Diversity of Aster Yellows Phytoplasmas in Lettuce

Home , Acholeplasmataceae, Insertion sequence, Phytoplasma

DIVERSITY OF ASTER YELLOWS PHYTOPLASMAS

IN LETTUCE

Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Jianhua Zhang, B. S.

*****

The Ohio State University 2003

Dissertation Committee: Approved by Dr. Sally A. Miller (adviser) Dr. Saskia A. Hogenhout (co-adviser) Adviser, Department of Plant Pathology Dr. Lowell R. Nault Dr. Terrence L. Graham Co-Adviser, Department of Entomology Dr. Sophien Kamoun

ABSTRACT

Aster yellows is a potentially devastating disease of lettuce, caused by a leafhopper- transmitted phytoplasma. Disease incidence varies in the range of 0-100% from year to year in Ohio lettuce fields. An unknown number of aster yellows phytoplasma strains infect lettuce. Aster yellows phytoplasma strains may be distributed differently in lettuce plants, potentially influencing leafhopper transmission of the pathogen. In this study I used molecular methods and symptom type to characterize several aster yellows phytoplasma strains.

At least five aster yellows phytoplasma strains were identified based on the symptoms they cause in China aster and lettuce. Strain AY-Witches’ broom (AY-WB) caused wilting in lettuce and witches’-broom in aster plants at the late stage of infection.

Aster yellows-Severe (AY-S) caused stunting, clustering and phyllody in aster. AY-

Semi-geotropism (AY-SG) differed from the others by causing semi-geotropism at the late stage of infection in aster and lettuce. Strain Bolt-White (AY-BW) infection resulted in chlorosis of newly emerging leaves and Strain Bolt-Distortion (AY-BD2) resulted in leaf and stem distortion in lettuce, mild symptoms compared to those caused by other strains.

ii Phytoplasmas were detected by polymerase chain reaction seven days before aster yellows symptoms appeared at the growing points of lettuce plants, indicating that aster yellows symptoms are closely related to the presence of phytoplasmas in an organ.

Differences in phytoplasma distribution were found between two aster yellows phytoplasma strains. The phytoplasmas of AY-S strain spread faster and more widely than the AY-BD2 strain in lettuce plants. At the early stage of infection, phytoplasmas were detected first from the midrib of inoculated leaves, then the stems and growing points, but not from the margins of inoculated leaves, suggesting that movement of aster yellows phytoplasmas in the inoculated leaves is mainly unidirectional.

RFLP analysis of PCR products amplified using the 16S rDNA primers F2/R2 indicates that all of the aster yellows phytoplasma strains belong to 16SrI phytoplasma group. AY-WB belongs to the 16SrI-A subgroup whereas the others belong to the 16SrI-

B subgroup. AY-WB can be distinguished easily from the other strains by PCR with strain specific primers BF/BR. AY-WB, AY-S, AY-BW and AY-SS can be distinguished from one another either by PCR-RFLP analysis of AY19P/AY19m-amplified products or by multiplex PCR. Primer typing can be used to differentiate most strains except AY-

BW and AY-SG. Phylogenetic analysis of partial sequences of 16S rRNA gene and 16S-

23S gene spacer regions showed that all aster yellows phytoplasma strains were clustered with most aster yellows phytoplasma sequences obtained from the Genbank database.

Five µg aster yellows phytoplasma chromosomal DNA was isolated from AY-WB using pulse field gel electrophoresis (PFGE). A shotgun library was constructed by

Integrated Genomics (Chicago, IL USA) and the 800 kb genome of AY-WB was sequenced with sequence saturation of 8.6-fold coverage. Sixteen contigs were iii constructed that cover approximately 87.5% of the sequence of the genome. The genome contains approximately 26.9% GC and 67% coding sequences. One contig contains the complete lettuce chloroplast genome with 128,839 bp and 36.5% GC content.

I identified 11 putative transposase-coding regions were found in the near-complete aster yellows phytoplasma AY-WB genome. The length of the putative transposase coding regions ranged from 237 to 963 bp. Inverted repeats (IR) were found for seven of the transposase coding regions and direct repeats (DR) were found in three of the transposase coding regions with IRs. No IR was found overhanging singular ORF coding regions. The putative transposase genes contain 23.4 to 27.4% GC similar to the rest of the phytoplasma genome (26.9%). Phylogenetic analysis suggests that the putative transposase genes in the aster yellows phytoplasma genome are clustered into one clade.

PCR with primers flanking transposase-coding regions amplified DNA fragments only from DNA extracts of aster yellows-symptomatic lettuce and aster yellows phytoplasma- infected leafhoppers, not from the extracts of healthy lettuce and leafhoppers. This suggests that the putative transposase coding sequences were in aster yellows phytoplasma DNA rather than contaminant DNA from lettuce. Amplification of putative transposase coding regions by external primers excludes the possibility of their existence in extrachromosomal elements. PCR analyses show that insertion sequences can be used to detect and separate strains of the aster yellows phytoplasma group.

Dedicated to my mother’s hopes

ACKNOWLEDGMENTS

As I begin to write this section, I am deeply touched by my recollection of the time that I have been studying and working under guidance of my adviser, and working with the professors in the Department of Plant Pathology and Entomology. First of all, I like to take the opportunity to thank my adviser, Dr. Sally A. Miller for giving me the opportunity to study under her guidance. I thank my co-adviser Dr. Saskia Hogenhout for her patience in teaching me molecular techniques. They not only taught me plant pathology, but also English writing skills; their continuous input and advice made it possible for me to complete this research project. The diversity of my SAC members broadened my knowledge in plant pathology; especially in vector-transmitted plant diseases. I should thank Dr. Lowell R. Nault for his genuine ideas on the aspects of entomology, Dr. Terrence L. Graham for his input from the aspect of plant-microbe interactions and Dr. Sophien Kamoun for his suggestions on bioinformatics.

I shall never forget that it was Dr. Terrence L. Graham who signed my extension documents while I was waiting for the decision from graduate schools. Dr. Michael J.

Boehm wrote a strong recommendation letter on behalf of my application. Without their full support and encouragement, I would never have had the chance to be accepted as a graduate student, no to mention to reach my academic goal.

vi My sincere appreciation is expressed to Mr. Ian Holford, Mr. Xiaodong Bai, Dr.

Laurence V. Madden, Dr. Brian McSpadden-Gardener, Dr. Trudy Torto and Dr. Walid

Hamada for their help in lab techniques. I should thank Ms. Melanie Ivey, Ms. Shujing

Dong, Ms. Kristen Willie, Ms. Joanne Hershberger, Ms. Helga Beke, Ms. Lynn West,

Ms. Leedy Laurel, Ms. Angie Strock, Mr. Jhony Mera, Mr. Bill Styer, Mr. Bob James and the greenhouse crew for their technical support. Without their help, it would have been impossible for me to finish my research in time. My appreciation is also extended to

Dr. Randy Rowe for his leadership of this department towards academic excellence.

Finally, I thank my wife Qiuzhen Tong for her endurance and love.

vii

VITA

1979 ...... B. S. in agronomy, Shandong Agriculture University, P. R. China

1979 – 1982 ...... Assistant researcher, Corn Research Institute, Shandong Academy of Agriculture Sciences

1983 –1985 ...... Associate researcher in agronomy Shandong Academy of Agriculture Sciences.

1986 –1988 ...... Visiting scientist in The University of Sydney, Sydney, Australia.

1992 – 1995 ...... Associate professor in agronomy Shandong Academy of Agriculture Sciences.

1995 – 1996 ...... Visiting scientist in The Ohio State University

1997 –1998 ...... Research assistant in The Ohio State University

1998—2003 ……………………… Ph D. student in plant pathology in The Ohio State University

viii

PUBLICATIONS

Selected research publication after 1991

1 J. Zhang et al. “Effect of mineral ions on seedling growth before the third leaf stage in maize.” J. Soil & Fertilizer, 1,32-35 (1992).

2 J. Zhang, et al. “Effect of plant regulator C150B on malt.” Barley Science 4. (1993).

3 J. Zhang et al. Variety identification in maize and sweet potato by electrophoresis. J. Plant Biology 3(1993)

4 J. Zhang, et al. “Peroxidase electrophoretogram coding and variety identification in maize”. Acta Agronomica Sinica (1995).

5 J. Zhang et al. “Light, dry matter accumulation and distribution in the population of different plant type varieties” J. Plant Biology 3(1). (1993).

6 J. Zhang et al. “Quantitative selection for compact high-yielding maize hybrids.” J. Agric. Sci. 125, 39- (1995).

7 J. Zhang, M. B. McDonald and P. M. Sweeney, "Soybean cultivar identification using RAPD." Seed Sci. & Technol., 24, 589-592 (1996).

8 J. Zhang, M. B. McDonald and P. M. Sweeney, "Random amplified polymorphic DNA (RAPDs) from seed of differing soybean and maize genotypes." Seed Sci. & Technol., 24, 513-522 (1996).

9 J. Marcos-Filho, M. B. McDonald, D. M. TeKrony and J, Zhang, " RAPD fragment profiles from deteriorating soybean seeds." Seed Technology, 19, 34-44 (1997).

10 J. Zhang, M. B. McDonald P. M. Sweeney, " Testing for genetic purity in petunia and cyclamen seed using random amplified polymorphic DNA markers." HortScience 32(2), 246-247 (1997).

11 J. Zhang, M. B. McDonald, " The saturated salt accelerated aging test for small- seeded crops." Seed Sci. & Technol. 25, 123-131 (1997).

ix 12 J. Zhang, S.A. Hogenhout and S.A. Miller, “Isolation of aster yellows phytoplasma genomic DNA from lettuce.” Phytopathology 91, S99 (2001).

13 S. A. Miller, J. Zhang, C.W. Hoy and L.R. Nault, “Monitoring aster yellows infectivity in leafhoppers during the vegetable growing season by the polymerase chain reaction” Phytopathology 87, S66 (1997).

14 J. Zhang, S.A. Miller, C. Hoy, X. Zhou, and L. Nault, “A rapid method for detection and differentiation of aster-yellows phytoplasma infected and inoculative leafhoppers.” Phytopathology (abstr.) 88, S84 (1998).

15 J. Zhang, S. A. Miller , L Nault, C. Hoy and S. Hogenhout, “Mapping the distribution of two strains of aster yellows phytoplasma in lettuce” Phytopathology 92 (2002).

16 F. Sahin, P. A. Abbasi, M. L. Lewis, J. Zhang and S. A. Miller. Diversity among strains of Xanthomons campestris pv. vitians from lettuce. Phytopathology. 93(1):64-70 (2003).

