L. B. Rodríguez Aparicio and G. Naharrro (1993). "Purification, gene cloning, amino acid sequence analysis, and expression of an extracellular lipase from an Aeromonas hydrophila isolate." Applied and Environmental Microbiology 59(8): 2411-2417. Araujo, R. M., R. M. Arribas and R. Pares (1991). "Distribution of Aeromonas species in waters with different levels of pollution." Journal of Applied Bacteriology 71: 182-186. Araujo, R. M., R. M. Arribas, F. Lucena, et al. (1989). "Relation between Aeromonas and faecal coliforms in fresh waters." Journal of Applied Bacteriology 67: 213- 217. Aravena-Román, M., G. B. Harnett, T. V. Riley, et al. (2011b). "Aeromonas aquariorum is widely distributed in clinical and environmental specimens and can be misidentified as Aeromonas hydrophila." Journal of Clinical Microbiology 49(8): 3006-3008. Aravena-Román, M., T. T. J. Inglis, B. Henderson, et al. (2012). "Antimicrobial susceptibilities of Aeromonas strains isolated from clinical and environmental sources to 26 antimicrobial agents." Antimicrobial Agents and Chemotherapy 56 (2): 1110-1112. Aravena-Román, M., T.V. Riley, T. J. J. Inglis, et al. (2011a). "Phenotypic characteristics of human clinical and environmental Aeromonas in Western Australia." Pathology 43(4): 350-356. Aravena-Román, M., R. Beaz-Hidalgo, T.J. J. Inglis, et al. (2013). "Aeromonas australiensis sp. nov., isolated from irrigation water." International Journal of Systematic and Evolutionary Microbiology 63: 2270-2276. Aravena-Román, M., T. J. J. Inglis, T. V. Riley (2014). “Distribution of 13 virulence genes among clinical and environmental Aeromonas spp. in Western Australia.” European Journal of Clinical Microbiology and Infectious Diseases 33(11): 1889-1895. Asao, T., S. Kozaki, K. Kato, et al. (1986). "Purification and characterisation of an Aeromonas hydrophila haemolysin." Journal of Clinical Microbiology 24(2): 228-232. Asao, T., Y. Kinoshita, S. Kosaki, et al. (1984). "Purification and some properties of Aeromonas hydrophila haemolysin." Infection and Immunity 46(1): 122-127. Ascencio, F., W. Martínez-Arias, M. J. Romero, et al. (1998). "Analysis of the interaction of Aeromonas caviae, A. hydrophila and A. sobria with mucins." FEMS Immumology and Medical Microbiology 20: 219-229. Ascensio, F., A. Ljungh and T. Wadström (1991). "New lectins an other putative adhesins in Aeromonas hydrophila." Experientia 47: 414-416. Ash, C., A. J. Martínez-Murcia and M. D. Collins (1993a). "Identification of Aeromonas schubertii and Aeromonas jandaei by using a polymerase chain reaction-probe test." FEMS Microbiology Letters 108: 151-156.

-- 259 --

Ash, C., A. J. Martínez-Murcia and M. D. Collins (1993b). "Molecular identification of Aeromonas sobria by using a polymerase chain reaction-probe test." Medical Microbiology Letters 2 80-86. Ashbolt, N. J., A. Ball, M. Dorsch, et al. (1995). "The identification of human health significance of environmental aeromonads." Water Science Technology 31(5- 6): 263-269. Atkinson, H. M. and T. J. Trust (1980). "Haemagglutination properties and adherence ability of Aeromonas hydrophila." Infection and Immunity 27(3): 938-946. Atkinson, H. M., D. Adams, R. S. Savvas, et al. (1987). "Aeromonas adhesin antigen." Experientia 43: 372-374. Austin, B. and C. Adams (1996). "Fish pathogens." In B. Austin, M. Altwegg, P. J. Gosling and S. Joseph (ed), The genus Aeromonas, John Wiley & Sons Ltd., West Sussex, England: 197-243. Austin, B. and D. A. Austin (1987). "Disease in farmed and wild fish." In Laird: Bacterial Fish Pathogens: Ellis Horwood Limited, Chichester, England 111- 195. Austin, B., D. A. Austin, I. Dalsgaard, et al. (1998). "Characterization of atypical Aeromonas salmonicida by different methods." Systematic and Applied Microbiology 21: 50-64. Austin, D. A., D. McIntosh and B. Austin (1989). “Taxonomy of fish associated Aeromonas spp., with the description of Aeromonas salmonicida subsp. smithia subsp. nov.” Systematic and Applied Microbiology 11, 277-290. Awan, M. B., M. M. Ahmed, A. Bari, et al. (2006). "Putative virulence factors of the Aeromonas spp. isolated from food and enviroment in Abu Dhabi, United Arab Emirates." Journal of Food Protection 69(7): 1713-1716. Baddour, L. M., and V. S. Baselski (1988). "Pneumonia due to Aeromonas hydrophila- complex: epidemiologic, clinical, and microbiologic features." Southern Medical Journal 81(4): 461-463. Bakken, J. S., C. C. Sanders, R. B. Clark, et al. (1988). "B-lactam resistance in Aeromonas spp. caused by inducible B-lactamases active against penicillins, cephalosporins, and carbapenems." Antimicrobial Agents and Chemotherapy 32(9): 1314-1319. Balaji, V., M. V. Jesudason and G. Sridharan (2004). "Cytotoxin testing of environmental Aeromonas spp. in Vero cell culture." Indian Journal of Medical Research 119(5): 186-189. Barer, M. R., S. E. Millership and S. Tabaqchali (1986). "Relationship of toxin production to species in the genus Aeromonas " Journal of Medical Microbiology 22: 303-309. Barghouthi, S., R. Young, M. O. J. Olson, et al. (1989). "Amonabactin, a novel trytophan- or phenylalanine-containing phenolate siderophore in Aeromonas hydrophila." Journal of Bacteriology 171(4): 1811-1816. Barghouthi, S., S. M. Payne, J. E. L. Arcenaux, et al. (1991). "Cloning, mutagenesis, and nucleotide sequence of a siderophore biosynthetic gene (amoA) from Aeromonas hydrophila." Journal of Bacteriology 173(16): 5121-5128. Barillo, D. J., A. T. McManus, W. G. Cioffi, et al. (1996). "Aeromonas bacteraemia in burn patients." Burns 22: 48-52. Barlow, R. and K. Gobius (2009). "Environmental reservoirs of integrons: the contribution of production environments to the presence of integrons in beef cattle." Poster P20-01, p.139 Annual Meeting of the Australian Society for Microbiology. Perth, Western Australia. Barnett, T. C., S. M. Kirov, M. S. Ström, et al. (1997). "Aeromonas spp. possess at least two distinct type IV pilus families." Microbial Pathogens 23: 241-247.

-- 260 --

Bailey and Scott (1994). "Vibrios and related species, Aeromonas, Plesionomonas, Campylobacter, Helicobacter, and others." Diagnostic Microbiology, Ch. 31, p.429-444. Baron, J. E., L. R. Peterson and S. M. Finegold, editors, Mosby- Year Boon Inc. St. Louis, Missouri. Bartolome, R. M., A. Andreu, M. Xercavins, et al. (1989). "Urinary tract infection by Aeromonas hydrophila in a neonate." Infection 17: 172-173. Bauab, T. M., C. E. Levy, J. Rodrigues, et al. (2003). "Niche-specific association of Aeromonas ribotypes from human and environmental origin." Microbiology and Immunology 47(1): 7-16. Bauters, T. G. M., F. M. A. Buyle, G. Verschraegen, et al. (2007). "Infection risk related to the use of medicinal leeches." Pharmacy World and Science 29: 122- 125. Beaz-Hidalgo, R., A. Alperi, M. J. Figueras, et al. (2009). "Aeromonas piscicola sp. nov., isolated from diseased fish." Systematic and Applied Microbiology 32: 471-479. Beaz-Hidalgo, R., A. Alperi, N. Bujan, et al. (2010). "Comparison of phenotypical and genetic identification of Aeromonas strains isolated from diseased fish." Systematic and Applied Microbiology doi:10.1016/j.syapm.1010.02.002. Beaz-Hidalgo, R., A. Martínez-Murcia, M. J. Figueras (2013). "Reclassification of Aeromonas hydrophila subsp. dhakensis Huys et al. 2002 and Aeromonas aquariorum Martínez-Murcia et al. 2008 as Aeromonas dhakensis sp. nov. comb nov. and emendation of the species Aeromonas hydrophila." Systematic and Applied Microbiology 36: 171-176. Beaz-Hidalgo, R., and M. J. Figueras (2013). "Aeromonas spp. whole genomes and virulence factors implicated in fish disease." Journal of Fish Diseases doi:10.1111/jfd.12025. Bechet, M. and R. Blondeau (2003). "Factors associated with the adherence and biofilm formation by Aeromonas caviae on glass surfaces." Journal of Applied Microbiology 94: 1072-1078. Belland, R. J. and T. J. Trust (1987). "Cloning of the gene for the surface array protein of Aeromonas salmonicida and evidence linking loss of expression with genetic deletion." Journal of Bacteriology 169(9): 4086-4091. Berg, K. A., C. Lyra, R. Maarit Niemi, et al. (2011). "Virulence genes of Aeromonas isolates, bacterial endotoxins and cyanobacterial toxins from recreational water samples associated with human health symptons." Journal of Water and Health 94: 670-679. Bernheimer, A. W. and L. S. Avigad (1974). "Partial characterization of aerolysin, a lytic toxin from Aeromonas hydrophila." Infection and Immunity 9(6): 1016- 1021. Bhowmik, P., P. K. Bag, T. K. Hajra, et al. (2009). "Pathogenic potential of Aeromonas hydrophila isolated from surface waters in Kolkata, India." Journal of Medical Microbiology 58: 1549-1558. Bi, Z. X., Y. J. Liu and C. P. Lu (2007). "Contribution of AhyR to virulence of Aeromonas hydrophila J-1." Research in Veterinary Science 83: 150-156. Bingle, L. E. H., C. M. Bailey and M. J. Pallen (2008). "Type VI secretion: a beginner's guide." Current Opinions in Microbiology 11: 3-8. BioMérieux (2010). "E-test antimicrobial susceptibility testing for in-vitro diagnostic use." BioMérieux, Marcy-l'Etoile, France. Bitton, G. (2014). “Microbiology of drinking water: production and distribution.” John Wiley and Sons Inc. Hoboken, New Jersey. Blatz, D. J. (1979). "Open fracture of the tibia and fibula complicated by infection with Aeromonas hydrophila." Journal of Bone and Joint Surgery 61(A): 790-791.

-- 261 --

Bogdanovic, R., M. Cobeljic, M. Markovic, et al. (1991). "Haemolytic-uraemic syndrome associated with Aeromonas hydrophila enterocolitis " Pediatric Nephrology 5: 293-295. Bonadonna, L., R. Briancesco, M. Ciccozzi, et al. (2001). "Biotyping, serotyping and genotyping of aeromonads from environmental and clinical samples." World Journal of Microbiology and Biotechnology 17: 673-676. Bondi, M., P. Messi, E. Guerriere, et al. (2000). "Virulence profiles and other biological characters in water isolated Aeromonas hydrophila." Microbiological Reviews 23: 347-356. Borchardt, M. A., M. E. Stemper and J. H. Standridge (2003). "Aeromonas isolates from human diarrhoeic stool and groundwater compared by pulse-field gel electrophoresis." Emerging Infectious Diseases 9(2): 224-228. Borrell, N., M. J. Figueras and J. Guarro (1998). "Phenotypic identification of Aeromonas genomospecies from clinical and environmental sources." Canadian Journal of Microbiology 44: 103-108. Borrell, N., S. G. Acinas, M. J. Figueras, et al. (1997). "Identification of Aeromonas clinical isolates by restriction fragment length polymorphism of PCR-amplified 16S rRNA genes." Journal of Clinical Microbiology 35(7): 1671-1674. Bossi-Küpfer, M., A. Genini, R. Peduzzi, et al. (2007). "Tracheobronchitis caused by Aeromonas veronii biovar sobria after near-drowning." Journal of Medical Microbiology 56: 1563-1564. Boudewijns, M., J. M. Bakkers, P. D. Sturm, et al. (2006). "16s rRNA gene sequencing and the routine microbiology laboratory: a perfect marriage?" Journal of Clinical Microbiology 44(9): 3469-3470. Braun, M., K. Stüber, Y. Schlatter, et al. (2002). "Characterisation of an ADP- ribosyltransferase toxin (AexT) from Aeromonas salmonicida subsp. salmonicida." Journal of Bacteriology 184(7): 1851-1858. Bravo, L., A. Fernandez, F. A. Nuñez, et al. (2012). "Aeromonas spp. asociada a enfermedad diarreica aguda en Cuba: estudios de casos y controles." Microbiologia 29(1): 44-48. Bravo, L., L. Morier, N. Castañeda, et al. (2003). "Aeromonas: an emerging pathogen associated with extraintestinal infection in Cuba." Revista Cubana de Medicina Tropical 55(3): 208-209. Bricknell, I. R., T. J. Bowden, J. Lomax, et al. (1997). "Antibody response and protection of Atlantic salmon (Salmo salar) immunised with an extracellular polysaccharide of Aeromonas salmonicida." Fish and Shellfish Immunology 7: 1-16. Brodsky, R. A., G. L. Mukhina, K. L. Nelson, et al. (1999). "Resistance of paroxysmal nocturnal haemoglobinuria cell to the glycosylphosphatidylinositol-binding toxin aerolysin." Blood 93: 1749-1756. Brumlik, M. J., F. G. van der Goot, K. R. Wong, et al. (1997). "The disulfide bond in the Aeromonas hydrophila lipase/acyltransferase stabilizes the structure but is not required for secretion or activity." Journal of Bacteriology 179: 3116- 3121. Bryant, T. N., J. V. Lee, P. A. West, et al. (1986)."Numerical classification of species of Vibrio and related genera." Journal of Applied Bacteriology 61: 437-467. Bücker, R., S. M. Krug, R. Rosenthal, et al. (2011). "Aerolysin from Aeromonas hydrophila perturbs tight junction integrity and cell lesion repair in intestinal epithelial HT-29/B6 cells." Journal of Infectious Diseases 204: 1283-1292. Buckley, J. T. and S. P. Howard (1999). "The cytotoxic enterotoxin of Aeromonas hydrophila is aerolysin." Infection and Immunity 67(1): 466-467.

-- 262 --

Buckley, J. T., L. N. Halasa and S. McIntyre (1982). "Purification and partial characterization of a bacterial phospholipid:colesterol acyltransferase " Journal of Biological Chemistry 255: 3320-3325. Burgos, A., G. Quindos, R. Martínez, et al. (1990). "In vitro susceptibility of Aeromonas caviae, Aeromonas hydrophila and Aeromonas sobria to fifteen antibacterial agents." European Journal of Clinical Microbiology and Infectious Diseases 9: 413-417. Burke, V., J. Robinson, M. Gracey, et al. (1984). "Isolation of Aeromonas hydrophila from a metropolitan water supply: seasonal correlation with clinical isolates." Applied and Environmental Microbiology 48: 361-366. Burke, V., M. Gracey, J. Robinson, et al. (1983). "The microbiology of childhood gastroenteritis: Aeromonas species and other infective agents." Journal of Infectious Diseases 148(1): 68-74. Burr, S. E., D. B. Diep and J. T. Buckley (2001). "Type II secretion by Aeromonas salmonicida: evidence for two periplasmic pools of proaerolysin." Journal of Bacteriology 183(20): 5956-5963. Burr, S. E., K. Stüber and J. Frey (2003). "The ADP-ribosylating toxin, AexT, from Aeromonas salmonicida subsp. salmonicida is translocated via a type III secretion pathway." Journal of Bacteriology 185(22): 6583-6591. Burr, S. E., K. Stüber, T. Wahli, et al. (2002). "Evidence for a type III secretion system in Aeromonas salmonicida subsp salmonicida." Journal of Bacteriology 184: 5966-5970. Byers, B. R., G. Massad, S. Barghouthi, et al. (1991). "Iron acquisition and virulence in the motile aeromonads: Siderophore-dependent an -independent systems." Experientia 47: 416-418. Callister, S. M. and W. A. Agger (1987). "Enumeration and characterization of Aeromonas hydrophila and Aeromonas caviae isolated from grocery store produce." Applied and Environmental Microbiology 53(2): 249-253. Canals, R., M. Altarriba, S. Vilches, et al. (2006b). "Analysis of the lateral flagellar gene system of Aeromonas hydrophila AH-3." Journal of Bacteriology 188(3): 852-862. Canals, R., S. Ramírez, S. Vilches, et al. (2006a). "Polar flagellum biogenesis in Aeromonas hydrophila." Journal of Bacteriology 188(2): 542-555. Canonica, F. P. and M. A. Pisano (1988). "Gas-liquid chromatography analysis of fatty acid methyl esters of Aeromonas hydrophila, Aeromonas sobria, and Aeromonas caviae." Journal of Clinical Microbiology 26(4): 681-685. Cao, H., S. He, R. H. Wang, et al. (2012). "Bdellovibrios, potential biocontrol bacteria against pathogenic Aeromonas hydrophila. " Veterinary Microbiology 154: 413-418. Cao, H., S. He, R. Wei, et al. (2011). "Bacillus amyloliquefaciens G1: a potential antagonistic bacterium against eel-pathogenic Aeromonas hydrophila." Evidence-Based Complementary and Alternative Medicine Vol. 2011, doi:10.1155/824104. Cao, T. B., and M. H. Saier Jr (2001). "Conjugal type IV macromolecular transfer systems of Gram-negative bacteria: organismal distribution, structural constraints and evolutionary conclusions." Microbiology 147: 3201-3214. Cao, Y., S. He, Z. Zhou, et al. (2012). “Orally administered thermostable N-acyl homoserine lactonase from Bacillus sp. strain A196 attenuates Aeromonas hydrophila infection in zebrafish.” Applied and Environmental Microbiology 78:1899-1908.

-- 263 --

Carnahan, A., L. Hammontree, L. Bourgeois, et al. (1990). "Pyrazinamidase activity as a phenotypic marker for several Aeromonas spp. isolated from clinical specimens." Journal of Clinical Microbiology 28(2): 391-392. Carnahan, A. M. (1993). "Aeromonas taxonomy: a sea of change." Medical Microbiology Letters 2: 206-211. Carnahan, A. M., T. Chakraborty, G. R. Fanning, et al. (1991a). "Aeromonas trota sp. nov., an ampicillin-susceptible species isolated from clinical specimens." Journal of Clinical Microbiology 29(6): 1206-1210. Carnahan, A. M., S. Behram and S. W. Joseph (1991b). "Aerokey II: a flexible key for identifying clinical Aeromonas species." Journal of Clinical Microbiology 29(12): 2843-2849. Carnahan, A., G. R. Fanning and S. W. Joseph (1991c). "Aeromonas jandaei (formerly genospecies DNA group 9 A. sobria), a new sucrose-negative species isolated from clinical specimens." Journal of Clinical Microbiology 29(3): 560-564. Carrello, A., K. A. Silburn, J. R. Budden, et al. (1988). "Adhesion of clinical and environmental Aeromonas isolates to HEp-2 cells." Journal of Medical Microbiology 26: 19-27. Cascales, E. (2008). "The type VI secretion toolkit." European Molecular Biology Organization Reports 9: 735-741. Cascón, A., J. Anguita, C. Hernanz, et al. (1996). "Identification of Aeromonas hydrophila hybridization group 1 by PCR assays." Applied and Environmental Microbiology 62(4): 1167-1170. Cascón, A., J. Fregeneda, M. Aller, et al. (2000a). "Cloning, characterization, and insertional inactivation of a major extracellular serine protease gene with elastolytic activity from Aeromonas hydrophila." Journal of Fish Diseases 23: 49-59. Cascón, A., J. Yugueros, A. Temprano, et al. (2000b). "A major secreted elastase is essential for pathogenicity of Aeromonas hydrophila." Infection and Immunity 68(6): 3233-3241. Castro-Escarpulli, G., J. M. Figueras, M. G. Aguilera-Arreola, et al. (2003). "Characterisation of Aeromonas spp. isolated from frozen fish intended for human consumption in Mexico." International Journal of Food Microbiology 84: 41-49. Cattoir, V., L. Poirel, C. Aubert, et al. (2008). "Unexpected occurrence of plasmid- mediated quinolone resistance determinants in environmental Aeromonas spp." Emerging Infectious Diseases 14(2): 231-237. Chacón, M. R., G. Castro-Escarpulli, L. Soler, et al. (2002). "A DNA probe specific for Aeromonas colonies." Diagnostic Microbiology and Infectious Disease 44: 221-225. Chacón, M. R., L. Soler, E. A. Groisman, et al. (2004). "Type III secretion systems in clinical Aeromonas isolates." Journal of Clinical Microbiology 42(3): 1285- 1287. Chacón, M. R., M. J. Figueras, G. Castro-Escarpulli, et al. (2003). "Distribution of virulence genes in clinical and environmental isolates of Aeromonas spp." Antonie van Leeuwenhoek 84: 269-278. Chakraborty, T., A. Schmid, S. Notermans, et al. (1990). "Aerolysin of Aeromonas sobria: evidence for formation of ion-permeable channels and comparison with alpha-toxin of Staphylococcus aureus." Infection and Immunity 58(7): 2127- 2132. Chakraborty, T., B. Hubble, H. Bergbauer, et al. (1986). "Cloning, expression, and mapping of the Aeromonas hydrophila aerolysin gene determinant in Escherichia coli K-12." Journal of Bacteriology 167: 368-374.

-- 264 --

Chakraborty, T., B. Huhle, H. Hof, et al. (1987). "Marker exchange mutagenesis of the aerolysin determinant in Aeromonas hydrophila demonstrates the role of aerolysin in A. hydrophila -associated systemic infections." Infection and Immunity 55(9): 2274-2280. Chakraborty, T., M. A. Montenegro, S. C. Sanyal, et al. (1984). "Cloning of the enterotoxin gene from Aeromonas hydrophila provides conclusive evidence of production of a cytotonic enterotoxin." Infection and Immunity 46(2): 435-441. Champsaur, H., A. Andremont, D. Mathieu, et al. (1982). "Cholera-like illness due to Aeromonas sobria." Journal of Infectious Diseases 145(2): 248-254. Chan, F. K. L., J. Y. L. Ching, T. K. W. Ling, et al. (2000). "Aeromonas infection in acute suppurative cholangitis: review of 30 cases." Journal of Infection 40: 69- 73. Chan, S. S. W. and K. C. Ng (2004). "Aeromonas spp. and infectious diarrhea, Hong Kong." Emerging Infectious Diseases 10(8): 1506-1507. Chang, B. J. and S. M. Bolton (1987). "Plasmids and resistance to antimicrobial agents in Aeromonas sobria and Aeromonas hydrophila clinical isolates." Antimicrobial Agents and Chemotherapy 31(8): 1281-1282. Chang, C. F., T. L. Chen, T. W. Chen, et al. (2005). "Recurrent dialysis-associated Aeromonas hydrophila peritonitis: reports of two cases and review of the literature." Peritoneal Dialysis International 25: 496-499. Chang, M. C., S. Y. Chang, S. L. Chen, et al. (1992). "Cloning and expression in Escherichia coli of the gene encoding an extracellular deoxyribonuclease (DNase) from Aeromonas hydrophila." Gene 122: 174-180. Chang, B. J. and J. M. Janda (2005). “Chapter 59, Aeromonas”, p. 1524-1540. In S. P. Borriello, P. R. Murray, and G. Funke (ed.), Topley & Wilson’s microbiology and microbial infections, 10th ed., vol. 2. Hoder Arnold, London, United Kingdom. Chang, Y. C., J. Y. Wang, A. Selvam, et al. (2008). "Multiplex PCR detection of enterotoxin genes in Aeromonas spp. from suspected food samples in Northern Taiwan." Journal of Food Protection 71(10): 2094-2099. Chao, C. M., C. C. Lai, H. G. Tang, et al. (2013). “Skin and soft tissue infections caused by Aeromonas species.” European Journal of Clinical Microbiology and Infectious Diseases 32(4): 543-547. Chart, H., D. H. Shaw, E. E. Ishiguro, et al. (1984). "Structural and immunochemical homogeneity of Aeromonas salmonicida lipopolysaccharide." Journal of Bacteriology 158(1): 16-22. Chauret, C., C. Volk, R. Creason, et al. (2001). "Detection of Aeromomas hydrophila in a drinking-water distribution system: a field and pilot study." Canadian Journal of Microbiology 47(8): 782-768. Chen, J. P., F. Nagayama and M. C. Chang (1991). "Cloning and expression of a chitinase gene from Aeromonas hydrophila in Escherichia coli." Applied and Environmental Microbiology 57(8): 2426-2428. Chen, P. L., W. C. Ko and C. J. Wu (2012). "Complexity of β-lactamases among clinical Aeromonas isolates and its clinical implications." Journal of Microbiology, Immunology and Infection 45(6): 398-403 Chester, F. D. (1901). "The classification of bacteria." In: The Manual of Determinative Bacteriology p.234. The MacMillan Company, New York. Chim, H. and C. Song (2007). "Aeromonas in critically ill patients." Burns 33: 756-759. Chmel, H. and D. Armstrong (1976). "Acute arthritis caused by Aeromonas hydrophila: clinical and therapeutic aspects." Arthritis and Rheumatism 19: 169-172.

-- 265 --

Cho, S., J. Park, S. J. Park, et al. (2003). "Purification and characterization of extracellular temperature-stable serine protease from Aeromonas hydrophila." Journal of Microbiology 41: 207-211. Chopra, A. K., C. W. Houston, J. W. Peterson, et al. (1992a). "Cloning, expression, and sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila." Canadian Journal of Microbiology 39: 513-523. Chopra, A. K., T. N. Vo and C. W. Houston (1992b). "Mechanism of action of a cytotonic enterotoxin produced by Aeromonas hydrophila." FEMS Microbiology Letters 91: 15-20. Chopra, A. K., R. Pham and C. W. Houston (1994). "Cloning and expression of putative cytotonic enterotoxin-encoding genes from Aeromonas hydrophila." Gene 139: 87-91. Chopra, A. K. and C. W. Houston (1999a). "Authors' reply." Infection and Immunity 67(1): 466-467. Chopra, A. K. and C. W. Houston (1999b). "Enterotoxins in Aeromonas-associated gastroenteritis." Microbes and Infection 1: 1129-1137. Chopra, A. K., C. W. Houston, J. W. Peterson, et al. (1993). "Cloning, expression, and sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila. " Canadian Journal of Microbiology 39: 513-523. Chopra, A. K., J. W. Peterson, X. J. Xu, et al. (1996). "Molecular and biochemical characterization of a heat-labile cytotonic enterotoxin from Aeromonas hydrophila." Microbial Pathogens 21: 357-377. Chopra, A. K., X. J. Xu, R. D. Gonzalez, et al. (2000). "The cytotoxic enterotoxin of Aeromonas hydrophila induces proinflammatory cytokine production and activates arachidonic acid metabolism in macrophages." Infection and Immunity 68: 2808-2818. Chopra, A. K., J. Graf, A. J. Horneman, et al. (2009). "Virulence factor-activity relationships (VFAR) with specific emphasis on Aeromonas species." Journal of Water and Health 7 Suppl 1: 529-554. Christensen, H., M. Bisgaard, W. Frederiksen, et al. (2001). "Is characterization of a single isolate sufficient for valid publication of a new genus or species? Proposal to modify Recommendation 30b of the Bacterilogical Code (1990 Revision)." International Journal of Systematic and Evolutionary Microbiology 51: 2221-2225. Christie, P. J. (2001). "Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines." Molecular Microbiology 40(2): 294-305. Christie, P. J. and E. Cascales (2005). "Structural and dynamic properties of bacterial type IV secretion systems (Review)." Molecular Membrane Biology 22(1-2): 51-61. Chu, S., S. Cavaignac, J. Feutrier, et al. (1991). "Structure of the tetragonal surface virulence array protein and gene of Aeromonas salmonicida." Journal of Biological Chemistry 266(23): 15258-15265. Chu, W. H. and C. P. Lu (2005a). "Multiplex PCR assay for the detection of pathogenic Aeromonas hydrophila." Journal of Fish Diseases 28: 437-441. Chu, W. H. and C. P. Lu (2005b). "Role of microfilaments and microtubules in the invasion of EPC cells by Aeromonas hydrophila " Journal of Veterinary Medicine B 52: 180-182. Chu, Y. W., C. H. Wong, G. K. L. Tsang, et al. (2006). "Lack of association between presentation of diarrhoeal symptoms and faecal isolation of Aeromonas spp. amongst outpatients in Hong Kong." Journal of Medical Microbiology 55(3): 349-351.

