sign in sign up
<<
Home , Phytoplasma

International Journal of Systematic and Evolutionary Microbiology (2013), 63, 766–776 DOI 10.1099/ijs.0.041202-0

‘Candidatus pruni’, a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal genes

Robert E. Davis,1 Yan Zhao,1 Ellen L. Dally,1 Ing-Ming Lee,1 Rasa Jomantiene2 and Sharon M. Douglas3

Correspondence 1Molecular Plant Laboratory, USDA-Agricultural Research Service, Beltsville, MD 20705, Robert E. Davis USA [email protected] 2Phytovirus Laboratory, Nature Research Centre, Vilnius, LT–08412, Lithuania 3The Connecticut Agricultural Experiment Station, New Haven, CT 06511, USA

X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rRNA gene RFLP group 16SrIII, subgroup A. Phylogenetic analyses of 16S rRNA gene sequences revealed that the X- disease phytoplasma strains formed a distinct subclade within the phytoplasma clade, supporting the hypothesis that they represented a lineage distinct from those of previously described ‘Candidatus Phytoplasma’ . sequence alignments revealed that all studied X- disease phytoplasma strains shared less than 97.5 % 16S rRNA gene sequence similarity with previously described ‘Candidatus Phytoplasma’ species. Based on unique properties of the DNA, we propose recognition of X-disease phytoplasma PX11CT1R as representative of a novel taxon, ‘Candidatus Phytoplasma pruni’. Results from nucleotide and phylogenetic analyses of secY and ribosomal protein (rp) gene sequences provided additional molecular markers of the ‘Ca. Phytoplasma pruni’ lineage. We propose that the term ‘Ca. Phytoplasma pruni’ be applied to phytoplasma strains whose 16S rRNA gene sequences contain the oligonucleotide sequences of unique regions that are designated in the formally published description of the taxon. Such strains include X-disease phytoplasma and - within the tolerance of a single base difference in one unique sequence - peach rosette, peach red suture, and little peach . Although not employed for taxon delineation in this work, we further propose that secY, rp, and other genetic loci from the reference strain of a taxon, and where possible oligonucleotide sequences of unique regions of those genes that distinguish taxa within a given 16Sr group, be incorporated in emended descriptions and as part of future descriptions of ‘Candidatus Phytoplasma’ taxa.

Peach (Prunus persica) and other stone fruit tree species are States (Stoddard et al., 1951). First reported in 1933 in the affected by diseases that seriously impact agricultural state of Connecticut and called the ‘X disease of peach’ production. X-disease has historically been one of the because of its unknown cause and mysterious nature, X- major limiting factors in peach production in the United disease of peach was for many years believed to be caused by a virus (Stoddard, 1934, 1938; Stoddard et al., 1951). Extensive early research indicated that the presumed virus Abbreviations: hf-PCRs, high-fidelity polymerase chain reaction; RFLP, restriction fragment length polymorphism. was seldom passed from peach tree to peach tree in the eastern US, but instead was mainly carried by The GenBank/EMBL/DDBJ accession numbers for the 16S rRNA, vectors from nearby forest growth to peach orchards. An secY, and ribosomal protein (rp) gene sequences of strain PX11CT1R are JQ044393 (rrnA), JQ044392 (rrnB), JQ268254 (secY), and important natural plant host of the was found to JQ360960 (rp), respectively. The GenBank/EMBL/DDBJ accession be wild chokecherry (Prunus virginiana) growing in the numbers for other strains used in this study are listed in Table 1. forest (reviewed by Douglas, 1986). In ensuing years, X- A supplementary figure and a supplementary table are available with the disease was reported in several states in the north-eastern online version of this paper. US, in California and other western states, and in Canada

766 041202 Printed in Great Britain ‘Candidatus Phytoplasma pruni’