FIELD OF STUDY

Major Field: Plant Pathology

TABLE OF CONTENTS

Page

Abstract ...... ii Dedication…………………………………………………………………….. v Acknowledgments ...... vi Vita ...... viii List of Tables ...... xiii List of Figures ...... xiv

Prologue………………………………………………………………………. 1

Chapter 1 Identification of aster yellows phytoplasma strains in lettuce based on symptoms and molecular techniques

Introduction …………………………………………………………... 18 Materials and Methods………………………………………………... 22 Results……………………………………………………………….… 29 Discussion ……………………………………………………………. 37 Summary ……………………………………………………………… 42

Chapter 2 Characterization of phytoplasma distribution within lettuce

Introduction …………………………………………………………… 73 Materials and Methods………………………………………………… 76

Results…………………………………………………………………. 79 Discussion……………………………………………………………... 82 Summary………………………………………………………………. 85

Chapter 3. Characterization of aster yellows phytoplasma strain AY-WB and sequencing of its 800 kb genome

Introduction …………………………………………………………… 97 xi Materials and Methods………………………………………………… 99 Results…………………………………………………………………. 107 Discussion……………………………………………………………… 112 Summary……………………………………………………………….. 115

Chapter 4. Transposase genes of the aster yellows phytoplasma genome

Introduction …………………………………………………………… 128 Materials and Methods………………………………………………… 130 Results and Discussion………………………………………………… 133 Summary…………………………………………………………….…. 138

Bibliography…………………………………………………………………… 161

xii

LIST OF TABLES

Table Page

1.1 16S rRNA gene sequences from Genbank database used in the phylogenetic analysis………………………………………………….. 69

1.2 16-23S spacer region sequences from Genbank database used in the phylogenetic analysis………………………………………………….. 70

1.3 Primer-typing of aster yellows phytoplasma strains collected from lettuce……………………………………………………….…… 71

1.4 Aster yellows symptoms caused by different aster yellows phytoplasma strains in lettuce and aster plants………………………... 72

2.1 Aster yellows phytoplasmas AY-S and AY-BD2 detected at different positions of inoculated leaves with polymerase chain reaction with primers F4/R1…………………………………………… 96

3.1 Sequence results derived from aster yellows phytoplasma AY-WB shotgun library…………………………………………………………. 126

3.2 Contigs containing sequences of the AY-WB 800 kb genome..……… 127

4.1 Primers for detection of putative transposase coding regions in aster yellows phytoplasmas……………………………………………. 158

4.2 Possible inverted repeats (IR) and direct repeats (DR) flanking putative transposase coding regions in aster yellows phytoplasma AY-WB………………………………………………………………… 159

4.3 Polymerase chain reaction (PCR) detection of putative transposase coding regions in phytoplasmas..………………………………………. 160

xiii

LIST OF FIGURES

Figure Page

1.1 Polymerase chain reaction-restriction fragment length polymorphism banding patterns of aster yellows phytoplasma isolates before and after the strain purification processes ……………………………….………. 48

1.2 Symptoms caused by aster yellows phytoplasma AY-WB in China aster.…………………………………………………………….. 49

1.3 Average height and standard error of the mean for aster yellows phytoplasma-infected and healthy aster plants………………………… 50

1.4 Average length and standard error of the mean for internodes of healthy aster plants and aster plants infected by aster yellows phytoplasma strain AY-WB at the 20-expanded leaf stage………..…. 51

1.5 Symptoms caused by aster yellows phytoplasma strain AY-WB in lettuce………………………………………………………………... 52

1.6 Ooze caused by aster yellows phytoplasma infection in lettuce ……… 53

1.7 Symptoms caused by aster yellows phytoplasma strain AY-S in China aster.…………………………………………………………….. 54

1.8 Symptoms caused by aster yellows phytoplasma strain AY-S in lettuce…………………………………………………………………... 55

1.9 Symptoms caused by aster yellows phytoplasma strain AY-SG in China aster……………………………………………………………… 56

1.10 Symptoms caused by aster yellows phytoplasma strain AY-SG in lettuce……………………………………………………………….. 57

1.11 Symptoms caused by aster yellows phytoplasma AY-BW in China aster……………………………………………………………… 58

xiv 1.12 Symptoms caused by aster yellows phytoplasma strain AY-BW in lettuce……………………………………………………………….. 59

1.13 Symptoms caused by aster yellows phytoplasma strain AY-BD2 in China aster.……………………………………………………………. 60

1.14 Symptoms caused by aster yellows phytoplasma strain AY-BD2 in lettuce. ………………………………………………………………… 61

1.15 Restriction fragment length polymorphism analysis of aster yellows phytoplasma 16S rDNA amplified by polymerase china reaction using the primers F2/R2. …………………………………….. 62

1.16 Heteroduplex mobility analysis of closely related aster yellows phytoplasma strains…………………………………………………… 63

1.17 Aster yellows phytoplasma strain identification by multiplex PCR using pooled primers S1/S2, 15F/15R, BWF/BWR and 21F/21R……. 65

1.18 Polymerase chain reaction using aster yellows phytoplasma AY-WB strain-specific primers BF/BR…………………………….… 65

1.19 Phylogenetic analysis of the 16S rRNA gene partial sequence of aster yellows phytoplasmas………………………………………………… 66

1.20 Phylogenetic analysis of the sequences of the 16S-23S gene spacer region of aster yellows phytoplasmas……..………………………….. 67

1.21 Symptoms caused by aster yellows phytoplasma strain AY-WB In aster inoculated before the flowering stage………………………… 68

2.1 Method of inoculation of lettuce with aster yellows phytoplasmas using inoculative leafhoppers (Macrosteles quadrilineatus Forbes)….. 91

2.2 Schematic representation of a sliding window method of calculating aster yellows movement in lettuce superimposed on a gel image…….. 92

2.3 Aster yellows-positive leaves detected by polymerase chain reaction in two sections around the stem of lettuce plants..…..………………. 93

2.4 Distribution of aster yellows phytoplasmas detected by polymerase chain reaction using primers F4/R1, within a lettuce plants infected by strain AY-BD2 …………………………………….……. 94

2.5 Phytoplasma distribution detected by polymerase chain reaction xv using primers F4/R1 within a lettuce plant infected by AY-S….……. 95

3.1 Polymerase chain reaction-restriction fragment length polymorphism analysis demonstrating that aster yellows phytoplasma AY-WB belongs to the16SrI-A subgroup.……………………………….…….. 122

3.2 Symptoms in lettuce and aster caused by aster yellows phytoplasma AY-WB ………....……………………………………………………. 123

3.3 Pulse field gel showing the 800 kb chromosome of AY-WB ………... 124

3.4 Phylogenetic analysis of tuf gene sequences of various aster yellows phytoplasma strains and apple proliferation phytoplasma……………. 125

4.1 Primers for detection of putative transposase coding regions in aster yellows phytoplasmas…………………………………………… 145

4.2 A frameshifting structure in putative transposase coding region AYP316-315 of aster yellows phytoplasma AY-WB genome………… 147

4.3 A frameshifting structure in putative transposase coding region AYP166-165 in aster yellows phytoplasma AY-WB genome…………. 148

4.4 Putative transposase gene fragments amplified by polymerase chain reaction from DNA extracts of lettuce infected by aster yellows phytoplasma strains……………………………………………………. 149

4.5 Putative transposase gene fragments amplified by polymerase chain reaction from DNA extracts of leafhoppers infected by aster yellows phytoplasma strains……………………………………………………. 151

4.6 A boxplot of GC contents of transposase genes in the genome of various organism genomes with different GC contents…………….. 152

4.7 Sequence alignment of putative transposase coding regions in the genome of aster yellows phytoplasma AY-WB………………… 153

4.8 Phylogenetic analysis of putative transposase coding regions in the aster yellows phytoplasma AY-WB genome………………………….. 157

xvi

PROLOGUE

Lettuce (Lactuca sativa) is an important vegetable crop in the United States.

According to the USDA Economic Research Service, the total U.S. lettuce production was 4.4 million tons (114,506 hectares) in 2000 and 4.6 million tons (123,510 hectares) in 2001. Most lettuce is produced for domestic markets. The farm value of lettuce production in the United States was $1.87 billion in 2000 and $1.91 billion in 2001.

However, lettuce production is often threatened by disease epidemics. Aster yellows is a potentially devastating diseases of lettuce, known for its irregular infection rate, varying from 0−100% in the same region from year to year (Howard et al. 1994; Peterson 1973).

The causal agent is a phytoplasma, previously known as a mycoplasmalike organism or

MLO.

Smith first described aster yellows as a plant disease in 1902 (Smith 1902). He recorded asymmetric symptom development in aster plants prior to symptom spread throughout the whole plant. Kunkel systematically studied aster yellows symptom development in infected China aster and the factors contributing to transmission of the disease. He pointed out that the main characteristic of the disease in China aster was stunting, varying with the age of the plant at the time of infection and with the size of the infected section. The leaf petioles, however, became abnormally upright and elongated in

infected plants. He also identified the vector species, incubation period in the vector and its overwintering niches (Kunkel 1924, 1925, 1926). At that time, all yellows-type plant diseases were presumed to be caused by viruses (Kunkel 1957; Littau and Maramorosch

1960; Maramorosch 1952) since the causal agents shared many characteristics with viruses. These included transmission by grafting and insect vectors, especially leafhoppers, and the ability to pass through bacteria-proof filters. Identification was mainly based on host symptoms, host range and vector species (Freitag et al. 1959;

Kunkel 1955).

The identity of the aster yellows causal agent was unknown until 1967 when Doi et al. (1967) demonstrated by electron microscopy that it actually was a cell wall-less microorganism designated as a mycoplasmalike organism (MLO) based upon its ultrastructural morphology, which was similar to mycoplasmas that infect animals. In addition, the antibiotic tetracycline was used either for control or diagnosis of the disease based on the disappearance of symptoms after treatment (Ishiie et al. 1967; Lee and

Davis 1992). The phytoplasmal cells are about 0.2-1.0 µm in diameter. Spherical and sometimes, helical forms have been reported (Lee and Davis 1992; Lee et al. 2000).

Jacoli (Jacoli 1978 a, b) observed morphological changes and degeneration of MLO cells during the process of infection. The spherical forms were observed about 10 days after infection, filamentous forms about 30 days after infection and other unusual structures at late stages of infection in cultured explants. Doi’s discovery of MLOs marked the beginning of a new era in the study of phytoplasmas. From the 1970s to early the 80s, many studies were conducted utilizing electron microscopy for phytoplasma detection. 2

(Chen 1978; Hiruki and Dijkstra 1973; Hirumi and Maramorosch 1973; Jacoli et al.

