THE ROLE OF TP63 IN THE PATHOPHYSIOLOGY OF
ANKYLOBLEPHARON ECTODERMAL DYSPLASIA AND CLEFTING
by
JASON DANIEL DINELLA
B.S., George Mason University, 2002
A thesis submitted to the
Faculty of the Graduate School of the
University of Colorado in partial fulfillment
of the requirements for the degree of
Doctor of Philosophy
Cell Biology, Stem Cells and Development Program
2017
This thesis for the Doctor of Philosophy degree by
Jason Daniel Dinella
has been approved for the
Cell Biology, Stem Cells and Development Program
by
Maranke Koster, Chair
Peter Koch, Advisor
Tom Evans
Rytis Prekeris
Xiao-Jing Wang
Kirk Hansen
Anna Bruckner
Date: December 15, 2017
ii
Dinella, Jason Daniel Ph.D., Cell Biology, Stem Cells and Development
The Role of TP63 in the Pathophysiology of Ankyloblepharon Ectodermal Dysplasia and
Clefting
Thesis directed by Professor Peter J. Koch
ABSTRACT
Ankyloblepharon ectodermal dysplasia and clefting (AEC) is a rare autosomal dominant disorder caused by heterozygous mutations in the TP63 gene. TP63 encodes several transcription factors required for normal development and maintenance of the epidermis and its derivatives. This critical role of TP63 is underscored by abnormal development of ectodermal lineage tissues and structures including the hair, teeth, nails, and sweat glands. Patients are also often born with craniofacial clefting and partially fused eyelids.
Perhaps the most striking aspect of the disorder is the associated skin erosion, which can present a potentially life-threatening circumstance to newborns and infants with the disorder. Currently, there is no cure. Patient data suggest that impaired TP63 function leads to defects in epidermal keratinocyte proliferation, differentiation, and adhesion. However, the molecular mechanisms by which TP63-AEC mutations affect these processes are not known. We posit that these defects could be key contributing factors to the skin erosions associated with AEC.
Using induced pluripotent stem cell (iPSC) technology coupled with recently established gene-editing techniques, we developed a platform upon which the regulatory and functional defects associated with AEC can be observed. iPSCs were generated from two healthy donors and four AEC patients carrying different TP63-AEC mutations. Gene correction was performed for three of the iPSC lines using TALENs and CRISPRs to generate conisogenic, complement iPSC lines to facilitate the identification of AEC- associated defects. All three pairs of patient and gene-corrected iPSC lines were
iii differentiated into keratinocytes. Initial transcriptome and protein analyses identified a number of genes involving cell adhesion as well as extracellular matrix deposition which were downregulated in patient iPSC-derived keratinocytes.
The work presented here provides evidence that TP63-AEC keratinocytes suffer a deficiency in adhesive strength and mechanical resistance as a result of decreased expression of cell-cell and cell-extracellular adhesion genes, and changes in desmosome and hemidesmosome signaling. These results provide the basis for further functional analysis which can be performed with tissue generated from the model developed in this work, yielding greater insight into the pathophysiology underlying AEC.
The form and content of this abstract are approved. I recommend its publication.
Approved: Peter J. Koch
iv
ACKNOWLEDGEMENTS
First, I would like to thank the members of the CSD community, and our former and current directors, Dr. Linda Barlow and Dr. Bruce Appel. Linda and Bruce have shown genuine interest and support towards the students in our program, and I cannot imagine it would be what it is today without their vision and guidance. Their enthusiasm for science has inspired me to take an interest in areas of developmental and cell biology outside of my own, and has motivated me to conduct more mechanistic and hypothesis-driven research. I have felt fortunate to be under their direction, and I appreciate their dedication to the program and the students, and I know others do as well.
I would like to acknowledge my fellow students, as I have been consistently impressed with the level of talent and professionalism demonstrated in their research and presentations, and I am truly honored and feel privileged to have been counted among them for these past years. Being in the Dermatology department on the 8th floor in RC1-North, I was separated from our main contingent. When Senthil Lakshmana Chetty joined Dr.
Maranke Koster’s laboratory adjacent to ours, I finally had another CSD student next door.
Senthil has always been good to talk to, to bounce ideas off of, or to share a laugh. While more often than not, Senthil was laughing at me rather than with me, it was great having another student to work alongside. Senthil has become a dear friend, and my time here at
UCD was made better through his friendship and camaraderie.
The other members of Maranke’s, as well as members of Dr. Dennis Roop’s laboratories have also kindly offered their advice and assistance over these past years and I want to thank them all for their help. In particular, Charles Wall in Dennis’s lab has been a dependable floor manager who has on every occasion ensured that my needs were addressed regarding any equipment, reagents, software, or facilities and operational issues.
He has also been a good state resource for me as it was through talks with Charlie that I
v have become familiar with some of the finest backcountry camping and trout fishing havens in Colorado. I am fortunate also to call him a friend.
In our lab, Saiphone Webb, in particular, has been a lifesaver on more than one occasion, rescuing me with backup cell cultures and experiments which have aided the progress of this work. She has been a joy in the lab, and a true asset to our team. Also from our lab, I thank Dr. Jiangli Chen. I worked more closely with Jiangli than with anyone else over these past years. I have learned a great deal under his tutelage, and indeed, much of what I now know about molecular biology can be attributed to him. He has also contributed to the work described in this thesis to include some of the Western blots I have presented, and also with the CRISPR-mediated gene-correction for two of our AEC patient iPSC lines.
I’d also like to thank the members of my Thesis Advisory Committee for accepting to take part, and for freeing up time from busy schedules to meet as a group. I appreciate all the attention and enthusiasm, as well as the advice and comments which have been given regarding my project. Also, a special thanks to Dr. Anna Bruckner at Children’s Hospital, for allowing me the opportunity to visit and interact with patients. This was a meaningful experience as it really did bring the work we do in the laboratory into perspective. Also, I would like to give a very special thank you to Dr. Maranke Koster, Chair of my committee.
Maranke has been an invaluable resource for me over the past years, especially regarding anything TP63. She has set my mind at ease and offered clarity and guidance countless times, and her positive nature has always been rejuvenating. Maranke really has been an inspiration for me, and I see her as my mentor as well in many ways. Also, Maranke has my thanks for sharing her translation skills during lab meetings. Absolutely invaluable.
Also invaluable to me is my family. I want to give a great thanks to my sister whom I love, all of my aunts, uncles, and cousins, and my friends for their patience and support, and for not letting me go full hermit through these years. I’ll never forget when one of my cousins asked me, “so, when are you gonna graduate?” Another interjected with, “you’re not
vi supposed to ask Ph.D. students that.” I am excited to be able to finally let them know there is an answer to that question now.
My mother and father, to whom I owe everything, have supported me and my decisions through this entire course. They have given me strength and positivity through good times, and some of the more difficult ones. Without them, I don’t think I would have been able to achieve any of what I have. Then again, it has always been important for me to make them proud of their son. So, I more than likely would still have tried. I just would have been a lot thinner for it, and probably without gas in the car. To my Mom and Dad, I love you both, and I thank you for all the love and support you have given me.
And lastly, I wish to give my thanks and appreciation to my advisor and mentor, Dr.
Peter Koch, to whom I owe the greatest debt of gratitude. I would like to thank Peter for accepting me as a student in his lab and allowing me to pursue a project and a direction that
I feel very passionate about, and one that was to be no small feat. At times it did present great challenges. Peter has kept faith in me during those times when I most needed encouragement and reassurance. And I want to thank him for the unending support he has provided through my progress, and my failures, each step of the way. He even complimented me once, I think.
Peter has taught me that I don’t have to “reinvent the wheel” every time I start an experiment. But then he also taught me that kits are for kids. I still like to use my kits, but through working with Peter, I have learned to think more critically about my data, and to focus my efforts towards designing more meaningful experiments. It will not be within any short amount of time that the words, “you have to think like a scientist,” or, “never assume anything”, will leave my memory, and I hope they never do. Over these past years, while working with Peter, I was becoming a better scientist, and a better person as well.
For all of this, I am grateful.
vii
TABLE OF CONTENTS
CHAPTER
I. INTRODUCTION…………………………………………………...……………….…..1
TP63 in Epidermal Development………………………………………………….1
Isoforms of TP63…………………………………………………….....….……1
Functional role of NP63…………………………………………….….……3
TP63-related ectodermal dysplasias…………………………………....….…5
Ankyloblepharon Ectodermal Dysplasia and Clefting……………………...... …6
Clinical symptoms and manifestation……………………………………....…6
Characteristics of AEC syndrome skin………………………………….…….8
Molecular genetics of AEC……………………………………………..…….10
Models for AEC…………………………………………………….…….….…….12
Np63 knockdown mouse model……………………………………..……..12
Heterozygous knock-in mouse model……………………………………….14
Epidermal Adhesion and Basement Membrane Proteins……….…….……...15
Desmosomes……………………………………………………...…...….…..15
Desmosomal protein knockout models……………………………….……..18
Desmosomal cadherins and epidermal cell signaling……………….…….19
Hemidesmosomes…………………………………………………………….20
Induced Pluripotent Stem Cells………………………………………………….23
Cellular reprogramming……………………………………………………….23
Induced pluripotent stem cells……………………………………………..…23
Characterization of induced pluripotent stem cells……………………..….26
Application of induced pluripotent stem cell technology…………………..27
Hypothesis and Specific Aims……………………………………………….…..31
viii
II. MATERIALS AND METHODS…………………………………………….…...…….33
Good Laboratory Practices………………………………………………....……33
Patient Information and Sample Acquisition…………………………..…...…..33
Dermal Fibroblast Derivation, Culture, and Maintenance………………...…..33
Genotyping…………………………………………………………………...... ….34
iPSC Generation, Characterization, and Pluripotent Stem Cell
Maintenance…………………………………………………………...….….……35
TALEN Mediated Gene-correction, Strategy and Design………...…………..38
CRISPR Mediated Gene-correction, Strategy and Design………….………..38
Transfection and Clonal Selection of iPSCs……………………………...... ….40
iPSC-derived Keratinocytes………………………………………..………...…..41
Fluorescence Activated Cell Sorting and Analysis…………………………….43
3D Organotypic Culture Model…………………………………………….....….43
Cell Adhesion Assay……………………………………………....……….…..…44
Strength of Adhesion Assay………………………………………………..…….45
LDH Cytotoxicity Assay…………………………………………………….……..45
qRT-PCR and Genomic PCR…………………………………....………..……..46
Protein Analysis by Western Blot…………………………………………....…..48
Histology and Immunocytochemistry……………………………………..….….49
Statistical Data Analysis…………………………………………………………..50
III. DEVELOPMENT OF AN IPSC-BASED DISEASE MODEL FOR AEC…...….….51
Introduction.………………………………………………..…………...... …....51
Results………………………………………………………………..…………….53
Fibroblast isolation and genotype………………………………………..…..53
iPSCs generated from patients with AEC……………………………...……54
Characterization of iPSCs……………………………………….....…………57
ix
Transfection and clonal selection of iPSCs…………………………...... ….62
TALEN-mediated genetic correction of TP63-AEC …………...... ….…64
CRISPR-mediated genetic correction of TP63-AEC………………….…...71
AEC patient iPSCs can differentiate into functional keratinocytes…….…73
Validation of the differentiation model………………………...……….…....81
Discussion………………………………………………….….………..…...... ….81
IV. AEC PATIENT iPSC-DERIVED KERATINOCYTES EXHIBIT CELL ADHESION
DEFECTS…………………………………………………………………………...….88
Introduction……………………………………...………………….……..……….88
Results………………………………………………………...………….…..…....90
Adhesion defects observed in AEC patient skin……………………………90
Expression analysis of desmosomal and hemidesmosomal adhesion
genes.……………………………………………………………………....…..90
Analysis of desmosomal protein expression………………………………..95
Immunocytochemical analysis of adhesion proteins……………...... ….95
TP63-AEC keratinocytes fail to downregulate ERK1/2 activity……….…101
AEC iPSC-derived keratinocytes exhibit cell adhesion defects…………105
Loss of cell adhesion is rescued by p38MAPK inhibition……………...... 107
p38MAPK activity is upregulated in TP63-AEC keratinocytes…………..107
Discussion…………...…………………………………….……………………..110
V. GENERAL DISCUSSION……………………………………………………..….…114
REFERENCES……………………………………………………………………...………..…...121
APPENDIX
A. CLINICAL OBSERVATION……………………………….………………………...141
x
LIST OF FIGURES
Figure 1.1. Human TP63 gene structure…………………………………………………..…...….2
Figure 1.2. Clinical Presentation of AEC………………………………………………….….……7
Figure 1.3. Epidermal skin equivalent……………………………………………………..…….…9
Figure 1.4. AEC skin exhibits differentiation and proliferation defects……………….…....….11
Figure 1.5. TP63-AEC SAM domain structural prediction…………………………..….....……13
Figure 1.6. Schematic representation of desmosome and component parts…………....…..16
Figure 1.7. Differentiation specific expression pattern of desmosomal proteins……….....…17
Figure 1.8. Basic principles underlying the use of iPSC technology……………………....….29
Figure 3.1. TP63-AEC mutations detected in AEC patient fibroblasts…………………..……55
Figure 3.2. Sendai transduced fibroblasts………………………………………..………………56
Figure 3.3. iPSCs are cleared of reprogramming vector sequence…………………..……….57
Figure 3.4. iPSC colonies can be established from AEC fibroblasts………………………….59
Figure 3.5. AEC iPSCs are similar to normal iPSCs in expression of pluripotency genes....60
Figure 3.6. AEC patient iPSCs differentiate into cells of the three embryonic germ layers...61
Figure 3.7. iPSCs can be successfully transfected using nucleofection…………...... 63
Figure 3.8. TALEN plasmid maps…………………………………………………….……....…..65
Figure 3.9. Donor plasmid correction sequence…………………………………….……....…..67
Figure 3.10. TP63-AEC exon 14 exchange matrix and screening strategy…………..…...…68
Figure 3.11. Overview of TP63-AEC exon 14 target site and correction strategy………..….69
Figure 3.12. Screening and sequencing gene-modified clones for patient AEC1……….…..70
Figure 3.13. Cas9n plasmid map………………………………….………………………….…..72
Figure 3.14. Overview of TP63-AEC exon 13 target site and correction strategy………..….74
Figure 3.15. Screening and sequencing gene-modified clones for patient AEC2………..….75
Figure 3.16. Differentiation of AEC patient iPSCs into keratinocytes……………………...….79
Figure 3.17. iPSCs differentiate into TP63 and KRT14 expressing cells……………………..80
xi
Figure 3.18. Keratinocytes differentiated from iPSCs demonstrate the ability to stratify...... 82
Figure 4.1. Gene expression analysis of AEC patient iPSC-derived keratinocytes…....……92
Figure 4.2. Cell-ECM adhesion components are downregulated in TP63-AEC
keratinocytes……………………….………………………...…………………….….94
Figure 4.3. AEC keratinocytes fail to express major desmosomal component genes…...….96
Figure 4.4. JUP is differentially expressed at the RNA and protein levels in AEC………..…98
Figure 4.5. AEC patient skin exhibits desmosomal and hemidesmosomal defects…..……..99
Figure 4.6. AEC keratinocytes fail to generate a connective epidermal sheet…….…...…..100
Figure 4.7. Immunofluorescence analysis reveals desmosomal defects in AEC…………..102
Figure 4.8. TP63-AEC keratinocytes fail to downregulate ERK1/2 signaling……………….104
Figure 4.9. TP63-AEC keratinocytes exhibit impaired ECM adhesion…………………..…..106
Figure 4.10. Loss of cell-cell adhesion is prevented by p38MAPK inhibition………..……..108
Figure 4.11. p38MAPK activity is upregulated in TP63-AEC keratinocytes………………...109
Figure 5.1. p38MAPK becomes active following depletion of DSG3 or JUP…………...... 118
xii
LIST OF TABLES
Table 1.1. Integrins and their ligands…………………………………………………………..…22
Table 1.2. iPSC reprogramming methods and integration potential………………………...... 25
Table 2.1. Primers used to genotype AEC patients at exon 13 and 14 of TP63………….....37
Table 2.2. Taq probes used in qRT-PCR to measure pluripotency gene expression…….…39
Table 2.3. Primers used to detect presence or absence of Sendai virus genetic material....39
Table 2.4. Mutagenic primers designed and used for donor plasmid mutagenesis….……...39
Table 2.5. ssODN correction sequence designed for TP63 exon 13………………….……...42
Table 2.6. Primer sets used to screen TALEN-transfected iPSCs……………….…….…..…42
Table 2.7. Primers used to sequence exon 14 of TP63 following clonal selection……...…..42
Table 2.8. Primer sets used to screen TALEN-transfected iPSCs………………….……...…42
Table 2.9. Primers used to sequence exon 13 of TP63 following clonal selection.……....…42
Table 2.10. Sequences of primers used for qRT-PCR……………………………………..…..47
Table 3.1. Genome editing efficiency……………………………………………………………..76
xiii
LIST OF ABBREVIATIONS
AEC Ankyloblepharon ectodermal dysplasia and clefting
14-3-3 Cell-cycle regulation and apoptosis gene
ADULT Acro-dermato-ungual-limbal-tooth syndrome
AFP Alpha fetoprotein
ALS Amyotrophic lateral sclerosis
SMA Alpha smooth muscle actin bFGF Basic fibroblast growth factor
BMP4 Bone morphogenetic protein 4
BNC1 Basonuclin 1
BSA Bovine serum albumin
BSC Biological safety cabinet
BSL-2 Biosafety level 2
BS-Seq Bisulfite sequencing
C57BL/6 Black 6 mouse strain
Cas9 CRISPR-associated protein 9
Cas9n Cas9 nickase (D10A mutation) cDNA Complementary DNA
CEL-1 Spinacia oleracea nuclease
CF-1 Carworth Farm mouse strain
ChIP Chromatin immunoprecipitation
Cldn-1 Claudin 1 c-MYC Myelocytomatosis viral proto-oncogene
COL17A1 Collagen type XVII alpha 1 chain
COL7A1 Collagen type VII alpha 1 chain
xiv
COLIV Collagen IV
CRISPR Clustered regularly interspaced short palindromic repeat
DBD DNA binding domain
DKSFM Defined Keratinocyte Serum Free Medium
DLX3 Distal-less homeobox 3
DMEM Dulbecco's Modified Eagle's Medium
DMEM-HG DMEM-High glucose
DMSO Dimethyl sulfoxide
N Dominant negative
DNA Deoxyribonucleic acid
Np63 Dominant negative alpha isoform of TP63
DSB Double-strand break
DSC1 Desmocollin 1
DSC2 Desmocollin 2
DSC3 Desmocollin 3
DSG1 Desmoglein 1
DSG2 Desmoglein 2
DSG3 Desmoglein 3
EB Embryoid body
ECM Extracellular matrix
ED Ectodermal dysplasia
EDJ Epidermal-dermal junction
ED-SF Ectodermal dysplasia - skin fragility
EDTA Ethylene diamine tetra-acetic acid
xv
EEC Ectrodactyly ectodermal dysplasia and clefting
EGFR Epidermal growth factor receptor
EHS Environmental Health and Safety
ES Embryonic stem
ESC Embryonic stem cell
ESQ-FBS ES-qualified fetal bovine serum
FAD Flavin-adenine dinucleotide
FBS Fetal bovine serum
Fgfr2 Fibroblast growth factor receptor 2
FokI Flavobacterium okeanokoites nuclease
Fras1 Fraser syndrome 1
GADD45 Growth arrest and DNA damage inducible protein
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GC Gene-corrected gDNA Genomic DNA
GLP Good laboratory practice gRNA Guide RNA
H9 Human ESC line - WA09 (NIHhESC-10-0062)
HDR Homology-directed repair hESC Human ESC hFib Human fibroblast
HLA Human leukocyte antigen
IKKa Conserved helix-loop-helix ubiquitous kinase indel Insertion or deletion iPSC Induced pluripotent stem cell iPSCd-kc Induced pluripotent stem cell derived keratinocyte
xvi
ITCH Itchy E3 ubiquitin protein ligase
ITGA6 Integrin 6
ITGB4 Integrin 4
ITS-X Insulin-transferrin-selenium-ethanolamine
IVL Involucrin
JEB Junctional epidermolysis bullosa
JUP Junctional plakoglobin
KLF4 Kruppel-like factor 4
KO-DMEM Knockout DMEM
KO-SR Knockout serum replacement
Krt1 Mouse homolog of KRT1
KRT1 Keratin 1
KRT14 Keratin 14
KRT18 Keratin 18
LAMA3 Laminin 3
LAMB3 Laminin 3
LAMC2 Laminin 2
LDH Lactose dehydrogenase
LOR Loricrin
LMS Limb mammary syndrome
MDM2 Mouse double minute 2 homolog
MEF Mouse embryonic fibroblast miRNA Micro RNA
MOI Multiplicity of infection mRNA Messenger RNA
xvii
NANOG Tír na nÓg - pluripotency gene
NEAA Non-essential amino acids
NGS Normal goat serum
NHEJ Non-homologous end joining
OCT3/4 Octamer-binding transcription factor 4 p14arf Alternate reading frame tumor supressor p21cip/waf Cyclin-dependent kinase inhibitor 1 p63 TP63
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PERP p53 apoptosis effector related to PMP-22
PFA Paraformaldehyde
PGK Phosphoglycerate kinase
PKP Plakophilin
PPE Personal protective equipment
PV Pemphigus vulgaris
PVDF Polyvinylidine fluoride
PxxP Proline rich qRT-PCR Quantitative real-time PCR
RA Retinoic acid
RDEB Recessive dystrophic epidermolysis bullosa
Rho Rhodopsin
RNA Ribonucleic acid
RPMI-1640 Roswell Park Memorial Institute (medium) 1640
RU486 Mifepristone
SAM Sterile--motif
xviii
SCNT Somatic cell nuclear transfer
SeV Sendai virus sgRNA Single-guide RNA
SHFM Split hand foot malformation shRNA Short hairpin RNA
SOX2 SRY-box 2
SSEA3 Stage-specific embryonic antigen 3
SSEA4 Stage-specific embryonic antigen 4 ssODN Single-stranded oligodeoxynucleotide
TA Transactivating
TALEN TAL-effector nuclease
Taq Thermophilus aquaticus polymerase
TBST Tris-hydroxymethyl aminomethane
TID Transactivation inhibitory domain
TK-Puro Thymidine kinase - Puromycin resistance
Trp53 Mouse homolog for TP53
Trp63 Mouse homolog for TP63
TP53 Tumor protein 53
TP63 Tumor protein 63
TP63-AEC TP63 in reference to the disease-gene or protein
TP73 Tumor protein 73
TRA-1-60 Podocalyxin
TRA-1-81 Podocalyxin
TUBB3 Class III tubulin
ZFN Zinc finger nuclease
xix
CHAPTER I
INTRODUCTION
TP63 in Epidermal Development
Isoforms of TP63. TP63 encodes a set of transcription factors which exist as multiple isoforms generated through separate transcription initiation sites (producing either
TA or N isoforms), and extensive alternative splicing of the primary transcript (producing ,
, or -isoforms) (Yang et al.,1998; McGrath et al., 2001; Rinne et al., 2007; Mangiulli et al.,
2009) (Fig 1.1). TP63 is part of the TP53 family, sharing up to 63% sequence homology with
TP53 and TP73 in the DNA-binding domain. As a result, TP63, and TP73 can bind and activate or repress certain TP53 target genes, such as p21Waf1/Cip1, GADD45, 14-3-3, and
MDM2; genes involved in cell cycle checkpoints, DNA repair, and apoptosis (Levrero et al.,
2000; Marin et al., 2000; Yang et al., 2000; Irwin et al., 2001; Westfall et al., 2003; Wong et al., 2010). While TP63 and TP73 are both related to TP53, neither performs a classical tumor-suppressor role.
Although the N isoform lacks the N-terminal transactivation domain, both TA and
N isoforms can potentially activate target genes (Dohn et al., 2001; King et al., 2003; Wu et al., 2003). Isoforms differ only at the 5’ or 3’ end as the core domains are identical. These include a proline rich domain (PxxP) thought to be involved in pro-apoptotic or transcriptional enhancement (Zhu et al., 1999; Strano et al., 2001), a DNA-binding domain
(DBD) sharing high sequence and structural homology with that of TP53, a tetramerization domain (Natan et al., 2012), and at least one alternate transactivation domain (Dohn et al.,
2001; Ghioni et al., 2002). The isoforms also include a sterile--motif (SAM) domain important for protein-protein interaction (Schultz et al., 1997; Bork and Koonan 1998;
Thanos et al., 1999; Chen et al., 2011; Sathyamurthy et al., 2011), as well as a post-SAM, or transactivation inhibitory domain (TID) (Ozaki et al., 1999; Serber et al., 2002) (Fig 1.1).
1
a
b
Figure 1.1. Human TP63 gene structure. (a) TA and N isoforms use alternative promoters (denoted by arrows) and alternative splicing (at , , and ) to generate six different transcripts. TA isoforms are encoded from the first promoter site and contain a transactivation (TA) domain. N isoforms are encoded from the second promoter. (b) Each isoform contains a proline rich region (PxxP), DNA binding domain (DBD), and oligomerization domain. Only isoforms contain a sterile--motif (SAM) domain and transactivation inhibitory domain (TID).
2
Functional role of NP63. The predominantly expressed isoform within the epidermis is NP63 (Yang et al., 1998; Liefer et al., 2000). NP63is expressed in keratinocytes within the basal compartment of the epidermis, where it plays the pivotal role of maintaining the proliferative capacity of basal keratinocytes as well as directing downstream differentiation. NP63 also controls cell adhesion and extracellular matrix
(ECM) gene expression within the basal compartment of the epidermis (Koster et al., 2004;
Carroll et al., 2006; Nguyen et al., 2006; Truong et al., 2006; Koster et al., 2007; Senoo et al., 2007).
Once cells exit the cell cycle, they begin to differentiate and lose adhesion to the basement membrane and migrate into the suprabasal layers of the epidermis. During this transition, a host of new structural and adhesion genes is expressed, while other genes which are expressed only in the basal layer are downregulated. As this occurs, NP63 is degraded through caspase or ubiquitin-dependent proteolysis mediated by TP53, MDM2, the E3 ligase, ITCH, or p14Arf (Ratovitski et al., 2001; Rossi et al., 2006; Vivo et al., 2009;
Galli et al., 2010), or is inhibited by miRNA-203 (Lena et al., 2008; Yi et al., 2008). TP63 can also be degraded following the upregulation of one of its own target genes, DLX3 (Di
Costanzo et al., 2009), which activates RAF1 to either directly or indirectly phosphorylate and resign TP63 to proteasome-mediated degradation. TP63 is also itself one of its target genes, so as the protein degrades, it does so at an increasing rate. A failure for TP63 to be downregulated due to the inability for one of these degradation pathways to process could result in a resistance for basal keratinocytes to leave the cell cycle, resulting in the formation of a hyperplastic epidermis exhibiting delayed epidermal differentiation (King et al.,
Oncogene 2003).
Within hours of a cell transiting to the suprabasal layer, NP63 expression drops to approximately 25% (Jackson et al., 2013). During this transit, the keratin and desmosomal
3 gene expression profiles begin to change, and new structural, junctional, and envelope proteins are expressed. In this fashion, NP63 both maintains a proliferative pool of cells within the basal compartment of the epidermis, and directs the exit of cells from this compartment into the suprabasal layers to begin the process of epithelial stratification.
TP63 also plays a critical role during embryonic development in regulating ectodermal differentiation and proliferation programs required for proper orofacial patterning, limbogenesis, and epithelial stratification, as was demonstrated by two research teams who independently and simultaneously generated Trp63 knockout mouse models (Mills et al.,
1999; Yang et al., 1999). The defects described in these reports reveal that in addition to being unable to form a stratified epithelium, Trp63 knockout mice were also unable to form limbs, whiskers, hair, and teeth, as well as lacrymal, mammary, and salivary glands. Skin from knockout mice consisted only of a single layer of simple epithelium expressing Krt18; a pre-keratinocyte surface ectoderm marker (Koster et al., 2004). Without p63, the cells comprising the single layer of simple epithelium could not stratify or induce expression of early keratinocyte markers, Krt14, integrin 4, or laminin-5 (Shalom-Freurstein et al., 2011).
Regarding these defects, two prevailing hypotheses emerged. One theory posits that
Trp63 is required to maintain the proliferative cell compartment within the epidermis, and that a loss of Trp63 in basal keratinocytes leads to an inability to sustain epithelial morphogenesis and developmental progress (Yang et al., 1999). Alternatively, Trp63 is hypothesized to be essential for epidermal differentiation, and that a loss of Trp63 results in a compromised ability to activate the epidermal differentiation cascade (Mills et al., 1999).
However, the absence of a stratified epithelium makes it difficult to determine which of these theories is likely correct.
More recently it has been shown that loss of Trp63 does in fact lead to defects in proliferation as well as stratification and differentiation, and when Trp53 is also knocked
4 down, proliferative potential returns, but not the ability to differentiate and stratify properly.
This suggests that the inability to stratify and differentiate as seen in Trp63 knockout mice may not be due inherently to an inability to proliferate as much as it is to the inability to direct the epidermal differentiation program without Trp63 (Truong et al., 2006). Potentially, the tissue hypoplasia observed in Trp63 knockout mice was due to loss of cell adhesion leading to apoptosis as opposed to inability to proliferate sufficiently for stratification to occur (Carroll et al., 2006). Still, these seminal works demonstrate the importance of TP63 in regulating ectodermal development. Not surprisingly, mutations within TP63 have been implicated in several forms of ectodermal dysplasia.
TP63-related ectodermal dysplasias. Ectodermal dysplasia (ED) comprises between 150 and 200 separate heterogeneous disorders which can arise de novo or be transmitted in an autosomal dominant fashion. EDs manifest as the abnormal development of ectodermal tissues and appendages, and are identified by dysgenesis of at least two ectodermal derivatives such as teeth, hair, nails, sweat glands, sebaceous glands, limbs, and skin. The prevalence of ED is estimated to be about 1 in 100,000 births in the United
States (National Institutes of Health, 2011). As would be expected, mutations in TP63 lead to defects in ectodermal development. Interestingly, TP63 mutations underlie five separate forms of ED, which attest to the importance of multiple functionally significant protein domains throughout TP63.
The resulting related disorders are characterized by a combination of developmental abnormalities involving orofacial clefting, limb deformities, and skin defects to include epidermal appendage defects (reviewed in Priolo et al., 2000). They include ankyloblepharon ectodermal dysplasia and clefting (McGrath et al., 2001) (AEC [OMIM
106260]), described in the following section; acro-dermato-ungual-lacrimal-tooth syndrome, characterized by ectrodactyly, syndactyly, nail dysplasia, lacrimal duct obstruction, hypodontia, and mammary gland hypoplasia (Amiel et al., 2001) (ADULT [OMIM 103285]);
5 ectrodactyly ectodermal dysplasia and clefting, characterized by ectrodactyly of the hands and feet, clefting of the lip and palate, sparse hair, and corneal abnormalities (Celli et al.,
1999) (EEC [OMIM 604292]); limb-mammary syndrome, characterized by hand and foot abnormalities, mammary gland hypoplasia, nail dystrophy, tooth defects, and lacrimal obstruction (Van Bokhoven et al., 1999) (LMS [OMIM 603543]); and split-hand/foot malformation, characterized by syndactyly of the feet and distal duplications of digits in the hands (Ianakiev et al., 2000) (SHFM [OMIM 605289]). While there is some degree of overlap between the clinical phenotypes represented by each TP63-related ED, there is also the potential for phenotypic variability within any particular condition, as well as between family members sharing the same mutation (Rinne et al., 2007).