(Stoddard et al., 1951). Studies in eastern and western US gene sequences, the characterization and phylogenetic have revealed that the pathogen can be transmitted by analysis of numerous phytoplasma strains, the estab- species of , including Colladonas clitellarius, C. lishment of a provisional ‘Candidatus Phytoplasma’ montanus, C. geminatus, Euscelidius variegatus, Fieberiella by the International Research Program for florii, Graphocephala confluens, Gyponana lamina, Keonella Comparative Mycoplasmology Phytoplasma/ confluens, Norvellina seminuda, Osbornellus borealis, Working Team-Phytoplasma Taxonomy Group (IRPCM, Paraphlepsius irroratus, and Scaphytopius delongi (S. acutus) 2004), and the formal description of over 30 ‘Candidatus (Kirkpatrick et al., 1990; Larsen & Whalen, 1988; McClure, Phytoplasma’ taxa (Davis et al., 2012; Gundersen et al., 1980; Rice & Jones, 1972). In addition to peach and 1994; IRPCM, 2004; Lee et al., 1998; Martini et al., 2012). chokecherry, species of the genus Prunus that are reportedly The phytoplasma strains that are associated with X-disease susceptible to infection by the X-disease pathogen include are classified in phytoplasma 16S rRNA gene RFLP group cherry (Prunus avium and Prunus cerasus), Japanese plum (16Sr group) 16SrIII, subgroup 16SrIII-A. Related strains, (Prunus salicina), almond (Prunus dulcis), apricot (Prunus classified in other subgroups of group 16SrIII, are the armeniaca), nectarine (Prunus persica var. nectarina), apparent causes of diseases in diverse plant species, Chinese bushcherry (Prunus japonica), Bessey cherry including blueberry, clover, goldenrod, milkweed, spirea, (Prunus besseyi), wild American plum (Prunus americana), , potato, walnut, and pecan (Table 1). The name wildgoose plum (Prunus munsoniana), and European plum ‘Candidatus Phytoplasma pruni’ was informally suggested (Prunus domestica) (Douglas, 1986; Stoddard et al., 1951). for X-disease phytoplasma (IRPCM, 2004), but the taxon was not formally described prior to the present Symptoms of X-disease on peach include tattered, shot- communication. holed appearance of ; loss of severely affected leaves, leaving a cluster of leaves at the ends of individual In this communication, we report results from the study of branches; dieback of branches; and death of trees phytoplasma strains associated with X-disease of peach in (Douglas, 1986; Stoddard, 1938; Stoddard et al., 1951). the United States and Canada, and of phytoplasma strains Application of insecticides in an effort to stem the spread associated with peach rosette, little peach, and peach red of X-disease, destruction of nearby chokecherry, treatment suture diseases in the United States. In the present study, of trees with , removal of symp- samples of symptomatic leaves were collected in 1992 and tomatic branches from diseased trees, replacement of trees 2011 from a total of six naturally diseased, commercially that are killed by the disease, and an integrated approach to cultivated peach trees exhibiting symptoms characteristic disease control have been practiced with varying degrees of of X-disease in the state of Connecticut, United States. The success (Allen & Davidson, 1978; Amin & Jensen, 1971; symptoms on the peach trees included chlorosis and Cooley et al., 1992; Douglas & McClure, 1988; Lacy, 1982; brittleness of leaves, tattered appearance of leaves (Fig. 1a), Lacy et al., 1980; Lukens et al., 1971; McClure et al., 1982; premature drop, and dieback of branches. The Nyland, 1971; Pearson & Sands, 1978; Rosenberger & collected leaves resembled peach X-disease symptomatic Jones, 1977; Sands & Walton, 1975). leaves depicted by Stoddard (1938) (Fig. 1b). Phytoplasma strains Canada X-disease (CX) and western X-disease X-disease of stone fruits is now attributed to infection of (WX) were each maintained separately by in plants plants by a phytoplasma (formerly -like of periwinkle (); Clover yellow edge organism; MLO), a wall-less bacterium embraced taxo- phytoplasma strain CYE (CYE-C) was in clover (Trifolium nomically within the class (Douglas, 1986; repens); and Walnut witches’-broom (WWB) phytoplasma Granett & Gilmer, 1971; Jones et al., 1974; Lee et al., was in lyophilized tissue of a WWB-diseased walnut tree. 1992; MacBeath et al., 1972; Nasu et al., 1970). In their Nucleic acid for use as template in PCR was extracted from evolutionary descent from walled in the / peach tissue samples, each consisting of mid-veins excised group, phytoplasmas underwent extensive from symptomatic leaves collected from one of the six size reduction (Marcone et al., 1999; Oshima diseased peach trees: DNA was extracted from leaves et al., 2004), losing genes that became unnecessary during collected from two peach trees in 2011 by the use of a adaptations to obligate, intracellular in plant modified method (Green et al., 1999) using DNeasy Plant and insect hosts (Davis et al., 2005). Due to the consequent DNA Extract kit (Qiagen); DNA was extracted in 1993 inability to obtain pure cultures of phytoplasmas in vitro, from leaves collected from four peach trees in 1992 using properties used to distinguish and describe species of methods described by Prince et al. (1993). Template DNAs culturable bacteria, including culturable mollicutes, are from walnut witches’-broom (WWB) and X-disease largely unattainable for phytoplasmas. However, DNA- phytoplasma strains WX (WX95) and CX (CX-95) were based technologies have enabled considerable progress in extracted from diseased plant tissues as described pre- phytoplasma classification and taxonomy. viously (Lee et al., 1991). Template DNAs were stored at 220C until further use. Over the past two decades, advances in DNA-based technologies have led to the establishment of a group/ For analysis of 16S rRNA gene sequences, the DNA subgroup classification system based on restriction frag- templates were used in separate, direct high-fidelity PCRs ment length polymorphism (RFLP) analysis of 16S rRNA (hf-PCRs) primed by primer pair P1/16S-SR and catalysed http://ijs.sgmjournals.org 767 R. E. Davis and others

Table 1. Group 16SrIII phytoplasma strains, subgroup affiliations, and nucleotide sequences used in this study

ND, Not determined; NA, not available.

Strain Associated disease 16Sr group- GenBank accession no. for: subgroup* 16S rRNA gene secY rp

‘Candidatus Phytoplasma pruni’ PX11CT1RD Peach X-disease 16SrIII-A JQ044393d(rrnA) JQ268254d JQ360960d JQ044392d(rrnB) PX11CT2D Peach X-disease 16SrIII-A JQ044391d(rrnA) JQ268253d JQ360959d JQ044390d(rrnB) PX92CT1D Peach X-disease 16SrIII-A JQ044389d(rrnA) JQ268252d JQ360958d JQ044388d(rrnB) PX92CT2D Peach X-disease 16SrIII-A JQ044387d(rrnA) ND ND JQ044386d(rrnB) PX92CT3D Peach X-disease 16SrIII-A JQ044385d(rrnA) ND ND JQ044384d(rrnB) PX92CT4D Peach X-disease 16SrIII-A JQ044383d(rrnA) JQ268251d JQ360957d JQ044382d(rrnB) PR Peach rosette 16SrIII-A* AF236121 NA NA LP Little peach 16SrIII-A AF236122 NA NA PRS Peach red suture 16SrIII-A AF236123 NA NA CX-95 Peach X-disease 16SrIII-A JQ044397d JQ268249d JQ360955d WX95 Peach X-disease 16SrIII-A JQ044396d JQ268250d JQ360956d ‘Candidatus Phytoplasma pruni’- related strains CYE (CYE-C) Clover yellow edge 16SrIII-B AF173558 GU004332 JQ360962d PBT Pecan bunchy top 16SrIII-C GU004371 GU004361 EF186807 GR1 Goldenrod yellows 16SrIII-D GU004372 GU004364 EF186810 SP1 Spirea stunt 16SrIII-E AF190228 GU004326 EF186806 MW1 Milkweed yellows 16SrIII-F AF510724 GU004340 EF186808 VAC (VacWB) Vaccinium witches’- 16SrIII-F X76430 GU004360 EF186809 broom AKpot7 Potato purple top 16SrIII-F GU004370 GU004358 NA WWB Walnut witches’- 16SrIII-G JQ044395d(rrnA) JQ390054d JQ360961d broom JQ044394d(rrnB) PoiBI Poinsettia branch 16SrIII-H AF190223 GU004328 EF186811 inducing MT117 Potato purple top 16SrIII-M FJ226074 GU004333 JQ044380 AKpot6 Potato purple top 16SrIII-N GU004365 GU004359 JQ044381

*16S rRNA gene RFLP group and subgroup classification of phytoplasma strain. Group is indicated by a Roman numeral; subgroup is indicated by a letter. Strain variant within a designated subgroup is indicated by an asterisk. DPhytoplasma strains first reported in this study. dNucleotide sequences determined in this study. For strains in which two sequence heterogeneous 16S rRNA genes were found, the identity of each partially sequenced rRNA is in parentheses.

by AccuPrime Taq DNA Polymerase High Fidelity (Life (Martini et al., 2007) followed by rp(III)-FN/rp(I)R1A (for Technologies) under conditions after Lee et al. (2004). To the remaining strains) under conditions after Martini et al. confirm the presence of sequence-heterogeneous rRNA (2007). The nucleotide sequence of primer rp(III)-FN was , products of PCR primed by P1/16S-SR were 59-GGTGAATTTTCTCCAACTCG-39 (this study). For ana- subjected to restriction endonuclease digestion, and the lysis of secY genomic regions from studied strains (except for resulting digest was analysed by 1 % agarose gel electro- strain CX-95), DNA fragments were amplified in hf-PCRs phoresis. For analysis of ribosomal protein (rp) genomic primed by L15F1A(III)/MapR1A(III) and catalysed by LA regions, DNA segments were amplified in hf-PCRs primed Taq DNA Polymerase (Takara Bio USA), followed by nested by primer pair rpL2F3/rp(I)R1A in direct PCR (for strain hf-PCR primed by secYF1(III)/secYR1(III) and catalysed CX-95), and in nested PCRs primed by rpL2F3/rp(I)R1A by AccuPrime Taq DNA Polymerase High Fidelity under