-- 266 --

Chuang, H. C., Y. H. Ho, C. J. Lay, et al. (2011). "Different clinical characteristics among Aeromonas hydrophila, Aeromonas veronii biovar sobria and Aeromonas caviae monomicrobial bacteraemia." Journal of Korean Medicine 26(1415-1420). Chuang, Y. C., S. F. Chiou, J. H. Su, et al. (1997). "Molecular analysis and expression of the extracellular lipase of Aeromonas hydrophila MCC-2." Microbiology 143: 803-812. Clark, N. M. and C. E. Chenoweth (2003). "Aeromonas infection of the hepatobiliary system: report of 15 cases and review of the literature." Clinical Infectious Diseases 37: 506-513. Clark, R. B. (1992). "Antibiotic susceptibilities of the Vibrionaceae to meropenem and other antimicrobial agents." Diagnostic Microbiology and Infectious Disease 15(5): 453-455. Clinical and Laboratory Standards Institute (2006). "Methods for the antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria." 2nd ed, M45-A2, vol. 30, no. 18. Clinical and Laboratory Standards Institute. Wayne, PA. Clinical and Laboratory Standards Institute (2011). "Performance standards for antimicrobial susceptibility testing: 21st informational supplement." M100- S21, vol. 31, no. 1. Clinical and Laboratory Standards Institute. Wayne, PA. Coenye, T. and J. J. LiPuma (2002). "Use of the gyrB gene for the identification of Pandoraea species." FEMS Microbiology Letters 208: 15-19. Cohen, K. L., P. R. Holyk, L. R. McCarthy, et al. (1983). "Aeromonas hydrophila and Plesiomonas shigelloides endophthalmitis." American Journal of Ophthalmology 96: 403-404. Colaco, C. B. (1982). "Aeromonas hydrophila liver abscess." The Lancet 1(8273): 680. Collado, L., I. Cleenwerck, S. Van Trappen, et al. (2009). "Arcobacter mytili sp. nov., an indoxyl acetate hydrolysis negative bacterium isolated from mussels." International Journal of Systematic and Evolutionary Microbiology 59: 1391- 1396. Collins, M. D., A. J. Martínez-Murcia and J. Cai (1993). "Aeromonas enteropelogenes and Aeromonas ichtiosmia are identical to Aeromonas trota and Aeromonas veronii, respectively, as revealed by small-subunit rRNA sequence analysis." International Journal of Systematic Bacteriology 43(4): 855-856. Colston, S. M., M. S. Fullmer, L. Beka, et al. (2014). “Bioinformatic genome comparisons for taxonomic and phylogenetic assignments using Aeromonas as a test case.” mBio 5(6): 1-13. Colwell, R. R., M. T. MacDonell and J. De Ley (1986). "Proposal to recognize the family Aeromonadaceae fam. nov." International Journal of Systematic Bacteriology 36(3): 473-477. Couillault, C. and J. J. Eubank (2002). "Diverse bacteria are pathogens of Caenorhabditis elegans." Infection and Immunity 70: 4705-4707. Cowan, S. T. and K. J. Steel (1993). "Manual for the identification of medical bacteria." 3rd ed. Cambridge University Press, London. Cui, H., S. Hao and E. Arous (2007). "A distinct cause of necrotizing fasciitis: Aeromonas veronii bv. sobria." Surgical Infections 8: 523-528. Dacanay, A., L. Knickle, K. S. Solansky, et al. (2006). "Contribution of the type III secretion system (TTSS) to virulence of Aeromonas salmonicida subsp. salmonicida." Microbiology 152: 1847-1856. Daily, O. P., S. W. Joseph, J. C. Coolbaugh, et al. (1981). "Association of Aeromonas sobria with human infection." Journal of Clinical Microbiology 13(4): 769- 777.

-- 267 --

Davin-Regli, A., C. Bollet, E. Chamorey, et al. (1998). "A cluster of cases of infections due to Aeromonas hydrophila revealed by combined RAPD and ERIC-PCR." Journal of Medical Microbiology 47: 499-504. Davin-Regli, A., Y. Abed, R. N. Charrel, et al. (1995). "Variations in DNA concentrations significantly affect the reproducibility of RAPD fingerprint patterns." Research in Microbiology 146: 561-568. Davis II, W. A., J. G. Kane and V. F. Garagusi (1978). "Human Aeromonas infections: a review of the literature and a case report of endocarditis " Medicine Baltimore 57(3): 267-277. Davies, J. and D. Davies (2010). "Origins and evolution of antibiotic resistance." Microbiology and Molecular Biology Reviews 74(3): 417-433. de la Morena, M., R. Van, K. Singh, et al. (1993). "Diarrhea associated with Aeromonas species in children in day care centers." Journal of Infectious Diseases 168: 215-218. Dean, H. M. and R. M. Post (1967). "Fatal infection with Aeromonas hydrophila in a patient with acute myelogenous leukaemia." Annals of Internal Medicine 66: 1177-1179. Defoirdt, T., P. Bossier, P. Sorgeloos, et al. (2005). "The impact of mutations in the quorum sensing systems of Aeromonas hydrophila, Vibrio anguillarum and Vibrio harveyi on their virulence towards gnotobiotically cultured Artemia franciscana." Environmental Microbiology 7(8): 1239-1247. Delamare, A. P. L., S. O. P. Costa, M. M. Da Silveira, et al. (2000). "Growth of Aeromonas species on increasing concentrations of sodium chloride." Letters in Applied Microbiology 30: 57-60. Demarta, A., M. Tonolla, A. P. Caminada, et al. (1999). "Signature region within the 16S rDNA sequences of Aeromonas popoffii." FEMS Microbiology Letters 172: 239-246. Demarta, A., G. Huys, M. Tonolla, et al. (2004). "Polyphasic taxonomic study of "Aeromonas eucrenophila-like" isolates from clinical and environmental sources." Systematic and Applied Microbiology 27: 343-349. Demarta, D., M. Küpfer, P. Riegel, et al. (2008). "Aeromonas tecta sp. nov., isolated from clinical and environmental sources." Systematic and Applied Microbiology 46: 439-444. Deodhar, L. P., K. Saraswathi and A. Varudkar (1991). "Aeromonas spp. and their association with human diarrheal disease." Journal of Clinical Microbiology 29(5): 853-856. DePauw, B. E. and P. E. Verweij, Ed. (2005). "Infections in patients with haematologic malignancies." In: Principles and Practice of Infectious Diseases. G. L. Mandel, J. E. Bennet and R. Dolin eds. 6th Ed. Philadelphia, PA. 3432-3441. Desmond, E. and J. M. Janda (1986). "Growth of Aeromonas species in enteric agar." Journal of Clinical Microbiology 23(6): 1065-1067. Di Pietro, A., G. Picerno, C. Chirico, et al. (2005). "Aeromonas hydrophila exotoxin induces cytoplasmic vacuolation and cell death in VERO cells." The New Microbiologica 28: 251-259. Dickson, W. A., P. Boothman and K. Have (1984). "An unusual source of hospital wound infection." British Medical Journal 289: 1727-1728. Ding, Z., K. Atmakuri, P. J. Christie (2003). "The outs and ins of bacterial type IV secretion substrates." Trends in Microbiology 11(11): 527-535. Dodd, H. N. and J. M. Pemberton (1996). "Cloning, sequencing, and characterization of the nucH gene encoding an extracellular nuclease from Aeromonas hydrophila JMP636." Journal of Bacteriology 178(13): 3926-3933.

-- 268 --

Dodd, H. N. and J. M. Pemberton (1999). "The gene encoding a periplasmic deaoxyribonuclease from Aeromonas hydrophila." FEMS Microbiology Letters 173: 41-46. Dooley, J. S. G. and T. J. Trust (1988). "Surface protein composition of Aeromonas hydrophila strains virulent for fish: identification of a surface array protein." Journal of Bacteriology 170(2): 499-506. Dooley, J. S. G., H. Engelhardt, W. Baumeister, et al. (1989). "Three dimensional structure of the surface layer from the fish pathogen Aeromonas salmonicida." Journal of Bacteriology 171: 190-197. Dooley, J. S. G., R. Lallier, D. H. Shaw, et al. (1985). "Electrophoretic and immunochemical analyses of the lipopolysaccharides from various strains of Aeromonas hydrophila." Journal of Bacteriology 164(1): 263-269. Donohue, M. J., A. W. Smallgood, S. Pfaller, et al. (2006). "The development of a matrix-assisted laser desorption/ionization mass spectrometry-based method for the protein fingerprinting and identification of Aermonas species using whole cells." Journal of Microbiology Methods 65: 380-389. Donohue, M. J., J. M. Best, A. W. Smallgood, et al. (2007). "Differentiation of Aeromonas isolated from drinking water distribution systems using matix- assited laser desorption/ionization-mass spectrometry." Annals of Chemistry 79: 1939-1946. Dorsch, M., N. J. Ashbolt, P. T. Cox, et al. (1994). "Rapid identification of Aeromonas species using 16S rDNA targeted oligonucleotide primers: a molecular approach based on screening of environmental isolates." Journal of Applied Bacteriology 77: 722-726. Du, F. and J. E. Galan (2009). "Selective inhibition of type III secretion activated signalling by the Salmonella effector AvrA." PloS Pathogens 5(9): 1-12. East, A. K. and M. D. Collins (1993). "Molecular characterization of DNA encoding 23S rRNA and 16S-23S rRNA intergenic spacer regions of Aeromonas hydrophila." FEMS Microbiology Letters 106: 129-134. Edberg, S. C., F. A. Browne and M. Allen (2007). "Issues for microbial regulation: Aeromonas as a model." Critical Reviews in Microbiology 33: 89-100. Edwards, P. R. and W. H. Ewing (1972). "Identification of Enterobacteriaceae." 3rd Ed. Burgess Publishing Company, Minneapolis, MN USA. Eggset, G., R. Bjornsdottir, R. Mcqueen Leifson, et al. (1994). "Extracellular glycerophospholipid:cholesterol acyltransferase from Aeromonas salmonicida: activation by serine protease." Journal of Fish Diseases 17: 17-29. Egorov, A. I., J. M. Birkenhauer, C. P. Frebis, et al. (2011). "Occurrence of Aeromonas spp. in a random sample of drinking water distribution systems in the USA." Journal of Water and Health 09.4: 785-796. Elcuaz, R., J. del Pino, A. Fernandez, et al. (1995). "Peritonitis caused by Aeromonas caviae in a patient undergoing peritoneal dialysis." Clinical Microbiology Newsletters 17: 5-6. Eley, A., I. Geary and M. H. Wilcox (1993). "Growth of Aeromonas spp. at 4 degree C and related toxin production " Letters in Applied Microbiology 16: 36-39. Elhariry, H. M. (2011). “Biofilm formation by Aeromonas hydrophila on green-leafy vegetables: cabbage and lettuce.”Foodborne Pathogens and Disease 8(1): 125- 131. Ender, P. T. and M. J. Dolan (1997). "Pneumonia associated with near-drowning " Clinical Infectious Diseases 25: 896-907. Epple, H. J., J. Mankertz, R. Ignatius, et al. (2004). "Aeromonas hydrophila beta- haemolysis induces active chloride secretion in colon epithelial cells (HT- 29/B6)." Infection and Immunity 72: 4848-4858.

-- 269 --

Erova, T. E., J. Sha, A. J. Horneman, et al. (2007). "Identification of a new hemolysin from diarrheal isolate SSU of Aeromonas hydrophila." FEMS Microbiology Letters 275: 301-311. Erova, T. E., L. Pillai, A. A. Fadl, et al. (2006). "DNA adenine methyltransferase influences the virulence of Aeromonas hydrophila." Infection and Immunity 74(1): 410-424. Esteve, C., M. C. Gutierrez and A. Ventosa (1995a). "Aeromonas encheleia sp. nov., isolated from european eels." International Journal of Systematic Bacteriology 45(3): 462-466. Esteve, C., M. C. Gutierrez and A. Ventosa (1995b). "DNA relatedness among Aeromonas allosaccharophila strains and DNA hybridization groups of the genus Aeromonas." International Journal of Systematic Bacteriology 45(2): 390-391. Esteve, C. and T. H. Birkbeck (2004). "Secretion of haemolysins and proteases by Aeromonas hydrophila EO63: separation and characterization of the serine protease (caseinase) and the metalloprotease (elastase)." Journal of Applied Microbiology 96: 994-1001. Esteve, C., E. Alcaide, R. Canals, et al. (2004). "Pathogenic Aeromonas hydrophila serogroup O:14 and O:81 strains with an S layer." Applied and Environmental Microbiology 70(10): 5898-5904. Esteve, C., L. Valera, C. Gutierrez, et al. (2003). "Taxonomic study of sucrose-positive Aeromonas jandaei-like isolates from faeces, water and eels: emendation of A. jandaei Carnahan et al. 1992." International Journal of Systematic and Evolutionary Microbiology 53: 1411-1419. Esteve, C., E. Alcaide and M. D. Blasco (2012). "Aeromonas hydrophila ssp. dhakensis isolated from faeces, water and fish in mediterranean Spain." Microbes and Environments 27(4): 367-273. Evans, A. S. (1976). "Causation and disease: the Henle-Koch postulates revisited." Yale Journal of Biology and Medicine 49: 175-195. Facklam, R. R., L. G. Thacker, B. Fox, et al. (1982). "Presumptive identification of streptococci with a new test system." Journal of Clinical Microbiology 15(6): 987-990. Fadl, A. A., C. L. Galindo, J. Sha, et al. (2006). "Deletion of the genes encoding the type III secretion system and cytotoxic enterotoxin alters host responses to Aeromonas hydrophila infection." Microbial Pathogens 40: 198-210. Fakruddin, M., K. S. Bin Mannan and S. Andrews (2013). “Viable but Nonculturable Bacteria: Food Safety and Public Health Perspective.” International Scholarly Research Notices Microbiology Vol. 2013; Article ID 703813 doi.org/10.1155/2013/703813. Falkow, S. (2004). "Molecular Koch's postulates applied to bacterial pathogenicity - a personal recollection 15 years later." Nature Reviews Microbiology 2: 1-6. Fang, H. M., R. Ge and Y. M. Sin (2004). "Cloning, characterisation and expression of Aeromonas hydrophila major adhesin." Fish and Shellfish Immunology 16: 645-658. Fang, J. S., J. B. Chen, W. J. Chen, et al. (1999). "Haemolytic-uraemic syndrome in an adult male with Aeromonas hydrophila enterocolitis " Nephrology Dialysis Transplantion 14: 439-440. Fanning, G. R., F. W. Hickman-Brenner, J. J. Farmer III, et al. (1985). "DNA relatedness and phenotypic analysis of the genus Aeromonas." Abstracts of the Annual Meeting of the American Society for Microbiology, Abstr. C 116, p. 319.

-- 270 --

Farias Millezi, A., M. Cardoso, E. Alves, et al. (2013). “Reduction of Aeromonas hydrophila biofilm on stainless still surface by essential oils.” Brazilian Journal of Microbiology 44(1) doi.org/10.1590/S1517-8382201300500001. Fehr, D., C. Casanova, A. Liverman, et al. (2006). "AopP, a type III effector protein of Aeromonas salmonicida, inhibits the NF-kB signalling pathway." Microbiology 152: 2809-2818. Fenollar, F., P. E. Fournier and R. Legre (1999). "Unusual case of A. sobria cellulitis associated with the use of leeches." European Journal of Clinical Microbiology and Infectious Diseases 18: 72-73. Ferguson, M. R., X. J. Xu, C. W. Houston, et al. (1997). "Hyperproduction, purification, and mechanism of action of the cytotoxic enterotoxin produced by Aeromonas hydrophila." Infection and Immunity 65(10): 4299-4308. Figueira, V., I. Vaz-Moreira, M. Silva, et al. (2011). "Diversity and antibiotic resistance of Aeromonas spp. in drinking and waste water treatment plants." Water Research 45: 5599-5611. Figueras, M. J. (2005). "Clinical relevance of Aeromonas sM503." Reviews in Medical Microbiology 16: 145-153. Figueras, M. J., A. Alperi, M. J., Saavedra, et al. (2009). "Clinical relevance of the recently described species Aeromonas aquariorum." Journal of Clinical Microbiology 47(11): 3742-3746. Figueras, M. J., A. Suarez-Franquet, M. R. Chacón, et al. (2005). "First record of the rare species Aeromonas culicicola from a drinking water supply." Applied and Environmental Microbiology 71(1): 538-541. Figueras, M. J., L. Soler, M. R. Chacón, et al. (2000b). "Extended method for discrimination of Aeromonas spp. by 16S rDNA RFLP analysis." International Journal of Systematic and Evolutionary Microbiology 50: 2069-2073. Figueras, M. J., J. Guarro and A. Martinez-Murcia (2000a). “Clinically relevant Aeromonas species”. Clinical Infectious Diseases 30: 988-989. Figueras, M. J., M. J. Aldea, N. Fernandez, et al. (2007a). "Aeromonas haemolytic uremic syndrome. A case and a review of the literature." Diagnostic Microbiology and Infectious Disease 58: 231-234. Figueras, M. J., A. Alperi and J. Guarro (2007b). "On the identification of clinical Aeromonas by a new restriction fragment length polymorphism of 16S rRNA method." Letters in Applied Microbiology 45: 692-693. Figueras, M. J., R. Beaz-Hidalgo, L. Collado, et al. (2011b). "Recommendations for a new bacterial species description based on analysis of the unrelated genera Aeromonas and Arcobacter. " The Bulletin of Bergey's International Society for Microbial Systematics 2(1): 1-16. Figueras, M. J., A. Alperi, R. Beaz-Hidalgo, et al. (2011a). "Aeromonas rivuli sp. nov., isolated from the upstream region of a karst water rivulet in Germany." International Journal of Systematic and Evolutionary Microbiology 61: 242- 248. Figueras, M. J., A. Alperi, J. Guarro, et al. (2006). "Genotyping of isolates included in the description of a novel species should be mandatory." International Journal of Systematic and Evolutionary Microbiology 56: 1183. Figura, N. (1985). "A comparison of various media in the detection of Aeromonas spp. from stool samples" Boll Ist Sieroter Milan 64: 167-169. Figura, N., L. Marri, S. Verdiani, et al. (1986). "Prevalence, species differentiation, and toxigenicity of Aeromonas strains in cases of childhood gastroenteritis and in controls." Journal of Clinical Microbiology 23(3): 595-599.

-- 271 --

Figura, N. and P. Guglielmetti (1987). "Differentiation of motile and mesophilic Aeromonas strains into species by testing for a CAMP-like factor." Journal of Clinical Microbiology 25(7): 1341-1342. Filler, G., J. H. H. Ehrich, E. Strauch, et al. (2000). "Acute renal failure in an infant associated with cytotoxic Aeromonas sobria isolated from patient's stool and from aquarium water as suspected source of infection." Journal of Clinical Microbiology 38(1): 469-470. Flandry, F., E. J. Lisecki, G. J. Domingue, et al. (1989). "Initial antibiotic therapy for alligator bites: characterization of the oral flora of Alligator mississippiensis." Southern Medical Journal 82: 262-266. Fock, W. L., C. L. Chen, T. J. Lam, et al. (2001). "Roles of an endogenous serum lectin in the immune protection of the blue gourami Trichogaster trichopterus (Pallus) against Aeromonas hydrophila." Fish and Shellfish Immunology 11: 101-113. Fontes, M. C., M. J. Saavedra, A. Monera, et al. (2010). "Phylogenetic identification of Aeromonas simiae from a pig, first isolate since species description." Veterinary Microbiology 142:313-316. Fosse, T., C. Giraud-Morin and I. Madinier (2003a). "B-lactam-resistance phenotypes in the genus Aeromonas." Pathologie Biologie 51: 290-296. Fosse, T., C. Giraud-Morin and I. Madinier (2003b). "Induced colistin resistance as an identifying marker for Aeromonas phenospecies groups." Letters in Applied Microbiology 36: 25-29. Fosse, T., C. Giraud-Morin, I. Madinier, et al. (2003c). "Sequence analysis and biochemical characterisation of chromosomal CAV-1 (Aeromonas caviae), the parental cephalosporinase of plasmid-mediated AmpC "FOX" cluster." FEMS Microbiology Letters 222: 93-98. Fosse, T., I. Madinier, F. Mantoux, et al. (2004). "Aeromonas hydrophila with plasmid- borne class A extended-spectrum Beta-lactamase TEM-24 and three chromosomal class B,C, and D Beta-lactamases, isolated from a patient with necrotizing fasciitis." Antimicrobial Agents and Chemotherapy 48(6): 2342- 2343. Fox, G. E., J. D. Wisotzkey and P. Jurtshuk Jr. (1992). "How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity." International Journal of Systematic Bacteriology 42: 166-170. Francki, K. T. and B. J. Chang (1994). "Variable expression of O-antigen and the role of lipopolysaccharide as an adhesin in Aeromonas sobria." FEMS Microbiology Letters 122: 97-102. Freij, B. J. (1984). "Aeromonas: biology of the organism and diseases in children." Pediatric Infectious Disease 3(2): 164-174. Freij, B. J. (1985). "The spectrum of Aeromonas infections." Clinical Reviews in Pediatric Infectious Diseases 143-155. Fricke, W. F., T. J. Welch, P. F. McDermott, et al. (2009). “Comparative genomics of the IncA/C multidrug resistance plasmid family.” Journal of Bacteriology 191(15): 4750-4757. Froquet, R., N. Cherix, S. E. Burr, et al. (2007). "Alternative host model to evaluate Aeromonas virulence." Applied and Environmental Microbiology 73(17): 5657-5659. Fyfe, L., G. Coleman and A. L. S. Munro (1988). "The combined effect of isolated Aeromonas salmonicida protease and haemolysin on Atlantic salmon, Salmo salar L., compared with that of a total extracellular products preparation." Journal of Fish Diseases 11: 101-104.

-- 272 --

Galindo, C. L., A. A. Fadl, J. Sha, et al. (2005). "Microarray and proteomics analyses of human intestinal epithelial cells treated with the Aeromonas hydrophila cytotoxic enterotoxin." Infection and Immunity 73(5): 2628-2643. Galindo, C. L., A. A. Fadl, J. Sha, et al. (2004). "Aeromonas hydrophila cytotoxic enterotoxin activates mitogen-activated protein kinases and induces apoptosis in murine macrophages and human intestinal epithelial cells." Journal of Biological Chemistry 279(36): 37597-37612. Galindo, C. L., J. Sha, A. A. Fadl, et al. (2006). "Host immune responses to Aeromonas virulence factors." Current Immunological Reviews 2: 13-26. Galindo, C. L., J. Sha, D. A. Ribardo, et al. (2003). "Identification of Aeromonas hydrophila cytotoxic enterotoxin-induced genes in macrophages using microaarrays." Journal of Biological Chemistry 278(41): 40198-40212. Gascón, J. (2006). "Epidemiology, etiology and pathophysiology of traveler's diarrhea." Digestion 73((suppl 1)): 102-108. Gascón, J., L. Ruiz, J. Canela, et al. (1993). "Epidemiologia de la diarrea del viajero turistas españoles a paises en desarrollo." Medicina Clinica 100: 365-367. Gavin, R., A. A. Rabaan, S. Merino, et al. (2002). "Lateral flagella of Aeromonas species are essential for epithelial cell adherence and biofilm formation." Molecular Microbiology 43(2): 383-397. Gavin, R., S. Merino, M. Altarriba, et al. (2003). "Lateral flagella are required for increased cell adherence, invasion and biofilm formation by Aeromonas spp." FEMS Microbiology Letters 224: 77-83. George, W. L., M. J. Jones and M. M. Nakata (1986). "Phenotypic characteristics of Aeromonas species isolated from adult humans." Journal of Clinical Microbiology 23(6): 1026-1029. Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2006). "Comparative study of cytotoxicity of Aeromonas spp. on four different cell lines." Comparative Immunology and Microbiological Infectious Diseases 29: 232-240. Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2007a). "Species identification of clinically important Aeromonas spp. by restriction fragment length polymorphism of 16S rDNA." Letters in Applied Microbiology 44: 550-554. Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2007b). " Reply." Letters in Applied Microbiology 45: 694. Girlich, D., L. Poirel and P. Nordmann (2010). "PER-6, an extended-spectrum B- lactamase from Aeromonas allosaccharophila." Antimicrobial Agents and Chemotherapy 54: 1619-1622. Gobat, P. F. and T. Jemmi (1993). "Distribution of mesophilic Aeromonas species in raw and ready-to-eat fish and meat products in Switzerland." International Journal of Food Microbiology 20: 117-120. Gold, W. L. and I. E. Salit (1993). "Aeromonas hydrophila infections of skin and soft tissue: report of 11 cases and review." Clinical Infectious Diseases 16: 69-74. Gonçalves, J. R., G. Brum, A. Fernandes, et al. (1992). "Aeromonas hydrophila fulminant pneumonia in a fit young man." Thorax 47: 482. Goñi-Urriza, M., C. Arpin, M. Capdepuy, et al. (2002). "Type II topoisomerase quinolone resistance-determining regions of Aeromonas caviae, A. hydrophila, and A. sobria complexes and mutations associated with quinolone resistance." Antimicrobial Agents and Chemotherapy 46(2): 350-359. Goñi-Urriza, M., L. Pineau, M. Capdepuy, et al. (2000). "Antimicrobial resistance of mesophilic Aeromonas spp. isolated from two European rivers." Journal of Antimicrobial Chemotherapy 46: 297-301.

-- 273 --

González-Barca, E., C. Ardanuy, J. Carratala, et al. (1997). "Fatal myofascial necrosis due to imipenem-resistant Aeromonas hydrohila." Scandinavian Journal of Infectious Diseases 29: 91-92. González-Serrano, C. J., J. A. Santos, M. L. García-López, et al. (2002). "Virulence markers in Aeromonas hydrophila and Aeromonas veronii biovar sobria isolates from freshwater fish and from a diarrhoea case." Journal of Applied Microbiology 93: 414–419. Goodwin, C. S., W. E. S. Harper, J. K. Stewart, et al. (1983). "Enterotoxigenic Aeromonas hydrophila and diarrhea in adults " Medical Journal of Australia 1: 25-26. Gosling, P. J. (1986). "Biochemical characteristics, enterotoxigenicity and susceptibility to antimicrobial agents of clinical isolates of Aeromonas species encountered in the western region of Saudi Arabia." Journal of Medical Microbiology 22: 51- 55. Gracey, M., V. Burke and J. Robinson (1982b). "Aeromonas-associated gastroenteritis." The Lancet ii(8311): 1304-1306. Gracey, M., V. Burke, J. Robinson, et al. (1984). "Aeromonas spp. in travellers' diarrhoea." British Medical Journal 289: 658. Gracey, M., V. Burke, R. C. Rockhill, et al. (1982a). "Aeromonas species as enteric pathogens." The Lancet 1(8265): 223-224. Graf, J. (1999a). "Diverse restriction fragment length polymorphism patterns of the PCR-amplified 16S rRNA genes in Aeromonas veronii strains and possible misidentification of Aeromonas species." Journal of Clinical Microbiology 37(10): 3194-3197. Graf, J. (1999b). "Symbiosis of Aeromonas veronii biovar sobria and Hirudo medicinalis, the medicinal leech: a novel model for digestive tract associations." Infection and Immunity 67(1): 1-7. Graf, J. (2000). "Symbiosis of Aeromonas and Hirudo medicinalis, the medicinal leech " ASM News 66: 147-153. Granum, P. E., K. O'Sullivan, J. M. Tomas, et al. (1998). "Possible virulence factors of Aeromonas spp. from food and water." FEMS Immunology and Medical Microbiology 21: 131-137. Gray, S. J., D. J. Stickler and T. N. Bryant (1990). "The incidence of virulence factors in mesophilic Aeromonas species isolated from farm animals and their environment." Epidemiology and Infection 105: 277-294. Grim, C. J., E. V. Kozlova, J. Sha, et al. (2013). "Characterization of Aeromonas hydrophila wound pathotypes by comparative genomic and functional analyses of virulence genes." Molecular Biology 4(2): e00064-13. Gryllos, I., J. G. Shaw, R. Gavin, et al. (2001). "Role of flm locus in mesophilic Aeromonas species adherence." Infection and Immunity 69(1): 65-74. Gudmunsdottir, B. K., I. Hvanndal, B. Bjornsdottir, et al. (2003). "Analysis of exotoxins produced by atypical isolates of A. salmonicida, by enzymatic and serological methods." Journal of Fish Diseases 26: 15-29. Guerra, I. M. F., R. Fadanelli, M. Figueiró, et al. (2007). "Aeromonas associated diarrhoeal disease in south Brazil: prevalence, virulence factors and antimicrobial resistance." Brazilian Journal of Microbiology 38: 638-643. Gustafson, C. E., C. J. Thomas and T. J. Trust (1992). "Detection of Aeromonas salmonicida from fish by using polymerase chain reaction amplification of the virulence surface array protein gene." Applied and Environmental Microbiology 58(12): 3816-3825. Hadi, N., Q. Yang, T. C. Barnett, et al. (2012). "Bundle-forming pilus locus of A. veronii bv. sobria." Infection and Immunity 80(4): 1351-1360.