Ankyloblepharon Ectodermal Dysplasia and Clefting
Clinical symptoms and manifestation. The clinical presentation of AEC is broadly characterized by a combination of developmental abnormalities in tissues and structures derived from the ectoderm, often involving clefting of the lip and palate, ankyloblepharon
(partial fusion of the eyelids), narrow lacrimal ducts, eyelash and eyebrow alopecia, irregular hair structure, tooth agenesis, nail dystrophy, atopic dermatitis, mild hypohydrosis, palmoplantar hyperkeratosis, malformations of the inner ear which can result in hearing loss, and widespread skin erosion without blisters, or with involvement only of the superficial layers (Rapp and Hodgkin 1968; Hay and Wells 1976; Greene et al., 1987; Crawford et al.,
1991; Siegfried et al., 2005; Dishop et al., 2009, Julapalli et al., 2009) (Fig 1.2).
As is common with other TP63-related disorders, the expressivity and manifestation of each of these definable characteristics varies from patient to patient, and between family members carrying the same mutation (Rinne et al., 2006). While some of these features may be shared with other TP63-related dysplasias, arguably the most striking and concerning feature of AEC is the severity of the associated skin phenotype.
6
a b
Figure 1.2. Clinical presentation of AEC. Photographs of AEC patients exhibiting (a) severe erosions of the scalp and (b) dermatitis of the upper body and shoulders. Patient images provided by the National Foundation for Ectodermal Dysplasias (NFED).
7
Skin erosions are present at birth for approximately 80% of AEC patients (Rinne et al., 2007). In each case, skin erosions are most severe during infancy and childhood. While these symptoms do decrease in frequency and severity as the patient ages, recurring erosions can be potentially life-threatening as wound sites are prone to bacterial, fungal, and yeast infection. Currently, there is no cure for AEC, and symptomatic care is only partially effective at managing pain and infection at the site of skin erosion in affected individuals.
Characteristics of AEC syndrome skin. At the cellular level, healthy skin is composed of four sublayers (five in the palms and soles). These layers include the basal layer, the deepest epidermal layer at the epidermal-dermal junction (EDJ); the spinous layer, named for the spines (desmosomes) observed around each cell within the layer as a result of the fixation process; the granular layer, for the keratohyalin granules which serve to bind intermediate keratin filaments; and the cornified layer, which is actually made of many layers of dead cells which have fused to form a protective barrier to the environment (Fig 1.3).
Together, these layers are commonly between 5 and 10 living cells thick.
TP63 expression is generally restricted to the proliferative cells within the basal compartment where it is expressed as NP63. These cells also express KRT14. During stratification, these proliferative basal cells give rise to daughter cells which either remain in the basal compartment, or exit the cell cycle and begin migrating into the spinous layer.
Differentiating cells immediately begin to downregulate the expression of TP63, and residual
TP63 protein is quickly degraded. Transiting cells then begin to express the intermediate keratinocyte marker, KRT1. Normal skin appears uniform and organized across the tissue, and a clear transition can be observed between the basal and spinous layers.
In contrast, AEC patient skin is highly disorganized and hyperplastic. TP63- expressing cells can be observed ‘floating’ well into the suprabasal compartment where they continue to proliferate. AEC patient skin also exhibits delayed and incongruous expression
8
Figure 1.3. Epidermal skin equivalent. Epidermal tissue generated in a 3D epidermal skin equivalent system replicates epidermal stratification, clearly illustrating the four main layers of the epidermis. They are the stratum corneum, stratum granulosum, stratum spinosum, and stratum basale. Epidermal skin equivalent was derived using NTERT keratinocytes, a kind gift from James G. Rheinwald, Harvard Skin Disease Research Center.
9 of KRT1 in the suprabasal layers of the epidermis (Fig 1.4). Since TP63 controls multiple essential functions within the epidermis, it is likely that the skin fragility seen in AEC patients is the result of a combination of interdependent defects including, but not limited to, weak adhesion, delayed differentiation, and possibly also a delay in the degradation of TP63.
Molecular genetics of AEC. AEC is a heritable form of ED which can arise de novo or be inherited in an autosomal dominant manner. AEC is most commonly linked to heterozygous missense, nonsense, or frameshift mutations in either exon 13 or exon 14 of the TP63 gene; the regions which code for the SAM and TID domains (Ozaki et al., 1999;
Serber et al., 2002; Dianzani et al., 2003; Shotelersuk et al., 2005). These mutations can result in amino acid substitutions or splice site defects. AEC can also be caused by mutations in exon 3-prime, an amino terminal exon specific to N isoforms through an alternate transcriptional start site in TP63 (Fig 1.1).
It is possible that mutations in separate regions of the gene could affect the function of the protein quite differently, either affecting the ability for the protein to bind target DNA sequences (perhaps due to mutations in the 3-prime exon), or potentially abrogating its ability to bind its normal interacting partners (mutations in exon 13 or exon 14, coding for the
SAM domain). As well, some mutations could result in gross conformational changes to the protein (McGrath et al., 2001). Either of these possibilities could potentially result in alterations in the activation of TP63 target genes. Nevertheless, the majority of known AEC mutations have been located in exon 13 or exon 14, which would presumably interfere with the function of the TP63 SAM domain, a putative protein-protein interaction domain.
NMR experiments aimed at assessing the stability and structure of the AEC-mutated
SAM domain would suggest the possibility of increased flexibility within the domain as a result. This could potentially alter its ability to acquire normal interacting partners, or even allow it to interact with new partners (Cicero et al., 2006). The crystal structure of TP63 SAM with a focus on sites of TP63-AEC mutation also confirmed the presence of salt bridges and
10
a Normal Human Skin
b Non-lesional AEC Patient Skin
Figure 1.4. AEC skin exhibits differentiation and proliferation defects. Immunofluorescence staining using antibodies against KRT1 (green), an intermediate keratinocyte differentiation marker, and Ki67 (green), a proliferation marker in (a) normal human skin and (b) non-lesional AEC patient skin. K14 (red), a keratinocyte filament marker, is expressed throughout the epidermis of normal and AEC patient skin. AEC patient skin exhibits delayed expression of KRT1 and abnormal proliferation in a highly disorganized squamous epithelium. Images adapted from Koster et al., 2009 and data unpublished. Scale bars, 50m.
11 hydrogen bonds at those sites which when abolished would probably cause a stearic clash between chemical groups or rearrangement within the hydrophobic core, which could affect the conformation and biological function of the protein (Sathyamurthy et al., 2011).
In order to predict the influence of the mutations identified for each patient in our
AEC cohort, a predictive modeling program was used (University of Colorado Skaggs
School of Pharmacy Computational Chemistry and Biology Core). The structural predictions for the SAM domain including the AEC mutations in our cohort suggested that AEC mutations abrogated hydrogen bonding potential within the hydrophobic core of the SAM domain (Fig 1.5).
Models for AEC
Np63 knockdown mouse model. While early Trp63 knockout models provided valuable insight into the roles and functions governed by p63 during development, in order to focus more closely on the role of Np63 in the epidermis, Koster et al. developed an
RU486-inducible Np63 knockdown mouse model whereby upon RU486 treatment, Np63 knockdown mice exhibited skin fragility (Koster et al., 2004). These mice were also found to be incapable of regenerating tissue in full-thickness wounds due to a failure for p63-ablated keratinocytes to commit to terminal differentiation. In addition, upon treatment, these mice exhibited defects in Krt1 expression as well as basement membrane abnormalities demonstrated by discontinuous staining for collagen IV (Koster et al., 2007).
Further investigation through microarray and chromatin immunoprecipitation (ChIP) assays highlighted two genes which are directly regulated by Np63. Those genes are
Fras1, controlling epidermal-dermal basement membrane maintenance, and IKKa, which is required for induction of intermediate keratinocyte differentiation and complete processing of the epidermal differentiation program. This more focused approach using an epidermal specific knockdown targeting Np63 isoforms revealed defects particular to the
12
Figure 1.5. TP63-AEC SAM domain structural prediction. The SAM domain forms a 5- alpha helical basket with a hydrophobic core. AEC mutations were found to be buried with side chains localized between the helices. This could disrupt the hydrophobic core of the TP63 SAM domain, potentially abrogating natural TP63 protein interactions. These disruptions could alternatively result in altered binding partner specificity. Model prediction was done for four of the TP63 mutations represented in our AEC cohort.
13 compromised function of p63 solely in the epidermis. Importantly, the mice born from this model exhibited an epidermal phenotype which partially phenocopied that of AEC, specifically involving basement membrane integrity and epidermal differentiation (Koster et al., 2007).
Heterozygous knock-in mouse model. More recently, a heterozygous knock-in mouse model was generated through germline transmission introducing a commonly studied
AEC-related SAM domain mutation (substitution L514F) to the Trp63 gene (Ferone et al.,
2012). While mice born of this model exhibit many of the major developmental defects associated with AEC, to include palatal hypoplasia and delays in tooth and hair follicle development, they do not survive to fully recapitulate the skin hyperplasia or erosive lesions seen in AEC patients. This could be due in part to the variable expressivity of Trp63 in knock-in mice or differences between mouse and human skin biology.
Epidermal progenitor cells in the Trp63+/L514F mice did exhibit a downregulation of
Fgfr2, a direct Trp63 target gene which has also been implicated in the development of several craniofacial disorders (Gorry et al., 1995; Hajihosseini et al., 2001). Also, notably, histological analysis of the epidermis of Trp63+/L514F mice did reveal delamination of stratified epithelia between the basal and supra-basal compartments (Ferone et al., 2013), closely resembling previously reported intra-epidermal acantholysis found in AEC patient tissue
(Payne et al., 2005). However, the penetrance of the phenotype is incomplete as these micro-blisters were only detectable in a small subset of pups, and macroscopic skin lesions were rarely observed. The similarity between the phenotype as reported by Payne et al., and that observed in PKP1-null patients with ectodermal dysplasia/skin fragility syndrome
(McGrath et al., 1997; McMillan et al., 2003) [OMIM 604536] suggests that the skin lesions associated with AEC could be related to desmosomal dysfunction, potentially involving genes which have been implicated in other related genodermatoses and blistering disorders
(reviewed in Amagai and Stanley 2012; reviewed in Petrof et al., 2012; Salam et al., 2014).
14
Indeed, additional investigation confirmed a downregulation of Dsc1, and Dsg1 in
Trp63+/L514F mice, and DSC3, and DSP in actual AEC patient tissue (Ferone et al., 2013;
Koster et al., 2014); genes which are important for promoting and preserving epidermal integrity and cell-cell adhesion (Chidgey et al., 2001; Vasioukhin et al., 2001; Chen et al.,
2008; Clements et al., 2012). These models, while useful to some degree, do not faithfully represent the genotype, nor capture the totality of defects associated with the phenotype of
AEC patients, and are clearly inappropriate for use in mechanistic studies where AEC- associated skin fragility is the focus of research.
Epidermal Adhesion and Basement Membrane Proteins
Desmosomes. Desmosomes are junctional adhesion complexes which are widely abundant in stratified epithelia. They serve the purpose of providing resistance to tissues that are regularly subjected to mechanical stress. Desmosomal complexes are made up of desmosomal cadherins (desmocollins and desmogleins) which comprise the transmembrane component, and desmosomal plaque proteins (plakophilins, plakoglobins, and desmoplakin) which link desmosomal cadherins to intermediate filaments within the cell, and PERP, which facilitates desmosome assembly and stabilization (Fig 1.6).
The desmosomal cadherins are calcium-dependent, and expressed differently depending on the cell type or stage of differentiation (Koch et al., 1990). Plakophilin (PKP), plakoglobin (JUP), and desmoplakin (DSP) are expressed throughout the epidermis, while desmoglein 2 (DSG2) and desmoglein 3 (DSG3) as well as desmocollin 2 (DSC2) and desmocollin 3 (DSC3) are mainly expressed in the basal layer. As cells begin to differentiate and leave the basal compartment, they begin to express desmocollin 1 (DSC1) and desmoglein 1 (DSG1). This expression increases while the expression of DSC2, DSC3,
DSG2, and DSG3 becomes progressively weaker (Fig 1.7). Many of these desmosomal components are transcriptionally regulated by TP63, and are found to be downregulated in models or AEC patient tissue (Ihrie et al., 2005; Ferone et al., 2013; Koster et al., 2014).
15
Figure 1.6. Schematic representation of desmosome and component parts. Desmosomes are formed as a result of interactions between desmosomal cadherins (DSC and DSG), desmosomal plaque proteins (JUP, PKP, and DSP). The extracellular domains of desmosomal cadherins interact with each other between cells. The intracellular domains of these proteins interact with intracellular desmosomal plaque proteins, which in turn link to intracellular keratin filaments (IF) through interaction with desmoplakin. These interactions provide adhesion between cells as well as cytoskeletal tension within cells (Image adapted from Schmidt and Koch, 2007).
16
Figure 1.7. Differentiation specific expression pattern of desmosomal proteins. Specific desmosomal proteins within each family are expressed differentially throughout the epidermal stratification process. This schematic illustrates the gene expression pattern that might be deficient in AEC skin. Normally, as basal cells begin to differentiate, DSC3 and DSG3 expression is decreased as there is a shift towards greater expression of DSC1 and DSG1.
17
Desmosomal protein knockout models. Desmosomal defects underlie a number of human disorders which share some intriguing phenotypic similarities with AEC. In the autoimmune disorders, pemphigus foliaceus (reviewed in Eyre and Stanley, 1987) and pemphigus vulgaris (Amagai et al., 1999) [OMIM 169610], antibodies develop against DSG1 and DSG3 (reviewed in Amagai and Stanley, 2012) and DSC3 (Refai et al., 2011). This leads to a loss of desmosomal junctions between cells in the epidermis and mucosal surfaces resulting in blistering at these sites. Through a similar mechanism, the loss of
DSG1 is implicated in the formation of superficial blisters and exfoliative skin erosions associated with staphylococcal scalded skin syndrome (SSSS), in this case, primarily caused by the release of epidermolytic toxins A (ETA) and B (ETB) from pathogenic strains of staphylococcus aureus, which attack DSG1 in the upper layers of the epidermis
(Hanakawa and Stanley, 2004).
Mutations in these and related proteins have also been shown to result in several skin defects. For example, nonsense mutations in DSC3 have been linked to hypotrichosis and skin blistering (Ayub et al., 2009). Mutations in DSG1 and JUP have been associated with palmoplantar keratoderma (Armstrong et al., 1999; Rickman et al., 1999; McKoy et al.,
2000). Mutations in PKP1 can cause ectodermal dysplasia-skin fragility syndrome (ED-SF)
(McGrath et al., 1997), and mutations in DSP can lead to skin fragility, woolly hair, or lethal acantholytic epidermolysis bullosa (Norgett et al., 2000; Jonkman et al., 2005).
In order to gain additional insight into the roles of these desmosomal proteins, knockout mouse models were developed. Immediately, some models proved to be embryonic lethal for mice with null mutations. To circumvent this, tissue specific models have since been developed. Current working models include those for Dsg3 and Dsc3, which demonstrated that loss of Dsg3 or Dsc3 resulted in pronounced blistering and alopecia phenotypes (Koch et al., 1997; Chen et al., 2008). Loss of Dsp1 resulted in skin fragility and keratinocyte differentiation defects (Vasioukhin et al., 2001). The loss of Dsc1
18 resulted in loss of cell adhesion in the upper layers of the epidermis and defects in differentiation and epidermal barrier formation (Chidgey et al., 2001). In the knockout mouse model for Perp, it was observed that the absence of Perp led to a loss of adhesion and intraepithelial blistering between the basal and suprabasal layers, but also enhanced proliferation in stratified epithelia (Ihrie et al., 2005; Marques et al., 2006). These results are not surprising when considering the important roles these proteins play in cell adhesion.
Desmosomal cadherins and epidermal cell signaling. Interestingy, in addition to these knockout and knockdown mouse studies, it has been discovered through further in vitro knockdown studies that there are also physiological roles for desmosomal cadherins to play as signaling components. Two mechanisms which could be of interest regarding the pathophysiology of AEC include the ERK1/2 pathway in relation to cell cycle exit and terminal differentiation, and the p38MAPK pathway concerning cytoskeletal tension.
Recent epidermal differentiation studies have shown that DSG1, specifically, is required for intermediate stage differentiation and suprabasal morphogenesis, as it controls the ERK1/2 pathway in the suprabasal layers of the epidermis through suppression of epidermal growth factor receptor (EGFR) (Getsios et al., 2009). As it follows, cells transiting from the proliferative basal layer within the epidermis begin to upregulate expression of
DSG1, and later, KRT1. Importantly, for a transiting cell to exit the cell cycle to begin differentiation, the EGFR-ERK1/2 signaling pathway must be suppressed. In these studies, cells for which DSG1 expression had been silenced were unable to suppress EGFR activity and the phosphorylation of ERK1/2, and ultimately failed to express intermediate and terminal epidermal differentiation markers such as KRT1 (Getsios et al., 2009). This highlights a critical role for DSG1 as not only an adhesion regulator, but as a key signaling component controlling cell cycle as well as downstream keratinocyte differentiation.
Similarly, studies focusing on the depletion of desmosomal components in pemphigus vulgaris have identified DSG3 and JUP as being involved in an adhesion
19 dependent signaling complex regulating p38MAPK activity (Spindler et al., 2013), whereby p38MAPK is found in an inactive (unphosphorylated) state when in complex with DSG3 and
JUP at the desmosome. In response to depletion of available DSG3 and JUP however, p38MAPK activity is rapidly upregulated. A loss of either of these components within the desmosome could lead to cell dissociation, Interestingly, it was observed that the upregulation in p38MAPK activity was coupled with an immediate retraction of keratin filaments and loss of cytoskeletal tension, leading to further loss of cell-cell adhesion
(Spindler et al., 2013). In theory, the disruption of one of these programs by a downregulation of DSG1 or DSG3 in AEC keratinocytes could be partly responsible for the delay in cell cycle exit and differentiation (and KRT1 expression), or loss of adhesion characteristic to the AEC epidermis.
Hemidesmosomes. Hemidesmosomes are adhesion complexes which serve the purpose of anchoring epithelial cells to the underlying basement membrane. Similar to desmosomes, they are also formed at plaques with intracellular and extracellular components. Within the cell, cytoplasmic tails of integrin subunits serve as anchor points for actin or keratin filaments. The extracellular components of the hemidesmosome however include various anchoring fibrils and integrins which interact with extracellular matrix proteins within the basal lamina (a component of the basement membrane), such as collagens, fibronectin, vitronectin, and laminin.
Depending on cell type, integrins will assemble at the cell membrane in various combinations as obligate heterodimers consisting of an and a subunit. The main functions of the integrins include serving as tether points for the cell to the ECM, and as transmembrane receptors, providing the cell with information regarding the surrounding environment. Signal transduction mediated by integrins also leads to the activation of specific receptor tyrosine kinases which regulate cell cycle, cytoskeletal rearrangement, differentiation, and migration.
20
Within the epidermis, integrins 6 (ITGA6) and 4 (ITGB4) are expressed constitutively and assist in hemidesmosome assembly, and attachment to the extracellular matrix protein, laminin 5, which is itself a heterotrimer comprised of laminin 3 (LAMA3), laminin 3 (LAMB3), and laminin 2 (LAMC2). There is some overlap regarding the various integrin combinations and their ligand specificity, for example, integrins 3 (ITGA3) and 1
(ITGB1) also interact with laminin 5. In this regard however, it does seem that integrin 64 plays a greater role in hemidesmosome assembly (Margadant et al., 2010), while integrin
31 serves to regulate several keratinocyte functions during wound healing and re- epithelialization (Frank and Carter, 2004). Other integrin complexes which exist within epidermal keratinocytes that are upregulated during wound healing include 51 which contributes to migration over fibronectin, v1 which aids in migration over vitronectin as well as fibrinogen, and 21 which binds collagen (Table 1.1).
Expression of the appropriate integrin and subunits and ECM components is crucial for maintaining adhesion between the epidermis and the dermal component of the skin, as well as for directing proper cell migration and re-epithelialization following injury. An impairment to the function of any of these hemidesmosome components can lead to fragile skin that is prone to separation between the epidermis and dermis in response to molecular events caused by even minor mechanical stress (reviewed in Shinkuma, 2015).
Highlighting the critical role played by the hemidesmosome in epidermal cell to ECM adhesion, multiple forms of the blistering disorder epidermolysis bullosa (EB) can be attributed to abnormalities or mutations in ITGA6 and ITGB4; LAMA3, LAMB3, and LAMC2; and collagens type VII and XVII (COL7A1 and COL17A1). While not found to be mutated in
AEC patients, some of these integrin and ECM proteins are transcriptionally regulated by
TP63 (Carroll et al., 2006) suggesting potentially that hemidesmosome defects could also be involved in the development and recurrence of skin fragility and skin erosion in AEC.
21
Table 1.1. Integrins and their ligands.
Receptor ComplexLigands
α1β1 Collagens; laminins α2β1 Collagens; laminins α3β1 Laminin-5 α5β1 Fibronectin α6β1 Laminins α7β1 Laminins αVβ1 Vitronectin; fibrinogen αVβ5 Vitronectin αVβ6 Fibronectin α6β4 Laminin-5 α2β1 Collagens; laminins Laminin-5 α3β1
22
Induced Pluripotent Stem Cells
Cellular reprogramming. The concept of cellular reprogramming, at its root, can be traced back arguably to the early accomplishments of John Gurdon, who tested whether or not genetic material from even the most differentiated cells could be used to generate an embryo when transplanted into an enucleated egg (Gurdon et al., 1962; Gurdon et al.,
1966). This work was an extension of earlier experiments performed by Briggs and King testing the potential for somatic cell nuclei of higher organisms (Rana pipiens) to be capable of supporting normal development after transplantation to an enucleated egg (Briggs and
King 1952). While they were successful in essentially performing somatic cell nuclear transfer (SCNT) using nuclei from blastocyst stage cells, they were not able to produce normal embryos using nuclei from later stage cells.
In line with Conrad Waddington’s epigenetic landscape theory which proposed the idea that a cell, once differentiated cannot transdifferentiate or dedifferentiate (Waddington,
1957), they determined that beyond a certain developmental stage, nuclei in differentiating cells must undergo some changes restricting their developmental capacity (Briggs and King
1956). Essentially, Gurdon was demonstrating that the genetic code required for
“programming” all cell types in an organism is in fact retained and intact in fully differentiated cells, and that nuclei from committed cells undergo a reset, or “reprogramming” in order to once again give rise to cells of all germ lineages post nuclear transfer. This seminal work in nuclear transfer and reprogramming lit the path for later achievements in the fields of transgenics research and reproductive biology (Matzuk et al., 1992) and nuclear transfer and cloning research (Wilmut et al., 1997). Probably the most recent descendent of this fate reversal research is induced pluripotent stem cell technology (Takahashi et al., 2006).
Induced pluripotent stem cells. Induced pluripotent stem cells (iPSC) were first generated from mouse fibroblasts which were transduced using various combinations of retroviruses comprising 24 gene candidates. Ultimately, a set of four specific genes which
23 control self-renewal and pluripotency in ESCs were found to be sufficient for cellular reversion to pluripotency. These genes code for what are commonly referred to as the
Yamanaka factors, KLF4, SOX2, OCT3/4, and c-MYC (Takahashi et al., 2006). Soon after, these same four factors were successful in reprogramming human fibroblasts (Masaki et al.,
2007; Takahashi et al., 2007), to include those isolated from an 82 year old patient with amyotrophic lateral sclerosis (ALS) (Dimos et al., 2008). These pioneering achievements using viruses to introduce these or other related pluripotency factors, however efficient, carried the unwanted effect of random integration of viral genetic material into the host genome. This, in turn, carries with it the risk of later reactivation of an integrated transgene
(Takahashi et al., 2006); a critical concern if considering iPSC-derived tissue for use in clinical applications.
More recently, various non-integrative methods have been developed and widely adopted which rely on the ectopic expression of induction factors to avoid this potential caveat. Such methods include repeated transfection with non-integrating DNA plasmids or minicircle vectors (Okita et al., 2008; Gonzalez et al., 2009), proteins (Zhou et al., 2009; Kim
2009), or modified mRNA (Warren et al., 2010), as well as alternative viral approaches using non-integrative viruses (Stadtfeld et al., 2008; Zhou and Freed, 2009; Fusaki et al., 2009;
Miyazaki et al., 2010; Ban et al., 2011) (Table 1.2).
Since the generation of iPSCs was initially reported, researchers have discovered additional combinations of genes which can be used to successfully generate iPSCs (Yu et al., 2007), and a number of small molecules which when administered in addition to the induction factors can facilitate the reprogramming process (Zhu et al., 2010; Li et al., 2011;
Yuan et al., 2011; Yu et al., 2011). Notably, it has also since been shown that somatic cell types representing all three germ layers are capable of being successfully "reprogrammed" to generate iPSCs, presenting alternative primary tissue sources for induction. These cell types include fibroblasts, b-lymphocytes, hepatocytes, gastric epithelial cells, keratinocytes,
24
Table 1.2. iPSC reprogramming methods and integration potential.
Reprogramming Method Integrative Efficiency References
Retrovirus Yes Moderate Takahashi et al. , 2006 Adenovirus No Low Stadtfeld et al. , 2008 Lentivirus Yes Moderate-High Sommer et al. , 2009 Transposible element Yes Low Woltjen et al. , 2009 Episomal vectors No Low Yu et al. , 2009 Protein No Low Zhou et al. , 2009 Sendai virus No High Fusaki et al. , 2009 mRNA/miRNA No Moderate-High Warren et al. , 2010 Small molecules No Moderate Hou et al. , 2013 Stimulus-triggered No High Obokata et al. , 2014
25 and renal epithelial cells (Aasen et al., 2008; Aoi et al., 2008; Hanna et al., 2008; Song et al., 2011; Zhou et al., 2011).
This versatility is important where a blood draw for instance, would be preferable to a skin biopsy for tissue sourcing, or when the downstream re-differentiated cell type of interest is derived from a specific germ cell lineage, as it has been demonstrated that cellular origin may influence the differentiation potential of iPSCs (Polo et al., 2010). Of further importance when sourcing tissue is the fact that skin cells exposed to UV light can acquire random mutations over time, ultimately rendering this source population of cells less desirable for use in clinical or therapeutic applications. At present however, dermal fibroblasts isolated from a skin biopsy are still the most commonly collected source material for iPSC generation.
Characterization of induced pluripotent stem cells. At the least stringent level of in vitro iPSC characterization, a morphological and fluorescent antibody analysis is performed to confirm embryonic stem cell (ESC) like morphology, and to detect expression of ESC-associated pluripotency markers; NANOG, TRA-1-60, TRA-1-81, and SSEA3 or
SSEA4. This is done using ESCs as controls, and is also commonly complemented by a qRT-PCR analysis for an extended set of markers. Pluripotent potential is functionally evaluated through spontaneous or directed differentiation to evaluate the ability for putative iPSCs to give rise to cells representative of the three embryonic germ layers. This is similarly assessed by immunocytochemistry or qRT-PCR for markers such as AFP, SMA, and TUBB3 to identify cells representative of the endodermal, mesodermal, and ectodermal lineages respectively.
Less commonly, but still considered the gold standard for pluripotency in human lines, a teratoma formation assay may also be performed (Noggle, Spagnoli and Brivanlou,
2007). This involves the subcutaneous injection of putative iPSCs into immunocompromised mice, which will give rise to a non-malignant teratoma comprised of differentiated cells of
26 each germ layer if the injected cells are indeed pluripotent. Genetic stability testing generally includes a high resolution G-band or spectral karyotype analysis, but a deeper level of validation can also be achieved through an epigenetic status assessment by BS-Seq for pluripotency-associated and differentiation genes, as well as an evaluation of X- chromosome reactivation in female lines.
After initial validation criteria have been met, iPSC cultures are carried for several passages to demonstrate their ability to maintain consistency of these ESC-like characteristics without reverting to their source cell type. If integrative methods are used to generate iPSCs, the silencing of introduced transgenes must be evaluated throughout this process.
Application of induced pluripotent technology. Previous research using ESCs must be credited for paving the way for current iPSC applications, as for all intents and purposes, iPSCs behave similarly to ESCs in function, and can be cultured and manipulated in much the same manner. This has enabled researchers to adopt previously established differentiation protocols developed for ESCs to be used similarly with iPSCs. However, subtle differences do exist. While during reprogramming, genes necessary to maintain pluripotency are reactivated and differentiation genes are silenced, iPSCs often still do express a number of "legacy" markers associated with the somatic cell type of origin
(Marchetto et al., 2009; Ghosh et al., 2010; Polo et al., 2010; Ohi et al., 2011). So, while iPSCs and ESCs are not absolutely identical, they do display much of the same potential.
For this project, it is important to be able to differentiate AEC-patient derived iPSCs into keratinocytes, the affected cell type. It has recently been demonstrated that keratinocytes can be differentiated from ESCs with high efficiency following treatment with retinoic acid (RA) and bone morphogenetic protein 4 (BMP4) (Metallo et al., 2008; Guenou et al., 2009). As with ESCs, iPSCs have also been successfully differentiated into functional keratinocytes using similar methods (Bilousova et al., 2010; Itoh et al., 2011, Petrova et al.,
27
2014). These iPSC-derived keratinocytes (iPSCd-kc) express KRT14 and TP63, and can be flow-sorted for keratinocyte-specific surface markers such as ITGA6 and ITGB4 in order to enrich the population for basal keratinocytes. Further, iPSCd-kcs can be driven towards intermediate and terminal stages of epidermal differentiation upon calcium exposure, and can form stratified tissue either in vitro, or when transplanted in vivo.
Other important skin cell types which have been successfully differentiated from iPSCs include melanocytes and fibroblasts (Ohta et al., 2011; Itoh et al., 2013; Jones et al.,
2013). The work described in these reports exemplifies how precursory and intermediate- stage differentiated cells can be directly derived from iPSCs which exhibit functional and behavioral characteristics comparable to those of native cells.
Since iPSCs can be derived from patients with specific mutations, cultured indefinitely, and differentiated into disease-relevant cell types, they represent the ideal starting point for investigating underlying disease pathologies. For example, as keratinocytes, melanocytes, and fibroblasts function together in the same biological niche, when cultured together, these cells are capable of organizing into a highly relevant and complex human skin equivalent, which can be used for studying epithelial-mesenchymal interactions or disease progression in vitro (Gledhill et al., 2015). Additionally, these qualities combine to create a platform upon which multiple drugs and their derivatives can also be screened in vitro to specifically eliminate toxic compounds, and identify novel therapeutic candidates for clinical application (Grskovic et al., 2011; Ebert et al., 2012) (Fig 1.8).