768 International Journal of Systematic and Evolutionary Microbiology 63 ‘Candidatus Phytoplasma pruni’

Fig. 1. Symptomatic leaves from X-diseased peach trees (Prunus persica) in Connecticut. Symptomatic leaves exhibit the tattered appearance characteristic of X-disease in peach. (a), Leaves collected in 2011 from X- diseased peach trees in Connecticut. (b), Scanned image of leaves hand drawn by E.M. Stoddard; from: Stoddard, 1938., with permission of the Connecticut Agricultural Experiment Station, New Haven. Black and white image is shown, because colours in the original were faded when scanned.

conditions previously described (Lee et al., 2010; Martini PX92CT3, and PX92CT4 (strains found in four trees et al., 2007). SecY genomic regions from strain CX-95 were sampled in 1992), respectively. amplified in direct hf-PCRs primed by primer pair SecYF1(III)/SecYR1(III). A negative control devoid of DNA template in the reaction mix was included in all Sequence-heterogeneous 16S rRNA genes in X- PCR assays. disease phytoplasma strains PCR products representing amplified genomic regions were Examination of the chromatograms from nucleotide analysed by 1 % agarose gel electrophoresis. The phyto- sequencing of 16S rRNA gene amplicons from the plasma-specific DNA bands were prepared for sequencing by Connecticut X-disease phytoplasma strains revealed that using a QIAquick Gel Extraction kit (Qiagen). The purified, a single base position in the 16S rRNA gene (corresponding amplified genomic regions were then sequenced by auto- to position 838 in GenBank accession no. JQ044393 of mated DNA sequencing (ABI Prism model 3730) of both strain PX11CT1R) was represented by two base-call peaks, strands to achieve 36 to 56 coverage per base position. one indicating a base call C and the other indicating a T, Nucleotide sequences of genes from other phytoplasmas in yielding a consensus Y, whereas all other base positions this study were obtained from the GenBank database (http:// were each represented by single peaks (Fig. 2a and data not www.ncbi.nlm.nih.gov/) (Table 1 and Table S1, available shown). We hypothesized that this result indicated the in IJSEM Online). Virtual RFLP analysis of nucleotide presence of two amplicons that were derived from two sequences and determination of 16Sr group and subgroup sequence-heterogeneous rRNA operons in each of the affiliations were performed using iPhyClassifier (Wei et al., strains from Connecticut. To test this hypothesis, we 2007; Zhao et al., 2009; http://plantpathology.ba.ars.usda. digested the 16S rRNA gene products, from PCRs primed gov/cgi-bin/resource/iphyclassifier.cgi). Phylogenetic ana- by P1/16S-SR, with the restriction endonuclease HpaI, lyses and nucleotide sequence alignments were performed since the C in one of the hypothesized operons was located using CLUSTAL in the MEGA4 software (Tamura et al.,2007) within this enzyme’s recognition site (GTTAAC) in the 16S and CLUSTAL version 5 from the LaserGene MEGALIGN rRNA gene. The resulting RFLP profiles after gel electro- program (DNASTAR). Oligonucleotide sequences of unique phoresis of the digested DNA (Fig. 2b) clearly indicated the regions in the 16S rRNA gene of ‘Ca. Phytoplasma pruni’ presence of two 16S rRNA gene species in each PCR were selected such that they were identical in both rRNA product, consistent with one undigested 16S rRNA gene operons of the reference strain. amplicon containing a T and a digested 16S rRNA gene In repeated experiments, 1.6 kb 16S rRNA gene fragments amplicon containing a C in the region corresponding to were amplified by PCR with primers P1/16S-SR, indicating the HpaI site. This finding, and cloning and sequencing of that all six peach trees exhibiting symptoms of X-disease in the two 16S rRNA gene species, confirmed that the Connecticut were infected by phytoplasma. The phyto- automated sequencing had revealed two sequence-hetero- plasmas detected in the six trees were designated strains geneous 16S rRNA genes in the PCR products from the PX11CT1R and PX11CT2 (strains found in two trees peach X-disease phytoplasma strains from Connecticut. By sampled in 2011), and strains PX92CT1, PX92CT2, contrast, neither the automated sequencing chromato- http://ijs.sgmjournals.org 769 R. E. Davis and others

consistent with the concept that these strains and the Connecticut strains possibly represent two closely related lineages. Nucleotide sequences of the 16S rRNA gene sequences from strains CX-95 and WX95, and from the two sequence-heterogeneous rRNA operons of each Connecticut X-disease phytoplasma strain, were deposited in the GenBank database (Table 1).

16Sr group and subgroup classification of X- disease and other peach-associated strains Sequence alignments revealed that strains PX11CT1R, PX11CT2, PX92CT1, PX92CT2, PX92CT3, and PX92CT4 shared 100 % 16S rRNA gene sequence similarity, of corresponding rRNA operons, with one another. As expected, results from computer-simulated, virtual RFLP analysis of 16S rRNA gene sequences revealed that all of these X-disease strains are members of group 16SrIII, subgroup 16SrIII-A, yielding 16S rRNA gene RFLP profiles identical with those of the two rRNA operons, rrnA and rrnB, of strain PX11CT1R (Fig. S1). Results from virtual RFLP analysis of 16S rRNA gene sequences of little peach and peach red suture phytoplasmas indicated that these phytoplasmas are also members of subgroup 16SrIII-A, and that peach rosette phytoplasma may be a subgroup 16SrIII- A variant strain whose 16S rRNA gene differs by a single base substitution in a Sau3AI restriction enzyme site (data not shown). Strain PX11CT1R from peach in Connecticut was selected for further study as representative of a novel taxon.

