TRPing up the Balance of Oxidative Stress - Transient Receptor Potential Vanilloid 1’s Role in Diabetic Microvascular Disease
A Dissertation
Presented in Partial Fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Graduate Studies, Northeast Ohio Medical University
Daniel J. DelloStritto
B.S., Integrative Life Sciences, Kent State University
Integrated Pharmaceutical Medicine Northeast Ohio Medical University
2016
Dissertation Committee: Ian Bratz Ph.D. (Advisor) Altaf Darvesh Ph.D. William M. Chilian Ph.D. Marc S. Penn M.D., Ph.D. Derek S. Damron Ph.D
Copyright Daniel DelloStritto 2016
Abstract
Diabetes is a growing epidemic worldwide leading to an increase in cardiovascular morbidity and mortality. The maintenance of coronary blood flow (CBF) is
crucial to supplying energy and oxygen to the working myocardium and this has been
demonstrated to be disrupted in diabetes. Specifically, our lab has illustrated the ion
channel Transient Receptor Potential Vanilloid subtype 1 (TRPV1) is a key regulator in
CBF control, but it’s contribution to CBF regulation is attenuated in diabetes. A crucial
mechanism behind pathologies seen in diabetes is the imbalance in oxidative stress
(OS). Herein, we determined the role for oxidative stress, specifically H2O2, to regulate
TRPV1-mediated CBF—demonstrating H2O2 differentially regulates TRPV1. Acutely,
H2O2 increases CBF through a TRPV1-dependent signaling; however, exposure to
prolonged OS blunts TRPV1-mediated endothelial signaling resulting in uncoupling of
CBF. Similarly, this altered OS environment is known to lead to an increase lipid
peroxidation (LPO). The LPO product 4-hydroxynonenal (4-HNE) increases oxidative
post translational modification (PTM) resulting in altered protein function. As such, we
established the ability of 4-HNE to modify TRPV1 resulting in blunting of TRPV1-
dependent CBF regulation. Further elucidation determined this process occurs via a
carbonylation reaction on Cysteine 621 of TRPV1. Overall, this dissertation
demonstrated a role for TRPV1 to sense the oxidative environment and subsequently
regulate CBF; however, in diabetes this perfusion is perturbed through the oxidative
modification of TRPV1 leading to potential avenues for future therapeutic targeting.
ii Acknowledgments
Working towards the ultimate goal of obtaining a Ph.D. can be quite treacherous, there are so many people along the way that impact your development as a scientist and as a person. I realize this list is long, however I believe each and every person truly contributed to this project either scientifically or keeping me in a balanced state.
Without family as the backbone I would not be here today. I want to thank my mother and father for their support through the years. They have guided me in numerous ways. They have sacrificed and pushed me every step of the way and for that, I owe them a true debt. My journey down this road would not have started if not for Drs. Eric Soehnlen and Soumitra Basu, who have been there since day one. Dr. Basu, you allowed me the opportunity to find a passion I did not knew existed within me. Eric, working with you inspired me and opened my eyes to a world of science; I am truly thankful for all of your guidance through these many years in all aspects, not only as scientific sounding board but as a confidant. Finally, I need to thank my wife Jessica for whom I would not have completed this process without. The support needed to fulfill these requirements can be grueling and without this support I would not have been able to be as successful as I have been.
During this process of professional growth there are those who have helped in other as aspects of my development. I would like to thank all of those friends whom I have made within the American Physician Scientists Association, you helped me grow as a physician-scientist and as a leader (thank you the BOD and EC of the 2015-2016 academic year including Drs. Alexander Adami, Dani Daye, Brittany Weber, Peter
iii Mittwede, Evan Noch, M. Kerry O’Banion, Moshe Levi, and Michael Guo). To my collaborator and friend Karen Doserch, thank you for pushing scientifically and challenging me to remember the immune system. Also, I would like to thank Angela Bennett for her unending help in the design of the cartoon figures.
Scientifically, I have been as lucky as I have personally. I want to thank the members of my committee for their countless hours of work and guidance through the years. Dr. William Chilian for providing leadership to the department as well as your thought provoking and crazy ideas. Dr. Derek Damron thank you for always pushing me
to question our work and others. Also, I always looked forward able to the many light
stories you told to provided that comic relief when necessary. Dr. Marc Penn for his advice about the many options open for physician-scientists. I want to thank the many other faculty members here at NEOMED (Drs. Charles Thodeti, Altaf Darvesh, Werner
Geldenhuys, June Yun, Denise Inman, Yeong-Renn Chen, Yoon-Kwang Lee and Kenneth
Rosenthal) that have helped my development as a student and a scientist. Also, I need to extend my gratitude to the fellow graduate students from IMS: Danielle Janota, Patti
McCallinhart, Suzanna Logan, Rituparna Ganguly, Ravi Adapala, Dan Luther, Soumyadip
Sahu, Holly Capelli and from Pharmaceutical Science: Gina Wilson and Matt Smith.
Furthermore, I am grateful for those that I have had the honor of training: Brittany Klarich,
Joe Fahmy, Sai Korada, and Pat Connell. You have always kept me on my toes and made sure to instill a sense of teaching and purpose into the science. Last, I have to thank Pritam
Sinharoy and Spencer Andrei from the Damron lab for always engaging in challenging
iv each other science. You helped expand my technical skills, but more importantly we grew scientifically in our many meetings pushing each other to justify our results or experiments.
Next I need to thank those who have helped me develop my wide array of my technical expertise. I first must thank Drs. Greg Dick and Ibra (Drew) Fancher for expanding my horizons in the field of patch-clamp electrophysiology: it truly is as much of an art as it is a science. Bethany Prudner, I have to thank you for teaching me about molecular biology and sparking a passion within me. Crucial to furthering more intricate designs in the molecular biology, I have to thank Matt Kiedrowski. Moreover, your friendship has been dear to me in my time at NEOMED. Next, I have to thank Cindy James from Ohio State for all of her help in the optimization of protein mass spectroscopy, while the sample may not have always worked your guidance was appreciated.
Finally, I need to send my deepest and upmost gratitude to my advisor Dr. Ian
Bratz, he has guided me through the troughs and peaks, the apices and nadirs of science and we have emerged only stronger. We have known each other for over 6 years and grown professionally and personally together. I need to thank you for taking a risk on me as your first graduate student and devoting your time to my development. I thank you for allowing me the freedom to make mistakes. I could always count on you to push me scientifically in our discussions, constantly challenging me, but respecting my opinion concurrently. Thank you Dr. Bratz and thank you everyone.
v Vita
Biographical Information:
Graduate Student, Northeast Ohio Medical University…..….…………….……2012 – 2016
Medical Doctorate Candidate, Northeast Ohio Medical University…………..2010-Present
Tutor/Teaching Assistant, Physiological Basis of Medicine, Infection and
Immunity…………………………………………………….…………….…….…..2012 – 2014
Publications:
1. Guarini G, Ohanyan VA, Kmetz JG, DelloStritto DJ, Shamhart PE, Thodeti C, Meszaros JG, Damron DS and Bratz IN. Disruption of TRPV1-mediated coupling of coronary blood flow to cardiac metabolism in diabetic mice: Role of nitric oxide and BK channels. Am J Physiol Heart Circ Physiol. May 2012 PMID: 22610171 2. DelloStritto DJ, Connell P, Dick GM, Fancher IS, Klarich B, Fahmy JN, Kang P, Chen Y-R, Damron DS, Thodeti CK, Bratz IN. Differential Regulation of TRPV1 channels by H2O2: Implications for Diabetic Microvascular Dysfunction. Basic Res Cardiol. 2016 Mar;111(2):21 PMID: 26907473 3. DelloStritto DJ, Sinahroy P, Connell P, Fahmy JN, Cappelli H, Thodeti CK, Geldenhuys WJ, Damron DS, and Bratz IN. 4-Hydroxynonenal dependent alteration of TRPV1-mediated coronary microvascular signaling. In submission. 4. Doersch KD, DelloStritto DJ, Newell-Rogers MK. The contribution of interleukin-2 to effective wound healing. Experimental Biology and Medicine, In Submission. 5. DelloStritto DJ. Why Societies. Journal of Clinical Investigation, In Progress (To Be Published October 2016).
Field of Study:
Major Field: Integrated Pharmaceutical Medicine
vi Table of Contents
Abstract...... ii
Acknowledgements...... iii - v
Vita...... vi
List of Tables……...... viii
List of Figures……...... ix - x
Chapter 1: Introduction……………………………………...... 1
Chapter 2: Materials and Methods……………...... 35
Chapter 3: Differential Regulation of TRPV1……...... 49
Chapter 4: 4-HNE Post-Translational Modification of TRPV1 and Interaction with Caveolin-
1: Implications for Microvascular Dysfunction ...... 76
Chapter 5: Overall Discussion and Conclusions...... 107
References...... 113
vii List of Tables
Table 1: Heart Rate and Blood Pressure Changes to Capsaicin and H2O2 in vivo………69
Table 2: Heart Rate and Blood Pressure Changes to capsaicin in vivo……..……………..79
Table 3: Primers for qRT-PCR……………………………………………………………..….94
viii List of Figures
Figure 1-1: Schematic of Nitric Oxide Regulation of Vascular Tone………….…….…...... 9
Figure 1-2 EDHF and the Role of Hydrogen Peroxide…………………….…………..…….14
Figure 1-3: Crucial role of Ca2+ signals within Endothelial and Vascular Smooth Muscle
Cells………….……………………………………………………………………………….....17
Figure 1-4: Hypothesis and Aims Schematic………………………………………….…...... 34
Figure 3-1: H2O2-dependent changes in coronary blood flow are TRPV1 dependent…..51
Figure 3-2: H2O2-dependent Relaxation of coronary microvessels is TRPV1 dependent…………………………………………………………………………………….....52
Figure 3-3: DTT and SNP do not alter vascular reactivity………….……….……….……...55
Figure 3-4: Electrophysiological Examination of TRPV1 Activation via Capsaicin and
H2O2………………………………………………………………………………………...... 57
Figure 3-5: In vivo Potentiation effects of H2O2 and Capsaicin on CBF …………....59
Figure 3-6: Potentiation of H2O2 and Capsaicin in coronary microvessels and HEK/BAEC
Cells …...………………………………………………………………………………….……..60
Figure 3-7: TRPV1-dependent changes in coronary blood flow regulation following
prolonged exposure to H2O2………………………………………………………………...... 63
Figure 3-8: Myocardial Oxidation Status…...………………………………………….……..64
Figure 3-9: : Microvessel reactivity to prolonged H2O2……………………………….…..66
Figure 3-10: Electrophysiological Changes in rTRPV1 upon prolonged exposure to
H2O2…………………………..…...………...…………………………………………….…...67
Figure 3-11: Prolonged H2O2 exposure does not alter rTRPV1 expression….…....……...68
Figure 4-1: 4-HNE decreases TRPV1-dependent Coronary Blood Flow Regulation….....78
Figure 4-2: 4-HNE decreases rTRPV1 mediated currents.………………..…………...... 81
Figure 4-3: 4-HNE decreases intracellular Ca2+ influx in MCECs ………………….…...... 83
ix Figure 4-4: Immunoblot of 6x His rTRPV1…...………..………………..…………….……...84
Figure 4-5: 6x-His pull-down of rTRPV1…………..…….…………………………….……...85
Figure 4-6: Mass Spectroscopy Sequence Coverage of rTRPV1-His...……..…….…...... 86
Figure 4-7: In silico Modeling of rTRPV1 transmembrane region and 4-HNE binding…....88
Figure 4-8: rTRPV1 Mutant Constructs does not alter electrophysiological response to
Capsaicin…………………………………………………………………………...…………...89
Figure 4-9: C621G Mutant Construct Rescues 4-HNE Mediated Decreases in rTRPV1-
Dependent Currents.………………………………………………………………………...... 90
Figure 4-10: Mutation of rTRPV1 prevents 4-HNE mediated Post-Translational
Modification……………………………………………………………………………………..92
Figure 4-11: 4-HNE and H2O2 effects on TRPV1 expression and mRNA ..………..…...93
Figure 4-12: 4-HNE impairs TRPV1 dependent eNOS signaling…..……………….……...95
Figure 4-13: Computational Modeling demonstrating TRPV1/Cav-1 Direct Interaction….97
Figure 4-14: Co-Immunoprecipitation Reveals Direct Interaction between TRPV1 and
Cav-1………………………………………………………………………………….………....98
x Chapter 1: Introduction
Clinical Relevance:
Cardiovascular disease is currently the leading cause of morbidity and mortality in the United States for both men and women, attributing to a staggering 610,000 deaths per
year (Mozaffarian et al., 2015). At an annual cost of more than $320 billion dollars from
direct medical and indirect costs in the form of lost wages and productivity (Mozaffarian et
al., 2015), this clinical issue clearly needs attention and investment from the research community to investigate the mechanism(s), by which, the pathological progression of these diseases occurs. It is only through intense scrutiny can we, the scientific community,
identify unique signaling pathways that will lead to therapeutic advancements with an
ultimate significant reduction in this clinical epidemic.
Contributing to this cardiovascular burden is the severe epidemiological rise of
diabetes. In 2014, the America Diabetes Association in conjunction with the Centers for
Disease Control (CDC) estimated that 21.9 million or 9.3% of the American population
had been currently diagnosed with diabetes. Furthermore, the development of diabetes is
not only on the rise in North American and developed countries, but continues to be a
worldwide epidemic. The WHO recently released its 2016 report on diabetes
demonstrating that diabetes is not only on the rise throughout the globe (8.5% of the
world’s population is afflicted in 2014 compared with 4.7% in 1980), but in middle to low-
income countries as well (Organization, 2016).
Overall, this disease increases the incidence of complications from cardiovascular
disease 2-4 times compared to non-diabetic patients (Lakka et al., 2002, Grundy, 2007).
1 While the presence of diabetes does increase the risk of developing gross atherosclerosis, and subsequently increase the risk of ischemic event, this modest increase does not explain the entire risk associated with diabetes. Extensive research has demonstrated that diabetes increases cardiac dysfunction, progressively, without gross atherosclerosis
(Rubler et al., 1972, Wold et al., 2005, Brooks et al., 2008, Schilling and Mann, 2012,
Forbes and Cooper, 2013, Adameova and Dhalla, 2014). As such, the interplay between diabetes and cardiovascular disease is vastly important to further health outcomes in
patients with these overlapping comorbidities. The overarching theme of this work
investigates a specific pathology (e.g. microvascular dysfunction) associated with
diabetes within the coronary microvasculature.
To put this work in perspective, an integrated approach is taken in reviewing the
applicable current literature. I will begin by examining the cardiovascular regulation and
hemodynamics at a systems level, with further examination of the unique hemodynamics
that are particular to the regulation of the coronary vasculature. Next, I will dive into an
overview of how neuronal, endothelial and smooth muscle cells integrate signals to
produce an overall vascular response with specific attention to review the role of Transient
Receptor Potentials, specifically TRPV1, ion channels on this control. Finally, this
introduction culminates in a review of diabetes and its associated pathophysiological processes, specifically Reactive Oxygen Species (ROS) and their contribution to
cardiovascular disease and coronary microvascular dysfunction.
Cardiovascular Hemodynamics
The regulation and maintenance of cardiovascular (CV) homeostasis is an
exceptionally complex multivariate process involving the interplay between the heart,
lungs, kidneys, vasculature, nervous system, and local/humeral control of blood. In one of
the most comprehensive systems analysis, Guyton, Coleman, and Granger detailed each
2 of these known variables and the overall effect on the system, as a whole, utilizing
computing power (Guyton AC et al., 1972). While each of these play a crucial role to the
overall regulation, herein we will review the major contributions of the heart and
vasculature.
In classical physiological terms described by Frank, Starling, Wiggers, Guyton and
others, measurement of the output by the heart (specifically the left ventricle), termed
cardiac output (CO), can be determined in various ways; most simplistically, by the formula
CO = Heart Rate (HR) X Stroke Volume (SV). Initially and somewhat obvious, experiments demonstrated the direct relationship between HR and CO (when one increases so does the other). In the classic experiment, experiments investigating volume depletion or administration of nitroglycerin it was demonstrated that an increased HR was necessary to maintain CO (Braunwald, 1974, Vatner et al., 1974). Later it was determined that this reflex arc occurred via the stimulation (or lack thereof) of baroreceptors within the carotid sinus that directly communicated with the vagus nerve innervating the heart at the sinoatrial node (Braunwald, 1974). However, this paradigm was determined to be a simplistic view, as experiments performed in humans where HR was artificially increased via electrical stimulation, demonstrated no increase in CO, due to decrease in SV (ROSS et al., 1965). Further, it was determined, when electrically controlled but stimulated with isoproterenolol, a β-adrenergic stimulus, CO increased via an increase in SV (ROSS et al., 1965). Simply put, it was determined that dependence on HR for cardiac efficiency needed revision, and subsequently further exploration in the other major component (e.g.
SV) was assessed.
The control of SV is mainly determined by the collection of three variables: preload, afterload and contractility. Through various eloquent experiments, Guyton and other cardiac physiologist determined the relationship between SV, venous return and preload,
3 ultimately determining the most crucial determinant of cardiac output was preload (Sabe and Heupler, 2013, Vest and Heupler, 2013b, Furst, 2014). Further investigation
demonstrated that the force of contraction (i.e. contractility) was also a crucial variable in
the determination of CO, although somewhat minor in comparison to preload. In their seminal paper, Luo et. al. demonstrated, the role of β-adrenergic signaling, and specifically phospholamban’s regulation of the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA)
pump and its ultimate control on the cardiomyocyte to regulate calcium handling (Luo et
al., 1994, James and Robbins, 2013). It had been previously known that calcium ions were
responsible for increased contractility and this was regulated via adrenergic stimulation;
however, they demonstrated that phospholamban was the crucial protein responsible with
the utilization of genetically modified mice. While preload and contractility are vital to the
overall regulation of CO and cardiovascular physiology in general further expansion on
their role is out of the scope of this monograph; for further reviews please see (Guyton AC
et al., 1972, Granger, 1998, Furst, 2014).
Of most importance in this investigation is the regulation of afterload; this is due to the role peripheral vasculature to regulate total peripheral resistance (TPR). Afterload can be defined further as the combination of three factors: resistance, inertia, and compliance
(Vest and Heupler, 2013a). While inertia and compliance play a crucial role in TPR, examination of resistance and its relationship to blood flow is described in more below.
Initial description on the regulation of flow within a closed system was carried out by the
French physicist, Jean Poiseuille, where he expanded on the relationship between flow and resistance: defined as Q = ΔP/R (Q = Flow, ΔP = Change in pressure, and R is resistance). Poiseuille’s work more closely examined the variables influencing resistance and defined it mathematically as R = [8 x η x L] / [π x r4] (R = resistance, η = viscosity of
fluid, L = length of tube, π = mathematical constant (3.14), and r = radius of vessel to the
4 4th power). Subsequently, Q is mathematically defined as Q = [ΔP x r4 x π] / [ 8 x η x L].
Ultimately, what can be derived from Poisseuille’s work is the importance of the radius change: for R (resistance) if the radius changes from 1 to 2 the resistance drops by a factor of 16. If resistance drops, then flow subsequently increases significantly demonstrating the critical role for radius to determine blood flow. While all vascular beds exhibit this radius to flow relationship, the coronary vasculature is unique and epitomizes this connection.
Coronary Blood Flow Regulation
Blood flow through vital organs is tightly regulated via the control of cardiac output, as mentioned above. However, regulation of blood flow in each vascular bed is more finely tuned by local factors. The heart, specifically the myocardium, is one of the more unique organs in respect to the vasculature structure and regulation. Specifically, when it comes to the consumption of oxygen (O2) and nutrients compared to many other tissues, the heart extracts anywhere from 60-80% of the arterial O2 in the coronary circulation under basal conditions suggesting that this vascular bed has a unique environment for which the vasculature has adapted (Duncker et al., 2015). Under increased metabolic demands (i.e. elevated heart rate and contractility), further oxygen extraction would be near impossible and as a result coronary blood flow (CBF) must increase to meet this increase in metabolic demand. CBF has been observed to increase over 4-5 times under pharmacological activation with adenosine and exercise in healthy male volunteers (Wyss et al., 2003). The ability for this drastic compensation in blood flow is known as coronary flow reserve
(Duncker and Bache, 2008, Duncker et al., 2015). Understanding the physiological
mechanisms by which CBF is regulated, specifically the microvascular control, is
tremendously important as evident by the overwhelming clinical evidence that this
5 significantly contributes to overall cardiovascular morbidity and mortality (Bairey Merz et al., 1999, Gulati et al., 2009).
Balancing the hearts supply and demand is crucial to the regulation of CBF; subsequently, there are many variables affecting delivery of blood and O2 to the myocardium. The heart is continuously cycling through contraction-relaxation states,
subjecting the CBF to occur most drastically during diastole. During systole, the
myocardium must generate enough pressure/force to overcome that of the vasculature
(i.e. the aortic pressure) and this results in a compression of the coronary vasculature
(Feigl, 1983, Duncker and Bache, 2008, Tune, 2014, Duncker et al., 2015). With the
intramyocardial pressure generated in the ventricular space, an imbalance exists between
the microvasculature perfusion of the endocardial and epicardial vasculature, where
(during systole) the compression forces collapse those vessels nearest to the
endocardium. Ultimately, this leaves the endocardium most susceptible to a metabolic
imbalance when the heart is under stress (Feigl, 1983, Tune et al., 2004, Duncker and
Bache, 2008, Tune, 2014, Duncker et al., 2015).
To balance the myocardial supply of nutrients a maximum increase in blood flow
4-6 times that of basal levels is needed. Utilizing the pressure-flow relationship (Q = ΔP/R), one can deduct that to produce this drastic change in flow, either pressure must rise within the aorta or resistance must decrease in the coronary vasculature. Experimentally, it has been shown that aortic pressure does not rise significantly with the increase of exercise concluding this rise in flow must be due to a decrease in resistance, which (as explained above) is inversely related to the radius to the 4th power of the coronary resistance vessels
(Feigl, 1983, Tune et al., 2004, Duncker and Bache, 2008, Tune, 2014, Duncker et al.,
2015).
6 The control of resistance arterioles in the CV system, but more specifically within the coronary vasculature area has been of great interest to many scientists. As is reviewed below, there are multiple levels of regulation that the entire vasculature is subject to. Within the coronary arterioles, it has been hypothesized that the most likely regulator is the production of local metabolites, of which some will be reviewed here (for larger overview see below and subsequent reviews). One of the most well-known regulators of CBF is adenosine. In 1963, two groups simultaneously hypothesized that adenosine, a nucleoside, was the mediator of metabolic control of CBF. The prevailing theory dictated that as the metabolic demand of the heart grew (i.e. increase HR, contractility and/or afterload), the high-energy phosphate bonds of ATP would be utilized such that the ATP pool would be diminished to a collection of ADP, AMP and ultimately, an increased
concentration of adenosine. While the other substrates (ATP/ADP/AMP) remain
impermeable to the cellular membrane, adenosine can readily diffuse. This theory had
held for many years, however with the advent of better pharmacological inhibitors,
enzymes for degradation, and genetically altered mice it has become clear this substrate
does not fully regulate the metabolic regulation of the coronary vasculature (Tune, 2014).
Further, factors such as oxygen, carbon dioxide (pH indirectly), adrenergic activation (both α and β) have all be implicated in the regulation of CBF (Feigl, 1983, Tune,
2014). Of note, H2O2 and epoxyeicosatrienoic acids (EETs) have come under more recent attention as potential endothelial derived hyperpolarization factors (EDHF) responsible in part for the regulation of CBF (Liu et al., 2011, Ellinsworth et al., 2016). The importance and implication for these latter factors, especially H2O2, will become more apparent throughout this literature review and dissertation.
The Triumvirate of Vascular Regulation:
7 The peripheral circulation and the control therein provides the oxygen, nutrients, signaling factors, and necessary vasoactive components needed to keep the tissues and cells in functional order. The regulation of vascular tone occurs at three distinct “levels”:
neuronal, the endothelial, and the vascular smooth muscle (VSM) layers, with each playing a distinct and necessary role for maintenance of vascular tone. While all three contribute to vascular regulation, the focus below is on VSM and endothelial cell (EC) layers and their regulation of vascular tone. For a comprehensive review on neuronal
control see review by Storkebaum and Carmeliet (Storkebaum and Carmeliet, 2011).
Endothelial Cells
EC regulation of vascular tone occurs through a multitude of mechanisms including
ionic, paracrine and autocrine signals. Most notably, when stimulated either via changes
in flow, local metabolites and/or exogenous signals, ECs increased production of a
substance termed endothelium derived relaxation factor (EDRF). This molecule, through
much controversy, was determined to be Nitric Oxide (NO) and was later demonstrated to
be produced via a protein termed nitric oxide synthase (NOS) (Pacher et al., 2007,
Edwards et al., 2010). Specifically, NOS has 3 isoforms (neuronal, inducible and
endothelial), and while their names imply tissue specificity, it is well known they are
synthesized by a variety of cells in multiple organs (Pacher et al., 2007).
In ECs, following the production of NO, it rapidly diffuses to the underlying VSM
layer and leads to modification and activation of numerous proteins. The first and most
commonly described mechanism by which NO mediates vasorelexation is via the
activation of the enzyme soluble guanyl cyclase (sGC) (Arnold Wp Fau - Mittal et al., 1977,
Pollock et al., 1991, Pacher et al., 2007, Bohlen, 2011, Félétou, 2011a, Félétou, 2011b).
sGC contains a heme structure, identical to that of hemoglobin, to which NO binds to
stimulate enzymatic activity, resulting in the conversion of GTP into cyclic GMP (cGMP).
8
Figure 1-1: Schematic of Nitric Oxide Regulation of Vascular Tone. The diagram demonstrates an overview of the production of NO within the endothelial cell and its subsequent regulation on VSMC. As demonstrated, eNOS utilizes O2, L-arginine and NADPH to produce NO and L-citrulline. Further, eNOS requires the cofactors of FMN, 2+ FAD, BH4 and signals from Ca -Calmodulin to regulate its activity. NO then diffuse across the member and acts on soluble guanyl cyclase (sGC), K+ channels, and SERCA. Finally, NO can be transported to sites within the body by reacting with hemoglobin and other proteins to form s-nitrosyl groups (reproduced with permission from (Félétou, 2011a)).
9 The resultant cGMP diffuses within the VSM cells to elicit activation of cGMP dependent protein kinase (cGKI) (Pacher et al., 2007, Félétou, 2011a). cGKI ultimately, through
2+ various (in)activations of proteins, decreases intracellular calcium concentrations ([Ca ]i) and calcium sensitivity leading to inactivation of myosin light chain kinase (MLCK) and decreases cross-bridging between myosin and actin in VSCM and resultant vessel relaxation (Hofmann et al., 2006, Félétou, 2011a, Félétou, 2011b) (Figure 1-1).
The aforementioned pathway was the first attributed to NO’s role as a vasoactive
molecule. However, it has since been demonstrated to regulate vascular tone via several
distinct mechanisms. A second well-defined role for NO in the role of vascular regulation
is its ability to react with cysteine residues to form s-nitrosylation end-products. This process has been demonstrated to be a form of second messenger signaling similar to that of phosphorylation (Hess et al., 2005, Lima et al., 2010, Martínez-Ruiz et al., 2013,
Zhao et al., 2015). Although not as fully characterized as the phosphorylation signaling cascade, within the vasculature, NO is known to act on a number of ion channels including
2+ + the KATP and Ca -sensitive K -channels demonstrating an sGCI-independent mechanism
for relaxation (Bolotina et al., 1994, Murphy and Brayden, 1995, Miura et al., 1999, Lynch
et al., 2006). Furthermore, another class of channels, known as the TRP ion channels,
have been implicated in vascular regulation (to be discussed below); in addition, they are
also regulated via s-nitrosylation (Yoshida et al., 2006).
In a pathophysiological state, NO and nitrosylation have been linked to harmful signaling cascades. Aberrant s-nitrosylation of Ryanodine Receptor 2 (hyponitrosylation)
and L-Type calcium channels has been implicated in the generation of arrhythmias (Sun et al., 2006, Cutler et al., 2012). In pathophysiological conditions, NO bioavailability is decreased due to a variety of factors including eNOS uncoupling. This process results in aberrant reactive oxygen species generation (discussed in more detail below). The
10 increased ROS concentrations further react with NO to produce peroxynitrate (ONOO-)
(Pacher et al., 2007, Chen et al., 2012). The ability of this free radical to irreversibly modify
cysteine or tyrosine residues have been implicated in pathophysiological signaling and
associated with apoptosis, necrosis, impaired energy metabolism, and dysfunctional fibroblast growth (Pacher et al., 2007). In contrast to s-nitrosylation, peroxynitration has
been demonstrated to be detrimental to the regulation of blood flow, in particular the
coronary vasculature (Li et al., 2004).
Caveolae and Caveolin-1
Unique EC subcellular morphological structures have been elucidated through the use of electron microscopy. Palade and colleagues described some of the first EM images of invaginations within the EC membrane, further postulating this to be another mechanism (besides fenestrations/pores) for fluid/nutrient movement across the EC in capillaries (PALADE, 1961). These invaginations were given the name caveolae and later determined to be surrounded by a protein termed caveolin (Boscher and Nabi, 2012).
Further characterization revealed three isoforms of caveolin existed (termed: caveolin-1, caveolin-2 and caveolin-3), with varying expression patterns across tissues. Within the endothelium, it was determined that Caveolin-1 (Cav-1) was most abundantly expressed.
Consequently, Cav-1 has been identified to be involved in multiple functions within the endothelium, including a role in cell proliferation, survival and differentiation (Boscher and Nabi, 2012). Furthermore, Cav-1 has been shown to play a role in many disease processes including (1) regulating insulin signaling in diabetes, (2) integral for the regulation of heart size and (3) aberrant mutations present in breast and other cancers
(Boscher and Nabi, 2012, Panneerselvam et al., 2012, Strålfors, 2012). Interesting in regards to vascular regulation, the Sessa lab has demonstrated the critical role of the protein-protein interaction between Cav-1 and eNOS to regulate the inverse enzymatic
11 activity of eNOS when bound to Cav-1 (Feron et al., 1996, Bernatchez et al., 2005,
Kraehling et al., 2016). Initial identified the interaction site on Cav-1 determined the binding between the protein partners and Cav-1. These sequences contain a specific spacing of aromatic-rich amino acids (ΦXΦXXXXΦ, ΦXXXXΦXXΦ, or ΦXΦXXXXΦXXΦ, where Φ =
Trp, Phe, or Tyr) termed the caveolin-scaffolding domain (Couet et al., 1997). Further studies elucidated the crucial role of Ca2+-Calmodulin and hsp90 in this regulation.
Specifically, it was demonstrated that activated Ca2+-Calmodulin decreased the interaction between eNOS and Cav-1, and that in the presence of hsp90, eNOS activity was increased significantly more (Gratton et al., 2000).
Furthermore, central to this dissertation, is the role of the ion channel TRPV1
(reviewed below), and the subsequent regulation or vascular reactivity within the coronary vasculature. Importantly, Cav-1 has been demonstrated to interact with several ion
channels including Kv, BKCa, SKCa and TRPV4 to elicit a regulatory role when bound
together (Alioua et al., 2008, Goedicke-Fritz et al., 2015, Perez-Verdaguer et al., 2016).