-- 274 --

Han, H. J., T. Taki, H. Kondo, et al. (2008). "Pathogenic potential of a collagenase gene from Aeromonas veronii." Canadian Journal of Microbiology 54: 1-10. Hänninen, M. L. (1994). "Phenotypic characteristics of the three hybridization groups of Aeromonas hydrophila complex isolated from different sources." Journal of Applied Bacteriology 76: 455-462. Hänninen, M. L. and A. Siitonen (1995). "Distribution of Aeromonas hydrophila phenospecies and genospecies among strains isolated from water, foods or from human clinical samples." Epidemiology and Infection 115: 39-50. Hänninen, M. L. and V. Hirvela-Koski (1997). "Pulse-field gel electrophoresis in the study of mesophilic and psychrophilic Aeromonas spp." Journal of Applied Microbiology 83: 493-498. Hänninen, M. L., J. Ridell and V. Hirvela-Koski (1995b). "Phenotypic and molecular characteristics of Aeromonas salmonicida subsp. salmonicida isolated in southern and northern Finland." Journal of Applied Bacteriology 79: 12-21. Hänninen, M. L., S. Salmi and A. Siitonen (1995c). "Maximum growth temperature ranges of Aeromonas spp. isolated from clinical and environmental sources." Microbial Ecology 29: 259-267. Hänninen, M. L., S. Salmi, L. Mattila, et al. (1995a). "Association of Aeromonas spp. with traveller's diarrhoea in Finland." Journal of Medical Microbiology 42: 26- 31. Haque, Q. M., A. Sugiyama, Y. Iwade, et al. (1996). "Diarrhoeal and environmental isolates of Aeromonas spp. produce a toxin similar to Shiga-like toxin I." Current Microbiology 32: 239-245. Hatje, E., H. E. Neuman and and M. Katouli (2011). "Pathogenesis of Aeromonas strains and the impact of probiotics using a human gut epithelium cell line." Australian Society for Microbiology Annual General Meeting. Hobart, Tasmania. Abstract 121: 132. Harf-Monteil, C., A. Le Fleche, P. Riegel, et al. (2004). "Aeromonas simiae sp. nov., isolated from monkey faeces." International Journal of Systematic and Evolutionary Microbiology 54: 481-485. Harikhrishnan, R., C. Balasundaram and M. Heo (2010a). "Effects of probiotics enriched diet on Paralychthis olivaceus infected with lymphocystis disease virus (LCDV). " Fish and Shellfish Immunology 29: 868-874. Harikrishnan, R., M. C. Kim, J. S. Kim, et al. (2010b). "Immune response and expression analysis of cathepsin K in goldfish during Aeromonas hydrophila infection." Fish and Shellfish Immunology 28: 511-516. Harris, R. L., V. Fainstein, L. Elting, et al. (1985). "Bacteremia caused by Aeromonas species in hospitalised cancer patients." Reviews of Infectious Diseases 7(3): 314-320. Havelaar, A. H., F. M. Schets, A. van Silfhout, et al. (1992). "Typing of Aeromonas strains from patients with diarrhoea and from drinking water." Journal of Applied Bacteriology 72: 435-444. Hayes, S. L., M. Waltmann, M. Donohue, et al. (2009). "Predicting virulence of Aeromonas isolates based on changes in transcription of c-jun and c-fos in human tissue culture cells." Journal of Applied Microbiology 107: 964-969. Hazen, T. C. (1979). "Ecology of Aeromonas hydrophila in a South Carolina cooling reservoir." Microbial Ecology 5: 179-195. Heckerling, P. S., T. M. Stine, J. C. Pottage Jr., et al. (1983). "Aeromonas hydrophila myonecrosis and gas gangrene in a nonimmunocompromised host." Archives of Internal Medicine 143: 2005-2006. Hedges, R. W., A. A. Medeiros, M. Cohenford, et al. (1985). "Genetic and biochemical properties of AER-1, a novel carbenicillin-hydrolysing beta-lactamase from

-- 275 --

Aeromonas hydrophila." Antimicrobial Agents and Chemotherapy 27(4): 479- 484. Heuzenroeder, M. W., C. Y. F. Wong and R. L. P. Flower (1999). "Distribution of two haemolytic toxin genes in clinical and environmental isolates of Aeromonas spp.: correlation with virulence in a suckling mouse model." FEMS Microbiology Letters 174: 131-136. Hickman-Brenner, F. W., K. L. MacDonald, A. G. Steigerwalt, et al. (1987). "Aeromonas veronii, a new ornithine decarboxylase-positive species that may cause diarrhoea." Journal of Clinical Microbiology 25(5): 900-906. Hickman-Brenner, F. W., G. R. Fanning, M. J. Arduino, et al. (1988). "Aeromonas schuberti, a new mannitol-negative species found in human clinical specimens." Journal of Clinical Microbiology 26(8): 1561-1564. Higgins, M., J. Carson and N. Gudkovs (2007). "Development of an improved identification matrix for Aeromonas salmonicida." World Association of Veterinary Laboratory Diagnosticians. 13th International Symposium, Melbourne, Australia. Concurrent Session 2.2. Hill, K. R., F. H. Caselitz and L. M. Moody (1954)."A case of acute, metastatic, myositis caused by a new organism of the family: Pseudomonadaceae." Wisconsin Medical Journal 3: 9-11. Hiraga, K., L. Shou, M. Kitazawa, et al. (1997). "Isolation and characterization of chitinase from a flake-chitin degrading marine bacterium, Aeromonas hydrophila H2330." Bioscience Biotechnology and Biochemistry 61: 174-176. Hiransuthikul, N., W. Tantisiriwat, K. Lertutsahakul, et al. (2005). "Skin and soft tissue infections among tsunami survivors in southern Thailand." Clinical Infectious Diseases 41: e93-e96. Hird, D. W., S. L. Diesch, R. G. McKinnell, et al. (1983). "Enterobacteriaceae and Aeromonas hydrophila in Minnesota frogs and tadpoles (Rana pipiens)." Applied and Environmental Microbiology 46(6): 1423-1425. Hirono, I. and T. Aoki (1991). "Nucleotide sequence and expression of an extracellular hemolysin gene of Aeromonas hydrophila." Microbial Pathogens 11: 189-197. Hirono, I. and T. Aoki (1993). "Cloning and characterisation of the three haemolysin genes of Aeromonas salmonicida." Microbial Pathogens 15: 269-282. Hirono, I., T. Aoki, T. Asao, et al. (1992). "Nucleotide sequences and characterization of haemolysin genes from Aeromonas hydrophila and Aeromonas sobria." Microbial Pathogens 13: 433-446. Ho, A. S. Y., T. A. Mietzner, A. J. Smith, et al. (1990). "The pili of Aeromonas hydrophila: identification of an environmentlly regulated "mini pilin"." Journal of Experimental Medicine 172: 795-806. Hokama, A. and M. Iwanaga (1991). "Purification and characterization of Aeromonas sobria pili, a possible colonization factor." Infection and Immunity 59(10): 3478-3483. Hokama, A. and M. Iwanaga (1992). "Purification and characterization of Aeromonas sobria Ae24 pili: a possible new colonization factor." Microbial Pathogens 13: 325-334. Hokama, A., Y. Honma and N. Nakasone (1990). "Pili of an Aeromonas hydrophila strain as a possible colonization factor." Microbiology and Immunology 34(11): 901-915. Holmberg, S. D. and J. J. Farmer III (1984). "Aeromonas hydrophila and Plesiomonas shigelloides as causes of intestinal infections." Review of Infectious Diseases 6: 633-639.

-- 276 --

Honda, T., M. Sato, T. Nishimura, et al. (1985). "Demonstration of cholera toxin-related factor in cultures of Aeromonas species by Enzyme-Linked Immunosorbent Assay." Infection and Immunity 50(1): 322-323. Hondur, A. K., K. Bilgihan, M. Y. Clark, et al. (2008). "Microbiologic study of soft contact lenses after laser subepithelial keratectomy for myopia." Eye Contact Lens 34: 24-27. Honma, Y. and N. Nakasone (1990). "Pili of Aeromonas hydrophila: purification, characterization and biological role." Microbiology and Immunology 34(2): 83- 98. Howard, S. P. and J. T. Buckley (1985). "Protein export by a Gram-negative bacterium: production of aerolysin by Aeromonas hydrophila." Journal of Bacteriology 161: 1118-1124. Howard, S. P. and J. T. Buckley (1986). "Molecular cloning and expression in Escherichia coli of the structural gene for the haemolytic toxin aerolysin from Aeromonas hydrophila." Molecular Genetics and Genomics 204: 289-295. Howard, S. P., W. J. Garland, M. J. Green, et al. (1987). "Nucleotide sequence of the gene for the hole-forming toxin aerolysin of Aeromonas hydrophila." Journal of Bacteriology 169(6): 2869-2871. Hsueh, P. R., L. J. Teng, N. Lee, et al. (1998). "Indwelling device-related and recurrent infections due to Aeromonas species." Clinical Infectious Diseases 26: 651- 658. Hua, H. T., C. Bollet, S. Tercian, et al. (2004). "Aeromonas popoffii urinary tract infection." Journal of Clinical Microbiology 42(11): 5427-5428. Huang, L. J., H. P. Chen, T. L. Chen, et al. (2006). "Secondary Aeromonas peritonitis is associated with polymicrobial ascites culture and absence of liver cirrhosis compared to primary Aeromonas peritonitis." Acta Pathologica Microbiologica et Immunologica Scandinavica 114: 772-778. Huddleston, J. R., J. C. Zak and R. M. Jeter (2006). "Antimicrobial susceptibilities of Aeromonas spp. isolated from environmental sources." Applied and Environmental Microbiology 72(11): 7036-7042. Huddleston, J. R., J. C. Zak and R. M. Jeter (2007). "Sampling bias created by ampicillin in isolation media for Aeromonas. " Canadian Journal of Microbiology 53: 39-44. Huddleston, J. R., J. M. Brokaw, J. C. Zak, et al. (2013). "Natural transformation as a mechanism of horizontal gene transfer among environmental Aeromonas spp." Systematic and Applied Microbiology 36(4): 224-234. Hudson, J. A., and K. M. De Lacy (1991). "Incidence of motile aeromonads in New Zeland retail foods." Journal of Food Protection 54(9): 696-699. Hugo, W. B., and E. G. Beveridge (1962). "A quantitative and qualitative study of the lipolytic activity of single strains of seven bacterial species." Journal of Applied Bacteriology 25: 72-82. Hunter, P. R. (1993). "The microbiology of bottled natural mineral waters." Journal of Applied Microbiology 74: 345-352. Hunter, W. J. and L. D. Kuykendall (2006). "Identification and characterisation of an Aeromonas salmonicida (syn Haemophilus piscium) strain that reduces selenite to elemental red selenium." Current Microbiology 52: 305-309. Husslein, V., B. Huhle, T. Jarchau, et al. (1988). "Nucleotide sequence and transcriptional analysis of the aerCaerA region of Aeromonas sobria encoding aerolysin and its regulatory region." Molecular Microbiology 2(4): 507-517. Husslein, V., H. Bergbauer and T. Chakraborty (1991). "Studies on aerolysin and a serine protease from Aeromonas trota sp. nov." Experientia 47: 420-421.

-- 277 --

Husslein, V., T. Chakraborty, A. Carnahan, et al. (1992). "Molecular studies on the aerolysin gene of Aeromonas species and discovery of a species-specific probe for Aeromonas trota species nova." Clinical Infectious Diseases 14: 1061- 1068. Huys, G., M. Vancanneyt, R. Coopman, et al. (1994). "Cellular fatty acid composition as a chemotaxonomic marker for the differentiation of phenospecies and hybridization groups in the genus Aeromonas." International Journal of Systematic Bacteriology 44(4): 651-658. Huys, G. and J. Swings (1999). "Evaluation of a fluorescent amplified fragment length polymorphism (FAFLP) methodology for the genotypic discrimination of Aeromonas taxa." FEMS Microbiology Letters 177: 83-92. Huys, G., I. Kersters, M. Vancanneyt, et al. (1995). "Diversity of Aeromonas sp. in Flemish drinking water production plants as determined by gas-liquid chromatographic analysis of cellular fatty acid methyl esters (FAMEs)." Journal of Applied Bacteriology 78: 445-455. Huys, G., P. Käempfer, M. JohnAlbert, et al. (2002a). "Aeromonas hydrophila subsp. dhakensis subsp. nov., isolated from children with diarrhoea in Bangladesh, and extended description of Aeromonas hydrophila subsp. hydrophila (Chester 1901) Stanier 1943 (approved lists 1980)." International Journal of Systematic and Evolutionary Microbiology 52: 705-712. Huys, G., R. Denys and J. Swings (2002b). "DNA-DNA reassociation and phenotypic data indicate synonymy between Aeromonas enteropelogenes Schubert et al. 1990 and Aeromonas trota Carnahan et al. 1991." International Journal of Systematic and Evolutionary Microbiology 52: 1969-1972. Huys, G., M. Cnockaert and J. Swings (2005). "Aeromonas culicicola Pidiyar et al. 2002 is a later subjective synonym of Aeromonas veronii Hickman-Brenner et al. 1987." Systematic and Applied Microbiology 28: 604-609. Huys, G., P. Käempfer and J. Swings (2001). "New DNA-DNA hybridization and phenotypic data on the species Aeromonas ichthiosmia and Aeromonas allosaccharophila: A. ichthiosmia Schubert et al. 1990 is a later synonym of A. veronii Hickman-Brenner et al. 1987." Systematic and Applied Microbiology 24: 177-182. Huys, G., M. Pearson, P. Käempfer, et al. (2003). "Aeromonas hydrophila subsp. ranae subsp. nov., isolated from septicaemic frogs in Thailand." International Journal of Systematic and Evolutionary Microbiology 53: 885-891. Huys, G., P. Käempfer, M. Altwegg, et al. (1997a). "Inclusion of Aeromonas DNA hybridization group 11 in Aeromonas encheleia and extended descriptions of the species Aeromonas eucrenophila and A. encheleia." International Journal of Systematic Bacteriology 47(4): 1157-1164. Huys, G., P. Käempfer, M. Altwegg, et al. (1997b). "Aeromonas popoffii sp. nov., a mesophilic bacterium isolated from drinking water production plants and reservoirs." International Journal of Systematic Bacteriology 47(4): 1165- 1171. Huys, G., M. Altwegg, M. L. Hänninen, et al. (1996a). "Genotypic and chemotaxonomic description of two subgroups in the species Aeromonas eucrenophila and their affiliation to A. encheleia and Aeromonas DA hybridization group 11." Systematic and Applied Microbiology 19: 616-623. Huys, G., R. Coopman, P. Janssen, et al. (1996b). "High-resolution genotypic analysis of the genus Aeromonas by AFLP fingerprinting." International Journal of Systematic Bacteriology 46(2): 572-580.

-- 278 --

Iaconis, J. P. and C. C. Sanders (1990). "Purification and characterization on inducible B-lactamses in Aeromonas spp."Antimicrobial Agents and Chemotherapy 34(1): 44-51. Igbinosa, I. H., E. O. Igbinosa and A.I. Okoh (2014). “Virulence gene markers and biofilm formation of Aeromonas species recovered from cow faeces.”Journal of Clinical and Cell Immunology 5(5) 184. Ilori, M. O., C. J. Amobi and A. C. Odocha (2005). "Factors affecting biosurfactant production by oil degrading Aeromonas spp. isolated from a tropical environment."Chemosphere 61: 985-992. Imamura, T., H. Kobayashi, R. Khan, et al. (2006). "Induction of vascular leakage and blood pressure lowering through kinin release by a serine protease from Aeromonas sobria." Journal of Immunology 177: 8723-8729. Ingham, A. B. and J. M. Pemberton (1995). "A lipase of Aeromonas hydrophila showing nonhaemolytic phospholipase C activity." Current Microbiology 31: 28-33. In-Young, N. and K. Joh (2007). “Rapid detection of virulence factors of Aeromonas isolated from a trout farm by hexaplex-PCR.” Journal of Microbiology 45(4): 297-304. Isenberg, H. D. (1992)."Clinical Microbiology Procedures Handbook." American Society for Microbiology 2: 16-17. Massachusetts Av. N. W. Washington DC. Ishiguro, E. E., W. W. Kay, T. Ainsworth, et al. (1981). "Loss of virulence during culture of Aeromonas salmonicida at high temperature." Journal of Bacteriology 148(1): 333-340. Isonhood, J. H. and M. Drake (2002). "Aeromonas species in foods." Journal of Food Protection 65(3): 575-582. Ivanova, E. P., N. V. Zhukova, N. M. Gorskova, et al. (2001). "Characterization of Aeromonas and Vibrio isolated from a drinking water reservoir." Journal of Applied Microbiology 90: 919-927. Iwanaga, M. and A. Hokama (1992). "Characterization of Aeromonas sobria TAP13 pili: a possible new colonization factor." Journal of General Microbiology 138: 1913-1919. Jagadish Kumar, K. and G. S. Vijaya Kumar (2013). “Cholera-like illness due to Aeromonas caviae.” Indian Pediatrics 50(10): 969-970. James, C., M. Dibley, V. Burke, et al. (1982). "Immunological cross-reactivity of enterotoxins of Aeromonas hydrophila and cholera toxin." Clinical and Experimental Immunology 47: 34-42. Janda, J. M. (1985). "Biochemical and exoenzymatic properties of Aeromonas species." Diagnostic Microbiology and Infectious Disease 3: 223-232. Janda, J. M., R. B. Clark and R. Brenden (1985). "Virulence of Aeromonas species as assessed through mouse lethality studies." Current Microbiology 12: 163-168. Janda, J. M. and M. R. Motyl (1985). "Cephalothin susceptibility as a potential marker for the Aeromonas sobria group." Journal of Clinical Microbiology 22(5): 854- 855. Janda, J. M. and P. S. Duffey (1988). "Mesophilic aeromonads in human disease: current taxonomy, laboratory identification and infectious disease spectrum." Review of Infectious Diseases 10(5): 980-997. Janda, J. M. and R. Brenden (1987). "Importance of Aeromonas sobria in Aeromonas bacteremia." Journal of Infectious Diseases 155(3): 589-591. Janda, J. M. and R. P. Kokka (1991). "The pathogenicity of Aeromonas strains relative to genospecies and phenospecies identification." FEMS Microbiology Letters 90: 29-34.

-- 279 --

Janda, J. M. and S. L. Abbott (2007). "16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls." Journal of Clinical Microbiology 45: 2761-2764. Janda, J. M. and S. L. Abbott (2010). "The genus Aeromonas: taxonomy, pathogenicity, and infection " Clinical Microbiology Reviews 23(1): 35-73. Janda, J. M. and S. L. Abbott (1999). "Unusual food-borne pathogens." Food-Borne Diseases 19: 553-582. Janda, J. M. and S. L. Abbott (1998). "Evolving concepts regarding the genus Aeromonas: an expanding panorama of species, disease presentations, and unanswered questions." Clinical Infectious Diseases 27: 332-344. Janda, J. M., E. J. Bottone and M. Reitano (1983). "Aeromonas species in clinical microbiology:significance, epidemiology, and speciation." Diagnostic Microbiology and Infectious Disease 1: 221-228. Janda, J. M., L. S. Oshiro, S. L. Abbott, et al. (1987). "Virulence markers of mesophilic aeromonads: association of the autoagglutination phenomenon with mouse pathogenicity and the presence of a peripheral cell-associated layer." Infection and Immunity 55(12): 3070-3077. Janda, J. M., M. Reitano, and E. J. Bottone (1984). "Biotyping of Aeromonas isolates as a correlate to delineating a species-associated disease spectrum." Journal of Clinical Microbiology 19(1): 44-47. Janda, J. M. and S. L. Abbott (2002). “Bacterial identification for publication: when is enough enough?.” Journal of Clinical Microbiology 40(6): 1887-1891. Jangid, K., R. Kong, M. Patole, et al. (2007). "luxRI homologs are universally present in the genus Aeromonas " BioMed Central Microbiology 7:93. Janssen, P., R. Coopman, G. Huys, et al. (1996). "Evaluation of the DNA fingerprinting method AFLP as a new tool in bacterial taxonomy." Microbiology 142: 1881- 1893. Jeanteur, D., N. Gletsu, F. Pattus, et al. (1992). "Purification of Aeromonas hydrophila major outer-membrane proteins: N-terminal sequence analysis and channel- forming properties." Molecular Microbiology 6(22): 3355-3363. Jiang, B. and S. P. Howard (1992). "The Aeromonas hydrophila exeE gene, required both for protein secretion and normal outer membrane biogenesis, is a member of a general secretion pathway." Molecular Microbiology 6(10): 1351-1361. Jones, B. L. and M. H. Wilcox (1995). "Aeromonas infections and their treatment." Journal of Antimicrobial Chemotherapy 35: 453-461. Jorge, M. T., S. de A. Nishioka, R. B. de Oliveira, et al. (1998). "Aeromonas hydrophila soft tissue infection as a complication of snake bite: report of three cases." Annals of Tropical Medicine and Parasitology 92(2): 213-217. Jorgensen, J. H. and J. F. Hindler (2007). "New consensus guidelines from the Clinical and Laboratory Standards Institute for antimicrobial susceptibility testing of infrequently isolated or fastidious bacteria." Clinical Infectious Diseases 44: 280-286. Joseph, S. W., A. M. Carnahan, P. R. Brayton, et al. (1991). "Aeromonas jandaei and Aeromonas veronii dual infection of a human wound following aquatic exposure." Journal of Clinical Microbiology 29(3): 565-569. Joseph, S. W. and A. Carnahan (1994). "The isolation, identification, and systematics of the motile Aeromonas species." Annual Review of Fish Diseases 4: 315-343. Joseph, S. W., O. P. Daily, W. S. Hunt, et al. (1979). "Aeromonas primary wound infection of a diver in polluted waters." Journal of Clinical Microbiology 10(1): 46-49. Käempfer, P. and M. Altwegg (1992). "Numerical classification and identification of Aeromonas genospecies." Journal of Applied Bacteriology 72: 341-351.

-- 280 --

Käempfer, P., K. Blasczyk and G. Auling (1994). "Characterization of Aeromonas genomic species by using quinone, polyamine and fatty acid patterns." Canadian Journal of Microbiology 40: 844-850. Käempfer, P. and S. P. Glaeser (2012). "Prokaryotic taxonomy in the sequencing era-the polyphasic approach revisited." Environmental Microbiology 14: 291-317. Kanamaru, S., P. G. Leiman, V. A. Kostyuchenko, et al. (2002). "Structure of the cell- puncturing device of bacteriophage T4." Nature 415: 553-557. Kao, H. T., Y. C. Huang and T. Y. lien (2003). "Fatal bacteraemic pneumonia caused by Aeromonas hydrophila in a previously healthy child." Journal of Microbiology, Immunology and Infection 36: 209-211. Kaper, J. B., H. Lockman and R. R. Colwell (1981). "Aeromonas hydrophila: ecology and toxigenicity of isolates from an estuary." Journal of Applied Bacteriology 50: 359-377. Karam, G. H., A. M. Ackley and W. E. Dismukes (1983). "Posttraumatic Aeromonas hydrophila osteomyelitis." Archives of Internal Medicine 143: 2073-2074. Karem, K. L., J. W. Foster and A. K. Bej (1994). "Adaptive acid tolerance response (ATR) in Aeromonas hydrophila. " Microbiology 140: 1731-1736. Kasai, H., K. Watanabe, E. Gasteiger, et al. (1998). "Construction of the gyrB database for the identification and classification of bacteria." Genome Informatics 9: 13- 21. Kay, W. W. and T. J. Trust (1991). "Form and function of the regular surface array (S- layer) of Aeromonas salmonicida." Experientia 47: 412-414. Kay, W. W., B. M. Phipps, E. E. Ishiguro, et al. (1985). "Porphyrin binding by the surface array virulence protein of Aeromonas salmonicida." Journal of Bacteriology 164(3): 1332-1336. Kay, W. W., J. T. Buckley, E. E. Ishiguro, et al. (1981). "Purification and disposition of a surface protein associated with virulence of A. salmonicida." Journal of Bacteriology 147: 1077-1084. Kaznowski, A., K. Wlodarczak and H. Paetz (1989). "A numerical taxonomy of Vibrionaceae isolated from water, sewage, water-oil emulsion and fishes." Systematic and Applied Microbiology 12: 172-178. Kaznowski, A. and E. Konecka (2005). "Identification of Aeromonas culicicola by 16S rDNA RFLP." Polish Journal of Microbiology 54(4): 335-338. Kelly, K. A., J. M. Koehler and L. R. Ashdown (1993). "Spectrum of extraintestinal disease due to Aeromonas species in tropical Queensland, Australia." Clinical Infectious Diseases 16: 574-579. Kersters, I., G. Huys, H. Van Duffel, et al. (1996). "Survival potential of Aeromonas hydrophila in freshwaters and nutrient-poor waters in comparison with other bacteria." Journal of Applied Bacteriology 80: 266-276. Ketover, B. P., L. S. Young and D. Armstrong (1973). "Septicaemia due to Aeromonas hydrophila: clinical and immunologic aspects." Journal of Infectious Diseases 127(3): 284-290. Khajanchi, B. K., J. Sha, E. V. Kozlova, et al. (2009). "N-Acylhomoserine lactones involved in quorum sensing control the type VI secretion system, biofilm formation, protease production, and in vivo virulence in a clinical isolate of Aeromonas hydrophila." Microbiology 155: 3518-3531. Khajanchi, B. J., A. A. Fadl, M. A. Borchardt, et al. (2010). "Distribution of virulence factors and molecular fingerprinting of Aeromonas species isolates from water and clinical samples: suggestive evidence of water-to-human transmissionV?." Applied and Environmental Microbiology 76(7): 2313-2325. Khajanchi, B. J., M. L. Kirtley, S. M. Brackman, et al. (2011). "Immunomodulatory and protective roles of quorum-sensing signaling molecules N-acyl Homoserine

-- 281 --

lactones during infection of mice with Aeromonas hydrophila." Infection and Immunity 79(7): 2646-2657. Khajanchi, B. J., E. V. Kozlova, J. Sha, et al. (2012). "The two-component QseBC signaling system regulates in vitro and in vivo virulence of Aeromonas hydrophila." Microbiology 158: 259-271. Khan, A. A. and C. E. Cerniglia (1997). "Rapid and sensitive method for the detection of Aeromonas caviae and Aeromonas trota by polymerase chain reaction." Letters in Applied Microbiology 24: 233-239. Khan, A. A., E. Kim and C. E. Cerniglia (1998). "Molecular cloning, nucleotide sequence, and expression in Escherichia coli of a haemolytic toxin (aerolysin) gene from Aeromonas trota." Applied and Environmental Microbiology 64(7): 2473-2478. Khan, A. A., M. S. Nawaz, S. A. Khan, et al. (1999). "Identification of Aeromonas trota (hybridization group 13) by amplification of the aerolysin gene using polymerase chain reaction." Molecular and Cellular Probes 13: 93-98. Khan, R., E. Takahashi, H. Nakura, et al. (2008). "Toxin production by Aeromonas sobria in natural environments: river vs seawater." Acta Medica Okayama 62(6): 363-371. Khan, R., E. Takahashi, T. Ramamurthy, et al. (2007). "Salt in surroundings influences the production of serine protease into milieu by Aeromonas sobria." Microbiology and Immunology 51(10): 963-976. Khan, M. L., G. Walters and T. Metcalfe (2007). “Bilateral endogenous endophthalmitis caused by Aeromonas hydrophila.” Eye 21: 1244-1245. Khan, S. J., R. H. Reed and M. G. Rasul (2012). "Thin-film fixed-bed reactor (TFFBR) for solar photocatalytic inactivation of aquaculture pathogen Aeromonas hydrophila." Microbiology 12(5): 1-11. Khardori, N. and V. Fainstein (1988). "Aeromonas and Plesiomonas as etiological agents." Annual Review of Microbiology 42: 395-419. Kienzle, N., M. Muller and S. Pegg (2000). "Aeromonas wound infections in burns." Burns 26: 478-482. Kimura, T. (1969). “A new subspecies of Aeromonas salmonicida as an etiological agent of furunculosis on "Sakuramasu" (Oncorhynchus masou) and Pink Salmon (O. gorbuscha) rearing for maturity.” Part 2. On the serological properties. Fish Pathology (Tokyo) 3, 45-52. Kimura, M. (1980). "A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences." Journal of Molecular Evolution 16: 111-120. Kingombe, C. I., G. Huys, D. Howald, et al. (2004). "The usefulness of molecular techniques to assess the presence of Aeromonas spp. harboring virulence markers in foods." International Journal of Food Microbiology 94: 113-121. Kingombe, C. I., G. Huys, M. Tonolla, et al. (1999). "PCR detection, characterization, and distribution of virulence genes in Aeromonas spp." Applied and Environmental Microbiology 65(12): 5293-5302. Kirov, S. M. (1993). "The public health significance of Aeromonas spp. in foods." International Journal of Food Microbiology 20: 179-198. Kirov, S. M. (1997). "Aeromonas and Plesiomonas". In: Food Microbiology: Fundamentals and Frontiers. eds. M. Doyle, L. Beuchat and T. Montville. ASM Press Washington DC: 265-286. Kirov, S. M. (2003). "Bacteria that express lateral flagella enable dissection of the multifunctional roles of flagella in pathogenesis." FEMS Microbiology Letters 224: 151-159.