1974, 1981; Thomas and Norri 1980). However, electron microscopy is technically complex and can not be used to distinguish phytoplasma species due to their morphological similarity and pleomorphic features. Fluorescent microscopy was also used for phytoplasma detection (Godszdziewski and Petzold 1975). Both methods are time-consuming and expensive. Dienes' Stain was developed as an indirect method for diagnosis of phytoplasma infection (Deeley et al. 1979), but the sensitivity of this method is relatively low.

Phytoplasmas inhabit host phloem and have not yet been cultured in vitro despite many attempts. Inability to culture phytoplasmas hinder their identification and classification. (Jacoli 1981; Eden-Green 1982; McCoy 1976, 1977; Nasu et al. 1974; Lee

1986). Thus, alternative methods using molecular markers have been developed.

Polyclonal and monoclonal antibodies were amongst the earliest molecular probes used for phytoplasma detection (Bonnet et al. 1990; Chen et al. 1992 a, b; Clark et al. 1989;

Davis et al. 1988; Lee and Davis 1992), usually in enzyme-linked immunosorbent assays

(ELISA). However, polyclonal antisera often have low specific titers and high background reactions with plant tissue, and thus are not useful for phytoplasma detection and differentiation. Monoclonal antibodies overcome the problem and are very useful in phytoplasma identification (Lee and Davis 1992). The polymerase chain reaction assay

(PCR) became the tool of choice for phytoplasma detection beginning in the early 1990s and is generally highly sensitive and specific. Universal primers have been developed

based on the sequences of conserved genes, such as the 16S rRNA gene, for detection of most phytoplasma species (Ahrens et al. 1992, 1993, 1994; Davis and Lee 1993; Lee et al. 1995).

Phytoplasmas belong to the Class Mollicutes, which contains only the order

Mycoplasmatales. The order includes three families with each family having one genus.

Mycoplasmataceae contains Mycoplasma; Acholeplasmataceae contains Achole-plasma and Spiroplasmataceae contains Spiroplasma. Phytoplasmas were found to be more closely related to Acholeplasma than to mycoplasmas based on sequence comparisons of a few conserved genes (Agrios 1997; Lim and Sears 1989, 1992; Kuske and Kirkpatrick

1992; Namba et al. 1993; Schneider et al. 1993; Gundersen et al. 1994). In 1992, the term MLO was replaced by ‘phytoplasma’ to characterize it as a plant pathogen (Sears and Kirkpatrick 1992). The characterization of new species of bacteria often requires

DNA sequence homology studies for comparison to other species. Since phytoplasmas have not been cultured, this is not yet possible. Southern hybridization with probes made from cloned phytoplasmal DNA fragments was used to identify phytoplasma groups

(Griffiths et al. 1994; Ko and Lin 1994; Kollar and Seemüler 1989). Lee et al. (1992) distinguished aster yellows phytoplasma strains by using a set of cloned DNA probes in

RFLP analysis. Later, they classified 40 phytoplasmas into nine 16S rDNA groups and

14 subgroups. This classification procedure was adapted by the International Research

Program of Comparative Mycoplasmology (Harrison 2001). A temporary taxonomic system was applied to phytoplasmas − Candidatus, which is arbitrarily given, based on

16S rDNA sequence comparison (Murray and Schleifer 1994; Zreik et al. 1995; Davis et 4

al. 1997; White et al. 1998; Griffiths et al. 1999; Montano et al. 2001). The number of phytoplasma 16S ribosomal groups has been expanded to fifteen and new groups are continually being added to the list (Gundersen et al. 1994). This classification method depends on the restriction enzymes used and some groups differ only in one restriction site. To overcome this limitation, other relatively less conserved genes were used as references in the classification, such as the tuf gene coding for the elongation factor and the ribosomal protein gene (rp). Currently, DNA sequence comparisons are being used in phytoplasma systematics (Lee et al. 1993; Liefting et al. 1996; Ahrens et al. 1994;

Schneider et al. 1997).

These new detection and classification technologies speed up the process of discovery of new phytoplasma species. Phytoplasmas have been found to cause diseases in hundreds of plant species and additional hosts continue to be discovered (Hwang et al.

1997). Aster yellows symptom diversity in nature can be caused by different strains or by dual infection (Alma et al. 1996; Lee et al. 1994). Dual infection complicates identification of aster yellows strains based on symptoms as well as classification using molecular markers (Kunkel 1955; Alma et al. 1996; Bianco et al. 1993; Gundersen et al.

1994). Thus, phytoplasma purification is essential before strain characterization. In addition, the development of specific molecular markers relies on preliminary isolation and purification of phytoplasma cell components such as DNA or proteins. A phytoplasma enrichment method using gradient centrifugation was developed (Jiang and

Chen 1987; Kollar and Seemüler 1989; Kollar et al. 1990) for serological and DNA based detection (Sinha 1974, 1979, 1983; Sears et al. 1989). Neimark and Kirkpatrick 5

(1993) used pulse field gel electrophoresis (PFGE) for genome size determination. The results indicate that phytoplasma genomes varied from 6401185 kb. PFGE was also used for aster yellows phytoplasma DNA isolation for genomic DNA library construction

(Zhang et al. 2001).

Despite the advantage of molecular identification over symptomatological identification in diseases caused by phytoplasmas, host symptom, host range and vector species identification are still commonly used in phytoplasmal disease diagnosis and strains identification simply due to their simplicity. Probably, most phytoplasmas are collected based on the symptoms of their hosts (Chiykowski 1991; Chiykowski and

Sinha 1989; Shiomi and Sugiura 1984). In addition, the traditional identification methods have practical means in agriculture because two close related phytoplasma species based on a molecular marker may have different host ranges. In contrast, distantly related phytoplasmas may cause similar symptoms in a host.

Although aster yellows is a potentially devastating disease of lettuce in Ohio, a systematic investigation of aster yellows phytoplasma strain diversity has not been conducted. Aster leafhoppers, the principal aster yellows vector, overwinter as eggs in winter cover crops in Ohio, but aster yellows phytoplasma is not transmitted by infected females to their offspring. Disease epidemics in vegetable production areas in Ohio are caused by immigrating aster yellows phytoplasma-infected leafhoppers from southern states in early spring (Hoy et al. 1992; Murral et al. 1996). Several questions remain in understanding the spread of this disease: 1) How many aster yellows strains or 6

phytoplasmas species infect lettuce in Ohio? 2) What kinds of symptoms do they produce? 3) What are their phylogenetic relationships to previously reported aster yellows phytoplasmas? 4) Do different phytoplasmas strains distribute differently within lettuce plants? To explore the answers to these questions became the objectives of the first part of our research.

Although aster yellows symptoms are commonly considered a result of abnormal hormone levels caused by phytoplasma infection (Lee and Davis 1992; Chang 1998), it is still unclear why different strains cause different symptoms, what decides phytoplasma host specificity and which genes are related to aster yellows phytoplasma pathogenicity.

Genome comparison may provide important clues for these questions. Genomes of a few microorganisms in the Class Mollicutes have been sequenced. The significance of these studies is that the mollicutes are important pathogens of animals or plants and their genomes are relatively small, thus, genome sequencing may elucidate the minimal genes required for self-replicating organisms. The genomes that have been completely sequenced range from 580,073 to 963, 879 bp and the GC contents in the genomes range from 25.5% to 40.01%. In mycoplasmas, over 90% of the genome sequences are coding sequences. However, spiroplasmas have significantly lower gene densities (60% on average). The number of rRNA gene operons also differs among the members of

Mollicutes. In M. pulmonis, M. genitalium, M. capricolum and M. pneumoniae (Sawada et al. 1981; Fraser et al. 1995; Himmelreich et al. 1996) a single rRNA gene operon was found in which no tRNA gene was present between the 16S and 23S rRNA genes. But most phytoplasma species (Schneider and Seemüller 1994) and Ureaplasma urealyticum 7

(Glass et al. 2000) contain two copies of rRNA operons. Among other genes, heat shock protein chaperonins GroEL and GroES were discovered in M. pneumoniae and M. genitalium but not in U. urealyticum. Transposable elements were reported in a number of organisms including the genomes of the mollicutes (Oshima et al. 2002; Zheng and

McIntosh 1995; Chambaud et al. 2001), which can cause gene deletion, insertion and inversion.

My hypothesis was that genome comparison between the aster yellows phytoplasma strains could lead to discovery of candidate genes that result in symptom differences and

DNA regions that could be used for strain differentiation. Furthermore, the comparison among phytoplasma species might provide information about the genes involved in host specificity and the comparison between virulent and avirulent phytoplasma strains might provide information of candidate genes for pathogenicity (Oshima et al. 2002). The diversity of aster yellows phytoplasma genome might be due to sequence insertion, deletion and reversion resulting from transposition. Thus, the objectives of the second part of my research were: 1) isolating DNA of sufficient purity and quantity to allow sequencing of the aster yellows phytoplasma AY-WB genome and annotation of the gene functions; and 2) investigating existence of transposase genes within aster yellows phytoplasma genomes.

REFERENCES

Agrios, G. N. 1997. Plant disease caused by mollecultes: phytoplasmas and spiroplasmas (In) Plant Pathology. Acad. Press. San Diego. pp.457-470.

Ahrens, U., Lorenz, K-H., Kison, H., Berges, R., Schneider, B. and Seemüller, E. 1994. Universal cluster-specific, and pathogen-specific PCR amplification of 16S rDNA for detection and identification of mycoplasmalike organisms. IOM letters. 3:250.

Ahrens, U., Lorenz, K-H. and Seemüller, E. 1993. Genetic diversity among mycoplasmalike organisms associated with stone fruit diseases. Mol. Plant-Mcrobe Interaction. 6:686-691.

Ahrens, U. and Seemüller, E. 1992. Detection of DNA of plant pathogenic mycoplasmalike organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene. Phytopathology 82:828-832.

Alma, A., Davis, R. E., Vibio, M., Danieli, A., Bosco, D., Arzone, A. and Bertaccini, A. 1996. Mixed infection of grapevines in northern Italy by phytoplasmas including 16S rRNA RFLP subgroup 16SrI-B strains previously unreported in this host. Plant Dis. 80:418-421.

Bianco, P. A., Davis, R. E., Prince, J. P., Lee, I-M. and Belli, G. U. 1993. Double and single infections by aster yellows and elm yellows MLOs in grapevines with symptoms characteristic of flavescence doree. Riv, Patol. Veg. 3:69-82.

Bonnet, F., Saillard, C. Kollar, A. Seemüller, E. and Dosba, F. 1990. Molecular probes for the apple proliferation MLO. Zentralbl. Bakteriol. Suppl. 20:908-909.

Doi, Y. M., Teranaka, M., Yora, K. and Asuyama, H. 1967. Mycoplasma or PLT-group- like microorganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches’ broom, aster yellows, or paulownia witches’ broom. Ann. Phytopathology Soc. Jpn. 33:259-266.