Specifically, when BKCa and Cav-1 are co-expressed it was observed that Cav-1 reduced
the surface expression by ~70% (Alioua et al., 2008). Goedicke-Fritz and colleagues
elucidated an interaction between TRPV4, SKCa and Cav-1 in endothelial cells and further revealed this protein-protein interaction increased in the presence of lamina flow. Finally, they went on to establish a role for Cav-1 in endothelial derived hyperpolarization in the cerebral vasculature suggesting the role of the TRPV4/SKCa/Cav-1 complex in this process (Goedicke-Fritz et al., 2015).
Endothelial Derived Hyperpolarization Factor (EDHF)
Another pathway by which ECs exert vasoactive control is via endothelial derived hyperpolarization factor (EDHF). Briefly, EDHF is a proposed “factor” (as it has still not
been conclusively resolved within the scientific community) released by the endothelium
12 that is responsible for VSMC hyperpolarization and ultimately vasorelaxation in response to acetylcholine (ACh) (Félétou, 2011a, Félétou, 2011b). Two of the initial EDRFs were established to be NO (as mentioned above) and another factor derived from arachidonic acid, specifically a metabolite of the cyclooxygenase pathway (eventually determined to be prostacyclin) (Félétou, 2011b). With the development of better pharmacological inhibitors, ACh-induced hyperpolarization of VSM layer via NO and prostacyclin were inhibited, but hyperpolarization of EC and subsequent relaxation still remained. This has led to the vigorous search for hyperpolarizing vasoactive substances and subsequent studies have potentially identified various compounds (for more detailed review see
(Félétou, 2011b)).
One compound that continues to be of interest as EDHF is H2O2 and while it is not the only proposed EDHF, substantial evidence exists for its role as a vasoactive substance in various vascular beds across multiple species (Edwards et al., 2010, Shimokawa, 2010,
Félétou, 2011b). The production of H2O2 in the endothelium has been proposed to occur
- via a two-step reaction. Initially, superoxide anions (O2 ) are produced from a variety of sources within the vasculature including NOS uncoupling, NAD(P)H oxidase, xanthine oxidase, cyclooxygenases, and lipoxygenases enzymes (Pacher et al., 2007, Ellinsworth et al., 2016). NAD(P)H oxidase has been suggested to be the major producer of superoxide species in the vasculature and accomplishes this via transfer of elections from oxygen to NAD(P)H (Ardanaz and Pagano, 2006). Furthermore, eNOS (as well as iNOS and nNOS) utilizes L-arginine for the production of NO with the help of the cofactor tetrahydrobiopterin (BH4). When BH4 levels become deficient, the enzymatic production
- of NO is no longer coupled to L-arginine oxidation, producing O2 (Takaki et al., 2008).
- Ultimately, following O2 production, superoxide dismutase (SOD), in this case endothelial
copper, zinc-SOD, oxidizes superoxide into the more stable H2O2
13
A
B
Figure 1-2: EDHF and the Role of Hydrogen Peroxide. A) Schematic depicting + endothelial dependent hyperpolarization factors including NO, K , H2O2, EETs, HEETs, and PGI2. B) Overview of putative pathways by which H2O2 can act as an EDHF. Following its production, H2O2 diffuses into the both ECs and VSMCs and regulate signaling pathways (PKG and cGMP) and ion channels including Kv, KATP, KIr, and BKCa. Reproduced with permission from(Shimokawa, 2010) (A) and (Félétou, 2011a) (B).
14
(Takaki et al., 2008, Shimokawa, 2010). Interestingly, Nox4 has been shown to produce
H2O2 in the endothelium without the intermediary production of superoxide ion
(Ellinsworth et al., 2016). The importance of H2O2 as an EDHF in the vasculature is
summarized in Figure 1-2.
Vascular Smooth Muscle (VSM) Cells
Ultimately, VSMCs are the effector cell for both neuronal and endothelial input and are ultimately responsible for the changes in vessel diameter through integration of vasoactive signals. As mentioned previously, ECs induce vasodilation via a plethora of pathways (i.e NO, EDHF, prostacyclin); however, the most characterized among them is the eNOS->sGC->cGKI mechanism. Central to this vascular relaxation is the concomitant
2+ 2+ decreases in [Ca ]i levels and Ca sensitivity via cGKI-dependent signaling. In contrast,
2+ VSMCs constrict via a rise [Ca ]i. This typically occurs, through depolarization of VSMC leading to the activation and opening of voltage gated calcium channels (VGCC) to allow
extra cellular Ca2+ to flow into the cytoplasm (Khalil, 2010). This calcium influx then
2+ 2+ activates Ryanodine and or IP3 receptors in a Ca -induce Ca release manner to release intracellular stores of calcium from within the sarcoplasmic reticulum (Ledoux et al., 2006,
Khalil, 2010). Further effects of Ca2+ in the VSMC correspond with the calcium sensitive protein kinase (PKC). With activation by diacylglycerol and Ca2+, PKC phosphorylates C- kinase Potentiated Protein phosphatase-1 (CPI-17), which inhibits MLC phosphatase enhancing the contraction (Khalil, 2010).
While the communication between the EC/Neuronal layers and VSM layer is vital to vascular control, VSM can exert their own regulation of the vasculature. Central to this
control of the cytoplasmic concentration of calcium which regulated by a variety of signals
and channels including the VGCC. These VGCC are sensitive, as their name implies, to
15 ionic (voltage) changes within VSMC. Neuronal and EC inputs can regulate this voltage sensitivity in a variety of ways including neuronal release of ACh (among others) to activate the Muscarinic receptors on both the endothelium and VSMC. Additionally, EC
release substances (i.e. Endothelin-1) that bind to VSMC and alter the ionic regulation
(Nelson and Quayle, 1995, Nilius and Droogmans, 2001, Storkebaum and Carmeliet,
2011).
At the center of this ionic regulation in VSMC is the presence of potassium channels responsible for integrating these signals and affecting vasomotor tone. There are 4 known classes of potassium channels within the VSMC: voltage gated potassium
2+ channels (KV), large conductance Ca -sensitive potassium channels (BKCa), ATP-
sensitive potassium channels (KATP), and inward-rectifying potassium channels (KIr)
(Nelson and Quayle, 1995, Ledoux et al., 2006, Ko et al., 2008). Briefly, each of these
receive input signals that alter their channel properties. Collectively, when activated, these
lead to a membrane hyperpolarization and vasorelaxation. Conversely, when these input
signals inhibit this group of ion channels, it leads to a depolarization of the VSMC and
Ca2+-influx and vasoconstriction. This summary is a gross oversimplification of the role of
K+-channels (and ion channels in general), as such please see the review by Nelson and
Quayle for a more detailed exploration of K+-channels in VSMCs (Nelson and Quayle,
1995).
Overall, the communication and ultimate vasoactive response is dictated by one
important ion: calcium. As Figure 1-3 demonstrates, calcium influx is central in both VSMC and ECs (and perivascular nerves, though not shown). In ECs, activation of eNOS occurs in a calcium dependent manner, where increased calcium activates the enzyme calmodulin, to increase eNOS activity (Arnold Wp Fau - Mittal et al., 1977, Pollock et al.,
1991, Félétou, 2011a, Félétou, 2011b). Ca2+ may enter the endothelium through a variety
16 A
B
Figure 1-3: Crucial role of Ca2+ signals within Endothelial and Vascular Smooth Muscle Cells. A) Within the endothelium increases in intracellular Ca2+ can occur through stimulation of compounds including IP3/DAG and AA/EETs. These products then activate multiple receptors within the endothelium to increase Ca2+. The responsible channels include: the TRP channels (TRPC, TRPV and TRPM), STIM1, Orai 1, and SERCA. This increase in Ca2+ activates a number of pathways including PKC and eNOS. B) Schematic of Ca2+ signals within the VSMCs demonstrate its central role for contraction/relaxation. Reproduced with permission from (Félétou, 2011a)(A) and (Khalil, 2010) (B).
17 of ion channels, including those in the transient receptor potential (TRP) superfamily
(Baylie and Brayden, 2011, Wong and Yao, 2011). Furthermore, it has been demonstrated
2+ that once intracellular calcium [Ca ]i concentrations increase, intermediate (IKCa) and small (SKCa) calcium activated potassium channels become activated. These channels are believed to be responsible for propagating the endothelial derived hyperpolarization factor (EDHF) signal (Baylie and Brayden, 2011, Félétou, 2011a, Félétou, 2011b, Wong
and Yao, 2011). In VSMC, Ca2+ is central to the determination of vasomotor tone. As
calcium enters into the cell contraction occurs, and the converse is true. Furthermore, Ca2+
levels are not only dictated by the ionic regulation (mentioned above), but can be regulated
2+ by Ca itself. For example, BKCa channels, which are similar to KV, become activated in a depolarized membrane potential; moreover, when Ca2+ enters the VSMC the voltage-
sensitivity of these ion channels shifts to the left (becoming active at more negative
potentials). This leads to potassium efflux from the channel, further repolarizing the VSMC
and providing a regulatory mechanism to prevent over-constriction within the vasculature
(Nelson and Quayle, 1995, Ledoux et al., 2006, Ko et al., 2008). Interestingly, TRP
channels, specifically, TRPV1 and TRPV4, are known to couple with BKCa (Nelson and
Quayle, 1995, Ledoux et al., 2006, Baylie and Brayden, 2011, Hill-Eubanks et al., 2014,
Earley and Brayden, 2015).
Overall, there are a numerous of other mechanisms regulating EC/VSM/neuronal
regulation of vascular control. Many of these can be reviewed more comprehensively
elsewhere, in works by Feletou, Duncker and colleages, Feigl, Vest and Heupler (Feigl,
1983, Nilius and Droogmans, 2001, Taniyama and Griendling, 2003, Ardanaz and
Pagano, 2006, Pacher et al., 2007, Duncker and Bache, 2008, Schulz et al., 2008,
Edwards et al., 2010, Khalil, 2010, Lima et al., 2010, Shimokawa, 2010, Baylie and
Brayden, 2011, Bohlen, 2011, Cioffi, 2011, Félétou, 2011a, Félétou, 2011b, Kurian et al.,
18 2011, Sabe and Heupler, 2013, Vest and Heupler, 2013b, Vest and Heupler, 2013a, Tune,
2014, Duncker et al., 2015, Earley and Brayden, 2015, Zhao et al., 2015, Ellinsworth et al., 2016). Finally, as one explores the regulation of cardiovascular hemodynamics it
becomes apparent that ion channels play an extremely vital role to this regulation. This
includes the role of potassium channels in VSMCs and ECs and VGCC in VSMC. Another
group of ion channels has been alluded to throughout the review of “classical” vascular
regulation. Termed the transient receptor potential (TRP) ion channels, this newer subset
of ion channels recently have been determined to play a role within the vasculature and have added more diversity to the understanding this already complex process.
Transient Receptor Potential (TRP) Channels:
TRP channels were first elucidated in a study describing the behavior of Drosophila
mutants that seemed to have impaired vision status upon exposure to bright light (Pak et
al., 1970, Earley, 2010). This mutant phenotype showed differences in the photoreceptor
membrane potential responses to continuous stimulation by bright light. In the mutant flies,
the response to changes in membrane potential are transient in contrast to the wild-type
flies whose response were continuous, and reveals how such channels received their
name (Montell and Rubin, 1989, Earley, 2010). Through the work of many, the TRP
superfamily of proteins have been characterized by the composition of 6 transmembrane
domains, with a pore loop found in between the fifth and sixth domains (Inoue et al., 2006,
Luo et al., 2008). Furthermore, other features of TRP channels is the presence of a
seventh domain, a ~25 amino acid residue domain termed the TRP domain, along with a
carboxyl and N-termini that dwell intracellularly (Clapham et al., 2001, Baylie and Brayden,
2011). Twenty-eight ion channels have been characterized to belong to the TRP
superfamily (Islam, 2011, Earley and Brayden, 2015). Further classification has divided
these channels into six sub-groups present in mice and humans: canonical (TRPC),
19 melastatin (TRPM), vanilloid (TRPV), polycystin (TRPP), mucolipin (TRPML) and ankyrin
(TRPA). Each group has been demonstrated to be in virtually all cell types to elicit a role in various physiological and pathophysiological processes (Earley, 2010, Hu et al., 2011,
Islam, 2011, Miller and Zhang, 2011, Nilius and Flockerzi, 2014, Earley and Brayden,
2015). The physiological role of this group of “truly remarkable protein[s]” have been intensely investigated over the last 15 years, and research has revealed that a number of these channels play a role in the regulation of the cardiovascular system.
Briefly, several members of the TRPC, TRPM, TRPV “families” have been identified to play a role in the cardiovascular system. Within the heart itself TRP channels
have been shown to contribute to numerous processes including the regulation of
contractility, pacemaker functions, and in the regulation of myocardial fibrotic process
(Adapala et al., 2013, Earley and Brayden, 2015). TRPV channels, specifically TRPV1,
have been demonstrated to be protective in models of ischemia/reperfusion and
myocardial infarction (Wang and Wang, 2005, Huang et al., 2009, Huang et al., 2010).
Overall, through the work of many, various TRP channels have been shown to play a
crucial role in endothelial, VSM cells, and perivascular nerves, demonstrating an
opportunity to investigate a new class crucial in the regulation of vascular tone (for more
comprehensive review see: (Baylie and Brayden, 2011, Wong and Yao, 2011, Hill-
Eubanks et al., 2014, Earley and Brayden, 2015)).
Transient Receptor Potential Vanilloid Ion Channels and Vascular Regulation
Recent studies in our lab have highlighted a role for the Transient Receptor
Potential Vanilloid Subtype 1 (TRPV1) channel in the vasculature, specifically the ability
of these channels in the endothelial layer to regulate coronary microvascular function.
TRPV1 is the seminal member of the TRPV family (six members numbered 1 through 6),
which derive its name from their homology with the first member of this family. TRPV1 is
20 named in response to the pivotal finding that it is activated by capsaicin, a vanilloid compound in chili peppers giving them their characteristically “hot” flavor (Baylie and
Brayden, 2011, Bevan et al., 2014). Of the 6 subtypes, only 4 have been implicated in vascular regulation (TRPV1-TRPV4 with TRPV1 reviewed below). TRPV2 has been identified to mainly be present in the smooth muscle layer and while activation did increase
2+ [Ca ]i, no studies subsequently have demonstrated a functional role (Baylie and Brayden,
2011, Earley and Brayden, 2015). TRPV3 has been shown to be involved in endothelial induced control of vascular function within cerebral arteries of rats, while in the smooth muscle it has identified via mRNA expression, however its functional role has yet to be revealed (Baylie and Brayden, 2011). Finally, TRPV4 role in the vasculature is as complex and diverse as TRPV1, and as such is out of the scope of this literature review (for further review see (Inoue et al., 2006, Earley, 2010, Baylie and Brayden, 2011, Earley and
Brayden, 2015).
Transient Receptor Potential Vanilloid Subtype 1 (TRPV1)
The initial discovery of TRPV1 was accomplished utilizing mRNA isolated from sensory neurons to identify ion channels that were activated by capsaicin (Caterina et al.,
1997, Hardie, 2007). TRPV1 has been extensively studied as evidenced by over 420 new papers per year from 2013-2015 published on Pubmed making it the most studied TRP channel. TRPV1 contains 6 transmembrane regions, is activated via ligands and demonstrates voltage-dependence, and ultimately acts as a non-specific cation channel
2+ (with a specificity towards Ca ; PCa/PNa ~5) (Bevan et al., 2014). TRPV1, a polymodal
channel, is induced by various physical and chemical stimuli including temperatures
greater than 42°C, capsaicin, allyl isothiocyanate, endocannabinoids, mechanical stimuli,
and endogenous ligands (i.e. anandamide) allowing these channels to function as broad
21 sensors in selective tissues (Earley, 2010, Baylie and Brayden, 2011, Wong and Yao,
2011, Hollis and Wang, 2013).
The regulation of TRPV1 is quite extensive and diverse and has been thoroughly
described elsewhere (Liao et al., 2013, Winter Z Fau - Buhala et al., 2013, Bevan et al.,
2014, Nilius and Flockerzi, 2014). Briefly, Phosphatidylinositol 4,5-bisphophate (PIP2) can both activate and inhibit TRPV1. PIP2-dependent inhibition of TRPV1 occurs via direct interaction/binding, yet elicits activation via cleavage of phospholipase C (Rohacs, 2015,
Ufret-Vincenty et al., 2015). TRPV1 is susceptible to rapid desensitization upon application of agonist, which occurs in the presence of Ca2+, suggesting a Ca2+-dependent process
(Rosenbaum et al., 2004, Bevan et al., 2014). A key structural component within all TRP
channels is the presence of the ankryin repeat domains. Importantly, ATP can directly binds and sensitizes TRPV1, but with the increase in Ca2+-influx through the channel, ATP is displaced allowing Ca2+-Calmodulin to bind and desensitize the channel (Lishko et al.).
This desensitization can be overcome and reversed via signaling mechanisms that include
PKA and PKC (specifically PKCε) (Mandadi et al., 2006, Bevan et al., 2014). Further, resensitization of TRPV1 has also been shown to involve a cross-talk mechanism between
TRPA1 and NO (Zhang et al., 2011, Sinharoy et al., 2015). Finally, TRPV1 has been shown to be sensitive to oxidative modification. Specifically, it was demonstrated that
TRPV1 could be s-nitrosylated at cysteines 621 and 616 and this PTM increased TRPV1’s sensitivity to pH and temperature (Yoshida et al., 2006). Finally, they also suggested a role for those same cysteines to be regulated by H2O2 and later work by Chuang and Lin
confirmed that these cysteines were being covalently modified by H2O2 (Yoshida et al.,
2006, Chuang and Lin, 2009). The assortment of substances and signals that are
responsible for the regulation of this ion channel offer an opportunity for further exploration
into TRPV1’s role in a diverse array of tissues and disease processes.
22 Initially, the discovery of TRPV1 in the dorsal root ganglions lead to an explosion
in the exploration of its function within the nervous system both in a sensory capacity (pain
and heat), but more recently in other neuronal tissues (Islam, 2011, Ramirez-Barrantes et al., 2016). However, since this initial discovery other tissues and cells have been identified to contain TRPV1. Specifically, there has been keen interest in the role of TRPV1 in the vasculature. (Inoue et al., 2006, Luo et al., 2008, Earley, 2010, Baylie and Brayden, 2011,
Cavanaugh et al., 2011, Torres-Narvaez et al., 2012, Hollis and Wang, 2013, Earley and
Brayden, 2015).
TRPV1 and the Vasculature
TRPV1 is expressed in numerous tissues that can affect regulation of vascular tone. This expression appears to vary by species and tissue. One complication with
TRPV1, and all ion channels for that matter, is the typical techniques by which protein expression is identified (i.e. western blots) depend on immunosensitivity of developed antibodies. Many of these antibodies have been shown to be quite susceptible to non- selective reactivity (Everaerts et al., 2009, Baylie and Brayden, 2011). As such, some of the best evidence for TRPV1 expression have come from a TRPV1 reporter mice demonstrating the distribution of TRPV1 in these various tissues. Through the use of these mice, TRPV1 was identified in arteriolar smooth muscle in various microvascular beds, possibly as a regulator of thermoregulation, and in perivascular nerves (Cavanaugh et al.,
2011). Furthermore, TRPV1 has been shown to be expressed in dog coronary vascular smooth muscle and selective vascular beds in rats (Hiett et al., 2014, Toth et al., 2014).
TRPV1 has also been identified in the endothelium (Golech et al., 2004, Bratz et al., 2008,
Ching et al., 2011, Ching et al., 2012). The expression of TRPV1 in all three layers of the
vasculature provides a unique opportunity to investigate the role of this ion channel in this
complex process. Below is an overview of TRPV1 in each of these vascular layers.
23 TRPV1-dependent VSM regulation of vasoreactivity has been quite variable within the literature. In the 1986 paper first documenting this effect, Duckles and co-workers
studied the differential regulation of capsaicin and capsaicin pre-treatment on cat middle
cerebral arteries and carotid arteries and aorta from guinea pig, both in vitro and in vivo
(Duckles, 1986). This study indicated that VSMCs of the middle cerebral artery contract in
response to capsaicin whereas the carotid artery and aorta of guinea pigs undergo
relaxation in response to capsaicin. In the guinea pig carotid artery and aorta, in vitro
relaxation was independent of the endothelium and was abolished by in vivo pre-treatment
with capsaicin. The authors rationalized that the variable capsaicin responses could be
explained as capsaicin causes contraction via a direct action on the VSMCs and dilation
was mediated via another substance released in response to capsaicin (Duckles, 1986).
Others have confirmed that capsaicin’s effects on the vasculature are variable (Earley,
2010, Baylie and Brayden, 2011, Earley and Brayden, 2015). Further investigations have
yielded a closer consensus that TRPV1 in VSMC induces vasoconstriction via increases
in intracellular calcium (Earley, 2010, Czikora et al., 2012, Earley and Brayden, 2015).
TRPV1 channels have the ability to influence neural control of vasodilation.
Calcitonin gene related peptide (CGRP) is coexpressed in TRPV1- expressing sensory
fibers that innervate the dural vasculature (Szallasi et al., 2007). Furthermore, TRPV1
expressed on trigeminal afferents in the cerebrovasculature is activated by the release of
anandamide from the endothelium (Akerman et al., 2004). TRPV1 channels are also found
to act as mechanoreceptors, sensing changes in arterial pressure, and are expressed in
afferent neuronal baroreceptor pathways. Signaling through these pathways is
compromised upon inhibition of TRPV1 channels, resulting in an increase of mean arterial
pressure (Sun et al., 2009). TRPV1 is also associated with the vasodilatory capability
through the release of CGRP and Substance P from TRPV1 expressing peripheral nerve
24 terminals. CGRP and Substance P bind to their respective receptors (CGRP-1 and
Neurokinin-1 receptor) on endothelial cells to elicit a robust increase in NO synthesis and release, resulting in smooth muscle relaxation (Gazzieri et al., 2006, Gupta et al., 2007,
Nicoletti et al., 2008, Starr et al., 2008).
Central to this dissertation, TRPV1 has been shown to be expressed in the endothelium. Initial work on TRPV1 and the endothelium demonstrated expression via mRNA. Initially, TRPV1 within the endothelium was first described in the brain (Golech et
al., 2004). Subsequent groups further identified other vascular endothelial cells that
contained TRPV1 (Bratz et al., 2008, Earley and Brayden, 2015). Our lab more recently
demonstrated the role of TRPV1 in the coronary vasculature (Bratz et al., 2008, Guarini
et al., 2012). Specifically, studies in swine and mice demonstrated endothelial TRPV1
increased NO production inducing vasorelaxation. Furthermore, we demonstrated that pH
(a known “activator”) of TRPV1 also regulated TRPV1-dependent vascular control of
coronary arterioles (Guarini et al., 2012). Similar to other TRP channels, the mechanisms
by which TRPV1 mediates vascular regulation within the endothelium include the
translation of physiological or chemical stimuli into changes in cytosolic Ca2+
concentration. This change in calcium activates the protein AKT leading to the regulation of CaMKII activity via phosphorylation, which further leads to AMPK phosphorylation.
Ultimately, AMPK alters eNOS functional activity in a direct and indirect fashion (Ching et
al., 2011, Ching et al., 2012, Ching et al., 2013).
Further work by our group not only demonstrated the role TRPV1 plays in coronary
vascular bed, but that in two diabetic models (swine on high fat/high cholesterol diet and mouse db/db model) the endothelial TRPV1-mediated coronary vascular control was impaired (Bratz et al., 2008, Guarini et al., 2012). Overall, this suggests TRPV1 may play
a central role in the development of diabetic microvascular dysfunction.
25 Diabetes Mellitus and Associated Complications:
The rate of diabetes has continued to climb at alarming rates, both in the United
States and across the world. Diabetes mellitus is characterized by two major sub-
classifications (Type I and Type II). However, there do exist a much smaller portion of
patients afflicted with diabetes that arise from other pathophysiological processes that
include pregnancy, endocrinopathies, genetic disorders and drug induced diabetes
(Forbes and Cooper, 2013). The pathological progression of type I diabetes, which compromises 5-15% of diabetic patients, is characterized by the autoimmune destruction
of the insulin producing β-cells within the pancreases, leading to a hypoinsulinimic state,
ultimately leading to hyperglycemia. Typically, this disease presents within the first two to
three decades in life.
Type II diabetes mellitus (T2DM) accounts for about 85% of the cases of diabetes
and presents in later decades (fifth through eighth). Pathologically, Type II differs from
Type I in that, there is a progressive increase in insulin receptor insensitivity, followed by a slow progression towards β-cell dysfunction if left untreated (Forbes and Cooper, 2013).
Recent large scale genome wide associated studies demonstrate at least 64 loci responsible for some of the heritability component to Type II diabetes (T2DM) (Morris et al., 2012). While these recent findings are important for the overall understanding of Type
II diabetes, it is widely accepted that a majority of Type II cases result from a “western lifestyle” leading to increases in obesity and progressing into T2DM. These factors include a diet rich in saturated fats and simple carbohydrates, with overall decreased physical activity (Forbes and Cooper, 2013).
The complications from both Type I and Type II diabetes are vast and include increased risk for nephropathy, neuropathy, glaucoma, and overall rise in morbidity and mortality due to cardiovascular disease (CVD) (Forbes and Cooper, 2013). This increase
26 in risk in CVD accounts for approximately half of the deaths observed in diabetes (Haffner
et al., 1998). With this increase in risk CVD complications can be broken down into two sub-categories: microvascular and macrovascular. Macrovascular complications are characterized by increased atherosclerosis in a multitude of vascular beds including the coronary arteries, aorta, and systemic arteries (e.g. brachial and iliac artery). Furthermore, this can lead to a decrease in overall compliance in the CV system leading to hypertension
(or at least worsening this CV process), which then compounds the cardiac complications further (Henry et al., 2003).
Diabetic Microvascular Dysfunction:
While macrovascular complications account for a significant percentage of the
CVD observed in diabetes, another and more often overlooked complication, is that of microvascular disease. Diabetic microvascular disease is defined as morphological and physiological changes present in the vascular system without significant contribution of atherosclerosis (Picchi et al., 2010). These include morphological changes in arterial thickness and overall increase fibrosis (both in the perivascular and interstitial layers) and functionally, NO signaling is impaired compared to non-diabetic controls (Picchi et al.,
2010, Adameova and Dhalla, 2014). This deficit in attention clinically may be due to the difficulty of assessing the physiology and pathology in a clinical setting; however, the mechanism of damage is drastically important as the studies that have been conducted have demonstrated a similar risk assessment as those in macrovascular observable diseases (Bairey Merz et al., 1999, Gulati et al., 2009). Recent evidence demonstrates
that diabetic patients with impaired coronary flow reserve (i.e. microvascular dysfunction)
and no evidence of coronary artery disease (CAD) have the same annualized cardiac
mortality as diabetic patients with known CAD, while those with intact coronary flow
reserve yielded a low mortality rate (Murthy et al., 2012).
27 Many theories exist as to the underlying mechanism behind this observed
phenomenon including the role of hyperglycemia, advanced glycation end products
(AGEs) signaling, altered PKC signaling, increase flux through polyol and hexosamine
pathways (Adameova and Dhalla, 2014). Brownlee proposed a hypothesis that would link
these major pathways: an overload of the glycolytic pathway (Brownlee, 2001). Ultimately, it was demonstrated that many of these pathways converted at one point: an increased production of oxidative stress. Physiologically, oxidative stress (OS) plays an important role in many organ systems. One of the classical pathways OS was demonstrated to be physiologically important was in innate immune cells (macrophages and neutrophils) where the production of H2O2 is vital for host defense against bacterial infections. Further
evidence has explored the role of OS in immune cells and discovered its vital role for the
activation/stimulation of important regulator pathways including NFκB, ERK, JNK, p38 and
PI3K/AKT (Wittmann et al., 2012). In the cardiovascular system, H2O2 is thought to act on
both the VSMC and EC and play a regulatory role in vascular tone (see above for EDHF)
(Ardanaz and Pagano, 2006, Bretón-Romero and Lamas, 2014). Furthermore, it was
demonstrated that physiological concentrations of H2O2 can signal EC to proliferate via the ERK1/2 MAPK pathway (Wung et al., 1999, Bretón-Romero and Lamas, 2014).
While this production of H2O2 will initially drive vasoreactivity the consequences of sustained increases in ROS (as seen in diabetes), can lead to overall endothelial and vascular dysfunction. As mentioned previously, with an increase in ROS, NO bioavailability decreases due to the increased formation of peroxynitrate (Pacher et al.,
2007, Chen et al., 2012). A decrease in NO bioavailability represents a pathway for impaired vascular relaxation. Conversely, with a reduction of the vasodilatory response diabetes also increases the vasoconstriction response from factors such as endothelian-
1 and angiotensin II (Brownlee, 2001, Jay et al., 2006, Forbes and Cooper, 2013, Isfort et
28 al., 2013). Recent work by Gutterman and colleagues have demonstrated in this NO
reduction endothelial-dependent dilation is preserved, at least initially. The focus of their
work has been on a “molecular switch” from NO to H2O2 and/or EETs (Gutterman et al.,
2016). Further, they propose this switch is to maintain the crucial blood flow required to a
tissue while acknowledging that the presence of a continued elevation of ROS does lead
to a pro-inflammatory, pro-proliferative and pro-thrombotic state (Gutterman et al., 2016).
It is also well documented that diabetes alters many ion channels including impairing
coronary BKCa, Kv, KATP channels in swine fed a high fat/high cholesterol diet (Borbouse et al., 2009, Borbouse et al., 2010). Central to this dissertation, diabetes has been shown
to alter TRPV1 within the vasculature as well (Bratz et al., 2008, Guarini et al., 2012, Sun et al., 2013).
Interestingly, the importance of ROS in the pathophysiology of many disease
processes, including diabetes, has been investigated extensively in the clinic. In large
randomized control clinical trials, the use of antioxidants has been used and shown to be
of no benefit or even detrimental in some conditions (Bjelakovic et al., 2013, Halliwell,
2013). While there have been criticisms of these trials, this collection provides insight into
the need for more research into the underlying mechanisms that so better therapeutic
agents can be developed and employed in the clinic to treat conditions like diabetic microvascular disease and diabetic cardiomyopathy.
Lipid Peroxidation and 4-hydroxynonenal:
The shift from a physiological to pathological level of ROS present in diabetes can leads to an overall increase in cellular oxidants. These vast reactive products react with many of the cellular products including DNA, proteins and lipids. As mentioned above,
- when oxidants (i.e. H2O2 and ONOO ) directly interact with proteins they modify their activity. However, when these oxidants react with lipids they produce byproducts of lipid
29 peroxidation. This complex process will produce a variety of end products depending on
the initial lipid composition (Benedetti et al., 1980, Poli et al., 2008, Ullery and Marnett,
2012, Chapple et al., 2013, Jaganjac et al., 2013, Ayala et al., 2014).
4-Hydroxy-2-nonenal (4-HNE) is produced by an increase in ROS leading to lipid peroxidation. 4-HNE is an α,β-unsaturated hydroxyalkenal produced from η-6 fatty acids such as linoleic and arachidonic acid (Catalá, 2009, Ullery and Marnett, 2012). The formation of 4-HNE is quite complex, but recently there have been advances in this field.