-- 282 --

Kirov, S. M. and K. Sanderson (1996). "Characterization of a type IV bundle-forming pilus (SFP) from a gastroenteritis-associated strain of A. veronii biovar sobria." Microbial Pathogens 21: 23-34. Kirov, S. M. and L. J. Hayward (1993). "Virulence traits of Aeromonas in relation to species and geographic region." Australian Journal of Medical Science 14: 54- 58. Kirov, S. M., B. C. Tassell, A. B. T. Semmler, et al. (2002). "Lateral flagella and swarming motility in Aeromonas species." Journal of Bacteriology 184(2): 547-555. Kirov, S. M., B. Rees, R. C. Wellock, et al. (1986). "Virulence characteristics of Aeromonas spp. in relation to source and biotype." Journal of Clinical Microbiology 24(5): 827-834. Kirov, S. M., D. S. Hui and L. J. Hayward (1993). "Milk as a potential source of Aeromonas gastrointestinal infection." Journal of Food Protection 56: 306- 312. Kirov, S. M., I. Jacobs, L. J. Hayward, et al. (1995b). "Electron microscopy examination of factors influencing the expression of filamentous surface structures on clinical and environmental isolates of Aeromonas veronii biotype sobria." Microbiology and Immunology 39: 329-338. Kirov, S. M., K. Sanderson and T. C. Dickson (1998). "Characterization of a type IV pilus produced by Aeromonas caviae." Journal of Medical Microbiology 47: 527-531. Kirov, S. M., L. A. O'Donovan and K. Sanderson (1999). "Functional characterization of type IV pili expressed on diarrhoea-associated isolates of Aeromonas species." Infection and Immunity 67(10): 5447-5454. Kirov, S. M., L. J. Hayward and M. N. Nerrie (1995a). "Adhesion of Aeromonas sp. to cell lines used as models for intestinal adhesion." Epidemiology and Infection 115: 465-473. Kirov, S. M., M. Castrisios and J. G. Shaw (2004). "Aeromonas flagella (polar and lateral) are enterocyte adhesins that contribute to biofilm formation on surfaces." Infection and Immunity 72(4): 1939-1945. Kirov, S. M., T. C. Barnett, C. M. Pepe, et al. (2000). "Investigations of the role of type IV Aeromonas pilus (Tap) in the pathogenesis of Aeromonas gastrointestinal infection." Infection and Immunity 68: 4040-4048. Küijper, E. J., L. van Alphen, E. Leenders, et al. (1989). “Typing of Aeromonas strains by DNA restriction endonuclease analysis and polyacrylamide gel electrophoresis of cell envelopes.” Journal of Clinical Microbiology 27: 1280- 1285. Kluyver, A. J. and C. B. van Neil (1936). "Prospects for a natural system of classification of bacteria." Zentralblatt Bakteriologie II Orig. 94: 369-403. Knochel, S. (1989). "Effect of temperature on hemolysin production in Aeromonas spp. isolated from warm and cold environments." International Journal of Food Microbiology 9: 225-235. Knochel, S. (1990). "Growth characteristics of motile Aeromonas spp. isolated from different environments." International Journal of Food Microbiology 10: 235- 244. Knochel, S. and C. Jeppesen (1990). "Distribution and characteristics of Aeromonas in food and drinking water in Denmark." International Journal of Food Microbiology 10: 317-322. Ko, W. C. and Y. C. Chuang (1995). "Aeromonas bacteremia: review of 59 episodes." Clinical Infectious Diseases 20: 1298-1304.

-- 283 --

Ko, W. C., H. C. Lee, Y. C. Chuang, et al. (2000). "Clinical features and therapeutic implications of 104 episodes of monomicrobial Aeromonas bacteraemia." Journal of Infection 40: 267-273. Ko, W. C., K. W. Yu, C. Y. Liu, et al. (1996). "Increasing antibiotic resistance in clinical isolates of Aeromonas strains in Taiwan." Antimicrobial Agents and Chemotherapy 40(5): 1260-1262. Ko, W. C., S. R. Chiang, H. C. Lee, et al. (2003). "In vitro and in vivo activities of fluoroquinolones against Aeromonas hydrophila." Antimicrobial Agents and Chemotherapy 47(7): 2217-2222. Ko, W. C., S. R. Chiang, J. J. Yan, et al. (2005). "Comparative pathogenicity of bacteraemic isolates of Aeromonas hydrophila and Klebsiella pneumoniae." Clinical Microbiology and Infection 11: 553-558. Kobayashi, H., A. Tateishi, H. Tsuge, et al. (2009b). "The carboxyl-terminal tail of Aeromonas sobria serine protease is associated with the chaperone." Microbiology and Immunology 53: 647-657. Kobayashi, H., E. Takahashi, K. Oguma, et al. (2006). "Cleavage specificity of the serine protease of Aeromonas sobria, a member of the kexin family of subtilases." FEMS Medical Letters 256: 165-170. Kobayashi, H., H. Utsunomiya, H. Yamanaka, et al. (2009a). "Structural basis for the kexin-like serine protease from Aeromonas sobria as sepsis-causing factor." Journal of Biological Chemistry 284(40): 27655-27663. Kodjo, A., F. Haond and Y. Richard (1997). "Molecular and phenotypic features of Aeromonas isolated from snails (Helix aspersa) affected with a new summer disease." Journal of Veterinary Medicine B 44: 245-252. Koehler, J. M. and L. R. Ashdown (1993). "In vitro susceptibilities of tropical strains of Aeromonas species from Queesnsland, Australia, to 22 antimicrobial agents." Antimicrobial Agents and Chemotherapy 37(4): 905-907. Kokka, R. P., J. M. Janda, L. S. Oshiro, et al. (1991). "Biochemical and genetic characterization of autoagglutinating phenotypes of Aeromonas species associated with invasive and noninvasive disease." Journal of Infectious Diseases 163: 890-894. Kong, R., A. Pelling, C. So, et al. (1999). "Identification of oligonucleotide primers targeted at the 16S-23S rRNA intergenic spacer for genus and species-specific detection of aeromonads." Marine Pollution Bulletin 38: 802-808. Konstantinidis, K. T. and J. M. Tiedje (2005). “Genomic insights that advance the species definition for prokaryotes.” Preceedings of the National Academy of Science 102 (7): 2567-2572. Korbsrisate, S., S. Dumnin, R. Chawengkirttkul, et al. (2002). "Distribution of Aeromonas hydrophila serogroups in different clinical samples and the development of polyclonal antibodies for rapid identification of the genus Aeromonas by direct agglutination." Microbiology and Immunology 46(12): 875-879. Korzeniewska, E., Z. Filipkowska, D. Zarnoch, et al. (2005). "Survival of Escherichia coli and Aeromonas hydrophila in non-carbonated mineral water." Polish Journal of Microbiology 54: 35-40. Kozaki, S., K. Kato, T. Asao, et al. (1987). "Activities of Aeromonas hydrophila haemolysins and their interaction with erythrocyte membranes." Infection and Immunity 55(7): 1594-1599. Kozaki, S., T. Asao, Y. Kamata, et al. (1989). "Characterization of Aeromonas sobria haemolysin by use of monoclonal antibodies against Aeromonas hydrophila haemolysins." Journal of Clinical Microbiology 27(8): 1782-1786.

-- 284 --

Kozinska, A. and A. Pekala (2012). "Characteristics of disease spectrum in relation to species, serogroups, and adhesion ability of motile aeromonads in fish." Science World Journal 2012: 1-9. Kozlova, E. V., V. L. Popov, J. Sha, et al. (2008). "Mutation in the S- ribosylhomocysteinase (luxS) gene involved in quorum sensing affects biofilm formation and virulence in a clinical isolate of Aeromonas hydrophila." Microbial Pathogenesis 45: 343-354. Kozlova, E. V., B. K. Khajanchi, J. Sha, et al. (2011). "Quorum sensing and c-di- GMPdependent alterations in gene transcripts and virulence-associated phenotypes in a clinical isolate of Aeromonas hydrophila." Microbial Pathogenesis 50: 213-223. Krovacek, K., A. Faris and I. Mansson (1991). "In vitro invasion of Aeromonas spp. to HEp-2 tissue culture cells." Acta Veterinaria Scandinavica 32: 139-143. Krovacek, K., A. Faris, S. B. Baloda, et al. (1992). "Prevalence and characterization of Aeromonas spp. isolated from foods in Uppsala, Sweden." Food Microbiology 9: 29-36. Krovacek, K., S. Dumontet, E. Eriksson, et al. (1995). "Isolation and virulence profiles of Aeromonas hydrophila implicated in an outbreak of food poisoning in Sweden." Microbiology and Immunology 39(9): 655-661. Krzymińska, S., A. Kaznowski and H. Spychala (2006). "Purification and characterization of cytolytic toxins produced by Aeromonas hydrophila." Polish Journal of Microbiology 55(1): 37-42. Krzymińska, S., A. Kaznowski, K. Lindner, et al. (2003). "Enteropathogenic activity and invasion of HEp-2 cells by Aeromonas caviae clinical isolates." Acta Microbiologica Polonica 52(3): 277-283. Krzymińska, S., A. Tanska and A. Kaznowski. (2011). "Aeromonas spp. induce apoptosis of epithelial cells through an oxidant-dependent activation of the mitochondrial pathway." Journal of Medical Microbiology 60: 889-898. Kuhn, I., G. Allestam, G. Huys, et al. (1997b). "Diversity, persistence and virulence of Aeromonas strains isolated from drinking water distribution systems in Sweden." Applied and Environmental Microbiology 63(7): 2708-2715. Kuhn, I., G. Huys, P. Janssen, et al. (1997c). "Diversity and stability of coliforms and Aeromonas in water from a well, studied over four years of time " Canadian Journal of Microbiology 43: 9-16. Kuhn, I., M. J. Albert, M. Ansaruzzaman, et al. (1997a). "Characterisation of Aeromonas spp. isolated from humans with diarrhoea, from healthy controls and from surface water in Bangladesh." Journal of Clinical Microbiology 35(2): 369-373. Kuhn, I., T. Lindberg, K. Olsson, et al. (1992). "Biochemical fingerprinting for typing of Aeromonas strains from food and water." Letters in Applied Microbiology 15: 261-265. Küijper, E. J., A. G. Steigerwalt, B. S. Schoenmakers, et al. (1989b). "Phenotypic characterization and DNA relatedness in human fecal isolates of Aeromonas spp." Journal of Clinical Microbiology 27(1): 132-138. Küijper, E. J., H. C. Zanen and M. F. Peters (1987). "Aeromonas-associated diarrhea in the Netherlands." Annals of Internal Medicine 106(4): 640-641. Küijper, E. J., L. van Alphen, E. Leenders, and et al. (1989a). "Typing of Aeromonas strains by DNA restriction endonuclease analysis and polyacrylamide gel electrophoresis of cell envelopes." Journal of Clinical Microbiology 27(6): 1280-1285. Kumar, S., K. Tamura, I. B. Jakobsen, et al. (2001). "MEGA2: molecular volutionary genetics analysis software." Bioinformatics 17(12): 1244-1245.

-- 285 --

Kumar, S., P. Mukhopadhyay, M. Chatterjee, et al. (2012). “Necrotizing fasciitis caused by Aeromonas caviae.” Avicenna Journal of Medicine 2(4): 94-96. Kunimoto, D., R. Rennie, D. M. Citron, et al. (2004). "Bacteriology of a bear bite wound to a human: case report." Journal of Clinical Microbiology 42: 3374- 3376. Küpfer, M., P. Kuhnert, B. M. Korczak, et al. (2006). "Genetic relationships of Aeromonas strains inferred from 16S rRNA, gyrB and rpoD gene sequences." International Journal of Systematic and Evolutionar Microbiology 56: 2743- 2751. Kushiramani, R. M., B. Maiti, M. Shekar, et al. (2012). "Recombinant Aeromonas hydrophila outer membrane protein 48 (Omp48) induces a protective immune response against Aeromonas hydrophila and Edwarsiella tarda." Research in Microbiology 163(4): 286-291. Laganowska, M. and A. Kasnowski (2005). "Polymorphism of Aeromonas spp. tRNA intergenic spacers." Systematic and Applied Microbiology 28: 222-229. Laganowska, M. and A. Kasnowski (2004). "Restriction fragment length polymorphism of 16S-23S rDNA intergenic spacer of Aeromonas spp." Systematic and Applied Microbiology 27: 549-557. Lai, C. C., C. C. Shiao, G. D. Lu, et al. (2007). "Aeromonas hydrophila and Aeromonas sobria bacteremia: rare pathogens of infection in a burn patient." Burns 33: 255-257. Lambert, M. A., F. W. Hickman-Brenner, J. J. Farmer III, et al. (1983). "Differenciation of Vibrionaceae species by their cellular fatty acids components." International Journal of Systematic Bacteriology 33: 777-792. Lamy, B., F. Laurent and A. Kodjo (2010). "Validation of a partial rpoB gene sequence as a tool for phylogenetic identification of aeromonads isolated from environmental sources." Canadian Journal of Microbiology 56: 217-228. Lamy, B., A. Kodjo, F. Laurent, et al. (2011). "Identification of Aeromonas isolates by matrix-assisted laser desorption ionization time-of-flight mass spectrometry." Diagnostic Microbiology and Infectious Disease 71: 1-5. Lan, X., N. Ozawa, N. Nishiwaki, et al. (2004). "Purification, cloning, and sequence analysis of Beta-N-acetylglucosaminidase from the chitinolytic bacterium Aeromonas hydrophila SUWA-9." Bioscience, Biotechnology and Biochemistry 68(5): 1082-1090. Lan, X., X. Zhang, J. Hu, et al. (2006). "Cloning, expression, and characterization of a chitinase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA- 9." Bioscience, Biotechnology and Biochemistry 70: 2437-2442. Lan, X., X. Zhang, R. Kodaira, et al. (2008). "Gene cloning, expression, and characterization of a second B-N-Acetylglucosaminidase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA-9." Bioscience, Biotechnology and Biochemistry 72(2): 492-498. Laufer, A. S., M. E. Siddall and J. Graf (2008). "Characterization of the digestive-tract microbiota of Hirudo orientalis, a European medicinal leech." Applied and Environmental Microbiology 74: 6151-6154. Lawson, M. A., V. Burke and B. J. Chang (1985). "Invasion of HEPp-2 cells by faecal isolates of Aeromonas hydrophila." Infection and Immunity 47(3): 680-683. Le Chevalier, M. W., T. M. Evans, R. J. Seidler, et al. (1982). "Aeromonas sobria in chlorinated drinking water supplies." Microbial Ecology 8: 325-333. Leclere, V., M. Bechet and R. Blondeau (2004). "Functional significance of a periplasmic Mn-superoxide dismutase from Aeromonas hydrophila." Journal of Applied Microbiology 96: 828-833.

-- 286 --

Lee, C. C., C. H. Chi, N. Y. Lee, et al. (2008). "Necrotizing fasciitis in patients with liver cirrhosis: predominance of monomicrobial Gram-negative bacillary infections." Diagnostic Microbiology and Infectious Disease 62: 219-225. Lee, K. K. and A. E. Ellis (1990). "Glycerophospholipid:cholesterol acyltransferase complexed with lipopolysaccharide (LPS) is a major lethal exotoxin and cytolysin of Aeromonas salmonicida: LPS stabilizes and enhances toxicity of the enzyme." Journal of Bacteriology 172(9): 5382-5393. Lehane, L. and G. T. Rawlin (2000). "Topically acquired bacterial zoonoses from fish: a review." Medical Journal of Australia 173: 256-259. Leung, K. Y. and R. M. Stevenson (1988b). "Characteristics and distribution of extracellular proteases from Aeromonas hydrophila.." Journal of General Microbiology 134: 151-160. Leung, K. Y. and R. M. Stevenson (1988a). “Tn5-induced protease-deficient strains of Aeromonas hydrophila with reduced virulence for fish.” Infection and Immunity 56(10): 2639-2644. Leung, K. Y., T. M. Lim, T. J. Lam, et al. (1996). "Morphological changes in carp epithelial cells infected with Aeromonas hydrophila." Journal of Fish Diseases 19: 167-174. Libisch, B., C. G. Giske, B. Kovacs, et al. (2008). "Identification of the first VIM metallo-B-lactamase-producing multiresistant Aeromonas hydrophila strain." Journal of Clinical Microbiology 46: 1878-1880. Lim, P. L. (2005). "Wound infections in tsunami survivors: a commentary." Annals of the Academy of Medicine of Singapore 3: 582-585. Lin, C. S., H. C. Chen and F. P. Lin (1997). "Expression and characterization of the recombinant gene encoding chitinase from Aeromonas caviae. " Enzyme Microbial Technology 21: 472-478. Liu, C. L., W. H. Chuang, C. C. Tu, et al. (2010). "Purification of a toxic cysteine protease produced by pathogenic Aeromonas hydrophila isolated from rainbow trout." Journal of Basic Microbiology 50: 1-10. Ljungh, A. and T. Kronevi (1982). "Aeromonas hydrophila toxins-intestinal fluid accumulation and mucosal injury in animal models." Toxicon 20: 397-407. Ljungh A., B. Wretlind and R. Mollby. (1981). "Separation and characterization of enterotoxin and two haemolysins from Aeromonas hydrophila. " Acta Pathologica and Microbiologica Scandinavica 89: 387-397. Ljungh, A. L. and T. Wadström (1979). “Aeromonas hydrophila enterotoxin.” Abstract 15th joint conference on cholera. U. S. – Japan Cooperative Medical Science Program. p. 71. Ljungh, A. L. and T. Wadström (1983). "Toxins of Vibrio parahaemolyticus and Aeromonas hydrophila." Journal of Toxicology and Toxin Reviews 1: 257-307. Llopis, F., J. Grau, F. Tubau, et al. (2004). "Epidemiological and clinical characteristics of bacteraemia caused by Aeromonas spp. as compared with Escherichia coli and Pseudomonas aeruginosa." Scandinavian Journal of Infectious Diseases 36: 335-341. Lopez, J. F., J. Quesada and A. Saied (1968). "Bacteraemia and osteomyelitis due to Aeromonas hydrophila : a complication during the treatment of acute leukaemia." American Journal of Clinical Pathology 50: 587-591. Lopez, L., C. Pozo, B. Rodelas, et al. (2005). "Identification of bacteria isolated from an oligotropic lake with pesticide removal capacities." Ecotoxicology 14: 299-312. Low, K. W., S. G. Goh, T. M. Lim, et al. (1998). "Actin rearrangements accompanying Aeromonas hydrophila entry into cultured fish cells." Journal of Fish Diseases 21: 55-65.

-- 287 --

Lu, S. Y., Y. L. Zhang, S. N. Geng, et al. (2010). "High diversity of extended-spectrum B-lactamase-producing bacteria in an urban river sediment habitat." Applied and Environmental Microbiology 76: 5972-5976. Lupiola-Gomez, P. A., Z. Gonzalez-Lama, M. T. Tejedor-Junco, et al. (2003). "Group 1 beta-lactamases of Aeromonas caviae and their resistance to beta-lactam antibiotics." Canadian Journal of Microbiology 49: 207-215. Lye, D. J. (2011). "Gastrointestinal colonization rates for human clinical isolates of Aeromonas veronii using a mouse model." Current Microbiology 63: 332-336. Lye, D. J., M. R. Rodgers, G. Stelma, et al. (2007). "Characterization of Aeromonas virulence using an immunocompromised mouse model." Current Microbiology 54: 195-198. Lye, D. J. (2009). "A mouse model for characterization of gastrointestinal colonization rates among environmental Aeromonas isolates." Current Microbiology 58: 454-458. Lynch, J. M., W. R. Tilson, G. R. Hodges, et al. (1981). "Nosocomial Aeromonas hydrophila cellulitis and bacteremia in a nonimmunocompromised patient." Southern Medical Journal 74(7): 901-902. Lynch, M. J., A. Swift, D. F. Kirke, et al. (2002). "The regulation of biofilm development by quorum sensing in Aeromonas hydrophila." Environmental Microbiology 4(1): 18-28. Maalej, S., R. Gdoura, S. Dukan, et al. (2004). "Maintenance of pathogenicity during entry into and resuscitation from viable but nonculturable state in Aeromonas hydrophila exposed to natural seawater at low temperature." Journal of Applied Microbiology 97: 557-565. MacFaddin, J. (1976). "Biochemical tests for the identification of medical bacteria." 2nd edition, The Williams and Wilkins Company, Baltimore. MacIntyre, S., T. J. Trust and J. T. Buckley (1979). "Distribution of glycerophospholipid-cholesterol acyltransferase in selected bacterial species." Journal of Bacteriology 139(1): 132-136. Macnab, R. M. and D. J. DeRossier (1988). "Bacterial flagellar structure and function. " Canadian Journal of Microbiology 34: 442-451. Mahabeer, Y., A. Khumalo, E. Kiratu, et al. (2014). “Posttraumatic brain abscess caused by Aeromonas hydrophila.” Journal of Clinical Microbiology 52(5): doi: 10.1128/JCM.00267-1. Majeed, K. N., A. F. Egan and I. C. MacRae (1990). "Production of exotoxins by Aeromonas spp. at 5 degrees C." Journal of Applied Bacteriology 69: 332-337. Maravić, A., M. Skočibušić, I. Samanić, et al. (2013). “Aeromonas spp. simultaneously harbouring blaCTX-M-15, blaSHV-12, blaPER-1 and blaFOX-2, in wild- growing Mediterranean mussel (Mytilus galloprovincialis) from Adriatic Sea, Croatia.” International Journal of Food Microbiology 166(2): 301-308. Marchandin, H., S. Godreuil, H. Darbas, et al. (2003). "Extended-spectrum B-lactamase TEM-24 in an Aeromonas clinical strain: acquisition from the prevalent Enterobacter aerogenes clone in France." Antimicrobial Agents and Chemotherapy 47(12): 3994-3995. Markovic, M., V. Djikanovic, P. Cakic, et al. (2007). "Aeromonas Salmonicida in Californian trout (Oncorhynchus Mykiss, Walbaum, 1792 ) and some biochemical characteristics of this bacteria." The International Journal of Microbiology ISSN: 1937-8289 3(1). Martin-Carnahan, A. and S. W. Joseph (2005). "Order XII. Aeromonadales ord. nov." 2: 556, part B, 2nd ed. Bergey's Manual of Systematic Bacteriology, eds, D. J. Brenner, N. R. Krieg, J. T. Staley and G. M. Garrity, Springer, New York.