Chambaud, I., Heilig, R., Stephane, R., Barbe, V., Samson, D., Galisson, F., Moszer, I., Dybvig, K., Wóblewski, H., Viari, A., Rocha, E. P. C. and Blanchard A. 2001. The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis. Nucleic Acids Res. 29: 2145-2153.

Chang, C. J. 1998. Pathogenicity of aster yellows phytoplasma and Spiroplasma Citri on periwinkle. Phytopathology 88:1347-1340.

Chen, J. C., Chang, C. J., Jarret, R. and Gawel, N. 1992. Isolation and cloning of DNA fragments from mycoplasmalike organism associated with walnut witches’- broom disease. Phytopathology 82:306-309.

Chen, M. 1978. Electron-microscope observations of several plant-infecting mycoplasma-like organisms. (In) Plant diseases due to mycoplasma-like organisms. Compiled by Food and Fertilizer Technology Center for the Asian and Pacific Region. 13-19.

Chen T-A., Lei, J. D. and Lin, C. P. 1992. Detection and identification of plant and insect mollicutes. (In) The mycoplasmas (ed.) Whitcomb, R. F., Tully, J .G. 5:393-424. New York: Academic.

Chiykowski, L. N. 1991. Vector-pathogen-host plant relationships of clover phyllody mycoplasmalike organism and the vector leafhopper Paraphlepsius irroratus. Can. J. Plant Pathol. 13:11-18.

Chiykowski, L. N. and Sinha R. C. 1989. Differentiation of MLO disease by means of symptomatology and vector transmission. Zentralbl. Bakterol. Hyg. Suppl. 20: 280-287.

Clark, M. F., Morton, A. and Buss, S. L. 1989. Preparation of MLO immunogens form plants and a comparison of polyclonal and monoclonal antibodies made against primula yellows MLO-associated antigens. Ann. Appl. Biol. 114:111-124.

Davis, M. J., Tsai, J. H., Cox, R. L., MaDaniel, L. L. and Harrison, N. A. 1988. Cloning of chromosomal and extrachromosomal DNA of the mycoplasma-like organism that causes maize bushy stunt disease. Mol. Plant Microbe Interact. 1:295-302.

Davis, R. E., Dally, E. L., Bertaccini, A., Lee, I-M. and Credi, R. C. 1993. Restriction fragment length polymorphism analyses and dot hybridization distinguish mycoplasma-like organisms associated with flavescence doree and southern European grapevine yellows disease in Italy. Phytopathology 83:772-776.

Davis, R. E., Dally, E. L., Gundersen, D. E., Lee, I-M. and Habili, N. 1997. Candidatus Phytoplasma australiense, a new phytoplasma taxon associated with Australian grapevine yellows. Int. J. Syst. Bacteriol. 47:262-269.

Davis, R. E. and Lee, I-M. 1993. Cluster-specific polymerase chain reaction amplification of 16S rDNA sequences for detection and identification of mycoplasmalike organisms. Phytopathology 83:1008-1011.

Davis, R. E., Lee, I-M., Douglas, S. M. and Dally, E. L. 1990. Molecular cloning and detection of chromosomal and extrachromsomal DNA of the mycoplasmalike organism (MLO) associated with little leaf disease in periwinkle (Catharanthus roseus). Phytopathology 80:789-793.

Deeley, J., Stevens, W. A., and Fox, R. T. V. 1979 Use of Dienes' stain to detect plant diseases induced by mycoplasmalike organisms. Phytopathology 69:1169-1171.

Deng, S. and Hiruki, C. 1990. Enhanced detection of a plant pathogenic mycoplasma-like organism by polymerase chain reaction. Proc. Japanese Acad. 66:140-144.

Doi Y., Teranaka, M., Yora, K. and Asuyama, H. 1967. Mycoplasma or PLT-group-like microorganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches’ broom, aster yellows, or paulownia witches’ broom. Ann. Phytopathology Soc. Japan 33:259-266 (in Japanese with English summary).

Eden-Green, S. J. 1982. Culture of other microorganisms from yellows-diseased plants. (In) Plant and insect mycoplasma techniques. (Ed.) M.J. Daniels, P.G. Markham, Book, London Croom Helm. pp. 201-239.

Fraser, C. M., Gocayne, J. D. and White, O. et al. 1995. The minimal gene complement of Mycoplasma genitalium. Science 270: 397-403.

Firrao, G. and Locci, R. 1993. Rapid preparation of DNA from phytopathogenic mycoplasma-like organisms for polymerase chain reaction analysis. Letters in Appl. Microbiol. 17:280-281.

Glass, J. I., Lefkowitz, E. J., Glass, J. S., Heiner, C. R. Chen, E. Y. and Cassell G. H. 2000. The complete sequence of the mucosal pathogen Ureaplasma urealyticum. Nature. 407: 757-762.

Griffiths, H. M., Sinclair, W. A., Smart, C. D. and Davis, R. E. 1999. The phytoplasma associated with ash yellows and lilac witches’broom: Candidatus Phytoplasma fraxini. Int. J. Syst. Bacteriol. 49:1605-1614.

Gundersen, D. E. and Lee, I-M. 1995. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathology Mediterr. 35:144-151.

Gundersen, D. E., Lee, I-M., Rehner, S. A., Davis, R. E. and Kingsbury, D. T. 1994. Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification. J. Bacteriol. 176: 5244-5254.

Harrison, N. A. 2001. Phytoplasma taxonomy. First internet conference on phytopathogenic Mollicutes. http://www.uniud.it/phytoplasma/pap/harr1810.html 11

Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B-C. and Herrmann, R. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24: 4420-4449.

Hiruki, C. and Dijkstra, J. 1973. Light and electron microscopy of vinca plants infected with mycoplasma-like bodies of the sandal spike disease. 2nd Int. Cong. Plant Pathol. Abstract, 640.

Hirumi, H. and Maramorosch, K. 1973 (a). Intracytoplasmic mycoplasmalike bodies in phloem parenchyma cells of aster yellow-infected Nicotiana rustica. Phytopathology Z. 77:71-83.

Hirumi, H. and Maramorosch, K. 1973(b). Ultrastructure of the aster yellows agent: mycoplasmalike bodies in sieve-tube elements of Nicotina rustica. Ann. N.Y. Acad. Sci. 225:201-222.

Howard, R. J., Garland, A. J. and Seaman, L.W. 1994. Diseases and pests of vegetable crops in Canada. The Canadian Phytopathology Society and the Entomol. Soc. Canada. pp. 144-157.

Hoy, C. W., Heady, S. E. and Koch, T. A. 1992. Species comparison, phenology, and possible origins of leafhoppers (Cicadellidae) in Ohio vegetable crops. Hort. Entomol. 85: 2336-2343.

Hwang, S. F., Chang K. F., Howard, R. J., Khadhair, A. H., Gaudiel, R. G. and Hiruki, C. 1997. First report of a yellows phytoplasma disease in purple cornflower (Echinacea spp.) in Canada. J. Plant Dis. and Protection, 104:182-192.

Ishiie, T., Doi, Y., Yora, K. and Asuyama, H. 1967. Suppressive effects of antibiotics of tetracycline group on symptom development of mulberry dwarf disease. Ann. Phytopathology Soc. Jpn. 33:267-275.

Jacoli, G. G. 1981. Attempts to culture in vitro mycoplasma-like organisms from plants. Phytopathology Z.102:148-152.

Jacoli, G. G. 1978 (a). Early phases of degeneration of mycoplasma-like bodies in plant tissue cultures infected with Mycoplasma hominis. Can. Microbiol. 24:1053- 1057.

Jacoli, G. G.1978 (b). Sequential degeneration of mycoplasma-like bodies in plant tissue cultures infected with aster yellows. Can. J. Bot. 56:133-140.

Jacoli, G. G. and Ronald, W. P.1974. Electron microscopic studies of plant tissue cultures infected with aster yellows disease. J. Ultrastruc. Res. 46:34-42. 12

Jiang, Y. P and Chen, T. A. 1987. Purification of mycoplasmalike organisms from lettuce with aster yellows disease. Phytopathology 77:949-953.

Khadhair, A. H., Kaw Chuk, L. M., Taillon, R. C. and Botar, G. 1998. Detection and molecular characterization of aster yellows phytoplasma in parsley. Can. J. Plant Pathology 20:55-61.

Ko, H. C. and Lin, C. P. 1994. Development and application of cloned DNA probes for a mycoplasmalike organism associated with sweet potato witches’-broom. Phytopathology 84:468-473.

Kollar, A. and Seemüler, E. 1989. Base composition of the DNA of mycoplasma-like organisms associated with various plant diseases. Phytoplathol. Z. 127:177-186.

Kollar, A., Seemüller, E., Bonnet, F., Saillard, C. and Bove, J. M. 1990. Isolation of the DNA of various plant pathogenic mycoplasmaike organisms from infected plants. Phytopathology 80:233-237.

Kunkel, L. O. 1924. Insect transmission of aster yellows. (Abs.) Phytopathology 14:54.

Kunkel, L. O. 1925. Insect transmission and host range of aster yellows. (Abs.) Science. 62:524.

Kunkel, L. O. 1926. Studies on aster yellows. Am. J. Bot. 13: 646-705.

Kunkel, L. O. 1955. Cross-protection between strains of yellows type virus. Adv. Virus. Res. 3:251-273.

Kunkel, L. O. 1957. Acquired immunity to infection by strains of aster yellows virus in aster leafhopper. Science 126:1233.

Kuske, C. R. and Kirkpatrick, B. C. 1992. Phylogenetic relationships between the western aster yellows mycoplasmalike organisms and other prokaryotes established by 16S rRNA gene sequence. Int. J. Syst. Bacteriol. 42:226-233.

Lee, I-M., Bertaccini, A. Vibio, M. and Gundersen, D. E. 1995. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85:728-735.

Lee, I-M., Davis, R. E., Chen, T-A., Chiykoshi, L. N. and Fletcher, J. 1992. A genotype- based system for identification and classification of mycoplasmalike organisms (MLOs) in the aster yellows MLO strain cluster. Phytopathology 82:977-986.

Lee, I-M., Davis, R. E. and Gundersen-Rindal, D. E. 2000. Phytoplasma: Phytopathogenic mollicutes. Ann. Rev. Microbiol. 54:221-255.

Lee I-M. and Davis, R. E. 1992. Mycoplasmas which infect plants and insects. (In) Mycoplasmas: Molecular Biology and Pathogenesis, ed. J. Maniloff, R. N. McElhansey, L.R. Finch and J.B. Baseman. pp. 379-390. Washington, DC. Am. Soc. Microbiol.

Lee, I-M., Hammond, R.W., Davis, R. E. and Gunderson, D. E. 1993. Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology 83:834-842.