Novel taxon from X-diseased peach To determine whether strain PX11CT1R represented a distinct taxon, the MEGALIGN option of the DNASTAR program and iPhyClassifier was used to align 16S rRNA gene sequences and calculate sequence similarities with 16S rRNA gene sequences of other phytoplasmas. The 16S Fig. 2. Evidence of sequence heterogeneous 16S rRNA genes rRNA gene sequences from both rRNA operons of strain in X-disease phytoplasma. (a) Chromatogram from nucleotide PX11CT1R exhibited less than 97.5 % sequence similarity sequencing of PCR-amplified rRNA gene amplicons from strain R with the corresponding fragments of 16S rRNA gene PX11CT1 . Double base-call is indicated by two peaks repre- sequences from all previously described ‘Ca. Phytoplasma’ senting bases C and T, respectively. The recognition site for species. Therefore, in accordance with guidelines for the restriction enzyme HpaI is underlined; the location of enzymic recognition of ‘Candidatus Phytoplasma’ species (IRPCM, cutting is indicated by a solid triangle. (b) RFLP patterns before R (U) and after (D) HpaI digestion of DNA. PX1, strain PX11CT1R, 2004), we propose that strain PX11CT1 is representative indicating two sequence-heterogeneous rRNA operons. PX2, of a novel, distinct ‘Candidatus Phytoplasma’ taxon, strain PX11CT2, indicating two sequence-heterogeneous rRNA designated ‘Candidatus Phytoplasma pruni’. operons. CX, strain CX-95, without evidence for sequence- A phylogenetic tree was constructed based on 16S rRNA heterogeneous rRNA operons. S, size standard 1 kb DNA ladder gene sequences from all previously described ‘Ca. Phy- (Life Technologies). toplasma’ taxa, the proposed ‘Ca. Phytoplasma pruni’, and Acholeplasma palmae; the two sequence-heterogeneous 16S rRNA genes of ‘Ca. Phytoplasma pruni’ were included grams, nor digestion of PCR products with HpaI, indicated (Table S1). The phylogenetic analysis indicated that ‘Ca. the presence of sequence-heterogeneous 16S rRNA genes in Phytoplasma pruni’ formed a well-supported branch strains CX-95 or WX95 (Fig. 2b and WX data not shown), representing a distinct, taxon level lineage (Fig. 3).

770 International Journal of Systematic and Evolutionary Microbiology 63 ‘Candidatus Phytoplasma pruni’

100 ‘Ca. Phytoplasma pruni’ rrnA (JQ044393) ‘Ca. Phytoplasma pruni’ rrnB (JQ044392)

90 99 ‘Ca. Phytoplasma omanense’ (EF666051) 10 ‘Ca. Phytoplasma phoenicium’ (AF515636) 52 ‘Ca. Phytoplasma castaneae’ (AB054986) 56 ‘Ca. Phytoplasma pini’ (AJ632155) 99 ‘Ca. Phytoplasma cynodontis’ (AJ550984) 29 ‘Ca. Phytoplasma oryzae’ (AB052873)

98 90 ‘Ca. Phytoplasma ulmi’ (AY197655) 44 100 ‘Ca. Phytoplasma rubi’ (AY197648) ‘Ca. Phytoplasma ziziphi’ (AB052876) 99 ‘Ca. Phytoplasma trifolii’ (AY390261) Ca. 90 ‘ Phytoplasma fraxini’ (AF092209) 92 ‘Ca. Phytoplasma sudamericanum’ (GU292081) 85 ‘Ca. Phytoplasma brasiliense’ (AF147708) Ca. 100 ‘ Phytoplasma australasiae’ (Y10097) 80 ‘Ca. Phytoplasma aurantifolia’ (U15442) 95 ‘Ca. Phytoplasma rhamni’ (X76431) 81 ‘Ca. Phytoplasma allocasuarinae’ (AY135523) ‘Ca. Phytoplasma tamaricis’ (FJ432664) 86 ‘Ca. Phytoplasma spartii’ (X92869) ‘Ca. Phytoplasma pyri’ (AJ542543) 56 Ca. 88 ‘ Phytoplasma prunorum’ (AJ542544) 30 ‘Ca. Phytoplasma mali’ (AJ542541) ‘Ca. Phytoplasma costaricanum’ (HQ225630) 100 ‘Ca. Phytoplasma asteris’ (M30790) 98 ‘Ca. Phytoplasma lycopersici’ (EF199549) Ca. 42 ‘ Phytoplasma fragariae’ (DQ086423) ‘Ca. Phytoplasma japonicum’ (AB010425) 72 ‘Ca. Phytoplasma convolvuli’ (JN833705) 34 14 ‘Ca. Phytoplasma australiense’ (L76865) 32 ‘Ca. Phytoplasma americanum’ (DQ174122) 24 ‘Ca. Phytoplasma graminis’ (AY725228) 99 ‘Ca. Phytoplasma caricae’ (AY725234)

Acholeplasma palmae ATCC 49389 (L33734)

Fig. 3. Phylogenetic tree inferred from analyses of 16S rRNA gene sequences from ‘Candidatus Phytoplasma’ species. The taxa used in construction of the phylogenetic tree included reference strains of 32 previously described ‘Ca. Phytoplasma’ species and ‘Ca. Phytoplasma pruni’ proposed in this communication (in bold type). Acholeplasma palmae ATCC 39389T served as the outgroup. GenBank accession numbers are given in parentheses. Maximum-parsimony analysis was conducted using the close neighbour interchange (CNI) algorithm implemented in software package MEGA4. The initial tree for the CNI search was obtained with the random addition of sequences (10 replicates). The reliability of the analysis was subjected to a bootstrap test with 1000 replicates. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Bar, 10 nt substitutions.