Although no consensus has formed, it has been document that anywhere from 3-5 different pathways exists for the potential formation of 4-HNE in vivo (Spickett, 2013).
Although many lipid peroxidation products can be formed when there is dysregulation of
ROS, it has been well established that 4-HNE is the major by-product exhibiting most of
the cytotoxic effects and thus thought to be the major transducer of this specific cellular
damage (Ayala et al., 2014, Choi et al., 2014). This highly reactive carbonyl species is known to react with the thiol group on cysteine residues, leading to the formation of
Michael adducts. Furthermore, it is known to react with the imidazole group on histidine residues as well as with lysine residues (Pryor and Porter, 1990, Esterbauer et al., 1991,
Nadkarni and Sayre, 1995). The reactivity to each amino acid is quite different. 4-HNE reacts with cysteine residues to a greater extent followed by histidine and finally lysine residues (Esterbauer et al., 1991, Poli et al., 2008).
Importantly, 4-HNE (like H2O2) displays a double-edge sword within cellular signaling. Interestingly, when β-cells of the pancreases were exposed to high glucose, 4-
HNE production increased. Unexpectedly, though this increased the glucose stimulated
insulin release via activation of PPAR-δ (Cohen et al., 2013). Furthermore, at sub- micromolar levels it has also been demonstrated that 4-HNE induces autophosphorylation of epidermal growth factor receptor (EGFR) implicating a potential role in cell proliferation
30 (Chapple et al., 2013). However, at concentrations above 10 μM 4-HNE has been shown
to modify proteins and be quite detrimental to their function. Recent work demonstrated that muscle exogenously treated with 4-HNE reduced insulin signaling which was reversed with the addition of compounds to increase the glutathione poll in the cell (Pillon et al., 2012). This work provided further evidence that the metabolism of 4-HNE occurs through glutathione, suggesting that a targeted approach for decreases 4-HNE sequelae would be to increase glutathione pools (Cohen et al., 2013, Jaganjac et al., 2013). The
other major consequence of pathophysiological 4-HNE modification is an increased flux
of proteins through the ubiquitin-proteasomeal pathway. In endothelial cells treated with
4-HNE, it was revealed that a reduction in protein expression of guanosine triphosphate cyclohydrolase I and heat shock protein 90 diminished eNOS activity and NO production
(Whitsett et al., 2007). Further examples of proteins being down regulated via increased degradation include adiponectin and alcohol dehydrogenase (Grune and Davies, 2003,
Carbone et al., 2004, Botzen and Grune, 2007, Catalá, 2009, Wang et al., 2012, Cohen et al., 2013).
Overall, 4-HNE has been identified as playing a role in the pathogenesis in diseases including cardiovascular disease and diabetes (Chapple et al., 2013, Cohen et al., 2013, Mali and Palaniyandi, 2014). Specifically, patients with dilated cardiomyopathy have demonstrated an increase in 4-HNE modified proteins in endomyocardial biopsies; patients with ischemic heart disease show increase in circulating modified proteins; and patients with deep vein thrombosis had an overall increase in circulating 4-HNE concentrations (Re et al., 1998, Nakamura et al., 2002, Dominguez-Rodriguez et al., 2005,
Poli et al., 2008). Interestingly, 4-HNE has been implicated to regulate ion channels.
Specifically, 4-HNE has been shown to enhance L-type calcium channel currents (Lu et
al., 2002, Akaishi et al., 2004) whereas the Ca2+-ATPase and Na+/K+-ATPase channels
31 demonstrated inhibition (Poli et al., 2008). Interestingly, 4-HNE has been previously shown to activate the TRPA1 channel, and further work by Cao and colleagues demonstrated this activation in β-cells in the pancreas released insulin independent of KATP or VGCC
activation (Trevisani et al., 2007, Cao et al., 2012). Taken together, it is no surprise that
4-HNE is of keen interest to the work herein due to it being a prevalent byproduct in diabetes and demonstrating its ability to regulate ion channels.
Relevance:
Overall, previous work by our group and others has demonstrated a central role
for TRPV1 in vascular function and the subsequent regulation of CBF. Further clarification,
demonstrated that TRPV1 regulation of CBF was dysfunctional of diabetes (swine and
mice) (Bratz et al., 2008, Guarini et al., 2012). This disruption of CBF in diabetes has been described in humans and characterized by diastolic dysfunction in the absence of other gross pathological findings (i.e. atherosclerosis or ischemic heart disease) (Rubler et al.,
1972, Brooks et al., 2008, Schilling and Mann, 2012). Many underpinnings have been proposed as being key to the development of this pathological process; central to these are two key understandings that (1) diabetes alters the microvasculature with in the coronary vascular bed and (2) diabetes increases the overall ROS leading to an imbalance environment. Ultimately, this suggests a central role for TRPV1 in the development of microvascular dysfunction observed in diabetes that demands to be explored.
It is well established that a ROS imbalance can lead to altered cellular functions, including the production of toxic byproducts. These are produced from a variety of cellular organelles including the lipid bilayer; moreover, the oxidation of said lipids results in lipid peroxidation products including the most prominent species 4-HNE. Finally, TRPV1 is known to be regulated and sensitive to cysteine modifications via many products including
H2O2 and 4-HNE. Overall, taking our previous results into account and an understanding
32 of TRPV1 regulation; the goal of this dissertation was to investigate diabetic microvascular dysfunction results from ROS-mediated post-translational modification of
TRPV1 leading to channel dysfunction and loss of endothelial TRPV1-mediated vascular signaling. Utilizing integrated varied approaches, we propose the following Specific Aims:
Aims:
1) H2O2 differentially regulates vascular endothelial TRPV1.
Rationale: Specifically, H2O2 acutely activates endothelial TRPV1 contributing to
CBF regulation. However, upon prolonged OS exposure, TRPV1 channel activity
becomes impaired, contributing to the overall microvascular dysfunction observed
in diabetes
2) (A) 4-HNE-mediated PTM of TRPV1 results in channel dysfunction leading to
attenuated TRPV1 interaction with Cav-1 and resultant decreased eNOS activity.
Rationale: Specifically, 4-HNE is produced via an increase in ROS, and
subsequently modifies TRPV1 via carbonylation of its cysteine residues ultimately
diminishing TRPV1- mediated eNOS signaling suggesting a role in diabetic
microvascular dysfunction. (B) Endothelial TRPV1 localizes to endothelial
caveolae to form a larger signaling complex with Cav-1/TRPV1/eNOS.
33 1 - Caveolin 2+ Ca vasorelaxation TRPV1 2+
Ca Impaired vasorelaxation Aim 2A TRPV1 Endothelial TRPV1 Endothelial - ROS 4 HNE ROS ROS ROS ROS ROS 2 2 O O 2 2 4: Hypothesis and Aims Schematic and Aims 4: Hypothesis H H - 2+ 2+ Ca Ca 2 O 2 vasorelaxation H Impaired vasorelaxation Figure 1 2 O TRPV1 2 TRPV1 H 2 O 2 H 2 2 O O 2 2 H H 2 2 O O 2 2 H H
[H2O2] 34 Chapter 2: Materials and Methods
Mice: All procedures were conducted with the approval of the Institutional Animal Care
and Use Committee of the Northeast Ohio Medical University (NEOMED) and in
accordance with National Institutes of Health Guidelines for the Care and Use of
Laboratory Animals (NIH publication 2011). All mice were originally purchased from
Jackson Labs (Bar Harbor, ME) after which mice were bred in the NEOMED animal facility.
Experiments were performed in 10 - 12 week-old male TRPV1 Knockout (V1KO –
C57BK/6 background), db/db or aged-matched, C57BK6/J (WT) mice as controls. Mice were housed in a temperature-controlled room with a 12:12-h light-dark cycle and maintained with access to food and water ad libitum.
Jugular and Femoral Artery Catheterization: Mice were initially anesthetized via inhaled anesthesia (isoflurane 1-3%) and subsequently placed and secured in supine position on temperature regulated platform (37°C). Subsequently, mice were treated with
Nair for hair removal on their ventral surfaces. Mice were then placed under a dissecting microscope and the right jugular vein was visualized, isolated and then cannulated for drug infusion. Following, hair was removed from the left hindpaw and the area was dissected exposing the femoral triad. The femoral artery was separated away from the femoral vein, tied off with suture and punctured. A 1.2F pressure catheter (Transonic), was inserted into the femoral artery (and advanced to the abdominal aorta) to continuously monitor blood pressure and heart rate in response to numerous interventions.
Contrast Echocardiography CBF Measurements: For myocardial contrast echocardiography (MCE), animals were prepared as described in previous section. Pre-
35 warmed echocardiography gel was placed on the thoracic cavity of the mouse where a short axis view of the heart was visualized at the mid-papillary level ACUSON SEQUOIA
512 Ultrasound System (Siemens) with low-MI (0.3) imaging, and high-MI (1.9) destruction
was used to detect changes in MBF. Appropriate settings were applied to reduce
background and images were captured at a rate of 20 Hz.
Experimental protocol: Following surgery, mice were given a bolus injection of the
ganglionic blocker hexamethonium (HEX, 5 mg/kg, Sigma) to eliminate reflex adjustments
and focus on the primary vascular actions of capsaicin and H2O2. Initial studies were
performed analyzing changes to coronary blood flow via continuous infusion of H2O2
and/or capsaicin administered in an escalating fashion at the rate of 20 or 40 µl/min for 4
min. Mice were infused with capsaicin (1 - 100 µg/kg) or H2O2 (0.2, 0.4, 2 and 4
µmol/kg/min) alone or in combination in the presence or absence of the TRPV1 inhibitor
SB366791 (100 μg/kg iv, Sigma). Furthermore, a subset of db/db mice were injected (via tail vein administration) with PEG-Catalase (3 times per week, 7000 Units/injection) for one week. Another subset of mice were infused with capsaicin (1 - 100 µg/kg) following a
4-HNE pre-treatment (10 mg/kg over 10 minutes). For those mice treated with
SB3667691, 10 minutes elapsed following each inhibitor before H2O2 and/or capsaicin infusion began to allow for MAP to stabilize. During all experiments non-targeted contrast was simultaneously infused. Non-targeted contrast was synthesized via combination of
Polysterate-40 and distearoyl phosphatidylcholine saturated with decafluorobutane gas and sonicated in sterile PBS. For validation of Method Please see (Ohanyan et al., 2015).
Isolated coronary microvessel reactivity studies: Mice were anesthetized and hearts
were excised and placed in ice-cold physiological saline solution. Coronary arterioles were
dissected free from ventricular wall tissue in buffer containing (mM) 145 NaCl, 5.0 KCl, 2.5
CaCl2, 1.17 MgSO4, 25.0 NaHCO3, 10 glucose; pH 7.4. Isolated vessels were then
36 cannulated onto glass pipettes and secured with silk suture in a temperature-controlled chamber (Danish Myotech, DMT, Atlanta, Georgia). Subsequently, the chamber was
mounted on the stage of an inverted microscope outfitted with a video camera and edge
detection analyzer. Arterioles were pressurized to 60 mmHg and warmed to 37ºC. Vessel
viability was determined using 60 mM KCl. Vessels were pre-contracted with the
thromboxane mimetic, U46619 (1 µM), and relaxation was assessed to capsaicin, sodium
nitroprusside (SNP), or H2O2. To further elucidate the mechanisms by which the relaxation
occurred inhibitors of NOS activity (L-NAME), various reducing agents (DTT), and
pharmacological inhibitors of the TRPV1 (SB366791) and voltage-gated potassium
channels (4-Aminopyridine, Kv; Penitrem A, BKCa;) were used. Similarly, the effects of
DTT on KCl-mediated contraction were examined. Finally, further experimentation investigated the role of 4-HNE on capsaicin induced vessel reactivity following 1-hour intraluminal infusion of 4-HNE (10 μM). Drugs were administered in 4 min. increments with steady state diameter measurements taken over the course of the final 30 seconds of concentration exposure.
Endothelium disruption: The endothelium was disabled in a subset of coronary arteriole experiments by passing ~1 ml of air through the lumen. Disruption of the endothelium was assessed by exposing U46619-constricted arterioles to Acetylcholine (ACh, 1 µM). Only arterioles where ACh-mediated vasodilation was absent (< 10%) were used.
TRPV1 DNA construct creation- Initial pCDNA3-rTRPV1 (WT) was obtained from the lab of Dr. David Julius. Subsequent plasmids were created and confirmed by standard sequencing methods. Mutant constructs of C616G-rTRPV1, C621G-rTRPV1, C634G- rTRPV1 and TriC-rTRPV1 are on the pCDNA3 plasmid and were acquired from Dr.
Viktorie Vlachova.
37 TRPV1-GFP fusion: Utilizing the TRPV1 sequence inserted in pCDNA3 primers were designed to add a HindIII restriction site at the 5’ end of the TRPV1 sequence and ApaI at
the 3’ end (5’- GAGACCCAAGCTTGGTACCGAGC-3’ (forward), 5’-
TCCATTGGGCCCATTTCTCCCCT-3’ (reverse)). The 3’ reverse primer was designed so
when TRPV1 was inserted into the pEGFP-N1 (Clonetech, Mountain View, CA, USA) it
would remain in-frame and add the EGFP to the Carboxy-terminal end of TRPV1.
Following, pEGFP and TRPV1 PCR product were sequentially digested with HindIII and
ApaI (New England BioLabs, Ipswich, MA, USA) and run on 1% agarose gel. Following
isolation of each product from agarose gel, ligation of TRPV1 into the pEGFP-N1 was
accomplished by utilizing T4 DNA Ligase (New England BioLabs, Ipswich, MA, USA) in a
3 to 1 molar ratio of insert to vector (TRPV1:pEGFP-1). Plasmid was transformed into
TOP10 E. coli (Thermofisher Scientific, Carlsbad, CA, USA) and grown on agar plates and
insertion was confirmed utilizing standard sequencing and visualization via florescent
microscopy.
TRPV1-6x His: The His tagged TRPV1 following was formed as a double stranded oligo
5’-CAGGGGAGAAACATCATCACCATCACCATTAACCCGGGGGGCC-3’ (Sense); 5’-
CCCCGGGTTAATGGTGATGGTGATGATGTTTCTCCC-3’ (anti-Sense) (Integrated DNA
Technologies). This DNA sequence was formed to utilize the overhangs to complement
the restriction enzyme overhangs of ApaI and PasI and continues to read in-frame
extended 6 His amino acids with a stop sequence following. As such, pCDNA3-TRPV1
(both WT and C621G mutant) was digested sequentially with ApaI and PasI (respectively)
and run on a 1% agarose gel. The linearized plasmid was isolated from the gel, removed
from agarose, and subsequently mixed and ligated with the His tag sequence to form
plasmids of WT-rTPV1-His and C621G-rTRPV1-His. His-tag was confirmed in a variety of
ways: 1) Following insertion of the new sequence, a new XmaI cutting site was inserted
38 allowing for differentiation between His tagged and non-His tagged TRPV1 constructs. 2)
Subsequent Plasmids were sent for DNA sequencing (GenScript Biotech Corp.,
Piscataway Township, NJ, USA). 3) Protein expression analysis was performed by western blot (see below for details) utilizing antibody specifically for the His Tag motif (His-
Tag Antibody #2365, Cell Signaling, Danvers, MA, USA). Generation of a His-tagged
TRPV1 was used to isolate TRPV1 from transfected HEK cells for the integration of PTM of TRPV1 via Mass spectroscopy and western blot (see protocols below). pLENTI-TRPV1: The development of a lentivirus for the transduction of HEK cells to constitutively express TRPV1 was accomplished by utilizing pENTR technology
(Thermofisher Scientific, Carlsbad, CA, USA). Briefly, pcDNA3-TRPV1 was digested with
KpnI and NotI (New England BioLabs, Ipswich, MA, USA) restrictive enzymes, as these were located both upstream and downstream (respectively) in the TRPV1 sequence as well as in the pENTR2B plasmid multiple cloning site. Following digestion of both pENTR2B and pcDNA3-TRPV1, linearized products were run on 1% agarose gel and products isolated via gel clean up kit (Omega Bio-teck, Norcross, GA, USA). Ligation of
TRPV1 into the pENTR2B was accomplished by utilizing T4 DNA Ligase (New England
BioLabs, Ipswich, MA, USA) in a 3 to 1 molar ratio of insert to vector (TRPV1:pENTR2B).
Plasmid was transformed into TOP10 E. coli (Thermofisher Scientific, Carlsbad, CA, USA)
and grown on agar plates and insertion was confirmed utilizing standard sequencing. Next, pENTER2B was mixed with pLENTI6.2/V5 (Thermofisher Scientific, Carlsbad, CA, USA) in equal concentrations and Clonase II was added. Proteinase K was added after 18 hours of the reaction to halt any further reaction. Stbl3 E. coli (Thermofisher Scientific, Carlsbad,
CA, USA) were then transformed with the pLENTI6.2/V5-TRPV1 plasmid and grown on agar. Initial plasmid verification was performed utilizing the endonuclease AflII and
samples were further verified by sequencing.
39 Constitutive Expressing HEK-TRPV1 cells: Following the formation of pLENTI-TRPV1 plasmids, HEK-293FT cells were grown to ~60% confluency in 125 mm plates and transfected with pLENTI-TRPV1, pMDL, pREV, pVSVG plasmids using a CaCl2 transfection protocol (Thermofisher Scientific, Carlsbad, CA, USA). Media was changed
24 hours after initial transfection. Following the media change, the media was then collected and centrifugated at ~2,000 x g to remove any cellular debris. The remaining media was then ultracentrifugated at ~20,000 RPM for 2 hours and viral particles were saved. Following the determination of blasticidin’s lethal concentration for HEK293A cells
(0.8 μg/mL), viral particles were added to HEK293A cell media and allowed to transform over 24 hours. Following transformation, cells were then grown in media containing blasticidin for 1 week until a mix population of HEK cells constitutively expressing TRPV1 were obtained. Confirmation was performed utilizing, western immunoblot probing for
TRPV1 (see protocol below).
Isolation of endothelial cells: Endothelial cells were isolated using the aortic explant method. Briefly, aortic rings and coronary microvessels were placed in Matrigel for 7 days.
The vascular tissue was carefully removed, and endothelial cells were isolated, washed, and plated on gelatin (0.1%)-coated dishes. Mouse aortic endothelial cells (MAEC) and coronary endothelial (MCECs) were cultured on fibronectin-coated tissue culture dishes and grown in a defined medium composed of low-glucose DMEM, 10% FBS, 10% Nu
Serum IV, basic fibroblast growth factor (6 ng/ml), heparin salt (0.1 mg/ml), 1% insulin- transferrin-selenium, and antibiotic/mycotic mix. Cells were cultured in a 37°C, 5% CO2 incubator, split at 90–95% confluence, and used between passages 11 and 22. MCEC from C57BL6 mice∼ were acquired from Cell Biologics (Chicago, IL) and grown in EC media containing VEGF, ECGS, Heparin, EGF, Hydrocortisone, L-Glutamine, Antibiotic-
Antimycotic solution and FBS.
40 Cell Culture and Transient Transfection: Overall, three main cell lines were used,
Human Embryonic Kidney-293A (HEK – Gift from Marc Penn laboratory) cells, Bovine
Aortic Endothelial Cells (BAEC – Cell Applications) and Mouse Coronary Endothelial Cells
(MCEC – Cell Applications). HEK cells were utilized as a model to investigate TRPV1- dependent currents due to their low expression of ion channels (Thomas and Smart,
2005). BAECs were used to examine if endothelial milieu alters TRPV1 compared to HEK.
HEK cells were maintained in Dulbecco’s Modified Eagle’s Media (ThermoFisher,
Carlsbad, CA) supplemented with 10% Fetal Bovine Serum, 2 mM L-Glutamine, 100 U/mL
Penicillin and 100 μg/mL Streptomycin. Bovine aortic endothelial (BAECs) cells were maintained (from passages 3 to 9) in bovine endothelial cell growth media from Cell
Applications (San Diego, CA). Commercially available MCECs (Cell Biologics, Chicago,
Il) were maintained (from passages 1 to 6) in mouse endothelial cell basal media provided.
Both BAEC and HEK293A cells were plated in a 12-well plate for 24 to 48 hrs. after which, cells were transfected with Mirus TransIT®-2020 according to the manufactures protocol. pCDNA3-Rat TRPV1(WT; Gift from Dr. David Julius) and pCDNA3- Rat TRPV1(C616G,
C621G, C634G and Tri-C mutant; Gift from Dr. Viktorie Vlachova) were co-transfected with EGFP-N1 (Clontech) (4:1 ratio). Cells were trypsinized and used within 36-48 hours
following transfection.
Cell Survival Assay: To examine the effects of prolonged H2O2 and 4-HNE exposure on
cell survival, a Prestoblue® assay (measure of cell survival) was performed in HEK and
BAECs for H2O2 treatment (1 μM to 10 mM;1 hour) and in HEK only for 4-HNE (1 μM to 5
mM; 1 hour). Briefly, HEK and BAEC cells were seeded into a 96-well plate and allowed to grow to confluence overnight. Cells were treated with H2O2 and 4-HNE in complete media for 1 hour. Following the 1-hour treatment, 4-HNE and H2O2 media was removed
and cells were washed with PBS. Prestoblue® reagent (Invitrogen) was added to complete
41 media (at 10% of final v/v) and 100uL of Presto blue and complete media were added to each well. Following a 2-hour and 4-hour incubation, plates were read for fluorescence
(535 nm excitation/ 615 nm emission). Each treatment was done in quadruplicate and data represents 3 separate experiments.
Patch-clamp electrophysiology: HEK and BAEC cells were transfected as described above and isolated for whole-cell patch clamp recordings. All solutions and subsequent current measurements were performed at room temperature. Cells were seeded on glass bottom and allowed to attach on inverted microscope. Cells were continuously perfused with solutions listed below. Data were acquired and analyzed using an Axopatch 200B amplifier and pCLAMP10 software (Axon Instruments, Union City, CA, USA). Currents were filtered with a low pass Bessel filter at 1 kHz and sampled at 5 kHz. Borosilicate pipettes (World Precision Instruments, Sarasota, FL, USA) were heated, pulled and fire polished to resistances of 0.5-3 MΩ. After whole-cell access was established, series resistance and membrane capacitance were compensated as completely as possible.
Current-voltage relationships were assessed by 400-ms step pulses from −100 to +100 mV in 20-mV increments from −40 mV holding potential. Steady state currents (average of 350-400 ms intervals) were used to generate I/V plots. Investigation of inward currents in non-transfected endothelial cells was accomplished via holding cell at -60 mV and examining H2O2-induced current following a 20 s burst of 100 μM H2O2. For whole-cell
patch, the extracellular bath solution contained (in mM): 135 NaCl, 5 KCl, 2CaCl2, 1
MgCl 2, 10 Glucose, 10 HEPES 5 Tris-base, and pH 7.4 with NaOH. Intracellular solutions contained 140 KCl 1 MgCl2, 1 EGTA, 5 MgATP, 1 Na-GTP, 10 HEPES, 5 Tris-base, and
pH 7.1 with KOH.
Molecular modeling and Docking studies: Molecular modeling studies were performed
using YASARA 14.7.17 (www.yasara.org) (Krieger et al., 2002). The crystal structure of
42 TRPV1 was used in our studies (Moiseenkova-Bell et al., 2008, Liao et al., 2013). The structure of 4-HNE was obtained from PubChem and used in the docking studies with
TRPV1. Using the docking program Autodock VINA (Trott and Olson, 2010), which is integrated into YASARA, global docking to the protein was assessed and binding simulations were then visually inspected for feasible interactions.
Intracellular Calcium Imaging: MCECs were cultured to 95% confluence and subsequently treated for 30 min with 4-HNE (10 μM) and subsequently incubated for 30 min with fura-2 acetoxy methylester (fura-2/AM; 2 μmol/L) in endothelial cell media without
FBS (Cell Biologics) at 37°C (total of 1-hour 4-HNE treatment). For complete protocol,
refer to Zhang et. al. (Zhang et al., 2011). Cells were mounted onto an Olympus IX-81 inverted fluorescence microscope (Olympus America, Lake Success, NY) and visualized utilizing the fluorescence imaging system Easy Ratio Pro (Horiba Instruments Inc,
Coraopolis, PA). Other equipment involved included a multi wavelength spectrofluorometer (DeltaRAM X) and a QuantEM512SC electron multiplying Charged-
Coupled Device camera (Photometrics, Tuscon, AZ). Images and photometric data were acquired by alternating excitation wavelengths between 340 and 380 nm (20 Hz) and monitoring an emission wavelength of 510 nm. Solutions were complete endothelial media without FBS, supplemented with either 4-HNE (10 μM) or capsaicin (100 nM- without 4-
HNE). Media plus 4-HNE was used as “basal media” to continue the presence of 4-HNE and following the resolution of a baseline, a switch in solutions to capsaicin was performed for 20s. Drugs were perfused in at a rate of 2 mL/min. Cells were analyzed for peak differences in calcium-influx versus baseline.
Western Blot Protocol: Cells were cultured and transfected with respective plasmids.
Following 48-hour incubation, cells were treated in their experimentally appropriate manner as outlined below. Cells were then washed with ice cold PBS and scrapped off
43 the bottom of plates. Cells were centrifugated at 1,000 x g for 5 min at 4° C. Triton-X 100
Buffer (Boston Bioproducts, Boston, MA), supplemented with proteinase inhibitor cocktail
inhibitor, (Sigma Aldrich, St. Louis, MO) was added to each sample and incubated for 30
min (with vigorous vortexing every 10 min). Following incubation, cells were centrifugated
at 20,000 x g for 20 minutes at 4° C and supernatant was collected. BCA protein assay
was performed to measure protein concentration and allowed for equal loading of ~20 μg
of protein. Samples were reduced utilizing lamelli buffer (Boston Bioproducts, Boston, MA,
USA) plus β-mercaptoethanol (Bio-rad Laboratories, Hercules, California, USA) (90/10 v/v
ration) and heated at 95 °C for 10 minutes. Next samples were loaded into a
polyacrylamide gel and run to completion. Samples were subsequently transferred to
PVDF membrane and blocked with 5-10% milk (Bio-rad Laboratories, Hercules, California,
USA) in 1% Teween-20 Tris-Buffered Saline (TBST) and incubated with indicated
antibodies.
TRPV1 expression following 4-HNE and H2O2 treatment: HEK cells were transfected with WT-rTRPV1 for 48 hours, and then treated with 100 μM H2O2 and 10 μM 4-HNE,
respectively for 1 hour. Following, cells were isolated and protein isolated and run on
polyacrylamide gel. Following transfer and blocking, membranes were incubated with anti-
TRPV1 (R-130, Santa Cruz biotechnology, Santa Cruz, CA, USA). This rabbit polyclonal
antibody, recognizes the first 130 amino acids on the N-terminal end of Rat TRPV1.
Quantification, was performed utilizing densitometry analysis from Image J (NIH,
Bethesda, MD, USA) with protein normalization to β-actin (C4 HRP, Santa Cruz
Biotechnology, Santa Cruz, CA, USA).
His Tagged TRPV1: Protein from HEK cells transfected with WT-rTRPV1, WT-rTRPV1-
His, and C621G-rTRPV1-His and probed for 6x His tag utilizing a rabbit polyclonal
antibody (#2365, Cell Signaling Technology, Danvers, MA, USA).
44 4-HNE PTM quantification: HEK cells transfected with WT-rTRPV1, WT-rTRPV1-His, and C621G-rTRPV1-His were treated for 1-hour with 10 μM 4-HNE. Following, protein isolation (utilizing Triton-X 100 Buffer without EDTA) supernatant was mixed with 50 μL of
Dynabeads® with a Ni-NTA moiety (ThermoFischer, Carlsbad, CA). Samples were then isolated utilizing manufactures protocol. Briefly, samples were allowed to sit for 30 min at
4°C with 20 mM imadozle to reduce non-specific binding. The samples were then washed with Wash Buffer (50 mM sodium-phosphate, pH 8.0, 300 mM NaCl, 0.01% Tween-20 and 50 mM imidazole). Following the final wash, beads were mixed with Elution buffer
(300 mM imidazole, 50 mM sodium-phosphate pH 8.0, 300 mM NaCl and 0.01% Tween-
20) to elute protein of interest. Goat anti-4-HNE antibody (Millipore, Darmstadt, Germany) and rabbit anti-TRPV1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were utilized to interrogate 4-HNE PTM of TRPV1. Membranes were then washed with excess TBST and rabbit anti-goat secondary (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was added. eNOS phosphorylation quantification following 4-HNE Treatment: The effects of 4-
HNE treatment on TRPV1-dependent phosphorylation of eNOS was examined. Following
1-hour pretreatment of 4-HNE (10 μM) or vehicle control, MCEC were treated with
capsaicin (1 μM for 5 and 15 minutes). Utilizing western blot (as outlined above) protein
was isolated (with the addition of a phosphatase inhibitor (Sigma)). Total protein was
loaded and phosphor-eNOS was probed utilizing an antibody to serine 1177 of eNOS (p-
eNOS) (Cell Signaling, Danvers, MA, USA). Total eNOS (t-eNOS) and β-actin (Santa Cruz
Biotechnology, Santa Cruz, CA, USA) were used as loading controls. Finally, the ratio of p-eNOS/t-eNOS was determined.
Cav1/TRPV1 Immunoprecipitation: Utilizing the Pierce Co-Immunoprecipitation Kit
(#26149, ThermoFischer, Carlsbad, CA, USA) TRPV1 (R-130, Santa Cruz biotechnology,
Santa Cruz, CA, USA) and Cav-1 (N-20, Santa Cruz biotechnology, Santa Cruz, CA, USA)
45 antibodies were conjugated to agarose beads per kits protocol. BAECs were cultured to confluency and protein was isolated as described in the Western Blot Protocol above.
Protein was then pre-cleared with agarose beads with no antibody conjugation. Then samples were mixed with TRPV1 or Cav-1 antibody for 30 min at 4 °C. The agarose beads were then separated and the remaining protein eluted. The protein bound to the conjugated beads was washed with PBS four times and then eluted with a low pH buffer
(pH = 2.8). Eluted proteins were then run on SDS-page gel and transferred to PVDF membrane. TRPV1 and Cav-1 protein were probed for as described according to western blot protocol above.
TRPV1-PTM investigation via Mass Spectroscopy: HEK cells were grown and
transfected with WT-rTRPV1-His for 48-hours and then treated with vehicle or 10 μM 4-
HNE for 1 hour. Protein was isolated utilizing the same protocol as 4-HNE PTM
quantification. Following the elution of the protein, it was loaded into two NuPAGE™
Novex™ 10% Bis-Tris Protein Gels (ThermoFischer, Carlsbad, CA, USA). One gel had
~5-10% of total protein and utilized to visualize TRPV1 via western blot protocol (see
above), while the other contained a majority of the elutant. Following, completion of
electrophoresis in MOPS buffer, the gel containing the majority elutant was stained
utilizing GelCode™ Blue Safe Protein Stain following manufactures protocol
(ThermoFischer, Carlsbad, CA, USA). Following the development of the western blot
examining for verification of TRPV1, the band that corresponded with TRPV1 in the
stained gel was cut out and sent to the core Mass Spectroscopy at The Ohio State
University to be processed and analyzed for potential PTM differences.