Lee I-M., Gundersen, D. E., Hammond, R.W., Davis, R. E.1994. Use of mycoplasmalike organism (MLO) group-specific oligotide primers for nested-PCR assays to detect mixed-MLO infections in a single host plants. Phytopathology 84:559-566.

Liefting, L.W., Andersen, M. T., Beever, R. E. and Gardner, R. C. 1996. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma. Appl. Environ. Microbiol. 62:3133-3139.

Lim, P.O. and Sears, B.B. 1989. 16S rRNA sequence indicates that plant-pathogenic mycoplasmalike organisms are evolutionarily distinct from animal mycoplasmas. J. Bacteriol. 171:5901-5906.

Lim, P. O. and Sears, B. B. 1992. Evolutionary relationships of a plant-pathogenic mycoplasmalike organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences. J. Bacteriol. 174:2606-2611.

Littau, V. C. and Maramorosch, K. 1960. A study of the cytological effects of aster- yellows virus on its insect vector. Virology. 10:483-500.

Maramorosch, K. 1952. Studies on the nature of the specific transmission of aster- yellows and corn-stunt viruses. Phytopathology 42:663-668.

Marcone, C., Lee, I-M., Davis, R. E., Ragozzino, A. and Seemüller, E. 2000. Classification of aster yellows-group phytoplasmas based on combined analyses of rRNA and tuf gene sequences. Int. J. Syst. Evolutionary Microbiol. 50:1703- 1713.

McCoy, R. E. 1976. Plant phloem sap: a potential mycoplasma growth medium. Proc. Soc. Gen. Microbiol. 3:155(Abstr.).

McCoy, R. E. 1977. Growth of mycoplasmas in phloem sap from lethal yellowing resistant Malayan dwarf coconut palm. Proc. Am. Phytoathol. Soc. 4:108(Abstr.).

Mitsuhashi, J. 1979. Artificial rearing and aseptic rearing of leafhopper vectors: Applications in virus and MLO research. (In) Leafhopper Vectors and Plant Disease Agents. Maramorosch, K. and Harris, K. F. (Ed). pp. 369-412.

Monttano, H. G., Davis, R. E., Dally, E. L., Hogenhout, S., Pimentel, J. P. and Brioso, P. S. T. 2001. ‘Candidatus phytoplasma brasiliense’’ a new phytoplasma taxon associated with hibiscus witches’ broom disease. Int. J. Syst. Environ. Microbiol. 51:1109-1118.

Murral, D. J., Nault, L. R., Casey, H. W., Madden, L. V. and Miller, S. A.1996. Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper (Homoptera: Cicadellidae). J. Econ. Entom. 89:1223-1232.

Murray, R. G. E. and Schleifer, K. H. 1994. Taxonomic notes: a proposal for recording the properties of putative taxa of prokaryotes. Int. J. syst. Bacteriol. 44:174-176.

Namba, S., Oyaizu, H., Kato, S., Iwanami, S. and Tsuchizaki. 1992. Phylogenetic diversity of phytopathogenic mycoplasmalike organisms. Int. J. Syst. Bacteriol. 43:461-467.

Nasu, S., Jensen, D. D., Richardson, J. 1974. Primary culturing of the western X mycoplasma-like organism from Collasous montanus leafhopper vectors. Appl. Entomol. Zool. 9:115-126.

Neimark, H. and Kirlpathrick, B. 1993. Isolation and characterization of full-length chromosomes from non-culturable plant-pathogenic mycoplasma-like organisms. Mol. Microbiol. 7:21-28.

Oshima, K., Miyata, S., Sawayanagi, T., Kakizawa, S., Nishigawa, H., Jung, H., Furuki, K., Yanazaki, M., Suzuki, S., Wei, W., Kuboyamy, T., Ugaki, M. and Namba, S. 2002. Minimal set of metabolic pathways suggested from the genome of onion yellows phytoplasma. J. Gen. Plant Pathol. 68:225-236.

Peterson, A. G. 1973. Host plant and aster leafhopper relationships. Proc. North Cent. Branch Entomol. Soc. Am. 28:66-70.

Sawada, M., Osawa, S., Kobayashi, H., Hori, H. and Muto, A. 1981. The number of ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 182: 502-504.

Schaff, D., Lee, I-M. and Davis, R. E. 1992. Sensitive detection and identification of mycoplasma-like organisms in plants by polymerase chain reactions. Biochem. and Biophys. Res. Commun. 186:1503-1509.

Schneider, B., Ahrens, U., Kirkpatrick, B. C. and Seemüller, E. 1993. Classification of plant-pathogenic mycoplasma-like organisms using restriction-site analysis of PCR-amplified 16S rDNA. J. Gen. Microbiol. 139:519-527.

Schneider, B., Marcone, C., Kampmann, M., Ragozzino, A., Lederer, W., Cousin, M-Y. and Seemüller, E. 1997. Characterization and classification of phytoplasmas from wild and cultivated plants by RFLP and sequence analysis of ribosomal DNA. European J. Plant Pathol. 103:675-686.

Sears, B. B., Lim P. O., Holland, N. Kirkpatrick, B. C. and Klomparens, K. L.1989. Isolation and characterization of DNA from a mycoplasmalike organism. Mol. Plant-Microbe Interactions. 2:175-180.

Sears, B. B. and Kirpatrick, B. C. 1994. Unveiling the evolutionary relationships of plant-pathogenic mycoplasmalike organisms. Am. Soc. Microbiol. News. 60: 307-312.

Seddas, A., Meignoz, R., Daire, X., Boudon-Padieu, E. 1996. Generation and characterization of monoclonal antibodies to flavescence doree phytoplasmas: Serological relationship and differences in electroblot immunoassay profiles of flavescence doree and Elm yellows phytoplasmas. European. J. Plant Pathol. 102:757-764.

Shiomi, T. and Sugiura, M. 1984. Grouping of mycoplasma-like organisms transmitted by the leafhopper vector, Macrosteles orientalis Virvaster, based on host range. Ann. Phytopathology Soc. Jpn. 50:149-157.

Siddique, A. B., Guthrie, J. N., Walsh, K. B., White, D. T. and Scott, P. T., 1998. Histopathology and within plant distribution of the phytoplasma associated Australian papaya dieback" Plant Dis. 82:1112-1120.

Sinha, R. C. 1974. Purification of mycoplasma-like organisms from China aster plants affected with clover phyllody. Phytopathology 64:1156-1158.

Sinha, R. C. 1979. Purification and serology of mycoplasma-like organisms from aster yellows-infected plants. Can. J. Plant Pathol. 1:65-70.

Sinha, R. C. 1983. Relative concentration of mycoplasma-like organisms in plants at various times after infection with aster yellows. Can. J. Plant Pathol. 5:7-10.

Smart, C. D., Schneider, B., Blomquist, C. L., Guerra, L. J., Harrison, N. A., Ahrens, U., Lorenz, K. H., Seemüller, E. and Kirkpatrick, B. C. 1996. Phytoplasma-specific PCR Primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 8:2988-2993.

Smith, R. E. 1902. Growing China aster. Hatch Exp. Station, MA. Agric. Coll. Bul. 79:1- 26.

Thomas, D. L. and Norri, R. C. 1980. The use of electron microscopy for lethal yellowing diagnosis. Proc. Florida State Hort. Soc. 93:196-199.

Tully, J. G., Whitcomb, R. F., Bove, J. M., Saglio P. 1973. Plant mycoplasmas: Serological relation between agents associated with citrus stubborn and corn-stunt diseases. Science 182:827-829.

White, D. T., Blackall, L. L., Scott, P. T. and Walsh, K.B. 1998. Phylogenetic positions of phytoplasmas associated with dieback, crinkle and mosaic diseases of papaya, and their proposed inclusion in ‘Candidatus Phytoplasma australiense’ and a new taxon ‘Candidatus Phytoplasma australasia’. Int. J. Syst. Bacteriol. 48: 941-945.

Zhang, J., Hogenhout, S. A. and Miller, S. A. 2001. Isolation of aster yellows phytoplasma genomic DNA from lettuce. Phytopathology 91:S99.

Zheng, J. and McIntosh, M. A. 1995. Characterization of IS1221 from Mycoplasma hyorhinis: expression of its putative transposase in Escherichia coli incorporates a ribosomal frameshift mechanism. Mol. Microbiol. 16:669-685.

Zreik, L., Carle, P., Bove, J. M. and Garnier, M. 1995. Characterization of the mycoplasmalike organism associated with witches’-broom disease of lime and proposition of a Candidatus taxon for the organsim Candidatus Phytoplasma aurantifolia. Int. J. Syst. Bacteriol. 45:449-453.

CHAPTER 1

ASTER YELLOWS PHYTOPLASMA STRAINS DIFFERENTIATED BASED ON HOST SYMPTOMS AND MOLECULAR MARKERS

INTRODUCTION

Although identification of phytoplasma strains by symptoms may be complicated by mixed infections and influenced by environmental factors, it is still one of the most common methods for phytoplasma disease diagnosis and phytoplasma species identification. Most phytoplasma species or strains were initially collected based on host symptoms. A classification of plant pathogens without considering host symptoms is impractical in agriculture because two strains considered to be closely related based on molecular markers or a few gene sequences may cause different symptoms or disease severity in the same host. For vector-transmitted pathogens, two closely related strains defined by a molecular marker may be transmitted in different ways or by different vectors. As a result, disease incidence may differ, or different plant species may be infected. Conversely, two molecularly distinct strains may cause identical symptoms and be transmitted in the same way to a host.

To identify aster yellows phytoplasma strains based on host symptoms, the factors that contribute to host symptom variation should be considered. Host growth stages

usually influence aster yellows symptom development, which means that plants infected at different growth stages by the same aster yellows phytoplasma strain may show totally different symptoms. Kunkel (1932), in his first experiment, did not find symptom differences between aster plants infected by aster yellows New York strain (eastern aster yellows) and those by the California strain (western aster yellows) except the California strain also infected celery while the New York strain did not. Later in his cross protection experiment, he found that western aster yellows caused stunting while eastern aster yellows caused production of spindly side shoots (Kunkel 1955). Chiykoski and Sinha

(1989) classified MLO into two groups based on flower symptoms, one causing virescence and the other causing flower size reduction. Other aster yellows phytoplasma strains causing distinct symptoms were also reported (Chiykowski 1973; Richardson

1967). Since aster yellows symptoms can be significantly modified by host growth stage and most literature available on aster yellows strain identification have been based on host symptoms at certain stages, it is difficult to compare an unknown strain with those previous reported (Kunkel 1955; Chiykowski 1987).