Description of ‘Candidatus Phytoplasma pruni’ AAAACAGGTGGTGC-39 (999-1027), 59-CTTGTCGTTA- GTTGCCAGCATGTAAT-39 (1083-1108), 59-GATGGGG- ‘Candidatus Phytoplasma pruni’ (pru9ni. L. gen. n. pruni of ACTTTAACGA-39 (1109-1125), 59-GGTTGATACAAAG-39 a peach-tree, from a tree of the genus Prunus). (1211-1223), and 59-TCTCAAAAAATCAATC-39 (1252-1267); PX11CT1R is the reference strain. P(Prunus, ); M].Daviset al., this study. [(Mollicutes) NC; NA; O, wall-less; NAS (GenBank acce- ssion no. JQ044393, rrnA; and JQ044392, rrnB), oligonu- Ribosomal protein (rp) and secY loci in ‘Ca. cleotide sequences of unique regions in the 16S rRNA gene Phytoplasma pruni’ and related strains are 59-CACATTAGTTAGTTGGTAGGGTAAAGGCCTAC- ‘Ca. Phytoplasma pruni’ PX11CT1R and additional X- C-39 (226-258), 59-GTACCTCGGTATG-39 (402-414), 59-T- disease phytoplasma strains were further distinguished from TATTAAGGAAGAAAAAAGAGTGGAAAAACTCCCT-39 other phytoplasmas of group 16SrIII, on the basis of analyses (425-459), 59-ACGGTACTTAA-39 (462-472), 59-TAAT- of genomic segments containing genes encoding ribosomal AAGTCTATAGTTTAATTTCAGTGCTTAACGCTGTTGT- and preprotein translocase SecY subunit. GCTATAG-39 (571-618), 59-GTTTTACTAGAGTGAG-39 (624-639), 59-TAAAACTGGTAC-39 (817-828), 59-TTTCT- In direct PCR, primer pair rpL2F3/rp(I)R1A primed TGCGAAGTTA-39 (970-984), 59-ATGGAGGTCATCAGG- amplification of a 1.7 kb DNA fragment, containing genes http://ijs.sgmjournals.org 771 R. E. Davis and others rpsS, rplV, and rpsC encoding ribosomal proteins S19, L22, CYE, MT117, MW1, and PBT. Interestingly, the secY-map and S3, respectively, from strain CX-95 and from the intergenic region from all of the X-disease phytoplasma subgroup 16SrIII-B phytoplasma strain CYE. In nested strains and strain PoiBI contained a 4-base insertion (bases PCR, primer pair rpL2F3/rp(I)R1A followed by nested TTTG at positions 1625–1628 in GenBank sequence primer pair rp(III)-FN/rp(I)R1A primed amplification of a JQ044393, strain PX11CT1R), compared to the secY-map 1.4 kb DNA fragment containing a partial rpsS, a complete intergenic regions from strains affiliated with diverse rplV, and a complete rpsC gene from strains PX11CT1R, subgroups of group 16SrIII (Fig. 5). PX11CT2, PX92CT1, PX92CT4, and WX95. S3 proteins R Phylogenetic analyses of 16S rRNA, secY, and ribosomal encoded by strains PX11CT1 , PX11CT2, PX92CT1, protein gene sequences yielded three mutually congruent PX92CT4, CX-95, and WX95 were identical in deduced R amino acid sequence. Deduced amino acid sequences of L22 trees, on each of which ‘Ca. Phytoplasma pruni’ PX11CT1 proteins of strains PX11CT1R, PX11CT2, PX92CT1, and and other X-disease-associated strains formed a well- PX92CT4 were mutually identical but differed from those of supported, distinct cluster (Fig. 6). The topologies of the strains CX-95 and WX95 by the same single amino acid secY and rp gene trees suggested at least two divergent substitution. The amplified rp genomic regions were branches of evolution, with strain CYE possibly represent- identical in nucleotide sequence, except for a single base ing a third (Fig. 6). The results were consistent with the difference located in rplV encoding the L22 ribosomal concept that the X-disease strains represented a lineage that protein. This base difference accounted for an amino acid was distinct among diverse subgroups within group 16SrIII substitution of S (serine) in both CX-95 and WX95, in place and raised the possibility that the group 16SrIII phyto- of A (alanine) at amino acid position 4, in the X-disease plasma lineages analysed represented at least two and phytoplasma strains. Interestingly, compared to the other perhaps at least three different phytoplasma taxa. In group 16SrIII strains studied, CYE phytoplasma has a 3-base particular, we noted that strain CYE was distinguished deletion and a 7-base insertion, the latter as part of a possibly from the other phytoplasma strains in this study, by its lineage-specific 7-base direct repeat, in the gene-encoding phylogenetic position in the rp and secY gene trees. L22, and a 3-base insertion in the gene-encoding S3. According to guidelines proposed by the IRPCM (2004), the term ‘Candidatus Phytoplasma pruni’ would strictly be Direct and nested PCRs with primer pair secYF1(III)/ R secYR1(III) yielded 1.7 kb DNA fragments from X-disease applied only to the reference strain (PX11CT1 ) described phytoplasma DNA templates (Table 1). Nucleotide herein, and other strains of X-disease phytoplasma would sequence analyses revealed that the amplicons each be referred to as ‘Candidatus Phytoplasma pruni’-related contained a partial (39-end) rpl15 ribosomal protein (rp) strains. Thus under this convention, multiple strains gene, a complete secY gene, and a partial (59-end) map undoubtedly of a given taxon, such as ‘Candidatus (methionine aminopeptidase) gene. Like various group Phytoplasma pruni’, are referred to simply as related to 16SrIII phytoplasma strains and unlike some other that taxon, potentially implying that such strains may phytoplasmas (Lee et al., 2010), the X-disease phytoplasma represent separate taxon level lineage(s). Other members of strains in this study lacked an adk (adenylate kinase) gene group 16SrIII, including strains classified in diverse between the secY and map genes, a feature that marks a subgroups in group 16SrIII, would also be rZeferred to as major evolutionary divergence among phytoplasma sub- ‘Candidatus Phytoplasma pruni’-related strains unless clades. A 9-base insertion/deletion (indel) in the secY named as separate taxa. Thus, more distantly related genomic locus distinguished two group 16SrIII phyto- strains, that may well represent distinct taxa level plasma strain clusters, one group containing strains having lineage(s), are disadvantageously not distinguished as such. R a secY gene length of 1263 bases (strains PX11CT1 , To resolve this issue, we propose that the term ‘Candidatus PX11CT2, PX92CT1, PX92CT4, CX-95, WX95, WWB, Phytoplasma pruni’ be applied to all strains whose 16S PoiBI, SP1), and the other group containing strains having rRNA gene sequences contain the oligonucleotide secY length of 1272 bases (strains CYE, MW1, GR1, PBT, sequences of unique regions that are designated in the PPTAKpot6, PPTAKpot7, PPTMT117, VAC) (Fig. 4). formally published description of the taxon (this study) Single nucleotide polymorphisms (SNPs) further distin- and as may be emended and/or revised. Results from guished the X-disease strains from group 16SrIII strains nucleotide sequence alignments indicated that application that are associated with other diseases and are classified in of this guideline would include geographically diverse X- other than subgroup 16SrIII-A (Fig. 4 and data not disease phytoplasma strains within ‘Ca. Phytoplasma shown). pruni’, but would exclude group 16SrIII strains such as Alignment of deduced amino acid sequences revealed that, clover yellow edge, potato purple top, walnut witches’- due to the observed 9-base indel, the SecY proteins broom, and other phytoplasmas listed in Table 1. In our encoded by X-disease, PoiBI, WWB, and SP1 phytoplasma view, the term ‘Ca. Phytoplasma pruni’-related strains strains shared a unique amino acid sequence including a would be applied to such latter phytoplasmas (Table 1). In three-amino acid deletion, in the context KQY—FS, these latter strains, the 16S rRNA genes differed by one or compared to the corresponding region [KQ(K/E)LFKL(S/ more bases in two or more of the oligonucleotide Y)] in group 16SrIII strains VAC, GR1, AKpot6, AKpot7, sequences that correspond to unique regions designated