-- 288 --

Martínez-Murcia, A. J. (1999). "Phylogenetic positions of Aeromonas encheleia, Aeromonas popoffii, Aeromonas DNA hybridization Group 11 and Aeromonas Group 501." International Journal of Systematic and Evolutionary Microbiology 49: 1403-1408. Martínez-Murcia, A. J., N. Borrel and M. J. Figueras (2000). "Typing of clinical and environmental Aeromonas veronii strains based on the 16S-23S rDNA spacers." FEMS Immunology and Medical Microbiology 28: 225-232. Martínez-Murcia, A. J., S. Benlloch and M. D. Collins (1992b). "Phylogenetic interrelationships of members of the genera Aeromonas and Plesiomonas as determined by 16S ribosomal DNA sequencing: lack of congruence with results of DNA-DNA hybridizations." International Journal of Systematic Bacteriology 42(3): 412-421. Martínez-Murcia, A. J., C. Esteve, E. Garay, et al. (1992a). "Aeromonas allosaccharophila sp. nov., a new mesophilic member of the genus Aeromonas." FEMS Microbiology Letters 91: 199-206. Martínez-Murcia, A. J., M. J. Figueras, M. J. Saavedra, et al. (2007). "The recently proposed species Aeromonas sharmana sp. nov., isolate GPTSA-6T, is not a member of the genus Aeromonas." International Microbiology 10: 61-64. Martínez-Murcia, A., M. J. Saavedra, V. R. Mota, et al. (2008). "Aeromonas aquariorum sp. nov., isolated from aquaria of ornamental fish." International Journal of Systematic and Evolutionary Microbiology 58: 1169-1175. Martínez-Murcia, A. J., J. Monera, A. Alperi, et al. (2009). "Phylogenetic evidence suggests that strains of Aeromonas hydrophila subsp. dhakensis belong to the species Aeromonas aquariorum sp. nov." Current Microbiology 58: 76-80. Martínez-Murcia, A. J., A. Monera, M. J. Saavedra, et al. (2011)." Multilocus phylogenetic analysis of the genus Aeromonas." Systematic and Applied Microbiology 34: 189-199. Martínez-Murcia, A. J., R. Beaz-Hidalgo, P. Svec, et al. (2013). "Aeromonas cavernicola sp. nov. isolated from fresh water of a brook in a cavern." Current Microbiology doi:10.1007/s00284-012-0253-x. Martínez, M. J., D. Simon-Pujol, F. Congregado, et al. (1995). "The presence of capsular polysaccharide in mesophilic Aeromonas hydrophila serotypes O:11 and O:34." FEMS Microbiology Letters 128: 69-74. Martino, M. E., L. Fasolato, F. Montemurro, et al. (2011). "Determination of microbial diversity of Aeromonas strains on the basis of multiloccus sequence typing, phenotype, and presence of putive virulence genes " Applied Environmental Microbiology 77(14): 4986-5000. Martins, L. M., C. Ferreira Catani, R. Marquez Falcon, et al. (2007). "Induction of apoptosis in Vero cells by Aeromonas veronii biovar sobria vacuolating cytotoxic factor." FEMS Immunology and Medical Microbiology 49: 197-204. Martins, L. M., R. Falcon Marquez and T. Yano (2002). "Incidence of toxic Aeromonas isolated from food and human infection." FEMS Immunology and Medical Microbiology 32: 237-242. Massad, G., J. E. L. Arcenaux and B. R. Byers (1991). "Diversity of siderophore genes encoding biosynthesis of 2,3-dihydroxybenzoic acid inAeromonas spp." Biom etals 7: 227-236. Massad, G., J. E. L. Arcenaux and B. R. Byers (1994). "Acquisition of iron from host sources by mesophilic Aeromonas species." Journal of General Microbiology 137: 237-241. Mateos, D., J. Anguita, G. Naharro, et al. (1993). "Influence of growth temperature on the production of extracellular virulence factors and pathogenicity of

-- 289 --

environmental and human strains of Aeromonas hydrophila." Journal of Applied Bacteriology 74: 111-118. McCardell, B. A., J. M. Madden, M. H. Kothary, et al. (1995). "Purification and characterisation of a CHO cell-elongating toxin produced by Aeromonas hydrophila." Microbial Pathogens 19: 1-9. McCleod, E. S., Z. Dadwood, R. MacDonald, et al. (1998). "Isolation and identification of sulphite and iron reducing hydrogenase positive facultative anaerobes from cooling water systems." Systematic and Applied Microbiology 21: 297-305. McCracken, A. W. and R. Barkley (1972). "Isolation of Aeromonas species from clinical sources." Journal of Clinical Pathology 25: 970-975. McMahon, M. A. S. and I. G. Wilson (2001). "The occurrence of enteric pathogens and Aeromonas species in organic vegetables." International Journal of Food Microbiology 70: 155-162. Megraud, F. (1986). "Incidence and virulence of Aeromonas species in feces of children with diarrhea." European Journal of Clinical Microbiology 5(3): 311-316. Mekisic, A. P. and J. R. Wardill (1992). "Crocodile attacks in the Northern Territory of Australia." Medical Journal of Australia 157: 751-754. Mellersh, A. R., P. Norman and G. H. Smith (1984). "Aeromonas hydrophila: and outbreak of hospital infection." Journal of Hospital Infections 5: 425-430. Mehmood, M. A., Y. Gai, Q. Zhuang, et al. (2010). “Aeromonas caviae CB101 contains four chitinases encoded by a single gene chi1.” Molecular Biotechnology 44: 231-220. Mendes-Marquez, C. L., L. Melo do Nascimento, G. Nazareth Diogo, et al. (2012). "Molecular characterization of Aeromonas spp. and Vibrio cholerae O1 isolated during a diarrhoeal outbreak." Revista do Instituto de Medicina Tropical de So Paulo 54(6): 299-304. Meng, X., Y. Liu and C. Lu (2009). "Expression, purification and molecular characterization of elastase from Aeromonas hydrophila strain J-1." Acta Microbiologica Sinica 49(12): 1613-1620. Mercer, N. S. G., D. M. Beere, A. J. Bornemisza, et al. (1987). "Medical leeches as sources of wound infection." British Medical Journal 294: 937. Merino, S., A. Aguilar, M. M. Nogueras, et al. (1999). "Cloning, sequencing, and role in virulence of two phospholipases (A1 and C) from mesophilic Aeromonas sp. serogroup O:34. " Infection and Immunity 67(8): 4008-4013. Merino, S., J. G. Shaw and J. M. Tomas (2006). "Bacterial lateral flagella:an inducible flagella system." FEMS Microbiology Letters 263: 127-135. Merino, S., S. Camprubi and J. M. Tomas (1992). "Effect of the growth temperature on outer membrane components and virulence of Aeromonas hydrophila strains of serotype O:34." Infection and Immunity 60: 43434-43439. Merino, S., S. Camprubi and J. M. Tomas (1993). "Incidence of Aeromonas spp. serotypes O:34 and O:11 among clinical isolates." Medical Microbiology Letters 2: 48-55. Merino, S., X. Rubires, A. Aguilar, et al. (1997). "The role of flagella and motility in the adherence and invasion to fish cell lines by Aeromonas hydrophila serogroup O:34 strains." FEMS Microbiology Letters 151: 213-217. Merino, S., X. Rubires, A. Aguilar, et al. (1996a). “The O:34-antigen lipopolysaccharide as an adhesin in Aeromonas hydrophila.” FEMS Microbiology Letters 139: 97-101. Merino, S., X. Rubires, A. Aguilar, et al. (1996b). "The role of the O-antigen lipopolysaccharide on the colonization in vivo of the germfree chicken gut by Aeromonas hydrophila serogroup O:34." Microbial Pathogens 20: 325-333.

-- 290 --

Merino, S., X. Rubires, S. Knochel, et al. (1995). "Emerging pathogens: Aeromonas spp. ." International Journal of Food Microbiology 28: 157-168. Miles, A. A. and E. T. Halnan (1937). "A new species of micro-organism (Proteus melanovogenes) causing black rot in eggs." Journal of Hygiene 37: 79-97. Millership, S. E., and B. Chattopadyay (1985). "Aeromonas hydrophila in chlorinated water supplies." Journal of Hospital Infections 6: 75-80. Millership, S. E. and S. V. Want (1993). "Characterisation of strains of Aeromonas spp. by phenotype and whole-cell protein fingerprinting." Journal of Medical Microbiology 39: 107-113. Millership, S. E., S. R. Curnow and B. Chattopadhyay (1983). "Faecal carriage rate of Aeromonas hydrophila." Journal of Clinical Pathology 36: 920-923. Miñana-Galbis, D., A. Urbizu-Serrano, M. Farfán, et al. (2009). "Phylogenetic analysis and identification of Aeromonas species based on sequencing of the cnp60 universal target." International Journal of Systematic and Evolutionary Microbiology 59: 1976-1983. Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2007). "Aeromonas bivalvium sp. nov., isolated from bivalve molluscs." International Journal of Systematic and Evolutionary Microbiology 57: 582-587. Miñana-Galbis, D., M. Farfán, J. G. Loren, et al. (2010). "Proposal to assign Aeromonas diversa sp. nov. as a novel species designation for Aeromonas group 501." Systematic and Applied Microbiology 33: 15-19. Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2004a). "Aeromonas molluscorum sp. nov., isolated from bivalve molluscs." International Journal of Systematic and Evolutionary Microbiology 54: 2073-2078. Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2004b). "Genetic diversity and population structure of Aeromonas hydrophila, Aer. bestiarum, Aer. salmonicida and Aer. popoffii by multilococus enzyme electrophoresis (MLEE)." Environmental Microbiology 6(3): 198-208. Miñana-Galbis, D., M. Farfán, J. G. Loren, et al. (2002). "Biochemical identification and numerical taxonomy of Aeromonas spp. isolated from environmental and clinical samples in Spain." Journal of Applied Microbiology 93: 420-430. Miñana-Galbis, D., M. Farfán, V. Albarral, et al. (2013). "Reclassification of Aeromonas hydrophila subspecies anaerogenes." Systematic and Applied Microbiology 36(5): 306-308. Miyake, M., K. Iga, C. Izumi, et al. (2000). "Rapidly progressive pneumonia due to Aeromonas hydrophila shortly after near-drowning." Internal Medicine 39(12): 1128-1130. Miyata, M. T. A., V. Inglis, T. Yoshida, et al. (1995). "RAPD analysis of Aeromonas salmonicida and Aeromonas hydrophila." Journal of Applied Bacteriology 79: 181-185. Mockracka, J., S. Krzyminska and E. Szcuka (2001). "Virulence factors of clinical isolates of Aeromonas caviae." Folia Microbiologica 46(4): 321-326. Morandi, A., O. Zhaxybayeva, J. P. Gogarten, et al. (2005). "Evolutionary and diagnostic implications of intragenomic heterogeneity in the 16S rRNA gene in Aeromonas strains." Journal of Bacteriology 187(18): 6561-6564. Morgan, D. R., P. C. Johnson, H. L. DuPont, et al. (1985). "Lack of correlation between known virulence properties of Aeromonas hydrophila and enteropathogenicity for humans." Infection and Immunity 50(1): 62-65. Morinaga, Y., K. Yanagihara, N. Araki, et al. (2011). "Clinical characteristics of seven patients with Aeromonas septicaemia in a Japanese hospital." Tohoku Journal of Experimental Medicine 225: 81-84. Mousdale, M. T. (1983). "Isolation of Aeromonas from faeces." The Lancet 1: 351.

-- 291 --

Moyer, N. P., G. Martinetti, J. Luthy-Hottenstein, et al. (1992). "Value of rRNA gene restriction patterns of Aeromonas spp. for epidemiological investigations. " Current Microbiology 24: 15-21. Moyer, N. P., H. K. Geiss, M. Marinescu, et al. (1991). "Media and methods for isolation of aeromonads from fecal specimens. A multilaboratory study." Experientia 47: 409-412. Moyer, N. P. (1987). "Clinical significance of Aeromonas species isolated from patients with diarrhoea." Journal of Clinical Microbiology 25(11): 2044-2048. Mukhopadyay, C., A. Bhargava and A. Ayyagri (2003). "Aeromonas hydrophila and aspiration pneumonia: a diverse presentation." Yonsei Medical Journal 44: 1087-1090. Munn, C. B., E. E. Ishiguro, W. W. Kay, et al. (1982). "Role of surface components in serum resistance of virulent Aeromonas hydrophila." Infection and Immunity 36(3): 1069-1075. Muñoz, P., V. Fernandez-Baca, T. Pelaez, et al. (1994). "Aeromonas peritonitis." Clinical Infectious Diseases 18: 32-37. Murphy, D. K., E. J. Septimus and D. C. Waagner (1992). "Catfish-related injury and infection: report of two cases and review of the literature." Clinical Infectious Diseases 14: 689-693. Murray, R. G. E., J. S. G. Dooley, P. W. Whippey, et al. (1988). "Structure of an S-layer on a pathogenic strain of Aeromonas hydrophila." Journal of Bacteriology 170(6): 2625-2630. Nagata, K., Y. Takeshima, K. Tomii, et al. (2011). "Fulminant fatal bacteraemic pneumonia due to Aeromonas hydrophila in a non-immunocompromised woman." Internal Medicine 50: 63-65. Nagpal, M. L., K. F. Fox and A. Fox (1998). "Utility of 16S-23S rRNA spacer region methodology: how similar are interspace regions within a genome and between strains for closely related organisms." Journal of Microbiological Methods 33: 211-219. Nakasone, N., C. Toma, T. Song, et al. (2004). "Purification and characterization of a novel metalloprotease isolated from Aeromonas caviae." FEMS Microbiology Letters 237: 127-132. Nakasone, N., M. Iwanaga, T. Yamashiro, et al. (1996). "Aeromons trota strains, which agglutinate with Vibrio cholerae O139 Bengal antiserum, possess a serologically distinct fimbrial colonization factor." Microbiology 142: 309-313. Nam, I. Y., H. Myung and K. Joh (2004). "Molecular cloning, purification, and characterization of an extracellular nuclease from Aeromonas hydrophila ATCC 14715." Journal of Microbiology and Biotechnology 14(1): 178-181. Namdari, H. and V. J. Cabelli (1989). "The suicide phenomenon in aeromonads." Applied and Environmental Microbiology 55(3): 543-547. Namdari, H. and E. J. Bottone (1990). "Microbiologic and clinical evidence supporting the role of Aeromonas caviae as a pediatric pathogen." Journal of Clinical Microbiology 28(5): 837-840. Nash, J. H. E., W. A. Findlay, C. C. Luebbert, et al. (2006). "Comparative genomics profiling of clinical isolates of Aeromonas salmonicida using DNA microarrays." BioMed Central Genomics 7(43): 1-15. Nathwani, D., R. B. S. Laing, G. Harvey and C. C. Smith (1991).“Treatment of symptomatic enteric Aeromonas hydrophila infection with ciprofloxacin.” Scandinavian Journal of Infectious Diseases 23: 653-654. Nawaz, M., S. A. Khan, A. A. Khan, et al. (2010). "Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish." Food Microbiology 27: 327-331.

-- 292 --

Nayduch, D., A. Honko, G. P. Noblet, et al. (2001). "Detection of Aeromonas caviae in the common housefly Musca domestica by culture and polymerase chain reaction." Epidemiology and Infection 127: 561-566. Nayduch, D., G. P. Noblet and F. J. Stutzenberger (2002). "Vector potential of houseflies for the bacterium Aeromonas caviae." Medical and Veterinary Entomology 16: 193-198. Nazer, H., E. H. Price, G. H. Hunt, et al. (1986). "Clinical associations of Aeromonas spp. in fecal specimens from children." Clinical Pediatrics 25(10): 516-519. Nerland, A. H. (1996). "The nucleotide sequence of the gene encoding GCAT from Aeromonas salmonicida ssp. salmonicida." Journal of Fish Diseases 19: 145- 150. Neuwirth, C., E. Siebor, F. Robin, et al. (2007). "First occurrence of an IMP metallo-B- lactamase in Aeromonas caviae: IMP-19 in an isolate from France." Antimicrobial Agents and Chemotherapy 51(12): 4486-4488. Neves, M. S., M. P. Nuñes and A. M. Milhomem (1994). "Aeromonas species exhibit aggregative adherence to HEp-2 cells." Journal of Clinical Microbiology 32(4): 1130-1131. Nhung, P. H., H. Hata, K. Ohkusu, et al. (2007). "Use of the novel phylogenetic marker dnaJ and DNA-DNA hybridization to clarify interrelationships within the genus Aeromonas." International Journal of Systematic and Evolutionary Microbiology 57(1232-1237). Nishikawa, Y., A. Hase, J. Ogawasara, et al. (1994). "Adhesion to and invasion of human colon carcinoma Caco-2 cells by Aeromonas strains." Journal of Medical Microbiology 40: 55-61. Nishikawa, Y. and T. Kishi (1988). "Isolation and characterization of motile Aeromonas from humans, food and environmental specimens." Epidemiology and Infection 101: 213-223. Nitta, H., H. Kobayashi, A. Irie, et al. (2007). "Activation of prothrombin by ASP, a serine protease released from Aeromonas sobria." FEBS Letters 581: 5935- 5939. Nitta, H., T. Imamura, Y. Wada, et al. (2008). "Production of C5a by ASP, a serine protease released from Aeromonas sobria. " Journal of Immunology 181: 3602- 3608. Noonan, B. and T. J. Trust (1995). "Molecular analysis of an A-protein secretion mutant of Aeromonas salmonicida reveals a surface layer-specific protein secretion pathway. " Journal of Molecular Biology 248: 316-327. Noterdaeme, L., S. Bigawa, A. G. Steigerwalt, et al. (1996). "Numerical taxonomy and biochemical identification of fish associated motile Aeromonas spp." Systematic and Applied Microbiology 19: 624-633. Notermans, S., A. Havelaar, W. Jansen, et al. (1986). "Production of "Asao Toxin" by Aeromonas strains isolated from feces and drinking water." Journal of Clinical Microbiology 23(6): 1140-1142. Oakey, H. J., J. T. Ellis and L. F. Gibson (1995). "Can RAPD-PCR be used to discriminate between the hybridisation groups of Aeromonas?." Medical Microbiology Letters 4: 373-381. Oakey, H. J., J. T. Ellis and L. F. Gibson (1996). "Differentiation of Aeromonas genomospecies using random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR)." Journal of Applied Bacteriology 80: 402-410. Oakey, H. J., L. F. Gibson and A. M. George (1998). "Co-migration of RAPD-PCR amplicons from Aeromonas hydrophila." FEMS Microbiology Letters 164: 35- 38.

-- 293 --

Odeyemi, O. A., A. Asmat and G. Usup (2012). “Antibiotic resistance and putative virulence factors of Aeromonas hydrophila isolated from estuary.” Journal of Microbiology, Biotechnology and Food Science 1(6): 1339-1357. Ogugbue, C. J. and T. Sawidis (2011). "Bioremediation and detoxification of synthetic wastewater containing triarylmethane dyes by Aeromonas hydrophila isolated from industrial effluent." Biotechnology Research International doi:10.4061/2011/967925. O'Hara, C. (2006). "Evaluation of the Phoenix 100 ID/AST system and NID panel for identification of Enterobacteriaceae, Vibrionaceae, and commonly isolated nonenteric Gram-negative bacilli." Journal of Clinical Microbiology 44(3): 928-933. Okamoto, K., T. Nomura, M. Hamada, et al. (2000). "Production of serine protease of Aeromonas sobria is controlled by the protein encoded by the gene lying adjacent to 3' and the protease gene." Microbiology and Immunology 9: 787- 798. Okumura, K., F. Shoji, M. Yoshida, et al. (2011). "Severe sepsis caused by Aeromonas hydrophila in a patient using tocilizumab: a case report." Journal of Medical Case Reports 5(499): 1-3. Ørmen, Ø. and Ø. Øestensvik (2001). "The occurrence of aerolysin-positive Aeromonas spp. and their cytotoxicity in Norwegian water sources." Journal of Applied Microbiology 90: 797-802. Ørmen, Ø., P. E. Granum, J. Lassen, et al. (2005). "Lack of agreement between biochemical and genetic identification of Aeromonas spp." Acta Pathologica, Microbiologica et Immunologica Scandinavica 113: 203-207. Osman, K. M., Z. M. S. Amin, M. A. K. Aly, et al. (2011). "SDS-PAGE heat shock protein profiles of environmental Aeromonas strains." Polish Journal of Microbiology 60(2): 149-154. Osterhout, G. J., V. H. Shull and J. D. Dick (1991)."Identification of clinical isolates of Gram-negative nonfermentative bacteria by an automated cellular fatty acid identification system." Journal of Clinical Microbiology 29(9): 1822-1830. Ottaviani, D., C. Parlani, B. Citterio, et al. (2011). "Putative virulence properties of Aeromonas strains isolated from food, environmental and clinical sources in Italy." International Journal of Food Microbiology 144: 538-545. Ouderkirk, J. P., D. Bekhor, G. S. Turett, et al. (2004). "Aeromonas meninigitis complicating medicinal leech therapy." Clinical Infectious Diseases 38: e36- e37. Overman, T. L. and J. M. Janda (1999). "Antimicrobial susceptibility patterns of Aeromonas jandaei, A. schubertii, A. trota, and A. veronii biotype veronii." Journal of Clinical Microbiology 37(3): 706-708. Overman, T. L. and J. P. Seabolt (1983). "Minimal inhibitory concentrations of antimicrobial agents against Aeromonas hydrophila determined with the Autobac MTS." Journal of Clinical Microbiology 17(6): 1175-1176. Oxoid Manual (1998).”Compiled by E. Y. Bridson, 8th Edition.” Published by OXOID Limited, Hampshire, England. Pablos, M., G. Huys, M. Cnockaert, et al. (2011). "Identification and epidemiological relationships of Aeromonas isolates from patients with diarrhoea, drinking water and foods." International Journal of Food Microbiology 147: 203-210. Pablos, M., M. A. Remacha, J. M. Rodríguez-Calleja, et al. (2010). "Identity, virulence genes, and clonal relatedness of Aeromonas isolates from patients with diarrhoea and drinking water." European Journal of Clinical Microbiology and Infectious Diseases 29: 1163-1172.

-- 294 --

Paisley, R. (1999). "Training Manual: MIS Whole Cell Fatty Acid Analysis by Gas Chromatography." Newark, MIDI-Inc. Del, USA. Palfreeman, S. J., L. K. Waters and M. Norris (1983). "Aeromonas hydrophila gastroenteritis." Australian and New Zealand Journal of Medicine 13: 524- 525. Palu, A. P., L. Martins G., M. A. Lemos M., et al. (2006). "Antimicrobial resistance in food and clinical Aeromonas isolates." Food Microbiology 23: 504-509. Palumbo, S. A., M. M. Bencivengo, F. Del Corral, et al. (1989). "Characterisation of the Aeromonas hydrophila group isolated from retail foods of animal origin." Journal of Clinical Microbiology 27(5): 854-859. Palumbo, S. A., F. Maxino, A. C. Williams, et al. (1985). "Starch-ampicillin agar for the quentitative detection of Aeromonas hydrophila." Applied and Environmental Microbiology 50: 1027-1030. Pampin, F., G. Bou, R. Galeiras, et al. (2012). "Aeromonas and meningitis: an unusual presentation." Neurocirugía 23(5): 200-202. Pang, M. D., X. Q. Lin, M. Hu, et al. (2012). "Tetrahymena: an alternative model host for evaluating virulence of Aeromonas strains." PLoS ONE 7(11): e48922. Park, T. S., S. H. Oh, E. Y. Lee, et al. (2003). "Misidentification of Aeromonas veronii biovar sobria as Vibrio alginolyticus by the Vitek system." Letters in Applied Microbiology 37: 349-353. Park, S. Y., H. Min Nam, K. Park, et al. (2011). "Aeromonas hydrophila sepsis mimicking Vibrio vulnificus infection." Annals of Dermatology 23(S1): S25- S27. Parker, J. L. and J. G. Shaw (2011). "Aeromonas spp. clinical microbiology and disease." Journal of Infection 62: 109-118. Parras, F., M. D. Díaz, J. Reina, et al. (1993). "Meningitis due to Aeromonas species: case report and review." Clinical Infectious Diseases 17: 1058-1060. Paton, A. W. and J. C. Paton (1998). "Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohaemorrhagic E. coli hlyA, rfb0111 and rf0157." Journal of Clinical Microbiology 36(2): 598-602. Paula, S. J., P. S. Duffey, S. L. Abbott, et al. (1988). "Surface properties of autoagglutinating mesophilic aeromonads." Infection and Immunity 56(10): 2658-2665. Pavan, M. E., S. L. Abbott, J. Zorzopulos, et al. (2000). "Aeromonas salmonicida ssp. pectinolytica ssp. nov., a new pectinase-positive subspecies isolated from a heavily polluted river." International Journal of Systematic and Evolutionary Microbiology 50: 1119-1124. Pazzaglia, G., J. R. Escalante, R. B. Sack, et al. (1990a). "Transient intestinal colonization by multiple phenotypes of Aeromonas species during the first week of life." Journal of Clinical Microbiology 28(8): 1842-1846. Pazzaglia G., R. B. Sack, A. L. Bourgeois, et al. (1990b). "Diarrhoea and intestinal invasiveness of Aeromonas strains in the removable intestinal tie rabbit model." Infection and Immunity 58(6): 1924-1931. Pemberton, J. M., S. P. Kidd and R. Schmidt (1997). "Secreted enzymes of Aeromonas." FEMS Microbiology Letters 152: 1-10. Pepe, C. M., M. W. Eklund and M. S. Ström (1996). "Cloning of an Aeromonas hydrophila type IV pilus biogenesis gene cluster: complementation of pilus assembly functions and characterisation of a type IV leader peptidase/N- methyltransferase required for extracellular protein secretion." Molecular Microbiology 19(4): 857-869.

-- 295 --

Petti, C. A., C. R. Polage and P. Schreckenberger (2005). "The role of 16S rRNA gene sequencing in identification of microorganisms misidentified by conventional methods." Journal of Clinical Microbiology 43(12): 6123-6125. Pham, C. A., S. J. Jung, N. T. Phung, et al. (2003). "A novel electrochemically active and Fe(III)-reducing bacterium phylogenetically related to Aeromonas hydrophila, isolated from a microbial fuel cell." FEMS Microbiology Letters 223: 129-134. Phipps, B. M. and W. W. Kay (1988). "Immunoglobulin binding by the regular surface array of Aeromonas salmonicida." Journal of Biological Chemistry 263(19): 9298-9303. Picȁo, R. C., L. Poirel, A. Demarta, et al. (2008). "Extended-spectrum B-lactamase PER-1 in an environmental Aeromonas media isolated from Switzerland." Antimicrobial Agents and Chemotherapy 52(9): 3461-3462. Picard, B. and P. Goullet (1987). "Epidemiological complexity of hospital aeromonas infections revealed by electrophoretic typing of esterases " Epidemiology and Infection 95: 5-14. Pickett, M. J., J. R. Greenwood and S. M. Harvey (1991). "Tests for detecting degradation of gelatin: comparison of five methods." Journal of Clinical Microbiology 29: 2322-2325. Pickett, M. J. and M. M. Pedersen (1970). "Characterization of saccharolytic nonfermentative bacteria associated with man." Canadian Journal of Microbiology 16(5): 351-362. Pidiyar, V., A. Kasnowski, N. Badri Narayan, et al. (2002). "Aeromonas culicicola sp. nov., from the midgut of Culex quinquefasciatus." International Journal of Systematic and Evolutionary Microbiology 52: 1723-1728. Pidiyar, V., K. Jangid, K. M. Dayananda, et al. (2003). "Phylogenetic affiliation of Aeromonas culicicola MTCC 3249T based on gyrB gene sequence and PCR- amplicon sequence analysis of cytolytic enterotoxin gene." Systematic and Applied Microbiology 26: 197-202. Pillai, L., J. Sha, T. E. Erova, et al. (2006). "Molecular and functional characterisation of a ToxR-regulated lipoprotein from a clinical isolate of Aeromonas hydrophila." Infection and Immunity 74(7): 3742-3755. Pin, C., M. L. Marin, M. L. García, et al. (1994). "Comparison of different media for the isolation and enumeration of Aeromonas spp. in foods." Letters in Applied Microbiology 18: 190-192. Pinna, A., L. A. Sechi, S. Zannetti, et al. (2004). "Aeromonas caviae keratitis associated with contact lens wear." Ophthalmology 111: 348-351. Pitarangsi, C., P. Echeverria, R. Whitmire, et al. (1982). "Enteropathogenicity of Aeromonas hydrophila and Plesiomonas shigelloides: prevalence among individuals with and without diarrhoea in Thailand." South East Asian Journal of Tropical Medicine and Public Health 13(3): 491-492. Pokhrel, B. M. and N. Thapa (2004). "Prevalence of Aeromonas in different clinical and water samples with special reference to gastroenteritis." Nepal Medical College Journal 6(2): 139-143. Pollack, F. P., M. Coluccio, R. Ruttimann, et al. (1998). "Infected stingray injury." Pediatric Infectious Diseases Journal 17: 349-360. Poole, K. (2000). "Efflux-mediated resistance to fluoroquinolones in gram-negative bacteria." Antimicrobial Agents and Chemotherapy 44: 2233-2241. Popoff, M. (1984). "Aeromonas."In: Bergey's Manual of Systematic Bacteriology Vol. 1, ed. N. R. Krieg. Williams and Wilkins, Baltimore, USA. Popoff, M. and M. Veron (1976). "A taxonomic study of the Aeromonas hydrophila- Aeromonas punctata group." Journal of General Microbiology 94: 11-22.