Quantitative RT-PCR: 1) RNA Isolation- TRPV1-constitutively expressing HEK cells
(see previous section for details), were seeded in 6-well plate and treated with 100 μM
H2O2 or 10 μM 4-HNE for 1 hour and mRNA isolated utilizing SV Total RNA Isolation
46 System (Promega, Madison, WI, USA). Briefly, cells were isolated similar to those in the western blot protocol. Following final PBS wash, cells were treated with RNA Lysis buffer and passed through a 25 g Needle to sheer genomic DNA. Dilution buffer was added and sample was heated to 70 °C for 3 minutes and spun at 20,000 x g for 10 minutes at room temperature. Following the clearing of the lysate, 95% ethanol was added and the total solution was transferred to a spin column to capture full RNA. While the DNA/RNA mixture was trapped in the silco spin column, a solution of DNase I was added to degrade any remaining DNA fragments for 15 min. Once the reaction had completed, and stop solution was added and the remaining RNA was washed and then eluted in TE buffer.
Measurements of purity and concentration were measured on NanoDrop 2000
Spectrophotometer (ThermoFischer, Carlsbad, CA, USA). 2) qRT-PCR- Equal amounts
of isolated RNA were added to reaction buffer containing reverse transcriptase overnight.
Subsequent experiments examined mRNA expression levels utilizing PrimeTime qPCR
technology (Integrated DNA Technologies, Coralville, Iowa, USA). For complete list of
Primer sequences used please see Table 3. Analysis was carried out via determining the
ΔΔCT with normalization for loading utilizing the constitutive expressing Hypoxanthine-
guanine phosphoribosyltransferase 1 mRNA expression and further normalization to
vehicle treatment.
X-band electron paramagnetic resonance (EPR): The redox activities of the
myocardium from wild type, db/db, and db/db-PEG-catalase were measured by X-band
EPR with the spin probe CM-H. Conversion of CM-H to stable nitroxide was measured by
EPR at 297 K in tissue homogenates (0.4 mg/mL) of mouse myocardium in KCl buffer
(140 mM KCl, 10 mM NaCl, 1 mM MgCl2, 1 mM EGTA, 1 mM EDTA, 2.5 mM potassium phosphate, 10 mM Trizma, adjusted to pH 7.4) freshly supplemented with 1 mM DTPA and 1 mM CM-H. b) Ebselen (0.3 µM) was included into the system to determine H2O2-
47 dependent CM-H oxidation rate. The reaction mixture was transferred into a 50-µL capillary (Wiretrol, Drummond Scientific Company, Broomall, PA), sealed by Critoseal
(Oxford Labware, St. Louis, MO), loaded into the EPR resonator (HS cavity, Bruker
Instrument, Billerica, MA), tuned and scanned in spectrum mode at exactly 2-min after the initial reaction. The instrumental settings used for detecting the three-line spectrum of the nitroxide formed were as follows: center field, 3360 G; sweep width, 60 G; microwave frequency, 9.43 GHz; power, 20 mW; receiver gain, 5.02 × 103; modulation frequency, 100
kHz; modulation amplitude, 1 G; time constant, 163.84 mS; conversion time, 41 mS;
sweep time, 41.98 S; number of X scans, 1. The spectral simulations (aN = 16.02 G) were
performed using the WinSim program developed at NIEHS by Duling. The CM-H
oxidation experiment was performed 6 times (n=6) for calculating redox activity.
Drugs: All drugs were purchased from Sigma Chemicals (St. Louis, MO, USA) unless otherwise stated. Capsaicin and Penitrem A were dissolved in stock solutions of ethanol.
SB366791 was dissolved in DMSO. Hexamethonium (5 mg/ml) stock solution was made up in saline.
Statistics. Data are expressed as mean ± SEM. Statistical comparisons were made with paired t-tests or two-way repeated measures analysis of variance (ANOVA; with
Bonferroni multiple comparison) as appropriate. For statistical analyses, GraphPad Prism
6.0 software for Windows 7 (GraphPad Software, San Diego, Calif) was utilized. In all tests, P< 0.05 was considered statistically significant.
48 Chapter 3: Differential Regulation of TRPV1
Previous studies from our lab demonstrated the impact of diabetes on vascular
TRPV1 in mice and porcine coronary blood flow regulation (Bratz et al., 2008, Ohanyan et al., 2011, Guarini et al., 2012). These studies established the role for TRPV1 in the regulation of coronary blood flow (CBF). Further, it was demonstrated that this TRPV1- mediated regulation occurred through TRPV1 expressed within the endothelium.
Importantly, these studies illuminated that TRPV1 regulation of CBF was attenuated in each model of Type-II diabetes (db/db mice and ossabaw swine on high fat/high cholesterol diet) (Bratz et al., 2008, Guarini et al., 2012). However, these studies did not investigate a specific etiology for this dysfunction. Nonetheless, it is well known that diabetes leads to an increase overall oxidative environment in tissues and cells (Kaneto et al., 2010). Moreover, investigations by Chuang and Lin demonstrated TRPV1 as a broad sensor of oxidative stress, specifically H2O2 (Chuang and Lin, 2009). Ultimately,
this lead to the hypothesis that TRPV1 regulates CBF; however, it is susceptible to damage. Thus, we sought to determine the role of ROS, specifically H2O2, on TRPV1-
dependent regulation of CBF. We believe TRPV1, as a broad sensor of OS, is initially
activated via H2O2; however, in a pathological state of increased ROS (i.e. diabetes) this
regulation is attenuated. As such, we investigated this hypothesis utilizing a
multidisciplinary approach of in vitro, ex vivo and cellular approaches (published results can be found in (DelloStritto et al., 2016)).
49 Results
Previous studies demonstrated an in vivo and in vitro role for TRPV1 in the
coronary vasculature. Thus, our initial studies examined the acute activation of TRPV1
and its control of CBF. This was accomplished by intrajugular (IJ) infusion of H2O2, while
simultaneously infusing non-specific contrast and utilizing echocardiography to assess
CBF changes. H2O2 infusion lead to a significant increase in measured CBF in WT mice,
but was attenuated by the specific TRPV1 antagonist SB366791 at H2O2 concentrations
of 2 and 4 μmol/kg/min (28.0 ± 1.9 ml/min/g WT vs. 17.8 ± 1.9 ml/min/g SB366791; 4
μmol/kg/min H2O2) (Figure 3-1A). Further, H2O2 -dependent regulation of CBF via was significantly attenuated in V1KO mice and db/db mice compared to WT at H2O2
concentrations of 0.4, 2, and 4 μmol/kg/min (28.0 ± 1.9 ml/min/g WT vs. 14.5 ± 1.1 ml/min/g V1KO vs. 14.5 ± 0.7 ml/min/g db/db at 4 μmol/kg/min of H2O2) (Figure 3-1B).
HR and BP were not significantly different across all groups at the various concentrations
(Table 1).
Further investigation of this regulation was accomplished utilizing isolation of secondary branches of the coronary vasculature that were cannulated and pressurized to
60 mmHg. Isolated microvessel viability was initially assessed by an increase in extracellular KCl. Following verification of viability, microvessels were preconstricted with the prostaglandin memetic U46619 (1 μM), and relaxation was monitored utilizing video edge detection microscopy. H2O2 induced a concentration-dependent relaxation which at the highest dose of H2O2, WT microvessels achieved 81.7% ± 3.4% relaxation compared
with preconstricted measurements. This response was significantly attenuated in the
presence of the TRPV1 antagonist, SB366791 (21.3% ± 4.4%) and 4-aminopyridine (4-
AP; 3 mM) (32.6% ±8.2%) (Figure 3-2B). When both SB and 4-AP were given
concurrently, relaxation was further reduced to 24.9% ± 3.0% (Figure 3-2B). 4-AP is a
50 AA
B
Figure 3-1: H2O2-dependent changes in coronary blood flow are TRPV1 dependent. A) Increases in CBF to H2O2 in WT mice (n=8) were attenuated when pre- treated with the TRPV1 antagonist SB366791 (100 μg/kg; n=6). B) CBF changes to acute intrajugular infusion of H2O2 in V1KO (n=6) and db/db (n=6) mice demonstrate an attenuated response compared to WT. adapted from (DelloStritto et al., 2016).
51 A B
C D
E F
Figure 3-2: H2O2-dependent relaxation of coronary microvessels is TRPV1 dependent. A) Representative graph demonstrating video edge detection of H2O2- dependent relaxation in isolated coronary arterioles from WT mice. B) Summary data of H2O2-dependent vasorelxation in WT microvessels in the presence or absence of pharmacological inhibitors to TRPV1 (SB366781; 10 μM; n = 6), Kv (4-AP; 3 mM; n = 6), BKCa (Pen A; 10 μM; n = 6) and in combination (SB/4-AP, n = 6). C) Summary of endothelial specific action of H2O2-dependent relaxation following denudation, in the presence of L-NAME and DTT (n = 6 each). D) Genotypic differences in H2O2- dependent relaxation between WT, V1KO and db/db mice (n = 37, 24, 12 respectively). E) Inhibition of potassium channels (Kv; 4-AP; n = 6 and BKCa; Pen A; n = 6) and oxidation (DTT; n = 6) in V1KO mice. F) Summary of H2O2-dependent relaxation in db/db mice in the presence and absence of TRPV1 inhibition (SB; n = 6), TRPV1/Kv inhibition (SB/4-AP; n = 6) and reduction agent DTT (n = 6). Adapted from (DelloStritto et al., 2016).
52 broad antagonist to voltage-gated potassium channels (Kv), overall demonstrating a role for both TRPV1 and Kv in H2O2-induced dilation in the coronary microvasculature. Further investigation into the role of other ion channels role, reveal that BKCa plays little role in this
specific vascular bed, as demonstrated by little reduction in overall relaxation (69.9% ±
4.2% vs 81.7% ± 3.4% in WT control) in microvessels inhibited by the BKCa antagonist penitrem A (10 μM) (Figure 3-2B).
The role of H2O2-induced Kv regulation of vascular tone has been previously explored and determined to be localized to the smooth muscle (Rogers et al., 2007,
Ohanyan et al., 2015). However, TRPV1 is localized to both the smooth muscle and endothelial layers. Thus, we sought to determine the role of each of these locations in the overall regulation of H2O2-mediated microvessel dilation. Studies were next performed
examining H2O2-mediated relaxation in isolated coronary microvessels following removal
of the endothelial layer by infusion of an intraluminal air bubble. Following, endothelial
denudation of the WT coronary microvessels, relaxation to H2O2 was examined and found
to be significantly attenuated (48.5% ± 7.5% vs 81.7% ± 3.4%; denuded vs control in WT
animals), suggesting a vital role for the endothelium in this process (Figure 3-2C). To
further explore the mechanism by which the endothelium is signaling the VSMC to relax,
the nitric oxide synthase inhibitor L-NG-Nitroarginine methyl ester (L-NAME) was given as a pretreatment to the WT microvessels and H2O2-mediated relaxation was determined.
Results demonstrate a significant reduction similar to that seen in denuded vessels (42.5%
± 2.5% L-NAME vs 48.5% ± 7.5% denuded and 82.3% ± 3.1% WT) (Figure 3-2C). Finally, the relaxation to H2O2 was completely blocked with the addition of the reducing agent dithiothreitol (13.5% ± 5.9% DTT vs 82.3% ± 3.1% in WT control; 10 μM DTT). Overall,
these results suggest a role for the endothelium and specifically eNOS in H2O2-mediated relaxation (Figure 3-2C).
53 To further investigate the role of TRPV1 in the signaling mechanism associated with H2O2-dependent relaxation, V1KO and db/db coronary microvessels were next examined. Overall, V1KO microvessels demonstrated a reduction in vasorelaxation to
H2O2 compared to WT control (81.7% ± 3.4% WT control vs 65.5% ± 3.7% V1KO) (Figure
3-2D). In the presence of the Kv antagonist, 4-AP, there was almost a complete loss of vasoreactivity (14.6% ± 3.0% 4-AP vs 65.5% ± 3.7% V1KO control). Similar effect occurred in the presence of the reducing agent DTT (11.6% ± 2.7% DTT vs 65.5% ± 3.7%
V1KO control) (Figure 3-2E). Further studies demonstrated in V1KO mice that denudation
(48.8% ± 16.6%), TRPV1 inhibition SB366791 (73.7% ± 4.9%), and combination of both
(64.1% ± 2.5%) had little effect comparted to V1KO control (65.5% ± 3.7%) (Figure 3-3B).
It is known that vascular regulation in diabetes is compromised and as such we next sought to determine if H2O2-dependent vascular regulation was diminished in the mouse model of diabetes. H2O2-dependent relaxation in db/db mice was compromised
demonstrating only 43.8% ± 4.7% relaxation vs 81.7% ± 3.4% in WT control. In presence
of TRPV1-antagonist, H2O2-dependent relaxation was significantly reduced compared to basal response (29.6% 43.8% SB366791 ± 6.7% vs 43.8% ± 4.7% in db/db control).
Further, significant reduction of vasorelaxation was recorded in the presence of both
TRPV1 and Kv inhibition (SB/4-AP; 10.4% ± 1.5% vs 43.8% ± 4.7% in db/db control).
Finally, DTT significantly attenuated response the response to H2O2, similar to that in WT and V1KO mice (7.4% ± 2.4%) (Figure 3-2F).
To verify that altered H2O2-mediated signaling were independent of altered VSMC- dependent relaxation mechanisms, sodium nitroprusside, a NO-donor, was applied to isolated microvessels following preconstruction with U46619. No significant differences were observed between WT, V1KO and db/db in the presence of 100 μM SNP (88.0% ±
2.1% WT; 86.9% ± 0.6% V1KO; 78.5% ± 11.6% db/db) (Figure 3-3A). Further exclusion
54
A B
C D
Figure 3-3: DTT and SNP do not alter vascular reactivity. A) The NO-donor SNP demonstrates no differences in relexation between WT, V1KO and db/db mice (n = 6 for each group). B) V1KO microvessels denuded (n = 6), and in the presences of the TRPV1 antagonist SB366791 (n = 6) and in combination with KV antagonist 4-AP (n = 6) demonstrates no basal differences to V1KO control (n = 24). C) Differing geneticly altered mice do not alter vasoconstriction response to KCl with or without DTT (n = 3 for all groups). D) Ach relaxation in WT mice was not significantly altered in the presence of DTT (n = 6). Adapted from (DelloStritto et al., 2016).
55 of other compounding factors demonstrated that DTT did not alter potassium-induced contraction in all three genotypes (Figure 3-3C) or ACh-dependent relaxation in WT mice
(93.2% ± 2.1% basal vs 90.5% ± 3.2%) (Figure 3-3D).
To explore the role of TRPV1 and H2O2-induced vascular reactivity on a molecular
level, electrophysiological techniques were employed. Previous studies from Chuang and
Lin demonstrated the capability of TRPV1 to be activated by H2O2 in an overexpression system involving Xenopus ooxytes (Chuang and Lin, 2009). However, physiologic activation of TRPV1 has yet to be explored. Initial studies of H2O2 activation were
accomplished utilizing TRPV1 transiently transfected into HEK cells (Figure 3-4A). To
establish a working model, the known activator of TRPV1, capsaicin, was utilized to
demonstrate capsaicin-dependent TRPV1-mediated currents. HEK cells in a whole-cell patch-clamp configuration demonstrated a dose-dependent ion efflux with increasing membrane holding potentials (Figure 3-4B). This model was then further validated in transiently transfected BAEC, demonstrating similar current densities to HEK (93.2 ± 33.7 pA/pF, BAEC vs. 97.5 ± 30.0 pa/pF, 100 nM Capsaicin in HEK at +100 mV) (Figure 3-
4C). Similar to capsaicin, H2O2 demonstrated a dose-dependent increase in current at
positive holding potentials in HEK cells (Figure 3-4D) that was completely blocked with
the TRPV1 antagonist SB36679 (Figure 3-4E). Recapitulating this, transient transfected
BAEC demonstrated similar current densities (81.7 ± 17.2 pA/pF, BAEC vs. 125.2 ± 42.8
HEK; 100 μM H2O2 at +100 mV) and antagonistic action of SB366791 (Figure 3-4F).
Finally, examination of intrinsic TRPV1 currents in cultured EC from WT and V1KO was accomplished while holding the EC’s at -60 mV and applying transient doses of H2O2.
Overall, V1KO EC demonstrated a reduction in overall inward current when compared to
WT controls (-143.3 ± 7.4 pA, WT vs. -60.9 ± 34.0 pA, V1KO) (Figure 3-4G – 3-4I).
The results above demonstrated H2O2-dependent CBF and vascular regulation
56
A B C
D E F
G H I
Figure 3-4: Electrophysiological Examination of TRPV1 Activation via Capsaicin and H2O2. A) Schematic and representative tracing of TRPV1 current in transiently transfected HEK cells. B) Summary I-V plot demonstrating acute electrophysiological activation or rTRPV1 via capsaicin (n = 6 cells for each concentration). C) I-V plot of BAEC transfected with rTRPV1 demonstrating a sensitivity to capsaicin (n = 6 cells). D) Electrophysiological summary of HEK cells transfected with rTRPV1 demonstrating a dose dependent increase in current following exposure to H2O2 and (E) this is inhibited by TRPV1 antagonist SB366791 (n = 7 cells, 1 μM; 7 cells, 10 μM; 8 cells, 100 μM; 6 cells, SB (10 μM)). F) I-V summary of BAEC cells exposed to H2O2 in the presence and absence of SB366791 (n = 6, 100 μM; n = 4, SB366791). G and H) Representative traces following exposure to 100 μM H2O2 of WT EC and V1KO EC. I) Summary inward current in WT vs V1KO EC (n = 6 for WT and V1KO). Adapted from (DelloStritto et al., 2016).
57 that in part is TRPV1-dependent. TRPV1 is a polymodal ion channel activated by a multitude of compounds and as such we sought to investigate the capability of H2O2 and capsaicin to potentiate the responses when exposed concurrently. Analysis of CBF changes in vivo was carried out in a similar fashion to Figure 3-1. While maintaining a
constant H2O2 concentration, increasing doses of capsaicin were infused and CBF
changes were measured via contrast echocardiography. Compared to WT controls only
exposed to capsaicin, those mice treated with capsaicin and H2O2 demonstrated a
significant increase in CBF at capsaicin concentrations of 20 and 100 μg/kg/min (19.6 ±
1.9 mL/min/g cap-WT vs. 28.1 ± 2.8 mL/min/g cap/H2O2 WT at 20 μg/kg.min) (14.5 ± 0.9
mL/min/g cap-WT vs. 29.8 ± 1.7 mL/min/g cap/H2O2 WT at 100 μg/kg.min) (Figure 3-5A).
Similar to the acute H2O2, the V1KO and db/db mice had blunted potentiation responses
compared to WT at 10, 20 and 100 μg/kg/min (Figure 3-5B).
Following in vivo examination of potentiated responses, coronary arterioles were
isolated and the ability of H2O2 to potentiate capsaicin-mediated relaxation was examined.
Interestingly, at lower capsaicin concentrations (H2O2 was held consistently at 100 nM)
there was a significant potentiation between WT capsaicin only and capsaicin and H2O2
(25.6% ± 3.0% vs 37.1% ± 2.4% at 10-6 capsaicin) (Figure 3-6A). V1KO microvessels demonstrated no response to capsaicin-mediated relaxation in the presence and absence of 100 nM H2O2 (Figure 3-6A). In diabetic mice, capsaicin-mediated relaxation was
bunted compared to WT, further confirming results previously published by our lab (69.8%
± 4.8% WT vs 23.3% ± 5.5% db/db at 10-4 capsaicin) (Figure 3-6B) (Guarini et al., 2012).
Interestingly, with the addition of low dose hydrogen peroxide, there was a significant increase in the relaxation between db/db with and without H2O2 (1.1% ± 0.7% control cap
-6 vs 15.0% ± 1.4% cap + 100 nM H2O2 at 10 capsaicin) (Figure 3-6B). However, at maximum capsaicin concentrations, there was no significant effect of H2O2 on capsaicin-
58 AA
B
Figure 3-5: In vivo Potentiation effects of H2O2 and Capsaicin on CBF. A) Summarized CBF changes observed in WT mice exposed to Capsaicin, Capsaicin and H2O2 and, Capsaicin, H2O2 and SB366791 (TRPV1 Antagonist) (n = 4 mice, 6 mice and 5 mice respectively). B) Genotypic differences in response to Capsaicin and H2O2 in V1KO and db/db mice compared with WT (n = 6 for all groups). Adapted from (DelloStritto et al., 2016).
59
A B
C D
E F
Figure 3-6: Potentiation of H2O2 and Capsaicin in coronary microvessels and HEK/BAEC Cells. A) WT and V1KO mouse coronary microvessel relaxation in reposed to increasing doses of capsaicin in the presence or absence of low dose H2O2 (n = 6 for all). B) db/db coronary microvessels exposed to capsaicin alone or capsaicin and H2O2. I-V summary plots of whole-cell electrophysiology of BAEC (C) and HEK (E) cells exposed to capsaicin alone (100 nM, n = 5 cells BAEC; n = 6 cells HEK) or capsaicin and H2O2 (100 nM capsaicin, 100 μM H2O2, n = 6 cells, BAEC; n = 6 cells, HEK). rTRPV1-poteinated responses in BAEC (D) and HEK (F) cells in the presence of the reducing agent DTT (10 μM, n = 6 cells, BAEC; n = 6 cells, HEK) and the TRPV1 antagonist SB366791 (10 μM, n = 5 cells, BAEC; n = 6 cells, HEK). Adapted from (DelloStritto et al., 2016).
60 mediated relaxation.
To examine if H2O2-mediated potentiation of capsaicin-mediated signaling
extended to TRPV1 currents, response to H2O2 and capsaicin was carried out in HEK and
BAEC cells transiently transfected with rTRPV1 via patch-clamp electrophysiology. Similar
to those responses observed in CBF regulation and microvessels, capsaicin-mediated
TRPV1 currents were increased significantly in the presence of 100 μm H2O2 in both HEK and BAEC versus those only treated with 100 nM capsaicin (93.2 ± 33.7 pA/pF cap vs
180.3 ± 34.3 pA/pF cap/H2O2 in BAEC at +100 mV) (97.5 ± 30.0 pA/pF cap vs. 204.0
±35.0 pA/pF cap/H2O2 in HEK at +100 mV) (Figure 3-6C and 3-6E). When HEK and
BAEC cells were exposed to the reducing agent DTT in the presence of both capsaicin and H2O2, currents returned to similar levels of capsaicin alone (105.7 ± 18.1 pA/pF
cap/H2O2/DTT vs 93.2 ± 33.0 pA/pF cap in BAEC at + 100 mV) (74.2 ± 14.7 pA/pF
cap/H2O2/DTT vs 97.5 ± 30.0 pA/pF cap in HEK at + 100 mV) (Figure 3-6D and 3-6F).
Lastly, the TRPV1 antagonist, SB366791, reduced the potentiated effects of H2O2 on capsaicin-mediated increases in TRPV1 currents similar to baseline (57.9 ± 6.7 pA/pF cap/H2O2/SB vs 27.8 ± 5.8 pA/pF baseline in BAEC at + 100 mV) (34.0 ± 10.7 pA/pF cap/H2O2/SB vs 14.1 ± 2.0 pA/pF baseline in HEK at + 100 mV) (Figure 3-6D and 3-6F).
These previous results highlight the role for TRPV1 in H2O2-induced vascular regulation. Moreover, previous studies from our lab had demonstrated TRPV1-mediated vascular signaling was disrupted in diabetes. As such, to better simulate the oxidative environment seen in diabetes, we next sought to determine the impact of prolonged OS in TRPV1-mediated vasoreactivity. Initially, CBF was measured in WT mice following 30 minutes of IJ infusion of H2O2. Capsaicin-dependent changes in CBF were examined and
shown to be impaired in those mice exposed to prolong H2O2 at capsaicin concentrations of 10, 20, and 100 μg/kg/min (19.6 ± 1.9 ml/min/g WT vs 11.9 ± 1.0 ml/min/g WT + LT
61 H2O2; 20 μg/kg/min) (Figure 3-7A). In addition, db/db mice had demonstrated an
attenuated capsaicin-mediated TRPV1-dependent changes in CBF in previous investigations (Guarini et al., 2012). As such, to determine if this blunted capsaicin- mediated TRPV1 dysfunction could be explained via the chronic production of H2O2,
db/db mice were subjected to tail vein injections (three total) of catalase conjugated with
Polyethylene glycol (PEG-catalase) over a 7-day period. This was performed with the thought that systemic catalase (an enzyme responsible for the breakdown of H2O2 into
H2O and O2) would decrease H2O2-dependent ROS and limit any subsequent ROS- induced TRPV1-signaling changes and rescue CBF. Following completion of this protocol, mice were examined for capsaicin-dependent CBF changes. Confirming our previous findings, db/db mice demonstrated an attenuated CBF in response to capsaicin exposure compared to WT at the 10, 20 and 100 μg/kg/min concentrations (19.6 ±1.6 ml/min/g WT vs 10.9 ±1.0 ml/min/g db/db; 20 μg/kg/min) (Figure 3-7B). In db/db mice treated with PEG- catalase, capsaicin dependent changes in CBF were significantly increased at the 10, 20 and 100 μg/kg/min concentrations (17.3 ± 0.6 ml/min/g db/db + PEG-catalase vs 10.9 ±1.0 ml/min/g db/db; 20μg/kg/min) (Figure 3-7B).
Catalase is the enzyme known to reduce and breakdown H2O2, and to confirm that giving PEG-catalase systemically altered the oxidation status of the myocardium we employed the technique of X-band EPR. Utilizing CM-H (a spin probe of cyclic hydroxylamine), nitroxide was stabilized in the myocardium tissue homogenate and under non-energized conditions the db/db myocardium was significantly more oxidized than WT myocardium (2.10 ± 0.04 nmol CM-H oxidized/min/mg proein WT vs 2.52 ± 0.24 nmol CM-
H oxidized/min/mg proein db/db) (Figure 3-8A) Conversely, db/db mice treated with PEG- catalase demonstrated a significantly reduced myocardium compared to both WT and non-treated db/db (Figure 3-8A), which was H2O2-dependent (0.40 ± 0.12 nmol CM-H
62 AA
BB
Figure 3-7: TRPV1-dependent changes in coronary blood flow regulation following prolonged exposure to H2O2. A) Summary plot of capsaicin mediated TRPV1-dependtent changes to CBF in WT control mice (n = 4 mice) and WT mice following 30-minute exposure to H2O2 at a rate of 0.4 μmol/kg/min (n = 6 mice). B) CBF changes in response to increase dose of capsaicin in WT mice (n = 4 mice), db/db mice (n = 7 mice), and db/db mice treated with ~7,000 U of PEG-catalase 3 times of a seven-day period (n = 5 mice). Adapted from (DelloStritto et al., 2016).
63 AA
B H 2 O 2 -Dependent Oxidation 1.5
1.0
# 0.5
0.0 nmol CM-H oxidized/min/mg protein CM-Hoxidized/min/mg nmol db/db
db/db + Catalase Figure 3-8: Myocardial Oxidation Status. A) Oxidation status of myocardium between WT (n = 9 mice), db/db (n = 5 mice), and db/db mice treated with catalase (n = 5 mice). B) H2O2-dependent portion of oxidation status of myocardiums from db/db (n = 4 mice), and db/db mice treated with catalase (n = 5 mice). Adapted from (DelloStritto et al., 2016).
64 oxidized/min/mg protein in db/db + PEG-catalase vs 1.00 ± 0.14 nmol CM-H oxidized/min/mg proein in db/db) (Figure 3-8B).
Next we sought to determine the role of prolonged OS exposure on the coronary microvasculature. WT, V1KO and db/db microvessels were isolated and cannulated, similar to previous experiments, and then infused with 100 nM H2O2 intraluminally for 1
hour and capsaicin-mediated relaxation was examined. WT coronary microvessels
infused with H2O2 for 1-hour demonstrated an attenuated relaxation compared to baseline
-4 responses (69.8% ± 4.8% WT vs 17.1% ± 5.5% LT-H2O2 at 10 capsaicin) (Figure 3-9A).
At the conclusion of the experiment, vessels were given ACh to determine if the blunted responses were specific to capsaicin-dependent signaling and not due to loss of endothelial-dependent signaling. Similar ACh responses were noted between baseline
WT vessels and those exposed to H2O2 (94.2% ± 2.1% control vs 78.0% ± 10.9 % LT-
H2O2) (Figure 3-9B). In V1KO mice, capsaicin-mediated relaxation was completely
absent and prolonged exposure to H2O2 does not alter this significantly (4.5% ± 0.9%
-4 V1KO vs 7.1% ± 2.4% LT-H2O2 at 10 capsaicin) (Figure 3-9C). Lastly, db/db
microvessels exposed to prolonged H2O2 demonstrated little deviation from baseline
-4 (23.3% ± 5.5% db/db vs 8.6% ± 1.5% LT-H2O2 at 10 capsaicin) (Figure 3-9D).
Finally, effects of prolonged H2O2 on capsaicin-mediated TRPV1-dependent
currents were investigated utilizing patch-clamp electrophysiology. In both BAEC and HEK
cells transiently transfected with rTRPV1, 1-hour H2O2 attenuated capsaicin-dependent
TRPV1-currents (93.2 ± 33.7 pA/pF Cap vs 57.1 ± 8.3 pA/pF LT- H2O2 in BAEC at + 100
mV) (97.5 ± 30.0 pA/pF Cap vs 54.4 ± 6.0 pA/pF LT- H2O2 in HEK at + 100 mV) (Figure
3-10C and 3-10D). This attenuation was present despite no evidence that this level of
H2O2 altered cellular viability in both BAEC and HEK cells (98.9% ± 1.4% BAEC, 88.5%
-4 ± 4.0% HEK; at 10 H2O2) (Figure 3-10A and 3-10B) or channel expression in transiently
65
A B
C D
Figure 3-9: Microvessel reactivity to prolonged H2O2. Capsaicin-mediated dilation of WT (A), V1KO (C), and db/db (D) coronary microvessels following intraluminal exposure to 100 nM H2O2 for 1-hour (WT: n = 6 vessels control; n = 6 vessels 100 nM H2O2 for 1-hour. V1KO: n = 6 vessels control; n = 6 vessels 100 nM H2O2 for 1-hour. db/db: n = 6 vessels control; n = 6 vessels 100 nM H2O2 for 1-hour). B) Quantification of acetylcholine induced relaxation in WT coronary microvessels following acute or 1- hour treatment of 100 nM H2O2 (n = 6 vessels acute; n = 6 vessels 1-hour). Adapted from (DelloStritto et al., 2016).
66
A B
C D
Figure 3-10: Electrophysiological Changes in rTRPV1 upon prolonged exposure to H2O2. Cell survival for HEK (A) and BAEC (B) cells upon increasing exposure to 2 H2O2 demonstrating an EC50 of 1.81 mM (R = 0.79) for HEK cells and an EC50 of 6.24 mM (R2 = 0.85) BAEC cells. Cells were seeded in quadruplicates in three separate experiments. Summary I-V plots in response to capsaicin in HEK (C) and BAEC (D) transiently transfected with rTRPV1 following 1-hour exposure to 100 μM H2O2 (HEK: n = 6 cells for baseline; 6 cells, 1-hour 100 μM H2O2. BAEC n = 5 cells for baseline; 6 cells, 1-hour 100 μM H2O2). Adapted from (DelloStritto et al., 2016).