Similarly, iPSC technology also holds the potential to provide proof-of-principle for future autologous cell-replacement applications involving the correction of causative gene- mutations prior to iPSC generation. This can occur naturally as shown recently in a patient with recessive dystrophic epidermolysis bullosa (RDEB [OMIM 226600]), where spontaneous gene-correction via recombination of a normal and affected allele resulted in a population of spontaneously revertant keratinocytes. These healthy keratinocytes were used
28
Figure 1.8. Basic principles underlying the use of iPSC technology. Somatic cells derived from patient tissue are reprogrammed into induced pluripotent stem cells (iPSC). Using gene-editing tools such as TALENs or CRISPRs, pathogenic mutations are then corrected in patient-derived iPSCs. Gene-corrected as well as disease-specific iPSCs are differentiated into the affected cell type and then used in disease-modeling. After a disease mechanism has been identified, the same approach can be used to identify candidate drug targets and screen for therapeutic compounds. Gene-corrected cells can also be used to generate healthy replacement tissue for use in autologous cell replacement therapies (Image adapted from Dinella et al., 2014).
29 as source tissue for iPSC generation and were then re-differentiated into keratinocytes capable of effectively restoring normal function to COL7A1, a protein affected in major forms of epidermolysis bullosa (Tolar et al., 2014). While revertant mosaicism is rare, this re- derived population of healthy keratinocytes represents, in principle, a resource of disease- free, proliferative cells which could theoretically be used to regenerate healthy skin.
In order to generate healthy tissue from non-mosaic individuals, targeted genome- editing methods are being employed to correct causative gene mutations in patient derived iPSCs. These gene-modification techniques include the use of zinc-finger nuclease (ZFN)
(Kim et al., 1996; Bibikova et al., 2002, Hockemeyer et al., 2009), transcription activator-like effector nuclease (TALEN) (Boch et al., 2009, Christian et al., 2010; Zhang et al., 2011;
Miller et al., 2011), or clustered regularly interspaced short palindromic repeat (CRISPR)
(Cong et al., 2013; Mali et al., 2013a; Ran et al., 2013a) technologies to “direct” single or double-strand breaks in host cell DNA and initiate site-specific homologous recombination.
Precise editing at a particular base can be further facilitated with the co-introduction of a donor template DNA sequence. An example was demonstrated by Osborn et al., whereby
TALENs were used to correct a causative COL7A1 gene mutation in primary fibroblasts from a patient with RDEB. Affected as well as gene-corrected fibroblasts were reprogrammed into iPSCs and allowed to differentiate in vivo. While both iPSC lines were capable of forming skin-like structures, only the gene-corrected iPSCs were capable of differentiating into
COL7A1 producing cells (Osborn et al., 2013).
Similarly, in a recent bid to produce an autologous replacement tissue for a patient with junctional epidermolysis bullosa (JEB [OMIM 226650]) carrying a LAMB3 splice-site mutation, epithelial holoclone stem cells were isolated from a patch of non-lesional tissue, and then transduced to express full length LAMB3. These transduced cells were then cultiavted into epidermal sheets and grafted back to denuded wound beds on the patient leading to the stable recovery of the patient without recurrent blistering (Hirsch et al., 2017).
30
Hypothesis and Specific Aims
Mutations in the transcription factor-encoding gene, TP63, lead to severe recurrent skin erosions in individuals afflicted with ankyloblepharon ectodermal dysplasia and clefting
(AEC). Although a link between TP63 mutations and AEC has been established, it is not yet clear how, mechanistically, these mutations contribute to the various disease phenotypes observed in AEC patients. Although previous studies have suggested defects in epidermal proliferation, differentiation, and cell-cell adhesion pathways in AEC skin, current models do not accurately represent the AEC genotype or phenotype. Consequently, the specific mechanisms by which mutations within TP63 ultimately lead to AEC-associated skin fragility remain largely undefined.
Understanding these disease mechanisms would provide the basis for the development of more effective treatments either through gene and cell-based therapies, or through the discovery of therapeutic compounds. Requisite to achieving this is the development of a robust, human patient-based disease model which can be used to study the underlying disease mechanisms which contribute to the pathology of AEC. One critical requirement for the establishment of this model is a renewable source of tissue. Another is that the system must be genetically defined.
I propose to use induced pluripotent stem cell (iPSC) and recently established genome editing technologies to correct the causative TP63 mutation, and generate conisogenic pairs of AEC patient derived iPSCs which differ genetically only at the site of the TP63-AEC mutation. This would essentially provide an unlimited source of genetically defined patient and gene-corrected keratinocytes for use in studying the underlying defects which contribute to the skin fragility phenotype seen in AEC patients. Before the establishment of these technologies, it would not have been technically feasible to design a human-based experimental disease-model that meets these criteria.
31
My hypothesis is that TP63-AEC mutations lead to a decrease in expression of genes required for the proper assembly and function of desmosomes and hemidesmosomes within the epidermis, resulting in skin fragility.
In testing this hypothesis, this thesis aimed to:
1. Develop a robust human cell-based model which can be used to study AEC in
vitro.
2. Generate gene-corrected iPSC-derived keratinocytes from patients with AEC.
3. Identify key adhesion genes which are downregulated in AEC keratinocytes.
4. Demonstrate that reduced expression of these genes contributes to loss of
adhesive properties in keratinocytes.
32
CHAPTER II
MATERIALS AND METHODS
Good Laboratory Practices and Safety
Good Laboratory Practices (GLP) and aseptic technique were observed while performing all methods, practices, and procedures detailed herein. Proper Personal
Protective Equipment (PPE) was worn and used when and where appropriate. All potentially hazardous work was performed in a chemical fume hood or a Class II Type A2 biological safety cabinet (BSC) under precautions accordant with Biosafety Level 2 (BSL-2) protocol.
Materials, reagents, and chemicals used during the course of this research were stored and disposed of in ways compliant with Environmental Health and Safety (EHS) guidelines and regulations.
Patient Information and Sample Acquisition
After written informed consent was obtained, skin biopsies were collected from eight
AEC patients and two familial control subjects using 4mm round biopsy punch tools by Dr.
Elaine Siegfried at St. Louis University, St. Louis, MO, Dr. Alanna Bree at Baylor College of
Medicine, Houston, TX, and Dr. Anna Bruckner at Children’s Hospital, Denver, CO. After procurement, samples were transported on ice in sterile 15mL conical tubes containing
Roswell Park Memorial Institute series 1640 (RPMI-1640) medium supplemented with 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA). All patients participating in the study met selection criteria and exhibited classic AEC phenotypes. Research protocol used was
17240. Helsinki guidelines were followed for all procedures.
Dermal Fibroblast Derivation, Culture, and Maintenance
Biopsy samples were processed into smaller pieces in a petri dish using sterile forceps and scissors. After dissection, biopsy pieces were streaked across the dish surface until semi-dry. Dissected tissue pieces were plated one each into wells of a cell culture treated 24-well plate and allowed to further dry until adherent. Once tissue pieces were
33 adherent, 400L of primary fibroblast growth medium: High glucose Dulbecco’s Modified
Eagle’s Medium (DMEM-HG) supplemented with 20% Earle’s Salts Medium 199 and 10% fetal bovine serum (FBS), with 1% GlutaMAX, 1% penicillin/streptomycin (Invitrogen),
100M -mercaptoethanol (Sigma-Aldrich, St. Louis, MO), and 10ng/mL recombinant human basic fibroblast growth factor (bFGF) (Peprotech, Rocky Hill, NJ) were added to each well. After day 1, the medium volume was increased to 700L per well and replaced every two days.
Fibroblast outgrowth was observable between day 2 and day 14 for each biopsy sample depending on donor age. Migrating fibroblasts were enzymatically passaged using
0.05% trypsin-EDTA (Invitrogen). Briefly, after dissociation, cells were collected into a sterile
15mL conical tube in serum-containing human fibroblast growth (hFib) medium: KnockOut
Dulbecco’s Modified Eagle’s Medium (KO-DMEM) supplemented with 2% FBS, 1%
GlutaMAX, 1% non-essential amino acids (NEAA), 1% insulin transferrin selenium ethanolamine (ITS-X) (Invitrogen), 100M -mercaptoethanol, and 10ng/mL bFGF, and centrifuged for 5 minutes at 200xg. Supernatant was aspirated and cells were resuspended in hFib medium to be seeded at a density of 2,500 to 5,000 cells/cm2 to freshly prepared
0.1% porcine gelatin (Sigma-Aldrich) coated 10cm dishes.
Tissue explants and fibroblasts were maintained in hFib medium and cultured in 5%
o CO2 at 37 C. Once fibroblast cultures had been passaged and established, each line was tested for mycoplasma by PCR (ATCC, Manassas, VA), and original tissue pieces which had produced migrating cells were collected to be cryopreserved in KO-DMEM containing
45% FBS and 10% dimethyl sulfoxide (DMSO) (Sigma-Aldrich).
Genotyping
Genotyping of the TP63 gene was performed for cultured fibroblasts from each patient and donor. As well, iPSC lines generated were genotyped to confirm the presence of
34 specific TP63 mutations found in source fibroblasts for each patient. Briefly, separate PCR primers were designed using Vector NTI Software (Invitrogen) to span genomic DNA sequence specifically for exons 13 and 14 (containing the SAM domain) of TP63. Genomic
DNA extraction was performed using a DNeasy Kit (Qiagen, Valencia, CA). PCR amplification products were purified using a QIAquick PCR Purification Kit (Qiagen) and sequenced directly by Sanger sequencing (University of Colorado DNA Sequencing Core).
PCR primers used are listed in Table 2.1.
iPSC Generation, Characterization, and Pluripotent Stem Cell Maintenance
Fibroblasts derived from selected patients were reprogrammed using a non- integrating RNA Sendai virus (Fusaki et al., 2009; Miyazaki et al., 2010) approach comprising the four classical reprogramming factors. This induction platform was chosen to avoid insertional mutagenesis, or the unpredictable or residual expression of virally integrated reprogramming factors.
Early passage (P3) control fibroblasts (Millipore, Billerica, MA) and AEC patient fibroblasts were seeded onto 0.1% porcine gelatin coated 6-well plates at a density of
100,000 cells per well, and cultured in hFib medium for 24 hours. At 24 hours, fibroblasts of one well for each line were treated with 0.25% trypsin-EDTA (Invitrogen), collected, and counted to determine approximate cell density per well. Cells in remaining wells were infected in 500L per well of human embryonic stem cell (hESC) medium: KO-DMEM with
20% KO-SR, 1% GlutaMAX, 1% non-essential amino acids, 100M -mercaptoethanol, and
10ng/mL bFGF, supplemented for infection with 8g/mL polybrene (Sigma-Aldrich), at a multiplicity of infection (MOI) of 5 for each viral reprogramming factor. Sendai vectors from the Cyto Tune-iPS Reprogramming Kit (Invitrogen) were used at a ratio of 1:1:1:1 encoding the four Yamanaka factors, KLF4, SOX2, OCT3/4, and c-MYC. 30 minutes post-infection, hESC medium with polybrene was added to a final volume of 1.5mL per well and infected
35 fibroblasts were incubated overnight. Growth medium was changed the following day to hFib medium and replaced daily for 6 days.
On day 7, in order to prevent overgrowth, transduced cells were enzymatically passaged using 0.05% trypsin-EDTA as previously detailed for dermal fibroblasts, and seeded at a density of 50,000 or 150,000 cells per well of a 6-well plate previously prepared with 25,000 cells/cm2 mitotically inactivated CF-1 MEF (MTI-GlobalStem, Gaithersburg,
MD), or coated with reduced growth factor Matrigel (BD Biosciences, San Jose, CA).
Medium was switched the following day to hESC medium for cultures with MEF, and to mTeSR1 medium (STEMCELL Technologies, Vancouver, Canada) for cultures on Matrigel.
Cultures were maintained in these conditions until ESC-like colonies appeared (between day 11 and day 14) and were of sufficient size to expand (between day 18 and day 21).
Putative iPSC colonies were passaged manually using P200 pipet tips and plated individually into Matrigel-coated wells of a 24-well plate in mTeSR1 medium supplemented with 10M Y-27632 ROCK inhibitor (PeproTech). Y-27632 was removed at or before 24 hours. Successive passages were performed enzymatically using Accutase (STEMCELL
Technologies). Briefly, dissociating cells were monitored while in Accutase until colony edges began to lift. Cells were collected in mTeSR1 medium and transferred to a sterile
15mL conical tube and centrifuged for 5 minutes at 180xg. Supernatant was aspirated and cells were resuspended in mTeSR1 medium containing 1M Y-27632 (1/10 the normal working concentration used during other procedures detailed herein) to be seeded at a ratio of 1:6 or 1:12 to freshly prepared Matrigel-coated wells of a 6-well plate. Established cultures were carried in 10cm dishes and maintained in mTeSR1 medium on Matrigel at 5%
o CO2 at 37 C. Five clones per line were cryopreserved at P3 or P4 in mTeSR1 supplemented with 40% FBS, 10% DMSO at a concentration of 500,000 cells/vial.
36
Table 2.1. Primers used to genotype AEC patients at exon 13 and 14 of TP63.
Primer NameForward Primer 5'-3'Reverse Primer 5'-3'Ampli con (nt)
p63 exon13 Fwd and RevCTTATCTCGCCAATGCAGTTGAACTACAA GGCGGTTGTCATC 241 p63 exon14 Fwd and RevGGGAATGATAGGATGCTGTGGAAGATTAA GCAGGAGTGCTT 507
37
Established iPSC cultures were tested for mycoplasma by PCR, and were validated and characterized by cell and colony morphology and a high nuclear to cytoplasmic ratio
(Thomson et al., 1998), embryoid body (EB) formation and spontaneous differentiation, pluripotency and differentiation gene expression both by qRT-PCR and immunofluorescence staining, G-band karyotype analysis or chromosome counts were performed for each line, and starting from P8, each line was tested for the absence of Sendai virus as confirmed by
PCR. iPSCs which had passed these criteria were again cryopreserved at 500,000 cells/vial to create a token stock. H9 ESCs (WiCell, Madison, WI) were used as a pluripotent control where relevant. Taq probes used to assess pluripotency at the RNA level are listed in Table
2.2. Primers used to detect Sendai virus are listed in Table 2.3.
TALEN Mediated Gene-correction, Strategy and Design
Two TAL effector nucleases (TALEN) were designed to target TP63 with a dimeric
FokI nuclease approach to limit the potential for off-target editing; pTAL.CMV-T7.016577
Left and pTAL.CMV-T7.016586 Right (Cellectis, Paris, France). The donor plasmid used for
TALEN-mediated gene editing was constructed by cloning a floxed hPGK-Puro dTK selection cassette flanked by 800 bp TP63 homology arms (University of Colorado Vector
Design Core) into a pBluescript SK+ empty vector (Agilent Technologies, Santa Clara, CA) digested with SpeI and PstI (New England Biolabs Inc., Ipswich, MA). TP63 template DNA within the donor plasmid was designed to include silent mutations to prevent further targeting after recombination has occurred. Silent mutations were introduced to the template using a Quickchange Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Mutagenic primers used are listed in Table 2.4.
CRISPR Mediated Gene-correction, Strategy and Design
Two guide RNA (gRNA) constructs were designed to target TP63 for editing using a dual Cas9 nickase paired approach to limit the potential for off-target editing. gRNAs were cloned into empty pSpCas9n(BB)-2A-Puro V2.0 vectors (donated by Feng Zhang, Addgene
38
Table 2.2. Taq probes used in qRT-PCR to measure pluripotency gene expression.
GeneAssay ID
POU5F1Hs00999632_g1 SOX2Hs01053049_s1 NANOGHs02387400_g1 LIN28Hs00702808_s1 FOXP1Hs00212860_m1 TERTHs00162669_m1
Table 2.3. Primers used to detect presence or absence of Sendai virus genetic material.
GeneForward Primer 5'-3'Reverse Primer 5'-3'Amplico n (nt)
SeVGGATCACTAGGTGATATCGAGCACCAGACAAGAGTTTAAGAGATATGT ATC 181
Table 2.4. Mutagenic primers designed and used for donor plasmid mutagenesis.
Substitution Primer 5'-3' Amplicon (nt)
G to C - Fwd GGGAATGATAGGATGCTGTCGACTAAATGTCCGTTTTTC --- G to C - Rev GAAAAACGGACATTTAGTCGACAGCATCCTATCATTCCC --- TC to AG - Fwd GGCAGCTCCACGAATTCAGCTCCCCTTCTCATC --- TC to AG - Rev GATGAGAAGGGGAGCTGAATTCGTGGAGCTGCC --- CAGT to TTCC - Fwd AAGCAGTGCCTCTACAGTTTCCGTGGGCTCCAGTGAGACC --- CAGT to TTCC - Rev GGTCTCACTGGAGCCCACGGAAACTGTAGAGGCACTGCTT --- C to A - Fwd CCATCTCTTTCCCACCACGAGATGAGTGGAATG --- C to A - Rev CATTCCACTCATCTCGTGGTGGGAAAGAGATGG ---
39 plasmid #62987). Correction template DNA used with the CRISPR approach consisted of a
168 bp single-stranded oligodeoxynucleotide (ssODN). As in the TALEN strategy, template
DNA was designed to include silent mutations to prevent further targeting after recombination. Off-target site analysis was done using CRISPR Design software
(crispr.mit.edu).
Transfection and Clonal Selection of iPSCs
iPSCs were dissociated into single cells using Accutase and nucleofected with 3g of each TALEN plasmid and 4g of linearized donor plasmid, or 2.5g of each
CRISPR/Cas9n plasmid and 100M of the ssODN template. Cells were transfected at 2E6 cells per cuvette using the Human Stem Cell Nucleofector Kit 1, program A-23 (Lonza,
Anaheim, CA). Transfected cells were seeded densely onto Matrigel coated 6-well plates at
1,000,000 cells per well in mTeSR1 medium supplemented with 10M Y-27632. After iPSCs began to form colonies, they were selected for puro-resistance using 700ng/mL puromycin for 2 to 7 days. Once cells had recovered from selection, they were again dissociated to single cells and seeded at a density of 500 cells/well to Matrigel/10% ES Qualified FBS
(ESQ-FBS) coated 6-well plates in mTeSR1 medium supplemented with 10M Y-27632.
Four hours after seeding, single cells were circled using a marker objective (Nikon
Instruments Inc., Melville, NY) and were observed daily to monitor continued isolation, colony formation, and morphology. Surviving colonies were manually passaged to begin propagation for screening and selection. TALEN-transfected cells were further nucleofected with 4g of pCAG-Cre:GFP (donated by Connie Cepko, Addgene #13776) to excise the floxed TK-Puromycin resistance cassette introduced during recombination.
For both gene-editing approaches, iPSC clones which had potentially undergone homologous recombination were screened by PCR using primers specific for newly integrated silent mutation sites previously designed into donor template DNA. Cre-mediated
40 removal of the selection cassette used in the TALEN approach was similarly confirmed by
PCR. Targeted gene-correction for each candidate clone was confirmed by Sanger sequencing (Quintara Biosciences, Berkeley, CA). The single-stranded oligonucleotide designed as a template sequence for use in correcting the TP63 exon 13 mutation is listed in Table 2.5. Screening and sequencing primers are listed in Tables 2.6-2.9.
iPSC-derived Keratinocytes
Embryoid bodies (EB) were formed using Aggrewell 400Ex plates (STEMCELL
Technologies) seeded at a density of 9E6 cells per well in EB formation medium: KO-DMEM with 20% KnockOut Serum Replacement (KO-SR), 1% GlutaMAX, 1% non-essential amino acids, 100M-mercaptoethanol, supplemented with 10M Y-27632. Y-27632 was removed at 24 hours. On day 3 following EB formation, EBs were collected and plated onto
0.05mg/mL collagen IV (Sigma-Aldrich) coated 10cm dishes in keratinocyte differentiation medium: Defined keratinocyte serum free medium (DKSFM) (Invitrogen) supplemented with
1M retinoic acid (RA) (Sigma-Aldrich) and 25ng/mL bone morphogenetic protein 4 (BMP4)
(R&D Systems, Minneapolis, MN). Medium was changed every day for 7 days, after which, differentiation factor treatment was discontinued and cultures were maintained in complete
DKSFM without further supplementation. At day 28, cultures were switched into a 7:3 mixture of DKSFM and CnT-57 medium (CELLnTEC, Bern, Switzerland) for an additional 7 days. At day 35, maturing keratinocytes were enzymatically passaged using Accutase onto
0.05mg/mL collagen IV coated dishes. Briefly, after dissociation, cells were collected into a sterile 15mL conical tube in Epilife medium (Invitrogen), and centrifuged for 5 minutes at
180xg. Supernatant was aspirated and cells were resuspended in Epilife medium to be seeded at a density of 5,000 cells/cm2 to freshly prepared 0.05mg/mL collagen IV coated
10cm dishes. Medium regime was switched completely to Epilife medium for the final stages of maturation. iPSC-derived keratinocytes were immunostained using antibodies against
41
Table 2.5. ssODN correction sequence designed for TP63 exon 13.
ssODN used with CRISPR/Cas9 for the correction of TP63 exon 13 mutation
5' TAAAATTTGAGAAAAGTCTAACAGTTACTTACATCCATGGAGTAATGCTCAATCTGA TAGATGGTGGTCAGTCCTTGTGTCGTGAAATAGTCCAGACATGATGAACAGCCCAAGC
GTGCCAAAAAACTGCAGAGGGAGGAGGGAAGAGGAAGGAGGAAACAGAAAAAGA 3'
* Site of corrected mutation is shown in red.
Table 2.6. Primer sets used to screen TALEN-transfected iPSCs.
Primer NameForward Primer 5'-3'Reverse Primer 5'-3'Ampli con (nt)
p63 puro fwd and revGGCCGAAGTTCCTATTCCGAGGCAGCAAATG TTTTCCCAA 1626 P5F and P6RCAACCAAGTGGTGGTGACATGGTGTCTTTCCTGCCTGTGT 189/310/2830
Table 2.7. Primers used to sequence exon 14 of TP63 following clonal selection.
Primer NameForward Primer 5'-3'Reverse Primer 5'-3'Ampli con (nt)
p63 Puro Seq 1230GCTTGTCGACTAAATGTCCGT --- 00 Exon 14 Rev --- CCAGAATCAGAATTAGATGCCAGGT 00
Table 2.8. Primer sets used to screen CRISPR-transfected iPSCs
Primer Name Forward Primer 5'-3' Reverse Primer 5'-3' Amplicon (nt) ssDNA Fwd and X13ss Rev2 TCTGCAGTTTTTTGGCACGC GAATAGCTCCTCTTTCCCACCTTG 378
Table 2.9. Primers used to sequence exon 13 of TP63 following clonal selection.
Primer Name Forward Primer 5'-3' Reverse Primer 5'-3' Amplicon (nt)
X13WT Fwd2 TCACCAGTAATCTCCAGACCTCCAG --- 00 X13WT Rev2 --- CAAGGTGGGAAAGAGGAGCTATTC 00
42
TP63 and keratin 14 prior to being selected for use in downstream experiments. For experiments involving intermediate and terminally differentiated keratinocytes, cells were cultured in CnT-02 medium (CELLnTEC) with a calcium concentration raised to 1.2mM Ca2+.
Phase-contrast imaging was done using a Nikon Eclipse TE3000-S inverted microscope and
Nikon NIS-Elements software (Nikon Instruments Inc.).
Fluorescence Activated Cell Sorting and Analysis
Cells to be sorted were harvested using 0.25% trypsin-EDTA (Invitrogen), collected in defined trypsin inhibitor (Invitrogen) and centrifuged for 5 minutes at 180xg. Cells were then resuspended in phosphate buffered saline (PBS) (Hyclone, South Logan, UT) and passed through a cell strainer into a polystyrene round bottom tube with a cell strainer cap
(Corning, Corning, NY), counted using a hemacytometer, and separated as samples to be stained with a particular antibody or to remain unstained. Samples were then centrifuged for an additional 5 minutes at 180xg to remove culture and collection media. Supernatant was aspirated and cell pellets were resuspended in PBS containing 2% FBS at a concentration of 100,000 cells/100L for antibody incubation. Conjugated antibodies were used at a concentration of 10L/mL (or 10L/1,000,000 cells). Cells were incubated with antibody for
15 minutes at room temperature. Stained samples were then rinsed with 4mL ice cold PBS with 2% FBS, centrifuged for 5 minutes at 180xg, and resuspended in ice cold PBS with 2%
FBS. Samples were sorted through a MoFlow XDP100 machine (Beckman Coulter, Brea,
CA). Sorted cells were collected in culture medium appropriate for the analyzed cell type.
3D Organotypic Culture Model
In order to assess the ability for iPSC-derived keratinocytes to undergo epithelial stratification and express terminal differentiation markers, cells were seeded into 12mm,
0.4m polycarbonate cell culture inserts at a density of 200,000 cells/insert in 400L of CnT-
57 medium (CELLnTEC). Medium was also added to the outside of the inserts to bring the
43 volume to an equal level inside and outside the inserts. Insert cultures were allowed to grow undisturbed for 2 days. On day 3, medium inside and outside of the inserts was gently aspirated and replaced with CnT-3D Prime medium (CELLnTEC). The volume on the outside of the inserts was brought up to the same level as inside. On day 4, the cultures were lifted to the air-liquid interface. Medium inside and outside of the inserts was gently aspirated. CnT-3D Prime medium was then added fresh only to the outside of the insert to an equal level with the bottom of the insert, leaving the interior dry. Fluid changes were performed every two days until between day 15 and day 19. Inserts were then removed from culture, fixed with 4% paraformaldehyde (PFA) (Sigma-Aldrich), and soaked in 70% ethanol overnight at 4oC. Fixed membranes were then excised from the plastic insert wells and
o embedded in wax for tissue sectioning. Cultures were maintained at 5% CO2 and 37 C in a humidified incubator.
Cell Adhesion Assay
iPSC-derived keratinocytes were seeded into two wells of a 0.05mg/mL collagen IV
12-well plate (Corning) and cultured in Epilife medium (Invitrogen) until confluent. Upon reaching confluence, cultures were switched into CnT-02 medium containing 1.2mM CaCl2 to induce calcium-dependent desmosomal plaque formation. After 24 hours, the second well was treated with the p38MAPK inhibitor, SB202190 (Sigma-Aldrich). At 48 hours, to release cell monolayers from the culture surface, wells were rinsed twice with PBS and incubated at
37oC with 5U/mL dispase (Invitrogen) and observed every 5 minutes until detachment.
Detached monolayers and dissociated fragments were carefully rinsed three times with PBS within the culture well. Plates were then placed on a rocker for up to 200 cycles. Imaging was performed immediately following fragmentation using a Leica M165 FC dissecting microscope. Supernatant samples were collected prior to dispase treatment and following mechanical stress for cytotoxicity assessment.
44
Strength of Adhesion Assay
Strength of adhesion was measured using a modified centrifugation assay (Garcia et al., 1998; Christ et al., 2010). Briefly, cells were seeded sparsely to the center-most 24 wells of a 96-well plate coated with 0.05mg/mL collagen IV and allowed to adhere for 4 hours.
Wells were rinsed, refilled with basal culture media and covered with adhesive film prior to centrifugation at 20xg. Cells were counted for 0xg, and again after centrifugation at 20xg.
Following centrifugation, wells were rinsed with 1xPBS, stained with Sirius Red, rinsed again with 1xPBS, and counted using a Nikon Eclipse TE3000-S inverted microscope. The difference between adherent cells prior to, and after centrifugation was calculated for each sample and G-force.
LDH Cytotoxicity Assay
To assess whether or not cytotoxicity played a role in fragmentation during the Cell
Dissociation Assay, lactate dehydrogenase (LDH) enzyme analysis was performed on supernatant samples recovered during the assay. LDH was measured using the Pierce LDH
Cytotoxicity Assay Kit (Thermo Fisher Scientific, Waltham, MA). Measurements were recorded using a Glomax Multi Detection System (Promega, Madison, WI). Protocol was followed according to manufacturer’s instructions. Briefly, 50L of each sample was transferred to a 96-well flat-bottom plate (Corning) in triplicate wells, to include a positive control sample (provided), a deionized water sample, a lysis control sample, and a PBS only sample. 50L of a Reaction Mixture (provided) was added to each well and the LDH reaction was allowed to process for 15 minutes before the addition of STOP Solution.
Measurements were taken at 490nm and 750nm. In addition to the calculations performed on PBS samples collected during the Cell Dissociation Assay, calculations were also performed for dispase samples taken before and after dispase treatment to confirm that the
45 dissociation reagent was not itself cytotoxic. % Cytotoxicity was calculated using the formula below:
% Cytotoxicity = PBS supernatant after shaking - PBS x 100 Lysis control sample
qRT-PCR and Genomic PCR
Total RNA was isolated using an RNeasy Plus Mini Kit (Qiagen). DNA was removed using provided gDNA eliminator columns or by treatment with DNase I (Qiagen) to avoid genomic DNA contamination. First-strand cDNA was synthesized from 1g of total RNA with random hexameric primers using a High-Capacity cDNA Reverse Transcription Kit (Thermo
Fisher Scientific). Quantitative PCR reactions were performed using LightCycler 480 SYBR
Green I Master Mix (Roche, Pleasanton, CA) in a reaction volume of 20L per microwell of a
96 well plate (Roche), and analyzed on a CFX96 Touch System (Bio-Rad, Hercules, CA). All primers were designed either in house or using IDT PrimerQuest Tool
(https://www.idtdna.com) or Roche Universal ProbeLibrary Assay Design Tool
(https://lifescience.roche.com). Each sample was run in triplicate, and three independent technical replicates were run for each biological sample under low or high calcium culture conditions. Results were normalized against basonuclin 1 (BNC1a; a keratinocyte marker,
(Tseng and Green 1994; Boldrup et al., 2012) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as internal reference genes. Relative gene expression was quantified using a 2^-DDCt method. Polymerase chain reactions (PCR) were performed using Taq polymerase (Invitrogen) or Phusion DNA polymerase (Thermo Fisher Scientific) in a total volume of 30L per reaction. PCR products were run on 0.8% to 1.2% agarose gels in Tris/Acetate/EDTA or Tris/Borate/EDTA to separate DNA by electrophoresis. DNA was stained for UV visualization and imaging using the intercalating agent, ethidium bromide.
Primers designed for use in qRT-PCR are catalogued in Table 2.10.
46
Table 2.10. Sequences of primers used for qRT-PCR.