Secondly, disease symptom development is a dynamic process. The symptoms at the beginning of infection may differ from the symptoms at later stages. Thus, it is inappropriate to compare the symptoms at early stages of infection by one aster yellows phytoplasma strain with symptoms at a later stage by another. The symptom variation of infected host plants in natural conditions may be partially the result of different stages of infection.

Furthermore, aster yellows symptom variation in lettuce fields can result from mixed infection. Phytoplasma mixed infection is not uncommon in the natural environment since leafhopper vectors move freely from plant to plant. The legume stylosanthes, with symptoms of phyllody and little leaves, was found to be infected by five different phytoplasmas (Schneider et al. 1998). A case of apple proliferation was found associated with aster yellows, elm yellows and X group phytoplasmas (Lee et al. 1995). Errampalli and Fletcher isolated two aster yellows phytoplasma strains, AY-OC1 and MLO-OC, from a single carrot plant (Errampalli and Fletcher 1991; Errampalli et al. 1986). Freitag

(1964) demonstrated that leafhoppers could acquire either of the aster yellows phytoplasma strains or both from a cross-protected Nicotiana rustica plant, which indicated that both of the aster yellows phytoplasma strains still survived in the plant.

Cross protection also was observed among ash yellows phytoplasma strains; the term preemptive dominance was used for the detection of a single strain from a dually infected plant (Sinclair and Griffiths 2000). Mixed infection was also detected by molecular methods such as nested PCR, PCR with strain specific primers or PCR-RFLP analysis

(Lee et al. 1993, 1994, and 1995). Theoretically, the PCR-based methods can detect mixed infection of a plant well before aster yellows symptoms appear. Since mixed infection can complicate phytoplasma strain identification, strain purification is needed.

Molecular markers have been used commonly for disease detection and classification since the 1980s. DNA-based markers possess the advantage of high specificity and sensitivity. In addition, they can be used to detect pathogens both from symptomatic and non-symptomatic plants and from insect vectors. For classification, Lee and his

colleagues estimated the genetic closeness of several phytoplasma species by using

Southern hybridization with several probes made from phytoplasmal DNA clones (Lee and Davis 1988; Lee et al. 1990). Later, a polymerase chain reaction (PCR) assay with phytoplasmal 16S rRNA gene-specific primers was used to detect phytoplasmas. The

PCR products were analyzed by restriction fragment length polymorphism (PCR-RFLP) to determine the relationship among different phytoplasma species (Lee et al. 1993). The

PCR product generated using universal primers P1/P7, spanning the 16S rDNA and 16S-

23S rDNA spacer region, contains significant sequence variation among different phytoplasma species, thus, the PCR-RFLP banding pattern has higher resolution than using the 16S rRNA gene alone in phytoplasma classification. Several primers have been developed based on the sequence variation of the 16S rDNA and 16S-23S spacer region for identification of phytoplasma species (Kirkpatrick et al. 1994; Smart et al. 1996). Tuf gene, encoding elongation factor, and ribosomal protein genes also have been used to differentiate closely related phytoplasma species (Schneider et al. 1997; Marcone et al.

2000; Smart et al. 1996). The most powerful and the highest resolution method is DNA sequence comparison. With recent improvements in DNA sequencing technique, it is becoming practical to compare DNA sequences of certain genes between different phytoplasma strains or species and at a reasonable cost. This method allows for greater resolution of genes than PCR-RFLP analysis for classification. The heteroduplex mobility assay (HMA), a PCR-based hybridization method, also has been used in identification of closely related phytoplasma strains. The method can differentiate aster yellows phytoplasma strains with less than two-nucleotide differences in PCR products

(Wang and Hiruki 2000; Palmano and Firrao 2000).

Although aster yellows is a potentially devastating disease of lettuce in Ohio, a systematic investigation has not been conducted on the aster yellows strains infecting lettuce. In this chapter, I describe five aster yellows phytoplasma strains found in lettuce.

The differentiation of these strains was based both on host symptoms and molecular markers. By using PCR-RFLP, multiplex PCR, HMA analysis and primer typing, I tried to justify our differentiation of these aster yellows phytoplasma strains based on symptoms. I also conducted a phylogenetic analysis using the 16S rDNA partial sequences and 16S-23S spacer sequences of these aster yellows phytoplasma strains and those in the Genbank database.

METHODOLOGY

Aster leafhopper colony establishment and maintenance

Aster leafhopper (Macrosteles quandrilineatus Forbes) is the main vector of aster yellows phytoplasma in the United States. A phytoplasma-free leafhopper colony was generated from leafhoppers collected from Celeryville, Ohio in 1998. The adult leafhoppers were placed on oat seedlings (Avena sativa) in cages in a growth chamber at

25°C with a light period of 16 hours per day. Females were allowed to oviposit.

Leafhopper nymphs at 2-3 instar stage were transferred to oat seedlings not previously exposed to leafhoppers in a new cage and maintained as described (Murral et al. 1996).

The leafhoppers of the new generation were tested for aster yellows phytoplasma infection by PCR using aster yellows phytoplasma-specific primers 16S F4/R1 (Davis

and Lee 1993) in 20 bulk samples each containing five leafhoppers. The healthy leafhopper population is kept on oat host plants in a nylon screen cage for continuous rearing.

Aster yellows phytoplasma (AYP) strain isolation and maintenance

Aster yellows phytoplasma isolates were collected from symptomatic lettuce plants from commercial lettuce fields in Celeryville, Ohio (41.00°N, 82.45°W) in 1998.

Symptomatic plants were first tested with the phytoplasma universal primers P1/P7

(Smart, C.D. et al. 1996) and aster yellows phytoplasma 16S rDNA primers F4/R1 before leafhopper acquisition. Aster yellows-positive plants with different symptoms were placed individually into separate nylon net cages and 2-3 instar nymphs of aster leafhoppers were allowed to feed on them for a 4-day acquisition access period (AAP) in a growth chamber at 25°C and a photoperiod of 16 hours per day. The infected lettuce plant was replaced by a 3-week-old oat plant following the AAP. The leafhoppers were continually kept within the cage for 4 weeks, sufficient for completion of the incubation period (Murral et al. 1996). The presumed inoculative leafhoppers were transferred individually to 3-week-old healthy China aster ‘Matsumoto Red’ (Stokes Seeds Ltd.

Buffalo, NY, U.S.A.) seedlings from an insect-free greenhouse. The China asters were exposed to leafhoppers for a 12-hour inoculation access period (IAP) and then transferred to an insect-free greenhouse with a day temperature of 25±2°C and a night temperature of 20±2°C for symptom development. Plants were categorized according to symptoms.

The plants with different symptoms were then exposed individually to healthy leafhopper nymphs for a 12-hr AAP as described above followed by 4-week incubation and 12-hr

IAP. The cycle was repeated three times for all the isolates. DNA was extracted from the aster plants showing various symptoms and analyzed by restriction fragment length polymorphism of PCR products as described below (PCR-RFLP). After three cycles, each aster plant was inoculated by four inoculative leafhoppers and the symptomatic plants were periodically analyzed (approximately every other month) using PCR-RFLP.

Seven strains were isolated: Aster yellows witches’ broom (AY-WB), Aster yellows severe (AY-S), Aster yellows bolt distortion No.2 (AY-BD2), Aster yellows bolt distortion No.3 (AY-BD3), Aster yellows bolt white (AY-BW), Aster yellows simi- geotropism (AY-SG) and AY-SS (an AY-S-like strain). Since AY-SS was lost during transfer and sufficient AY-BD3-infected plants were not available for symptom determination, the host symptoms caused by these two strains are not discussed although their molecular characteristics sometimes are mentioned along with those of other strains in the molecular identification section. Neither segregation of host symptoms nor segregation of PCR-RFLP banding patterns was observed in the purified strains after the purification process. The purified aster yellows phytoplasma strains were maintained by successive transfers between leafhoppers and China aster or transferred by leafhoppers to

Romaine lettuce (Lactuca sativa) ‘Parris Island Cos’ (ASGROW Vegetable Seeds,

Gonzales, CA. U.S.A.) for symptom differentiation.

Host symptom differentiation of aster yellows phytoplasma strains

Romaine lettuce ‘Parris Island Cos’ plants were inoculated at about the eight and 12 expanded-leaf stages. China aster ‘Matsumoto Red’ (Stokes Seeds Ltd. Buffalo, NY,

U.S.A.) plants were inoculated at the growth stages10, 15 and 20 expanded-leaf stage

using AYP inoculative leafhoppers. Aster plants inoculated at the 20 expanded-leaf stage did not show distinct symptom differences among the aster yellows phytoplasma strains, therefore, only the symptoms of aster plants inoculated at 10 and 15 expanded- leaf stages are described. The symptoms described herein were of aster plants infected at

10 and 15 expanded-leaf stages and lettuce plants infected at eight and 12 expanded-leaf stages. The two growth stages for both host plants were arbitrarily referred to as the early or the late growth stages, respectively. Five plants were inoculated for each aster yellows phytoplasma strain by four to five inoculative leafhoppers in a nylon screen cage (3.0 cm in diameter and 1.0 cm high). The side of the cage with nylon net was placed against the leaf surface so that the leafhoppers could feed through the holes. The IAP lasted 72 hours. Then the leafhoppers were removed and the plants were sprayed with insecticide

1100 Pyrethrum TR (Whitmire Micro-Gen Research Laboratories Inc. St. Louis, MO) and placed in a greenhouse (day temperature 25±2°C and night temperature 20±2°C) for symptom development. Symptoms were mainly evaluated twice at early (20 days after initiation of IAP) and late (50 days after initiation of IAP) stages of infection. The host symptoms caused by different strains were compared in reference to uninfected plants, including leaf color and form, and branch (aster) and stem growth. Plant height was measured from the soil surface to the highest point of the plants. Each internode of infected and uninfected aster plants also was measured. Three plants were randomly selected from the aster plants infected by each strain and the experiment was repeated once.

PCR-RFLP, multiplex PCR and heteroduplex mobility analysis

Aster yellows phytoplasma DNA was extracted using the CTAB method (Zhang et al. 1998). The DNA was amplified with PCR using primers AY19p/AY19m (Schaff et al. 1992), P1/P7 (Smart et al. 1996), F2/R2 or F4/R1 (Davis and Lee 1993) respectively.

The primer pair BF/BR was developed from an aster yellows phytoplasma AY-WB genomic DNA clone. The sequences of these primers are: BF 5’-AGG ATG GAA CCC

TTC AAT GTC-3’; BR 5’-GGA AGT CGC CTA CAA AAA TCC-3’.