67
A B
Figure 3-11: Prolonged H2O2 exposure does not alter rTRPV1 expression. Representative (A) and summarized (B) data of immunoblot of rTRPV1 in transiently transfected HEK cells following prolonged (1-hour) exposure to 100 μM H2O2 normalized to β-actin. Experiments were performed in duplicates on three separate experiments. Adapted from (DelloStritto et al., 2016).
68
Table 1
Table 1: Heart Rate and Blood Pressure Changes to Capsaicin and H2O2 in vivo. Adapted from (DelloStritto et al., 2016).
69 transfected HEK cells (100% ± 30.5% VT vs 104% ± 44.7% LT- H2O2) (Figure 3-11).
Discussion
Overall, these experiments demonstrate the importance of a well-regulated
oxidative environment. Importantly, this investigation examined the impact of OS
imbalance on coronary blood flow regulation. The major findings of these studies, which
were highlighted in a recent publication are 1) H2O2-mediated activation of endothelial
TRPV1 elicits vascular relaxation and regulates CBF changes; 2) TRPV1 activation via
H2O2 in the presence of capsaicin potentiates TRPV1 currents and subsequent vascular and CBF changes; and 3) Prolonged exposure to increased H2O2 concentrations (as
associated with OS) leads to TRPV1 channel dysfunction, ultimately resulting in
microvascular dysfunction and uncoupling of CBF. Each of these major findings were
examined in an integrated approach beginning at the cellular level via path-clamp,
followed by functional studies in isolated murine coronary arterioles, and concluding with
an examination of in vivo effects utilizing contrast echocardiography. Other major findings
include V1KO mice demonstrate attenuated responses to H2O2 alone and in conjunction with capsaicin induced vascular relaxation; while db/db mice exhibited an even further reduction in said responses. Moreover, we demonstrated that in V1KO ECs ion flux in the presence of H2O2 is reduced in comparison to WT controls. Finally, we demonstrated that
db/db mice treated systemically with PEG-catalase restored capsaicin-mediated TRPV1-
dependent CBF. Taken together this work demonstrates that TRPV1 can be differentially
regulated by hydrogen peroxide.
Previously, H2O2 has been linked to regulation of the coronary vasculature; however, this is the first evidence that TRPV1 is a key sensor in this process. Previous work by the Chilian, Tune, and Gutterman groups have demonstrated a key role for H2O2
in the coronary vasculature (Rogers et al., 2006, Rogers et al., 2007, Liu et al., 2011,
70 Beyer and Gutterman, 2012, Bubolz et al., 2012, Ohanyan et al., 2015, Ellinsworth et al.,
2016, Gutterman et al., 2016). These initial studies illustrate hydrogen peroxide’s effect in the vasculature occurred through 4-AP-sensitive KV channels. Our results, contribute to
these observations in that when WT mice were given 4-AP and the TRPV1 antagonist
SB366791, only a fraction of the H2O2-induced vasodilation remained. Also, when V1KO
mice were used, removing any potential pharmacological variables, the addition of 4-AP
reduced the vasodilator capacity similar to that of vessels treated with DTT. Furthermore,
BKCa channels have also been shown to play a role in in vasomotor tone, and be sensitive
to H2O2 (Barlow and White, 1998, Barlow et al., 2000). However, our results demonstrated
a minimal role for BKCa channels. More confusing, our previous work demonstrated in this
same vascular bed that capsaicin-induced TRPV1 mediated vasorelexation was in fact
BKCa dependent. These differences could be explained by the specificity of the TRPV1
agonist versus the diversity of signaling pathways and ion channels H2O2 activates.
Further, while the isolated coronary microvessel experiments demonstrated a
duality in regulation by both TRPV1 and KV channels in the presence of H2O2, the in vivo
experiments did not concur with this observation. In V1KO mice, CBF chances in response
to increasing concentration of H2O2 lead to minimal observable changes. This could be due to many factors including degradation of IJ delivered H2O2, the administration of
anesthesia or the fact that rodents, in this case mice, have a more rapid heart rate when compared to other mammals. HR has been shown to be proportional to resting CBF, and
as such, in mice with drastically elevated HRs, the capacity of coronary flow reserve to
change is reduced (Duncker and Bache, 2008). This potential diminished ΔCBF in mice
could imply that when giving pharmacological mediators in vivo, the effect observed in
isolated arterioles would be mitigated. Finally, the fact these mice are under anesthesia
71 cannot be discounted as isoflurane has been demonstrated to affect CBF velocity in mice
(Hartley et al., 2007).
Potentiation of TRPV1 current by H2O2 had been previously described, but this
investigation is the first to demonstrate the effect within the vasculature. In isolated
coronary arterioles, this response was only observed at lower concentrations of capsaicin
when H2O2 was held constant. However, in vivo responses displayed a continued rise in
CBF even at the highest capsaicin concentration. Further work should be done to characterize the potentiation when capsaicin is held constant with an increasing H2O2
concentration.
Key to this aim was the demonstration that the oxidative environment is vital in determining the regulation of TRPV1 in vascular regulation. A variety of TRP channels including TRPA1 (Trevisani et al., 2007, Trevisan et al., 2013), TRC5/TRPC1 (Yoshida et al., 2006), TRPM2/TRPM7 (Miller and Zhang, 2011) and TRPV1 (Chuang and Lin, 2009), have emerged as key sensors in OS. Herein, we further validated that H2O2 does in fact activate TRPV1 channels. Furthermore, we demonstrated, in response to H2O2, an ionic
flux into HEK/EC cells expressing TRPV1 as well as a significant difference between EC of V1KO and WT mice—underscoring the role for TRPV1 within the endothelium.
Evidence that cysteines played a crucial role in H2O2 activation was tangible when cells expressing rTRPV1 were treated with both capsaicin and H2O2 in the presence of DTT
(which reduces disulfide bonds on cysteine residues). This resulted in an attenuation of
TRPV1 currents to a level comparable to capsaicin alone. Previous studies elucidated the
importance of cysteines, specifically TRPV1-C616 and C621, in the activation and
modulation of TRPV1 channels by these oxidative responses (Yoshida et al., 2006). The
complexity of this process is epitomized by continued studies demonstrating that in the
presence of oxidative stimuli TRPV1 can be sensitized by disulfide bonds within the
72 cytoplasmic domain and/or dimerization of the TRPV1 subunits (Chuang and Lin, 2009,
Wang and Chuang, 2011).
There are a variety of other ion channels susceptible to oxidative modification
including various potassium channels like the Kv1, Kv2, Kv7 and Kv11 subtypes (Barlow
et al., 2000, Rogers et al., 2006, Rogers et al., 2007, Sahoo et al., 2014). Svoboda et al.
eloquently demonstrated an increase in sulfenic acid-modified proteins is associated with
atrial fibrillation. They determined that this increase in oxidative modification on Kv1.5
cysteine (C581) was responsible for altered channel surface expression resulting in
inhibition of overall currents and ultimately inducing a sustained arrhythmia (Svoboda et
al., 2012). Similar to the Kv channels, the large conductance potassium channel has also
been shown to be redox sensitive (Barlow et al., 2000, Sahoo et al., 2014). Finally L-Type
Ca2+ channels, transiently exposed to ROS, increases channel activity over a sustained
period of time (9 hours) (Hool, 2008). This sustained activity was due to Ca2+-influx which further enhanced mitochondrial ROS production in a positive feedback loop.
Throughout this chapter oxidative modification has been synonymous with H2O2
and more broadly ROS. However, many other oxidative post-translational modifications
can occur on proteins including carbonylation, glutathionylation, sulfhydration and
nitrosylation (Pacher et al., 2007, Miller and Zhang, 2011, Chen et al., 2012, Spickett and
Pitt, 2012, Ayala et al., 2014, Sahoo et al., 2014). Furthermore, many of these ROS-
induced alterations do not only occur on cysteine residues but also methionine, tyrosine,
histidine and tryptophan residues (Sahoo et al., 2014). The overall change in the ROS
(simulated by H2O2) can be driving other processes occurring on TRPV1 including (i)
reacting with NO to form peroxinitrate or (ii) producing an environment such that TRPV1
becomes s- glutathionylated. As such, the results within this chapter need to be kept in
perspective to guide future studies.
73 There exists a fine balance within the cell: with physiological stimulation ROS can
increase to produce such a desired response. Moreover, there exists a counter-regulatory
set of enzymes and signals to quell the response when complete (glutathione pools,
vitamin E and vitamin C) (Chen et al., 2012). When this balance is disrupted aberrant
signals can arise leading to sequelae. Within this chapter, this transition into an
unfavorable OS environment was accomplished via the extended treatment of H2O2. From in vivo observations in CBF to patch-clamp electrophysiology this long-term (LT) H2O2
diminished TRPV1 activity and signaling ultimately resulting in blunted TRPV1-dependent
microvascular function. In isolated coronary vessels taken from WT animals, prolonged
H2O2 treatment reduced the capsaicin-induced TRPV1-dependent vascular response similar to responses observed in db/db mice. Interestingly, db/db mice treated with catalase for 1 week demonstrated rescue of capsaicin-mediated increases in CBF. The utilization of catalase, and confirmation by X-band EPR, provides evidence that, not just
ROS but specifically H2O2, is responsible for the depressed TRPV1-mediated control of
the coronary vasculature. This attenuation due to ROS represents a novel insight into the
potential mechanism of diabetic induced TRPV1-attenuation of CBF control.
An interesting observation from these results is that H2O2 treatment in the coronary arterioles lead to a NO-dependent vasorelaxation. Recently, Gutterman and colleagues
proposed that, in human patients, without coronary artery disease (CAD) CBF was
regulated by NO synthesis and signaling. However, those with CAD, still in fact do have vasoreactivity within the coronary microvasculature (although impaired), but this occurs
through the production and signaling of H2O2 (Gutterman et al., 2016). This observation shines a new light onto the role of TRPV1 within the coronary vasculature with the potential
TRPV1 role at the crossroads of these two key vasoactive signals. A few key distinctions
between this study of the combined H2O2 and NO signaling and the work of Gutterman
74 and colleagues is the use of the mouse model as well as the disease state. It has been well established that vascular beds are quite unique even within the same species, but they can diverge even more in their signaling mechanisms across species (Feigl, 1983,
Tune et al., 2004, Tune, 2014, Duncker et al., 2015). Furthermore, this study was conducted in a model of diabetes and not CAD. Interestingly another ion channel, TRPV4, could also play a role in this “molecular switch”. TRPV4, similar to TRPV1, can be activated by H2O2 to regulate vasoreactivty. Vascular regulation by TRPV4 occurs via multiple
pathways including regulation of eNOS activity as well as altering the IKCa and SKCa ion channels which are key for EDHF-vasorelaxation (Bubolz et al., 2012, Earley and
Brayden, 2015). Taken together, TRPV4 or TRPV1, could be activated by H2O2 to help
potentiate and regulate NO signaling in a healthy subject; however, in a CAD state,
following the “switch” to H2O2, these ion channels could regulate dilation via EDHF signal
transduction.
Overall, this chapter confirms our previous work, demonstrating endothelial
TRPV1 regulates the coronary vasculature. Subsequently, it elaborates on the regulation of TRPV1 via ROS, specifically H2O2. This work on differential regulation provides a novel
layer of complexity in the regulatory signals that govern TRPV1 ionic function. Moreover, this extends into the physiological realm by demonstrating that differential regulation of
TRPV1 is applicable to vascular function and CBF regulation. Finally, this work provides further motivation for future investigations into the role oxidative regulation in diabetic microvascular disease.
75 Chapter 4: 4-HNE Post-Translational Modification of TRPV1 and Interaction with
Caveolin-1: Implications for Microvascular Dysfunction
As with many scientific questions, the insights from further understanding the differential regulation of TRPV1 lead to many more questions than answers. Specifically, it was curious that long-term H2O2 had such a marked effect on TRPV1-mediated blood flow regulation and TRPV1-dependent currents. This lead to the question: how is prolonged exposure to H2O2 exerting this alteration? Through a greater understanding of
the literature it became apparent there were three possibilities: 1) direct oxidation, to the
extent of irreversible modification, of a cysteine residue 2) H2O2-generated second
messenger(s) altering TRPV1 directly and 3) H2O2 activation of cellular signaling
mechanisms regulating TRPV1. While there was ample investigative justification to pursue options 1 or 3 ultimately, the mechanism behind possibility #2 seemed quite attractive, in that there was a growing body of literature on the post-translation modification of TRPV1, but nothing directly linked to H2O2.
One well known consequence of increased ROS is H2O2-mediated lipid
peroxidation leading to the production of lipid peroxidation products. This is process can occur in both an enzymatic or non-enzymatic fashion to ultimately lead to a diverse array
of byproducts including 4-hydroxynonenal (4-HNE). Indeed, harmful levels of 4-HNE have
been associated with enhanced protein degradation and inhibition of protein function,
specifically related to kinases, membrane proteins and ion channels (Bennaars-Eiden et
al., 2002, Usatyuk et al., 2006, Hyun, 2010).
76 As such, the present studies were designed to test the impact of the lipid peroxidation product 4-HNE on TRPV1-dependent function utilizing an integrated approach. Overall, we examined the role of 4-HNE-mediated PTM on TRPV1-dependent
CBF regulation, TRPV1-dependent vasorelaxation of coronary arterioles, and how 4-HNE altered capsaicin-dependent TRPV1-mediated channel function. We hypothesize that
TRPV1 is covalently modified by 4-HNE on cysteine residues leading to attenuated
TRPV1 activity and ultimate TRPV1-dependent signaling dysfunction of the coronary vasculature. TRPV1 signaling in the endothelium centers around eNOS activity (Ching et al., 2011, Ching et al., 2012, Ching et al., 2013) and as such we tested if 4-HNE would alter TRPV1-mediated eNOS signaling. Finally, as it is known Cav-1 regulates eNOS activity, we sought to determine if TRPV1 directly interacts with Cav-1 to form a larger signaling complex and thus regulate eNOS activity and NO production. Interestingly, coupled with the hypothesis and results of Aim 1, this leaves potential for converging or multiple (oxidative and/or covalent modification) pathways by which cysteine modification of TRPV1 can dysregulate its function.
Results
Initial studies investigated the influence of 4-HNE on TRPV1-mediated vascular regulation. Capsaicin (given intrajugularly (IJ); 1 – 100 μg/kg/min) mediated changes in
CBF in WT mice were blunted at 10 and 20 μg/kg/min concentrations following prior administration of 4-HNE (IJ; 4 mg/kg over 10 minutes) (20.5 ± 0.9 ml/min/g WT vs 13.4 ±
1.1 ml/min/g WT + 4-HNE; 20 μg/kg/min) (Figure 4-1A). No effects of capsaicin on blood pressure and heart rate (continually monitored) were observed (Table 2). Using isolated murine coronary microvessels, 4-HNE effects on capsaicin-mediated relaxation were examined before and following intraluminal infusion of 4-HNE (10 μM) for 1-hour. 4-HNE markedly attenuated capsaicin-mediated relaxation in WT mice (68.7% ± 7.3% WT
77 AA
BB
CC
Figure 4-1: 4-HNE decreases TRPV1-dependent coronary blood flow regulation. A) Contrast echocardiography determination of TRPV1-dependent changes in CBF in WT mice in the absence (n = 7) or presence of 4-HNE (n = 6; 4 mg/kg). B) Capsaicin- dependent vasorelaxation of WT coronary arterioles in the presence or absence of intraluminally infused 4-HNE (n = 7 vessels/group; 10 μM 4-HNE). C) db/db microvessels exposed to increasing doses of capsaicin in the presence or absence of 4-HNE (n = 6 vessels/group; 10 μM 4-HNE).
78
WT WT WT WT (4-HNE) (4-HNE) [Capsaicin] (µg/kg) Blood Pressure Heart Rate Blood Pressure Heart Rate
Baseline 72.2 ± 5.6 517 ± 26 65.9 ± 6.6 493 ± 20 1 75.0 ± 5.3 499 ± 24 66.7 ± 6.6 500 ± 20 10 77.1 ± 5.4 479 ± 24 66.0 ± 6.2 494 ± 20 20 81.5 ± 5.4 480 ± 20 70.1 ± 3.4 497 ± 19 100 88.2 ± 6.5 501 ± 12 83.9 ± 5.2 492 ± 24
Table 2: Heart Rate and Blood Pressure Changes to capsaicin in vivo.
79 vs 37.0% ± 4.3% WT + 4-HNE at 10-4 capsaicin) (Figure 1B). However, 4-HNE treatment
had no further effect on capsaicin-mediated vasorelaxation in isolated microvessels from
db/db mice (Figure 4-1C).
Having established that 4-HNE directly attenuates TRPV1 mediated signaling at
the whole animal and vascular levels, we next examined if 4-HNE-mediated effects are
due to 4HNE directly attenuating TRPV1-mediated currents using patch-clamp
electrophysiology. HEK293 cells were transiently transfected with pCDNA3-TRPV1 (WT)
and treated with 4-HNE (10 μM) for 1-hour, isolated, and TRPV1-specific currents were
examined (cells remained in 4-HNE supplemented media). 4-HNE treatment significantly decreased capsaicin-dependent TRPV1-mediated currents to 100 nM capsaicin (98.1 ±
20.5 pA/pF Cap vs 47.8 ± 6.6 pA/pF Cap/4-HNE in HEK at + 100 mV) (Figure 4-2A). To ensure this concentration of 4-HNE did not demonstrate toxic cellular effects, cell survival of HEK cells treated with 4-HNE was examined via PrestoBlue® assay, which verified that this observed decrease in TRPV1 activity was not due to increased cellular death (94.3%
± 2.1% HEK; at 10-5 4-HNE) (Figure 4-2B).
Transiently transfecting cells demonstrated a controlled cellular environment where 4-HNE effects could be measured. However, since endothelial TRPV1 has been shown to be vital in vascular regulation we next sought to verify 4-HNE-mediated effects on intrinsic TRPV1 activity in MCECs. This was achieved with the use of calcium imaging.
Representative traces of MCECs loaded with fura-2 acetoxy methylester (fura-2/AM; 2
μmol/L) illuminate the transient increases in intracellular free Ca2+ concentration ([Ca2+]i) to capsaicin treatment (Figure 4-3A). Overall, this represents the intrinsic TRPV1- mediated activation. However, when MCECs were pretreated with 4-HNE (10 μM for 1 hour), the capsaicin-mediated TRPV1-dependent [Ca2+]i was significantly blunted
compared to control (Figure 4-3B and 4-3D). To confirm the specificity of capsaicin
80 A
BB
Figure 4-2: 4-HNE decreases rTRPV1 mediated currents: A) I-V summary plot of TRPV1-dependent currents in HEK cells, in whole-cell configuration, in the presence of absence of 4-HNE (n = 9 cells/group; 10 μM 4-HNE, 1 hour). B) Cell survival of HEK cells exposed to increasing doses of 4-HNE for 1-hour (n = 3 separate experiments, performed in triplicates).
81 activation, cells pretreated with the TRPV1 antagonist SB366791 (10 μM) demonstrated
2+ a complete lack of capsaicin-mediated transient increases in [Ca ]i. (Figure 4-3C and 4-
3D). Similar to the electrophysiology results, prolonged 4-HNE treatment significantly
2+ diminished capsaicin-dependent increases in [Ca ]i in MCECs (0.29 ± 0.02 Cap vs 0.20
± 0.2 Cap/4-HNE vs 0.03 ± 0.01 Cap/SB in HEK; Δ340/380 Ratio) (Figure 4-3D).
Following determination that 4-HNE alters TRPV1 functional activity, we next sought to determine potential 4-HNE modification sites on TRPV1. To best determine the
specific amino acid modified by 4-HNE, we rationalized that mass spectroscopy would be
an optimal unbiased approach. To further facilitate this, we sought to tag our protein for
easy isolation for mass spectroscopy determination. Utilizing predesigned primers that
optimally inserted into our plasmid, we added a 6x-Histidine tag to our pCDNA3-rTPV1 plasmid (see Materials and Methods for further details). Following confirmation via sequencing, confirmation of protein expression was determined via immunoblotting
(Figure 4-4), demonstrating 6x-His tag was present at the protein level.
Following successful tagging of TRPV1, we next sought to pull-down TRPV1-His and demonstrate specificity of the 6x-His tag. HEK cells were transfected with pCDNA3-
TRPV1 with and without 6x-His; next, whole protein was isolated and subsequently eluted via a pull-down assay with Dynabeads containing a nickel moiety to isolate histidine rich
proteins. Following elution, products were run on polayacrylamide gel and stained with
coomassie blue (Figure 4-5). Lanes 3 and 4 (supernatants of 6x-His pull-down) served as a positive control for the presence of protein, while the elution lanes (lanes 1 and 2)
demonstrate the specificity of 6x-His tag on TRPV1 pull-down at ~100 kD. With confirmation of specificity, samples were given to Ohio State University’s Mass
Spectroscopy Core where the samples were processed. Multiple samples were processed and protocols were continually optimized. It should be stated again, TRPV1 is a 6
82
A B
C D
Figure 4-3: 4-HNE decreases intracellular Ca2+ influx in MCECs. Representative traces of MCECs loaded with Fura2-AM, exposed to ATP (10 μM; positive control) and then capsaicin alone (A), capsaicin and 4-HNE (B), or capsaicin and SB366791 (TRPV1 antagonist) (C). D) Summative intracellular calcium changes compared to baseline when exposed to capsaicin, capsaicin + 4-HNE (1-hour pretreatment; 10 μM), and capsaicin + SB366791 (10 μM) (n = 24 cells, capsaicin; n = 17 cells, 4-HNE; n = 5 cells, SB366791).
83
TRPV1: X X X X 6x His: X X
100 kD- Anti-His Tag
100 kD- TRPV1
43 kD- β-actin
Figure 4-4: Immunoblot of 6x His rTRPV1. Immunoblot demonstrating protein expression of 6x-His tag of TRPV1 in pCDNA3-plasmid transfected into HEK cells.
84
Lane #: 1 2 3 4 TRPV1: X X X X 6 x His: X X Supernatant: X X
100 kD
Figure 4-5: 6x-His pull-down of rTRPV1. Comassie Blue stained polyacrylamide gel of TRPV1 pulled-down with or without 6x-His tag (~100 kD). Red box highlights a protein at ~100 Kd (presumably TRPV1) that is only pulled-down in the presence of the His-tag motif.
85 AA 1 MEQRASLDSE ESESPPQENS CLDPPDRDPN CKPPPVKPHI FTTRSRTRLF GKGDSEEASP 61 LDCPYEEGGL ASCPIITVSS VLTIQRPGDG PASVRPSSQD SVSAGEKPPR LYDRRSIFDA 121 VAQSNCQELE SLLPFLQRSK KRLTDSEFKD PETGKTCLLK AMLNLHNGQN DTIALLLDVA 181 RKTDSLKQFV NASYTDSYYK GQTALHIAIE RRNMTLVTLL VENGADVQAA ANGDFFKKTK 241 GRPGFYFGEL PLSLAACTNQ LAIVKFLLQN SWQPADISAR DSVGNTVLHA LVEVADNTVD 301 NTKFVTSMYN EILILGAKLH PTLKLEEITN RKGLTPLALA ASSGKIGVLA YILQREIHEP 361 ECRHLSRKFT EWAYGPVHSS LYDLSCIDTC EKNSVLEVIA YSSSETPNRH DMLLVEPLNR 421 LLQDKWDRFV KRIFYFNFFV YCLYMIIFTA AAYYRPVEGL PPYKLKNTVG DYFRVTGEIL 481 SVSGGVYFFF RGIQYFLQRR PSLKSLFVDS YSEILFFVQS LFMLVSVVLY FSQRKEYVAS 541 MVFSLAMGWT NMLYYTRGFQ QMGIYAVMIE KMILRDLCRF MFVYLVFLFG FSTAVVTLIE 601 DGKNNSLPME STPHKCRGSA CKPGNSYNSL YSTCLELFKF TIGMGDLEFT ENYDFKAVFI 661 ILLLAYVILT YILLLNMLIA LMGETVNKIA QESKNIWKLQ RAITILDTEK SFLKCMRKAF 721 RSGKLLQVGF TPDGKDDYRW CFRVDEVNWT TWNTNVGIIN EDPGNCEGVK RTLSFSLRSG 781 RVSGRNWKNF ALVPLLRDAS TRDRHATQQE EVQLKHYTGS LKPEDAEVFK DSMVPGEK
B y13 y12 y11 y10 y9 y8 y7 y6 y5 y4 y3 B 332K G L T P L A L A A S S G K345 b3 b4 b6 b7 b8 b9 b10 b11 b12 b13
299.16 400.30 610.51 681.15 794.65 865.54 936.61 1023.70 1167.68 b3 b4 b6 b7 b8 b9 b10 b11 b13 1110.97 b12
101.04 210.20 (97+113) 70.64 113.50 70.89 71.07 87.09 87.27 56.71 Thr Pro-Leu Ala Leu Ala Ala Ser Ser Ser
291.22 378.28 449.36 520.38 633.44 704.50 817.65 914.55 1015.59 1185.67 y3 y4 y5 y6 y7 y8 y9 y10 y11 y13 1128.71 y12
87.06 71.08 71.02 113.06 71.06 113.15 96.90 101.04 113.12 56.96 Ser Ala Ala Leu Ala Leu Pro Thr Leu Gly
200 300 400 500 600 700 800 900 1000 1100 1200 m/z
Figure 4-6: Mass Spectroscopy Sequence Coverage of rTRPV1-His. A) Sequence coverage of the rat TRPV1 sequence coverage obtained from HEK cells transfected with pCDNA3-TRPV1-His demonstrating 41% sequence coverage. B) Detailed mass over charge analysis of subsection of TRPV1 sequence.
86 transmembrane protein making the isolation of the TM portion of the protein extremely difficult. Overall, ~41% sequence coverage was achieved. Finally, it is important to note that only 3 of the 18 cysteines were covered in this sequence (~17%) (Figure 4-6). This amino acid was investigated more closely because it is well known within the literature that 4-HNE reacts at the fastest rate with cysteines.
Since only ~41% sequence converage was acheived with mass spectroscopy, an alternative approach using computational modeling was explored. Using the in silco
modeling program YASARA 14.7.17 (www.yasara.org), we initially explored potential 4-
HNE covalent modification sites. Following the construction of the 6 transmembrane
subunit of TRPV1 using YASARA 14.7.17, potential interactions between 4-HNE and
TRPV1 were examined using binding algorithms inherent to the program (Autodock VINA).
Autodock VINA revealed that 4-HNE has multiple potential binding motifs on TRPV1
(Figure 4-7), in particular centered around Cysteine residues in the pore helices (TM5-
TM6), specifically Cysteine residues 616, 621 and 634. Using the same binding
algorithms, the effects of a single point residue mutation (cysteine to glycine) at the
aforementioned cysteines on 4-HNE-mediated interaction was examined. Importantly, the
single point mutations for each individual residue (C616C, C621G or C634G) or in concert
(TriC) had no effect on the overall predicted structure of TRPV1, yet Autodock VINA
predicted a decrease in 4-HNE-mediated PTM on TRPV1 pore residues (Figure 4-7C- 4-
7F). The results of the computational modeling therefore led us to examine the effects of each point mutation on 4-HNE-dependent blunting of TRPV1 activity. Plasmids pertaining to each point mutation were a gift from Dr. Viktorie Vlachova.
Next, these four plasmids were transfected into HEK cells and exposed to capsaicin to initially examine channel functionality. Capsaicin-dependent TRPV1 currents in the four mutant constructs (C616G, C621G, C634G and TriC) showed no statistical
87
A B C
D E F
Figure 4-7: In silico modeling of rTRPV1 transmembrane region and 4-HNE binding. A) The transmembrane portion of rWT-TRPV1 modeled utilizing YASARA 14.7.17, further analysis demonstrating the three cysteines within proximity of the pore region of TRPV1 (TM5/TM6). B) Utilizing the binding algorithm within Autodock VINA, 4-HNE interaction with TRPV1 was modeled and observed changes occurred in the red circle of all the mutated constructs C) C616G-TRPV1, D) C621G-TRPV1, E) C634G-TRPV1 and F) Tri C to G-TRPV1.
88
A B
C D
Figure 4-8: rTRPV1 Mutant Constructs does not alter electrophysiological response to Capsaicin. A-D) TRPV1 constructs with individual cysteines mutated to glycine (C616G, C621G or C634G) or all three combined (TriC) demonstrate no statistical difference compared to WT-rTRPV1 (n = 8 cells, WT; 13 cells, C616G; 11 cells, C621G; 8 cells, C634G; 9 cells, TriC).
89
A B
C D
Figure 4-9: C621G Mutant Construct Rescues 4-HNE Mediated Decreases in rTRPV1-Dependent Currents. I-V plots summarizing whole cell electrophysiology recordings of capsaicin-mediated TRPV1-dependent currents in HEK cells transiently transfected with mutant constructs following 1-hour pretreatment with 4-HNE (10 μM). C616G-TRPV1 (A; n = 8 cells, capsaicin; n = 9 cells, 4-HNE) and C634G-TRPV1 (C; n = 11 cells, capsaicin; n = 7 cells, 4-HNE), demonstrate similar attenuation in capsaicin-dependent TRPV1 currents following 4-HNE treatment. Whereas, C621G- TRPV1 (B; n = 13 cells, capsaicin; n = 6 cells, 4-HNE) and TriC-TRPV1 (D; n = 8 cells, capsaicin; n = 10 cells, 4-HNE) in the presence of 4-HNE have no attenuation in capsaicin-mediated TRPV1 current.
90 significant difference compared to the WT-TRPV1 construct (Figure 4-8A – 5-8D). Having
established attenuated 4-HNE-mediated PTM on TRPV1 pore residues using
computational mapping and binding algorithms, we next assessed each mutant
construct’s ability to rescue TRPV1 function when exposed to prolonged 4-HNE treatment
construct’s ability to rescue TRPV1 function when exposed to prolonged 4-HNE treatment
(10 μM for 1 hour). Patch-clamp analysis of the TriC mutant construct revealed its ability
to rescue capsaicin-induced TRPV1 currents in the presence of 4-HNE (87.2 ± 15.0 pA/pF
Cap vs 103.3 ± 19.4 pA/pF Cap/4-HNE; TriC mutant in HEK at + 100 mV) (Figure 4-9D).
To further elucidate the specific residue(s) vital to restoration of channel activity, each
individual mutant construct was examined in the presence of 4-HNE. Interestingly, C616G
and C634G displayed attenuated capsaicin-mediated currents similar to the WT-TRPV1
construct in the presence of 4-HNE ((128.4.2.1 ± 18.4 pA/pF Cap vs 85.2 ± 19.8 pA/pF
Cap/4-HNE; C616G mutant in HEK at + 100 mV) (141.9 ± 17.2 pA/pF Cap vs 62.9 ± 10.5
pA/pF Cap/4-HNE; C634G mutant in HEK at + 100 mV) (Figure 4-9A and 4-9C); whereas,
the mutant construct C621G, exhibited complete rescue similar to the TriC mutant (113.0
± 10.0 pA/pF Cap vs 126.6 ± 34.4 pA/pF Cap/4-HNE; C621G mutant in HEK at + 100 mV)
(Figure 4-9B).