772 International Journal of Systematic and Evolutionary Microbiology 63 ‘Candidatus Phytoplasma pruni’

PX11CT1R (JQ268254) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 516 PX11CT2 (JQ268253) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 519 PX92CT1 (JQ268252) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 519 PX92CT4 (JQ268251) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 519 CX-95 (JQ268249) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 512 WX95 (JQ268250) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 515 PoiBI (GU004328) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 533 WWB (JQ390054) CGGTTCAAGAAAAATTTCTTTTTGACATCAAACAATATTTTTCTAA------GTCTAGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 519 SP1 (GU004326) CGGTTCAAGAAAAATTTCTTTTTGACATTAAACAATATTTTTCTAA------GTCTGGTTTATTTGAAGCTAATGGTTCTATATATTTTTTATCTTT 591 VAC (GU004360) TGTTTCAAGAACAATTTTTTTTTGATTATAAACAAAAACTTTTTAAGCTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 476 GR1 (GU004364) CGTTTCAAGAACAATTTTTTTTTGATTATAAACAAAAACTTTTTAAGCTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 472 AKpot6 (GU004359) CGTTTCAAGAACAATTGGCTTTTGATTATAAACAAAAACTTTTTAAGCTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 480 AKpot7 (GU004358) CGTTTCAAGAACAATTGGATTTTGATTATAAACAAAAACTTTTTAAGCTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 468 CYE (GU004332) CGTTTCAAGAAAAATTTCTTTTTGACTTTAAACAAGAACTTTTTAAACTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 510 MT117 (GU004333) CGTTTCAAGAACAATTTTTGTTTGATTATAAACAAAAACTTTTTAAGCTTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 518 MW1 (GU004340) CGTTTCAAGAACAATTTTTTTTTGATTATAAACAAAAACTTTTTAAGATTTCTAAGTCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 516 PBT (GU004361) CGATTCAAGAACAATTTTTTTTTGATTATAAACAAAAACTTTTTAAGCTTTATAAGCCTAGTTTATTTGAAGTTAATGGTTCTATATATTTTTTATCTTT 480

Fig. 4. Alignment of partial secY gene sequences from phytoplasma strains classified in group 16SrIII. Base identities differing from those of strain PX11CT1R are boxed. Most SNPs and 9-base indel in the secY gene are correlated with a major evolutionary divergence among group III phytoplasma strains. GenBank accession numbers are given in parentheses. Numbers at the ends of the sequences indicate base positions of the last base shown for a given GenBank sequence. Additional SNPs, not shown, are present in the remaining portion of the secY gene. Strain abbreviations and names are given in Table 1.

(this paper) for the reference strain of ‘Ca. Phytoplasma ecological fitness determined by genes other than those pruni’ (data not shown). These examples may indicate that encoding 16S rRNA (Davis & Sinclair, 1998). distinct species are signalled by a difference of at least one base in a minimum of two unique 16S rRNA gene regions In this communication, we propose recognition of a new designated for a described species; under this criterion, species, ‘Candidatus Phytoplasma pruni’, principally on the peach rosette (GenBank accession no. AF236121), little basis of the gene encoding 16S rRNA. While current peach (AF236122), and peach red suture (AF236123) guidelines recommend analysis and description of only this phytoplasmas would be considered (as additional strains single gene (from just one rRNA operon) for delineation of of) ‘Ca. Phytoplasma pruni’ (Table 1). As more is learned such a unique ‘Candidatus Phytoplasma’ species (IRPCM, about their biology and molecular genetics, it is possible that 2004), we include nucleotide sequences for both sequence- some ‘Ca. Phytoplasma pruni’-related strains (as designated heterogeneous 16S rRNA genes as recommended pre- in this communication) could eventually be recognized as viously (Davis et al., 2003). We also provide data on representing additional distinct species whose descriptions two additional genomic loci for the designated ‘Ca. will incorporate unique regions of yet other genes. Such Phytoplasma pruni’ reference strain PX11CT1R, as well as progress seems likely to lead to emended descriptions for other strains, since improved delineation of species of existing ‘Ca. Phytoplasma’ species that could include should be achieved through analyses of more variable gene revisions of species-unique oligonucleotide sequences in 16S sequences (Lee et al., 2010; Martini et al., 2007). rRNA genes. Presumably, additional genes will become part Availability of nucleotide sequences from multiple genetic of phytoplasma species descriptions, because evolutionary loci, such as those encoding SecY and ribosomal proteins, divergence probably proceeds largely through selection for especially for the reference strain of a ‘Ca. Phytoplasma’

secY-map map Fig. 5. Nucleotide sequence alignment of the PX11CT1R (JQ268254) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T PX11CT2 (JQ268253) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T secY-map intergenic regions from diverse phyto- PX92CT1 (JQ268252) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T plasma strains classified in group 16SrIII. PX92CT4 (JQ268251) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T Comparable regions for strains PBT, GR1, CX-95 (JQ268249) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T AKpot6, and AKpot7 were not available at the WX95 (JQ268250) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T time of writing. Four-base indel in the secY-map PoiBI(GU004328) T T T A GA T T T A A GGCA GGT T T GT T A CCCT T T A T GA T A A T A A T intergenic region is boxed. secY-map, intergenic WWB (JQ390054) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATAATAAT region, partial. map,59-end of the map gene. SP1 (GU004326) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATAATAAT Direction of translation is indicated by an arrow. VAC (GU004360) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATATAT AT Vertical line marks start of map genes. GenBank CYE (GU004332) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATAATAAT accession numbers are given in parentheses. MT117 (GU004333) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATAATAAT Strain abbreviations and names are given in MW1 (GU004340) TTTAGATTTAAGGCAGG-- - - TTACCCTTTATGATAATAAT Table 1. http://ijs.sgmjournals.org 773 R. E. Davis and others

PX11CT1R rrnA (JQ044393) (a) PX92CT1 rrnA (JQ044389) PX92CT2 rrnA (JQ044387) PX92CT3 rrnA (JQ044385) PX92CT4 rrnA (JQ044383) 96 CX-95 (JQ044397) PX11CT2 rrnA (JQ044391) [A] WX95 (JQ044396) PX11CT1R rrnB (JQ044392) PX11CT2 rrnB (JQ044390) 51 PX92CT2 rrnB (JQ044386) 65 PX92CT1 rrnB (JQ044388) PX92CT4 rrnB (JQ044382) 89 PX92CT3 rrnB (JQ044384) WWB rrnB (JQ044394) [G] PoiBI (AF190223) [H] WWB rrnA (JQ044395) [G] SP1 (AF190228) [E] CYE (AF175304) [B] GR1 (GU004372) [D] AKpot7 (GU004370) [F] 81 AKpot6 (GU004365) [N] 76 VAC (HQ589201) [F] MT117 (FJ226074) [M] 57 PBT (GU004371) [C] MW1 (AF510724) [F] 1