GeneForward Primer 5'-3'Reverse Primer 5'-3'Amplico n (nt)
BNC1aTGGAGGGCTGTAATGCTACCGGTGGAGGTTTAGGTTTGAGC 72 DSC1GTGGGGCAGGGAGATACTGTTGTCCACACAAATACACCTTTTC 93 DSC3CCTTCTAAACTAGAGGCAGACAAAACTGCAGACCTGAAGCACTCTT 67 DSG1TGGCTACATTTGCAGGACAACGGTTCATCTGCGTCAGTAG 86 DSG3CACAACAAATTTTCATGGGTGATCATCTGCATCTGTGGCATT 85 DSP1CCAGAACTCGGACGGCTACATCAAGCAGTCGGAGCAGTT 99 GAPDHAGCCACATCGCTCAGACACGCCCAATACGACCAAATCC 66 ITGA6TTTGAAGATGGGCCTTATGAACCCTGAGTCCAAAGAAAAACC 153 JUPGATCTTCCGGCTCAACACCGATGTTCTCCACCGACGAGT 64 KRT1ATCAATCTCGGTTGGATTCGTCCGCTTGTTGATTTCATCC 130 KRT14CCTCCTCCCAGTTCTCCTCTATGACCTTGGTGCGGATTT 76 LAMA3TGCAAGCGAGTTATGTGGAGCAAGCCTTTATGATCCCGATA 74 LAMB3GAAGATGTCAGACGCACACGCATCAGTGTCGGGGTCTGT 70 LAMC2CAGAAGCCCAGAAGGTTGATACACTGAGAGGCTGGTCCAT 109 PERPGACCCCAGATGCTTGTCTTCACCAGGGAGATGATCTGGAA 79 TP63v4GGTTGGCAAAATCCTGGAGGGTTCGTGTACTGTGGCTCA 119
47
Protein Analysis by Western Blot
Whole cell lysates were generated in Laemmli buffer supplemented with 5% - mercaptoethanol. Samples were aliquoted, heated, and stored at -80oC until use. Proteins were run on 8% polyacrylamide gels through SDS-PAGE, electrophoretically transferred to a polyvinylidine difluoride (PVDF) membrane, blocked with either 5% non-fat milk or 5% BSA in Tris buffered saline with 0.1% Tween 20 (TBST), and blotted with primary antibodies overnight at 4oC. Following primary antibody incubation, membranes were rinsed 3 times in
TBST and incubated with LI-COR fluorescent secondary antibodies (LI-COR Biotechnology,
Lincoln, NE) for one hour at room temperature.
Antibodies were diluted in 5% non-fat milk/TBST or 5% BSA/TBST. The following primary antibodies were used: p63 (rabbit polyclonal, 1:500, Cell Signaling Technology Inc.,
Danvers, MA), p38MAPK (rabbit monoclonal, 1:500, Cell Signaling Technology Inc.), p- p38MAPK (rabbit monoclonal, 1:500, Cell Signaling Technology Inc.), DSG1 (27B2, mouse monoclonal, 1:1000, Novus Biologicals, Littleton, CO), DSC1 (772906, rat monoclonal,
1:1000, R&D Systems), DSG3 (5H10, mouse monoclonal, 1:10, kindly gifted by James
Wahl, University of Nebraska, Lincoln, NE), DSC3 (U114, mouse monoclonal, 1:1000,
Fitzgerald Industries Intl, Acton, MA), ERK1/2 (rabbit monoclonal, 1:500, Cell Signaling
Technology Inc.), p-ERK1/2 (rabbit monoclonal, 1:500, Cell Signaling Technology Inc.) JUP
(PG5.1, mouse monoclonal, 1:300, Fitzgerald Industries Intl) KRT1 (guinea pig polyclonal,
1:500, a kind gift from Dennis Roop, University of Colorado Denver, Denver, CO). Relative protein amounts were normalized against -Actin (AC-15, mouse monoclonal, 1:16000,
Abcam, Cambridge, MA). Protein band intensities were imaged using a LI-COR Odyssey Fc
Imaging System (LI-COR Biotechnology), and quantified using ImageJ analysis software
(https://imagej.nih.gov/).
48
Histology and Immunocytochemistry
AEC patient skin biopsies were fixed overnight in formalin before being transferred to
70% ethanol. Sections were then dehydrated, cleared, and embedded on-edge in Paraplast
(Sigma-Aldrich) and paraffin wax. Processed samples were sectioned at 4m, and slides were baked at 60oC for 15 minutes. iPSCs and plated EBs prepared for pluripotency and spontaneous differentiation staining were fixed for 18 minutes in 4% PFA in PBS, rinsed three times with PBS, permeabilized with 0.5% saponin (Sigma-Aldrich) in PBS for 15 minutes, and blocked for 45 minutes with 6% NGS (Invitrogen) in PBS. Post-differentiation iPSCd keratinocytes stained for keratinocyte marker expression and desmosomal plaque assembly were fixed in ice-cold methanol (Sigma-Aldrich) for 5 minutes, rinsed three times with PBS, and blocked for 45 minutes with 6% bovine serum albumin (BSA) (Thermo Fisher
Scientific) in PBS. Samples were incubated with primary antibodies overnight at 4oC.
Following primary antibody incubation, cells were washed three times with 0.01% Tween 20, and 1% normal goat serum (NGS) (Thermo Fisher Scientific) or BSA in PBS, and were incubated for one hour with secondary antibodies at room temperature.
Antibodies were diluted in 3% NGS or 3% BSA in PBS. All cell culture staining was performed in glass bottom or Permanox chamber slides (LABTEK, Scotts Valley, CA) coated with Matrigel (BD Biosciences) or 0.05mg/mL collagen IV. Primary antibodies used are as follows: SSEA-3 (MC-631, rat monoclonal, 1:100, R&D Systems), TRA-1-60 (TRA-1-60, mouse monoclonal, 1:500, Chemicon, Billerica, MA), and NANOG (rabbit polyclonal, 1:500,
Abcam) for pluripotency; a-SMA (1A4, mouse monoclonal, 1:500, Sigma-Aldrich), Tuj1
(rabbit polyclonal, 1:1000, Sigma-Aldrich), and AFP (rabbit polyclonal, 1:500, DAKO, Santa
Clara, CA) for spontaneous differentiation; p63 (rabbit polyclonal, 1:100, Cell Signaling
Technology Inc.), DSC3 (U114, mouse monoclonal, 1:10, Fitzgerald Industries Intl), DSG1/2
(DG3.10, mouse monoclonal, 1:10, RDI, Flanders, NJ), DSG3 (5H10, mouse monoclonal, undiluted, James Wahl), DSP1/2 (mouse polyclonal, 1:10, RDI), JUP (PG5.1, mouse
49 monoclonal, 1:100, Fitzgerald Industries Intl), KRT1 (guinea pig polyclonal, 1:50, Dennis
Roop), and KRT14 (guinea pig polyclonal, 1:75, Dennis Roop) for epidermal differentiation and desmosomal plaque formation. Imaging was performed using a Nikon Eclipse 90i upright microscope and Nikon NIS-Elements software v3.10.
Statistical Data Analysis
When comparing two independent data sets in analyzing quantitative measurement data, the ‘Student’s’ t-test (unpaired) was used. A one-way ANOVA test was used to compare means between unrelated groups. Statistical significance was defined at P<0.05.
Statistical analyses were performed using GraphPad statistical software (GraphPad
Software Inc., La Jolla, CA).
50
CHAPTER III
DEVELOPMENT OF AN IPSC-BASED DISEASE MODEL FOR AEC
Introduction
Ankyloblepharon ectodermal dysplasia and clefting (AEC) arises most often due to mutations within a region of TP63 coding for a sterile--motif (SAM) domain, and is associated with severe skin fragility as a result of defects in either keratinocyte proliferation, differentiation, or adhesion. In this research, we aimed to tease out which of these particular functions is responsible for contributing to the AEC erosional skin phenotype. In order to investigate the pathogenesis of AEC, a faithful model which can accurately represent the disorder must be developed, or a consistent source of patient tissue must be made available.
Due to biological differences between mouse and human skin, mouse models developed to study the developmental defects associated with AEC do not fully recapitulate the phenotype as it is expressed in human patients. Ideally, primary keratinocytes isolated from AEC patient tissue would be used to study the disorder in vitro. Unfortunately, while epidermal stem cells are able to be carried in culture and can give rise to intermediate-stage differentiated or transit-amplifying cells of the same lineage, with current methods, only a limited percentage will retain stem-like, proliferative properties, and their expansion potential in vitro is still finite. A large amount of starting material would be necessary to overcome these limitations. Since AEC is a relatively rare disorder, source tissue in the amount required to conduct extensive research is not readily obtainable, and the amount of keratinocytes which could be derived from a small tissue punch would not be adequate for conducting comprehensive transcriptomic, proteomic, or functional studies.
With the advent of induced pluripotent stem cell (iPSC) technology (Takahashi et al.,
2007; Masaki et al., 2007), it has become possible to generate patient-derived, disease- specific pluripotent stem cells, capable of both self-renewal, and differentiation into
51 essentially any cell type in the body (Thomson et al., 1998; Reubinoff et al., 2000; Yu et al.,
2007; Lowry et al., 2008; Park et al., 2008). This constitutes a major advantage where a large quantity of starting material is necessary for comprehensive investigation, or where in vitro cultures of adult tissue from complex organ systems are difficult to maintain, or where patient tissue is not readily accessible.
Additionally, with recent advances in genome-editing technologies such as TALEN
(Zhang et al., 2011; Miller et al., 2011) and CRISPR/Cas9n (Cong et al., 2013; Mali et al.,
2013a; Ran et al., 2013a), the possibility of utilizing one of these methods to effect homologous recombination in mammalian cells to correct the causative gene mutation has become more practicable. Indeed, gene-corrected AEC patient iPSCs may hold some value from a translational perspective as proof-of-concept for the potential to generate healthy iPSC-differentiated tissue to be used in therapeutic applications. More significant, however, to the research presented in this thesis, is that these two technologies together present a highly versatile and powerful combined tool option for modeling AEC in a physiologically relevant and disease-specific in vitro system.
Towards this regard, gene-corrected iPSC lines from AEC patients could serve as healthy, genetically matched counterparts to AEC affected cell lines, differing genetically only at the site of mutation. Using these conisogenic cell lines as controls instead of genetically unrelated controls when comparing affected and healthy cells would help to avoid undesirable background effects which would be present due to genetic variability. This is arguably necessary, as any introduced background variability could affect the phenotype.
Similarly, the use of genetically matched controls would avoid genetic background variability when striking comparisons between AEC patients harboring different mutations, as it is quite possible that various mutations throughout exon 13 and exon 14 of TP63 could subtly manifest in different ways (Rinne et al., 2007).
52
In order for this model to be effective in studying the skin phenotype associated with
AEC, gene-corrected and patient iPSCs would need to be able to differentiate into functional keratinocytes, the affected cell type. Already, human keratinocyte differentiation has been achieved with ESCs through treatment with retinoic acid (RA) and bone morphogenetic protein 4 (BMP4) (Metallo et al., 2008; Guenou et al., 2009), a method that has been successfully repurposed for use in the iPSC system (Itoh et al., 2011; Petrova et al., 2014).
Keratinocytes raised using these methods express TP63 and KRT14, and possess the ability to form a functional keratinized stratified epithelium in vitro, characterized by the upregulation of later-stage keratinocyte differentiation genes such as KRT1, IVL, and LOR
(Metallo et al., 2008; Guenou et al., 2009; Itoh et al., 2011; Petrova et al., 2014).
One of the main goals of this project is the development of a robust human patient- based model which can be used to elucidate the disease-mechanisms underlying the pathogenesis of AEC. The overall research plan is to compare transcriptional and functional differences observed between AEC patient iPSC-derived keratinocytes and gene-corrected
AEC patient iPSC-derived keratinocytes in order to identify causative links between mutations in TP63, and the skin fragility phenotype associated with AEC. For these reasons, the ability to successfully differentiate and culture AEC patient, as well as gene-corrected keratinocytes for use in studying functional defects occurring in the TP63-AEC system is the aim of this part of the project. Until recently, the development of such a model was not feasible. This chapter describes a physiologically relevant, disease-specific model to be used to investigate the mechanisms underlying the pathogenesis of AEC.
Results
Fibroblast isolation and genotype. Tissue biopsy samples were received from 7
AEC patients and 2 familial controls and prepared as detailed in Materials and Methods.
Fibroblast isolation was successful for each patient and donor sample, and fibroblast stocks as well as the original tissue pieces were cryopreserved for each donor and patient within
53 four weeks of accession. DNA for each patient fibroblast line was prepared and genotyped as detailed in Materials and Methods. Missense mutations were detected in either exon 13 or exon 14 for all of the AEC patients, while no causative mutations were detected in TP63 in familial control or commercial control fibroblast samples (Fig 3.1).
iPSCs generated from patients with AEC. One control fibroblast line (Millipore
SCC058) and four patient fibroblast lines (AEC1, AEC2, AEC3, AEC4) were selected for iPSC reprogramming. Selection criteria were based on patient history with the diagnosis of skin erosions during the patient’s life. As an additional point of consideration, since the conformation and functionality of the TP63 SAM and TID domains could be differentially affected as a result of mutations arising at different sites, two patients were deliberately selected to represent mutations in exon 13, and two to represent mutations in exon 14. To reiterate, since mutations occurring at different sites within the coding regions for the SAM and TID domains of TP63 would presumably lead to subtle differences in TP63 functionality, we chose to compare cells from individuals harboring mutations in distinct regions to facilitate the identification of shared defects likely to contribute to the AEC skin phenotype.
Within the first few days following infection, cells began to exhibit a noticeable shift from the classic spindle-like fibroblast morphology (Fig 3.2a) to that of a more rounded ESC- like morphology featuring a prominent nucleus. ESC-like colonies of between 10 and 20 cells in size began to emerge between day 5 and day 6 for each infected cell line (Fig 3.2b), and in some instances, transduced cells began to form multiple colonies adjacent to or overlapping one another, so much so, in fact, that it became difficult to discern the origin or entirety of any one colony. Three days after reseeding the transduced cells, the presence of individual ESC-like colonies of between 20 and 30 cells again became apparent. Emerging putative iPSC colonies had grown large enough to manually passage between day 14 and day 18 in order to begin expansion and characterization. To maintain clonality, only isolated colonies (i.e., not fused with other emergent colonies) were selected for transfer.
54
a
Location of Mutation Exon Base Change Amino Acid Change
I537T 13 T/C I/T F513S 13 T/C F/S F526L 13 C/G F/L
Location of MutationExonBase ChangeAmino Acid Change
*R598L 14 G/TR/L P551L 14 C/TP/L D601V 14 A/TD/V *R598L 14 G/TR/L
b
Figure 3.1. TP63-AEC mutations detected in AEC patient fibroblasts. (a) Missense mutations were detected for AEC patients in either exon 13 or exon 14 of TP63. (b) Schematic illustrating the location of each mutation. * Two patients were found to carry the same mutation.
55
a
b
Figure 3.2. Sendai transduced fibroblasts. (a) Patient derived fibroblasts prior to transduction. (b) Sendai (SeV) transduced fibroblasts begin to show signs of colony formation by day 6 post-infection. Scale bars, 100m.
56
Three days after reseeding the transduced cells to newly prepared culture wells, the presence of individual ESC-like colonies of between 20 and 30 cells again became apparent. Emerging putative iPSC colonies had grown large enough to manually passage between day 14 and day 18 in order to begin expansion and characterization. To maintain clonality, only isolated colonies (i.e., not fused with other emergent colonies) were selected for transfer.
Characterization of iPSCs. Characterization assays were carried out between 8 and 12 passages after colonies were first “picked” from induction wells. This delay was observed to allow time for the Sendai virus used during reprogramming to be completely removed as detected by PCR (Fig 3.3). Putative iPSC clones selected for characterization were ESC-like in cell and colony morphology, and cells within the colonies exhibited a high nuclear to cytoplasmic ratio characteristic of pluripotent cells (Fig 3.4). There was no evidence of revertant (to fibroblast) cells or grossly differentiating growth-zones within the cultures.
Colonies which were fixed and immunostained for pluripotency defining markers exhibited positive expression for NANOG, TRA-1-60, and SSEA-3 (Fig 3.4). This was complemented by high gene expression levels of pluripotency genes POU5F1, NANOG,
FOXP1, SOX2, LIN28, and TERT, by qRT-PCR when compared to normal healthy human iPSCs (Fig 3.5). Putative iPSCs for each line were also capable of forming embryoid bodies
(EB) (Fig 3.6) and spontaneously differentiating into cells representative of the three primary developmental germ layers: endoderm, mesoderm, and ectoderm (Brivanlou et al., 2003)
(Fig 3.6). Chromosome counts were also performed for each selected cell line to confirm genetic stability; that they are free of mosaic triploidy (e.g., chromosomes 12, 17, or X) which can occur randomly or as a result of selection pressures during in vitro cell culture
(Draper et al., 2004; Mitalipova et al., 2005).
57
Figure 3.3. iPSCs are cleared of reprogramming vector sequence. PCR using primers specific to sequence within the Sendai vectors used during reprogramming was done for putative iPSCs. Between P8 and P12, Sendai virus was absent in all clones tested.
58
Fig 3.4. iPSC colonies can be established from AEC fibroblasts. iPSCs produced from an AEC patient carrying a mutation in exon 13 of TP63 (AEC 1) and from an AEC patient carrying a mutation in exon 14 of TP63 (AEC 2). iPSCs produced for both patients are positive for the pluripotency markers NANOG, TRA-1-60, and SSEA-3. Scale bars, 100m.
59
7
6
5
4 hiPSC 07
AEC 1 3 AEC2
2
1
0 POU5F1 NANOG FOXP1 SOX2 LIN28 TERT
Fig 3.5. AEC iPSCs are similar to normal iPSCs in expression of pluripotency genes. AEC patient iPSC lines express pluripotency markers POU5F1 (OCT3/4), NANOG, FOXP1, SOX2, LIN28, and TERT to a comparable degree with unaffected human iPSCs. This analysis was done by qRT-PCR.
60
AEC AEC
EBs
AFP
-SMA
TUBB3
Figure 3.6. AEC patient iPSCs differentiate into cells of the three embryonic germ layers. iPSCs for patients AEC1 and AEC2 are capable of forming embryoid bodies (EB) and spontaneously differentiating into cells expressing the endoderm marker, -fetoprotein (AFP), mesoderm, -smooth muscle actin (-SMA), and ectoderm, -tubulin III (TUBB3). Scale bars, 100m.
61
Transfection and clonal selection of iPSCs. Before transfection of TALENs and
CRISPRs into iPSCs it was imperative to identify a method which would offer the highest transfection efficiency and survival, as iPSCs are notoriously resistant to transfection and infection, as well as to genetic modification. Multiple lipid transfection reagents were tested with a pMAX-GFP expression plasmid (Lipofectamine, Invitrogen; Fugene6, Roche; TransIT-
HeLaMONSTER, Mirus Bio, Madison WI), however expression of GFP was only observed at the edges of iPSC colonies using these reagents. A more efficient method was found using
Lonza’s Nucleofection kits. Two kits and 12 programs were tested. 3 programs effected transfection between 40% and 50% (Fig 3.7).
While iPSCs were dissociated to single cells during transfection, they were reseeded densely, with no overt threat to recovery or survival. Culturing cells after selection was more challenging as cells necessarily needed to be seeded sparsely to initiate clonal expansion.
For deriving viable single cell iPSC clones after transfection with either TALENs or
CRISPRs, the method developed to overcome the problem of apoptosis relied first on the ability for the Rho-associated kinase inhibitor, Y-27632, to prevent apoptosis in dissociated human pluripotent cells (Watanabe et al., 2007), and hinged on the idea that E-cadherin as well as integrin complexes 61, 51, and v5 are expressed in hESCs ( Xu et al., 2010,
Nagaoka et al., 2006; Braam et al., 2008; Miyazaki et al., 2008; Vuoristo et al., 2008;
Rowland et al., 2010). E-cadherin is important in maintaining cell-cell adhesion in human pluripotent cell colonies, and these particular integrin receptors are important in mediating adhesion to laminin, fibronectin, and vitronectin respectively (Ruoslahti et al., 1991). E- cadherin and integrin signaling have also been shown to regulate each other through the modulation of Rho activity in hESCs (Xu et al., 2010).
The Matrigel which was used as a substrate is a mixture of ECM proteins standardly derived from the Engelbreth-Holm-Swarm mouse sarcoma cell line. This mixture includes laminin, fibronectin, and vitronectin, among other proteins. However, Matrigel as a substrate
62
Figure 3.7. iPSCs can be successfully transfected using nucleofection. With the efficiencies of using TALEN and CRISPR to effect homologous recombination being low in iPSCs, it was important to start with an efficient method for transfection. Phase contrast images of iPSCs 2 days after being transfected as single cells using nucleofection. Cells were seeded densely as single cells and have come together to form colonies. GFP expression in transfected iPSCs indicates that they can be transfected to approximately 40% to 50% efficiency through multiple nucleofector programs. Scale bars, 50m.
63 alone did not seem to adequately support the adhesion and growth of sparsely seeded pluripotent stem cells. For this reason, Matrigel was supplemented with 10% ESQ-FBS in an effort to increase the concentrations of fibronectin and vitronectin which are present in serum. After supplementation, cells were able to adhere and grow into colonies.
Out of all surviving cells which had formed colonies, 25% had maintained ESC-like morphology, 75% had begun to differentiate. This could be either be due to the possibility that cells which were already likely to differentiate adhered and survived more successfully than pluripotent cells. Conversely, the differentiation could have occurred as a result of being isolated in culture. Although it was ES-qualified (leads to less differentiation) for use with pluripotent cells, the observed differentiation in some of the clonal colonies could also have been the result of growth factor signaling from other proteins introduced along with the added FBS.
TALEN-mediated genetic correction of TP63-AEC. The TALENs and targeting strategy used to edit the AEC-mutation in exon 14 were designed at Cellectis (Paris,
France) using proprietary Custom TALEN Hit search software (Cellectis) to determine relevant genomic sequence which would be feasible to target in exon 14 of TP63. Briefly, two TALENs were designed to target TP63 using a dimeric FokI nuclease approach (Fig
3.8). This dual TALEN strategy implements one important design feature which requires
DNA binding of both TALENs in close enough proximity for the FokI monomers to dimerize and cleave DNA (Wah et al., 1997; Bitinaite et al., 1998; Cermak et al., 2011). Since both
TALEN units were designed to be sequence specific, the possibility that they might both bind at more than one site throughout the genome is highly unlikely (Mussolino et al., 2011), dramatically reducing the chance that non-target cleavage would occur.
After DNA cleavage occurs at a target site, DNA can be repaired through a non- homologous end joining mechanism (NHEJ), or by homology directed repair (HDR). Either event can occur, and repeatedly. In order to reduce the chances of this occurring when a
64 a
b
Figure 3.8. TALEN plasmid maps. Plasmid maps showing standard features of TALEN plasmid (pTAL.CMV-T7) to include TALEN repeat variable diresidue (RVD) binding sequence. Transcription can be driven either by CMV or T7 promoters. (a) Right arm TALEN containing N-terminal S tag and (b) Left arm TALEN containing N-terminal HA tag. Two separate TALE-nucleases (with FokI cleavage domain) are required to cleave DNA in order to increase target specificity.
65 substitution is desired, a donor plasmid was co-transfected along with TALENs to introduce a template for homologous recombination. This donor plasmid was derived from endogenous TP63 sequence to which silent mutations were introduced in order to prevent repeat TALEN binding and DNA cleavage (and NHEJ). These silent mutations also provide a sequence that can be used to screen for positive clones (Fig 3.9). For the TALEN approach, a floxable thymidine kinase-puromycin resistance (TK-Puro) selection cassette was designed into the donor plasmid to facilitate selection of iPSCs (Fig 3.10). An overview of the strategy is provided in Figure 3.11.
In order to detect whether or not recombination had occurred in selected iPSCs, a forward PCR primer was designed over bacterial sequence that would be introduced with the cassette to be used with a reverse designed over endogenous TP63 sequence. This ensured that the diagnostic fragment would only be amplified through PCR if donor sequence had successfully integrated at the designated site (Fig 3.12a). A second set of primers were designed surrounding the floxable regions to confirm Cre-recombinase mediated excision of the cassette. There are three possible diagnostic fragments expected as a result from this screen. The amplification of these fragments would indicate whether a) homologous recombination had occurred but the cassette was still present, b) successful excision had occurred and the selection cassette is no longer present, and c) whether one or both alleles had been modified during homologous recombination, as evidenced by the presence or absence of a fragment indicative of endogenous sequence. The only reason for the absence of this fragment would be if homologous recombination had occurred on both alleles (Fig 3.12b).
TALEN activity, as evaluated by a CEL1 mismatch cleavage assay, was decidedly too low to feasibly identify positive clones. The use of a selection method was necessary. It is not certain whether the lower efficiency observed in iPSCs was a result of lower overall transfection efficiency, or a lower efficiency of homologous recombination, or cell survival in
66
Figure 3.9. Donor plasmid correction sequence. The design of the donor plasmid intended to correct the AEC mutation in TP63 exon 14 for AEC 1 patient included a number of features to increase efficiency and also to be useful during screening. First, restriction sites were added by PCR in order to be able to clone the donor sequence into the expression plasmid (1 and 9). Multiple sites were mutated simultaneously using four primers designed to introduce silent mutations to be used in screening (2 and 8) as well as to prevent TALENs from binding after homologous recombination had occurred (3 and 5). TALEN binding sites that were to acquire these silent mutations are emboldened (4 and 6). These sites also allow the screening of clones by PCR to identify whether donor sequence is present in the target genome indicating homologous recombination had occurred, and at the target site. The point of mutation is confirmed and guanine is retained (7).
67
ta ca
CTCAAGGCTGTGCCTTT
floxable A grey). n
taacttcgtataatgtatgctatacgaagtt
ca
ACACAGGCAGGAAAGACAC
GACTAAATGTCCGTTTTTCTCCCTGTTTTCATTCTCC
c . A second set of primers was was primers of set second A .
green, (TK in PGK a promoter by
TP63 actagttctaga
Cre-recombinase mediated ollowing
orward primer was sufficient (highlighted (highlighted sufficient was primer orward
ecombinase activity (highlighted in green). green). in (highlighted activity ecombinase ggaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcccccg
enous
primer lies within bacterial sequence sequence bacterial within lies primer
TAGAGACTAAGTGAAGTGTTCT The donor plasmid used as a correction template template correction a as used plasmid donor The
CGAGATGAGTGGAATGACTTCAACTTTGACATGGATGCTCGCCGCAATAAGCAACAGCGC
a agttcctattctctagaaagtataggaactt
written is mutation in AEC1 the for nucleotide correct he es as one of the loxP sites will remain (loxP sites in red). PCR PCR red). in sites (loxP remain will sites loxP the of one as es
ggccgaagttcctattccga TTTACCAATGAAGAAACTGAGGCCAG
ctctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactccc
TGTTATTGATGCTGTGCGATTCACCCTCCGCCAGACCATCTCTTTCCCACC G
aagcttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggtctcgcacattcttcacgt
ATCTGGCAAGTCTGAAAATCCCTGAGCAATTTCGACATGCGATCTGGAAGGGCATCCTGGACCACCGGCAGCTCCACGAATTCagCTCCCCTTCTCATCTCCTGCGGACCCCAAGCAGTGCCTCT
included an 818 base 5’ homology arm, and a 1437 base 3’ homology arm (highlighted i (highlighted arm homology 3’ base 1437 a and arm, homology 5’ base an 818 included
TCCATTAATACCTTTCTTCTAGTGACTAGCCAGGTAAATTCAAGCATAAGTAcgggccccccctcgaggtcgagacggtatcgatggcgcggaattcaaaaagtttaaacaaaaaaggcgcgc
AEC exon 13 exchange matrix and screening strategy. screening and matrix exchange 13 exon AEC
GCCTCACCATGTGAGCTCTTCCTATCCCTCTCCTAACTGCCAGCCCCCTAAAAGCACTCCTGCTTAATCTTCAAAGCCTTCTCCCTAGCTCCTCCCCTTCCTCTTGTCTGATTTCTTAGGGGAAGGAGA
TP63
TP63- . .