To further validate that 4-HNE-mediated decreases in TRPV1 activity was due to
modification of residue C621, 6x His-tag pull-downs were performed on HEK293 cells
transfected with WT and C621G mutant constructs containing 6x His-tag. Following 36 to
48 hours post transfection, cells were treated with 10 μM 4-HNE or vehicle for 1 hour and
TRPV1 was pulled down using a Ni-NTA moiety (Dynabeads) and then probed for 4-HNE
covalent modification. We found significant interaction between WT-TRPV1 and 4-HNE
compared to the vehicle control (~1.3-fold increase) (Figure 4-10A and 4-10B). However,
this 4-HNE-TRPV1 interaction was significantly reduced in cells expressing C621G-
91
A
M 4-HNE M 4-HNE µ WT-TRPV1µ + C621G-TRPV1 WT-TRPV1 VT 10 C621G-TRPV1 VT + 10 100 Kd- Anti-4-HNE
100 Kd-
Anti-TRPV1
B C
Figure 4-10: Mutation of rTRPV1 prevents 4-HNE mediated Post-Translational Modification. A) Representative immunoblot of 6x-his tag pulldown of WT-rTRPV1 and C621G-rTRPV1 in the presence of absence of 4-HNE (1-hour pretreatment; 10 μM). B) 4-HNE treatment increased 4-HNE-dependent PTM of TRPV1 and this was attenuated in the C621G-rTRPV1 mutant construct (C).
92
HEK-293A A NS (Transfected) B 2.0 VT 4-HNE 1.5 -actin )
100 kD- β TRPV1 1.0
0.5 (normalized to (normalized
42 kD- β-actin Expression TRPV1 Relative 0.0 -5 ] VT
4-HNE [10 C
Figure 4-11: 4-HNE and H2O2 effects on TRPV1 expression and mRNA. A) Representative immunoblot of HEK cells transfected with rTRPV1 in the presence and absence of 4-HNE (10 μM, 1 hour). B) Quantification of fold change of TRPV1 following 1-hour treatment with 10 μM 4-HNE (normalized to β-actin (n=3)). C)HEK cells constitutively expressing rTRPV1 were treated with 4-HNE (10 μm) or H2O2 (100 μm) for 1-hour. Following, RNA was isolated and cDNA libraries were generated via reverse transcription. TRPV1 primers were then utilized to quantitate mRNA expression (n =2 experiments performed in triplicates).
93
Real Time PCR Primers Gene RefSeq Primers Rat NM_0319 Probe: 5'-/56- TRPV1 82 FAM/TTTGCCCTG/ZEN/GTTCCCCTTCTGAG/31A8kFQ/-3' Forward: 5'-ATGTCTATCTCGAGTGCTTGC-3' Reverse: 5'-CCCTGAGCTTCTCCCTGAG-3' Human NM_0001 Probe: 5'-/56- HPRT 94 FAM/AGCCTAAGA/ZEN/TGAGAGTTCAAGTTGAGTTTGG/31 ABkFQ/-3' Forward: 5'-GCGATGTCAAT AGGACTCCAG-3' Reverse: 5'-TTGTTGT AGGAT ATGCCCTTGA-3' CMV Probe: 5'- Promot /5TET/TGTCGTAAC/ZEN/AACTCCGCCCCATT/31ABkFQ/-3' er Forward: 5'-GA TTTCCAAGTCTCCACCCC-3' Reverse: 5'-AGACCTCCCACCGT ACAC-3'
Table 3: Primers for qRT-PCR.
94
A B
1.5 ) S e O g 1.0 n N a e / h S C
O d l N o e 0.5 - F p (
0.0 0 5 15 Time (min) C D 2.0 10 µM 4-HNE ) S
e 1.5 O g n N a e / h S
C 1.0
O d l N o e - F
p 0.5 (
0.0 0 5 15 Time (min) Figure 4-12: 4-HNE impairs TRPV1 dependent eNOS signaling. A) Representative blot of eNOS phosphorylation at serine 1177 (and total eNOS) in mouse coronary endothelial cells (MCEC) treated with 1 µM capsaicin at 5 and 15 minutes. B) Phosphorylation changes in response to TRPV1 stimulation (n=2). C) Representative blot of eNOS phosphorylation (and total eNOS) in MCEC pre-treated with 4-HNE for 1-hour followed by 1 µM capsaicin at 5 and 15 minutes. D) Phosphorylation changes in response to TRPV1 stimulation (n=4).
95 TRPV1 mutant (Figure 4-10A and 4-10C) (note: the first lane of the representative blot is
from a separate experiment compared to latter lanes). These data suggest 4-HNE
modifies residue C621 to alter its channel activity.
4-HNE has been shown to regulate expression of channels through a variety of means. As such, we sought to determine if 4-HNE (and LT H2O2) altered TRPV1 protein and RNA expression. HEK cells constitutively expressing TRPV1 were treated with 10 μM
4-HNE for 1 hour. Protein was isolated and probed and no difference in expression was noted (Figure 4-11A and 4-11B). Further examination to determine how 4-HNE and H2O2
would affect RNA expression. Following treatment, RNA was isolated and expression was shown to be reduced in both treatments by qRT-PCR when compared to control. (Figure
4-11C). This is an interesting contrast to protein expression in both treatment protocols.
Previous work by our lab and others had established the molecular coupling of
TRPV1 to eNOS signaling (Bratz et al., 2008, Ching et al., 2011, Ching et al., 2012, Guarini et al., 2012, Ching et al., 2013). Furthermore, it was demonstrated that this eNOS signaling was disrupted in the diabetic model of diabetes. As previously mentioned, 4-HNE is elevated in diabetes and as such we next sought to determine how 4-HNE altered this signaling cascade. MCECs were treated with 1 μM capsaicin from 5 to 15 minutes and the eNOS activity was determined utilizing phosphorylation status of Serine 1177. Upon exposure to capsaicin, eNOS phosphorylation increased in control MCEC, whereas those treated with 10 μM 4-HNE demonstrated an attenuation in eNOS phosphorylation in response to capsaicin (Figure 4-12).
eNOS is regulated via multiple mechanisms including chemical modulation/PTM
(phosphorylation and S-nitrosylation) as well as protein-protein interactions. A well-known regulator is the physical interaction between eNOS and the protein Cav-1. Cav-1 is responsible for suppressing eNOS function until corresponding signaling disjoins the
96 AA B
CC DD
Figure 4-13: Computational Modeling demonstrating TRPV1/Cav-1 direct interaction. A) Ribbon diagram of TRPV1 (red) bound to Cav-1 (blue). B) TRPV1 surface interaction with Cav-1 (green). C-D) Close-up view of binding occurring in the TRPV1/Cav-1 complex at TRPV1 sequence: WDRFVKRIFY.
97
AA BB —100 kDa —100 kDa —75 kDa IP: TRPV1 —75 kDa IP: Cav-1 IB: TRPV1 IB: TRPV1 —50 kDa —50 kDa
IP: TRPV1 IP: Cav-1 —20 kDa IB: Cav-1 IB: Cav-1 —20 kDa
Figure 4-14: Co-Immunoprecipitation Reveals Direct Interaction between TRPV1 and Cav-1. A) TRPV1 pulldown via antibody demonstrates direct Cav-1 interaction. B) Conversely, Cav-1 pulldown illustrates a TRPV1/Cav-1 association.
98 protein-protein interaction. Interestingly, while the signaling mechanism between TRPV1 and eNOS has been investigated, the interaction between Cav-1 and TRPV1 to form a
large signaling complex has not been explored. As such, we sought to explore this
potential interaction initially utilizing computer modeling (similar to Figure 4-7). Modeling
results demonstrated 10 likely “binding interaction scenarios”. However, further
investigation of the TRPV1 sequence revealed TRPV1 contains a potential Cav-1 binding motifs (where Ø represents any aromatic amino acid and X represents any amino acid)
ØXXØXXXXØØ. This is a mirror image to the conical binding motif of cav-1 ØXXXXØXXØ
(Alioua et al., 2008). This corresponding sequence in TRPV1, 426WDRFVKRIFY435, occurs
just before the TRPV1 TM1 and as such made one modeling prediction the most likely
(Figure 4-13). Experimentally, BAECs were cultured and subsequent protein was isolated,
which was treated with agarose beads conjugated with either TRPV1 or Cav-1 antibodies.
Following pull-down and elution western immunoblot demonstrated when TRPV1 was
immunoprecipitated, Cav-1 was concurrently isolated (Figure 4-14A). Furthermore, when
Cav-1 was immunologically pulled-down TRPV1 was present similarly (Figure 4-14B).
Overall, demonstrating a potential binding partner in a larger protein signaling complex.
Discussion:
The results of this aim determined that 4-HNE directly affects TRPV1 activity, as
demonstrated on a vertical scale from the cellular level to the in vivo regulation of coronary
blood flow. Furthermore, a key pore cysteine residue, Cysteine 621, was shown to be
responsible for this impaired activity associated with 4-HNE binding. In addition, we
establish further roles for the pore forming cysteine residues in the regulation of TRPV1 function; specifically, we expand the current understanding to include the notion that these residues are further controlled by signals of 4-HNE-mediated PTM. Moreover, we found that single amino acid mutation could rescue TRPV1 function in the presence of 4-HNE. 99 Also, coupling of eNOS to endothelial TRPV1 has been recently illustrated by our lab and
others; more importantly, a decrease in NO bioavailability is a well characterized
phenomenon that contributes to diabetic microvasculature dysfunction. A mechanism to
describe endothelial dysfunction could be 4-HNE-mediated PTM and resultant TRPV1
dysfunction leading to blunted TRPV1-dependent eNOS activation and NO production. As
such, we investigated the effects of 4-HNE on TRPV1-mediated activation of eNOS (via
eNOS phosphorylation). We report here that 4-HNE decreased TRPV1-dependent eNOS
phosphorylation. Finally, to further elucidate the signaling cascade association with
TRPV1-dependent eNOS activation, initial studies examined the ability of TRPV1 to directly interact with Cav-1 and thus regulate eNOS activity. Initial results illustrate the ability of TRPV1 to directly interact with Cav-1, a novel mechanism to linking TRPV1- mediated activation of eNOS. Taken together, our results establish a novel role of 4-HNE
modification of TRPV1 to elicit decreased channel activity and subsequent eNOS
phosphorylation, which ultimately could contribute to the microvascular dysfunction and
regulation of CBF observed in diabetes.
The reactivity and/or selectivity of 4-HNE’s to each amino acid is quite different, as
it is known to preferentially modify cysteine residues (0.6 molar HNE/amino acids ratio)
over histidine (1 x 10-3) and lysine (3 x 10-4) residues (Esterbauer et al., 1991, Poli et al.,
2008). Due to their reactive nature, adduct formation with proteins, phospholipids and nucleic acids has been linked to cytotoxic events (Jaganjac et al., 2013, Ayala et al., 2014).
4-HNE elicit its effects in a variety of manners including protein activation, inhibition and increase degradation via the ubiquitin-proteasome pathway. Specifically, 4-HNE has been shown to decrease adiponectin levels in adipocytes in a dose-dependent manner and this observation could be reversed via treatment with the proteasome inhibitor MG132 (Wang et al., 2012). This resulting decrease in adiponectin is significant in that adiponectin levels
100 are inversely related to obesity and its complications (Ahima et al., 2014). However, the
expression level of TRPV1 protein was not effected following 1-hour 4-HNE treatment.
This differs from the current literature on 4-HNE and ion channels and suggests an avenue
for further exploration about the interaction of 4-HNE and TRPV1.
Oxidative stress-mediated regulation of ion channels has been of recent interest
by many groups. TRP channels, specifically TRPV1 and TRPA1, have become well
recognized as broad sensors of oxidative challenges (Trevisani et al., 2007). Chuang et.
el. demonstrated the sensitivity of TRPV1 to reactive oxygen species, specifically H2O2
(Chuang and Lin, 2009), identifying the importance of cysteine modification in TRPV1 activity. Further work by Susankova et. al. demonstrated key pore cysteines are sensitive to dithiothreitol relative to TRPV1’s temperature sensitivity and activation (Susankova et al., 2006). A recent study reported the ability of 4-HNE to interact and activate the TRPA1 channel (Trevisani et al., 2007). However, in that same study, only 4-HNE-mediated activation (and not attenuation) of TRPV1 was examined and shown not to stimulate
TRPV1. Furthermore, TRPA1 has been shown to be expressed in pancreatic beta cells and that activation by 4-HNE increases insulin independently of KATP channels (Cao et al.,
2012).
Moreover, 4-HNE has been demonstrated to affect a number of other ion channels including BKCa. In a recent study, polyunsaturated fatty acids, arachidonic acid and 4-HNE
were investigated for their role in regulating mitochondrial BKCa. While some metabolites did alter the channels activity, 4-HNE had no effect on the mitochondrial BKCa (Olszewska et al., 2014). However, rat retinal arterioles given the β2- adrenoceptor agonist,
salbutamol, relaxation occurred via BKCa and this was attenuated by the addition of 4-HNE
(Mori et al., 2015). Similarly, Kishimoto et al., recently demonstrated the possibility of 4-
HNE-dependent modification of TRPV1 in the human esophageal epithelial cell line
101 Het1A, although, again, no direct effects on channel activity were examined (Kishimoto et
al., 2011). The TRPV1 structure/sequence reveals that there are 19 cysteines residues
per subunit, with only a few known to be redox sensitive, specifically the 3 pore region
cysteines of interest in the current study. Recently, David Julius’ lab elucidated a partial
structure for TRPV1 with high-resolution Cryo-EM (Cao et al., 2013, Liao et al., 2013).
With further exploration of this structure in multiple states, this advancement in the field
will bring about greater understanding of ion channels, including the exploration of how
PTM (including 4-HNE) affects ion channel gating, kinetics and/or structure.
The production of 4-HNE is a well-established phenomenon resulting from the
imbalance of oxidative stress. In the case of diabetic patients, reports have demonstrated
an increase in 4-HNE modification levels compared to non-diabetic patients (Nakayama et al., 2005, Jaganjac et al., 2013). Furthermore, 4-HNE has been exhibited to play a critical role in cardiovascular diseases, including, in the development and progression of atherosclerosis, cardiac hypertrophy and myocardial ischemia-reperfusion (Chapple et al.,
2013, Mali and Palaniyandi, 2014). Specifically, in spontaneously hypertensive rats 4-HNE was increased leading to adduct formation with liver kinase B1 (LKB1) (Dolinsky et al.,
2009). Formation of this adduct reduced the activity of LKB1, leading to an increase activity of mTOR/p706S kinase in isolated cardiomyocytes resulting in a hypertrophy (Dolinsky et al., 2009).
4-HNE’s role in atherosclerosis is important as levels have been observed to be increased in oxidized LDL particles infiltrating the vascular smooth muscle cell (VSMC) layer (Mali and Palaniyandi, 2014). This leads to increased stress signaling and proliferation within the VSMC (Chapple et al., 2013). In addition, atherosclerosis risk increases when endothelial function becomes impaired and 4-HNE has also been observed to contribute to said endothelial dysfunction. For instance, in an elegant study
102 by Usatyuk et. al., the authors demonstrated the ability of 4-HNE to disrupt the endothelial barrier via 4-HNE-mediated increases in ROS production. Using transendothelial electrical resistance measurements, they demonstrated 4-HNE treatment disrupted the endothelial barrier through aberrant MAPK signaling cascade ( specifically ERK, JNK, and p38 MAPK) resulting in actin remodeling (Usatyuk and Natarajan, 2004). Interestingly, they demonstrated a differential effect of 4-HNE. At lower concentrations (<50 μM) this effect was independent of cell death and apoptosis; however, at higher and longer treatments cell death was apparent. Subsequent studies also investigated the importance of GSH pools. Specifically noting that prevention of increased endothelial permeability was accomplished pharmacologically by rescuing glutathione pools with NAC and mercaptopropionyl glycine (Usatyuk et al., 2006). Finally, they expanded their understanding of 4-HNE signaling cascade in EC by noting changes in focal adhesions and cell-to-cell contact; determining the roles of adherins, integrins and connexions
(Usatyuk et al., 2006).
Understanding oxidative challenges to TRPV1, specifically endothelial TRPV1, will lead to further insights into the regulation of vascular function. In the current study, we demonstrate that oxidative stress-induced PTM (4-HNE) of TRPV1 was associated with attenuated endothelial TRPV1 signaling. In comparison, previous studies have found a 4-
HNE activation of endothelial TRPA1 elicited cerebral artery dilation (Sullivan et al., 2015).
This is thought to occur via EDHF signaling through myoendothelial gap junctions. Further effects of 4-HNE on the vasculature are illustrated through the alteration of endothelial nitric oxide (NO) production. Pope et. al. demonstrated 4-HNE decreases NO release through decreased activity of dimethylarginine dimethylamine hydrolase (DDAH), a protein involved in methylarginine metabolism (Pope et al., 2007). However, our study does demonstrate that in fact 4-HNE effects TRPV1 mediated eNOS phosphorylation,
103 suggesting a convergence of pathways that contribute to endothelial and microvascular
dysfunction observed in diabetes. The regulation of NO production by eNOS is complex
and multifactorial with the integration and balance between competing signals and even
the physical interaction between other proteins, such as caveolin-1 (Bernatchez et al.,
2005, Kraehling et al., 2016).
Cav-1’s regulation of eNOS activity (via physical interaction) and thus NO
production is well established. As such, we sought to further determine if TRPV1 could
directly and indirectly influence Cav-1’s inhibitory regulation of eNOS. Cav-1 is a 22 kD
protein that is highly expressed in many cells, including abundant endothelial expression
(Feron et al., 1996, Couet et al., 1997, Bernatchez et al., 2005, Boscher and Nabi, 2012,
Panneerselvam et al., 2012, Kraehling et al., 2016). It has been established that Cav-1 is
the protein surrounding invaginations within the endothelium termed caveolae. Since its
initial description, among the many roles Cav-1 has been proposed to play, major
consensus exists in the description of its coupling and regulation to eNOS in endothelial
cells. Early work demonstrated that this physical association inhibited the production of
NO via decreasing eNOS activity (Bernatchez et al., 2005, Boscher and Nabi, 2012).
Further studies elucidated that Ca2+ influx and subsequent Ca2+-calmodulin activation (in the presence of hsp90) was pivotal in the release of eNOS from Cav-1. This dissociation leads to an increase in production of NO (Gratton et al., 2000). Recent studies have demonstrated that Cav-1 binds with ion channels including BKCa and another vanilloid
TRP channel, TRPV4 (Alioua et al., 2008, Goedicke-Fritz et al., 2015). Taken together, these observations open the possibility that TRPV1 and Cav-1 could directly interact. This would be important because when stimulated TRPV1, could transmit the calcium signal quickly, to activate Ca2+-calmodulin (these proteins have also been observed to interact)
(Ching et al., 2011). This suggests the potential role for the signaling complex consisting
104 of TRPV1/eNOS/Cav-1/Calmodulin/hsp90 could be responsible for transmitting external
signals to induce a vascular response.
Overall, the current study provides novel insight into physiological consequences
of 4-HNE aberrant regulation of ion channels and the functional importance of pore
cysteines in TRPV1. A diverse combination of the lipid peroxidation products have been
demonstrated to increase in diabetes and alter cellular functions which include 4- oxononenal (4-ONE), 4-hydroxyhexenal (4-HHE), and 4-hydroxy-2E,6Z-dodecadienal (4-
HDDE) (Benedetti et al., 1980, Esterbauer et al., 1991, Pillon and Soulage, 2012, Cohen et al., 2013). However, 4-HNE is the most widely studied as it is derived from ω-6- polyunsaturated fats formed via non-enzymatic processes (Pillon and Soulage, 2012,
Cohen et al., 2013). As such, we cannot exclude the possibility of other lipid peroxidation products from contributing to the altered function of TRPV1 seen in diabetes. Future studies will need to examine the role for other lipid peroxidation products on TRPV1 function. Finally, TRPV1 possesses 19 cysteine residues in one subunit of its tetrameric structure with each cysteine possessing a unique microenvironment susceptible to a variety of stimuli (Wang and Chuang, 2011, Ogawa et al., 2016). Although the current chapter demonstrates a likely role for C621 in the 4-HNE dependent blunting of endothelial
TRPV1 signaling, the ability of 4-HNE to modify other residues (cysteine, histidine and lysine) and effect TRPV1 signaling cannot be discounted. Initially, we did try to utilize a non-biased approach (mass spectroscopy) to determine which resides were potentially modified. However, these efforts proved arduous as only ~41% sequence coverage was achieved. Although not ideal, future studies could address the role of other residues by systematically mutating all of the (other) cysteines, histidine and lysine individually (and in concert) and observe if any have a similar rescue profile to that of C621G mutant.
105 In conclusion, this chapter demonstrated the ability of 4-HNE dependent PTM to
attenuate TRPV1-dependent signaling, vascular function and regulation of CBF. 4-HNE is
responsible for decreased TRPV1 activity via apparent PTM of the Cysteine 621 residue in the pore forming region. The functional consequence of 4-HNE–associated PTM of
TRPV1 results in decreased TRPV1-dependent eNOS signaling ultimately contributing to microvascular dysfunction.
106 Chapter 5: Overall Discussion and Conclusions
The work within this dissertation was an extension of recent findings by our lab. As
mentioned previously, we had demonstrated a crucial role for endothelial TRPV1 to
regulate coronary blood flow and that the ability of this ion channel to properly regulate
microvascular function (hence coronary blood flow) was disrupted in two models of Type
II diabetes (mice and swine) (Bratz et al., 2008, Guarini et al., 2012). This central role of
diabetes in altering TRPV1 signaling allowed for the development of a hypothesis that was centered around oxidative stress-induced PTM-mediated dysfunction of TRPV1. Previous work related to TRPV1 and coronary blood flow highlighted the opportunity to investigate
H2O2 as a key underpinning to this physiological and aberrant regulation (Barlow and
White, 1998, Yoshida et al., 2006, Chuang and Lin, 2009, Wang and Chuang, 2011,
Bretón-Romero and Lamas, 2014). Consequently, initial results in this dissertation
(Chapter 3) demonstrated that TRPV1 is differentially regulated under various conditions
of oxidative stress. As such, acute H2O2 exposure activated TRPV1, eliciting a vascular response (relaxation). However, under an increased oxidative exposure, TRPV1 activity was drastically diminished at the cellular, in vitro, and in vivo level. In subsequent studies
(Chapter 4), it was observed that a similar decrease in activity at all three levels occurred
following 4-HNE exposure. Further work in Chapter 4 attempted to connect this channel
dysfunction to diabetic microvascular dysfunction, it was determined that 4-HNE
decreased capsaicin-mediated TRPV1-dependent phosphorylation of eNOS.
Overall, a natural progression of elevated ROS (either exposure time and/or levels)
in diabetes is associated with increased lipid peroxidation
107 (Poli et al., 2008, Pillon et al., 2012, Cohen et al., 2013, Jaganjac et al., 2013). This central
theme underlies the connection between the work of Aim 1 (Chapter 3) and Aim 2
(Chapter 4) on a molecular level. Further work should be done to investigate the causality
between ROS (H2O2)-induced lipid peroxidation and TRPV1 activity. Furthermore, the
connection between TRPV1 and 4-HNE PTM should also be further interrogated. This
latter point has the unique challenge, whereby one must be able to isolate TRPV1 and
utilize the best available techniques to observe this PTM. Moreover, we did not
demonstrate 4-HNE modification of TRPV1 was increased in our diabetic model. There
are many challenges to this last point; however, with recent technological advances, like
the CRISPR technology, tagging of proteins in vivo to facility specific pull-down have
become feasible (Miano et al., 2016). As such, while I would like to draw a direct line
between the casualty of ROS and the 4-HNE PTM of TRPV1, however I cannot discount two (or more) separate pathways altering TRPV1 activity. For instance, an increase in
ROS (specifically H2O2) is known to lead to altered cysteine function potentially via a
reversible oxidation (sulfenylation) or potentially irreversible modification such as the
formation of a side group of sulfinic or sulfonic acid (Chung et al., 2013).
Work by Chuang and Lin, Susankova et. al., and Yoshida et al., established the
basis for TRPV1 as a sensor of oxidative stress (Susankova et al., 2006, Yoshida et al.,
2006, Chuang and Lin, 2009). Their work was crucial in determining the oxidative
regulation for specific cysteines within the TRPV1 structure. While not an emphasis of the
manuscript, Yoshida and colleagues demonstrated that TRPV1 expressed HEK cells
elicited a calcium influx when exposed to H2O2. They then determined that this response was abolished in a mutant construct of TRPV1 where the two cysteines of interest (C616 and C621) were substituted with tryptophan or serine (C616W C621S) (Yoshida et al.,
2006). This understanding of oxidative modification regulation set the groundwork to
108 develop and refine our hypothesis. Conclusively, this lead to the observation that 4-HNE
modifies a familiar cysteine: C621. Through this work, we have identified that this specific
cysteine residue is key in the detrimental regulation of TRPV1 from both oxidative (H2O2) and covalent (4-HNE) challenges. This provides an avenue for the development of targeted pharmaceutical agents. Interestingly, this potential therapeutic agent could be used to target aberrant TRPV1-regulation of CBF (as outlined in this dissertation); moreover, these oxidative modification has been shown to be an important in other
(patho)physiological processes including inflammatory hyperalgesia (Keeble et al., 2009),
suggesting development could be valuable in multiple disease states.
Many receptors and ion channels are susceptible to oxidative modifications.
Interestingly, the ryanodine receptor has been demonstrated to be modified by many such
modifications including nitric oxide, glutathione, and carbonylation (Aracena-Parks et al.,
2006, Gonzalez et al., 2010, Cutler et al., 2012, Shao et al., 2012, Moore et al., 2013,
Yang et al., 2014). This ion channel is a microcosm for a greater understanding of the
consequences of oxidative PTM. The capability of this and many other ion channels to be
modified by a diverse set of oxidative signals demonstrates the importance for (1) understanding which oxidative modifications are crucial for receptor modulation and (2) how said signals can converge in vivo. TRPV1 can now be utilized similarly to the
ryanodine receptor due in part to the fact that they both can be modified by a variety of
oxidative signals. Moreover, the uniqueness of this dissertation is that it established the
importance of an oxidative balance which resulted in a switch of TRPV1—from an
activated to an attenuated state.
Another example of a TRP channel susceptible to complex oxidative modifications
is TRPA1. This “sister” ion channel to TRPV1 is sensitive to hydrogen peroxide like
TRPV1, however is activated by 4-HNE (Trevisani et al., 2007, Sawada et al., 2008). This
109 activation is important in many physiological processes including insulin release and
cerebral artery dilation (Cao et al., 2012, Sullivan et al., 2015). Interestingly, and
confounding this understanding, TRPV1-TRPA1 are known to exhibit cross-talk.
Specifically, it has been demonstrated that TRPA1 and TRPV1 are co-localized in neurons
and when heterologously expressed in HEK cells (Staruschenko et al., 2010).
Furthermore, the cross-talk mechanism, which has been demonstrated to require NO and
PKCε, regulates resensitization and vascular signaling (Miyamoto et al., 2009, Zhang et
al., 2011, Sinha et al., 2015, Sinharoy et al., 2015). Ultimately, this gives rise to questions about the existence of coexpressed ion channels in different cells and tissues. It is interesting to speculate as to what would happen in a co-expressing tissue where 4-HNE desensitizes TRPV1 but activates TRPA1. While they both signal through Ca2+, this selective signaling through one TRP versus another could be important depending on what other proteins are co-localized.
When one zooms out to apply the underpinnings of what has been observed, it is
key to harken back TRPV1’s role in the coronary microvasculature. The tight control of
vasomotor tone in the coronary microvasculature is essential for the delivery of O2 and
other nutrients to one of the most metabolically active tissues (Tune et al., 2004, Tune,
2014). In this dissertation, we have demonstrated to role for H2O2-mediated TRPV1
regulation of CBF in conjunction with other ion channels including 4-AP sensitive Kv
channels. Interestingly, the expression of smooth muscle Kv1.5 was recently
demonstrated to play a role in metabolic dilation of the coronary vasculature (Ohanyan et
al., 2015). They demonstrated the importance of this specific channel under increased
cardiac work; suggesting the common signal for this regulation was H2O2. While this
dissertation did not directly address the coupling of blood flow to cardiac work, we
determined that the common signal, H2O2, appears to regulate TRPV1 as well. Overall,
110 this demonstrates a redundancy in the control of coronary blood flow, which would be
important such that any specific loss of function of one channel (be that through genetic
or environmental ablation) does not become a fatal alteration.
Moreover, our previous work demonstrated a reduced capacity of TRPV1-
dependent regulation of CBF in diabetes (Guarini et al., 2012). This is important because
diabetes is known to increase cardiovascular morbidity and mortality risk by 2 to 4 fold
(Lakka et al., 2002, Grundy, 2007). This uncoupling of CBF, in the form of decreased
coronary flow reserve (CFR), has been observed to affect overall mortality diabetes
(Murthy et al., 2012). Results determined that when patients were stratified by condition,
with the inclusion of an additional factor, CFR, diabetic patients without atherosclerosis,
but impaired CFR demonstrated a mortality risk similar to those patients with both diabetes
and gross atherosclerosis (~2.8%/year over three years) (Murthy et al., 2012).
Interestingly, those same patients of impaired CFR and diabetes had an increase in
mortality 9 times that of a cohort of diabetic patients that did not exhibit impaired CFR
(Murthy et al., 2012). Taken together, we defined a mechanism by which prolonged H2O2
and/or 4-HNE exposure disrupted TRPV1 CBF regulation, suggesting that the attenuated
CFR observed in diabetes could be due to an OS imbalance and aberrant TRPV1
signaling. Overall, this underscores the crucial need for investment in 3 vital areas to help
reduce the overall risk of diabetes in impaired CFR: (1) continue in-depth understanding of the underlying pathophysiology of CBF/CFR impairment (2) innovation and implantation of less invasive more accurate clinical evaluation of CBF/CFR and (3) the identification of pharmacological “protectors” in regards to CBF/CFR.
In conclusion, the work described herein demonstrates that H2O2 mediates
coronary vascular and blood flow through a TRPV1-mediated signaling cascade in a differential manner. The observed disruption of said vasculature and blood flow in
111 diabetes, is due in part to an imbalance of ROS leading to PTM of TRPV1 by 4-HNE
(and/or H2O2). Overall, providing a novel mechanism of disrupted regulation of CBF in diabetes with the potential for future development targeted therapeutic agents to mitigate the known risk.
112
References
Adameova, A. and Dhalla, N. S. (2014) Role of microangiopathy in diabetic cardiomyopathy. Heart Failure Reviews 19(1): 25-33.
Adapala, R. K., Thoppil, R. J., Luther, D. J., Paruchuri, S., Meszaros, J. G., Chilian, W. M. and Thodeti, C. K. (2013) TRPV4 channels mediate cardiac fibroblast differentiation by integrating mechanical and soluble signals. J Mol Cell Cardiol 54: 45-52.
Ahima, R. S., Scolaro, L. M. and Park, H.-K. (2014) Adipokines and Metabolism. Metabolic Syndrome: A Comprehensive Textbook. S. R. Ahima. Cham, Springer International Publishing: 1- 35.