-- 296 --

Popoff, M. Y., C. Coynault, M. Kiredjian, et al. (1981). "Polynucleotide sequence relatedness among motile Aeromonas species." Current Microbiology 5: 109- 114. Potomski, J., V. Burke, I. Watson, et al. (1987). "Purification of cytotoxic enterotoxin of Aeromonas sobria by use of monoclonal antibodies." Journal of Medical Microbiology 23: 171-177. Presley, S. M., T. R. Rainwater, G. P. Austin, et al. (2006). "Assessment of pathogens and toxicans in New Orleans, LA following hurricane Katrina." Environmental Science and Technology 40: 468-474. Pridgeon, J. W., P. H. Klesius, X. Mu, et al. (2011). "Identification of unique DNA sequences present in highly virulent 2009 Alabama isolates of Aeromonas hydrophila." Veterinary Microbiology 152: 117-125. Puah, S. M., S. D. Puthucheary, F. Y. Liew, et al. (2013). "Aeromonas aquariorum clinical isolates: antimicrobial profiles, plasmids and genetic determinants." International Journal of Antimicrobial Agents 41(3): 281-284. Pukatzki, S., A. T. Ma, A. T. Revel, et al. (2007). "Type VI secretion system translocates a phage tail spike-like protein into target cells where it cross-links actin." Proceedings of the National Academy of Sciences USA 104: 15508- 15513. Pukatzki, S., S. B. McAuley and S. T. Miyata (2009). "The type VI secretion system: translocation of effectors and effector-domains." Current Opinions in Microbiology 12: 11-17. Purdue, G. H. and J. L. Hunt (1996). "Aeromonas hydrophila infection in burn patients." Burns 14: 220-221. Puthucheary, S. D., S. Moi Puah and K. Heng Chua (2012). "Molecular characterization of clinical isolates of Aeromonas species from Malaysia." PloS One 7(2). Qadri, S. M., L. P. Gordon, R. D. Wende, et al. (1976). "Meningitis due to Aeromonas hydrophila." Journal of Clinical Microbiology 3: 102-104. Quinn, D. M., C. Y. F. Wong, H. M. Atkinson, et al. (1993). "Isolation of carbohydrate-reactive outer membrane proteins of Aeromonas hydrophila." Infection and Immunity 61(2): 371-377. Quinn, D. M., H. M. Atkinson, A. H. Bretag, et al. (1994). "Carbohydrate-reactive, pore-forming outer membrane proteins of Aeromonas hydrophila." Infection and Immunity 62(9): 4054-4058. Rabaan, A. A., I. Gryllos, J. M.Tomas, et al. (2001). "Motility and the polar flagellum are required for Aeromonas caviae adherence to Hep-2 cells." Infection and Immunity 69(7): 4257-4267. Rael, R. M. and W. T. Frankenberger Jr (1996). "Influence of pH, salinity, and selenium on the growth of Aeromonas veronii in evaporation agricultural drainage water." Water Research 30(2): 422-430. Rahman, A. F. M. S. and J. M. T. Willoughby (1980). "Dysentery-like syndrome associated with Aeromonas hydrophila." British Medical Journal 281: 976. Rahman, M., G. Huys, M. Rahman, et al. (2007a). "Persistence, transmission, and virulence characteristics of Aeromonas strains in a duckweed aquaculture- based hospital sewage water recycling plant in Bangladesh." Applied and Environmental Microbiology 73(5): 1444-1451. Rahman, M. H., S. Suzuki and K. Kawai (2001). “Formation of viable but non- culturable state (VBNC) of Aeromonas hydrophila and its virulence in goldfish, Carassius auratus.” Microbiology Research 156(1): 103-106. Rahman, M., P. Colque-Navarro, I. Kuhn, et al. (2002). "Identification and characterization of pathogenic Aeromonas veronii biovar sobria associated

-- 297 --

with epizootic ulcerative syndrome in fish in Bangladesh." Applied and Environmental Microbiology 68(2): 650-655. Rahman, M., R. Simm, A. Kader, et al. (2007b). "The role of c-di-GMP signaling in an Aeromonas veronii biovar sobria strain." FEMS Microbiology Letters 273: 172-179. Ramamurthy, T., A. Ghosh, G. P. Pazhani and S. Shinoda (2014). “Current perspectives on viable but non-culturable (VBNC) pathogenic bacteria.” Frontiers in Public Health doi: 10.3389/fpubh.2014.00103. Ramteke, P. W., S. P. Pathak, A. R. Gautam, et al. (1993). "Association of Aeromonas caviae with sewage pollution." Journal of Environmental Science and Health A28(4): 859-870. Rangrez, A. Y., K. M. Dayananda, S. Atanur, et al. (2006). "Detection of conjugation related type IV secretion machinery in Aeromonas culicicola." PloS One 1(1): 1-5. Rangrez, A. Y., M. Y. Abajy, W. Keller, et al. (2010). “Biochemical characterization of three putative ATPases from a new type IV secretion system of Aeromonas veronii plasmid pAC3249A.” BMC Biochemistry 11:10 doi:10.1186/1471- 2091-11-10. Rasch, M., V. Gaedt Kastbjerg, J. Bartholin Bruhn, et al. (2007). "Quorum sensing signals are produced by Aeromonas salmonicida and quorum sensing inhibitors can reduce production of a potential virulence factor." Diseases of Aquatic Organisms 78: 105-113. Rasmussen, B. and K. Bush (1997). "Carbapenem-hydrolyzing B-lactamases " Antimicrobial Agents and Chemotherapy 41: 223-232. Rasmussen, B. A., D. Keeney, Y. Yang, et al. (1994). "Cloning and expression of a cloxacillin-hydrolysing enzyme and a cephalosporinase from Aeromonas sobria AER 14M in Escherichia coli: requirement for an E. coli chromosomal mutation for efficient expression of the class D enzyme." Antimicrobial Agents and Chemotherapy 38(9): 2078-2085. Rautelin, H., A. Sivonen, A. Kuikka, et al. (1995b). "Role of Aeromonas isolated from feces of Finnish patients." Scandinavian Journal of Infectious Diseases 27: 207-210. Rautelin, H., M. L. Hänninen, A. Sivonen, et al. (1995a). "Chronic diarrhea due to a single strain of Aeromonas caviae." European Journal of Clinical Microbiology and Infectious Diseases 14(1): 51-53. Raynor, A. C., H. G. Bingham, H. H. Caffee, et al. (1983). "Alligator bites and related infections." Journal of the Florida Medical Association 70: 107-110. Reines, H. D. and F. V. Cook (1981). "Pneumonia and bacteremia due to Aeromonas hydrophila." Chest 80(3): 264-267. Reinhard, J. F. and W. L. George (1985). "Comparative in vitro activities of selected antimicrobial agents against Aeromonas species and Plesiomonas shigelloides." Antimicrobial Agents and Chemotherapy 27(4): 643-645. Renaud, F., J. Freney, J. M. Boeufgras, et al. (1988). "Carbon substrate assimilation patterns of clinical and environmental strains of A. hydrophila, Aeromonas sobria and A. caviae observed with a micromethod." Zentralblatt für Bakteriologie, Mikrobiologie und Hygiene A269: 323-330. Revord, M. E., J. Goldfarb and S. B. Shurin (1988). "Aeromonas hydrophila wound infection in a patient with cyclic neutropaenia following a piranha bite." Pediatric Infectious Disease Journal 7(1): 70-71. Rhodes, G., G. Huys, J. Swings, et al. (2000). "Distribution of oxytetracycline resistance plasmids between aeromonads in hospital and aquaculture environments: implication of Tn1721 in dissemination of the tetarcycline

-- 298 --

resistance determinant Tet A." Applied and Environmental Microbiology 66(9): 3883-3890. Rhodes, G., J. Parkhill, C. Bird, et al. (2004). "Complete nucleotide sequence of the conjugative tetracycline resistance plasmid pFBAOT6, a member of a group of IncU plasmids with global ubiquity." Applied and Environmental Microbiology 70(12): 7497-7510. Ribardo, D. A., K. R. Kuhl, I. Boldogh, et al. (2002). "Early cell signalling by the cytotoxic enterotoxin of Aeromonas hydrophila in macrophages." Microbial Pathogens 32: 149-163. Roberts, M. T. M., D. A. Enoch, K. A. Harris, et al. (2006). "Aeromonas veronii biovar sobria bacteraemia with septic arthritis confirmed by 16S rDNA PCR in an immunocompetent adult." Journal of Medical Microbiology 55: 241-243. Robinson, J., V. Burke, P. J. Worthy, et al. (1984)." Media for isolation of Aeromonas spp. from faeces." Journal of Medical Microbiology 18: 405-411. Robinson, J., J. Beaman, L. Wagener, et al. (1986)."Comparison of direct plating with the use of enrichment culture for isolation of Aeromonas spp. from faeces." Journal of Medical Microbiology 22: 315-317. Robson, W. L. M., A. K. C. Leung and C. L. Trevenen (1992). "Haemolytic-uraemic syndrome associated with Aeromonas hydrophila enterocolitis." Pediatric Nephrology 6: 221-222. Rodríguez-Calleja, J. M., M. L. García-Lopez, J. A. Santos, et al. (2006). "Rabbit meat as a source of bacterial foodborne pathogens." Journal of Food Protection 69(5): 1106-1112. Rodríguez, C. N., B. Novoa and A. Figueras (2008). "Immune response of zebrafish (Danio rerio) against a newly isolated bacterial pathogen Aeromonas hydrophila." Fish and Shellfish Immunology 25: 239-249. Rodríguez, C. N., R. Campos, B. Pastran, et al. (2005). "Sepsis due to extended- spectrum B-lactamase-producing Aeromonas hydrophila in a pediatric patient with diarrhoea and pneumonia." Clinical Infectious Diseases 41(3): 421-422. Rodríguez, L. A., A. E. Ellis and T. P. Nieto (1992). "Purification and characterization of an extracellular metalloprotease, serine protease and haemolysin of Aeromonas hydrophila strain B32: are lethal for fish." Microbial Pathogenesis 13: 17-24. Roffey, P. E., and J. M. Pemberton (1990). "Cloning and expression of an Aeromonas hydrophila chitinase gene in Escherichia coli. " Current Microbiology 21: 329- 337. Roger, F., B. Lamy, E. Jumas-Bilak, et al. (2012a). "Ribosomal multi-operon diversity: an original perspective on the genus Aeromonas." PLos One 7: e46268. Roger, F., H. Marchandin, E. Jumas-Bilak, et al. (2012b). "Multiloccus genetics to reconstruct aeromonad evolution." BioMedCentral Microbiology 12: 62. Rosco Diatabs Manual (2000). 5th edition. Taastrup, Denmark Rossolini, G. M., A. Zanchi, A. Chiesurin, et al. (1995). "Distribution of cphA or related carbapenemase-encoding genes and production of carbapenemases activity in members of the genus Aeromonas. " Antimicrobial Agents and Chemotherapy 39: 346-349. Rossolini, G. M., T. Walsh and G. Amicosante (1996). "The Aeromonas metallo-B- lactamases: genetics, enzymology, and contribution to drug resistance." Microbial Drug Resistance 2(2): 245-252. Royle, J. A., D. Isaacs, G. Eagles, D. Cass, N. Gilroy, S. Chen, D. Malouf and C. Griffiths (1997). "Infections after shark attacks in Australia." Pediatric Infectious Diseases 16: 531-532.

-- 299 --

Ruíz de Gonzalez, P., C. Escolano, J. C. Rodríguez, et al. (1994). "Aeromonas sobria spontaneous bacterial peritonitis and bacteraemia." American Journal of Gastroenterology 89: 290-291. Rust, L., C. R. Messing and B. H. Iglewski (1994). "Elastase assays." Methods in Enzymology 235: 554-562. Saavedra, M. J., V. Perea, M. C. Fontes, et al. (2007). "Phylogenetic identification of Aeromonas strains isolated from carcasses of pig as new members of the species Aeromonas allosaccharophila." Antonie van Leeuwenhoek 91: 159- 167. Saavedra, M. J., M. J. Figueras and A. J. Martínez-Murcia (2006). "Updated phylogeny of the genus Aeromonas." International Journal of Systematic and Evolutionary Microbiology 56: 2481-2487. Saha, P. and T. Chakrabarti (2006). "Aeromonas sharmana sp. nov., isolated from a warm spring." International Journal of Systematic and Evolutionary Microbiology 56: 1905-1909. Saitou, N. and M. Nei (1987). "The neighbour-joining method: a new method for reconstructing phylogenetic trees." Molecular Biology and Evolution 4(4): 406- 425. San Joaquín, V. H. and D. A. Pickett (1988). "Aeromonas-associated gastroenteritis in children." Pediatric Infectious Diseases 7: 53-57. Sánchez-Céspedes, J., M. D. Blasco, S. Marti, et al. (2008). "Plasmid-mediated QnrS2 determinant from a clinical Aeromonas veronii isolate." Antimicrobial Agents and Chemotherapy 52(8): 2990-2991. Sánchez-Céspedes, J., M. J. Figueras, C. Aspiroz, et al. (2009). "Development of imipenem resistance in an Aeromonas veronii biovar sobria clinical isolate recovered from a patient with cholangitis." Journal of Medical Microbiology 58: 451-455. Santos, J. A., C. J. Gonzalez, A. Otero, et al. (1999). "Haemolytic activity and siderophore production in different Aeromonas species isolated from fish." Applied and Environmental Microbiology 65(12): 5612-5614. Santos, P. G., P. A. Santos, A. R. Bello, et al. (2010). "Association of Aeromonas caviae polar and lateral flagella with biofilm formation." Letters in Applied Microbiology 52: 49-55. Satta, G., P. E. Varaldo, G. Grazi, et al. (1977). "Bacteriolytic activity in staphylococci." Infection and Immunity 16(1): 37-42. Sawle, G. V., B. C. Das, P. R. Acland, et al. (1986). "Fatal infection with Aeromonas sobria and Plesiomonas shigelloides." British Medical Journal 292: 525-526. Schaefer, A. L., D. L. Val, B. L. Hanzelka, et al. (1996). “Generation of cell-to-cell signals in quorum-sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein.” Proceeding of the National Academy of Sciences of the United States of America 93(18): 9505-9509. Scheffer, J., W. Konig, V. Braun, et al. (1988). "Comparison of four haemolysin- producing organisms (Escherichia coli, Serratia marcescens, Aeromonas hydrophila and Listeria monocytogenes) for release of inflammatory mediators from various cells." Journal of Clinical Microbiology 26(3): 544-551. Schoenhofen, I., C. C. Stratilo and S. P. Howard (1998). "An ExeAB complex in the type II secretion pathway of Aeromonas hydrophila: effect of ATP-binding cassette mutations on complex formation and function." Molecular Microbiology 29(5): 1237-1247. Schreier, J. C. (1969). "Modification of DNase test medium for rapid identification of Serratia marcescens." American Journal of Clinical Pathology 51: 711-716.

-- 300 --

Schröder, G. and E. Lanka (2005). "The mating pair formation system of conjugative plasmids - a versatile secretion machinery for transfes of proteins and DNA." Plasmid 54: 1-25. Schubert, R. H. W. (1967a). "The taxonomy and nomenclature of the genus Aeromonas Kluyver and van Niel 1936. Part I. Suggestions on the taxonomy and nomenclature of the aerogenic Aeromonas species." International Journal of Systematic Bacteriology 17: 23. Schubert, R. H. W. (1967b). "The taxonomy and nomenclature of the genus Aeromonas Kluyver and van Niel 1936. Part II. Suggestions on the taxonomy and nomenclature of the anaerogenic Aeromonas species." International Journal of Systematic Bacteriology 17: 273. Schubert, R. H. W. (1987). "Ecology of aeromonads and isolation from environmental samples." Experientia 43: 351-354. Schubert, R. H. W. (1968). "The taxonomy and nomenclature of the genus Aeromonas Kluyver and Van Niel 1936." International Journal of Systematic Bacteriology 18(1): 1-7. Schubert, R. H. W. and M. Hegazi (1988). "Aeromonas eucrenophila species nova Aeromonas caviae a later and illegitimate synonym of Aeromonas punctata." Zentrablatt Bakteriologie Hygiene A268: 34-39. Schubert, R. H. W., M. Hegazi and W. Wahlig (1990a). "Aeromonas ichtiosmia species nova." Hygiene and Medicine 15: 477-479. Schubert, R. H. W., M. Hegazi and W. Wahlig (1990b). "Aeromonas enteropelogenes species nova." Hygiene and Medicine 15: 471-472. Schubert, R. H. W. (1974). "Genus II. Aeromonas.” In Buchanan and Gibbons (Editors), Bergey’s Manual of Determinative Bacteriology, 8th Ed., The Williams and Wilkins Co., Baltimore, 345-348. Schubert, R. H. W. (1991). "Aeromonads and their significance as potential pathogens in water." Journal of Applied Bacteriology Sym. Supp. 70: 131S-135S. Schultz, A. J. and B. A. McCardell (1988). "DNA homology and immunological cross- reactivity between Aeromonas hydrophila cytotonic toxin and cholera toxin." Journal of Clinical Microbiology 26: 57-61. Schwenteit, J., L. Gram, K. F. Nielsen, et al. (2010). "Quorum sensing in Aeromonas salmonicida subsp. achromogenes and the effect of the autoinducer synthase AsaI on bacterial virulence." Veterinary Microbiology 147: 389-397. Scott, E. G., C. M. Russell, K. T. Noell, et al. (1978). "Aeromonas hydrophila sepsis in a previously healthy man." Journal of the American Medical Association 239(17): 1742. Sechi, L. A., A. Deriu, M. P. Falchi, et al. (2002). "Distribution of virulence genes in Aeromonas spp. isolated from Sardinian waters and from patients with diarrhoea." Journal of Applied Microbiology 92: 221-227. Sedláček, I., E. Krejčí, A. Andělová, et al. (2012). "Aeromonas hydrophila subsp. dhakensis a causative agent of gastroenteritis imported into the Czech Republic." Annals of Agriculture and Environmental Medicine 19(3): 409- 413. Seetha, K. S., B. T. Jose and A. Jasthi (2004). "Meningitis due to Aeromonas hydrophila." Indian Journal of Medical Microbiology 22(3): 191-192. Segatore, B., O. Massidda, G. Satta, et al. (1993). "High specificity of cphA-encoded metallo-B-lactamase from Aeromonas hydrophila AE036 for carbapenems and its contribution to B-lactam resistance." Antimicrobial Agents and Chemotherapy 37: 1324-1328.

-- 301 --

Seidler, R. J., D. A. Allen, H. Lockman, et al. (1980). "Isolation, enumeration, and characterization of Aeromonas from polluted waters encountered in diving operations." Applied and Environmental Microbiology 39(5): 1010-1018. Sen, K. and M. Rodgers (2004). “Distribution of six virulence factors in Aeromonas species isolated from US drinking water utilitiies: a PCR identification.” Journal of Applied Microbiology 97:1077-1086. Sen, K. (2005). "Development of a rapid identification method for Aeromonas species by multiplex-PCR." Canadian Journal of Microbiology 51(11): 957-966. Sen, K. and D. Lye (2007). "Importance of flagella and enterotoxins for Aeromonas virulence in a mouse model." Canadian Journal of Microbiology 53: 261-269. Senderovich, Y., S. Ken-Dror, I. Vainblat, et al. (2012). "A molecular study on the prevalenece and virulence potential of Aeromonas spp. recovered from patients suffering from diarrhoea in Israel." PloS One 7(2): 1-6. Senderovich, Y., Y. Gershtein, E. Halewa, et al. (2008). "Vibrio cholerae and Aeromonas: do they share a mutual host." International Society for Microbial Ecology 2: 276-283. Sepe, A., P. Barbieri, R. Peduzzi, et al. (2008). "Evaluation of recA sequencing for the classification of Aeromonas strains at the genotype level." Letters in Applied Microbiology 46: 439-444. Seshadri, K., S. W. Joseph, A. K. Chopra, et al. (2006). "Genome sequence of Aeromonas hydrophila ATCC 7966: the jack of all trades." Journal of Bacteriology 188(23): 8272-8282. Sha, J., C. L. Galindo, V. Pancholi, et al. (2003). "Differential expression of the enolase gene under in vivo versus in vitro growth conditions of Aeromonas hydrophila." Microbial Pathogens 34: 195-204. Sha, J., E. V. Kozlova and A. K. Chopra (2002). "Role of various enterotoxins in Aeromonas hydrophila-induced gastroenteritis: generation of enterotoxin gene- deficient mutans and evaluation of their enterotoxin activity." Infection and Immunity 70(4): 1924-1935. Sha, J., L. Pillai, A. A. Fadl, et al. (2005). "The type III secretion system and cytotoxic enterotoxin alter the virulence of Aeromonas hydrophila " Infection and Immunity 73(10): 6446-6457. Sha, J., M. Lu and A. K. Chopra (2001). "Regulation of the cytotoxic enterotoxin gene in Aeromonas hydrophila characterisation of an iron uptake regulator." Infection and Immunity 69(10): 6370-6381. Sha, J., S. F. Wang, G. Suarez, et al. (2007). "Further characterization of a type III secretion system (T3SS) and of a new effector protein froma clinical isolate of Aeromonas hydrophila - Part I." Microbial Pathogens 43: 127-146. Sha, J., T. E. Erova, R. A. Alyea, et al. (2009). "Surface-expressed enolase contributes to the pathogenesis of clinical isolate SSU of Aeromonas hydrophila." Journal of Bacteriology 191(9): 3095-3107. Sha, J., J. A. Rosenzweig, E. V. Kozlova, et al. (2013). "Evaluation of the roles played by Hcp and VgrG type 6 secretion system effectors in Aeromonas hydrophila SSU pathogenesis.” Microbiology 159(6): 1120–1135. Shannon, K., A. King and I. Phillips (1986). "Beta-lactamases with high activity against imipenem and Sch 34343 from Aeromonas hydrophila." Journal of Antimicrobial Therapy 17: 45-50. Sharma, A., N. Dubey and B. Sharan (2005). "Characterization of aeromonads isolated from the river Narmada, India." International Journal of Hygiene and Environmental Health 208: 425-433.

-- 302 --

Shaw, D. H. and H. J. Hodder (1978). "Lipopolysaccharides of the motile aeromonads; core oligosaccharide analysis as an aid to taxonomic classification." Canadian Journal of Microbiology 24: 864-868. Shaw, J. G., J. P. Thornley, I. Palmer, et al. (1995). "Invasion of tissue culture cells by A. caviae." Medical Microbiology Letters 4: 324-331. Sherlock, C. H., D. R. Burdge and J. A. Smith (1987). "Does Aeromonas hydrophila preferentially colonized the bowels of patients with haematologic malignancies?." Diagnostic Microbiology and Infectious Disease 7: 63-68. Shieh, H. S. (1987). "Protection of Atlantic salmon against motile aeromonad septicaemia with Aeromonas hydrophila protease." Microbiology Letters 36: 133-138. Shimada, T., R. Sakazaki, K. Horigome et al. (1984). "Production of cholera-like enterotoxin by Aeromonas hydrophila." Japanese Journal of Medical Science and Biology 37: 141-144. Shotts, E. B., T. C. Hsu and W. D. Waltman (1985). "Extracellular proteolytic activity of Aeromonas hydrophila complex." Fish Pathogens 20(1): 37-44. Sierra, J. C., G. Suarez, J. Sha, et al. (2007). "Biological characterization of a new type III secretion system effector from a clinical isolate of Aeromonas hydrophila - Part II." Microbial Pathogens 43: 147-160. Silver, A. C., N. M. Rabinowitz, S. Küffer, et al. (2007). "Identification of Aeromonas veronii genes required for colonization by the medicinal leech, Hirudo verbana." Journal of Bacteriology 189: 6763-6772. Simidu, U., K. Ashino and E. Kaneko (1971). "Bacterial flora of phyto-and zoo- plankton in the inshore water of Japan." Canadian Journal of Microbiology 17: 1157-1160. Singh, D. V. and S. C. Sanyal (1992a). "Enterotoxicity of clinical and environmental isolates of Aeromonas spp." Journal of Medical Microbiology 36: 269-272. Singh, D. V. and S. C. Sanyal (1992b). "Haemolysin and enterotoxin production by Aeromonas caviae isolated from diarrhoeal patients, fish and environment." Journal of Diarrhoeal Disease Research 10(1): 16-20. Singh, D. V. and S. C. Sanyal (1992c). "Production of haemolysis and its correlation with enterotoxicity in Aeromonas spp." Journal of Medical Microbiology 37: 262-267. Singh, D. V. and S. C. Sanyal (1999). "Virulence patterns of Aeromonas eucrenophila isolated from water and infected fish." Journal of Diarrhoeal Disease Research 17(1): 37-42. Sinha, S., S. Chattopadhyay, S. K. Bhattacharya, et al. (2004). "An unusually high level of quinolone resistance associated with type II topoisomerase mutations in quinolone resistance-determining regions of Aeromonas caviae isolated from diarrhoeal patients." Research in Microbiology 155: 827-829. Sirinavin, S., S. Likitnukul and S. Lolekha (1984). "Aeromonas septicaemia in infants and children." Pediatric Infectious Diseases 3(2): 122-124. Sitrit, Y., C. E. Vorgias, I. Chet, et al. (1995). "Cloning and primary structure of the chiA gene from Aeromonas caviae." Journal of Bacteriology 177(14): 4187- 4189. Sletyr, U. B. and P. Messner (1983). "Crystalline surface layers on bacteria." Annual Reviews in Microbiology 37: 311-319. Smith, I. W. (1963). "The classification of Bacterium salmonicida." Journal of General Microbiology 33: 263. Smith, J. A. (1980a). "Aeromonas hydrophila: analysis of 11 cases." Canadian Medical Association Journal 122: 1270-1272.

-- 303 --

Smith, J. A. (1980b). "Ocular Aeromonas hydrophila " American Journal of Ophthalmology 89: 449-451. Sniezko, S. F. (1957). "The genus Aeromonas Kluyver and Van Neil 1936." In: R. S. Breed, E. G. D. Murray, and N. R. Smith (eds.), Bergey's Manual of Determinative Bacteriology p. 189-193. Williams and Wilkins Co. Baltimore, MD. Snowden, L., L. Wernbacher, D. Stenzel, et al. (2006). "Prevalence of environmental Aeromonas in South East Queensland, Australia: a study of their interactions with human monolayer Caco-2 cells." Journal of Applied Microbiology 101: 964-975. Snower, D. P., C. Ruef, A. P. Kuritza, et al. (1989). "Aeromonas hydrophila infection associated with the use of medicinal leeches." Journal of Clinical Microbiology 27(6): 1421-1422. Sohn, H. J., D. N. Nam, Y. S. Kim, et al. (2007). "Endogenous Aeromonas hydrophila endophthalmitis in an immunocompromised patient." Korean Journal of Ophthalmology 21: 45-47. Solaro, L. and J. Michael (1986). "Aeromonas hydrophila peritonitis in a renal transplant recipient." Journal of Infection 13(3): 300-301. Soler, L., M. A. Yañez, M. R. Chacón, et al. (2004). "Phylogenetic analysis of the genus Aeromonas based on two housekeeping genes." International Journal of Systematic and Evolutionary Microbiology 54: 1511-1519. Soler, L., M. J. Figueras, M. R. Chacón, et al. (2003a). "Comparison of three molecular methods for typing Aeromonas popoffii isolates." Antonie van Leeuwenhoek 83: 341-349. Soler, L., F. Marco, J. Vila, et al. (2003b). “Evaluation of two miniaturized systems, MicroScan W/A and BBL Crystal E/NF, for the identification of clinical isolates of Aeromonas spp.” Journal of Clinical Microbiology 41: 1511-1519. Soler, L., M. J. Figueras, M. R. Chacón, et al. (2002). "Potential virulence and antimicrobial susceptibility of Aeromonas popoffii recovered from freshwater and seawater." FEMS Immunology and Medical Microbiology 32: 243-247. Soutourina, O. A. and P. N. Bertin (2003). "regulation cascade of flagellar expression in Gram-negative bacteria." FEMS Microbiology Reviews 27(4): 505-523. Stackebrandt, E. and B. M. Goebel (1994). "Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in Bacteriology." International Journal of Systematic Bacteriology 44(4): 846- 849. Stackebrandt, E., W. Fredericksen, G. M. Garrity, et al. (2002). "Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology." International Journal of Systematic and Evolutionary Microbiology 52: 1043- 1047. Stanier, R. Y. (1943). "A note of the taxonomy of Proteus hydrophilus." Journal of Bacteriology 46: 213-214. Stephenson, J. R., S. E. Millership and S. Tabaqchali (1987). "Typing of Aeromonas species by polyacrilamide-gel electrophoresis of radiolabelled cell proteins." Journal of Medical Microbiology 24: 113-118. Stintzi, A. and K. N. Raymond (2000). "Amonobactin-mediated iron acquisition from transferrin and lactoferrin by Aeromonas hydrophila: direct measurement of individual of microscopic rate constants." Journal of Biological Inorganic Chemistry 5: 57-66. Stuber, K., S. E. Burr, M. Braun, et al. (2003). "Type III secretion genes in Aeromonas salmonicida subsp. salmonicida are located on a large thermolabile virulence plasmid." Journal of Clinical Microbiology 41(8): 3854-3856.