CCTGGAAAAGGAATGTGACCTAAATTTGGGGAACTTCATTAGTATCCCCATAACATGCAAAAATGAGGTAACAATACAACATAATAATAATACAAATGGTTAATATTTATAGAGTGTGTTGTAATTTATAAAATACTTTCATAG
CAACCAAGTGGTGGTGACAT
cctgcagggcggCCTCATGTTTCTATTTGGGATTTTTGCCCTCTCATCTAGCTATTATCCCAAT
blue). Exon 14 in purple. Yellow regions highlight silent mutations. T mutations. silent regions highlight Yellow purple. 14 in blue). Exon
A third set of primers were designed to be used for sequencing candidate f The candidate clones. sequencing for used be to designed were primers of set A third
designed to detect whether the cassette had been successfully excised following Cre-r excised successfully been had the cassette whether detect to designed
surrounding the cassette (highlighted in white), and the reverse primer lies in endog in primer reverse lies the and white), in (highlighted cassette the surrounding
primers were designed to confirm integration at the target site where the forward forward the where site target the at integration confirm to designed were primers
excision. This leaves behind a “flox scar” of approximately 34 bas approximately of scar” “flox a behind This leaves excision.
puromycin resistance in blue). loxP sites surrounding the cassette facilitate its removal f removal its facilitate the cassette surrounding sites blue). loxP in resistance puromycin
cassette was designed to include a thymidine kinase-puromycin resistance fusion gene driven driven gene fusion resistance kinase-puromycin thymidine a include to designed was cassette
Figure 3.10 Figure green, highlighted in white (G/T substitution). substitution). (G/T white in highlighted green, for exon 14 of 14 of exon for
GTGCTTAGTTCCATAGAGTTGAAGACTCAGAGAACTAATTTTATTTTCTAATTTGTGGATCAATAGATTCAGATCAATTAAACCAGAGCATCAGGGAATGATAGGATGCTGT actagt CTGTATTTACCTATGAGTCTATAGCATCTTTTGCCCTATAAAGCAATTGTATCTCATTTTACCAAAGAAGAAACTGAGGCTGGTAGAGAATAAGTGACTTGCTGAAGTTCTATAGCCAGTCAGTGACCATCAAAACCTCTGCCACAGTTT TCTCACTCCAAGCACAATGTGCTGTTTACCTACCATTCcGCCCTGTGAAAATATGAGCTATCACTGAAACAATCTAAAGAAGAGCTAACGCAGATAAATGTAAGTGATATCACCACAGTCAGTTAAGGTTGACCCTATTTGCAATGCCTT CTGCACCCATTCACAGAACATAGACACAGTTGCTCTGCATTTTGATACCTTGCTTTATTCAAACACCAAGAGACCTTTTAGATAAAAGTGCCGTTTCAGGTTCTGAGGATGCCCTAAGTCCCTAATTTTTTCACTTAGTTATGTGACTTT AAACTTGTCAACCTCTCTGGCCTTCAGTTGTTCTATCTATAAAACAGGTCTAATAATGTTTACCACTAATCTGGGGATTAAATGATATCATGAATATAAAATAATTCAGGGCCTGGCACATAGAAAGTACTCAATCTTTTCTTCTCATCT CCT acttcgtataatgtatgctatacgaagttat tctgaggcggaaagaaccagctggggctcgagatccactagttctagcctcgaggctagagcggcc at ATGACACCTTCCCCTGTTGCACAGG ACAGTttccGTGGGCTCCAGTGAGACCCGGGGTGAGC ATCAAAGAGGAGGGGGAGTGA AGTAAGAGGCTACCTCTTACCTAACATCTGACCTGGCATCTAATTCTGATTCTGGCTTTAAGCCTTCAAAACTATAGCTTGCAGAACTGTAGCTGCCATGGCTAGGTAGAAGTGAGCAAAAAAGAGTTGGGTGTCTCCTTAAGCTGCAGA GATTTCTCATTGACTTTTATAAAGCATGTTCACCCTTATAGTCTAAGACTATATATATAAATGTATAAATATACAGTATAGATTTTTGGGTGGGGGGCATTGAGTATTGTTTAAAATGTAATTTAAATGAAAGAAAATTGAGTTGCACTT ATTGACCATTTTTTAATTTACTTGTTTTGGATGGCTTGTCTATACTCCTTCCCTTAAGGGGTATCATGTATGGTGATAGGTATCTAGAGCTTAATGCTACATGTGAGTGACGATGATGTACAGATTCTTTCAGTTCTTTGGATTCTAAAT ACATGCCACATCAAACCTTTGAGTAGATCCATTTCCATTGCTTATTATGTAGGTAAGACTGTAGATATGTATTCTTTTCTCAGTGTTGGTATATTTTATATTACTGACATTTCTTCTAGTGATGATGGTTCACGTTGGGGTGATTTAATC CAGTTATAAGAAGAAGTTCATGTCCAAACGTCCTCTTTAGTTTTTGGTTGGGAATGAGGAAAATTCTTAAAAGGCCCATAGCAGCCAGTTCAAAAACACCCGAC TTGGGAAAACATTTGCTGCC
cgacctggcgcgcacgtttgcccgggagatgggggaggctaactgag
ggacgtcttggccaaacgcctccgtcccatgcacgtctttatcctggattacgaccaatcgcccgccggctgccgggacgccctgctgcaacttacctccgggatggtccagacccacgtcaccacccccggctccataccgacgatctg
ttcggggacggccgtgccgccccagggtgccgagccccagagcaacgcgggcccacgaccccatatcggggacacgttatttaccctgtttcgggcccccgagttgctggcccccaacggcgacctgtacaacgtgtttgcctgggcctt
acacatcgaccgcctggccaaacgccagcgccccggcgagcggcttgacctggctatgctggccgcgattcgccgcgtttacgggctgcttgccaatacggtgcggtatctgcagggcggcgggtcgtggcgggaggattggggacagct
ccgccatcccatcgccgccctcctgtgctacccggccgcgcgataccttatgggcagcatgaccccccaggccgtgctggcgttcgtggccctcatcccgccgaccttgcccggcacaaacatcgtgttgggggcccttccggaggacag
atcggccggggacgcggcggtggtaatgacaagcgcccagataacaatgggcatgccttatgccgtgaccgacgccgttctggctcctcatatcgggggggaggctgggagctcacatgccccgcccccggccctcaccctcatcttcga
aaccaccaccacgcaactgctggtggccctgggttcgcgcgacgatatcgtctacgtacccgagccgatgacttactggcaggtgctgggggcttccgagacaatcgcgaacatctacaccacacaacaccgcctcgaccagggtgagat
ccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgccggatccatgcccacgctactgcgggtttatatagacggtcctcacgggatggggaa
tgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccagccatgg caaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacct
cagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcagggcgcgccgagagcagcggccgggaaggggcggtgcgggaggcggggtgtggggcggtagtgtgggcTctgttcc cgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcc
ccgttcgcagcgtcacccggatcttcgccgctacccttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtctcactagtaccctcg ggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgacccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcgga actgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggct
68
he he
Red caps. all in is 14 sequence exon
RVD TALEN signed over reside to .
TP63 rrection. Orange underlined sequence in t in sequence underlined Orange rrection.
strategy. correction and 14 target xon site e
AEC
TP63-
f
correction sequence represents silent mutations in the template sequence intentionally de intentionally sequence template the in mutations silent represents sequence correction
Figure 3.11. Overview o Overview 3.11. Figure target sites. Green underlined sequence represents the healthy replacement nucleotide replacement the healthy represents sequence underlined Green sites. target for co mutation the AEC identifies sequence underlined Red cutsites. indicate arrows
69 a b
c
Patient AEC 1 Corrected
Figure 3.12. Screening and sequencing gene-modified clones for patient AEC1. A TALEN approach was used to correct the TP63 exon 14 gene-mutation in patient AEC1. (a) Initial screening by PCR relied on a forward primer specific for donor sequence to be used with a reverse primer designed to bind endogenous TP63 DNA. The resulting fragment if homologous recombination had occurred is 1626 bp. (b) Second level screening was performed following Cre-mediated excision of the selection cassette. An unsuccessful excision would be indicated by a 2830 bp fragment. The successful excision of the selection cassette is evidenced by a 310 bp fragment with minimal leftover foreign genetic material. Endogenous sequence produces a 189 bp fragment. Normal human epidermal keratinocytes (NHEK) were used as a control that does not contain foreign DNA. (c) Successful homologous recombination and gene-correction for the causative AEC mutation in patient AEC1 was determined by sequencing exon 14 of the TP63 gene.
70 iPSCs, as pluripotent stem cells are highly sensitive to DNA damage (Liu et al., 2014).
Through using the TALEN-mediated editing approach, we were able to identify clones that had successfully undergone homologous recombination (Fig. 3.12c). Although, out of 261 clones carried and screened post-selection, only 19 (7.3%) had incorporated the selection cassette (as determined using additional primer sets to sequence the entire region). Subsequent sequence analysis revealed that out of those 19 clones, only 5 had also incorporated the gene correction on the mutant allele (26.3%) resulting in an overall efficiency of 2.0%. Gene-corrected cell lines resulting from this approach for patient AEC1 are designated GC1.
CRISPR-mediated genetic correction of TP63-AEC. The CRISPR plasmids and strategy used to edit the AEC-mutation in exon 13 were designed by Dr. Jiangli Chen.
Briefly, and in a similar approach to that taken for the TALEN-mediated gene-modification strategy, two separate single guide RNA (sgRNA) constructs were designed to target TP63 and perform single strand cleavage using a modified Cas9 enzyme (Cas9-D10A) (Fig 3.13) which has been mutated so that it can only cut one strand of DNA (Jinek et al., 2012; Mali et al., 2013b; Ran et al., 2013b). Because two sgRNAs are used together specifically designed to target sites within close proximity, this modified Cas9n is capable of placing two nicks close enough together to lead to DNA breakage, leaving staggered ends as opposed to the blunt ends normally caused by Cas9 (Zuo and Liu, 2016). As intended with the TALEN approach, this dual target site requirement greatly decreases the rate of unwanted off-target cleavage (Ran et al., 2013b). gRNAs were cloned into empty Cas9n-Puro CRISPR vectors under a U6 promoter, and a 168 bp single-stranded oligodeoxynucleotide (ssODN) correction template was designed as described in Materials and Methods. As in the TALEN strategy, template DNA was also designed to include silent mutations to prevent further targeting after recombination (Fig 3.14). Off-target site prediction was done using CRISPR
Design software (crispr.mit.edu).
71
Figure 3.13. Cas9n plasmid map. Plasmid map showing standard features of the Cas9n plasmid (Cas9n(BB)-2A-puro) used. The main features include a U6 promoter for sgRNA expression and a CAG promoter driving expression of a Cas9 nickase-T2A-puromycin cassette. Two separate plasmids are required each carrying a separate sgRNA. Cas9n(BB)- 2A-Puro plasmid was donated by Feng Zhang, Addgene plasmid #62987.
72
Using the CRISPR approach was less cumbersome than the TALEN approach.
However, this could be due in some part to the fact that the CRISPRs were transfected in along with a small ssODN as the template for gene-correction. A similar approach was taken for CRISPRs as was for TALENs in that a PCR-based screen was used following selection.
In this case, one PCR primer was designed to bind over silent mutations introduced through homologous recombination. The complementary primer was designed in endogenous TP63 sequence outside of the range of the template ssODN. Amplification of this diagnostic fragment indicated that indeed, homologous recombination did occur at the target site (Fig
3.15a). However, out of 283 clones carried post-selection using the CRISPR method, only
81 were found to have integrated the correction sequence (28.6%). Out of those 81 clones, sequence analysis revealed that only 9 had undergone clean homologous recombination on the appropriate allele (11.1%) (Fig 3.15b). Notably, after using the CRISPR approach it was found that many of the positive selected clones had also acquired insertions or deletions at the target site. This is most likely due to a high level of Cas9 activity and DNA repair through
NHEJ, which is prone to error and often the cause of indels when employing CRISPR/Cas9 for genome modification. Overall, the efficiency out of 283 clones carried was 3.2%. Gene- corrected cell lines resulting from this approach to correct mutations in exon 13 for patients
AEC2 and AEC3 are designated GC2 and GC3 respectively (Table 3.1).
AEC patient iPSCs can differentiate into functional keratinocytes. Differentiation of keratinocytes from pluripotent stem cells has already been successfully attempted in
ESCs, and repeated in iPSCs, however, no protocols have been standardized as of yet.
Most previously published methods employ a strategy of introducing morphogens or growth factors to culture media at various intervals and concentrations in efforts to direct differentiation from a pluripotent state towards a desired terminal fate. After reviewing recent publications detailing methods for differentiating pluripotent cells into keratinocytes specifically, 8 protocols were selected for testing.
73
exon 13 sequence is in all caps. Sites Sites caps. all in is 13 sequence exon
over sgRNA target sites. target sgRNA over
TP63
ssODN the in sequence geunderlined
indicate arrows Red fcomplex. Cas9n-gRNA the
xon 13 target site and correction strategy. correction and 13 target xon site
e AEC
TP63-
f
cutsites. Red underlined sequence identifies the AEC mutation for correction. Oran correction. for mutation AEC the identifies sequence underlined Red cutsites.
Figure 3.14. Overview o Overview 3.14. Figure represents silent mutations in the template sequence intentionally designed to reside reside to designed intentionally template sequence the in mutations silent represents o binding todirect sites (PAM) motif adjacent protospacer the represent blue in
74 a
b
Homozygous Patient AEC 2 Corrected mutant
Figure 3.15. Screening and sequencing gene-modified clones for patient AEC2. The PCR-based strategy to screen for clones after CRISPR/Cas9n mediated recombination relied on using one primer specific for introduced silent mutations and another anchored in endogenous DNA outside the length of the provided ssODN template. (a) PCR amplification produced diagnostic fragments at the expected 378 bp for multiple clones post-selection. (b) Sequencing results for Patient AEC2 gene-corrected iPSC clones indicate that the causative allele in exon 13 of TP63 was successfully corrected in multiple cases. Interestingly, two clones had undergone some combination of homologous recombination and likely HDR. Instead of the causative mutation being removed from the gene, it was duplicated on the opposite allele.
75
Table 3.1. Genome editing efficiency.
Genome Editing Clones expanded Clones with integrated Homozygous normal Overall Efficiency Method post selection template sequence clones TALEN/FokI 261 19 (7.3%)5 (26.3%)2.0% CRISPR/Cas9n 283 81 (28.6%)9 (11.1%)3.2%
76
Major differences between published methods included the starting state of the cells to be differentiated, the factors with which media were supplemented, and the media and growth matrices used throughout the differentiation process. Some protocols called for starting the differentiation following the formation of embryoid bodies (EB) – pluripotent cell aggregates that have begun to differentiate, while others opted to begin with a recently seeded monolayer culture of cells which were then treated with differentiation factors in various media. Most protocols relied on similar concentrations of retinoic acid (RA) or ascorbic acid (AA), and bone morphogenetic protein 4 (BMP4). After initial treatment with differentiation factors, all protocols relied on classical flavin-adenine dinucleotide (FAD) or various defined keratinocyte media to drive the completion of the differentiation process.
The main criteria considered for selecting a protocol to adopt included the efficiency of producing KRT14-positive cells with keratinocyte-like morphology, culture homogeneity, and the survivability of differentiated cells. Normal iPSCs were differentiated alongside H9
ESCs as a differentiation efficiency control. Differentiated keratinocyte-like cells were characterized through this testing phase by immunocytochemistry for KRT8, KRT14, and
TP63, qRT-PCR for TP63 and KRT14, and FLOW cytometry for ITGA6 and ITGB4 to assess the quality and yield produced by each of the differentiation protocols under review. iPSCd-kcs were also prompted to stratify in vitro using a 3D organotypic modeling system to validate their ability to undergo epithelial stratification and express terminal epidermal differentiation markers.
After testing all conditions, a series of slight modifications were made, and ultimately, a protocol using RA, BMP4, and defined, serum-free media was established for use with this project (as detailed in Materials and Methods). As keratinocyte differentiation takes approximately 56 days from the start of differentiation (Fig 3.16a) to the point where a highly homogenous, morphologically keratinocyte-like population is established, it became critical to maintain a consistent supply of keratinocytes in the differentiation pipeline. To
77 accommodate this considerably long differentiation course, differentiation runs were set up and staggered for each iPSC line on a 7 to 10 day cycle.
As iPSCs enter the epidermal differentiation program, they first begin to commit to an epithelial lineage. By day 4 following the beginning of treatment with RA and BMP4, cells had lost their ESC-like morphology completely. By day 16 differentiating cells adopted an epithelial morphology and migrated into unpopulated areas of the culture vessel as a sheet.
By day 28, differentiating cells had assumed a completely epithelial morphology (Fig 3.16b) and exhibited high levels of expression for TP63 and KRT14 as evidenced by immunofluorescence staining (Fig 3.17).
Differentiating cells were routinely maintained in the same culture vessel until reaching day
28 before being passaged for the first time. This long incubation was observed as passaging during this critical stage in the differentiation program often led to loss of viability and homogeneity. This was seen while attempting to prevent overgrowth of the culture by passaging differentiating cells out at day 7, day 11, day 14, day 21, or day 24 following RA and BMP4 treatment. This presents somewhat of a limitation as starting EBs or iPSCs which are seeded too densely or divide too rapidly will have overgrown the size of the culture dish and senesced by the time the cells would be stable enough to passage. To avoid overgrowth and senescence, 10cm dishes were seeded with 3 to 4 uniformly sized EBs/cm2.
Cultures were routinely assessed for homogeneity and for expression of basal keratinocyte markers, TP63 and KRT14. This assessment was done following the first passage, and again when set up for data collection experiments. Cultures were considered acceptable for use once they had achieved >90% dual expression for TP63 and KRT14. In order to maintain consistency in results, the window for cells to be used in data collection experiments was set between day 55 and day 75. Ideally, a pure population would be isolated by sorting for dual expression of keratinocyte-specific surface markers such as
ITGA6 and ITGB4, as was done during protocol optimization. However, the risk would be in
78
a
b
Figure 3.16. Differentiation of AEC patient iPSCs into keratinocytes. (a) Schematic representation of the strategy for the directed differentiation of keratinocytes from iPSCs in vitro. RA and BMP4 are added for a total of 7 days. Cells are allowed to grow until day 35 before passaging. Differentiating cells will have adopted keratinocyte morphology and gene expression patterns by day 56. (b) By day 4, differentiating cells have lost ESC-like morphology. By day 16, cells will have adopted an overall epithelial-like morphology and migrated as a sheet into unpopulated areas of the culture vessel. By day 28, differentiated cells have assumed a characteristic epithelial cellular morphology and will grow in sheets until dissociated. Scale bars, 100m.
79
a
b
Fig 3.17. iPSCs differentiate into TP63 and KRT14 expressing cells. (a) iPSC-derived cells take on morphology of keratinocytes by day 28 post-differentiation. (b) Also by day 28, keratinocytes derived from iPSCs express keratin filament protein KRT14 (green), and basal keratinocyte marker, TP63 (red). Scale bars, 100m.
80
potentially collecting non-phenotypic cells, as TP63 has been shown by chromatin immunoprecipitation (ChIP) to bind regulatory regions adjacent to integrin 6 and integrin
4. The expression of these genes was also shown in the same report to be downregulated after Np63 expression was reduced by short hairpin RNAs (shRNA) designed against isoforms of TP63 (Carroll et al., 2006).
Validation of the differentiation model. In order to fully validate the efficiency of the protocol used for differentiating keratinocytes from iPSCs, iPSCd-kcs were exposed to calcium in a 3D organotypic culture system. With this system, natural keratinocytes would be able to stratify and form what is essentially a functional epidermal equivalent in vitro. iPSCd- kcs were able to stratify and express the envelope protein, loricrin (Fig 3.18), a terminal keratinocyte differentiation marker. These data serve as validation for the differentiation protocol and maintain that the cells derived from iPSCs using the method described in this work are bona fide keratinocytes.
Discussion
Here, we developed and characterized a human cell-based model for generating patient and gene-corrected keratinocytes useful in studying AEC in vitro. Through the development of this model, we demonstrate that fibroblasts isolated from AEC patients can be reprogrammed to iPSCs, which in turn can be gene-corrected for TP63-AEC mutations using multiple genome-editing platforms, and further, that keratinocytes can be differentiated from AEC patient as well as gene-corrected patient iPSCs. This represents an important step towards being able to accurately observe, in vitro, the effects of the disorder where keratinocyte biology and pathology are the focus.
81
a b
c d
Figure 3.18. Keratinocytes differentiated from iPSCs demonstrate the ability to stratify in vitro. One hallmark of an epidermal keratinocyte is the ability to contribute to the formation of stratified epithelium. In order to test if our iPSCs can differentiate into bona fide keratinocytes, cells were exposed to high calcium (1.2mM) at the air liquid interface. (a) iPSCd-kcs were capable of forming a stratified epithelium as evidenced by the formation of granular and cornified layers. (b) They were proliferative at the basal layer as shown by PCNA (green) and expressed KRT14 (red) throughout the epidermal reconstruct. (c) They possess the ability to form desmosomes as shown by DSC3 localization between cells, and (d) they were capable of terminal keratinocyte differentiation as demonstrated by loricrin expression at the granular layer. Scale bars, 20m.
82
Fibroblasts derived from patient tissue samples revealed either missense or nonsense mutations in either exon 13 or exon 14 of the TP63 gene for each patient. iPSCs were generated from selected patients using a non-integrative Sendai virus approach in order to reduce the chance of random integration of transgenic material to the patient cell genome. The resulting reprogrammed cells assumed ESC-like cell and colony morphology, and strongly expressed pluripotency markers as would be expected of ESCs. Sendai viruses used during reprogramming were found to be absent from each iPSC line by P12.
Importantly, iPSCs generated from AEC patients can be maintained in a pluripotent state, and will spontaneously differentiate when pluripotency maintenance factors are removed from the culture system. Overall, the Sendai virus approach to reprogramming fibroblasts has proven, in our hands, to be highly efficient. To date, and to my knowledge, this is the first account of iPSCs being generated for patients with AEC.
By using TALEN and CRISPR/Cas9n genome-editing techniques, we were able to successfully introduce genetic modifications to patient-derived iPSCs. This success relied heavily on being able to early select for candidate cells and effectively screen clones which had potentially undergone homologous recombination. The effective recovery and expansion of gene-corrected clones then relied on our ability to culture iPSCs as single isolated cells which could survive and maintain pluripotency long enough to establish clonal colonies. These challenges were met through novel design strategies developed to maximize our efforts, and ultimately produce multiple clones for each technique used to generate gene-corrected AEC patient-derived iPSCs.
After using both TALEN and CRISPR methods to effect homologous recombination in iPSCs, upon selection and screening, it became apparent that there were differences in efficiency between the two approaches. Initially, prior to designing a TK-Puro selection cassette to incorporate into the donor plasmid for use with the TALEN approach, a CEL1 digest strategy comparing mutational efficiency in 293FTs and iPSCs transfected equally
83 with only the R and L TALEN arms was used to evaluate homologous recombination efficiency. While the assay worked, it was apparent that the number of clones that would need to be raised and further sequenced was not workable. Therefore, a floxed puromycin selection cassette was introduced to the template plasmid to help enrich the population for positive clones. This increased the size of the donor plasmid considerably, and also required more downstream manipulation of positive clones to remove the cassette. Additionally, there is a chance that residual foreign genetic material following excision of the introduced selection cassette could interfere with alternative splice sites necessary for the proper expression of the Np63 isoform. So, while the strategy used here with TALENs was successful, it inherently presented more limitations than that used with the CRISPR/Cas9n system. With either strategy, a selection method was necessary.
When introducing a donor sequence (either in the form of a linearized plasmid or an ssODN) for use with homologous recombination, a number of different events can occur after target-site DNA is cleaved. First, cleaved DNA can be repaired based on homology with the opposite allele instead of the provided template through homology directed DNA repair (HDR), which occurs naturally in the absence of a template. While effectively
“correcting” the gene-mutation, this method of editing would not incorporate silent template
DNA mutations, and the resulting corrected clones would not be positively detected during screening. Homologous recombination can also occur on the unaffected allele, which would produce a positive clone for homologous recombination, but one that still harbors the mutation on the affected allele. Similarly, partial homologous recombination can occur introducing silent screening mutations, but allowing the mutation to persist which will pass screening, but fail to pass as a “corrected” clone during sequencing. Lastly, cleaved DNA can be repaired through non-homologous end joining (NHEJ) which often results in mutational insertions or deletions (indel). This last mechanism may be advantageous when
84 designing knockout strategies to disrupt gene expression (Mani et al., 2005; Ye et al., 2014;
Hutter et al., 2015), but is not desirable when attempting to edit a single nucleotide.
Both methods were employed successfully to correct a causative mutation in iPSCs derived from patients with AEC. Overall, the number of cells which survived initial selection was higher using the CRISPR approach. However, interestingly, upon sequencing clones which had incorporated donor DNA sequence and passed initial screening, the CRISPR approach gave rise to more unexpected or unwanted genetic modifications such as indels or incorporation of template sequence to both alleles.
These results suggest that the CRISPR/Cas9n was possibly more active than the
TALENs, and repeatedly cut target-site DNA until template sequence was incorporated to prevent further gRNA binding. Although the CRISPR approach did involve more random effects, more correctly modified clones were produced as well. In addition, this approach was useable without the introduction of a large donor plasmid carrying a selection cassette which later needed to be removed from gene-corrected cells, as was originally designed for use with the TALEN approach. The TALEN approach could potentially be modified to work with a much smaller ssODN which could increase the efficiency of homologous recombination while perhaps avoiding many of the unwanted indels associated with the use of CRISPRs. However, a selection of some sort would probably still be necessary.
Interestingly, the CRISPR approach did produce two homozygous mutant clones where presumably, gRNA binding and DNA cleavage had occurred on the unaffected allele, but the affected allele was used as an HDR template to convert the healthy allele to a mutation carrying allele.
The goal of this research is to identify defects linked to TP63-AEC which could potentially underlie skin fragility in AEC patients heterozygous for the mutation. To this end, the model developed was designed deliberately to recapitulate the phenotype as it would be expressed physiologically in AEC patients; as the mutation is expressed in a heterozygous
85 fashion. Homozygous mutant clones, however, could be very useful tools to include in future experiments investigating in particular, protein-protein interactions involving TP63. While the heterozygous expression of TP63 in patient iPSCd-kcs allows us to study defects related to the disorder as it is expressed in patients, since TP63 forms a tetramer (dimer of dimers), the presence of normal TP63 in heterozygous cells could convolute results when studying, for instance, the effects of a TP63 SAM domain mutation on the protein interaction role performed by the TP63 SAM domain specifically.
Precipitation of the TP63 protein complex followed by mass spectrometry could help to identify proteins which specifically interact with unaffected TP63, heterozygous TP63, and
TP63-AEC. Investigation into the protein-protein interactions involving TP63-AEC in a completely homozygous mutant scenario could possibly identify novel interactions specific to TP63-AEC, as well as those which may be abrogated due to disruption of the TP63 SAM domain. Due to the heterozygous nature of the TP63 tetramer, this same approach in heterozygous cells (for the TP63-AEC mutation) would possibly help to identify novel protein interactions, but may fail to clearly identify protein interactions abrogated as a result of a
TP63-AEC mutation.
It is still not clear if cells with two affected TP63 alleles will be able to progress during differentiation to form what could be considered bona fide keratinocytes due to the critical role TP63 plays in epidermal commitment, however cells carrying the same mutation on both alleles have been differentiated in our laboratory and do express TP63 as well as
KRT14 (data not shown). If these cells do not progress to generate, bona fide keratinocytes due to the severity of the mutational defect, time-matched microarray experiments could still be conducted comparing transcriptional differences along the course of differentiation in gene-corrected, AEC-patient, and homozygous mutant TP63 (within a genetically defined system), to identify pathways which are aaffected during keratinocyte differentiation.
86
Of the protocols tested for differentiating keratinocytes from pluripotent stem cells, the majority relied on the use of RA and BMP4 during initial stages followed by the use of keratinocyte supportive media to complete the differentiation process in later stages.
Treatment of pluripotent stem cells with the vitamin A derivative, retinoic acid, has been shown to support differentiation into an ectodermal lineage (Rohwedel 1998, Strubing 1995,
Guan et al., 2001). In order to directly block neural ectoderm differentiation, bone morphogenetic protein 4 was added (Ying et al., 2003). RA concentration was held consistent through all protocols at 1M, while BMP4 concentration varied between protocols from 10ng/mL to 25ng/mL. The allowance for this deviation could be due to differences in starting differentiation media which may have already included BMPs from other sources, such as FBS used in certain formulations. However, the concentration of initiating factors is critical to maintain as in this case, too low of a dosage of RA or too high of a dosage of
BMP4 could result in mesodermal differentiation, resulting for instance, in the generation of beating cardiomyocytes instead of epidermal keratinocytes (Hosseinkhani et al., 2006), which was also observed on two occasions.
One potential concern while differentiating AEC patient iPSCs into keratinocytes stemmed from two previous reports arguing that fully functional Np63 is required for cells to enter a K14-positive epithelial commitment (Medawar et al., 2008), and that ESCs carrying
AEC mutations do not express KRT14 while differentiating, and ultimately fail to commit to an epidermal fate (Rostagno et al., 2010). Irrespective of these predictions, the results described in this chapter demonstrate that cells from both gene-corrected and AEC patient iPSC lines are indeed capable of differentiating into TP63 and KRT14 expressing keratinocytes. This essentially means that through using an iPSC-based differentiation approach, a renewable source of AEC patient keratinocytes can be established, and further, that stem cells carrying AEC mutations can in fact differentiate into bona fide keratinocytes.
87
CHATPER IV
AEC PATIENT iPSC-DERIVED KERATINOCYTES EXHIBIT CELL ADHESION DEFECTS
Introduction
AEC shares phenotypic similarities with several blistering skin disorders such as pemphigus vulgaris (PV), ectodermal dysplasia-skin fragility (ED-SF), and epidermolysis bullosa (EB) regarding associated skin lesions. Due to the degree of similarity, in some cases newborns with AEC are misdiagnosed with EB (Siegfried et al., 2005). While AEC is not a blistering disorder, there could still be some shared pathophysiology between these related genodermatoses.
Pemphigus vulgaris is a severe autoimmune skin disease caused by the development of antibodies against DSG1 and DSG3. This leads to the depletion of functional desmosomes in the skin and mucosal surfaces resulting in intraepidermal blister formation and erosions due to the secondary separation of epithelial cells (Amagai et al.,
1998). This loss of adhesion is further exacerbated by cytokeratin retraction and p38MAPK phosphorylation (Spindler et al., 2013).
Ectodermal dysplasia-skin fragility syndrome is caused by mutations in PKP1, and leads to skin erosions, nail dystrophy, and hypotrichosis (McGrath et al., 1997). The skin erosions associated with ED-SF are due to weakness within the desmosomal plaque which leads to desmosomal detachment and cell separation within the epidermis. ED-SF is now classified as a specific suprabasal form of epidermolysis bullosa (Fine et al., 2008).
Epidermolysis bullosa comprises many different yet related disorders of which there are five main types (simplex, junctional, dystrophic, aquisita, and kindler syndrome). EB is characterized by very fragile skin and widespread severe blistering primarily as a result of a combination of mutations in KRT5 or KRT14 (intermediate filament proteins), PLEC
(cytoskeletal filament cross-linking protein), ITGA6 and ITGB4 (integrins 6 and 4),
LAMA3, LAMB3, LAMC2 (the functional components of Laminin 5; LAM332), and COL7A1
88 and COL17A1 (collagens 7A1 and 17A1). These proteins are important for providing structure and scaffolding to epidermal keratinocytes, and for maintaining adhesion between cells and extracellular matrices through interactions involved in the assembly and stability of hemidesmosomes. Other manifestations of this disorder can include syndactyly, often as a result of fusion between digits due to repeated formation of scar tissue secondary to blistering events.
While not much is known about the pathophysiology underlying AEC, it does seem to share some phenotypic similarity with these other disorders. One image published of perilesional AEC tissue illustrates a delamination between the basal and suprabasal compartments in AEC skin (Payne et al., 2005). Interestingly, it is at this junction where healthy cells begin to leave the cell cycle and upregulate expression of DSG1 and KRT1. It is reasonable that the skin fragility and delay in epidermal differentiation associated with
AEC may, at least in part, be caused by defects in cell cycle and cell adhesion. Recent studies by our group and others have provided some evidence to substantiate this theory
(Ihrie et al., 2005; Carroll et al., 2006; Ferone et al., 2013; Koster et al., 2014).
First, in order to assess whether epidermal differentiation or cell adhesion defects were present in AEC, immunocytochemical staining was performed on AEC patient tissue sections. These preliminary results gave reason to further investigate potential desmosomal and differentiation defects using our in vitro AEC model. Of the desmosomal and desmosomal-associated genes expressed within the epidermis, Dsc3, Dsp, Dsg1, and Perp have also been shown to be direct target genes of Trp63 in mice (Ihrie et al., 2005; Ferone et al., 2013). Claudin-1 (Cldn-1) which encodes a tight junction protein expressed in the suprabasal layers of the epidermis has also been shown to be a direct target of Trp63
(Lopardo et al., 2008).
It has also been observed in our lab and others that Np63 deficient cells, as well as actual AEC patient skin, exhibit a downregulation in several hemidesmosomal components
89 to include FRAS1, ITGA6, collagens IV and VII (Carroll et al., 2006; Koster et al., 2007,
Koster et al., 2009), and laminin 5 (unpublished data). In this chapter, we examine the potential differences in epidermal differentiation, desmosome, and hemidesmosome gene and protein expression in AEC patient iPSCd-kcs and their gene-corrected counterparts, and conduct a side-by-side comparison demonstrating the reduced ability for AEC patient iPSCd-kcs to maintain cell-cell and cell-ECM adhesion in response to mechanical stress.