The primers P1/P7 and F4/R1 were used for detection of possible phytoplasma infection. F2/R2 and AY19p/AY19m were used for PCR-RFLP analysis. The PCR reaction mixture contained the following ingredients: 1X PCR buffer (200 mM Tris-HCl pH 8.4 and 500 mM KCl), 2.0 mM MgCl2, 0.2 mM dNTPs, 0.5 µM each of primers

AY19p/AY19m, P1/P7, F2/R2 or F4/R1, 1.25 unit of Taq DNA polymerase in a final volume of 50 µl for PCR-RFLP (or 25 µl for detection). PCR was conducted with the following conditions: 94°C for three minutes, 30 cycles of 94°C for 30 sec, 47ûC (for

AY19p/AY19m) or 50ûC (for P1/P7, F2/R2 or F4/R1) or 55ûC (for BF/BR) for 30 sec, and 72°C for one minute (for F4/R1 or BF/BR) or 1.5 minutes. (for AY19p/AY19m,

P1P7 or F2/R2) with 10 minute extension at 72ûC after the last cycle. For PCR-RFLP analysis, the PCR product concentration was estimated by electrophoresis using a 1% agarose. The 1.1-kb PCR products amplified with primers AY19p/AY19m were digested with DraI and the 1.2-kb PCR products amplified with primers F2/R2 were digested with

AluI, RsaI, HhaI and HaeIII at 37 ûC for four hours (Lee et al. 1993). The digested

products were analyzed by electrophoresis in a 5% polyacrylamide gel at 3.5V/cm gel in

1X TBE buffer (pH8.0) at room temperature and stained in 0.5 µg/ml ethidium bromide solution.

The heteroduplex mobility analysis was conducted on PCR products amplified with primers S10F/S10R. The primers target the putative AL1 protein gene of aster yellows phytoplasma and generate a 400 bp PCR product from DNA extracts of aster yellows phytoplasma-infected plants. The primer sequences are: S10F 5’-CCT AGC CCT ACC

AAA AGC-3’ and S10R 5’-CTG ATT TAG GTG AGA AAA TCC-3’. The PCR assay was conducted under the conditions as described above except that annealing condition was at 55ûC for 30 seconds. The HMA was conducted as described (Wang and Hiruki

2000). After PCR, 4.5 µl PCR product was mixed in equal amounts with PCR product from the other purified strain. Then 1.0 µl annealing buffer (100 mM Tris-HCl pH8.0, 10 mM EDTA and 1 M NaCl) was added. The mixed DNA was incubated at 98ûC for four minutes and then at 37ûC for two hours. The DNA was analyzed by electrophoresis in a

5% polyacrylamide gel with 2.5V/cm gel at room temperature for seven hours.

The PCR fragments amplified from different AYP strains with primers

AY19p/AY19m were purified by using a QIAquick Gel Extraction kit (Cat. 28706

QIAGEN GmbH, Germany) and ligated with pGM-T Easy Vector (Systems). The vectors were then used to transform JM109 competent cells according to the manual

(Promega, 2800 Woods Hollows Road, Madison, WI). The clones with inserts were selected by using Xgal-IPTG (Promerga) for white color colonies. DNA was extracted

from the overnight culture of the selected white colonies (in LB with 20ug/ml ampicillin.

Sambrook et al. 1989) by using Miniprep kit (QIAGEN Inc. Valencia, CA). The DNA was diluted to 10ng/µl and amplified with PCR with T7/SP6 primers. The PCR products were sequenced. Four primer pairs were designed based on sequence variation among the aster yellows phytoplasma strains and were used for multiplex PCR. The sequences of the primers are listed below:

Primer Sequence Product size (bp)

S1 CGCTAACAAATGTAAAGGCAAG 493 S2 CTTTAATAGGACTATGAGGG

21F CCAATCATTTAGATAAAATTGATACC 519 21R TGTAGTTGAGTTCTATGTAGC

15F CCCTCAAACCCACGAAGTT 390 15R TACTGTGTTCCCTTACTCC

BWF TCTTCTATGGGCTAAACGGACTAGGT 199 BWR GTGGTCTACACTAACACGATTGC

The PCR mix contained 1.5X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTPs, 0.1 µM

S1/S2 each, 0.1 µM 21F/21R each, 0.075µM 15F/15R each and 0.125 µM BWF/BWR each, 1.85 unit Taq DNA polymerase/25 µl reaction mix. The touch down PCR program was used. Following two minutes denaturation at 94ûC, the first five cycles were: 94ûC for 30s, 58ûC (annealing) for 1 min and 65ûC for two minutes. For the next 10 cycles, the annealing temperature was changed to 57 ûC and in the last 15 cycles, annealing temperature was set at 56 ûC. The other reaction factors were the same as in the first five cycles. The PCR products were analyzed in a 1% agarose gel as described above.

Phylogenetic analysis of aster yellows phytoplasma strains

P1/P7 PCR products purified using a QIAquick Gel Extraction kit were sequenced from both ends and the partial sequences of the 16S rRNA gene (about 400 bp) and the

16S-23S spacer regions (about 200 bp) were compared with those of other aster yellows phytoplasmas and phytoplasma species selected from the Genbank database. The corresponding sequence of Acholeplasma was used as the outgroup (Table 1.1, 1.2). The sequence alignments were conducted both with ClustalX 1.81 (Jeanmougin et al. 1998) and ClustalW 1.82 (http://www.ebi.ac.uk/culstalw/). The phylogenetic tree was drawn by using neighbor-joining method of the computer program PAUP* 4.0 (phylogenetic analysis using parsimony) for Macintosh written by David Swofford (Sinauer Associates

Inc. Publishers, Sunderland, Massachusetts).

RESULTS

Aster yellows phytoplasma strain isolation

Field-collected AYP isolates IAY-WB, IBD-2, IBD-3, IAY-SG and IAY-S did not show segregation of either symptoms or PCR-RFLP banding patterns after three rounds of purification, and thus were designated as AYP strains AY-WB, AY-BD2, AY-BD3 and AY-SG respectively. Segregation was observed in isolate ISS that caused symptoms similar to those caused by AY-S. One AY-WB isolate was recovered that showed the same symptoms and PCR-RFLP fingerprint as purified AY-WB during the second round of the purification process. The purified AY-SS strain lacked two bands (850 bp and 350 bp) in PCR-RFLP analysis that matched the banding pattern of AY-WB, which

suggested that isolate ISS was a mixture of AY-SS and AY-WB. The PCR-RFLP banding pattern of isolate IBW showed a loss of an 820-bp band during the purification process. These two purified strains were named as AY-SS and AY-BW respectively

(Figure 1.1).

Symptoms of aster yellows phytoplasma strains

AY-WB. Vein clearing was the first symptom appearing in China aster plants infected by

AY-WB, usually occurring 14 days after inoculation, regardless of the growth stage at which the plants were inoculated. For plants inoculated at the early growth stage, leaf petioles were abnormally upright and the stems were stunted. Yellowing began from the newly emerged leaves and progressed down to the newly expanded leaves. Infected plants showed witches’-broom symptoms at later stages of infection, usually six weeks after inoculation. Eventually, the whole plant yellowed and the growing points became necrotic. The plant died without producing flowers. Plants infected at the late growth stage showed vein clearing, and leaf petioles became abnormally upright compared with healthy plants. Witches’-broom was also observed at the late stage of infection (Figure

1.2). Flowers sometimes appeared in plants inoculated at the 20 expanded-leaf stage but they were small, lacked pigment or were sterile. The stems of infected plants were much shorter than those of uninfected plants regardless of growth stage in which the plants were inoculated (Figure 1.3). Aster yellows phytoplasma infection mainly suppressed elongation of internodes on top of the plants (Figure 1.4).

In lettuce, vein clearing also was the first observed symptom at both plant growth stages (Figure 1.5). When infected at the early growth stage, the whole plants became yellow, beginning from young emerging leaves, and progressing to expanded leaves. The symptomatic leaves were significantly smaller compared with those in healthy plants. At the late stage of infection, the plant wilted slightly, especially in sunlight, although some recovery was observed at night. Finally the plant died. The plants infected at the late growth stage usually showed symptoms on newly emerging leaves and newly fully expanded leaves. At late stage of infection, the plants bolted. Latex-like ooze was observed from the top leaves and the stem and leaf deformation was observed. The ooze was originally milky white and then turned to brown (Figure 1.6).

AY-S. In China aster, AY-S caused stunting in plants infected at all the growth stages

(Figure 1.7). The newly emerging leaves were chlorotic for a short period of time (2-3 days) then gradually became light to deep green and were smaller than normal leaves of healthy plants. Since the stem and branches failed to elongate, these small leaves formed clusters. The plants infected at the 20 expanded-leaf stage produced flowers but their coronals were green and leaf-shaped (phyllody) and sterile.

In lettuce, AY-S significantly suppressed plant growth when the plants were infected at the early growth stage (Figure 1.8). The newly emerged symptomatic leaves were progressively smaller and lacked of leaf blades until no more leaves formed. The color of newly emerged leaves was light green and the leaves were upright. Old leaves tended to

flatten. The leaves of plants infected at the late stage also were progressively smaller with loss of leaf blades. A latex-like ooze was observed on top leaves and stems at the late stage of infection.

AY-SG. Strain AY-SG caused stunting and chlorosis in China aster plants (Figure 1.9).

Leaf petioles were upright in plants infected at the early growth stage but stems were stunted. Newly emerged leaves were small and chlorotic. Fewer branches were observed than the plants infected by AY-S at the same growth stage. Plants infected at the 15 expanded-leaf stage showed semi-geotropism both at the early and the late stage of infection.

In lettuce, strain AY-SG caused chlorosis of newly emerged leaves (Figure 1.10).

Symptomatic leaves curled backward. Growth reduction was observed in the plants infected at the early growth stage. The stems and leaves of the plants infected at the late growth stage were deformed and showed semi-geotropism similar to those of aster plants infected at the late growth stage. Latex-like ooze was observed at late stage of infection.

AY-BW. Chlorosis was the main characteristic of AY-BW infection (Figure 1.11). In aster, the newly emerged leaves of infected plants first exhibited vein clearing for short period of time (1-2 days). The leaves and leaf petioles became abnormally upright. As the disease progressed, all newly emerging leaves were chlorotic and progressively smaller. Plants infected at the early stage were stunted but less so than plants infected by

aster yellows phytoplasma AY-SG. Fewer leaf clusters was observed than those in plants infected with AYP-SS. Plants infected at the late growth stage showed symptoms similar to those in plants infected at the early growth stages.

Vein clearing was the first symptom observed in infected lettuce (Figure 1.12).

Leaves were narrow and abnormally upright. Plants infected at the early growth stage became chlorotic. Bolting was observed in late infected lettuce. Ooze was observed at the late stage of infection especially in the plants infected at late growth stage.