-- 304 --

Suarez, G., J. C. Sierra, J. M. L. Kirtley, et al. (2010a). "Role of Hcp, a type 6 secretion system effector, of Aeromonas hydrophila in modulating activation of host immune cells." Microbiology 156: 3678-3688. Suarez, G., J. C. Sierra, J. Sha, et al. (2008). "Molecular characterization of a functional type VI secretion system from a clinical isolate of Aeromonas hydrophila." Microbial Pathogens 44: 344-361. Suarez, G., J. C. Sierra, T. E. Erova, et al. (2010b). "A type VI secretion system effector protein, VgrG1, from Aeromonas hydrophila that induces host cell toxicity by ADP ribosylation of actin." Journal of Bacteriology 192(1): 155-168. Subashkumar, R., T. Thayumanavan, G. Vivekanandhan, et al. (2006). "Occurrence of Aeromonas hydrophila in acute gastroenteritis among children." Indian Journal of Medical Research 123: 61-66. Swift, S., A.V. Karlyshex, L. Fish, et al. (1997). "Quorum sensing in Aeromonas hydrophila and Aeromonas salmonicida: identification of the LuxRI homologs AhyRI and AsaRI and their cognate N-acylhomoserine lactone signal molecules." Journal of Bacteriology 179(17): 5271-5281. Swift, S., M. J. Lynch, L. Fish, et al. (1999b). "Quorum sensing-dependent regulation and blockade of exoprotease production in Aeromonas hydrophila." Infection and Immunity 67: 5192-5199. Swift, S., P. Williams and G. S. A. B. Stewart Ed. (1999a). "N-Acylhomoserine lactones and quorum sensing in proteobacteria:" In Cell-cell signalling in Bacteria. eds, G. M. Dunny and S. C. Winans, (eds). Washington, DC: American Society for Microbiology Press, pp. 291-314. Szabo, E. A., K. J. Scurrah and J. M. Burrows (2000). "Survey for psychotrophic bacterial pathogens in minimally processed lettuce." Letters in Applied Microbiology 30: 456-460. Szczuka, E. and A. Kaznowski (2004). "Typing of clinical and environmental Aeromonas sp. strains by Ramdom Amplified Polymorphic DNA PCR, Repetitive Extragenic Palindromic PCR, and Enterobacterial Repetitive Intergenic Consensus Sequence PCR." Journal of Clinical Microbiology 42(1): 220-228. Szczuka, E. and A. Kaznowski (2007). "Characterization of Aeromonas caviae and A. veronii by standardized cellular protein electrophoresis patterns." Folia Microbiologica 52(1): 65-69. Takahashi, A., M. Nakano, K. Okamoto, et al. (2006). "Aeromonas sobria haemolysin - causes diarrhoea by increasing secretion of HCO3 ." FEMS Microbiology Letters 258: 92-95. Takahashi, E., H. Ozaki, Y. Fujii, et al. (2014). “Properties of hemolysin and protease produced by Aeromonas trota.” Plos One DOI: 10.1371/journal.pone.0091149. Takano, Y., Y. Asao, Y. Kohri, et al. (1996). "Fulminant pneumonia and sepsis due to Aeromonas hydrophila in an alcohol abuser." Internal Medicine 35(5): 410- 412. Talon, D., M. J. Dupont, J. Lesne, et al. (1996). "Pulse-field gel electrophoresis as an epidemiological tool for clonal identification of Aeromonas hydrophila." Journal of Applied Bacteriology 80: 277-280. Tamura, K., J. Dudley, M. Nei, et al. (2007)."MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0." Molecular Biology and Evolution 24: 1596-1599. Tamura, K., D. Peterson, N. Peterson, et al. (2011). "MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods." Molecular Biology and Evolution 28: 2731- 2739.

-- 305 --

Taneja, N., S. Khurana, A. Trehan, et al. (2004). “An outbreak of hospital acquired diarrhoea due to Aeromonas sobria.” Indian Pediatrics 41(9): 912-916. Tayler, A. E., J. A. Ayala, P. Niumsup, et al. (2010). "Induction of B-lactamase production in Aeromonas hydrophila is responsive to B-lactam-mediated changes in peptidoglycan composition." Microbiology 156: 2327-2335. Tena, D., A. Gonzalez-Praetorius, C. Gimeno, et al. (2007). "Infeccion extraintestinal por Aeromonas spp.: revision de 38 casos." Enfermedades Infecciosas en Microbiología Clinica 25(4): 235-241. Thangaviji, V., M. Michaelbabu, S. Balakrishnan Anand, et al. (2012). "Immunization with the Aeromonas OMP provides protection against Aeromonas hydrophila in goldfish (Carassius auratus)." Journal of Microbial & Biochemical Technology 4: 045-049. Thomas, S. R. and T. J. Trust (1995). "Tyrosine phosphorylation of the tetragonal paracrystalline array of Aeromonas hydrophila: molecular cloning and high- level expression of the S-layer protein gene." Journal of Molecular Biology 245: 568-581. Thomas, S. R., P. Lutwyche and T. J. Trust (1997). "S-layer and homogeneous length lipopolysaccharide O-polysaccharide chains contribute to the ability of Aeromonas hydrophila to produce lethal disease in rainbow trout." FEMS Microbiology Letters 154(1): 1-7. Thompson, J. D., D. G. Higgins and T. J. Gibson (1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice." Nucleic Acids Research 22: 4673-4680. Thompson, J. D., T. J. Gibson, F. Plewniak, et al. (1997). "The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools." Nucleic Acids Research 25(24): 4876-4882. Thompson, C. C., F. L. Thompson, K.Vandemeulebroecke, et al. (2004). "Use of recA as an alternative phylogenetic marker in the family Vibrionaceae." International Journal of Systematic and Evolutionary Microbiology 54: 919- 929. Thornley, J. P., J. G. Shaw, I. A. Gryllos, et al. (1997). "Virulence properties of clinically significant Aeromonas species: evidence for pathogenicity." Reviews in Medical Microbiology 8(2): 61-72. Thornton, J., S. P. Howard and J. T. Buckley (1988). "Molecular cloning of a phospholipd-cholesterol acyltransferase from Aeromonas hydrophila. Sequence homologies with lecithin-cholesterol acyltransferase and other lipases." Biochimica et Biophysica Acta 959: 153-159. Tindall, B. J., R. Rosselló-Mora, H. J. Busse, et al. (2010). "Notes on the characterization of prokaryote strains for taxonomic purposes." International Journal of Systematic and Evolutionary Microbiology 60: 249-266. Titball, R. W. and C. B. Munn (1985). "The purification and some properties of H-lysin from Aeromonas salmonicida." Journal of General Microbiology 131: 1603- 1609. Todd, L. S., J. C. Hardy, M. F. Stringer, et al. (1989). "Toxin production by strains of Aeromonas hydrophila grown in laboratory media and prawn puree." International Journal of Food Microbiology 9: 145-156. Travis, L. B. and J. A. Washington (1985). "The clinical significance of stool isolates of Aeromonas." American Journal of Clinical Pathology 85: 330-336. Trower, C. J., S. Abo, K. N. Majeed, et al. (2000). "Production of an enterotoxin by a gastroenteritis-associated Aeromonas strain." Journal of Medical Microbiology 49: 121-126.

-- 306 --

Trust, T. J. and R. A. H. Sparrow (1974). "The bacterial flora in the alimentary tract of freshwater salmonid fishes." Canadian Journal of Microbiology 20: 1219- 1228. Trust, T. J., W. W. Kay and E. E. Ishiguro (1983). "Cell surface hydrophobicity and macrophage association of Aeromonas salmonicida." Current Microbiology 9: 315-318. Tsai, G. J. and T. H. Chen (1996). "Incidence and toxigenicity of Aeromonas hydrophila in seafood." International Journal of Food Microbiology 31: 121-131. Tsai, M. S., C. Y. Kuo, M. C. Wang, et al. (2006). "Clinical features and risk factors for mortality in Aeromonas bacteremic adults with haemotologic malignancies." Journal of Microbiology, Immunology and Infection 39: 150-154. Turnbull, P. C. B., J. V. Lee, M. D. Miliotis, et al. (1984). "Enterotoxin production in relation to taxonomic groupings and source of isolation of Aeromonas species." Journal of Clinical Microbiology 19(2): 173-180. Ueda, M., A. Fujiwara, T. Kawaguchi, et al. (1995). "Purification and some properties of six chitinases from Aeromonas sp. No. 10S-24." Bioscience, Biotechnology and Biochemistry 59: 2162-2164. Ueda, M. and M. Arain (1992). "Purification and some properties of B-N- acetylglucosaminidase from Aeromonas sp. 10S-24." Bioscience, Biotechnology and Biochemistry 56: 1204-1297. Ullmann, D., G. Krause, D. Knabner, et al. (2005). "Isolation and characterization of potentially human pathogenic, cytotoxin-producing Aeromonas strains from retailed seafood in Berlin, Germany." Journal of Veterinary Medicine B 52: 82- 87. United States Environmental Protection Agency USEPA (1998). Guidelines for ecological risk assessment. Announcement of the drinking water contaminant candidate list. Federal Register: 63(03): 10247-10287. Urdiain, M., A. López-López, C. Gonzalo, et al. (2008). "Reclassification of Rhodobium marinum and Rhodobium pfenningii asAfifella marina gen. nov. comb. nov. and Afifella pfenningii comb.nov., a new genus of photoheterotrophic Alphaproteobacteria and emended descriptions of Rhodobium, Rhodobium orientis and Rhodobium gokarnense." Systematic and Applied Microbiology 31: 339-351. Vadivelu, J., S. D. Puthucheary and P. Navaratnam (1991). "Exotoxin profiles of clinical isolates of Aeromonas hydrophila." Journal of Medical Microbiology 35: 363-367. Valera, L. and C. Esteve (2002). "Phenotypic study by numerical taxonomy of strains belonging to the genus Aeromonas." Journal of Applied Microbiology 93: 77- 95. Vally, H., A. Whittle, S. Cameron, et al. (2004). "Outbreak of Aeromonas hydrophila wound infections associated with mud football." Clinical Infectious Diseases 38: 1084-1089. Van der Kooij, D. and W. A. M. Hijnen (1988). "Nutritional versatility and growth kinetics of an Aeromonas hydrophila strain isolated from drinking water." Applied and Environmental Microbiology 54(11): 2842-2851. Van Houdt, R., A. Aertsen and C. W. Michiels (2007). "Quorum-sensing-dependent switch to butanediol fermentation prevents lethal medium acidification in Aeromonas hydrophila AH-IN." Research in Microbiology 158: 379-385. Van Houdt, R. and C. W. Michiels (2010). “Biofilm formation and the food industry, a focus on the bacterial outer surface.” Journal of Applied Microbiology p 1-15 doi:10.1111/j.1365-2672.2010.04756.x.

-- 307 --

Veron, M. and F. Gasser (1963)."Sur la detection de l'hydrogene sulfure produit par certaines enterobacteriacees dans les milieux dits de diagnostic rapide." Annals of the Institute Pasteur 105: 524-534. Vila, J., F. Marco, L. Soler, et al. (2002). "In vitro antimicrobial susceptibility of clinical isolates of Aeromonas caviae, A. hydrophila and Aeromonas veronii biotype sobria." Journal of Antimicrobial Chemotherapy 49: 697-702. Vila, J., J. Ruíz, F. Gallardo, et al. (2003). "Aeromonas spp. and traveler's diarrhea: clinical features and antimicrobial resistance." Emerging Infectious Diseases 9(5): 552-555. Vilches, S., C. Urgell, S. Merino, et al. (2004). "Complete type III secretion system of a mesophilic Aeromonas hydrophila strain." Applied and Environmental Microbiology 70(11): 6914-6919. Vilches, S., N. Jimenez, J. M. Tomas, et al. (2009). "Aeromonas hydrophila AH-3 type III secretion system expression and regulatory network." Applied and Environmental Microbiology 75(19): 6382-6392. Vilches, S., R. Canals, M. Wilhems, et al. (2007). "Mesophilic Aeromonas UDP- glucose pyrophosphorylase (GaIU) mutants show two types of lipopolysaccharide structures and reduced virulence." Microbiology 153: 2393- 2404. Villari, P., M. Crispino, P. Montuori, et al. (2003). "Molecular typing of Aeromonas isolates in natural mineral waters." Applied and Environmental Microbiology 69 (1): 697-701. Villari, P., M. Crispino, P. Montuori, et al. (2000). "Prevalence and molecular characterization of Aeromonas spp. in ready-to-eat foods in Italy." Journal of Food Protection 63(12): 1754-1757. Vipond, R., I. R. Bricknell, E. Durant, et al. (1998). "Defined deletion mutans demonstrate that the major secreted toxins are not essential for the virulence of Aeromonas salmonicida." Infection and Immunity 66: 1990-1998. Vivas, J., B. E. Razquin, P. Lopez-Fierro, et al. (2004). "Correlation between production of acyl homoserine lactones and proteases in an Aeromonas hydrophila aroA live vaccine." Veterinary Microbiology 101: 167-176. von Graevenitz, A. (2007). "The role of Aeromonas in diarrhoea: a review." Infection 35(2): 59-64. von Graevenitz, A., G. J. Osterhout and J. D. Dick (1991). "Grouping of some clinically relevant Gram-positive rods by automated fatty acid analysis." Acta Pathologica, Microbiologica et Immunologica Scandinavica 99: 147-154. von Graevenitz, A., and L. Zinterhofer (1970). "The detection of Aeromonas hydrophila in stool specimens." Health Laboratory Science 7: 124-127. von Graevenitz, A., and A. H. Mensch (1968). "The genus Aeromonas in human bacteriology." New England Journal of Medicine 278(3): 245-249. Wadström, T., A. Ljungh and B. Wretlind (1976). "Enterotoxin, haemolysin and cytotoxic protein in Aeromonas hydrophila from human infections." Acta Pathologica, Microbiologica Scandinavica Sect. B, 84: 112-114. Wahli, T., S. E. Burr, D. Pugovkin, et al. (2005). "Aeromonas sobria, a causative agent of disease in farmed perch, Perca fluviatilis L." Journal of Fish Diseases 28: 141-150. Wakabayashi, H., K. Kanai, T. C. Hsu, et al. (1981). "Pathogenic activities of Aeromonas hydrophila biovar hydrophila (Chester) Popoff and Veron, 1976 to fishes." Fish Pathogens 15(3/4): 319-325. Walsh, T. R., R. A. Stunt, J. A. Nabi, et al. (1997). "Distribution and expression of B- lactamase genes among Aeromonas spp." Journal of Antimicrobial Therapy 40: 171-178.

-- 308 --

Walsh, T. R., S. Gamblin, D. C. Emery, et al. (1996). "Enzyme kinetics and biochemical analysis of ImiS, the metallo-B-lactamase from Aeromonas sobria 163a." Journal of Antimicrobial Chemotherapy 37: 423-431. Walsh, T. R., W. A. Neville, M. H. Hara, et al. (1998). "Nucleotide and amino acid sequences of the metallo-B-lactamase, ImiS, from Aeromonas veronii bv. sobria." Antimicrobial Agents and Chemotherapy 42: 436-439. Wang, G., C. G. Clark, C. Liu, et al. (2003). "Detection and characterization of the haemolysin genes in Aeromonas hydrophila and Aeromonas sobria by multiplex PCR." Journal of Clinical Microbiology 41(3): 1048-1054. Wang, G., K. D. Tyler, C. K. Munro, et al. (1996). "Characterization of cytotoxic, haemolytic Aeromonas caviae clinical isolates and their identification by determining presence of a unique haemolysis gene." Journal of Clinical Microbiology 34(12): 3203-3205. Washington, J. A. (1972). "Aeromonas hydrophila in clinical bacteriologic specimens." Annals of Internal Medicine 76: 611-614. Washington, J. A. I. (1973). "The role of Aeromonas hydrophila in clinical infection." Infectious Diseases Reviews 2: 75-86. Watanabe, N., K. Morita, T. Furukawa, et al. (2004). "Sequence analysis of amplified DNA fragments containing the region encoding the putative lipase substrate- binding domain and genotyping of Aeromonas hydrophila." Applied and Environmental Microbiology 70(1): 145-151. Watson, I. M., J. O. Robinson, V. Burke, et al. (1985). "Invasiveness of Aeromonas spp. in relation to biotype, virulence factors, and clinical features." Journal of Clinical Microbiology 22(1): 48-51. Wauters, G. (1973). "Improve methods for the isolation and recognition of Yersinia enterocolitica." Control Microbiology and Immunology 2: 68-70. Wayne, L. G., D, J, Brenner, R. R. Colwell, et al. (1987)." International committee on systematic bacteriology. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics." International Journal of Systematic Bacteriology 37: 463-464. Whitby, P. W., M. Landon and G. Coleman (1992). "The cloning and nucleotide sequence of the serine protease gene (aspA) of Aeromonas salmonicida ssp. salmonicida." FEMS Microbiology Letters 99: 65-72. Whitlock, M. R., P. M. O'Hare, R.Sanders, et al. (1983). "The medicinal leech and its use in plastic surgery: a possible cause for infection." British Journal of Plastic Surgery 36: 240-244. Wilcox, M. H., A. M. Cook, A. Eley, et al. (1992). "Aeromonas sp. as a potential cause of diarrhoea in children." Journal of Clinical Pathology 45: 959-963. Wilcox, R. A., G. K. Chin and M. Segasothy (2000). "Aeromonas hydrophila infection secondary to an electrical burn." Medical Journal of Australia 173: 219-220. Wilhelms, M., R. Molero, J. G. Shaw, et al. (2011). "Transcriptional hierarchy of Aeromonas hydrophila polar-flagellum genes." Journal of Bacteriology 193(19): 5179-5190. Williams, S. G., L. T. Varcoe, S. R. Attridge, et al. (1996). "Vibrio cholerae Hcp, a secreted protein coregulated with HlyA." Infection and Immunity 64: 238-289. Wong, C. Y. F., G. Mayrhofer, M. W. Heuzenroeder, et al. (1996). "Measurement of virulence of aeromonads using a suckling mouse model of infection." FEMS Immunology and Medical Microbiology 15: 233-241. Wong, C. Y. F., M. W. Heuzenroeder, D. M. Quinn, et al. (1997). "Cloning and characterization of two immunophilin-like genes ilpA and fkpA, on a single 3.9- kilobase fragment of Aeromonas hydrophila genomic DNA." Journal of Bacteriology 179(11): 3397-3403.

-- 309 --

Wong, C. Y. F., M. W. Heuzenroeder and R. L. P. Flower (1998). "Inactivation of two haemolytic toxin genes in Aeromonas hydrophila attenuates virulence in a suckling mouse model." Microbiology 144: 291-298. Wretlind, B. and L. Heden (1973). "Formation of extracellular haemolysin by Aeromonas hydrophila in relation to protease and staphylolytic enzyme." Journal of General Microbiology 78: 57-65. Wu, C. J., H. C. Lee, T. T. Chang, et al. (2009). "Aeromonas spontaneous bacterial peritonitis: a highly fatal infectious disease in patients with advanced lliver cirrhosis." Journal of the Formosa Medical Association 108: 293-300. Wu, C. J., J. J. Wu, J. J. Yan, et al. (2007). "Clinical significance and distribution of putative virulence markers of 116 consecutive clinical Aeromonas isolates in southern Taiwan." Journal of Infection 54: 151-158. Wu, C. J., P. L. Chen, J. J. Wu, et al. (2012). "Distribution and phenotypic and genotypic detection of a metallo-B-lactamase, CphA, among bacteraemic Aeromonas isolates." Journal of Medical Microbiology 61: 712-719. Wu, C. J., Y. C. Chuang, M. F. Lee, et al. (2011). "Bacteraemia due to extended- spectrum-B-lactamase-producing Aeromonas species at a medical centre in Southern Taiwan." Antimicrobial Agents and Chemotherapy 55(12): 5813- 5818. Wu, M. L., Y. C. Chuang, J. P. Chen, et al. (2001). "Identification and characterization of the three chitin-binding domains within the multidomain chitinase chi92 from Aeromonas hydrophila JP101." Applied and Environmental Microbiology 67: 5100-5106. Xu, X. J., M. R. Ferguson, V. L. Popov, et al. (1998). "Role of a cytotoxic enterotoxin in Aeromonas-mediated infections: development of transposon and isogenic mutants." Infection and Immunity 66(8): 3501-3509. Yabuki, M., K. Mizushina, T. Amatasu, et al. (1986). "Purification and characterization of chitinase and chitobiase produced by Aeromonas hydrophila subsp. anaerogenes A52." Journal of General and Applied Microbiology 32: 25-38. Yamamoto, S. and S. Harayama (1996). "Phylogenetic analysis of Acinetobacter strains based on the nucleotide sequences of gyrB genes and on the amino acod sequences of their products." International Journal of Systematic Bacteriology 46: 506-511. Yamamoto, S. and S. Harayama (1998). "Phylogenetic relationships of Pseudomonas putida strains deduced from the nucleotide sequences of gyrB, rpoD and 16S rRNA genes." International Journal of Systematic Bacteriology 48: 813-819. Yates, F. (1934). "Contingency table involving small numbers and the χ2 test." Supplement to the Journal of the Royal Statistical Society 1(2): 217-235. Yañez, M. A., V. Catalan, D. Apraiz, et al. (2003). "Phylogenetic analysis of members of the genus Aeromonas based on gyrB gene sequences." International Journal of Systematic and Evolutionary Microbiology 53: 875-883. Yang, I. and K. Bush (1996). "Biochemical characterization of the carbapenem- hydrolyzing B-lactamase AsbM1 from Aeromonas sobria AER 14M: a member of a novel subgroup of metallo-B-lactamases." FEMS Microbiology Letters 137: 193-200. Yang, X., Q. Q. Yang, Q. Y. Guo, et al. (2008). "Aeromonas salmonicida peritonitis after eating fish in a patient undergoing CAPD." Peritoneal Dialysis International 28(3): 316-317. Ye, Y., X. H. Xu and J. B. Li (2010). "Emergence of CTX-M-3, TEM-1 and a new plasmid-mediated MOX-4 AmpC in a multiresistant Aeromonas caviae isolated from a patient with pneumoniae." Journal of Medical Microbiology 59: 843-847.

-- 310 --

Yokoyama, R., Y. Fujii, Y. Noguchi, et al. (2002). "Physicochemical and biological properties of an extracellular serine protease of Aeromonas sobria." Microbiology and Immunology 46: 383-390. Yousuf, F. A., R. Siddiqui and N. A. Khan (2013). "Acanthamoeba castellanii of the T4 genotype is a potential environmental host for Enterobacter aerogenes and Aeromonas hydrophila." Parasites and Vectors 6: 169 doi:10.1186/1756-3305-6-169. Yu, H. B., P. S. Srinivasa Rao, H. C. Lee, et al. (2004). "A type III secretion system is required for Aeromonas hydrophila AH-1 pathogenesis." Infection and Immunity 72(3): 1248-1256. Yu, H. B., R. Kaur, S. Lim, et al. (2007). "Characterization of extracellular proteins produced by Aeromonas hydrophila AH-1." Proteomics 7: 436-449. Yu, H. B., Y. L. Zhang, Y. L. Lau, et al. (2005). "Identification and characterisation of putative genes and gene clusters in Aeromonas hydrophila PPD134/91." Applied and Environmental Microbiology 71(8): 4469-4477. Yu, Y., X. H. Xu, J. B. Li (2010). “Emergence of CTX-M-3, TEM-1 and a new plasmid-mediated MOX-4 AmpC in a multiresistant Aeromonas caviae isolate from a patient with pneumonia.” Journal of Medical Microbiology 59(7): 843- 847. Yucel, N. and S. Erdogan (2010). "Virulence properties and characterization of aeromonads isolated from foods of animal origin and environmental sources." Journal of Food Protection 73(5): 855-860. Zacaria, J., A. P. L. Delamare, S. O. P. Costa, et al. (2010). "Diversity of extracellular proteases among Aeromonas determined by zymogram analysis." Journal of Applied Microbiology 109: 212-219. Zemelman, R., C. Gonzalez, M. A. Mondaca, et al. (1984). "Resistance of Aeromonas hydrophila to B-lactams antibiotics." Journal of Antimicrobial Chemotherapy 14: 575-579. Zhang, Y. L., Y. L. Lau, E. Arakawa, et al. (2003). "Detection and genetic analysis of group II capsules in Aeromonas hydrophila." Microbiology 149: 1051-1060. Zhiyong, Z., L. Xiaoju and G. Yanyu (2002). "Aeromonas hydrophila infection: clinical aspects and therapeutic options " Reviews in Medical Microbiology 13(4): 151- 162. Ziemke, F., M. G. Höfle, J. Lalucat, et al. (1998). "Reclassificcation of Shewanella putrefaciens Owen's genomic group II as Shewwanella baltica sp. nov." International Journal of Systematic Bacteriology 48: 179-186. Zmyslowska, I., K. Korzekwa and J. Szarek (2009). "Aeromonas hydrophila in fish aquaculture " Journal of Comparative Pathology 141(1): 313. Zywno, S. R., J. Arceneaux, M. Altwegg, et al. (1992). "Siderophore production and DNA hybridization groups of Aeromonas spp." Journal of Clinical Microbiology 30(3): 619-622.

-- 311 -- Evolutionary distances based on the percentage sequence dissimilarities of all current Aeromonas species and 60 isolates identified as A. dhakensis (A. aquariorum) using Clustal W and Mega 5 software (combined gyrB and rpoD dissimilarities). Numbers in brackets indicate strains with similar nucleotide sequences.