Results
Adhesion defects observed in AEC patient skin. Immunofluorescence staining for desmosomal and extracellular matrix proteins proteins in AEC skin revealed a defect in collagen IV (COLIV) deposition as well as focal absence of ITGA6 at the basement membrane. This suggests the possibility of a hemidesmosomal defect in AEC skin. As well, the focal absence of desmosomal plaque protein, DSP1, and desmosomal cadherin, DSC3 were observed (Koster et al., 2009; Koster et al., 2014). Some areas of the epidermis were completely void of expression for these markers. These observations pointedly suggest a desmosomal defect is present in AEC skin. These observations suggesting a decrease in expression of certain desmosomal proteins prompted a more comprehensive analysis of desmosomal and adhesion gene and protein expression in AEC patient iPSCd-kcs as they undergo intermediate and terminal differentiation.
Expression analysis of desmosomal and hemidesmosomal adhesion genes.
Since keratinocytes are a calcium dependent cell type which differentiate and form desmosomal junctions in a concentration and time-dependent manner (Pillai et al., 1990; reviewed in Windoffer et al., 2002), to replicate different stages of differentiation and intercellular adhesion within the epidermis, iPSCd-kcs from gene-corrected and patient lines were cultured in low (0.07mM) calcium, which maintains keratinocytes in their basal state, and high (1.2mM) calcium to induce desmosome formation and intermediate keratinocyte differentiation. As cell-cell contact can also initiate differentiation in keratinocytes, cells were
90 allowed to reach up to 90% confluence before collection of low calcium, basal keratinocyte samples. High calcium samples were treated with calcium once they had attained 100% confluence, and then collected at 24 and 48 hours for gene expression analysis. Collected samples were analyzed by qRT-PCR for expression of TP63, PERP, DSP1, KRT1, DSC1,
DSC3, DSG1, DSG3, and JUP, using BNC1 and GAPDH as reference genes (as described in Materials and Methods).
Overall, the expression levels for desmosomal genes DSC1, DSG1, and DSG3 were found to be upregulated in gene-corrected iPSCd-kcs compared to patient derived cells over the course of calcium treatment. AEC1 did not seem to be as affected as AEC2 regarding
PERP and DSC3 expression. Interestingly, the expression levels for JUP did not seem to be heavily affected over the time course, and were not very different between patient and gene- corrected iPSCd-kcs in both AEC1 and AEC2. JUP expression did begin to increase in GC2 at the 48 hour time point (Fig 4.1). However, due to low sample size and variability in gene expression within the same cell line when differentiated in separate runs, these preliminary data lack statistical significance. Statistical power would be increased with an increase in sample size. These initial findings however were suggestive of a broader desmosomal defect potentially present in AEC keratinocytes.
An expression analysis for ITGA6 and LAMA3, LAMB3, and LAMC2 was performed by qRT-PCR for keratinocytes from each pair under low calcium conditions as these genes are expressed in keratinocytes occupying the basal compartment. As expected, expression levels of these genes were found to be downregulated in both AEC1 and AEC2 iPSC- derived keratinocytes. Interestingly, the receptor, ITGA6 was found to be downregulated to a greater extent in AEC1, while the components for its ligand, laminin 5 were found to be more highly downregulated in AEC2 (Fig 4.2). These discrepancies could again be due to differences in TP63 transcriptional function between patients due to slightly different mutational effects.
91
a
Figure 4.1. Gene expression analysis of AEC patient iPSC-derived keratinocytes. qRT- PCR data for low and high calcium iPSCd-kcs for (a) AEC1 and GC1, and (b) AEC2 and GC2. Samples were collected prior to calcium induction (T0), 24 hours after calcium (T24), and 48 hours after calcium (T48). Data were normalized for basonuclin mRNA levels and are represented as +/- SD. n=2 for AEC1, n=2 for GC1, n=3 for AEC2, n=4 for GC2. n=1 for JUP for all samples.
92
b
Figure 4.1. Continued.
93
a
b
Figure 4.2. Cell-ECM adhesion components are downregulated in TP63-AEC keratinocytes. qRT-PCR analysis of low calcium iPSCd-kcs for (a) AEC1 and GC1, and (b) AEC2 and GC2. Samples were collected while subconfluent. Data were normalized for basonuclin mRNA levels and are represented as +/- SD. *=P<0.05, **=P<0.01, ****=P<0.0001. n=1 for GC1 and GC2, n=5 for AEC1 and AEC2.
94
Analysis of desmosomal protein expression. To further investigate the regulation of desmosomal components at the protein level, protein lysates were collected for the same cell lines over the same time points. Mostly consistent with the RNA levels for samples collected over the same time course, protein levels were greatly increased in gene-corrected compared to AEC patient iPSCd-kcs for DSC1, DSC3, DSG1, DSG3 and KRT1 (Fig 4.3).
The one exception was JUP. Intriguingly, JUP protein was almost completely absent in AEC patient iPSCd-kcs, whereas it did not seem to be affected greatly at the RNA level (Fig 4.4).
Immunocytochemical analysis of adhesion proteins. Immunocytochemistry results for AEC patient tissue revealed further evidence of downregulation of desmosomal adhesion proteins in peri-lesional or non-lesional AEC skin (Fig 4.5). TP63 expression was evident within the basal layer of the epidermis but also present in the suprabasal layers, and the epidermis was also hyperplastic. DSC1, DSC3, DSG1, and DSP were all shown to be focally downregulated in certain areas. Unfortunately, antibodies to test DSG3 in paraffin fixed tissue are currently unavailable.
In order to observe the expression and localization of these same proteins at the cellular level, to include DSG3, chamber slides were seeded with gene-corrected and patient lPSCd-kcs and treated with calcium to induce terminal differentiation. Slides were fixed for low calcium as well as at 24 hours in high calcium and stained for TP63, DSG3,
DSC3, DSG1, DSP1, and the adherens junction protein, -catenin (CTNNB1). Before AEC iPSCd-kcs were fixed for staining, phase contrast images were taken for each time point. It was observed that by 24 hours, gene-corrected iPSCd-kcs began to lose phase brightness around their edges and become more flat, fusing into one uniform epithelial sheet. This sheet grew more uniform over the duration of calcium exposure (to 120 hours, data not shown). Conversely, following calcium exposure, AEC patient iPSCd-kcs seemed resistant to initiating these interactions, remaining phase bright around the edges – lacking cell-cell contact, or revealing areas of the culture surface void of cells (Fig 4.6).
95 a
Figure 4.3. AEC keratinocytes fail to express major desmosomal component genes. Compared to their gene-corrected complements, iPSCd-kcs from both (a) AEC1 and (b) AEC2 fail to upregulate expression of DSG3, DSC3, DSG1, and the intermediate differentiation marker KRT1 when compared to GC1 and GC2 keratinocytes.
96 b
Figure 4.3. Continued.
97
a
b
Figure 4.4. JUP is differentially expressed at the RNA and protein levels in AEC. (a) Gene expression analysis of JUP by qRT-PCR does not detect as large a difference as that seen at the protein level between GC2 and AEC2. (b) Protein analysis by immunoblotting reveals a marked decrease in JUP protein in patient derived cells. n=1 for JUP for all samples.
98
a b
c d
e f
Figure 4.5. AEC patient skin exhibits desmosomal and hemidesmosomal defects. Immunofluorescence analysis performed on AEC patient tissue sections revealed that (a) TP63 (green) is highly expressed at the basal layer and continuously expressed into the suprabasal layers. (b) Decreased DSG1 (red) expression is evident throughout the suprabasal layers of the epidermis. (c) Large areas of the epidermis are depleted of DSP (green) expression. (d) DSC1 (red) expression is highly incongruous. (e) ITGA6 (green) expression is decreased at the epidermal-dermal junction. (f) Large areas of AEC epidermis display substantially reduced DSC3 (red) expression. White arrows indicate areas of abnormality. Scale bars, 50m.
99 a
b
Figure 4.6. AEC keratinocytes fail to generate a connective epidermal sheet. (a) GC1 forms a characteristic epidermal sheet following calcium treatment as evidenced by images taken at the 24 and 48 hour time points. AEC1 fails to form appropriate contcts between cells. (b) Similarly, GC2 is capable of forming an epidermal sheet over 24 and 48 hours, while AEC2 cells fail to come together, flatten, and form critical contacts. Scale bars, 100m.
100
Through immunofluorescence staining, it was evident that TP63 expression was high for both patient and gene-corrected cells, and localized to the nucleus in each case. DSC3,
DSG1, and DSG3 were all shown to be in much higher abundance and localized more to the cell membrane in gene-corrected iPSCd-kcs than in patient iPSCd-kcs, where little to no expression of these proteins was observable at the plasma membrane between adjacent cells. While each of these proteins were shown to be downregulated in AEC patient iPSCd- kcs, DSG3 demonstrated the greatest localization defect. As with the other desmosomal cadherins, DSG3 is normally distributed in a linear punctate pattern localized to the desmosmal plaques at the cell membrane. In AEC iPSCd-kcs, after exposure to calcium, available DSG3 was found to be localized within the cell, and not at the cell membrane (Fig
4.7). KRT14 expression was high and did not, by eye, seem to be differentially expressed.
TP63-AEC keratinocytes fail to downregulate ERK1/2 activity. In order for keratinocytes to properly enter the differentiation program and begin expression of downstream intermediate differentiation markers such as KRT1, they must first exit the cell cycle. This is achieved through the suppression of EGFR-ERK1/2 signaling. It has been shown that when DSG1 expression is silenced, ERK1/2 continues to be phosphorylated, and KRT1 expression is ultimately prevented (Getsios et al., 2009). We hypothesized that in
TP63-AEC keratinocytes, which exhibit a decrease in expression for DSG1 and a delay in
KRT1 expression (reference to Fig 1.4), that ERK1/2 signaling was not suppressed, or active to a greater degree, than in gene-corrected keratinocytes. Through Western blot analysis we were able to detect an increased abundance of phosphorylated ERK1/2 in AEC patient iPSCd-kcs when compared to gene-corrected counterpart cells by 24 hours after exposure to 1.2mM calcium. We interpret the increased abundance of phosphor-ERK1/2 as a continued phosphorylation potentially correlating to the decrease in DSG1 expression in
TP63-AEC keratinocytes (Fig 4.8).
101
a b
c d
e f
g h
Figure 4.7. Immunofluorescence analysis reveals desmosomal defects in AEC.
102
Figure 4.7. Immunofluorescence analysis reveals desmosomal defects in AEC. Monolayers generated for GC3 and AEC3 iPSCd-kcs were exposed to calcium (1.2mM) and allowed to differentiate for 24 hours prior to staining. Monolayer-differentiated keratinocytes are positive for TP63 (green) expression in both (a) GC3 and (b) AEC3 cultures. (c) For GC3 differentiated keratinocytes, DSG3 (green) protein is localized at the cell membrane between cells as would be expected from normal human keratinocytes. (d) In AEC3 differentiated keratinocytes, DSG3 is absent between cells. DSG3 is however detectable in a punctate distribution surrounding the nucleus. This could be indicative of a DSG3 localization defect in AEC3 keratinocytes. (e) DSC3 (green) is expressed and distributed normally to the cell membrane in GC3 differentiated monolayer cells, (f) but is largely absent in AEC3 differentiated monolayer, as was similarly observed in immunofluorescence stained AEC patient tissue (Fig 4.5f). (g) DSG1 (green) has been upregulated in GC3 cultures as expected after calcium-treatment. DSG1 is expressed and distributed to the cell membrane between cells in a normal pattern. (h) DSG1 protein is differentially expressed between cells in AEC3 monolayer. Some areas exhibit an expression and localization pattern similar to what would be seen for normal or gene-corrected keratinocytes. Other cells demonstrate decreased expression for DSG1. Scale bars, 10m.
103
a
b
Figure 4.8. TP63-AEC keratinocytes fail to downregulate ERK1/2 signaling. GC2 and AEC2 keratinocytes were treated with 1.2mM calcium for 24 hours. (a) GC2 keratinocytes exhibit an upregulation of DSG1 and differentiation markers DSC1 and KRT1 while AEC2 keratinocytes exhibit a delay in upregulation of these proteins. (b) AEC2 keratinocytes exhibit a higher level of phosphor-ERK when compared to GC2 keratinocytes.
104
AEC iPSC-derived keratinocytes exhibit cell adhesion defects. These deficiencies in desmosome and hemidesmosome protein expression strongly suggested a potential weakness in adhesive strength between TP63-AEC keratinocytes. Functional tests to evaluate adhesive strength in low calcium and calcium-exposed, late-stage differentiated keratinocytes were conducted to assess if this was indeed the case. Under low calcium conditions, and concerning hemidesmosomal integrity, the results from gene expression and immunofluorescence analysis of various integrins and ECM components suggested that patient iPSCd kcs might exhibit a decreased potential to adhere to proteins within the basement membrane. Preliminary RNA and protein analyses in our lab also revealed a downregulation in 2 and 1 integrins in TP63-AEC keratinocytes, for which collagen IV is the associated ligand (data not shown). To assess this possibility, we used a modified centrifugation assay (Garcia et al., 1998; Christ et al., 2010) to quantify AEC2 and GC2 iPSC-derived keratinocyte adhesive strength to collagen IV under varying loads of force. At
20xg of force, roughly 5% of GC2 keratinocytes had detached from the culture surface, while 85% of AEC2 keratinocytes had lost adhesion to the substrate (Fig. 4.9).
To assess stability of adhesion between TP63-AEC keratinocytes under high-calcium conditions, monolayer-differentiated epithelial sheets were successfully generated for both
AEC patient and gene-corrected iPSCd-kcs. Upon treatment with dispase, a protease which cleaves fibronectin and collagen IV, sheets detached from the culture surface within 20 minutes for each sample. Not surprisingly, AEC patient derived sheets dissociated into clumps while gene-corrected iPSC-derived sheets maintained adhesion during mechanical stress (Fig 4.10). These results are consistent with the abnormal desmosomal protein distributions as evidenced by the immunocytochemical stains performed on AEC patient tissue and 2D differentiated AEC patient iPSC derived keratinocytes. In short, the results of this cell adhesion assay indicate that the AEC patient derived tissue was much less resistant to mechanical stress than the gene-corrected derived sheets.
105
a b
Figure 4.9. TP63-AEC keratinocytes exhibit impaired ECM adhesion. AEC2 and GC2 keratinocytes were plated on collagen IV coated plates and subjected to centrifugation at 20xg. (a) Applied force did not effectively detach GC2 keratinocytes (~5% detachment), while (b) AEC2 cells detached readily under 20xg (~85% detachment).
106
Loss of cell-cell adhesion is rescued by p38MAPK inhibition. Since loss of epidermal keratinocyte adhesion can occur at least in part due to the depletion of desmosomal components such as DSG3 and JUP, and by the subsequent activation of p38 mitogen-activated protein kinase (p38MAPK) (Spindler et al., 2014), we attempted to prevent patient dissociation by inhibiting the phosphorylation of p38MAPK specifically
(Sharma et al., 2007). This experiment focused on determining whether maintaining DSG3-
JUP dependent desmosomal integrity is sufficient to prevent the loss of adhesion in AEC patient-derived epithelial sheets. At the same time, this experiment evaluates the role p38MAPK plays in the loss of cell adhesion in AEC-TP63 keratinocytes. Using the same cell adhesion assay, the p38MAPK inhibitor, SB202190, was added to monolayer-differentiated epithelial sheets for 24 hours prior to dispase treatment. Cell sheets formed from both gene- corrected and AEC patient iPSCd-kcs treated with the p38MAPK inhibitor maintained adhesion for 200 cycles of rocking with no sign of dissociating for either sample (Fig 4.10).
p38MAPK activity is upregulated in TP63-AEC keratinocytes. In light of the results from the previous cell dissociation experiment whereby inhibition of p38MAPK activity was able to maintain cell adhesion in monolayer differentiated epithelial sheets for both AEC and GC samples, we hypothesized that p38MAPK activity would be increased in
TP63-AEC keratinocytes, and that if so, this activity could have potentially contributed to the overall loss of adhesion due to mechanical stress. In order to determine whether or not this was the case, cells for both GC2 and AEC2 were exposed to 1.2mM calcium and collected at 48 hours. From the Western blot data assessing the abundance of phosphorylated p38MAPK compared to total p38MAPK, it is apparent that p38MAPK activity is upregulated in TP63-AEC keratinocytes (Fig 4.11). This suggests that in addition to the other defects described in this work, the abundance of phosphorylated p38MAPK in TP63-AEC keratinocytes could also be at least partially involved in the pathophysiology of AEC.
107
a
b
Figure 4.10. Loss of adhesion is prevented by p38MAPK inhibition. (a) Exposure to dispase followed by slight mechanical stress led to dissociation in a monlayer differentiated from AEC2 patient iPSCd-kcs. Treatment with the p38MAPK inhibitor, SB202190 prevented this dissociation. (b) GC2 iPSC-differentiated monolayer cells did not dissociate without the p38MAPK inhibitor, or when treated.
108
38 kD
38 kD
42 kD
Figure 4.11. p38MAPK activity is upregulated in TP63-AEC keratinocytes. Protein analysis for phosphorylated p38MAPK and total p38MAPK of GC2 and AEC2 keratinocytes at 48 hours of 1.2mM calcium exposure. Compared to the amount of total p38MAPK for each sample, AEC2 exhibits an increased abundance of phosphorylated p38MAPK.
109
Discussion
The data presented in this chapter demonstrate that AEC patient iPSCd-kcs exhibit a significant delay in the expression of important cell-adhesion and cytoskeletal scaffolding proteins. Although, there were some differences between the two patients in gene- expression profile regarding some of the genes analyzed. This could potentially be attributed to variability between patients as seen at the phenotypic level as well, or perhaps due to differences owing to the location of the mutation, as one patient line was selected to express a mutation in the TID domain (AEC1), and the others within the SAM domain (AEC2 and
AEC3) of TP63. Some of these differences could also potentially be resolved by increasing sample size as well as further diversifying the sample group to represent additional TP63-
AEC mutations.
DSC3 as well as DSG3 were shown to be downregulated at the RNA and protein levels in both AEC1 and AEC2 samples. A decrease in expression or functionality of either of these proteins could undoubtedly contribute to the skin fragility associated with AEC, as both have been implicated in other blistering skin disorders where loss of either of these proteins leads to suprabasal acantholysis (Koch et al., 1997; Chen et al., 2008; Refai et al.,
2011; reviewed in Amagai and Stanley, 2012). More specifically, this deficiency could lead to severe defects in adhesion at the suprabasal-basal junction. Histopathology of a biopsy in one documented patient did reveal suprabasal delamination (Payne et al., 2005), which would be consistent with a desmosomal adhesion defect involving a decrease in expression of these particular proteins.
Immunofluorescence staining of TP63-AEC keratinocytes (AEC3) revealed a limited distribution of these proteins along the cell membrane, and interestingly in the case of
DSG3, in addition to being downregulated, was observed to be widely dispersed throughout the cell in TP63-AEC keratinocytes. This cytoplasmic localization of DSG3 was initially surprising, but could potentially be explained along with the decreased availability of the
110 desmosomal plaque protein, JUP, which while not discernibly downregulated at the RNA level in AEC patient iPSCd-kcs, was almost completely absent at the protein level.
Under low calcium conditions, or in uncoupled cells, JUP and DSG3 continuously assemble within the cell (Troyanovsky et al., 1994; reviewed in Andl and Stanley, 2001) forming what could be considered “half-desmosomes” (Demlehner et al., 1995). These half- desmosomes can be trafficked throughout the cell and to the plasma membrane through kinesin dependent transport (Nekrasova et al., 2011), but are eventually internalized and degraded barring contact with an adjacent cell (Burdett, 1993; reviewed in Delva et al.,
2009). Notably, JUP has been shown to be post-translationally regulated and stably maintained through this association to increase its metabolic stability and accumulation, as
JUP is particularly vulnerable to degradation in the absence of a cadherin partner
(Kowalczyk et al., 1994). In return, JUP is thought to potentially assist in coupling desmosomal cadherins to the motor complex for transport. Normally, under high calcium conditions, these desmosomal components interact at the cell membrane with DSC3 and
DSP to stabilize each other as desmosomal plaque and junctional assembly occurs
(Kowalczyk et al., 1996; Kowalczyk et al., 1997; Sheu et al., 1989; Hatzfeld et al., 2003;
Aoyama et al., 2009).
When considering the importance of these interactions in mediating intracellular protein trafficking and the preservation of protein stability, one possible reason DSG3 was found by immunofluorescence staining to be dispersed internally in TP63-AEC keratinocytes instead of at the plasma membrane could be the absence of available JUP. In a reciprocal manner, one possible explanation for the observed depletion of JUP protein could potentially be that it is more vulnerable to degradation due to the decrease in available DSC3 and
DSG3.
Beyond these interactions, DSG3 and JUP also function together at the cell membrane forming a multiprotein signaling complex involving p38MAPK (Spindler et al.,
111
2013). Regarding the role of this complex, it has been demonstrated for PV that the depletion of either DSG3 or JUP is followed by an immediate upregulation in p38MAPK activity, and a rapid collapse in cytokeratin tension within the cell (Calkins et al., 2005;
Spindler et al., 2014). This subsequent collapse of keratin filaments and cellular retraction can be blocked by inhibiting p38MAPK phosphorylation (Berkowitz et al., 2005; Lee et al.,
2009; Jolly et al., 2010; Spindler et al., 2013; Hartlieb et al., 2014). We attempted to stabilize cellular adhesion in our AEC model through inhibiting this activity to limit the retraction response which would occur if separation did in fact depend on desmosomal strength.
Without the p38MAPK inhibitor, monolayer differentiated TP63-AEC keratinocytes dissociated in response to mechanical stress, while gene-corrected iPSCd-kcs demonstrated resistance to epithelial sheet fragmentation. After treatment with the inhibitor, cell adhesion was maintained throughout the monolayer in both AEC and GC samples, essentially restoring mechanical stability to TP63-AEC epithelial sheets, indicating that p38MAPK phosphorylation could play a role in the loss of adhesion in AEC keratinocytes as it is shown to appropriately maintain adhesion when its activity is inhibited. Additionally, we found that at the protein level, phosphorylated p38MAPK was more abundant in TP63-AEC than in gene-corrected keratinocytes after calcium induction. In this context, loss of adhesion within the AEC epidermis could presumably be a result of an imbalance between available p38MAPK, phosphorylated p38MAPK, and the DSG3-JUP desmosomal complex.
This imbalance would be due in part to a causal relationship between the availability of DSG and JUP within the system, which when in deficit would allow more p38MAPK to be available for phosphorylation. The overall outcome however, would be the loss of cell adhesion as it is related to the overabundance of phosphor-p38MAPK.
In addition to the downregulation of DSC3 and DSG3, AEC1 and AEC2 also both demonstrated a decreased level of expression for DSC1 and DSG1 when compared to GC1 and GC2 at the RNA and protein levels. Normally, as cells transit from the basal to the
112 suprabasal layers in stratifying epidermis, DSG1, and to some degree, DSC1, are required to suppress EGFR-ERK1/2 signaling, in turn allowing keratinocytes to exit the cell cycle and initiate the later-stage epidermal differentiation program (Getsios et al., 2009). Therefore, it is possible that the hyperplasia and delay in KRT1 expression and intermediate to terminal differentiation exhibited in AEC patient tissue, and the decreased expression of KRT1 at the
RNA and protein levels in AEC1 and AEC2 could also indirectly be attributed to a decreased expression of DSG1.
In the larger picture, the observed delay in epidermal differentiation is an important factor to consider as potentially also contributing to the skin fragility associated with AEC. In this regard, not only would AEC epidermis be weaker due to decreased adhesive properties within the epidermis, but also due to a decrease in epidermal structural integrity and a delay in barrier formation. However, it is important to note that a delay in differentiation does not necessarily translate to a complete inability to differentiate, and is in the case of AEC, still secondary in clinical importance and order to the desmosomal gene expression defects, as adhesion defects in a fully formed epidermis will still result in blistering.
And finally, in addition to these observed desmosomal defects, the dramatic decrease in attached AEC2 keratinocytes to collagen IV when subjugated to mechanical force reveals a significantly reduced ability for TP63-AEC keratinocytes to maintain adhesion to extracellular matrix proteins at the basal lamina, presumably due to integrin and extracellular matrix deposition defects. When put into perspective, this suggests that not only might AEC keratinocytes exhibit weak adhesive properties between cells as described above, but also between cells and extracellular substrate, supporting the possibility that tissue fragility and loss of epidermal adhesion could occur on several levels within the AEC epidermis, and is likely the effect of a combination of defects. Undeniably, the defects demonstrated through the use of the iPSC-based model do describe a skin fragility phenotype due to reduced adhesive strength.
113
CHAPTER V
GENERAL DISCUSSION
TP63, as a transcription factor, is a key regulator for multiple biological processes.
As has been described in this thesis, mutations in TP63 can result in a variety of separate complex disorders, some with skin involvement. The overarching hypothesis of this research is that mutations in TP63-AEC lead to decreased expression of genes involved in desmosome and hemidesmosome assembly and function, resulting in defects in keratinocyte adhesion and differentiation. One of the main goals of this thesis project was to develop a robust, human patient-based model that can be used to investigate the mechanisms underlying the pathophysiology of AEC.
To that end, we decided to combine iPSC and gene-correction technologies to generate conisogenic pluripotent cell lines of patient origin, and to use these pairs of iPSCs as source material for the differentiation into AEC patient and gene-corrected keratinocytes.
The reason for choosing an iPSC-based model was in order to have access to a system where cells can express TP63-AEC mutations as they would be expressed in actual AEC patient keratinocytes, but also one that could offer an unlimited supply of source material as
AEC patient tissue is not readily available.
There was some doubt that pluripotent stem cells carrying a TP63-AEC mutation could commit to an epidermal fate (Medawar et al., 2008; Rostagno et al., 2010) but through the modification of previously published methods to differentiate ESCs and iPSCs into keratinocytes (Guenou et al., 2009; Metallo et al., 2008; Itoh et al., 2011; Petrova et al.,
2014), we were able to do so with a high level of efficiency. We were also able to generate gene-corrected iPSC lines from three patients with AEC, which can as well be differentiated into functional keratinocytes.
Through using this system to model AEC, multiple defects relating to epidermal adhesion and differentiation were recorded for patient iPSC-derived keratinocytes which
114 were not observed in their gene-corrected counterparts. Results of the experiments illustrated and detailed in this thesis provide evidence that the skin fragility, epidermal hyperplasia, and delayed differentiation associated with AEC could be the result of an early impaired epidermal adhesion program, specifically involving the downregulation of key desmosomal adhesion genes, and changes in desmosome components and signaling.
From immunofluorescence staining experiments performed in our lab on AEC patient tissue sections, it was evident that desmosomal gene expression was heavily downregulated in a focal pattern throughout the AEC patient epidermis. TP63-AEC keratinocytes derived from our in vitro system, when prompted to commit to a more terminal epidermal fate in 2D, demonstrated a comparable reduced expression pattern regarding the abundance and distribution of desmosomes at the cell-cell interface. For the majority of proteins assessed, this was the case, however, regarding DSG3, it was not immediately clear whether the observed absence of DSG3 signal at the cell membrane of TP63-AEC keratinocytes was an effect of downregulation, or mislocalization, as DSG3 protein was detectable, albeit in small amounts, within the cell as opposed to at the cell membrane.
Gene expression analysis by qRT-PCR of patient and gene-corrected iPSCd-kc samples collected over a calcium-exposure time course revealed a marked decrease in ability for patient iPSCd-kcs to adequately upregulate expression of multiple desmosomal genes, to include DSG3. These results were also largely confirmed at the protein level, suggesting that the lack of desmosomal components present at the cell membrane in AEC keratinocytes was primarily due to a downregulation in desmosomal gene expression.
The absence of JUP at the protein level in TP63-AEC keratinocytes was surprising given the similar gene expression between patient and gene-corrected samples, however if taken in context with the downregulation of DSC3 and DSG3 which couple with and stabilize
JUP, one might hypothesize that the absence of JUP is the result of a downregulation in desmosomal cadherin gene expression. As JUP is thought to be involved in mediating
115
DSG3 transport to the plasma membrane, it is thereby also possible that the mislocalization observed for DSG3 is a result of the decrease in available JUP protein. Likewise, it has also been shown by our lab that nuclear JUP can directly regulate the expression of DSC3
(Tokonzaba et al., 2013). Therefore, it is conceivable that a decrease in available JUP could contribute to the observed downregulation of DSC3 as well.
Possibly playing another relevant role in regulating the stability of desmosomes and cell-cell adhesion in AEC patient skin is the p38-mitogen activated protein kinase, p38MAPK. Through immunoprecipitation experiments performed in human epidermal keratinocytes it has been demonstrated that p38MAPK interacts with DSG3 and JUP at the desmosome (Spindler et al., 2013; Hartlieb et al., 2014). When DSG3 is depleted in the presence of anti-desmoglein 3 antibodies, p38MAPK becomes activated. This in turn triggers downstream mediators such as heat shock protein 27 (HSP27) which ultimately leads to a retraction of cytokeratin filaments and a collapse in keratin tension within the cell
(Lavoie et al., 1993; Guay et al., 1997; Berkowitz et al., 2005; Calkins et al., 2005). p38MAPK inhibition can prevent this collapse, and has been shown to prevent cytoskeletal changes and blister formation in mouse models for pemphigus vulgaris and pemphigus foliaceus (Berkowitz et al., 2005; Berkowitz et al., 2006).
In the cell adhesion assays described in Chapter 4, we used the p38MAPK inhibitor,
SB202190, to stabilize cell adhesion in AEC patient iPSC-derived epidermal sheets, or more precisely, to prevent keratin retraction in response to dispase treatment. These experiments demonstrated that under slight mechanical stress, untreated patient-derived epidermal sheets fragmented readily, whereas treatment with SB202190 prevented dissociation.
Additionally, we were able to detect a greater level of phosphorylated p38MAPK protein in
TP63-AEC when compared to gene-corrected keratinocytes after 48 hours of calcium treatment suggesting that an overabundance of phosphor-p38MAPK could play a contributory role in the overall pathophysiology underlying AEC. In a broader sense, the
116 results presented here support a model in which DSG3 and JUP act together in a signaling through interaction role retaining p38MAPK at the cell membrane, which is not only required for maintaining cell-cell adhesion, but is of central importance regarding the maintenance and protection of cytoskeletal integrity as well (Fig. 5.1).
Beyond this desmosomal involvement, the results from the cell-ECM adhesive strength centrifugation assay further demonstrate epidermal adhesion defects specific to integrin expression and hemidesmosomal integrity in TP63-AEC keratinocytes. This is not to discount the decreased expression of extracellular matrix proteins such as laminins and collagens which are also shown here by immunofluorescence to be downregulated. Through both adhesion assays, TP63-AEC cells demonstrated a reduced ability to withstand normal mechanical force compared to gene-corrected samples. Additionally, further adhesion strength assays would need to be performed to assess individual integrin receptor and ligand interactions. This would involve the specific inhibition by antibodies of compensatory integrins (receptors) while assessing adhesive potential over purified extracellular matrices
(ligands).