(b) PX11CT1R (JQ268254) WX95 (JQ268250) 96 PX92CT1 (JQ268252) [A] CX-95 (JQ268249) 70 PX11CT2 (JQ268253) PX92CT4 (JQ268251) PoiBI (GU004328) [H] 1263 bases 99 SP1 (GU004326) [E] ACTTTCTAA WWB (JQ390054) [G] CYE (GU004332) [B] 1272 bases PBT (GU004361) [C] GR1 (GU004364) [D] GCTTTCTAA 50 MT117 (GU004333) [M] 1272 bases 99 VAC (GU004360) [F] AKpot6 (GU004359) [N] 96 96 AKpot7 (GU004358) [F] MW1 (GU004340) [F] 5 GATTTCTAA

(c) PX11CT1R (JQ360960) Fig. 6. Phylogenetic trees inferred from PX11CT2 (JQ360959) analyses of 16S rRNA (a), secY (b), and rp 71 PX92CT1 (JQ360958) (c) gene sequences from phytoplasma strains PX92CT4 (JQ360957) [A] classified in diverse subgroups of group 98 WX95 (JQ360956) 16SrIII. 16SrIII subgroup classifications of the 66 CX-95 (JQ360955) strains are given in small and large brackets. 99 PoiBI (EF186811) [H] GenBank accession numbers are given in 79 WWB (JQ360961) [G] parentheses. Strain abbreviations and names SP1 (EF186806) [E] are given in Table 1. The lengths of secY genes CYE (JQ360962) [B] and base compositions of the 9-base inser- PBT (EF186807) [C] tions in the secY gene that distinguish major VAC (EF186809) [F] 68 lineages are indicated on branches. The trees AKpot6 (JQ044381) [N] 99 were constructed using the CNI algorithm in MT117 (JQ044380) [M] MEGA4. Numbers at nodes indicate bootstrap GR1 (EF186810) [D] 71 confidence values. Bars, number of nucleotide MW1 (EF186808) [F] 5 substitutions. species, should aid future efforts to assess whether various adhesion genes, and immunodominant protein genes) strain lineages within group 16SrIII may represent from the reference strain of a species, and where possible additional species. We propose that secY, rp, and other oligonucleotide sequences of their unique regions that dis- genetic loci (such as map, tuf, groEL, dnaK, gcp, rpoB, tinguish species within a given 16Sr group, be incorporated

774 International Journal of Systematic and Evolutionary Microbiology 63 ‘Candidatus Phytoplasma pruni’ in emended descriptions and as part of future descriptions of Mycoplasmology, Baden near Vienna, 1988, pp. 288–297. Stuttgart: ‘Candidatus Phytoplasma’ species. Gustav Fischer Verlag. Lacy, G. H. (1982). Peach X-disease: Treatment site damage and yield response following antibiotic infusion. Plant Dis 66, 1129–1133. Acknowledgements Lacy, G. H., McIntyre, J. L., Walton, G. S. & Dodds, J. A. (1980). Rapid We gratefully acknowledge Lloyd Chiykowski, Bruce Kirkpatrick, and method for and effects of infusing trees with concentrated C.J. Chang for supplying CX, WX, and WWB phytoplasma samples, oxytetracycline-HCl solutions for pear decline control. Can J Plant respectively; and Jonathan Shao for excellent assistance in bioinfor- Pathol 2, 96–101. matics analyses and for proofreading the manuscript. Larsen, K. J. & Whalen, M. E. (1988). Dispersal of Paraphlopsius irroratus (Say) (Homoptera: Cicadellidae) in peach and cherry orchards. Environ Entomol 17, 842–851. References Lee, I. M., Davis, R. E. & Hiruki, C. (1991). Genetic interrelatedness among clover proliferation mycoplasmalike organisms (MLOs) and Allen, W. R. & Davidson, T. R. (1978). Dosage response and duration other MLOs investigated by nucleic acid hybridization and restriction of symptom remission in X-diseased peach trees treated with fragment length polymorphism analyses. Appl Environ Microbiol 57, oxytetracycline-HCl in Ontario. Plant Disease Reporter 62, 311–313. 3565–3569. Amin, P. W. & Jensen, D. D. (1971). Effects of tetracycline on the Lee, I.-M., Gundersen, D. E., Davis, R. E. & Chiykowski, L. N. (1992). transmission and pathogenicity of the western X disease agent in its Identification and analysis of a genomic strain cluster of mycoplasma- insect and plant hosts. Phytopathology 61, 696–702. like organisms associated with Canadian peach (eastern) X disease, Cooley, D. R., Tattar, T. A. & Schieffer, J. T. (1992). Treatment of X- western X disease, and clover yellow edge. J Bacteriol 174, 6694–6698. disease of peaches using oxytetracycline microinjection capsules. Lee, I.-M., Gundersen-Rindal, D. E., Davis, R. E. & Bartoszk, I. M. HortScience 27, 235–237. (1998). Revised classification scheme of phytoplasmas based on RFLP Davis, R. E. & Sinclair, W. A. (1998). Phytoplasma identity and disease analyses of 16S rRNA and ribosomal protein gene sequences. etiology. Phytopathology 88, 1372–1376. Phytopathology 83, 834–842. Davis, R. E., Jomantiene, R., Kalvelyte, A. & Dally, E. L. (2003). Lee, I.-M., Gundersen-Rindal, D. E., Davis, R. E., Bottner, K. D., Differential amplification of sequence heterogeneous ribosomal RNA Marcone, C. & Seemu¨ ller, E. (2004). ‘‘Candidatus Phytoplasma genes and classification of the ‘Fragaria multicipita’ phytoplasma. asteris’’, a novel phytoplasma taxon associated with aster yellows and Microbiol Res 158, 229–236. related diseases. Int J Syst Evol Microbiol 54, 1037–1048. Davis, R. E., Jomantiene, R. & Zhao, Y. (2005). Lineage-specific decay Lee, I.-M., Bottner-Parker, K. D., Zhao, Y., Davis, R. E. & Harrison, of folate biosynthesis genes suggests ongoing host adaptation in N. A. (2010). Phylogenetic analysis and delineation of phytoplasmas phytoplasmas. DNA Cell Biol 24, 832–840. based on secY gene sequences. Int J Syst Evol Microbiol 60, 2887–2897. Davis, R. E., Zhao, Y., Dally, E. L., Jomantiene, R., Lee, I. M., Wei, W. & Lukens, R. J., Miller, P. M., Walton, G. S. & Hitchcock, S. W. (1971). Kitajima, E. W. (2012). ‘Candidatus Phytoplasma sudamericanum’, a Incidence of X-disease of peach and eradication of chokecherry. Plant novel taxon, and strain PassWB-Br4, a new subgroup 16SrIII-V Disease Reporter 55, 645–647. phytoplasma, from diseased passion fruit ( f. MacBeath, J. H., Nyland, G. & Spurr, A. R. (1972). Morphology of flavicarpa Deg.). Int J Syst Evol Microbiol 62, 984–989. mycoplasma-like bodies associated with peach X-disease in Prunus Douglas, S. M. (1986). Detection of mycoplasma-like organisms in persica. Phytopathology 62, 935–937. peach and chokecherry with X-disease by fluorescence . Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. & Seemu¨ ller, E. Phytopathology 76, 784–787. (1999). Chromosome sizes of phytoplasmas composing major Douglas, S. M. & McClure, M. S. (1988). New integrated approach for phylogenetic groups and subgroups. Phytopathology 89, 805–810. controlling X-disease of stone fruits. In Connecticut Agricultural Martini, M., Lee, I. M., Bottner, K. D., Zhao, Y., Botti, S., Bertaccini, A., Experiment Station Bulletin No 854, pp. 1–10. New Haven: Connecticut Harrison, N. A., Carraro, L., Marcone, C. & other authors (2007). Agricultural Experiment Station. Ribosomal protein gene-based phylogeny for finer differentiation and Granett, A. L. & Gilmer, R. M. (1971). associated with X- classification of phytoplasmas. Int J Syst Evol Microbiol 57, 2037–2051. disease in various Prunus species. Phytopathology 61, 1036–1037. Martini, M., Marcone, C., Mitrovic´, J., Maixner, M., Delic´, D., Myrta, A., Green, M. J., Thompson, D. A. & MacKenzie, D. J. (1999). Easy and Ermacora, P., Bertaccini, A. & Duduk, B. (2012). ‘‘Candidatus efficient DNA extraction from woody plants for the detection of Phytoplasma convolvuli’’, a new phytoplasma taxon associated with phytoplasmas by polymerase chain reaction. Plant Dis 83, 482–485. bindweed yellows in four European countries. Int J Syst Evol Microbiol Gundersen, D. E., Lee, I.-M., Rehner, S. A., Davis, R. E. & Kingsbury, 62, 2910–2915. D. T. (1994). Phylogeny of mycoplasmalike organisms (phytoplas- McClure, M. S. (1980). Spatial and seasonal distribution of leafhopper mas): a basis for their classification. J Bacteriol 176, 5244–5254. vectors of peach X-disease in Connecticut. Environ Entomol 9, 668– IRPCM (2004). ‘Candidatus Phytoplasma’, a taxon for the wall-less, 672. non-helical that colonize plant phloem and . Int J McClure, M. S., Andreadis, T. G. & Lacy, G. H. (1982). Manipulating Syst Evol Microbiol 54, 1243–1255. orchard ground cover to reduce invasion by leafhopper vectors of Jones, A. L., Hooper, G. R. & Rosenberger, D. A. (1974). Association peach X-disease. J Econ Entomol 75, 64–68. of mycoplasmalike bodies with little peach and X-disease. Nasu, S., Jensen, D. D. & Richardson, J. (1970). Electron microscopy Phytopathology 64, 755–756. of Mycoplasma-like bodies associated with insect and plant hosts of Kirkpatrick, B. C., Fisher, G. A., Fraser, J. D. & Purcell, A. H. (1990). peach Western X-disease. Virology 41, 583–595. Epidemiology and phylogenetic studies on western X-disease Nyland, G. (1971). Remission of symptoms of pear decline in pear mycoplasma-like organisms. In Recent Advances in Mycoplasmology. and X-disease in peach after treatment with a tetracycline. Proceedings of the 7th Congress of the International Organization for Phytopathology 61, 904–905. http://ijs.sgmjournals.org 775 R. E. Davis and others