Akaishi, T., Nakazawa, K., Sato, K., Saito, H., Ohno, Y. and Ito, Y. (2004) Modulation of Voltage-Gated Ca2+ Current by 4-Hydroxynonenal in Dentate Granule Cells. Biological and Pharmaceutical Bulletin 27(2): 174-179.
Akerman, S., Kaube, H. and Goadsby, P. J. (2004) Anandamide acts as a vasodilator of dural blood vessels in vivo by activating TRPV1 receptors. British Journal of Pharmacology 142(8): 1354-1360.
Alioua, A., Lu, R., Kumar, Y., Eghbali, M., Kundu, P., Toro, L. and Stefani, E. (2008) Slo1 Caveolin-binding Motif, a Mechanism of Caveolin-1-Slo1 Interaction Regulating Slo1 Surface Expression. Journal of Biological Chemistry 283(8): 4808-4817.
Aracena-Parks, P., Goonasekera, S. A., Gilman, C. P., Dirksen, R. T., Hidalgo, C. and Hamilton, S. L. (2006) Identification of Cysteines Involved in S-Nitrosylation, S-Glutathionylation, and Oxidation to Disulfides in Ryanodine Receptor Type 1. Journal of Biological Chemistry 281(52): 40354-40368.
Ardanaz, N. and Pagano, P. J. (2006) Hydrogen Peroxide as a Paracrine Vascular Mediator: Regulation and Signaling Leading to Dysfunction. Experimental Biology and Medicine 231(3): 237- 251.
113 Arnold Wp Fau - Mittal, C. K., Mittal Ck Fau - Katsuki, S., Katsuki S Fau - Murad, F. and Murad, F. (1977) Nitric oxide activates guanylate cyclase and increases guanosine 3':5'-cyclic monophosphate levels in various tissue preparations. (0027-8424 (Print)).
Ayala, A., Muñoz, M. F. and Argüelles, S. (2014) Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxidative Medicine and Cellular Longevity 2014: 360438.
Bairey Merz, C. N., Kelsey, S. F., Pepine, C. J., Reichek, N., Reis, S. E., Rogers, W. J., Sharaf, B. L. and Sopko, G. (1999) The Women’s Ischemia Syndrome Evaluation (WISE) Study: protocol design, methodology and feasibility report. Journal of the American College of Cardiology 33(6): 1453-1461.
Barlow, R. S., El-Mowafy, A. M. and White, R. E. (2000) H2O2 opens BKCa channels via the PLA2-arachidonic acid signaling cascade in coronary artery smooth muscle. American Journal of Physiology - Heart and Circulatory Physiology 279(2): H475-H483.
Barlow, R. S. and White, R. E. (1998) Hydrogen peroxide relaxes porcine coronary arteries by stimulating BKCachannel activity. American Journal of Physiology - Heart and Circulatory Physiology 275(4): H1283-H1289.
Baylie, R. L. and Brayden, J. E. (2011) TRPV channels and vascular function. Acta Physiologica 203(1): 99-116.
Benedetti, A., Comporti, M. and Esterbauer, H. (1980) Identification of 4-hydroxynonenal as a cytotoxic product originating from the peroxidation of liver microsomal lipids. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism 620(2): 281-296.
Bennaars-Eiden, A., Higgins, L., Hertzel, A. V., Kapphahn, R. J., Ferrington, D. A. and Bernlohr, D. A. (2002) Covalent Modification of Epithelial Fatty Acid-binding Protein by 4- Hydroxynonenal in Vitro and in Vivo : EVIDENCE FOR A ROLE IN ANTIOXIDANT BIOLOGY. Journal of Biological Chemistry 277(52): 50693-50702.
Bernatchez, P. N., Bauer, P. M., Yu, J., Prendergast, J. S., He, P. and Sessa, W. C. (2005) Dissecting the molecular control of endothelial NO synthase by caveolin-1 using cell-permeable peptides. Proceedings of the National Academy of Sciences of the United States of America 102(3): 761-766.
Bevan, S., Quallo, T. and Andersson, D. A. (2014) Trpv1. Mammalian Transient Receptor Potential (TRP) Cation Channels, Springer: 207-245. 114
Beyer, A. M. and Gutterman, D. D. (2012) Regulation of the human coronary microcirculation. Journal of Molecular and Cellular Cardiology 52(4): 814-821.
Bjelakovic, G., Nikolova, D. and Gluud, C. (2013) Antioxidant supplements to prevent mortality. JAMA 310(11): 1178-1179.
Bohlen, H. G. (2011) Nitric Oxide and the Cardiovascular System. Comprehensive Physiology, John Wiley & Sons, Inc.
Bolotina, V. M., Najibi, S., Palacino, J. J., Pagano, P. J. and Cohen, R. A. (1994) Nitric oxide directly activates calcium-dependent potassium channels in vascular smooth muscle. Nature 368(6474): 850-853.
Borbouse, L., Dick, G. M., Asano, S., Bender, S. B., Dincer, U. D., Payne, G. A., Neeb, Z. P., Bratz, I. N., Sturek, M. and Tune, J. D. (2009) Impaired function of coronary BK(Ca) channels in metabolic syndrome. Am.J.Physiol Heart Circ.Physiol 297(5): H1629-H1637.
Borbouse, L., Dick, G. M., Payne, G. A., Berwick, Z. C., Neeb, Z. P., Alloosh, M., Bratz, I. N., Sturek, M. and Tune, J. D. (2010) Metabolic syndrome reduces the contribution of K+ channels to ischemic coronary vasodilation. Am.J.Physiol Heart Circ.Physiol 298(4): H1182-H1189.
Boscher, C. and Nabi, I. R. (2012) CAVEOLIN-1: Role in Cell Signaling. Caveolins and Caveolae: Roles in Signaling and Disease Mechanisms. J.-F. Jasmin, P. G. Frank and M. P. Lisanti. New York, NY, Springer US: 29-50.
Botzen, D. and Grune, T. (2007) Degradation of HNE-modified proteins--possible role of ubiquitin. Redox Report: Communications In Free Radical Research 12(1): 63-67.
Bratz, I. N., Dick, G. M., Tune, J. D., Edwards, J. M., Neeb, Z. P., Dincer, U. D. and Sturek, M. (2008) Impaired capsaicin-induced relaxation of coronary arteries in a porcine model of the metabolic syndrome. American Journal of Physiology - Heart and Circulatory Physiology 294(6): H2489-H2496.
Braunwald, E. (1974) Regulation of the circulation. I. N Engl J Med 290(20): 1124-1129.
Bretón-Romero, R. and Lamas, S. (2014) Hydrogen peroxide signaling in vascular endothelial cells. Redox Biology 2: 529-534.
115
Brooks, B. A., Franjic, B., Ban, C. R., Swaraj, K., Yue, D. K., Celermajer, D. S. and Twigg, S. M. (2008) Diastolic dysfunction and abnormalities of the microcirculation in type 2 diabetes. Diabetes, Obesity and Metabolism 10(9): 739-746.
Brownlee, M. (2001) Biochemistry and molecular cell biology of diabetic complications. Nature 414(6865): 813-820.
Bubolz, A. H., Mendoza, S. A., Zheng, X., Zinkevich, N. S., Li, R., Gutterman, D. D. and Zhang, D. X. (2012) Activation of endothelial TRPV4 channels mediates flow-induced dilation in human coronary arterioles: role of Ca2+ entry and mitochondrial ROS signaling. Am J Physiol Heart Circ Physiol 302(3): H634-642.
Cao, D.-S., Zhong, L., Hsieh, T.-h., Abooj, M., Bishnoi, M., Hughes, L. and Premkumar, L. S. (2012) Expression of Transient Receptor Potential Ankyrin 1 (TRPA1) and Its Role in Insulin Release from Rat Pancreatic Beta Cells. PLoS ONE 7(5): e38005.
Cao, E., Liao M Fau - Cheng, Y., Cheng Y Fau - Julius, D. and Julius, D. (2013) TRPV1 structures in distinct conformations reveal activation mechanisms. Nature(1476-4687 (Electronic)).
Carbone, D. L., Doorn, J. A. and Petersen, D. R. (2004) 4-Hydroxynonenal regulates 26S proteasomal degradation of alcohol dehydrogenase. Free Radic Biol Med 37(9): 1430-1439.
Catalá, A. (2009) Lipid peroxidation of membrane phospholipids generates hydroxy- alkenals and oxidized phospholipids active in physiological and/or pathological conditions. Chemistry and Physics of Lipids 157(1): 1-11.
Caterina, M. J., Schumacher, M. A., Tominaga, M., Rosen, T. A., Levine, J. D. and Julius, D. (1997) The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389(6653): 816-824.
Cavanaugh, D. J., Chesler, A. T., Jackson, A. C., Sigal, Y. M., Yamanaka, H., Grant, R., O'Donnell, D., Nicoll, R. A., Shah, N. M., Julius, D. and Basbaum, A. I. (2011) Trpv1 Reporter Mice Reveal Highly Restricted Brain Distribution and Functional Expression in Arteriolar Smooth Muscle Cells. The Journal of Neuroscience 31(13): 5067-5077.
116 Chapple, S. J., Cheng, X. and Mann, G. E. (2013) Effects of 4-hydroxynonenal on vascular endothelial and smooth muscle cell redox signaling and function in health and disease. Redox Biol 1: 319-331.
Chen, A. F., Chen, D. D., Daiber, A., Faraci, F. M., Li, H., Rembold, C. M. and Laher, I. (2012) Free radical biology of the cardiovascular system. Clin Sci (Lond) 123(2): 73-91.
Ching, L.-C., Chen, C.-Y., Su, K.-H., Hou, H.-H., Shyue, S.-K., Kou, Y. R. and Lee, T.-S. (2012) Implication of AMP-activated protein kinase in transient receptor potential vanilloid type 1- mediated activation of endothelial nitric oxide synthase. Molecular Medicine (Cambridge, Mass.) 18: 805-815.
Ching, L.-C., Kou, Y. R., Shyue, S.-K., Su, K.-H., Wei, J., Cheng, L.-C., Yu, Y.-B., Pan, C.-C. and Lee, T.-S. (2011) Molecular mechanisms of activation of endothelial nitric oxide synthase mediated by transient receptor potential vanilloid type 1. Cardiovascular Research 91(3): 492- 501.
Ching, L. C., Zhao, J. F., Su, K. H., Shyue, S. K., Hsu, C. P., Lu, T. M., Lin, S. J. and Lee, T. S. (2013) Activation of transient receptor potential vanilloid 1 decreases endothelial nitric oxide synthase phosphorylation at Thr497 by protein phosphatase 2B-dependent dephosphorylation of protein kinase C. Acta Physiologica 209(2): 124-135.
Choi, S.-I., Yoo, S., Lim, J. Y. and Hwang, S. W. (2014) Are Sensory TRP Channels Biological Alarms for Lipid Peroxidation? International Journal of Molecular Sciences 15(9): 16430-16457.
Chuang, H. H. and Lin, S. (2009) Oxidative challenges sensitize the capsaicin receptor by covalent cysteine modification. Proc.Natl.Acad.Sci.U.S.A 106(47): 20097-20102.
Chung, H. S., Wang, S.-B., Venkatraman, V., Murray, C. I. and Van Eyk, J. E. (2013) Cysteine Oxidative Posttranslational Modifications: Emerging Regulation in the Cardiovascular System. Circulation Research 112(2): 382-392.
Cioffi, D. L. (2011) Redox regulation of endothelial canonical transient receptor potential channels. Antioxid Redox Signal 15(6): 1567-1582.
Clapham, D. E., Runnels, L. W. and Strubing, C. (2001) The trp ion channel family. Nat Rev Neurosci 2(6): 387-396.
117 Cohen, G., Riahi, Y., Sunda, V., Deplano, S., Chatgilialoglu, C., Ferreri, C., Kaiser, N. and Sasson, S. (2013) Signaling properties of 4-hydroxyalkenals formed by lipid peroxidation in diabetes. Free Radical Biology and Medicine 65: 978-987.
Couet, J., Li, S., Okamoto, T., Ikezu, T. and Lisanti, M. P. (1997) Identification of Peptide and Protein Ligands for the Caveolin-scaffolding Domain: IMPLICATIONS FOR THE INTERACTION OF CAVEOLIN WITH CAVEOLAE-ASSOCIATED PROTEINS. Journal of Biological Chemistry 272(10): 6525-6533.
Cutler, M. J., Plummer, B. N., Wan, X., Sun, Q.-A., Hess, D., Liu, H., Deschenes, I., Rosenbaum, D. S., Stamler, J. S. and Laurita, K. R. (2012) Aberrant S-nitrosylation mediates calcium-triggered ventricular arrhythmia in the intact heart. Proceedings of the National Academy of Sciences 109(44): 18186-18191.
Czikora, A., Lizanecz, E., Bako, P., Rutkai, I., Ruzsnavszky, F., Magyar, J., Porszasz, R., Kark, T., Facsko, A., Papp, Z., Edes, I. and Toth, A. (2012) Structure-activity relationships of vanilloid receptor agonists for arteriolar TRPV1. Br.J.Pharmacol. 165(6): 1801-1812.
DelloStritto, D. J., Connell, P. J., Dick, G. M., Fancher, I. S., Klarich, B., Fahmy, J. N., Kang, P. T., Chen, Y.-R., Damron, D. S., Thodeti, C. K. and Bratz, I. N. (2016) Differential regulation of TRPV1 channels by H2O2: implications for diabetic microvascular dysfunction. Basic Research in Cardiology 111(2): 1-16.
Dolinsky, V. W., Chan, A. Y., Robillard Frayne, I., Light, P. E., Des Rosiers, C. and Dyck, J. R. (2009) Resveratrol prevents the prohypertrophic effects of oxidative stress on LKB1. Circulation 119(12): 1643-1652.
Dominguez-Rodriguez, A., Abreu-Gonzalez, P., de la Rosa, A., Vargas, M., Ferrer, J. and Garcia, M. n. (2005) Role of endogenous interleukin-10 production and lipid peroxidation in patients with acute myocardial infarction treated with primary percutaneous transluminal coronary angioplasty interleukin-10 and primary angioplasty. International journal of cardiology 99(1): 77-81.
Duckles, S. P. (1986) Effects of capsaicin on vascular smooth muscle. Naunyn Schmiedebergs Arch Pharmacol 333(1): 59-64.
Duncker, D. J. and Bache, R. J. (2008) Regulation of coronary blood flow during exercise. Physiol Rev 88(3): 1009-1086.
118 Duncker, D. J., Koller, A., Merkus, D. and Canty, J. M., Jr. (2015) Regulation of coronary blood flow in health and ischemic heart disease. Prog Cardiovasc Dis 57(5): 409-422.
Earley, S. (2010) Vanilloid and Melastatin Transient Receptor Potential Channels in Vascular Smooth Muscle. Microcirculation 17(4): 237-249.
Earley, S. and Brayden, J. E. (2015) Transient Receptor Potential Channels in the Vasculature. Physiological Reviews 95(2): 645-690.
Edwards, G., eacute, eacute, tou, M. and Weston, A. H. (2010) Endothelium-derived hyperpolarising factors and associated pathways: a synopsis. Pflügers Archiv - European Journal of Physiology 459(6): 863-879.
Ellinsworth, D. C., Sandow, S. L., Shukla, N., Liu, Y., Jeremy, J. Y. and Gutterman, D. D. (2016) Endothelium-Derived Hyperpolarization and Coronary Vasodilation: Diverse and Integrated Roles of Epoxyeicosatrienoic Acids, Hydrogen Peroxide, and Gap Junctions. Microcirculation 23(1): 15-32.
Esterbauer, H., Schaur Rj Fau - Zollner, H. and Zollner, H. (1991) Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. (0891-5849 (Print)).
Everaerts, W., Sepulveda, M. R., Gevaert, T., Roskams, T., Nilius, B. and De Ridder, D. (2009) Where is TRPV1 expressed in the bladder, do we see the real channel? Naunyn Schmiedebergs Arch Pharmacol 379(4): 421-425.
Feigl, E. O. (1983) Coronary physiology. Physiological Reviews 63(1): 1-205.
Félétou, M. (2011a) The Endothelium, Part I: Multiple Functions of the Endothelial Cells - - Focus on Endothelium-Derived Vasoactive Mediators. Colloquium Series on Integrated Systems Physiology: From Molecule to Function, Morgan & Claypool Life Sciences. 3: 1-306.
Félétou, M. (2011b) The Endothelium, Part II: EDHF-Mediated Responses "The Classical Pathway". Colloquium Series on Integrated Systems Physiology: From Molecule to Function, Morgan & Claypool Life Sciences. 3: 1-306.
Feron, O., Belhassen, L., Kobzik, L., Smith, T. W., Kelly, R. A. and Michel, T. (1996) Endothelial Nitric Oxide Synthase Targeting to Caveolae: SPECIFIC INTERACTIONS WITH CAVEOLIN ISOFORMS IN CARDIAC MYOCYTES AND ENDOTHELIAL CELLS. Journal of Biological Chemistry 271(37): 22810-22814.
119
Forbes, J. M. and Cooper, M. E. (2013) Mechanisms of Diabetic Complications. Physiological Reviews 93(1): 137-188.
Furst, B. (2014) Regulation of Cardiac Output. The Heart and Circulation, Springer: 111- 131.
Gazzieri, D., Trevisani, M., Tarantini, F., Bechi, P., Masotti, G., Gensini, G. F., Castellani, S., Marchionni, N., Geppetti, P. and Harrison, S. (2006) Ethanol dilates coronary arteries and increases coronary flow via transient receptor potential vanilloid 1 and calcitonin gene-related peptide. Cardiovasc.Res. 70(3): 589-599.
Goedicke-Fritz, S., Kaistha, A., Kacik, M., Markert, S., Hofmeister, A., Busch, C., Banfer, S., Jacob, R., Grgic, I. and Hoyer, J. (2015) Evidence for functional and dynamic microcompartmentation of Cav-1/TRPV4/K(Ca) in caveolae of endothelial cells. Eur J Cell Biol 94(7-9): 391-400.
Golech, S. A., McCarron, R. M., Chen, Y., Bembry, J., Lenz, F., Mechoulam, R., Shohami, E. and Spatz, M. (2004) Human brain endothelium: coexpression and function of vanilloid and endocannabinoid receptors. Brain Res Mol Brain Res 132(1): 87-92.
Gonzalez, D. R., Treuer, A. V., Castellanos, J., Dulce, R. A. and Hare, J. M. (2010) Impaired S-Nitrosylation of the Ryanodine Receptor Caused by Xanthine Oxidase Activity Contributes to Calcium Leak in Heart Failure. Journal of Biological Chemistry 285(37): 28938-28945.
Granger, H. J. (1998) Cardiovascular physiology in the twentieth century: great strides and missed opportunities. American Journal of Physiology - Heart and Circulatory Physiology 275(6): H1925-H1936.
Gratton, J.-P., Fontana, J., O'Connor, D. S., Garcı́a-Cardeña, G., McCabe, T. J. and Sessa, W. C. (2000) Reconstitution of an Endothelial Nitric-oxide Synthase (eNOS), hsp90, and Caveolin- 1 Complex in Vitro : EVIDENCE THAT hsp90 FACILITATES CALMODULIN STIMULATED DISPLACEMENT OF eNOS FROM CAVEOLIN-1. Journal of Biological Chemistry 275(29): 22268- 22272.
Grundy, S. M. (2007) Cardiovascular and Metabolic Risk Factors: How Can We Improve Outcomes in the High-Risk Patient? The American Journal of Medicine 120(9, Supplement 1): S3- S8.
120 Grune, T. and Davies, K. J. A. (2003) The proteasomal system and HNE-modified proteins. Molecular Aspects of Medicine 24(4–5): 195-204.
Guarini, G., Ohanyan, V. A., Kmetz, J. G., DelloStritto, D. J., Thoppil, R. J., Thodeti, C. K., Meszaros, J. G., Damron, D. S. and Bratz, I. N. (2012) Disruption of TRPV1-mediated coupling of coronary blood flow to cardiac metabolism in diabetic mice: role of nitric oxide and BK channels. American Journal of Physiology - Heart and Circulatory Physiology 303(2): H216-H223.
Gulati, M., Cooper-DeHoff, R. M., McClure, C. and et al. (2009) Adverse cardiovascular outcomes in women with nonobstructive coronary artery disease: A report from the women's ischemia syndrome evaluation study and the st james women take heart project. Archives of Internal Medicine 169(9): 843-850.
Gupta, S., Lozano-Cuenca, J., Villalon, C. M., de, V. R., Garrelds, I. M., Avezaat, C. J., van Kats, J. P., Saxena, P. R. and MaassenVanDenBrink, A. (2007) Pharmacological characterisation of capsaicin-induced relaxations in human and porcine isolated arteries. Naunyn Schmiedebergs Arch.Pharmacol. 375(1): 29-38.
Gutterman, D. D., Chabowski, D. S., Kadlec, A. O., Durand, M. J., Freed, J. K., Ait-Aissa, K. and Beyer, A. M. (2016) The Human Microcirculation: Regulation of Flow and Beyond. Circulation Research 118(1): 157-172.
Guyton AC, Coleman TG, a. and HJ, G. (1972) Circulation: Overall Regulation. Annual Review of Physiology 34(1): 13-44.
Haffner , S. M., Lehto , S., Rönnemaa , T., Pyörälä , K. and Laakso , M. (1998) Mortality from Coronary Heart Disease in Subjects with Type 2 Diabetes and in Nondiabetic Subjects with and without Prior Myocardial Infarction. New England Journal of Medicine 339(4): 229-234.
Halliwell, B. (2013) The antioxidant paradox: less paradoxical now? Br J Clin Pharmacol 75(3): 637-644.
Hardie, R. C. (2007) TRP channels and lipids: from Drosophila to mammalian physiology. The Journal of Physiology 578(1): 9-24.
Hartley, C. J., Reddy, A. K., Madala, S., Michael, L. H., Entman, M. L. and Taffet, G. E. (2007) Effects of Isoflurane on Coronary Blood Flow Velocity in Young, Old and ApoE−/− Mice Measured by Doppler Ultrasound. Ultrasound in Medicine & Biology 33(4): 512-521.
121 Henry, R. M. A., Kostense, P. J., Spijkerman, A. M. W., Dekker, J. M., Nijpels, G., Heine, R. J., Kamp, O., Westerhof, N., Bouter, L. M. and Stehouwer, C. D. A. (2003) Arterial Stiffness Increases With Deteriorating Glucose Tolerance Status: The Hoorn Study. Circulation 107(16): 2089-2095.
Hess, D. T., Matsumoto, A., Kim, S. O., Marshall, H. E. and Stamler, J. S. (2005) Protein S- nitrosylation: purview and parameters. Nat Rev Mol Cell Biol 6(2): 150-166.
Hiett, S. C., Owen, M. K., Li, W., Chen, X., Riley, A., Noblet, J., Flores, S., Sturek, M., Tune, J. D. and Obukhov, A. G. (2014) Mechanisms underlying capsaicin effects in canine coronary artery: implications for coronary spasm. Cardiovascular Research 103(4): 607-618.
Hill-Eubanks, D. C., Gonzales, A. L., Sonkusare, S. K. and Nelson, M. T. (2014) Vascular TRP Channels: Performing Under Pressure and Going with the Flow. Physiology 29(5): 343-360.
Hofmann, F., Feil, R., Kleppisch, T. and Schlossmann, J. (2006) Function of cGMP- Dependent Protein Kinases as Revealed by Gene Deletion. Physiological Reviews 86(1): 1-23.
Hollis, M. and Wang, D. H. (2013) Transient receptor potential vanilloid in blood pressure regulation. Curr.Opin.Nephrol.Hypertens. 22(2): 170-176.
Hool, L. C. (2008) Evidence for the regulation of L-type Ca2+ channels in the heart by reactive oxygen species: mechanism for mediating pathology. Clinical And Experimental Pharmacology & Physiology 35(2): 229-234.
Hu, H., Bandell, M., Grandl, J. and Petrus, M. (2011) High-Throughput Approaches to Studying Mechanisms of TRP Channel Activation.
Huang, W., Rubinstein, J., Prieto, A. R., Thang, L. V. and Wang, D. H. (2009) Transient receptor potential vanilloid gene deletion exacerbates inflammation and atypical cardiac remodeling after myocardial infarction. Hypertension 53(2): 243-250.
Huang, W., Rubinstein, J., Prieto, A. R. and Wang, D. H. (2010) Enhanced postmyocardial infarction fibrosis via stimulation of the transforming growth factor-beta-Smad2 signaling pathway: role of transient receptor potential vanilloid type 1 channels. J.Hypertens. 28(2): 367- 376.
122 Hyun, D.-H. (2010) Effect of the overexpression of mutant ubiquitin (K48R) on the cellular response induced by 4-hydroxy-2,3-trans-nonenal, an end-product of lipid peroxidation. Neuroscience Letters 477(3): 115-120.
Inoue, R., Jensen, L. J., Shi, J., Morita, H., Nishida, M., Honda, A. and Ito, Y. (2006) Transient Receptor Potential Channels in Cardiovascular Function and Disease. Circulation Research 99(2): 119-131.
Isfort, M., Stevens, S. C., Schaffer, S., Jong, C. J. and Wold, L. E. (2013) Metabolic dysfunction in diabetic cardiomyopathy. Heart Fail Rev.
Islam, M. S. (2011) Transient receptor potential channels. Springer Science & Business Media.
Jaganjac, M., Tirosh, O., Cohen, G., Sasson, S. and Zarkovic, N. (2013) Reactive aldehydes – second messengers of free radicals in diabetes mellitus. Free Radical Research 47(sup1): 39-48.
James, J. and Robbins, J. (2013) Ablating a Cardiac Protein: Causality at Last. Circulation Research 112(11): 1415-1419.
Jay, D., Hitomi, H. and Griendling, K. K. (2006) Oxidative stress and diabetic cardiovascular complications. Free Radic.Biol.Med. 40(2): 183-192.
Kaneto, H., Katakami, N., Matsuhisa, M. and Matsuoka, T. A. (2010) Role of reactive oxygen species in the progression of type 2 diabetes and atherosclerosis. Mediators.Inflamm. 2010: 453892.
Keeble, J. E., Bodkin, J. V., Liang, L., Wodarski, R., Davies, M., Fernandes, E. S., Coelho, C. F., Russell, F., Graepel, R., Muscara, M. N., Malcangio, M. and Brain, S. D. (2009) Hydrogen peroxide is a novel mediator of inflammatory hyperalgesia, acting via transient receptor potential vanilloid 1-dependent and independent mechanisms. Pain 141(1-2): 135-142.
Khalil, R. A. (2010) Regulation of Vascular Smooth Muscle Function. Colloquium Series on Integrated Systems Physiology: From Molecule to Function, Morgan & Claypool Life Sciences. 2: 1-62.
Kishimoto, E., Naito, Y., Handa, O., Okada, H., Mizushima, K., Hirai, Y., Nakabe, N., Uchiyama, K., Ishikawa, T., Takagi, T., Yagi, N., Kokura, S., Yoshida, N. and Yoshikawa, T. (2011) Oxidative stress-induced posttranslational modification of TRPV1 expressed in esophageal
123 epithelial cells. American Journal of Physiology - Gastrointestinal and Liver Physiology 301(2): G230-G238.
Ko, E. A., Han, J., Jung, I. D. and Park, W. S. (2008) Physiological roles of K+ channels in vascular smooth muscle cells. J Smooth Muscle Res 44(2): 65-81.
Kraehling, J. R., Hao, Z., Lee, M. Y., Vinyard, D. J., Velazquez, H., Liu, X., Stan, R. V., Brudvig, G. W. and Sessa, W. C. (2016) Uncoupling Caveolae From Intracellular Signaling In Vivo. Circulation Research 118(1): 48-55.
Krieger, E., Koraimann, G. and Vriend, G. (2002) Increasing the precision of comparative models with YASARA NOVA—a self-parameterizing force field. Proteins: Structure, Function, and Bioinformatics 47(3): 393-402.
Kurian, M. M., Berwick, Z. C. and Tune, J. D. (2011) Contribution of IKCa channels to the control of coronary blood flow. Exp.Biol.Med.(Maywood.) 236(5): 621-627.
Lakka, H. M., Lakka, T. A., Tuomilehto, J. and Salonen, J. T. (2002) Abdominal obesity is associated with increased risk of acute coronary events in men. Eur Heart J 23(9): 706-713.
Ledoux, J., Werner, M. E., Brayden, J. E. and Nelson, M. T. (2006) Calcium-Activated Potassium Channels and the Regulation of Vascular Tone. Physiology 21(1): 69-78.
Li, H., Gutterman, D. D., Rusch, N. J., Bubolz, A. and Liu, Y. (2004) Nitration and Functional Loss of Voltage-Gated K+ Channels in Rat Coronary Microvessels Exposed to High Glucose. Diabetes 53(9): 2436-2442.
Liao, M., Cao E Fau - Julius, D., Julius D Fau - Cheng, Y. and Cheng, Y. (2013) Structure of the TRPV1 ion channel determined by electron cryo-microscopy. Nature(1476-4687 (Electronic)).
Lima, B., Forrester, M. T., Hess, D. T. and Stamler, J. S. (2010) S-Nitrosylation in Cardiovascular Signaling. Circulation Research 106(4): 633-646.
Lishko, P. V., Procko, E., Jin, X., Phelps, C. B. and Gaudet, R. (2007) The Ankyrin Repeats of TRPV1 Bind Multiple Ligands and Modulate Channel Sensitivity. Neuron 54(6): 905-918.
124 Liu, Y., Bubolz, A. H., Mendoza, S., Zhang, D. X. and Gutterman, D. D. (2011) H2O2 Is the Transferrable Factor Mediating Flow-Induced Dilation in Human Coronary Arterioles. Circulation Research 108(5): 566-573.
Lu, C., Chan, S. L., Fu, W. and Mattson, M. P. (2002) The Lipid Peroxidation Product 4- Hydroxynonenal Facilitates Opening of Voltage-dependent Ca2+ Channels in Neurons by Increasing Protein Tyrosine Phosphorylation. Journal of Biological Chemistry 277(27): 24368- 24375.
Luo, D., Zhang, Y.-W., Peng, W.-J., Peng, J., Chen, Q.-Q., Li, D., Deng, H.-W. and Li, Y.-J. (2008) Transient receptor potential vanilloid 1-mediated expression and secretion of endothelial cell-derived calcitonin gene-related peptide. Regulatory Peptides 150(1–3): 66-72.
Luo, W., Grupp, I. L., Harrer, J., Ponniah, S., Grupp, G., Duffy, J. J., Doetschman, T. and Kranias, E. G. (1994) Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of beta-agonist stimulation. Circulation Research 75(3): 401-409.
Lynch, F. M., Austin, C., Heagerty, A. M. and Izzard, A. S. (2006) Adenosine and hypoxic dilation of rat coronary small arteries: roles of the ATP-sensitive potassium channel, endothelium, and nitric oxide. American Journal of Physiology - Heart and Circulatory Physiology 290(3): H1145- H1150.
Mali, V. R. and Palaniyandi, S. S. (2014) Regulation and therapeutic strategies of 4- hydroxy-2-nonenal metabolism in heart disease. Free Radical Research 48(3): 251-263.
Mandadi, S., Tominaga, T., Numazaki, M., Murayama, N., Saito, N., Armati, P. J., Roufogalis, B. D. and Tominaga, M. (2006) Increased sensitivity of desensitized TRPV1 by PMA occurs through PKCε-mediated phosphorylation at S800. Pain 123(1–2): 106-116.