Together with the desmosomal defects observed, the data presented here depict a skin fragility phenotype which could manifest in response to mechanical injury or stress at both the cell-cell and cell-ECM interface in the AEC epidermis. AEC patient tissue also exhibits a delay in epidermal differentiation, and epidermal hyperplasia. Conceivably, this could be partially due to an inability for TP63-AEC keratinocytes to properly exit the cell cycle and initiate the epidermal differentiation program. As was shown from this work,
ERK1/2 signaling is maintained in TP63-AEC keratinocytes while it is downregulated in response to calcium during differentiation in healthy, gene-corrected keratinocytes. This is potentially a result of the observed decreased level of DSG1 expression as it has been shown to regulate EGFR-ERK1/2 signaling and ERK1/2 phosphorylation in keratinocytes to
117
Figure 5.1. p38MAPK becomes active following depletion of DSG3 or JUP. p38MAPK is bound by a DSG3-JUP complex in an inactive state at the cell membrane. The loss of either DSG3 or JUP allows p38MAPK to become phosphorylated which in turn leads to keratin filament retraction and acantholysis within the epidermis.
118 allow cell cycle exit and terminal differentiation. A defect in this program could in effect result in oversaturation of proliferative keratinocytes within the epidermis leading to the observed hyperplasia. This could also account for the delay in KRT1 expression as it should be upregulated following DSG1 expression as cells transit from the basal to suprabasal compartments within the epidermis. Overall, the results from this particular set of experiments do suggest a delay in epidermal differentiation and integrity, and a weakness in desmosome and hemidesmosome assembly or abundance in the AEC epidermis, and do certainly substantiate the notion that skin fragility in AEC can be, at least in part, attributed to a desmosome or hemidesmosome deficiencies within the epidermis.
Moreover, the work described in this thesis validates the feasibility of using a human patient iPSC-based model to generate disease-relevant pathologic cells for the study of
AEC. In addition, the gene-correction and differentiation aspects of this model provide proof- of-principle that a reproducible system for the generation of gene-corrected keratinocytes can be established for patients with AEC.
Although iPSC and gene-editing technologies are poised to make an enormous impact in the field of regenerative medicine, and much progress has been made in that direction, there are still some final concerns which must be addressed. Top among those is the safety of using iPSCs in cell-replacement therapies. iPSCs, like ESCs, are by definition, pluripotent, and can lead to teratoma formation. Before cells derived from iPSCs might be reintroduced to patients, if this were the goal, they would need to be carefully sorted to ensure that any stubborn or undifferentiated cells are excluded from the transplant population. In addition, cells cultured in vitro for a prolonged period of time may acquire chromosomal abnormalities or random single point mutations (Draper et al., 2004; Hussein et al., 2011). This highlights the need for the development of more optimized protocols and screening methods before cell-replacement strategies can be fully realized.
119
There is also currently not much data regarding whether or not syngeneic iPSCs, once fully reprogrammed and re-differentiated, will be tolerated by a patient’s immune system upon re-transplantation. These concerns stem from the fact that iPSCs, like ESCs, exhibit higher human leukocyte antigen (HLA) expression when differentiating in vitro (Boyd et al., 2009). Presentation of these antigens could potentially stimulate an immunogenic response post-transplantation. Another serious concern is a potential change in parental allele silencing which could lead to the generation of neo-antigens. Similarly, there is the possibility that editing a homozygous gene mutation could introduce or expose a new epitope on the protein. In response to these concerns, it has been suggested that transplantation tolerance could be established using minimal host conditioning, even with
ESCs (Robertson et al., 2007). More recently, it has been shown that transplanted cells differentiated from iPSCs reveal limited or no immunogenicity when transplanted to healthy immune-competent C57BL/6 mice (Araki et al., 2013; Guha et al., 2013).
Indeed, while there are certain medical circumstances which would benefit directly from a regenerative tissue or transplant therapy, to treat AEC, discovering a drug which could rescue the associated early adhesion defects for multiple patients may represent the more immediately feasible therapeutic approach. To this end, a human patient-based disease model such as the one developed here can be used to great effect not only in the detection of disorder-associated defects, but similarly in the validation of potential drug candidates, the evaluation of drug toxicity, and the identification of responder and non- responder groups.
120
REFERENCES
Aasen, T., Raya, A., Barrero, M.J., Garreta, E., Consiglio, A., Gonzalez, F., Vassena, R., Bilic, J., Pekarik, V., Tiscornia, G., Edel, M., Boue, S., Izpisua Belmonte, J.C., 2008. Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat Biotechnol 26, 1276-1284.
Amagai, M., Nishikawa, T., Nousari, H.C., Anhalt, G.J., Hashimoto, T., 1998. Antibodies against desmoglein 3 (pemphigus vulgaris antigen) are present in sera from patients with paraneoplastic pemphigus and cause acantholysis in vivo in neonatal mice. J Clin Invest 102, 775-782.
Amagai, M., Stanley, J.R., 2012. Desmoglein as a target in skin disease and beyond. J Invest Dermatol 132, 776-784.
Amagai, M., Tsunoda, K., Zillikens, D., Nagai, T., Nishikawa, T., 1999. The clinical phenotype of pemphigus is defined by the anti-desmoglein autoantibody profile. J Am Acad Dermatol 40, 167-170.
Amiel, J., Bougeard, G., Francannet, C., Raclin, V., Munnich, A., Lyonnet, S., Frebourg, T., 2001. TP63 gene mutation in ADULT syndrome. Eur J Hum Genet 9, 642-645.
Andl, C.D., Stanley, J.R., 2001. Central role of the plakoglobin-binding domain for desmoglein 3 incorporation into desmosomes. J Invest Dermatol 117, 1068-1074.
Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., Yamanaka, S., 2008. Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 321, 699-702.
Aoyama, Y., Yamamoto, Y., Yamaguchi, F., Kitajima, Y., 2009. Low to high Ca2+ -switch causes phosphorylation and association of desmocollin 3 with plakoglobin and desmoglein 3 in cultured keratinocytes. Exp Dermatol 18, 404-408.
Araki, R., Uda, M., Hoki, Y., Sunayama, M., Nakamura, M., Ando, S., Sugiura, M., Ideno, H., Shimada, A., Nifuji, A., Abe, M., 2013. Negligible immunogenicity of terminally differentiated cells derived from induced pluripotent or embryonic stem cells. Nature 494, 100-104.
Armstrong, D.K., McKenna, K.E., Purkis, P.E., Green, K.J., Eady, R.A., Leigh, I.M., Hughes, A.E., 1999. Haploinsufficiency of desmoplakin causes a striate subtype of palmoplantar keratoderma. Hum Mol Genet 8, 143-148.
Ayub, M., Basit, S., Jelani, M., Ur Rehman, F., Iqbal, M., Yasinzai, M., Ahmad, W., 2009. A homozygous nonsense mutation in the human desmocollin-3 (DSC3) gene underlies hereditary hypotrichosis and recurrent skin vesicles. Am J Hum Genet 85, 515-520.
121
Ban, H., Nishishita, N., Fusaki, N., Tabata, T., Saeki, K., Shikamura, M., Takada, N., Inoue, M., Hasegawa, M., Kawamata, S., Nishikawa, S., 2011. Efficient generation of transgenefree human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A 108, 14234-14239.
Berkowitz, P., Hu, P., Liu, Z., Diaz, L.A., Enghild, J.J., Chua, M.P., Rubenstein, D.S., 2005. Desmosome signaling. Inhibition of p38MAPK prevents pemphigus vulgaris IgG-induced cytoskeleton reorganization. J Biol Chem 280, 23778-23784.
Berkowitz, P., Hu, P., Warren, S., Liu, Z., Diaz, L.A., Rubenstein, D.S., 2006. p38MAPK inhibition prevents disease in pemphigus vulgaris mice. Proc Natl Acad Sci U S A 103, 12855-12860.
Bibikova, M., Golic, M., Golic, K.G., Carroll, D., 2002. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics 161, 1169-1175.
Bilousova, G., Chen, J., Roop, D.R., 2011. Differentiation of mouse induced pluripotent stem cells into a multipotent keratinocyte lineage. J Invest Dermatol 131, 857-864.
Bitinaite, J., Wah, D.A., Aggarwal, A.K., Schildkraut, I., 1998. FokI dimerization is required for DNA cleavage. Proc Natl Acad Sci U S A 95, 10570-10575.
Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., Bonas, U., 2009. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509-1512.
Boldrup, L., Coates, P.J., Laurell, G., Nylander, K., 2012. p63 Transcriptionally regulates BNC1, a Pol I and Pol II transcription factor that regulates ribosomal biogenesis and epithelial differentiation. Eur J Cancer 48, 1401-1406.
Bork, P., Koonin, E.V., 1998. Predicting functions from protein sequences--where are the bottlenecks? Nat Genet 18, 313-318.
Boyd, A.S., Wood, K.J., 2009. Variation in MHC expression between undifferentiated mouse ES cells and ES cell-derived insulin-producing cell clusters. Transplantation 87, 1300-1304.
Braam, S.R., Zeinstra, L., Litjens, S., Ward-van Oostwaard, D., van den Brink, S., van Laake, L., Lebrin, F., Kats, P., Hochstenbach, R., Passier, R., Sonnenberg, A., Mummery, C.L., 2008. Recombinant vitronectin is a functionally defined substrate that supports human embryonic stem cell self-renewal via alphavbeta5 integrin. Stem Cells 26, 2257-2265.
Briggs, R., King, T.J., 1952. Transplantation of Living Nuclei From Blastula Cells into Enucleated Frogs' Eggs. Proc Natl Acad Sci U S A 38, 455-463.
Brivanlou, A.H., Gage, F.H., Jaenisch, R., Jessell, T., Melton, D., Rossant, J., 2003. Stem cells. Setting standards for human embryonic stem cells. Science 300, 913-916.
122
Burdett, I.D., 1993. Internalisation of desmosomes and their entry into the endocytic pathway via late endosomes in MDCK cells. Possible mechanisms for the modulation of cell adhesion by desmosomes during development. J Cell Sci 106 ( Pt 4), 1115-1130.
Calkins, C.C., Setzer, S.V., Jennings, J.M., Summers, S., Tsunoda, K., Amagai, M., Kowalczyk, A.P., 2006. Desmoglein endocytosis and desmosome disassembly are coordinated responses to pemphigus autoantibodies. J Biol Chem 281, 7623-7634.
Carroll, D.K., Carroll, J.S., Leong, C.O., Cheng, F., Brown, M., Mills, A.A., Brugge, J.S., Ellisen, L.W., 2006. p63 regulates an adhesion programme and cell survival in epithelial cells. Nat Cell Biol 8, 551-561.
Celli, J., Duijf, P., Hamel, B.C., Bamshad, M., Kramer, B., Smits, A.P., Newbury-Ecob, R., Hennekam, R.C., Van Buggenhout, G., van Haeringen, A., Woods, C.G., van Essen, A.J., de Waal, R., Vriend, G., Haber, D.A., Yang, A., McKeon, F., Brunner, H.G., van Bokhoven, H., 1999. Heterozygous germline mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell 99, 143-153.
Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., Voytas, D.F., 2011. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res 39, e82.
Chen, J., Den, Z., Koch, P.J., 2008. Loss of desmocollin 3 in mice leads to epidermal blistering. J Cell Sci 121, 2844-2849.
Chidgey, M., Brakebusch, C., Gustafsson, E., Cruchley, A., Hail, C., Kirk, S., Merritt, A., North, A., Tselepis, C., Hewitt, J., Byrne, C., Fassler, R., Garrod, D., 2001. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation. J Cell Biol 155, 821-832.
Christ, K.V., Williamson, K.B., Masters, K.S., Turner, K.T., 2010. Measurement of single-cell adhesion strength using a microfluidic assay. Biomed Microdevices 12, 443-455.
Christian, M., Cermak, T., Doyle, E.L., Schmidt, C., Zhang, F., Hummel, A., Bogdanove, A.J., Voytas, D.F., 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757-761.
Cicero, D.O., Falconi, M., Candi, E., Mele, S., Cadot, B., Di Venere, A., Rufini, S., Melino, G., Desideri, A., 2006. NMR structure of the p63 SAM domain and dynamical properties of G534V and T537P pathological mutants, identified in the AEC syndrome. Cell Biochem Biophys 44, 475-489.
Clements, S.E., Techanukul, T., Lai-Cheong, J.E., Mee, J.B., South, A.P., Pourreyron, C., Burrows, N.P., Mellerio, J.E., McGrath, J.A., 2012. Mutations in AEC syndrome skin reveal a role for p63 in basement membrane adhesion, skin barrier integrity and hair follicle biology. Br J Dermatol 167, 134-144.
123
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.
Crawford, P.J., Aldred, M.J., Clarke, A., 1991. Clinical and radiographic dental findings in X linked hypohidrotic ectodermal dysplasia. J Med Genet 28, 181-185.
Delva, E., Tucker, D.K., Kowalczyk, A.P., 2009. The desmosome. Cold Spring Harb Perspect Biol 1, a002543.
Demlehner, M.P., Schafer, S., Grund, C., Franke, W.W., 1995. Continual assembly of halfdesmosomal structures in the absence of cell contacts and their frustrated endocytosis: a coordinated Sisyphus cycle. J Cell Biol 131, 745-760.
Di Costanzo, A., Festa, L., Duverger, O., Vivo, M., Guerrini, L., La Mantia, G., Morasso, M.I., Calabro, V., 2009. Homeodomain protein Dlx3 induces phosphorylation-dependent p63 degradation. Cell Cycle 8, 1185-1195.
Dianzani, I., Garelli, E., Gustavsson, P., Carando, A., Gustafsson, B., Dahl, N., Anneren, G., 2003. Rapp-Hodgkin and AEC syndromes due to a new frameshift mutation in the TP63 gene. J Med Genet 40, e133.
Dimos, J.T., Rodolfa, K.T., Niakan, K.K., Weisenthal, L.M., Mitsumoto, H., Chung, W., Croft, G.F., Saphier, G., Leibel, R., Goland, R., Wichterle, H., Henderson, C.E., Eggan, K., 2008. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321, 1218-1221.
Dinella, J., Koster, M.I., Koch, P.J., 2014. Use of induced pluripotent stem cells in dermatological research. J Invest Dermatol 134, e23.
Dishop, M.K., Bree, A.F., Hicks, M.J., 2009. Pathologic changes of skin and hair in ankyloblepharon-ectodermal defects-cleft lip/palate (AEC) syndrome. Am J Med Genet A 149A, 1935-1941.
Dohn, M., Zhang, S., Chen, X., 2001. p63alpha and DeltaNp63alpha can induce cell cycle arrest and apoptosis and differentially regulate p53 target genes. Oncogene 20, 3193-3205.
Draper, J.S., Smith, K., Gokhale, P., Moore, H.D., Maltby, E., Johnson, J., Meisner, L., Zwaka, T.P., Thomson, J.A., Andrews, P.W., 2004. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nat Biotechnol 22, 53-54.
Ebert, A.D., Liang, P., Wu, J.C., 2012. Induced pluripotent stem cells as a disease modeling and drug screening platform. J Cardiovasc Pharmacol 60, 408-416.
124
Eyre, R.W., Stanley, J.R., 1987. Human autoantibodies against a desmosomal protein complex with a calcium-sensitive epitope are characteristic of pemphigus foliaceus patients. J Exp Med 165, 1719-1724.
Ferone, G., Mollo, M.R., Thomason, H.A., Antonini, D., Zhou, H., Ambrosio, R., De Rosa, L., Salvatore, D., Getsios, S., van Bokhoven, H., Dixon, J., Missero, C., 2013. p63 control of desmosome gene expression and adhesion is compromised in AEC syndrome. Hum Mol Genet 22, 531-543.
Ferone, G., Thomason, H.A., Antonini, D., De Rosa, L., Hu, B., Gemei, M., Zhou, H., Ambrosio, R., Rice, D.P., Acampora, D., van Bokhoven, H., Del Vecchio, L., Koster, M.I., Tadini, G., Spencer-Dene, B., Dixon, M., Dixon, J., Missero, C., 2012. Mutant p63 causes defective expansion of ectodermal progenitor cells and impaired FGF signalling in AEC syndrome. EMBO Mol Med 4, 192-205.
Fine, J.D., Eady, R.A., Bauer, E.A., Bauer, J.W., Bruckner-Tuderman, L., Heagerty, A., Hintner, H., Hovnanian, A., Jonkman, M.F., Leigh, I., McGrath, J.A., Mellerio, J.E., Murrell, D.F., Shimizu, H., Uitto, J., Vahlquist, A., Woodley, D., Zambruno, G., 2008. The classification of inherited epidermolysis bullosa (EB): Report of the Third International Consensus Meeting on Diagnosis and Classification of EB. J Am Acad Dermatol 58, 931- 950.
Frank, D.E., Carter, W.G., 2004. Laminin 5 deposition regulates keratinocyte polarization and persistent migration. J Cell Sci 117, 1351-1363.
Fusaki, N., Ban, H., Nishiyama, A., Saeki, K., Hasegawa, M., 2009. Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sci 85, 348-362.
Galli, F., Rossi, M., D'Alessandra, Y., De Simone, M., Lopardo, T., Haupt, Y., AlsheichBartok, O., Anzi, S., Shaulian, E., Calabro, V., La Mantia, G., Guerrini, L., 2010. MDM2 and Fbw7 cooperate to induce p63 protein degradation following DNA damage and cell differentiation. J Cell Sci 123, 2423-2433.
Garcia, A.J., Huber, F., Boettiger, D., 1998. Force required to break alpha5beta1 integrin fibronectin bonds in intact adherent cells is sensitive to integrin activation state. J Biol Chem 273, 10988-10993.
Getsios, S., Simpson, C.L., Kojima, S., Harmon, R., Sheu, L.J., Dusek, R.L., Cornwell, M., Green, K.J., 2009. Desmoglein 1-dependent suppression of EGFR signaling promotes epidermal differentiation and morphogenesis. J Cell Biol 185, 1243-1258.
Ghioni, P., Bolognese, F., Duijf, P.H., Van Bokhoven, H., Mantovani, R., Guerrini, L., 2002. Complex transcriptional effects of p63 isoforms: identification of novel activation and repression domains. Mol Cell Biol 22, 8659-8668.
125
Ghosh, Z., Wilson, K.D., Wu, Y., Hu, S., Quertermous, T., Wu, J.C., 2010. Persistent donor cell gene expression among human induced pluripotent stem cells contributes to differences with human embryonic stem cells. PLoS One 5, e8975.
Giudice, A., Trounson, A., 2008. Genetic modification of human embryonic stem cells for derivation of target cells. Cell Stem Cell 2, 422-433.
Gledhill, K., Guo, Z., Umegaki-Arao, N., Higgins, C.A., Itoh, M., Christiano, A.M., 2015. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells. PLoS One 10, e0136713.
Gonzalez, F., Barragan Monasterio, M., Tiscornia, G., Montserrat Pulido, N., Vassena, R., Batlle Morera, L., Rodriguez Piza, I., Izpisua Belmonte, J.C., 2009. Generation of mouse induced pluripotent stem cells by transient expression of a single nonviral polycistronic vector. Proc Natl Acad Sci U S A 106, 8918-8922.
Gorry, M.C., Preston, R.A., White, G.J., Zhang, Y., Singhal, V.K., Losken, H.W., Parker, M.G., Nwokoro, N.A., Post, J.C., Ehrlich, G.D., 1995. Crouzon syndrome: mutations in two spliceoforms of FGFR2 and a common point mutation shared with Jackson-Weiss syndrome. Hum Mol Genet 4, 1387-1390.
Greene, S.L., Michels, V.V., Doyle, J.A., 1987. Variable expression in ankyloblepharon ectodermal defects-cleft lip and palate syndrome. Am J Med Genet 27, 207-212.
Guan, K., Chang, H., Rolletschek, A., Wobus, A.M., 2001. Embryonic stem cell-derived neurogenesis. Retinoic acid induction and lineage selection of neuronal cells. Cell Tissue Res 305, 171-176.
Guay, J., Lambert, H., Gingras-Breton, G., Lavoie, J.N., Huot, J., Landry, J., 1997. Regulation of actin filament dynamics by p38 map kinase-mediated phosphorylation of heat shock protein 27. J Cell Sci 110 ( Pt 3), 357-368.
Guenou, H., Nissan, X., Larcher, F., Feteira, J., Lemaitre, G., Saidani, M., Del Rio, M., Barrault, C.C., Bernard, F.X., Peschanski, M., Baldeschi, C., Waksman, G., 2009. Human embryonic stem-cell derivatives for full reconstruction of the pluristratified epidermis: a preclinical study. Lancet 374, 1745-1753.
Guha, P., Morgan, J.W., Mostoslavsky, G., Rodrigues, N.P., Boyd, A.S., 2013. Lack of immune response to differentiated cells derived from syngeneic induced pluripotent stem cells. Cell Stem Cell 12, 407-412.
Gurdon, J.B., 1962. The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J Embryol Exp Morphol 10, 622-640.
Gurdon, J.B., Uehlinger, V., 1966. "Fertile" intestine nuclei. Nature 210, 1240-1241.
126
Hajihosseini, M.K., Wilson, S., De Moerlooze, L., Dickson, C., 2001. A splicing switch and gain-of-function mutation in FgfR2-IIIc hemizygotes causes Apert/Pfeiffer-syndrome-like phenotypes. Proc Natl Acad Sci U S A 98, 3855-3860.
Hanakawa, Y., Stanley, J.R., 2004. Mechanisms of blister formation by staphylococcal toxins. J Biochem 136, 747-750.
Hanna, J., Markoulaki, S., Schorderet, P., Carey, B.W., Beard, C., Wernig, M., Creyghton, M.P., Steine, E.J., Cassady, J.P., Foreman, R., Lengner, C.J., Dausman, J.A., Jaenisch, R., 2008. Direct reprogramming of terminally differentiated mature B lymphocytes to pluripotency. Cell 133, 250-264.
Hartlieb, E., Rotzer, V., Radeva, M., Spindler, V., Waschke, J., 2014. Desmoglein 2 compensates for desmoglein 3 but does not control cell adhesion via regulation of p38 mitogen-activated protein kinase in keratinocytes. J Biol Chem 289, 17043-17053.
Hatzfeld, M., Green, K.J., Sauter, H., 2003. Targeting of p0071 to desmosomes and adherens junctions is mediated by different protein domains. J Cell Sci 116, 1219-1233.
Hay, R.J., Wells, R.S., 1976. The syndrome of ankyloblepharon, ectodermal defects and cleft lip and palate: an autosomal dominant condition. Br J Dermatol 94, 277-289.
Hirsch, T., Rothoeft, T., Teig, N., Bauer, J.W., Pellegrini, G., De Rosa, L., Scaglione, D., Reichelt, J., Klausegger, A., Kneisz, D., Romano, O., Seconetti, A.S., Contin, R., Enzo, E., Jurman, I., Carulli, S., Jacobsen, F., Luecke, T., Lehnhardt, M., Fischer, M., Kueckelhaus, M., Quaglino, D., Morgante, M., Bicciato, S., Bondanza, S., De Luca, M., 2017. Regeneration of the entire human epidermis using transgenic stem cells. Nature 551, 327- 332.
Hockemeyer, D., Soldner, F., Beard, C., Gao, Q., Mitalipova, M., DeKelver, R.C., Katibah, G.E., Amora, R., Boydston, E.A., Zeitler, B., Meng, X., Miller, J.C., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., Jaenisch, R., 2009. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol 27, 851-857.
Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D., Jaenisch, R., 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29, 731-734.
Hosseinkhani, M., Hosseinkhani, H., Khademhosseini, A., Bolland, F., Kobayashi, H., Gonzalez, S.P., 2007. Bone morphogenetic protein-4 enhances cardiomyocyte differentiation of cynomolgus monkey ESCs in knockout serum replacement medium. Stem Cells 25, 571-580.
127
Hussein, S.M., Batada, N.N., Vuoristo, S., Ching, R.W., Autio, R., Narva, E., Ng, S., Sourour, M., Hamalainen, R., Olsson, C., Lundin, K., Mikkola, M., Trokovic, R., Peitz, M., Brustle, O., Bazett-Jones, D.P., Alitalo, K., Lahesmaa, R., Nagy, A., Otonkoski, T., 2011. Copy number variation and selection during reprogramming to pluripotency. Nature 471, 58- 62.
Hutter, G., Bodor, J., Ledger, S., Boyd, M., Millington, M., Tsie, M., Symonds, G., 2015. CCR5 Targeted Cell Therapy for HIV and Prevention of Viral Escape. Viruses 7, 4186-4203.
Ianakiev, P., Kilpatrick, M.W., Toudjarska, I., Basel, D., Beighton, P., Tsipouras, P., 2000. Split-hand/split-foot malformation is caused by mutations in the p63 gene on 3q27. Am J Hum Genet 67, 59-66.
Ihrie, R.A., Marques, M.R., Nguyen, B.T., Horner, J.S., Papazoglu, C., Bronson, R.T., Mills, A.A., Attardi, L.D., 2005. Perp is a p63-regulated gene essential for epithelial integrity. Cell 120, 843-856.
Irwin, M.S., Kaelin, W.G., 2001. p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 12, 337-349.
Itoh, M., Kiuru, M., Cairo, M.S., Christiano, A.M., 2011. Generation of keratinocytes from normal and recessive dystrophic epidermolysis bullosa-induced pluripotent stem cells. Proc Natl Acad Sci U S A 108, 8797-8802.
Jackson, S.J., Zhang, Z., Feng, D., Flagg, M., O'Loughlin, E., Wang, D., Stokes, N., Fuchs, E., Yi, R., 2013. Rapid and widespread suppression of self-renewal by microRNA-203 during epidermal differentiation. Development 140, 1882-1891.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.
Jolly, P.S., Berkowitz, P., Bektas, M., Lee, H.E., Chua, M., Diaz, L.A., Rubenstein, D.S., 2010. p38MAPK signaling and desmoglein-3 internalization are linked events in pemphigus acantholysis. J Biol Chem 285, 8936-8941.
Jones, J.C., Sabatini, K., Liao, X., Tran, H.T., Lynch, C.L., Morey, R.E., Glenn-Pratola, V., Boscolo, F.S., Yang, Q., Parast, M.M., Liu, Y., Peterson, S.E., Laurent, L.C., Loring, J.F., Wang, Y.C., 2013. Melanocytes derived from transgene-free human induced pluripotent stem cells. J Invest Dermatol 133, 2104-2108.
Jonkman, M.F., Pasmooij, A.M., Pasmans, S.G., van den Berg, M.P., Ter Horst, H.J., Timmer, A., Pas, H.H., 2005. Loss of desmoplakin tail causes lethal acantholytic epidermolysis bullosa. Am J Hum Genet 77, 653-660.
128
Julapalli, M.R., Scher, R.K., Sybert, V.P., Siegfried, E.C., Bree, A.F., 2009. Dermatologic findings of ankyloblepharon-ectodermal defects-cleft lip/palate (AEC) syndrome. Am J Med Genet A 149A, 1900-1906.
Kim, J.B., Greber, B., Arauzo-Bravo, M.J., Meyer, J., Park, K.I., Zaehres, H., Scholer, H.R., 2009. Direct reprogramming of human neural stem cells by OCT4. Nature 461, 649-643.
Kim, Y.G., Cha, J., Chandrasegaran, S., 1996. Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl Acad Sci U S A 93, 1156-1160.
King, K.E., Ponnamperuma, R.M., Yamashita, T., Tokino, T., Lee, L.A., Young, M.F., Weinberg, W.C., 2003. deltaNp63alpha functions as both a positive and a negative transcriptional regulator and blocks in vitro differentiation of murine keratinocytes. Oncogene 22, 3635-3644.
Koch, P.J., Mahoney, M.G., Ishikawa, H., Pulkkinen, L., Uitto, J., Shultz, L., Murphy, G.F., Whitaker-Menezes, D., Stanley, J.R., 1997. Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris. J Cell Biol 137, 1091-1102.
Koch, P.J., Walsh, M.J., Schmelz, M., Goldschmidt, M.D., Zimbelmann, R., Franke, W.W., 1990. Identification of desmoglein, a constitutive desmosomal glycoprotein, as a member of the cadherin family of cell adhesion molecules. Eur J Cell Biol 53, 1-12.
Koster, M.I., Dai, D., Marinari, B., Sano, Y., Costanzo, A., Karin, M., Roop, D.R., 2007. p63 induces key target genes required for epidermal morphogenesis. Proc Natl Acad Sci U S A 104, 3255-3260.
Koster, M.I., Dinella, J., Chen, J., O'Shea, C., Koch, P.J., 2014. Integrating animal models and in vitro tissue models to elucidate the role of desmosomal proteins in diseases. Cell Commun Adhes 21, 55-63.
Koster, M.I., Kim, S., Mills, A.A., DeMayo, F.J., Roop, D.R., 2004. p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev 18, 126-131.
Koster, M.I., Marinari, B., Payne, A.S., Kantaputra, P.N., Costanzo, A., Roop, D.R., 2009. DeltaNp63 knockdown mice: A mouse model for AEC syndrome. Am J Med Genet A 149A, 1942-1947.
Kowalczyk, A.P., Palka, H.L., Luu, H.H., Nilles, L.A., Anderson, J.E., Wheelock, M.J., Green, K.J., 1994. Posttranslational regulation of plakoglobin expression. Influence of the desmosomal cadherins on plakoglobin metabolic stability. J Biol Chem 269, 31214-31223.
Kowalczyk, A.P., Borgwardt, J.E., Green, K.J., 1996. Analysis of desmosomal cadherinadhesive function and stoichiometry of desmosomal cadherin-plakoglobin complexes. J Invest Dermatol 107, 293-300.
129
Kowalczyk, A.P., Bornslaeger, E.A., Borgwardt, J.E., Palka, H.L., Dhaliwal, A.S., Corcoran, C.M., Denning, M.F., Green, K.J., 1997. The amino-terminal domain of desmoplakin binds to plakoglobin and clusters desmosomal cadherin-plakoglobin complexes. J Cell Biol 139, 773- 784.
Lavoie, J.N., Hickey, E., Weber, L.A., Landry, J., 1993. Modulation of actin microfilament dynamics and fluid phase pinocytosis by phosphorylation of heat shock protein 27. J Biol Chem 268, 24210-24214.
Lee, H.E., Berkowitz, P., Jolly, P.S., Diaz, L.A., Chua, M.P., Rubenstein, D.S., 2009. Biphasic activation of p38MAPK suggests that apoptosis is a downstream event in pemphigus acantholysis. J Biol Chem 284, 12524-12532.
Lena, A.M., Shalom-Feuerstein, R., Rivetti di Val Cervo, P., Aberdam, D., Knight, R.A., Melino, G., Candi, E., 2008. miR-203 represses 'stemness' by repressing DeltaNp63. Cell Death Differ 15, 1187-1195.