A. allosaccharophila (DSM 11576) A. aquariorum (CECT 7289) 9.8 A. bestiarum (ATCC 51108) 10.0 9.2 A. bivalvium (CECT 7113) 12.8 11.2 11.4 A. caviae (ATCC 13136) 10.6 8.7 11.1 11.1 A. encheleia (DSM 11577) 11.3 10.0 9.9 10.7 9.6 A. eucrenophila (ATCC 23309) 10.8 8.5 10.4 11.0 9.0 7.0 A. hydrophila (ATCC 7966) 9.4 4.6 9.2 12.7 8.8 10.0 8.9 A. jandaei (ATCC 49568) 7.2 7.9 9.8 11.4 9.6 9.3 8.4 9.3 A. media (ATCC 39907) 8.7 9.2 8.3 10.1 7.5 6.9 6.5 8.8 8.7 A. molluscorum (DSM 17090) 15.3 12.8 12.7 10.8 13.4 11.0 11.7 13.5 13.6 12.0 A. popoffii (CIP 105493) 10.7 9.5 4.3 11.5 12.6 10.8 10.2 10.4 10.5 10.1 11.7 A. simiae (DSM 16559) 17.1 15.9 16.2 17.6 16.0 16.0 16.6 16.1 14.7 16.0 17.4 17.1 A. sobria (CDC 9540-76) 8.2 10.2 10.7 13.2 11.4 12.0 11.2 10.1 8.8 11.0 13.5 11.4 17.7 A. tecta (CECT 7082) 10.6 9.9 9.6 11.5 9.4 7.0 5.7 9.8 9.4 7.0 12.3 10.7 16.1 10.5 A. trota (ATCC 49657) 8.9 10.2 10.6 12.2 9.4 11.8 10.4 10.3 8.9 10.0 13.6 11.4 16.0 10.6 11.0 A. veronii bv. sobria (ATCC 9071) 3.5 10.3 10.6 12.5 10.2 10.2 10.7 9.8 7.4 9.5 14.6 11.3 17.0 8.4 10.3 8.6 A. salmonicida ssp. salmonicida (CEC 10.6 10.4 6.9 11.8 11.7 10.3 10.0 10.0 10.7 10.2 12.5 8.0 17.7 10.5 9.6 11.5 10.5 Aeromonas spp. HG11 (CECT 4253) 10.8 9.6 8.9 10.2 9.2 1.4 6.4 9.6 8.8 6.5 11.2 10.1 15.9 11.1 6.2 11.2 10.2 9.8 A. piscicola (CECT 7443) 10.7 10.0 4.5 12.8 11.7 10.1 10.7 10.1 10.8 10.0 12.6 5.2 17.7 11.6 10.4 10.8 11.7 6.3 9.8 A. rivuli (CECT 7518) 14.6 12.3 11.6 10.3 12.2 10.2 10.7 13.0 13.3 11.0 5.4 11.4 18.1 12.5 11.5 13.2 14.1 13.3 10.4 12.3 A. fluvialis (CECT 7401) 5.3 9.5 10.3 12.8 11.0 10.6 11.1 9.8 8.4 10.3 15.0 11.5 17.6 7.7 10.6 9.4 5.5 11.3 10.4 11.8 13.6 A. taiwanensis (CECT 7403) 11.6 10.8 12.8 11.5 6.6 10.6 9.9 10.6 10.8 8.5 13.6 12.8 16.7 12.4 10.8 10.3 11.3 13.2 10.2 13.4 13.0 12.3 A. sanarellii (CECT 7402) 11.6 9.5 11.8 10.8 5.7 10.8 10.2 9.9 10.6 7.7 14.4 12.8 16.9 12.9 11.1 11.1 10.4 13.3 10.8 12.6 12.7 11.5 7.0 A. diversa (CECT 2478) 16.6 16.0 16.9 18.0 15.5 16.4 16.7 15.5 16.6 15.5 19.1 18.5 11.1 18.1 17.4 17.4 17.7 17.6 15.9 18.0 18.3 17.6 15.9 16.8 Isolate 31 9.6 1.4 9.3 11.2 8.8 10.2 8.6 5.0 8.0 9.3 12.9 9.9 16.0 10.0 10.1 9.8 10.2 10.5 9.6 10.6 12.0 9.6 11.3 10.0 16.4 Isolate 32 9.9 1.2 9.3 11.0 8.5 9.4 8.7 5.0 8.7 8.7 13.0 9.8 16.1 10.3 10.0 10.2 10.4 10.1 9.3 10.0 12.0 9.6 10.4 9.5 16.3 1.6 Isolates (47 95 139 165) 10.5 1.8 9.5 11.7 9.3 10.3 8.3 6.1 8.5 9.4 12.4 9.6 16.0 10.7 9.6 10.3 11.1 10.4 9.5 10.0 12.4 10.5 10.8 10.5 16.8 2.0 2.0 Isolates (56 220) 9.5 1.8 9.2 11.5 8.7 9.9 8.6 4.4 8.4 9.1 13.2 10.2 16.8 10.1 9.8 10.2 10.2 10.3 9.6 9.8 12.0 9.4 10.7 9.8 16.6 2.0 1.8 2.6 Isolate 60 9.2 1.2 9.4 11.0 8.3 10.2 8.2 4.4 8.2 8.9 13.0 10.0 16.2 9.6 9.4 9.9 10.0 10.1 9.9 10.2 11.8 9.4 10.3 9.4 16.1 1.7 1.6 2.3 1.1 Isolate 67 9.9 1.1 9.8 11.7 8.3 10.4 8.4 4.5 8.6 9.3 13.6 10.3 16.0 10.4 9.6 10.0 10.6 10.5 10.0 10.3 12.6 9.9 10.6 9.5 16.1 1.6 1.5 2.4 1.8 1.1 Isolate 70 10.6 1.7 10.1 11.9 9.4 10.5 9.4 4.9 9.1 9.6 13.9 10.8 16.8 10.8 10.5 10.8 10.8 11.0 10.5 10.8 12.9 10.4 11.5 10.1 17.0 2.3 1.7 2.8 1.7 1.7 1.8 Isolate 71 9.3 1.6 9.3 11.6 8.9 10.5 8.6 5.2 8.4 9.5 13.2 9.9 16.1 10.3 10.1 10.4 10.4 11.0 9.9 10.5 12.3 9.4 11.4 10.2 16.6 1.0 2.0 2.2 1.8 1.7 1.4 2.3 Isolates (73 74) 9.9 1.1 9.6 11.6 8.7 10.3 8.7 4.7 8.5 9.3 13.7 10.2 16.3 10.5 9.9 10.3 10.6 10.4 10.2 10.2 12.5 9.9 11.0 9.9 16.4 1.6 1.1 2.4 1.4 1.1 0.6 1.4 1.6 Isolate 79 9.3 1.3 9.5 11.2 8.4 10.3 8.3 4.5 8.3 9.0 13.3 10.1 16.3 10.0 9.5 9.8 10.1 10.2 10.0 10.3 12.0 9.5 10.4 9.5 16.2 1.6 1.7 2.4 1.2 0.3 1.2 2.0 1.8 1.2 Isolate 88 11.0 2.0 10.4 12.0 9.4 11.1 8.9 5.2 9.4 9.5 14.3 11.2 17.0 11.0 10.4 11.0 11.4 11.7 10.8 11.4 13.0 10.7 11.7 9.9 17.4 2.6 2.4 3.1 2.4 2.0 1.9 0.9 2.6 2.1 2.1 Isolate 91 9.4 1.2 9.2 11.1 8.3 10.4 8.2 4.4 8.2 8.9 13.2 9.8 16.0 10.1 9.4 9.6 10.2 10.3 9.9 10.2 11.7 9.4 10.3 9.4 15.9 1.7 1.6 2.1 1.1 0.4 1.1 1.9 1.7 1.1 0.5 2.2 Isolates (93 172) 9.9 2.0 9.6 11.7 9.4 10.3 8.9 5.2 8.7 10.1 12.7 10.2 16.8 10.8 10.2 10.7 10.6 10.7 9.6 10.3 12.3 9.8 11.9 10.5 16.8 2.0 2.6 2.5 1.6 1.9 2.4 2.3 1.4 2.4 2.0 2.6 1.9 Isolate 104 10.0 1.7 9.3 11.7 8.7 10.3 8.6 4.7 8.4 9.5 13.2 10.1 16.3 10.4 10.0 10.4 10.3 10.7 9.5 10.1 12.3 9.9 10.8 9.9 16.3 2.3 2.5 2.5 0.9 1.6 1.9 2.4 1.9 2.1 1.7 2.7 1.4 1.5 Isolate 107 9.8 1.7 9.5 11.8 8.9 10.7 8.4 5.3 8.6 9.8 13.4 10.1 16.3 10.6 10.1 10.1 10.6 11.1 9.9 10.6 12.3 9.6 11.3 10.2 16.4 1.3 2.1 2.1 1.9 1.8 1.3 2.4 0.5 1.7 1.7 2.5 1.6 1.5 1.8 Isolate 121 10.0 1.3 9.8 11.6 9.0 10.3 8.9 4.8 8.8 9.5 13.4 10.1 16.8 10.3 10.3 10.4 10.5 10.7 10.2 10.6 12.6 9.8 10.7 10.1 16.4 1.7 1.7 2.7 2.1 1.7 1.6 2.2 1.9 1.6 1.6 2.1 1.7 2.9 2.4 2.2 Isolates (123 124) 9.5 1.1 9.5 11.2 8.5 10.3 8.3 4.7 8.3 9.4 13.0 9.9 16.1 10.2 9.8 10.3 10.3 10.2 10.0 10.1 12.3 9.5 10.8 9.6 16.2 2.0 1.9 2.2 1.4 0.7 1.2 2.2 2.0 1.4 0.8 2.3 0.7 1.6 1.5 1.9 2.0 Isolate 141 9.6 1.1 9.5 11.4 8.7 10.3 8.4 4.7 8.2 9.3 13.2 10.1 16.1 10.3 9.9 10.2 10.4 10.3 10.0 10.1 12.3 9.6 11.0 9.9 16.2 1.0 1.1 1.8 1.2 1.1 1.0 1.4 1.0 0.6 1.2 2.1 1.1 1.8 1.9 1.1 1.6 1.4 Isolate 154 10.1 1.8 9.8 11.5 8.8 10.6 8.7 4.6 8.8 9.4 13.3 10.5 16.4 10.2 10.1 10.2 10.5 11.0 10.1 10.8 12.2 9.9 11.1 9.9 16.3 2.3 2.2 2.9 1.4 1.0 1.5 1.3 2.1 1.9 1.3 1.4 1.2 1.8 1.7 2.1 2.2 1.3 1.9 Isolate 168 10.2 1.3 9.5 11.7 8.9 9.6 8.6 4.9 8.3 9.4 12.8 10.1 15.8 10.6 10.0 10.8 10.6 10.8 9.2 10.3 12.2 10.2 10.3 10.2 16.0 1.9 1.9 2.3 1.9 2.0 1.9 2.2 2.3 1.9 2.1 2.5 1.8 2.1 1.6 2.2 2.0 1.9 1.9 2.3 Isolate 169 10.4 1.3 9.6 11.7 9.4 10.5 9.0 4.9 8.7 9.6 13.3 10.2 15.9 10.6 10.3 10.4 10.8 11.0 10.1 10.6 12.5 10.4 11.3 10.3 16.3 2.3 2.1 2.4 2.1 1.7 1.8 0.8 2.3 1.8 2.0 1.1 1.7 1.9 1.8 2.2 2.2 1.8 1.8 1.3 1.6 Isolate 176 9.4 0.7 9.3 11.3 8.2 10.2 8.4 4.3 8.2 9.1 13.4 9.9 15.8 10.0 9.6 10.1 10.2 10.3 9.8 10.1 12.2 9.4 10.4 9.4 15.9 1.2 1.1 2.0 1.4 0.7 0.4 1.4 1.0 0.6 0.8 1.7 0.7 2.0 1.5 1.1 1.2 1.0 0.6 1.3 1.5 1.4 Isolate 180 9.9 1.0 9.2 11.8 9.0 9.5 8.7 4.6 8.0 9.6 13.0 10.0 16.3 10.4 9.9 10.5 10.5 10.6 9.1 9.8 12.2 9.8 11.1 10.1 16.4 1.6 1.8 2.2 1.0 1.7 1.6 1.9 1.6 1.6 1.8 2.2 1.7 1.4 0.9 1.7 1.9 1.6 1.4 2.0 1.1 1.5 1.2 Isolate 182 10.5 1.8 10.0 12.2 8.9 10.5 8.7 4.8 9.3 9.4 13.0 10.7 16.1 10.8 10.1 10.3 11.2 11.1 10.0 10.7 12.4 10.4 10.5 10.0 16.0 2.2 2.2 2.8 1.8 1.9 1.6 2.3 2.0 2.0 2.0 2.6 1.7 2.4 1.7 1.9 2.1 2.2 2.0 2.0 1.3 2.1 1.4 1.8 Isolate 183 10.1 1.0 9.6 11.4 9.1 10.6 8.5 5.2 8.4 9.6 13.3 10.0 16.2 10.4 10.2 10.3 10.5 10.5 9.9 10.3 12.5 10.0 11.1 9.9 16.6 1.4 1.6 1.8 2.0 1.7 1.4 2.1 1.8 1.6 1.6 2.2 1.5 2.0 1.7 1.5 1.7 1.4 1.4 2.2 1.3 1.7 1.2 1.2 2.0 Isolate 212 10.1 1.3 9.8 11.8 8.9 10.3 8.8 4.5 8.6 9.3 13.6 10.5 16.4 10.2 10.0 10.3 10.5 10.7 9.8 10.7 12.6 10.1 10.8 10.0 16.3 1.9 1.7 2.6 1.7 1.1 1.2 0.8 1.7 1.4 1.4 1.1 1.5 1.9 1.8 1.8 1.8 1.8 1.4 0.7 1.8 0.8 0.8 1.5 1.7 1.9 Isolate 213 11.9 3.5 11.6 14.1 11.0 12.4 10.5 7.0 10.7 11.8 15.0 12.4 18.7 12.7 12.0 12.2 12.7 12.9 11.6 12.5 14.2 11.8 13.5 11.9 18.5 3.3 3.9 4.2 3.5 3.8 3.1 3.6 2.5 3.5 3.9 3.7 3.8 2.5 3.6 2.4 4.2 3.9 3.1 3.3 3.8 3.6 3.1 3.1 3.7 3.5 3.0 Isolates (222 257) 10.3 2.1 10.1 12.3 9.6 10.7 9.1 5.3 9.1 10.3 13.4 10.6 17.1 11.1 10.4 10.8 11.1 11.3 10.1 11.1 12.7 10.2 11.9 10.5 17.4 1.7 2.5 2.8 2.1 2.4 2.3 2.2 1.1 2.3 2.5 2.3 2.4 1.1 2.4 1.4 2.0 2.7 1.7 2.2 2.4 2.2 1.9 1.7 2.5 2.3 1.8 2.2 Isolates (223 232 240) 9.5 0.4 9.2 11.2 8.7 9.8 8.5 4.6 7.9 9.2 13.0 9.5 16.0 10.0 9.9 10.2 10.1 10.2 9.4 10.0 12.5 9.3 10.8 9.8 16.0 1.4 1.2 1.8 1.8 1.2 1.1 1.7 1.6 1.1 1.3 2.0 1.2 1.8 1.7 1.7 1.1 0.9 1.1 1.8 1.3 1.3 0.7 1.2 1.8 1.0 1.3 3.7 2.3 Isolate 226 10.0 1.9 9.5 12.0 8.7 10.4 9.0 4.9 8.6 9.8 13.4 10.5 16.4 10.6 10.2 10.7 10.5 11.0 9.6 10.5 12.6 9.6 11.7 9.9 16.4 1.7 2.3 2.5 1.7 2.0 1.7 2.2 0.7 1.9 2.1 2.5 2.0 1.3 1.4 0.8 2.4 2.3 1.3 2.1 2.2 2.2 1.3 1.5 1.9 2.1 1.6 2.4 1.2 1.9 Isolate 227 10.0 1.2 9.6 11.3 8.8 10.7 8.0 4.8 8.6 8.9 13.3 10.3 16.6 10.4 10.3 10.2 10.5 11.0 10.4 10.7 12.4 9.6 11.1 9.3 16.3 1.4 1.6 2.2 2.0 1.4 1.3 2.1 1.6 1.5 1.5 1.8 1.4 2.2 2.3 1.5 1.7 1.5 1.1 1.8 2.1 2.1 1.1 2.0 2.0 1.6 1.7 3.5 2.3 1.2 1.9 Isolate 228 10.2 1.4 10.0 11.7 8.6 10.7 8.5 4.6 8.8 9.4 13.3 10.5 16.3 10.6 10.3 9.5 10.7 10.8 10.4 10.7 12.6 10.0 10.6 9.9 16.1 1.4 1.8 2.4 2.2 1.6 1.3 2.3 1.8 1.7 1.5 2.4 1.6 2.4 2.5 1.5 1.9 1.7 1.3 2.0 2.3 2.3 1.3 2.2 2.0 1.8 1.9 3.7 2.5 1.4 2.1 1.0 Isolates (229 234) 9.3 1.2 9.2 11.1 8.2 10.2 8.2 4.4 8.2 9.1 13.2 9.8 16.2 9.9 9.6 10.0 10.0 10.4 9.9 10.1 11.7 9.2 10.5 9.3 16.1 1.6 1.6 2.2 0.8 0.5 1.0 1.9 1.4 1.2 0.6 2.0 0.5 1.6 1.3 1.3 1.7 0.6 1.2 1.0 1.9 1.9 0.8 1.4 1.8 1.4 1.5 3.3 2.1 1.2 1.7 1.2 1.4 Isolates (230 236 249) 9.6 0.7 9.2 11.5 8.8 10.4 8.4 4.9 8.2 8.9 13.3 9.5 16.0 10.0 10.3 10.4 10.5 10.5 10.0 10.3 12.6 9.8 11.0 9.8 16.3 1.3 1.5 2.3 2.1 1.5 1.2 2.0 1.3 1.4 1.6 2.3 1.5 2.5 2.0 1.8 1.4 1.6 1.4 1.8 1.8 1.8 0.8 1.7 1.9 1.5 1.4 3.6 2.2 0.9 2.0 1.5 1.7 1.5 Isolates (235 250) 9.3 1.5 9.3 11.6 8.7 10.3 8.6 4.9 8.2 9.5 13.2 10.1 16.3 10.3 9.9 10.4 10.4 10.6 9.8 10.2 12.3 9.2 11.4 9.9 16.4 1.3 1.9 2.0 1.7 1.6 1.5 2.2 0.5 1.5 1.7 2.5 1.6 1.3 2.0 0.6 2.0 1.9 0.9 2.3 2.2 2.2 1.1 1.5 2.1 1.7 1.8 2.6 1.2 1.5 0.6 1.5 1.7 1.3 1.8 Isolate 239 9.3 1.5 8.9 11.3 8.5 9.9 8.4 4.1 8.2 9.1 12.9 9.9 16.6 9.9 9.5 10.0 10.0 10.3 9.4 9.6 11.8 9.2 10.5 9.5 16.3 1.7 1.9 2.5 0.3 1.0 1.5 1.8 1.5 1.5 1.1 2.1 1.0 1.3 0.6 1.6 1.8 1.3 1.3 1.3 1.6 1.8 1.1 0.7 1.5 1.7 1.4 3.2 1.8 1.5 1.4 1.7 1.9 0.7 1.8 1.4 Isolate 241 9.9 1.6 9.8 11.5 8.6 10.6 8.0 4.8 8.5 9.2 13.5 10.3 16.4 10.6 10.0 10.3 10.7 10.7 10.1 10.4 12.4 10.0 11.1 9.5 16.6 1.4 2.0 2.1 1.8 1.7 1.4 2.3 1.2 1.6 1.8 2.0 1.7 2.0 2.1 1.3 2.1 2.0 1.0 2.4 2.3 2.3 1.2 1.6 2.2 1.8 1.9 3.3 1.9 1.6 1.5 1.2 1.4 1.4 1.9 0.9 1.5 Isolate 242 10.0 1.4 9.8 11.3 8.6 10.8 8.0 4.8 8.4 9.4 13.3 9.8 16.8 10.4 9.6 9.9 10.5 10.6 10.3 10.7 12.3 9.6 10.8 9.6 16.9 1.8 1.8 2.6 2.0 1.6 1.3 2.1 1.8 1.5 1.7 2.0 1.4 2.6 2.3 1.7 1.7 1.5 1.3 2.0 2.3 2.1 1.1 1.8 2.2 1.6 1.7 3.7 2.3 1.4 2.1 1.6 1.8 1.4 1.7 1.7 1.7 1.6 Isolate 244 10.3 1.1 9.8 11.8 9.2 10.3 8.6 4.7 8.4 9.3 13.4 10.3 16.2 10.5 10.0 10.3 10.7 10.7 9.6 10.7 12.6 10.3 11.0 10.2 16.3 2.1 1.9 2.2 1.9 1.3 1.6 1.0 2.1 1.6 1.6 1.3 1.5 1.7 1.6 2.0 2.0 1.6 1.6 1.1 1.4 0.4 1.2 1.3 1.9 1.5 0.4 3.4 2.0 1.1 2.0 1.9 2.1 1.7 1.6 2.0 1.6 2.1 1.9 Isolate 251 9.8 1.2 9.0 11.2 8.6 10.6 8.3 4.5 8.6 8.8 13.3 9.5 16.4 10.2 9.9 9.9 10.3 10.4 10.1 10.2 12.0 9.5 10.6 9.6 16.2 1.8 1.6 2.4 1.6 1.0 1.3 2.1 2.0 1.5 0.9 2.0 0.8 2.2 1.7 1.7 1.5 1.1 1.5 1.4 1.9 1.9 1.1 2.0 1.8 1.2 1.7 3.9 2.7 1.2 2.3 1.1 1.4 0.8 1.5 1.9 1.3 2.0 1.6 1.7 Isolate 255 9.8 0.9 9.2 11.4 8.5 10.2 8.4 4.5 8.3 9.3 12.7 9.8 16.0 10.3 9.6 9.8 10.4 10.2 9.6 9.9 12.3 9.6 10.7 9.9 16.0 0.9 1.5 1.7 1.7 1.4 1.1 2.0 1.1 1.3 1.5 2.3 1.4 1.9 2.0 1.2 1.6 1.7 0.7 2.1 1.8 2.0 0.9 1.3 1.7 1.3 1.6 3.2 1.8 1.1 1.4 1.1 0.9 1.3 1.4 1.0 1.4 0.7 1.5 1.8 1.5 Isolate 256 9.9 1.5 9.4 11.6 8.5 10.6 9.0 5.1 8.3 9.9 13.9 10.2 15.9 10.3 10.0 10.6 10.2 11.1 10.2 10.5 12.7 9.8 11.0 9.6 16.6 1.7 1.9 2.5 1.7 1.6 1.3 1.8 1.3 1.5 1.7 2.1 1.6 2.3 1.4 1.4 2.0 1.9 1.3 2.1 2.2 1.8 0.9 1.5 2.1 1.7 1.6 3.4 2.2 1.5 1.2 1.9 2.1 1.3 1.6 1.4 1.4 1.5 1.7 2.0 1.9 1.4 Isolate 258 10.1 2.2 10.1 12.4 9.4 11.1 9.1 5.6 8.9 10.3 13.8 10.8 17.1 11.0 10.4 11.0 11.2 11.4 10.5 11.0 12.9 10.0 12.2 10.6 17.3 2.0 2.6 2.7 2.4 2.3 2.0 2.9 1.2 2.0 2.4 3.2 2.3 2.0 2.7 1.3 2.7 2.6 1.6 3.0 2.9 2.9 1.8 2.2 2.8 2.4 2.5 2.1 1.9 2.2 1.3 2.2 2.4 2.0 2.5 0.7 2.1 1.6 2.4 2.7 2.6 1.7 2.1 Isolate 263 9.9 1.3 9.4 11.6 8.7 10.3 8.7 4.7 8.5 9.1 13.2 10.0 15.5 10.3 10.2 10.0 10.6 10.7 10.1 10.5 12.5 9.9 10.7 10.0 16.2 1.1 1.7 2.3 2.3 1.7 1.2 1.8 1.1 1.6 1.8 2.1 1.7 2.5 2.4 1.6 1.6 2.0 1.2 2.0 2.2 1.8 1.0 2.1 1.9 1.9 1.6 3.6 2.2 1.3 1.8 1.3 1.1 1.7 1.0 1.6 2.0 1.3 1.9 2.0 1.7 0.8 1.4 2.3 Isolate 278 10.2 1.5 9.8 11.7 8.9 9.5 8.8 4.9 8.7 9.3 13.2 10.5 16.4 10.6 10.2 10.8 10.6 10.6 9.5 10.3 12.2 10.1 10.5 10.2 16.4 1.7 1.3 2.7 1.3 1.8 1.7 1.6 2.1 1.3 1.9 2.3 1.8 2.3 2.0 2.2 1.8 2.1 1.3 2.1 0.6 2.0 1.3 1.3 1.3 1.7 1.6 3.6 2.2 1.5 2.0 1.9 2.1 1.7 1.8 2.0 1.4 2.1 2.1 1.8 1.9 1.6 2.0 2.7 2.0 Isolate 279 10.0 1.4 9.6 11.5 8.6 11.0 8.3 4.8 8.5 9.4 13.7 10.0 16.6 10.6 9.8 10.0 10.5 10.6 10.2 10.6 12.5 10.0 10.8 9.8 16.7 1.5 1.8 2.3 1.9 1.4 1.3 2.1 1.7 1.3 1.1 2.0 1.0 2.5 1.8 1.4 1.5 1.7 1.1 2.2 2.0 1.9 0.9 1.7 2.1 1.3 1.7 3.8 2.2 1.4 1.8 1.8 1.8 1.5 1.7 1.6 1.6 1.5 1.0 1.7 1.4 1.4 1.4 2.3 1.9 2.0 A. schubertii (ATCC 43700) 16.7 15.5 16.4 17.1 15.8 16.6 16.4 15.4 15.6 15.4 19.3 17.6 11.2 18.1 17.0 17.0 17.7 17.5 15.8 17.4 18.2 17.5 15.5 16.8 3.6 16.0 15.9 16.3 16.3 15.6 15.6 16.7 16.1 16.0 15.8 17.0 15.4 16.6 16.1 16.0 16.2 15.5 15.8 16.1 15.8 16.0 15.4 16.2 15.5 16.1 16.1 18.4 17.0 15.8 16.2 15.9 15.4 15.6 15.9 16.0 16.1 15.9 16.2 16.1 15.8 15.3 16.0 16.8 15.4 16.2 16.2 Evolutionary distances based on the percentage sequence dissimilarities of current Aeromonas and strain 266T using Clustal_W and Mega 4 software (combined gyrB and rpoD dissimilarities)

A. piscicola (CECT_7443) A. rivuli (CECT 7518) 12.0 A. bestiarum (ATCC 51108) 4.3 11.5 A. popoffii (CIP 105493) 4.9 11.6 4.1 A_salmonicida ssp. salmonicida (CECT 894) 6.1 13.0 6.6 7.6 A. molluscorum (DSM 17090) 12.4 5.4 12.4 11.8 12.4 A. media (ATCC 39907) 10.3 11.0 8.6 10.3 10.2 11.9 A. encheleia (DSM 11577) 10.0 10.1 9.7 10.9 10.0 10.9 6.7 A. eucrenophila (ATCC 23309) 10.8 11.0 10.4 10.4 9.5 11.8 6.3 6.8 A. trota (ATCC 49657) 11.0 13.0 10.5 11.2 11.2 13.5 10.0 11.8 10.4 A. sobria (CDC 9540-76) 11.2 12.4 10.3 11.2 10.2 13.2 10.8 12.0 11.4 10.3 A. jandaei (ATCC 49568) 10.7 13.1 9.5 10.4 10.7 13.3 8.4 9.4 8.3 8.7 9.0 A. allosaccharophila (DSM 11576) 10.5 14.3 9.5 10.2 10.1 14.8 8.2 11.2 10.4 8.8 7.6 6.8 A. caviae (ATCC 13136) 12.2 12.2 11.5 12.9 11.9 13.2 7.7 9.6 9.0 9.5 11.2 9.4 10.3 A. schubertii (ATCC 43700) 17.7 18.3 16.7 18.2 17.7 19.3 15.8 17.1 16.8 16.7 18.7 16.1 16.6 16.2 A. simiae (DSM 16559) 17.9 18.0 16.6 17.3 17.9 17.1 16.1 16.1 16.6 15.8 18.2 15.0 16.8 16.1 11.7 A. tecta (CECT 7082) 10.3 11.4 9.5 10.7 9.2 12.4 6.5 6.9 5.3 11.1 10.1 9.0 9.9 9.1 17.2 15.8 A. bivalvium (CECT 7113) 12.4 9.9 11.1 11.2 11.2 10.3 9.7 10.5 10.7 11.6 13.1 11.1 12.3 10.7 16.9 17.4 11.1 A. hydrophila (ATCC 7966) 10.1 12.9 9.2 10.3 9.6 13.1 8.8 10.2 9.0 10.4 10.1 9.2 9.4 8.8 15.6 16.3 9.5 12.5 A. dhakensis (A. aquariorum) (CECT 7289) 10.1 12.4 9.3 9.6 10.2 12.8 9.4 10.2 8.7 10.2 10.4 7.9 9.7 8.8 15.7 16.2 9.9 11.1 4.8 A. veronii bv. sobria (ATCC 9071) 11.6 13.7 10.2 10.8 10.3 14.4 9.1 10.3 10.3 8.7 7.8 7.2 3.3 9.9 17.7 16.7 10.0 12.2 9.7 10.3 A. veronii bv.veronii (DSM 7386) 10.9 13.9 10.1 10.2 10.0 14.5 8.5 9.9 9.9 8.5 7.7 6.7 3.1 10.2 17.6 17.2 9.3 12.0 9.3 9.6 1.7 A. taiwanensis (CECT 7403) 13.5 12.9 13.0 12.9 13.1 13.3 8.5 10.5 9.5 10.2 11.9 10.5 11.2 6.4 15.7 16.6 10.4 11.1 10.4 10.8 11.1 10.9 A. sanarellii (CECT 7402) 12.6 12.4 11.8 12.8 13.2 13.9 7.5 10.8 9.9 11.2 12.8 10.4 11.5 5.5 17.1 17.1 10.4 10.3 10.1 9.9 10.2 10.8 6.9 Strain 266 11.7 14.2 11.0 11.9 11.0 15.0 9.9 11.9 10.4 8.4 8.8 8.7 5.6 10.8 17.9 17.7 11.1 13.1 10.4 11.1 5.5 5.4 11.1 11.7 A. diversa (CECT 4254) 13.1 12.8 11.7 13.2 12.2 13.9 8.5 5.5 9.6 12.6 13.1 10.7 12.0 10.8 12.8 16.5 9.2 12.4 11.0 11.2 12.0 11.9 11.5 12.3 13.2 A. fluvialis (CECT 7401) 11.6 13.3 10.0 11.1 10.9 14.5 10.0 10.7 10.8 9.6 7.3 8.2 5.4 10.8 17.6 17.4 10.0 12.4 9.9 9.6 5.4 5.0 12.2 11.6 7.5 12.5 Aeromonas spp. HG11 (CECT 4253) 9.6 10.3 8.7 10.1 9.4 11.1 6.3 1.5 6.2 11.1 11.0 8.8 10.8 9.2 16.2 16.0 6.1 10.0 9.9 9.9 10.3 9.9 10.1 10.8 11.9 4.2 10.4 A. culicicola (CECT 5761) 11.4 13.8 10.5 11.1 10.2 14.8 9.2 10.7 10.2 9.2 8.1 7.2 3.7 10.2 18.0 17.7 10.3 13.2 10.0 10.8 1.7 2.3 11.5 10.8 5.1 12.4 5.6 10.7