Martínez-Ruiz, A., Araújo, I. M., Izquierdo-Álvarez, A., Hernansanz-Agustín, P., Lamas, S. and Serrador, J. M. (2013) Specificity in S-Nitrosylation: A Short-Range Mechanism for NO Signaling? Antioxidants & Redox Signaling 19(11): 1220-1235.
Miano, J. M., Zhu, Q. M. and Lowenstein, C. J. (2016) A CRISPR Path to Engineering New Genetic Mouse Models for Cardiovascular Research. Arteriosclerosis, Thrombosis, and Vascular Biology 36(6): 1058-1075.
Miller, B. A. and Zhang, W. (2011) TRP channels as mediators of oxidative stress. Adv Exp Med Biol 704: 531-544. 125
Miura, H., Liu, Y. and Gutterman, D. D. (1999) Human Coronary Arteriolar Dilation to Bradykinin Depends on Membrane Hyperpolarization: Contribution of Nitric Oxide and Ca2+- Activated K+ Channels. Circulation 99(24): 3132-3138.
Miyamoto, T., Dubin, A. E., Petrus, M. J. and Patapoutian, A. (2009) TRPV1 and TRPA1 Mediate Peripheral Nitric Oxide-Induced Nociception in Mice. PLoS ONE 4(10): e7596.
Moiseenkova-Bell, V. Y., Stanciu, L. A., Serysheva, I. I., Tobe, B. J. and Wensel, T. G. (2008) Structure of TRPV1 channel revealed by electron cryomicroscopy. Proceedings of the National Academy of Sciences 105(21): 7451-7455.
Montell, C. and Rubin, G. M. (1989) Molecular characterization of the drosophila trp locus: A putative integral membrane protein required for phototransduction. Neuron 2(4): 1313-1323.
Moore, C. J., Shao Ch Fau - Nagai, R., Nagai R Fau - Kutty, S., Kutty S Fau - Singh, J., Singh J Fau - Bidasee, K. R. and Bidasee, K. R. (2013) Malondialdehyde and 4-hydroxynonenal adducts are not formed on cardiac ryanodine receptor (RyR2) and sarco(endo)plasmic reticulum Ca2+- ATPase (SERCA2) in diabetes. Molecular and Cellular Biochemistry(1573-4919 (Electronic)).
Mori, A., Takei, T., Sakamoto, K., Nakahara, T. and Ishii, K. (2015) 4-Hydroxy-2-nonenal attenuates beta2-adrenoceptor-mediated vasodilation of rat retinal arterioles. Naunyn Schmiedebergs Arch Pharmacol 388(5): 575-582.
Morris, A. P., Voight, B. F., Teslovich, T. M., Ferreira, T., Segrè, A. V., Steinthorsdottir, V., Strawbridge, R. J., Khan, H., Grallert, H., Mahajan, A., Prokopenko, I., Kang, H. M., Dina, C., Esko, T., Fraser, R. M., Kanoni, S., Kumar, A., Lagou, V., Langenberg, C., Luan, J. a., Lindgren, C. M., Müller-Nurasyid, M., Pechlivanis, S., Rayner, N. W., Scott, L. J., Wiltshire, S., Yengo, L., Kinnunen, L., Rossin, E. J., Raychaudhuri, S., Johnson, A. D., Dimas, A. S., Loos, R. J. F., Vedantam, S., Chen, H., Florez, J. C., Fox, C., Liu, C.-T., Rybin, D., Couper, D. J., Kao, W. H. L., Li, M., Cornelis, M. C., Kraft, P., Sun, Q., van Dam, R. M., Stringham, H. M., Chines, P. S., Fischer, K., Fontanillas, P., Holmen, O. L., Hunt, S. E., Jackson, A. U., Kong, A., Lawrence, R., Meyer, J., Perry, J. R. B., Platou, C. G. P., Potter, S., Rehnberg, E., Robertson, N., Sivapalaratnam, S., Stančáková, A., Stirrups, K., Thorleifsson, G., Tikkanen, E., Wood, A. R., Almgren, P., Atalay, M., Benediktsson, R., Bonnycastle, L. L., Burtt, N., Carey, J., Charpentier, G., Crenshaw, A. T., Doney, A. S. F., Dorkhan, M., Edkins, S., Emilsson, V., Eury, E., Forsen, T., Gertow, K., Gigante, B., Grant, G. B., Groves, C. J., Guiducci, C., Herder, C., Hreidarsson, A. B., Hui, J., James, A., Jonsson, A., Rathmann, W., Klopp, N., Kravic, J., Krjutškov, K., Langford, C., Leander, K., Lindholm, E., Lobbens, S., Männistö, S., Mirza, G., Mühleisen, T. W., Musk, B., Parkin, M., Rallidis, L., Saramies, J., Sennblad, B., Shah, S., Sigurðsson, G., Silveira, A., Steinbach, G., Thorand, B., Trakalo, J., Veglia, F., Wennauer, R., Winckler, W., Zabaneh, D., Campbell, H., van Duijn, C., Uitterlinden, A. G., Hofman, A., Sijbrands, E., Abecasis, G.
126 R., Owen, K. R., Zeggini, E., Trip, M. D., Forouhi, N. G., Syvänen, A.-C., Eriksson, J. G., Peltonen, L., Nöthen, M. M., Balkau, B., Palmer, C. N. A., Lyssenko, V., Tuomi, T., Isomaa, B., Hunter, D. J., Qi, L., Wellcome Trust Case Control, C., Investigators, M., Consortium, G., Consortium, A.-T. D., Consortium, S. D., Shuldiner, A. R., Roden, M., Barroso, I., Wilsgaard, T., Beilby, J., Hovingh, K., Price, J. F., Wilson, J. F., Rauramaa, R., Lakka, T. A., Lind, L., Dedoussis, G., Njølstad, I., Pedersen, N. L., Khaw, K.-T., Wareham, N. J., Keinanen-Kiukaanniemi, S. M., Saaristo, T. E., Korpi-Hyövälti, E., Saltevo, J., Laakso, M., Kuusisto, J., Metspalu, A., Collins, F. S., Mohlke, K. L., Bergman, R. N., Tuomilehto, J., Boehm, B. O., Gieger, C., Hveem, K., Cauchi, S., Froguel, P., Baldassarre, D., Tremoli, E., Humphries, S. E., Saleheen, D., Danesh, J., Ingelsson, E., Ripatti, S., Salomaa, V., Erbel, R., Jöckel, K.-H., Moebus, S., Peters, A., Illig, T., de Faire, U., Hamsten, A., Morris, A. D., Donnelly, P. J., Frayling, T. M., Hattersley, A. T., Boerwinkle, E., Melander, O., Kathiresan, S., Nilsson, P. M., Deloukas, P., Thorsteinsdottir, U., Groop, L. C., Stefansson, K., Hu, F., Pankow, J. S., Dupuis, J., Meigs, J. B., Altshuler, D., Boehnke, M. and McCarthy, M. I. (2012) Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes. Nature genetics 44(9): 981-990.
Mozaffarian, D., Benjamin, E. J., Go, A. S., Arnett, D. K., Blaha, M. J., Cushman, M., de Ferranti, S., Després, J.-P., Fullerton, H. J., Howard, V. J., Huffman, M. D., Judd, S. E., Kissela, B. M., Lackland, D. T., Lichtman, J. H., Lisabeth, L. D., Liu, S., Mackey, R. H., Matchar, D. B., McGuire, D. K., Mohler, E. R., Moy, C. S., Muntner, P., Mussolino, M. E., Nasir, K., Neumar, R. W., Nichol, G., Palaniappan, L., Pandey, D. K., Reeves, M. J., Rodriguez, C. J., Sorlie, P. D., Stein, J., Towfighi, A., Turan, T. N., Virani, S. S., Willey, J. Z., Woo, D., Yeh, R. W. and Turner, M. B. (2015) Heart Disease and Stroke Statistics—2015 Update: A Report From the American Heart Association. Circulation 131(4): e29-e322.
Murphy, M. E. and Brayden, J. E. (1995) Nitric oxide hyperpolarizes rabbit mesenteric arteries via ATP-sensitive potassium channels. J Physiol 486 ( Pt 1): 47-58.
Murthy, V. L., Naya, M., Foster, C. R., Gaber, M., Hainer, J., Klein, J., Dorbala, S., Blankstein, R. and Di Carli, M. F. (2012) Association Between Coronary Vascular Dysfunction and Cardiac Mortality in Patients With and Without Diabetes Mellitus. Circulation 126(15): 1858-1868.
Nadkarni, D. V. and Sayre, L. M. (1995) Structural definition of early lysine and histidine adduction chemistry of 4-hydroxynonenal. (0893-228X (Print)).
Nakamura, K., Kusano, K., Nakamura, Y., Kakishita, M., Ohta, K., Nagase, S., Yamamoto, M., Miyaji, K., Saito, H., Morita, H., Emori, T., Matsubara, H., Toyokuni, S. and Ohe, T. (2002) Carvedilol Decreases Elevated Oxidative Stress in Human Failing Myocardium. Circulation 105(24): 2867-2871.
Nakayama, M., Inoguchi, T., Sonta, T., Maeda, Y., Sasaki, S., Sawada, F., Tsubouchi, H., Sonoda, N., Kobayashi, K., Sumimoto, H. and Nawata, H. (2005) Increased expression of NAD(P)H
127 oxidase in islets of animal models of Type 2 diabetes and its improvement by an AT1 receptor antagonist. Biochemical and Biophysical Research Communications 332(4): 927-933.
Nelson, M. T. and Quayle, J. M. (1995) Physiological roles and properties of potassium channels in arterial smooth muscle. American Journal of Physiology - Cell Physiology 268(4): C799- C822.
Nicoletti, P., Trevisani, M., Manconi, M., Gatti, R., De, S. G., Zagli, G., Benemei, S., Capone, J. A., Geppetti, P. and Pini, L. A. (2008) Ethanol causes neurogenic vasodilation by TRPV1 activation and CGRP release in the trigeminovascular system of the guinea pig. Cephalalgia 28(1): 9-17.
Nilius, B. and Droogmans, G. (2001) Ion Channels and Their Functional Role in Vascular Endothelium. Physiological Reviews 81(4): 1415-1459.
Nilius, B. and Flockerzi, V. (2014) Mammalian Transient Receptor Potential (TRP) Cation Channels. Springer.
Ogawa, N., Kurokawa, T., Fujiwara, K., Polat, O. K., Badr, H., Takahashi, N. and Mori, Y. (2016) Functional and Structural Divergence in Human TRPV1 Channel Subunits by Oxidative Cysteine Modification. Journal of Biological Chemistry 291(8): 4197-4210.
Ohanyan, V., Yin, L., Bardakjian, R., Kolz, C., Enrick, M., Hakobyan, T., Kmetz, J., Bratz, I., Luli, J., Nagane, M., Khan, N., Hou, H., Kuppusamy, P., Graham, J., Fu, F. K., Janota, D., Oyewumi, M. O., Logan, S., Lindner, J. R. and Chilian, W. M. (2015) Requisite Role of Kv1.5 Channels in Coronary Metabolic Dilation. Circulation Research 117(7): 612-621.
Ohanyan, V. A., Guarini, G., Thodeti, C. K., Talasila, P. K., Raman, P., Haney, R. M., Meszaros, J. G., Damron, D. S. and Bratz, I. N. (2011) Endothelin-mediated in vivo pressor responses following TRPV1 activation. Am.J.Physiol Heart Circ.Physiol 301(3): H1135-H1142.
Olszewska, A., Bednarczyk, P., Siemen, D. and Szewczyk, A. (2014) Modulation of the mitochondrial large-conductance calcium-regulated potassium channel by polyunsaturated fatty acids. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1837(10): 1602-1610.
Organization, W. H. (2016) Global Report on Diabetes.
Pacher, P., Beckman, J. S. and Liaudet, L. (2007) Nitric Oxide and Peroxynitrite in Health and Disease. Physiological Reviews 87(1): 315-424.
128 Pak, W. L., Grossfield, J. and Arnold, K. S. (1970) Mutants of the visual pathway of Drosophila melanogaster. Nature 227(5257): 518-520.
PALADE, G. E. (1961) Blood Capillaries of the Heart and Other Organs. Circulation 24(2): 368-384.
Panneerselvam, M., Patel, H. H. and Roth, D. M. (2012) Caveolins and Heart Diseases. Caveolins and Caveolae: Roles in Signaling and Disease Mechanisms. J.-F. Jasmin, P. G. Frank and M. P. Lisanti. New York, NY, Springer US: 145-156.
Perez-Verdaguer, M., Capera, J., Martinez-Marmol, R., Camps, M., Comes, N., Tamkun, M. M. and Felipe, A. (2016) Caveolin interaction governs Kv1.3 lipid raft targeting. Sci Rep 6: 22453.
Picchi, A., Capobianco S Fau - Qiu, T., Qiu T Fau - Focardi, M., Focardi M Fau - Zou, X., Zou X Fau - Cao, J.-M., Cao Jm Fau - Zhang, C. and Zhang, C. (2010) Coronary microvascular dysfunction in diabetes mellitus: A review. (1949-8462 (Electronic)).
Pillon, N. J., Croze, M. L., Vella, R. E., Soulère, L., Lagarde, M. and Soulage, C. O. (2012) The Lipid Peroxidation By-Product 4-Hydroxy-2-Nonenal (4-HNE) Induces Insulin Resistance in Skeletal Muscle through Both Carbonyl and Oxidative Stress. Endocrinology 153(5): 2099-2111.
Pillon, N. J. and Soulage, C. O. (2012) Lipid Peroxidation by-Products and the Metabolic Syndrome.
Poli, G., Schaur, R. J., Siems, W. G. and Leonarduzzi, G. (2008) 4-Hydroxynonenal: A membrane lipid oxidation product of medicinal interest. Medicinal Research Reviews 28(4): 569- 631.
Pollock, J. S., Förstermann, U., Mitchell, J. A., Warner, T. D., Schmidt, H. H., Nakane, M. and Murad, F. (1991) Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured and native bovine aortic endothelial cells. Proceedings of the National Academy of Sciences 88(23): 10480-10484.
Pope, A. J., Druhan, L., Guzman, J. E., Forbes, S. P., Murugesan, V., Lu, D., Xia, Y., Chicoine, L. G., Parinandi, N. L. and Cardounel, A. J. (2007) Role of DDAH-1 in lipid peroxidation product- mediated inhibition of endothelial NO generation. American Journal of Physiology - Cell Physiology 293(5): C1679-C1686.
129 Pryor, W. A. and Porter, N. A. (1990) Suggested mechanisms for the production of 4- hydroxy-2-nonenal from the autoxidation of polyunsaturated fatty acids. (0891-5849 (Print)).
Ramirez-Barrantes, R., Cordova, C., Poblete, H., Munoz, P., Marchant, I., Wianny, F. and Olivero, P. (2016) Perspectives of TRPV1 Function on the Neurogenesis and Neural Plasticity. Neural Plasticity 2016: 12.
Re, G., Lanzarini C Fau - Vaona, I., Vaona I Fau - Pazzaglia, M., Pazzaglia M Fau - Palareti, G., Palareti G Fau - Bassein, L., Bassein L Fau - Guarnieri, C. and Guarnieri, C. (1998) Systemically circulating oxidative species in human deep venous thrombosis. (0969-9546 (Print)).
Rogers, P. A., Chilian, W. M., Bratz, I. N., Bryan, R. M., Jr. and Dick, G. M. (2007) H2O2 activates redox- and 4-aminopyridine-sensitive Kv channels in coronary vascular smooth muscle. Am.J.Physiol Heart Circ.Physiol 292(3): H1404-H1411.
Rogers, P. A., Dick, G. M., Knudson, J. D., Focardi, M., Bratz, I. N., Swafford, A. N., Jr., Saitoh, S., Tune, J. D. and Chilian, W. M. (2006) H2O2-induced redox-sensitive coronary vasodilation is mediated by 4-aminopyridine-sensitive K+ channels. Am.J.Physiol Heart Circ.Physiol 291(5): H2473-H2482.
Rohacs, T. (2015) Phosphoinositide regulation of TRPV1 revisited. Pflügers Archiv - European Journal of Physiology 467(9): 1851-1869.
Rosenbaum, T., Gordon-Shaag, A., Munari, M. and Gordon, S. E. (2004) Ca2+/calmodulin modulates TRPV1 activation by capsaicin. J Gen Physiol 123(1): 53-62.
ROSS, J., LINHART, J. W. and BRAUNWALD, E. (1965) Effects of Changing Heart Rate in Man by Electrical Stimulation of the Right Atrium: Studies at Rest, during Exercise, and with Isoproterenol. Circulation 32(4): 549-558.
Rubler, S., Dlugash, J., Yuceoglu, Y. Z., Kumral, T., Branwood, A. W. and Grishman, A. (1972) New type of cardiomyopathy associated with diabetic glomerulosclerosis. Am J Cardiol 30(6): 595-602.
Sabe, M. and Heupler, F. (2013) Cardiac Output. Cardiovascular Hemodynamics: An Introductory Guide. S. Anwaruddin, M. J. Martin, C. J. Stephens and T. A. Askari. Totowa, NJ, Humana Press: 65-73.
130 Sahoo, N., Hoshi, T. and Heinemann, S. H. (2014) Oxidative Modulation of Voltage-Gated Potassium Channels. Antioxidants & Redox Signaling 21(6): 933-952.
Sawada, Y., Hosokawa, H., Matsumura, K. and Kobayashi, S. (2008) Activation of transient receptor potential ankyrin 1 by hydrogen peroxide. Eur.J.Neurosci. 27(5): 1131-1142.
Schilling, J. D. and Mann, D. L. (2012) Diabetic Cardiomyopathy: Bench to Bedside. Heart Failure Clinics 8(4): 619-631.
Schulz, E., Jansen, T., Wenzel, P., Daiber, A. and Münzel, T. (2008) Nitric Oxide, Tetrahydrobiopterin, Oxidative Stress, and Endothelial Dysfunction in Hypertension. Antioxidants & Redox Signaling 10(6): 1115-1126.
Shao, C. H., Tian, C., Ouyang, S., Moore, C. J., Alomar, F., Nemet, I., D'Souza, A., Nagai, R., Kutty, S., Rozanski, G. J., Ramanadham, S., Singh, J. and Bidasee, K. R. (2012) Carbonylation Induces Heterogeneity in Cardiac Ryanodine Receptor Function in Diabetes Mellitus. Molecular Pharmacology 82(3): 383-399.
Shimokawa, H. (2010) Hydrogen peroxide as an endothelium-derived hyperpolarizing factor. Pflügers Archiv - European Journal of Physiology 459(6): 915-922.
Sinha, S., Sinharoy, P., Bratz, I. N. and Damron, D. S. (2015) Propofol Causes Vasodilation
Sinharoy, P., Zhang, H., Sinha, S., Prudner, B. C., Bratz, I. N. and Damron, D. S. (2015) Propofol restores TRPV1 sensitivity via a TRPA1-, nitric oxide synthase-dependent activation of PKCepsilon. Pharmacol Res Perspect 3(4): e00153.
Spickett, C. M. (2013) The lipid peroxidation product 4-hydroxy-2-nonenal: Advances in chemistry and analysis. Redox Biology 1(1): 145-152.
Spickett, C. M. and Pitt, A. R. (2012) Protein oxidation: role in signalling and detection by mass spectrometry. Amino Acids 42(1): 5-21.
Starr, A., Graepel, R., Keeble, J., Schmidhuber, S., Clark, N., Grant, A., Shah, A. M. and Brain, S. D. (2008) A reactive oxygen species-mediated component in neurogenic vasodilatation. Cardiovasc.Res. 78(1): 139-147.
131 Staruschenko, A., Jeske, N. A. and Akopian, A. N. (2010) Contribution of TRPV1-TRPA1 interaction to the single channel properties of the TRPA1 channel. J.Biol.Chem. 285(20): 15167- 15177.
Storkebaum, E. and Carmeliet, P. (2011) Paracrine control of vascular innervation in health and disease. Acta Physiologica 203(1): 61-86.
Strålfors, P. (2012) Caveolins and Caveolae, Roles in Insulin Signalling and Diabetes. Caveolins and Caveolae: Roles in Signaling and Disease Mechanisms. J.-F. Jasmin, P. G. Frank and M. P. Lisanti. New York, NY, Springer US: 111-126.
Sullivan, M. N., Gonzales, A. L., Pires, P. W., Bruhl, A., Leo, M. D., Li, W., Oulidi, A., Boop, F. A., Feng, Y., Jaggar, J. H., Welsh, D. G. and Earley, S. (2015) Localized TRPA1 channel Ca(2+) signals stimulated by reactive oxygen species promote cerebral artery dilation. Science signaling 8(358): ra2-ra2.
Sun, H., Li, D.-P., Chen, S.-R., Hittelman, W. N. and Pan, H.-L. (2009) Sensing of Blood Pressure Increase by Transient Receptor Potential Vanilloid 1 Receptors on Baroreceptors. The Journal of Pharmacology and Experimental Therapeutics 331(3): 851-859.
Sun, J., Picht, E., Ginsburg, K. S., Bers, D. M., Steenbergen, C. and Murphy, E. (2006) Hypercontractile Female Hearts Exhibit Increased S-Nitrosylation of the L-Type Ca2+ Channel α1 Subunit and Reduced Ischemia/Reperfusion Injury. Circulation Research 98(3): 403-411.
Sun, J., Pu, Y., Wang, P., Chen, S., Zhao, Y., Liu, C., Shang, Q., Zhu, Z. and Liu, D. (2013) TRPV1-mediated UCP2 upregulation ameliorates hyperglycemia-induced endothelial dysfunction. Cardiovasc.Diabetol. 12: 69.
Susankova, K., Tousova, K., Vyklicky, L., Teisinger, J. and Vlachova, V. (2006) Reducing and Oxidizing Agents Sensitize Heat-Activated Vanilloid Receptor (TRPV1) Current. Molecular Pharmacology 70(1): 383-394.
Svoboda, L. K., Reddie, K. G., Zhang, L., Vesely, E. D., Williams, E. S., Schumacher, S. M., O’Connell, R. P., Shaw, R., Day, S. M., Anumonwo, J. M., Carrol, K. S. and Martens, J. R. (2012) Redox-Sensitive Sulfenic Acid Modification Regulates Surface Expression of the Cardiovascular Voltage-Gated Potassium Channel, Kv1.5. Circulation research 111(7): 842-853.
Szallasi, A., Cortright, D. N., Blum, C. A. and Eid, S. R. (2007) The vanilloid receptor TRPV1: 10 years from channel cloning to antagonist proof-of-concept. Nat.Rev.Drug Discov. 6(5): 357- 372. 132
Takaki, A., Morikawa, K., Tsutsui, M., Murayama, Y., Tekes, E., Yamagishi, H., Ohashi, J., Yada, T., Yanagihara, N. and Shimokawa, H. (2008) Crucial role of nitric oxide synthases system in endothelium-dependent hyperpolarization in mice. J Exp Med 205(9): 2053-2063.
Taniyama, Y. and Griendling, K. K. (2003) Reactive Oxygen Species in the Vasculature: Molecular and Cellular Mechanisms. Hypertension 42(6): 1075-1081.
Thomas, P. and Smart, T. G. (2005) HEK293 cell line: a vehicle for the expression of recombinant proteins. J Pharmacol Toxicol Methods 51(3): 187-200.
Torres-Narvaez, J. C., Mondragon, L., V, Varela, L. E., Perez-Torres, I., Diaz Juarez, J. A., Suarez, J. and Hernandez, G. P. (2012) Role of the transient receptor potential vanilloid type 1 receptor and stretch-activated ion channels in nitric oxide release from endothelial cells of the aorta and heart in rats. Exp.Clin.Cardiol. 17(3): 89-94.
Toth, A., Czikora, A., Pasztor, E. T., Dienes, B., Bai, P., Csernoch, L., Rutkai, I., Csato, V., Manyine, I. S., Porszasz, R., Edes, I., Papp, Z. and Boczan, J. (2014) Vanilloid receptor-1 (TRPV1) expression and function in the vasculature of the rat. J Histochem Cytochem 62(2): 129-144.
Trevisan, G., Hoffmeister, C., Rossato, M. F., Oliveira, S. M., Silva, M. A., Ineu, R. P., Guerra, G. P., Materazzi, S., Fusi, C., Nassini, R., Geppetti, P. and Ferreira, J. (2013) TRPA1 receptor stimulation by hydrogen peroxide is critical to trigger pain during MSU-induced inflammation. Arthritis Rheum.
Trevisani, M., Siemens, J., Materazzi, S., Bautista, D. M., Nassini, R., Campi, B., Imamachi, N., Andrè, E., Patacchini, R., Cottrell, G. S., Gatti, R., Basbaum, A. I., Bunnett, N. W., Julius, D. and Geppetti, P. (2007) 4-Hydroxynonenal, an endogenous aldehyde, causes pain and neurogenic inflammation through activation of the irritant receptor TRPA1. Proceedings of the National Academy of Sciences 104(33): 13519-13524.
Trott, O. and Olson, A. J. (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31(2): 455-461.
Tune, J. D. (2014) Coronary Circulation. Colloquium Series on Integrated Systems Physiology: From Molecule to Function, Morgan & Claypool Life Sciences. 6: 1-189.
133 Tune, J. D., Gorman, M. W. and Feigl, E. O. (2004) Matching coronary blood flow to myocardial oxygen consumption. J.Appl.Physiol (1985.) 97(1): 404-415.
Ufret-Vincenty, C. A., Klein, R. M., Collins, M. D., Rosasco, M. G., Martinez, G. Q. and Gordon, S. E. (2015) Mechanism for phosphoinositide selectivity and activation of TRPV1 ion channels. The Journal of General Physiology 145(5): 431-442.
Ullery, J. C. and Marnett, L. J. (2012) Protein modification by oxidized phospholipids and hydrolytically released lipid electrophiles: Investigating cellular responses. Biochimica et Biophysica Acta (BBA) - Biomembranes 1818(10): 2424-2435.
Usatyuk, P. V. and Natarajan, V. (2004) Role of Mitogen-activated Protein Kinases in 4- Hydroxy-2-nonenal-induced Actin Remodeling and Barrier Function in Endothelial Cells. Journal of Biological Chemistry 279(12): 11789-11797.
Usatyuk, P. V., Parinandi, N. L. and Natarajan, V. (2006) Redox Regulation of 4-Hydroxy-2- nonenal-mediated Endothelial Barrier Dysfunction by Focal Adhesion, Adherens, and Tight Junction Proteins. Journal of Biological Chemistry 281(46): 35554-35566.
Vatner, S. F., Higgins, C. B. and Braunwald, E. (1974) Sympathetic and parasympathetic components of reflex tachycardia induced by hypotension in conscious dogs with and without heart failure. Cardiovasc Res 8(2): 153-161.
Vest, A. R. and Heupler, F. (2013a) Afterload. Cardiovascular Hemodynamics: An Introductory Guide. S. Anwaruddin, M. J. Martin, C. J. Stephens and T. A. Askari. Totowa, NJ, Humana Press: 29-51.
Vest, A. R. and Heupler, F. (2013b) Preload. Cardiovascular Hemodynamics: An Introductory Guide. S. Anwaruddin, M. J. Martin, C. J. Stephens and T. A. Askari. Totowa, NJ, Humana Press: 3-27.
Wang, L. and Wang, D. H. (2005) TRPV1 gene knockout impairs postischemic recovery in isolated perfused heart in mice. Circulation 112(23): 3617-3623.
Wang, S. and Chuang, H. H. (2011) C-terminal dimerization activates the nociceptive transduction channel transient receptor potential vanilloid 1. J.Biol.Chem. 286(47): 40601-40607.
Wang, Z., Dou, X., Gu, D., Shen, C., Yao, T., Nguyen, V., Braunschweig, C. and Song, Z. (2012) 4-Hydroxynonenal differentially regulates adiponectin gene expression and secretion via
134 activating PPARγ and accelerating ubiquitin–proteasome degradation. Molecular and Cellular Endocrinology 349(2): 222-231.
Whitsett, J., Picklo, M. J. and Vasquez-Vivar, J. (2007) 4-Hydroxy-2-Nonenal Increases Superoxide Anion Radical in Endothelial Cells via Stimulated GTP Cyclohydrolase Proteasomal Degradation. Arteriosclerosis, Thrombosis, and Vascular Biology 27(11): 2340-2347.
Winter Z Fau - Buhala, A., Buhala A Fau - Otvos, F., Otvos F Fau - Josvay, K., Josvay K Fau - Vizler, C., Vizler C Fau - Dombi, G., Dombi G Fau - Szakonyi, G., Szakonyi G Fau - Olah, Z. and Olah, Z. (2013) Functionally important amino acid residues in the transient receptor potential vanilloid 1 (TRPV1) ion channel - an overview of the current mutational data. (1744-8069 (Electronic)).
Wittmann, C., Chockley, P., Singh, S. K., Pase, L., Lieschke, G. J. and Grabher, C. (2012) Hydrogen Peroxide in Inflammation: Messenger, Guide, and Assassin. Advances in Hematology 2012: 6.
Wold, L. E., Ceylan-Isik, A. F. and Ren, J. (2005) Oxidative stress and stress signaling: menace of diabetic cardiomyopathy. Acta Pharmacol Sin 26(8): 908-917.
Wong, C. O. and Yao, X. (2011) TRP channels in vascular endothelial cells. Adv Exp Med Biol 704: 759-780.
Wung, B. S., Cheng, J. J., Chao, Y. J., Hsieh, H. J. and Wang, D. L. (1999) Modulation of Ras/Raf/Extracellular Signal–Regulated Kinase Pathway by Reactive Oxygen Species Is Involved in Cyclic Strain–Induced Early Growth Response-1 Gene Expression in Endothelial Cells. Circulation Research 84(7): 804-812.
Wyss, C. A., Koepfli, P., Mikolajczyk, K., Burger, C., von Schulthess, G. K. and Kaufmann, P. A. (2003) Bicycle Exercise Stress in PET for Assessment of Coronary Flow Reserve: Repeatability and Comparison with Adenosine Stress. Journal of Nuclear Medicine 44(2): 146-154.
Yang, Y., Jin, X. and Jiang, C. (2014) S-Glutathionylation of Ion Channels: Insights into the Regulation of Channel Functions, Thiol Modification Crosstalk, and Mechanosensing. Antioxidants & Redox Signaling 20(6): 937-951.
Yoshida, T., Inoue, R., Morii, T., Takahashi, N., Yamamoto, S., Hara, Y., Tominaga, M., Shimizu, S., Sato, Y. and Mori, Y. (2006) Nitric oxide activates TRP channels by cysteine S- nitrosylation. Nature Chemical Biology 2(11): 596-607.
135 Zhang, H., Wickley, P. J., Sinha, S., Bratz, I. N. and Damron, D. S. (2011) Propofol restores transient receptor potential vanilloid receptor subtype-1 sensitivity via activation of transient receptor potential ankyrin receptor subtype-1 in sensory neurons. Anesthesiology 114(5): 1169- 1179.
Zhao, Y., Vanhoutte, P. M. and Leung, S. W. S. (2015) Vascular nitric oxide: Beyond eNOS. Journal of Pharmacological Sciences 129(2): 83-94.
136