Levrero, M., De Laurenzi, V., Costanzo, A., Gong, J., Wang, J.Y., Melino, G., 2000. The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J Cell Sci 113 ( Pt 10), 1661-1670.
Li, Z., Yang, C.S., Nakashima, K., Rana, T.M., 2011. Small RNA-mediated regulation of iPS cell generation. EMBO J 30, 823-834.
Liefer, K.M., Koster, M.I., Wang, X.J., Yang, A., McKeon, F., Roop, D.R., 2000. Downregulation of p63 is required for epidermal UV-B-induced apoptosis. Cancer Res 60, 4016-4020.
Liu, J.C., Lerou, P.H., Lahav, G., 2014. Stem cells: balancing resistance and sensitivity to DNA damage. Trends Cell Biol 24, 268-274.
Lopardo, T., Lo Iacono, N., Marinari, B., Giustizieri, M.L., Cyr, D.G., Merlo, G., Crosti, F., Costanzo, A., Guerrini, L., 2008. Claudin-1 is a p63 target gene with a crucial role in epithelial development. PLoS One 3, e2715.
Lowry, W.E., Richter, L., Yachechko, R., Pyle, A.D., Tchieu, J., Sridharan, R., Clark, A.T., Plath, K., 2008. Generation of human induced pluripotent stem cells from dermal fibroblasts. Proc Natl Acad Sci U S A 105, 2883-2888.
Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., Church, G.M., 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 31, 833-838.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013b. RNA-guided human genome engineering via Cas9. Science 339, 823-826.
130
Mangiulli, M., Valletti, A., Caratozzolo, M.F., Tullo, A., Sbisa, E., Pesole, G., D'Erchia, A.M., 2009. Identification and functional characterization of two new transcriptional variants of the human p63 gene. Nucleic Acids Res 37, 6092-6104.
Mani, M., Smith, J., Kandavelou, K., Berg, J.M., Chandrasegaran, S., 2005. Binding of two zinc finger nuclease monomers to two specific sites is required for effective double-strand DNA cleavage. Biochem Biophys Res Commun 334, 1191-1197.
Marchetto, M.C., Yeo, G.W., Kainohana, O., Marsala, M., Gage, F.H., Muotri, A.R., 2009. Transcriptional signature and memory retention of human-induced pluripotent stem cells. PLoS One 4, e7076.
Margadant, C., Charafeddine, R.A., Sonnenberg, A., 2010. Unique and redundant functions of integrins in the epidermis. FASEB J 24, 4133-4152.
Marin, M.C., Kaelin, W.G., Jr., 2000. p63 and p73: old members of a new family. Biochim Biophys Acta 1470, M93-M100.
Marques, M.R., Ihrie, R.A., Horner, J.S., Attardi, L.D., 2006. The requirement for perp in postnatal viability and epithelial integrity reflects an intrinsic role in stratified epithelia. J Invest Dermatol 126, 69-73.
Masaki, H., Ishikawa, T., Takahashi, S., Okumura, M., Sakai, N., Haga, M., Kominami, K., Migita, H., McDonald, F., Shimada, F., Sakurada, K., 2007. Heterogeneity of pluripotent marker gene expression in colonies generated in human iPS cell induction culture. Stem Cell Res 1, 105-115.
Matzuk, M.M., Finegold, M.J., Su, J.G., Hsueh, A.J., Bradley, A., 1992. Alpha-inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature 360, 313-319.
McGrath, J.A., Duijf, P.H., Doetsch, V., Irvine, A.D., de Waal, R., Vanmolkot, K.R., Wessagowit, V., Kelly, A., Atherton, D.J., Griffiths, W.A., Orlow, S.J., van Haeringen, A., Ausems, M.G., Yang, A., McKeon, F., Bamshad, M.A., Brunner, H.G., Hamel, B.C., van Bokhoven, H., 2001. Hay-Wells syndrome is caused by heterozygous missense mutations in the SAM domain of p63. Hum Mol Genet 10, 221-229.
McGrath, J.A., McMillan, J.R., Shemanko, C.S., Runswick, S.K., Leigh, I.M., Lane, E.B., Garrod, D.R., Eady, R.A., 1997. Mutations in the plakophilin 1 gene result in ectodermal dysplasia/skin fragility syndrome. Nat Genet 17, 240-244.
McKoy, G., Protonotarios, N., Crosby, A., Tsatsopoulou, A., Anastasakis, A., Coonar, A., Norman, M., Baboonian, C., Jeffery, S., McKenna, W.J., 2000. Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease). Lancet 355, 2119-2124.
131
McMillan, J.R., Haftek, M., Akiyama, M., South, A.P., Perrot, H., McGrath, J.A., Eady, R.A., Shimizu, H., 2003. Alterations in desmosome size and number coincide with the loss of keratinocyte cohesion in skin with homozygous and heterozygous defects in the desmosomal protein plakophilin 1. J Invest Dermatol 121, 96-103.
Medawar, A., Virolle, T., Rostagno, P., de la Forest-Divonne, S., Gambaro, K., Rouleau, M., Aberdam, D., 2008. DeltaNp63 is essential for epidermal commitment of embryonic stem cells. PLoS One 3, e3441.
Metallo, C.M., Ji, L., de Pablo, J.J., Palecek, S.P., 2008. Retinoic acid and bone morphogenetic protein signaling synergize to efficiently direct epithelial differentiation of human embryonic stem cells. Stem Cells 26, 372-380.
Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., Rebar, E.J., 2011. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29, 143-148.
Mills, A.A., Zheng, B., Wang, X.J., Vogel, H., Roop, D.R., Bradley, A., 1999. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 398, 708-713.
Mitalipova, M.M., Rao, R.R., Hoyer, D.M., Johnson, J.A., Meisner, L.F., Jones, K.L., Dalton, S., Stice, S.L., 2005. Preserving the genetic integrity of human embryonic stem cells. Nat Biotechnol 23, 19-20.
Miyazaki, M., Segawa, H., Yamashita, T., Zhu, Y., Takizawa, K., Hasegawa, M., Taira, H., 2010. Construction and characterization of a fluorescent sendai virus carrying the gene for envelope fusion protein fused with enhanced green fluorescent protein. Biosci Biotechnol Biochem 74, 2293-2298.
Miyazaki, T., Futaki, S., Hasegawa, K., Kawasaki, M., Sanzen, N., Hayashi, M., Kawase, E., Sekiguchi, K., Nakatsuji, N., Suemori, H., 2008. Recombinant human laminin isoforms can support the undifferentiated growth of human embryonic stem cells. Biochem Biophys Res Commun 375, 27-32.
Muller, E.J., Williamson, L., Kolly, C., Suter, M.M., 2008. Outside-in signaling through integrins and cadherins: a central mechanism to control epidermal growth and differentiation? J Invest Dermatol 128, 501-516.
Mussolino, C., Morbitzer, R., Lutge, F., Dannemann, N., Lahaye, T., Cathomen, T., 2011. A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res 39, 9283-9293.
Nagaoka, M., Koshimizu, U., Yuasa, S., Hattori, F., Chen, H., Tanaka, T., Okabe, M., Fukuda, K., Akaike, T., 2006. E-cadherin-coated plates maintain pluripotent ES cells without colony formation. PLoS One 1, e15.
132
Natan, E., Joerger, A.C., 2012. Structure and kinetic stability of the p63 tetramerization domain. J Mol Biol 415, 503-513.
Nekrasova, O.E., Amargo, E.V., Smith, W.O., Chen, J., Kreitzer, G.E., Green, K.J., 2011. Desmosomal cadherins utilize distinct kinesins for assembly into desmosomes. J Cell Biol 195, 1185-1203.
Nguyen, B.C., Lefort, K., Mandinova, A., Antonini, D., Devgan, V., Della Gatta, G., Koster, M.I., Zhang, Z., Wang, J., Tommasi di Vignano, A., Kitajewski, J., Chiorino, G., Roop, D.R., Missero, C., Dotto, G.P., 2006. Cross-regulation between Notch and p63 in keratinocyte commitment to differentiation. Genes Dev 20, 1028-1042.
Norgett, E.E., Hatsell, S.J., Carvajal-Huerta, L., Cabezas, J.C., Common, J., Purkis, P.E., Whittock, N., Leigh, I.M., Stevens, H.P., Kelsell, D.P., 2000. Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma. Hum Mol Genet 9, 2761-2766.
Ohi, Y., Qin, H., Hong, C., Blouin, L., Polo, J.M., Guo, T., Qi, Z., Downey, S.L., Manos, P.D., Rossi, D.J., Yu, J., Hebrok, M., Hochedlinger, K., Costello, J.F., Song, J.S., RamalhoSantos, M., 2011. Incomplete DNA methylation underlies a transcriptional memory of somatic cells in human iPS cells. Nat Cell Biol 13, 541-549.
Ohta, S., Imaizumi, Y., Okada, Y., Akamatsu, W., Kuwahara, R., Ohyama, M., Amagai, M., Matsuzaki, Y., Yamanaka, S., Okano, H., Kawakami, Y., 2011. Generation of human melanocytes from induced pluripotent stem cells. PLoS One 6, e16182.
Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., Yamanaka, S., 2008. Generation of mouse induced pluripotent stem cells without viral vectors. Science 322, 949-953.
Osborn, M.J., Starker, C.G., McElroy, A.N., Webber, B.R., Riddle, M.J., Xia, L., DeFeo, A.P., Gabriel, R., Schmidt, M., von Kalle, C., Carlson, D.F., Maeder, M.L., Joung, J.K., Wagner, J.E., Voytas, D.F., Blazar, B.R., Tolar, J., 2013. TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21, 1151-1159.
Ozaki, T., Naka, M., Takada, N., Tada, M., Sakiyama, S., Nakagawara, A., 1999. Deletion of the COOH-terminal region of p73alpha enhances both its transactivation function and DNA binding activity but inhibits induction of apoptosis in mammalian cells. Cancer Res 59, 5902- 5907.
Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A., Lensch, M.W., Cowan, C., Hochedlinger, K., Daley, G.Q., 2008. Disease-specific induced pluripotent stem cells. Cell 134, 877-886.
133
Payne, A.S., Yan, A.C., Ilyas, E., Li, W., Seykora, J.T., Young, T.L., Pawel, B.R., Honig, P.J., Camacho, J., Imaizumi, S., Heymann, W.R., Schnur, R.E., 2005. Two novel TP63 mutations associated with the ankyloblepharon, ectodermal defects, and cleft lip and palate syndrome: a skin fragility phenotype. Arch Dermatol 141, 1567-1573.
Petrof, G., Mellerio, J.E., McGrath, J.A., 2012. Desmosomal genodermatoses. Br J Dermatol 166, 36-45.
Petrova, A., Celli, A., Jacquet, L., Dafou, D., Crumrine, D., Hupe, M., Arno, M., Hobbs, C., Cvoro, A., Karagiannis, P., Devito, L., Sun, R., Adame, L.C., Vaughan, R., McGrath, J.A., Mauro, T.M., Ilic, D., 2014. 3D In vitro model of a functional epidermal permeability barrier from human embryonic stem cells and induced pluripotent stem cells. Stem Cell Reports 2, 675-689.
Pillai, S., Bikle, D.D., Mancianti, M.L., Cline, P., Hincenbergs, M., 1990. Calcium regulation of growth and differentiation of normal human keratinocytes: modulation of differentiation competence by stages of growth and extracellular calcium. J Cell Physiol 143, 294-302.
Polo, J.M., Liu, S., Figueroa, M.E., Kulalert, W., Eminli, S., Tan, K.Y., Apostolou, E., Stadtfeld, M., Li, Y., Shioda, T., Natesan, S., Wagers, A.J., Melnick, A., Evans, T., Hochedlinger, K., 2010. Cell type of origin influences the molecular and functional properties of mouse induced pluripotent stem cells. Nat Biotechnol 28, 848-855.
Priolo, M., Silengo, M., Lerone, M., Ravazzolo, R., 2000. Ectodermal dysplasias: not only 'skin' deep. Clin Genet 58, 415-430.
Rafei, D., Muller, R., Ishii, N., Llamazares, M., Hashimoto, T., Hertl, M., Eming, R., 2011. IgG autoantibodies against desmocollin 3 in pemphigus sera induce loss of keratinocyte adhesion. Am J Pathol 178, 718-723.
Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., Zhang, F., 2013a. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389.
Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., Zhang, F., 2013b. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308.
Rapp, R.S., Hodgkin, W.E., 1968. Anhidrotic ectodermal dysplasia: autosomal dominant inheritance with palate and lip anomalies. J Med Genet 5, 269-272.
Ratovitski, E.A., Patturajan, M., Hibi, K., Trink, B., Yamaguchi, K., Sidransky, D., 2001. p53 associates with and targets Delta Np63 into a protein degradation pathway. Proc Natl Acad Sci USA 98, 1817-1822.
134
Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., Bongso, A., 2000. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 18, 399- 404.
Rickman, L., Simrak, D., Stevens, H.P., Hunt, D.M., King, I.A., Bryant, S.P., Eady, R.A., Leigh, I.M., Arnemann, J., Magee, A.I., Kelsell, D.P., Buxton, R.S., 1999. N-terminal deletion in a desmosomal cadherin causes the autosomal dominant skin disease striate palmoplantar keratoderma. Hum Mol Genet 8, 971-976.
Rinne, T., Brunner, H.G., van Bokhoven, H., 2007. p63-associated disorders. Cell Cycle 6, 262-268.
Rinne, T., Hamel, B., van Bokhoven, H., Brunner, H.G., 2006. Pattern of p63 mutations and their phenotypes--update. Am J Med Genet A 140, 1396-1406.
Robertson, N.J., Brook, F.A., Gardner, R.L., Cobbold, S.P., Waldmann, H., Fairchild, P.J., 2007. Embryonic stem cell-derived tissues are immunogenic but their inherent immune privilege promotes the induction of tolerance. Proc Natl Acad Sci USA 104, 20920-20925.
Rohwedel, J., Kleppisch, T., Pich, U., Guan, K., Jin, S., Zuschratter, W., Hopf, C., Hoch, W., Hescheler, J., Witzemann, V., Wobus, A.M., 1998. Formation of postsynaptic-like membranes during differentiation of embryonic stem cells in vitro. Exp Cell Res 239, 214- 225.
Rossi, M., Aqeilan, R.I., Neale, M., Candi, E., Salomoni, P., Knight, R.A., Croce, C.M., Melino, G., 2006. The E3 ubiquitin ligase Itch controls the protein stability of p63. Proc Natl Acad Sci U S A 103, 12753-12758.
Rostagno, P., Wolchinsky, Z., Vigano, A.M., Shivtiel, S., Zhou, H., Van Bokhoven, H., Ferone, G., Missero, C., Mantovani, R., Aberdam, D., Virolle, T., 2010. Embryonic stem cells as an ectodermal cellular model of human p63-related dysplasia syndromes. Biochem Biophys Res Commun 395, 131-135.
Rowland, T.J., Miller, L.M., Blaschke, A.J., Doss, E.L., Bonham, A.J., Hikita, S.T., Johnson, L.V., Clegg, D.O., 2010. Roles of integrins in human induced pluripotent stem cell growth on Matrigel and vitronectin. Stem Cells Dev 19, 1231-1240.
Ruoslahti, E., 1991. Integrins. J Clin Invest 87, 1-5.
Salam, A., Proudfoot, L.E., McGrath, J.A., 2014. Inherited blistering skin diseases: underlying molecular mechanisms and emerging therapies. Ann Med 46, 49-61.
Saporta, M.A., Grskovic, M., Dimos, J.T., 2011. Induced pluripotent stem cells in the study of neurological diseases. Stem Cell Res Ther 2, 37.
135
Sathyamurthy, A., Freund, S.M., Johnson, C.M., Allen, M.D., Bycroft, M., 2011. Structural basis of p63alpha SAM domain mutants involved in AEC syndrome. FEBS J 278, 2680- 2688.
Schmidt, A., Koch, P.J., 2007. Desmosomes: just cell adhesion or is there more? Cell Adh Migr 1, 28-32.
Schultz, J., Ponting, C.P., Hofmann, K., Bork, P., 1997. SAM as a protein interaction domain involved in developmental regulation. Protein Sci 6, 249-253.
Senoo, M., Pinto, F., Crum, C.P., McKeon, F., 2007. p63 is essential for the proliferative potential of stem cells in stratified epithelia. Cell 129, 523-536.
Serber, Z., Lai, H.C., Yang, A., Ou, H.D., Sigal, M.S., Kelly, A.E., Darimont, B.D., Duijf, P.H., Van Bokhoven, H., McKeon, F., Dotsch, V., 2002. A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol Cell Biol 22, 8601-8611.
Sharma, P., Mao, X., Payne, A.S., 2007. Beyond steric hindrance: the role of adhesion signaling pathways in the pathogenesis of pemphigus. J Dermatol Sci 48, 1-14.
Sheu, H.M., Kitajima, Y., Yaoita, H., 1989. Involvement of protein kinase C in translocation of desmoplakins from cytosol to plasma membrane during desmosome formation in human squamous cell carcinoma cells grown in low to normal calcium concentration. Exp Cell Res 185, 176-190.
Shinkuma, S., 2015. Dystrophic epidermolysis bullosa: a review. Clin Cosmet Investig Dermatol 8, 275-284.
Shotelersuk, V., Janklat, S., Siriwan, P., Tongkobpetch, S., 2005. De novo missense mutation, S541Y, in the p63 gene underlying Rapp-Hodgkin ectodermal dysplasia syndrome. Clin Exp Dermatol 30, 282-285.
Siegfried, E., Bree, A., Fete, M., Sybert, V.P., 2005. Skin erosions and wound healing in ankyloblepharon-ectodermal defect-cleft lip and/or palate. Arch Dermatol 141, 1591-1594.
Song, B., Niclis, J.C., Alikhan, M.A., Sakkal, S., Sylvain, A., Kerr, P.G., Laslett, A.L., Bernard, C.A., Ricardo, S.D., 2011. Generation of induced pluripotent stem cells from human kidney mesangial cells. J Am Soc Nephrol 22, 1213-1220.
Spindler, V., Dehner, C., Hubner, S., Waschke, J., 2014. Plakoglobin but not desmoplakin regulates keratinocyte cohesion via modulation of p38MAPK signaling. J Invest Dermatol 134, 1655-1664.
Spindler, V., Rotzer, V., Dehner, C., Kempf, B., Gliem, M., Radeva, M., Hartlieb, E., Harms, G.S., Schmidt, E., Waschke, J., 2013. Peptide-mediated desmoglein 3 crosslinking prevents pemphigus vulgaris autoantibody-induced skin blistering. J Clin Invest 123, 800-811.
136
Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K., 2010. A reprogrammable mouse strain from gene-targeted embryonic stem cells. Nat Methods 7, 53-55.
Strano, S., Rossi, M., Fontemaggi, G., Munarriz, E., Soddu, S., Sacchi, A., Blandino, G., 2001. From p63 to p53 across p73. FEBS Lett 490, 163-170.
Strubing, C., Ahnert-Hilger, G., Shan, J., Wiedenmann, B., Hescheler, J., Wobus, A.M., 1995. Differentiation of pluripotent embryonic stem cells into the neuronal lineage in vitro gives rise to mature inhibitory and excitatory neurons. Mech Dev 53, 275-287.
Sullivan, S., Cowan, C., Eggan, K., 2007. Human embryonic stem cells: the practical handbook. John Wiley & Sons, Chichester, West Sussex, England; Hoboken, NJ.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872.
Takahashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.
Thanos, C.D., Bowie, J.U., 1999. p53 family members p63 and p73 are SAM domaincontaining proteins. Protein Sci 8, 1708-1710.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147.
Tokonzaba, E., Chen, J., Cheng, X., Den, Z., Ganeshan, R., Muller, E.J., Koch, P.J., 2013. Plakoglobin as a regulator of desmocollin gene expression. J Invest Dermatol 133, 2732- 2740.
Tolar, J., McGrath, J.A., Xia, L., Riddle, M.J., Lees, C.J., Eide, C., Keene, D.R., Liu, L., Osborn, M.J., Lund, T.C., Blazar, B.R., Wagner, J.E., 2014. Patient-specific naturally gene reverted induced pluripotent stem cells in recessive dystrophic epidermolysis bullosa. J Invest Dermatol 134, 1246-1254.
Troyanovsky, S.M., Troyanovsky, R.B., Eshkind, L.G., Krutovskikh, V.A., Leube, R.E., Franke, W.W., 1994. Identification of the plakoglobin-binding domain in desmoglein and its role in plaque assembly and intermediate filament anchorage. J Cell Biol 127, 151-160.
Truong, A.B., Kretz, M., Ridky, T.W., Kimmel, R., Khavari, P.A., 2006. p63 regulates proliferation and differentiation of developmentally mature keratinocytes. Genes Dev 20, 3185-3197.
Tseng, H., Green, H., 1994. Association of basonuclin with ability of keratinocytes to multiply and with absence of terminal differentiation. J Cell Biol 126, 495-506.
137 van Bokhoven, H., Jung, M., Smits, A.P., van Beersum, S., Ruschendorf, F., van Steensel, M., Veenstra, M., Tuerlings, J.H., Mariman, E.C., Brunner, H.G., Wienker, T.F., Reis, A., Ropers, H.H., Hamel, B.C., 1999. Limb mammary syndrome: a new genetic disorder with mammary hypoplasia, ectrodactyly, and other Hand/Foot anomalies maps to human chromosome 3q27. Am J Hum Genet 64, 538-546.
Vasioukhin, V., Bowers, E., Bauer, C., Degenstein, L., Fuchs, E., 2001. Desmoplakin is essential in epidermal sheet formation. Cell Biol 3, 1076-1085.
Vivo, M., Di Costanzo, A., Fortugno, P., Pollice, A., Calabro, V., La Mantia, G., 2009. Downregulation of DeltaNp63alpha in keratinocytes by p14ARF-mediated SUMO conjugation and degradation. Cell Cycle 8, 3545-3551.
Vuoristo, S., Virtanen, I., Takkunen, M., Palgi, J., Kikkawa, Y., Rousselle, P., Sekiguchi, K., Tuuri, T., Otonkoski, T., 2009. Laminin isoforms in human embryonic stem cells: synthesis, receptor usage and growth support. J Cell Mol Med 13, 2622-2633.
Waddington, C.H., 1957. The strategy of the genes; a discussion of some aspects of theoretical biology. Allen & Unwin, London,.
Wah, D.A., Hirsch, J.A., Dorner, L.F., Schildkraut, I., Aggarwal, A.K., 1997. Structure of the multimodular endonuclease FokI bound to DNA. Nature 388, 97-100.
Warren, L., Manos, P.D., Ahfeldt, T., Loh, Y.H., Li, H., Lau, F., Ebina, W., Mandal, P.K., Smith, Z.D., Meissner, A., Daley, G.Q., Brack, A.S., Collins, J.J., Cowan, C., Schlaeger, T.M., Rossi, D.J., 2010. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7, 618-630.
Watanabe, K., Ueno, M., Kamiya, D., Nishiyama, A., Matsumura, M., Wataya, T., Takahashi, J.B., Nishikawa, S., Nishikawa, S., Muguruma, K., Sasai, Y., 2007. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol 25, 681-686.
Westfall, M.D., Mays, D.J., Sniezek, J.C., Pietenpol, J.A., 2003. The Delta Np63 alpha phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay-Wells syndrome-derived mutations. Mol Cell Biol 23, 2264-2276.
Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J., Campbell, K.H., 1997. Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810-813.
Windoffer, R., Borchert-Stuhltrager, M., Leube, R.E., 2002. Desmosomes: interconnected calcium-dependent structures of remarkable stability with significant integral membrane protein turnover. J Cell Sci 115, 1717-1732.
Wong, P.P., Pickard, A., McCance, D.J., 2010. p300 alters keratinocyte cell growth and differentiation through regulation of p21(Waf1/CIP1). PLoS One 5, e8369.
138
Wu, G., Nomoto, S., Hoque, M.O., Dracheva, T., Osada, M., Lee, C.C., Dong, S.M., Guo, Z., Benoit, N., Cohen, Y., Rechthand, P., Califano, J., Moon, C.S., Ratovitski, E., Jen, J., Sidransky, D., Trink, B., 2003. DeltaNp63alpha and TAp63alpha regulate transcription of genes with distinct biological functions in cancer and development. Cancer Res 63, 2351- 2357.
Xu, Y., Zhu, X., Hahm, H.S., Wei, W., Hao, E., Hayek, A., Ding, S., 2010. Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules. Proc Natl Acad Sci U S A 107, 8129-8134.
Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M.D., Dotsch, V., Andrews, N.C., Caput, D., McKeon, F., 1998. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 2, 305-316.
Yang, A., McKeon, F., 2000. P63 and P73: P53 mimics, menaces and more. Nat Rev Mol Cell Biol 1, 199-207.
Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R.T., Tabin, C., Sharpe, A., Caput, D., Crum, C., McKeon, F., 1999. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 398, 714-718.
Ye, L., Wang, J., Beyer, A.I., Teque, F., Cradick, T.J., Qi, Z., Chang, J.C., Bao, G., Muench, M.O., Yu, J., Levy, J.A., Kan, Y.W., 2014. Seamless modification of wild-type induced pluripotent stem cells to the natural CCR5Delta32 mutation confers resistance to HIV infection. Proc Natl Acad Sci U S A 111, 9591-9596.
Yi, R., Poy, M.N., Stoffel, M., Fuchs, E., 2008. A skin microRNA promotes differentiation by repressing 'stemness'. Nature 452, 225-229.
Ying, Q.L., Nichols, J., Chambers, I., Smith, A., 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115, 281-292.
Yu, J., Chau, K.F., Vodyanik, M.A., Jiang, J., Jiang, Y., 2011. Efficient feeder-free episomal reprogramming with small molecules. PLoS One 6, e17557.
Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Slukvin, II, Thomson, J.A., 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917-1920.
Yuan, X., Wan, H., Zhao, X., Zhu, S., Zhou, Q., Ding, S., 2011. Brief report: combined chemical treatment enables Oct4-induced reprogramming from mouse embryonic fibroblasts. Stem Cells 29, 549-553.
139
Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., Arlotta, P., 2011. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol 29, 149-153.
Zhou, T., Benda, C., Duzinger, S., Huang, Y., Li, X., Li, Y., Guo, X., Cao, G., Chen, S., Hao, L., Chan, Y.C., Ng, K.M., Ho, J.C., Wieser, M., Wu, J., Redl, H., Tse, H.F., Grillari, J., Grillari-Voglauer, R., Pei, D., Esteban, M.A., 2011. Generation of induced pluripotent stem cells from urine. J Am Soc Nephrol 22, 1221-1228.
Zhou, W., Freed, C.R., 2009. Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells. Stem Cells 27, 2667-2674.
Zhu, J., Jiang, J., Zhou, W., Zhu, K., Chen, X., 1999. Differential regulation of cellular target genes by p53 devoid of the PXXP motifs with impaired apoptotic activity. Oncogene 18, 2149-2155.
Zhu, S., Li, W., Zhou, H., Wei, W., Ambasudhan, R., Lin, T., Kim, J., Zhang, K., Ding, S., 2010. Reprogramming of human primary somatic cells by OCT4 and chemical compounds. Cell Stem Cell 7, 651-655.
Zuo, Z., Liu, J., 2016. Cas9-catalyzed DNA Cleavage Generates Staggered Ends: Evidence from Molecular Dynamics Simulations. Sci Rep 5, 37584.
140
APPENDIX A
Clinical Observation
The clinical and translational significance of this thesis work lies in the correction of the TP63-AEC mutation in AEC patient iPSCs, followed by the differentiation of healthy, disease-free keratinocytes. This successful demonstration stands to provide the first proof- of-concept that a stem cell-based, gene-based therapy could be applied towards the generation of healthy replacement tissue for patients with AEC. In a broader sense, this research provides support for similar strategies which can be applied to other forms of ectodermal dysplasia and genetic skin disorders. The disease-model system described in this thesis can also feasibly be adapted for drug-screening and target identification purposes, presenting researchers with a platform upon which small compounds can be evaluated. This ultimately may lead to the development of new treatments able to stabilize aberrant pathways found to be deregulated in TP63-AEC keratinocytes.
For my primary clinical experience, as part of the Colorado Clinical and Translational
Sciences Institute (CCTSI) Pre-doctoral Fellowship, I was given the opportunity to learn about the clinical aspects of genetic skin disorders by shadowing Dr. Anna Bruckner during her Genetic Skin Disease and Epidermolysis Bullosa clinics. This clinical experience allowed me to interact with patients suffering from a wide range of related skin disorders, and to observe patient care firsthand. Through this track, I was also able to learn about current treatment strategies, how they were developed, why they are effective, and where they are lacking.
Epidermolysis bullosa comprises a number of different yet related genetic conditions resulting from a combination of mutations in genes important for cell-cell and extracellular matrix adhesion, as well as genes important for intermediate filament scaffolding within a cell. These mutations normally result in loss of function effects which are expressed in patients as severe blistering and scarification of the skin and other epithelial tissues. These
141 blisters can arise in response to even minor mechanical stress and can have devastating consequences on a patient to include reduced life expectancy.
As a Ph.D. student, most of my time was spent in the laboratory, where the concept of “patients” is understood, but not fully realized. I am fortunate to have been selected to be part of the CCTSI program and to have Dr. Bruckner as my Clinical Mentor. This added educational track has provided me with a very unique learning experience, as seeing firsthand the effects these disorders have on patients and their families has brought the importance of the work that translational scientists do into perspective. I think probably one of the most profound experiences I will not soon forget involved a girl with EB who was not maintaining her drug treatment, nor her diet or personal grooming, she was not using painkillers or maintaining her gastronomy tube, she was failing in school and retracting from social activities, and clearly, she was suffering from depression. Her depression wasn’t caused so much by the pain she had experienced, or the dressing changes, or the repeated surgeries, as it was stemming from the realization that there were experiences in life that were not going to be available to her, and she was genuinely afraid for her future.
Witnessing this, I’m not afraid to say, had a staggering effect on me.
After meeting patients with such severe symptoms, considering the underlying defects which have been described as leading to these types of disorders, and the treatment strategies which could potentially be developed to improve patient care and quality of life, I feel a personal obligation to apply myself the best way I can to help bring the science that I do to the clinic. If I’m honest, it has not always been easy to get up on a Sunday morning, with a fresh foot of snow on the ground, and nobody to clear the roads, to get to the lab.
However, when I think of these patients, and how what I do today might be able to help, even in some small way, make things better for them tomorrow, I’m out the door. I’m not a clinician, and I cannot provide direct care, and I realize that the research I do will not soon
142 result in the administration of new treatments for patients with genetic disorders, but I have made this work my mission, and I am glad to know that others here have as well.
I am proud of what we have accomplished here at UC Denver, and am proud to continue to do my part to further the advancement of stem cell research and clinical application. But in order for us to be truly successful in developing and applying new strategies to treat and care for patients, I feel that more emphasis will need to be placed on interdisciplinary research and collaboration between fundamental research scientists, applied scientists, and clinical scientists. I am encouraged that this is indeed the direction we are heading, and I do believe that the future of translational research is bright.
143