Oshima, K., Kakizawa, S., Nishigawa, H., Jung, H.-Y., Wei, W., Stoddard, E. M. (1934). Progress report on the investigation of a new Suzuki, S., Arashida, R., Nakata, D., Miyata, S. & other authors peach disease. Conn Pomol Soc Proc (1933) (44), 31–36. (2004). Reductive evolution suggested from the complete genome Stoddard, E. M. (1938). The ‘‘X disease’’ of peach. In June 1938 sequence of a plant-pathogenic phytoplasma. Nat Genet 36, 27–29. Circular, vol. 122, pp. 54–60. New Haven: Connecticut Agricultural Pearson, R. C. & Sands, D. C. (1978). Eastern X-disease of peach: Experiment Station. Symptom remission and yield response following yearly injections of Stoddard, E. M., Hildebrand, E. M., Palmiter, D. H. & Parker, K. G. . Plant Disease Reporter 62, 753–757. (1951). X-disease. In Virus Diseases and Other Disorders with Viruslike Prince, J. P., Davis, R. E., Wolf, T. K., Lee, I.-M., Mogen, B. D., Dally, Symptoms of Stone Fruits in North America United States Department E. L., Bertaccini, A., Credi, R. & Barba, M. (1993). Molecular detection of Agriculture Agriculture Handbook, vol. 10, pp. 37–42. Washington: of diverse mycoplasmalike organisms (MLOs) associated with - United States Government Printing Office. vine yellows and their classification with aster yellows, X-disease, and Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007). MEGA4: Molecular yellows MLOs. Phytopathology 83, 1130–1137. Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Rice, R. E. & Jones, R. A. (1972). Leafhopper vectors of the western X- Evol 24, 1596–1599. disease pathogen: collections in central California. Environ Entomol 1, Wei, W., Davis, R. E., Lee, I.-M. & Zhao, Y. (2007). Computer- 726–730. simulated RFLP analysis of 16S rRNA genes: identification of ten new Rosenberger, D. A. & Jones, A. L. (1977). Symptom remission in X- phytoplasma groups. Int J Syst Evol Microbiol 57, 1855–1867. diseased peach trees as affected by date, method, and rate of Zhao, Y., Wei, W., Lee, I.-M., Shao, J., Suo, X. & Davis, R. E. (2009). application of oxytetracycline-HCl. Phytopathology 67, 277–282. Construction of an interactive online phytoplasma classification tool, Sands, D. C. & Walton, G. S. (1975). Tetracycline injections for iPhyClassifier, and its application in analysis of the peach X-disease control of Eastern X-disease and bacterial spot of peach. Plant Disease phytoplasma group (16SrIII). Int J Syst Evol Microbiol 59, 2582– Reporter 59, 573–576. 2593.

776 International Journal of Systematic and Evolutionary Microbiology 63