AY-BD2. In China aster, AY-BD2 caused symptoms similar to those caused by AY-WB at the early stage of infection (Figure 1.13). The leaf petioles became abnormally upright and the stem was less stunted than in plants infected by AY-WB. The symptomatic leaves formed a cluster and were chlorotic at the late stage of infection. Extraordinary branches and stem elongation were not observed at any stage of infection and in the plants infected at either growth stages. The growth of infected plants was less suppressed compared with those infected by the other aster yellows phytoplasma strains.

Vein clearing was also the first symptom observed in lettuce, similar to symptoms caused AY-WB. The newly emerged leaves were yellow (Figure 1.14). Plants infected at the early growth stage did not show stem elongation, but the leaves were distorted. The newly expanded leaves of the plants infected at the late growth stage were light green with vein clearing. The symptoms were usually observed in newly expanded leaves.

Leaves that were fully expanded at the time of inoculation did not show symptoms. The symptoms were relatively mild compared to those caused by the other strains. A latex- ooze was often observed on the top leaves and stems.

Characterization of aster yellows phytoplasma strains with PCR-RFLP analysis

A 1.2-kb DNA fragment was amplified from the DNA extracts of all the aster yellows phytoplasma strains using aster yellows phytoplasma 16S rDNA primers F2/R2.

RFLP analysis of the fragments of different aster yellows phytoplasma strains indicated that aster yellows phytoplasma AY-WB differed from the other strains by HhaI restriction of PCR products amplified by F2/R2. The PCR product of AY-WB was cut in one place and other strains were cut in two places by HhaI (Figure 1.15). PCR-RFLP patterns for all strains were the same when the restriction enzymes AluI, RsaI and HaeIII were used. AY-WB was sorted to the 16SrI-A subgroup and all the other strains were classified into 16SrI-B subgroup (AluI or RsaI-digested PCR products of strain AY-SG were run in a separate gel not shown here).

Unique fingerprints were observed for AY-WB, AY-BW and AY-S by RFLP analysis of AY19p/AY19m-amplified PCR products digested with DraI. AY-BD2, AY-

SG, AY-BD3 and AY-SS were not distinguished from one another. The total molecular weight of the digested fragments of AY-WB was the same as the original PCR product

(Figure 1.1). The sum of the digested fragments of the other strains, however, was larger than the original PCR products, which suggests that the aster yellows phytoplasma genomes may contain more than one altered copy of the DNA fragment.

Identification of the aster yellows phytoplasma strains by heteroduplex mobility analysis

A 400-bp DNA fragment was amplified from DNA extracts of AY-BW, AY-S, AY-

BD3 and AY-SG infected plants by PCR using primers S10F/S10R (Figure 1.16). No

PCR products were generated from DNA extracts of AY-WB, AY-BD2 or AY-SS (not shown). Heterologous banding patterns were observed in hybridization of AY-BW×AY-

BD3, AY-BW×AY-SG, AY-S×AY-BD3 and AY-S×AY-SG as three bands in each of the lanes containing the hybridization product, which indicated that AY-BW differed from AY-BD3 and AY-SG, and AY-S also differed from AY-BD3 and AY-SG.

However, no differences were observed between AY-S and AY-BW or between AY-

BD3 and AY-SG. The DNA fragments amplified from AY-BW and AY-S were smaller than those of AY-SG or AY-BD3 (Figure 1.16).

Strain identification by PCR, multiplex PCR and primer typing.

PCR with primers S1/S2 generated 493 bp DNA fragments from AY-WB and AY-S.

PCR with primers15F/15R amplified a 390 bp DNA fragment from all the aster yellows strains except AY-WB, and with primers BWF/BWR amplified a 199 bp fragment from all the strains except AY-S. PCR with primers 21F/21R generated a 519 bp fragment from AY-BW, AY-BD2, AY-BD3 and AY-SG. Multiplex PCR with these primers

(pooled) generated four PCR bands from DNA extract of AY-BW that corresponding to each of the four primer pairs, one band from AY-WB (492 bp), two from AY-SS (390 and 199 bp) and two from AY-S (493 and 199 bp) (Figure 1.17). Thus, strain AY-BW,

AY-WB, AY-S and AY-SS had unique fingerprint(s). AY-BD2, AY-BD3 and AY-SG showed the same banding patterns (three bands) and were not distinguished by the primer sets. Five of seven aster yellows phytoplasma strains were differentiated by using five pairs of primers in separate PCR reactions (primer typing). Only AY-BW and AY-SG could not be differentiated with these primers (Table 1.3). PCR with primers BF/BR generated a 900-bp product only from DNA extracts of host plants infected by AY-WB, not from the DNA extracts of healthy leafhoppers, healthy host plants such as lettuce, carrot and celery, or other phytoplasma species such as Western X, Grapevine yellows and Beet leafhopper transmitted virescence agent. Thus, the primers were considered

AY-WB strain specific (Figure 1.18).

Phylogenetic analysis of 16S rRNA genes.

The phylogenic analysis of 16S rRNA gene partial sequences showed that all of the aster yellows phytoplasma strains collected from lettuce in Ohio were in the same cluster

(Group 2) with most aster yellows phytoplasmas from the Genbank database (Figure

1.19) and they shared 98-100% sequence homology. This was consistent with the classification based on PCR-RFLP analysis of 16S rDNA. Only Paulownia witches’- broom phytoplasma, a member of 16SrI-D subgroup according to PCR-RFLP analysis, was classified into a separate group (Group 1) that shared 87-99% sequence similarity with the other aster yellows phytoplasmas. Acholeplasma palmae, as an outgroup, showed 85-91% sequence similarity to the aster yellows phytoplasmas. Among the other phytoplasma species, they shared 84-94% sequence similarity in the partial sequence of the 16S rRNA gene.

Based on sequences of the 16S-23S spacer regions, most of the aster yellows phytoplasmas also were sorted into one cluster in which three subgroups were classified

(Figure 1.20). Aster yellows phytoplasma strains collected from lettuce in Ohio were in two subgroups (Subgroup 2 and Subgroup 3). AY-WB, AY-BD2 and Clover phyllody phytoplasma were in Subgroup 2. AY-S, AY-BW and AY-SG, along with AY1, AYP and AYPW, were classified into Subgroup 3. AYPB was classified into Subgroup 1.

However, TBB was classified into separate cluster. The aster yellows phytoplasma strains collected from lettuce shared 97-98% sequence similarity. Acholeplasma had only

16-23% DNA sequence similarity in the 16S-23S rRNA gene spacer region with the phytoplasmas.

DISCUSSION

In addition to the ‘Bolt’ and ‘Severe’ strains that had been reported in lettuce (Murral

1996), at least three other strains were identified as involved in aster yellows epidemics in Ohio. Strain AY-BD2 caused symptoms similar to ‘Bolt’ or aster yellows eastern strain (or New York strain). AY-WB caused symptoms similar to AY-BD2 or aster yellows eastern strain in China aster at an early stage of infection, but caused different symptoms at later stages of infection. Strain AY-WB caused witches’-broom in aster while AY-BD2 did not. In lettuce, AY-WB caused wilting but AY-BD2 caused mild chlorosis and leaf distortion in plants at the early growth stage. Strain AY-SG caused symptoms typical of aster yellows western strain in China aster (Kunkel, L.O. 1955;

Chiykowski, L. N. 1987). The symptoms of AY-S matched those of the original Ohio

strain ‘Severe’ and partially matched the symptoms (stunting and phyllody) of AY-OC1, which was considered to be a western strain (Errampalli D. and Fletcher J. 1991).

However, AY-S did not cause elongation of internodes in aster plants. The symptoms caused by Strain AY-BW did not match those caused by any of the aster yellows phytoplasma strains reported in the literature to our knowledge (Table 1.4) although it has identical 16S rDNA partial sequence with Maryland aster yellows and aster yellows

B isolates.

Aster yellows symptom development is a dynamic process. Infected plants may show different symptoms at different stages of infection. Therefore, two strains may show similar symptoms at one stage of infection but different symptoms at the others. For example, all of the aster yellows phytoplasma strains caused vein clearing at the very beginning of symptom development, and it was difficult to distinguish one strain from another at this time. Strain AY-WB and AY-BD2 did not cause different symptoms until the late stage of infection, when AY-WB caused witches’-broom in aster and wilting in lettuce, while AY-BD2 caused stem and leaf distortion in lettuce. Thus, aster yellows phytoplasma strain identification or comparison among strains should be made at several stages of infection, especially for closely related strains.

Host growth stage at the time of inoculation also significantly affects symptom appearance. Aster plants inoculated at an early growth stage by different strains showed more symptom variation than the plants infected at a late growth stage. Aster yellows phytoplasmas are generally thought to cause symptoms by modifying plant growth,

either by causing abnormal plant hormone levels or disturbing nutrient translocation, resulting in starvation of growing points of infected plants (Lee and Davis 1992; Kunkel

1926). Young plants are undergoing rapid morphological changes; thus, infection can result in significant morphological modification to infected plants. However, plants reaching maturity are undergoing limited morphological change and are not as readily modified. As a result, the infection by different strains can only cause limited symptom differences. Aster yellows phytoplasma infection before the flowering stage only caused morphological changes in flowers and the limited difference can hardly be used for identification of closely related strains (Figure 1.21). Thus, young aster plants should be used for strain identification. In addition, since symptom variation may be more pronounced in one plant species than another, more than one host species may be needed to differentiate closely related aster yellows phytoplasma strains.

The term “stem elongation” is often used to describe the symptom of aster yellows phytoplasma infection (Uehara et al. 1999; Lee et al. 2000). The plant height comparison between healthy aster plants and those infected by different Ohio aster yellows phytoplasma strains, however, indicated that all the infected plants were shorter than the healthy aster plants. The earlier the infection occurred, the shorter the plants became, which was consistent with results from previous studies (Kunkel 1926). Further, abnormal internode elongation was not observed in the infected aster plants compared with healthy aster plants. The abnormally upright leaf petioles during the early stage of infection by some aster yellows phytoplasma strains appeared to be abnormal elongation of the stem but in fact it was not (Figure 1.3, 1.4).

Ooze from lettuce plants caused by aster yellows phytoplasma infection is first reported here. The symptom occurred about 3 weeks after symptom appearance. It was a common symptom for all the aster yellows phytoplasma strains that were isolated from lettuce. The milky sap was exuded from leaves and stems of infected plants and then dried and turned brown, similar to ooze of other bacteria (Figure 1.5). The symptom was mainly observed on the top leaves or stems in romaine lettuce, and was visible for a few days. The amount of exudate differed among the plants infected by different strains.

Symptomatic plants also showed leaf deformation or scars on stems. The contents of the droplets were positive for aster yellows by PCR using aster yellows phytoplasma specific primers F4/R1 and AY19p/AY19m (unpublished data). This symptom at the late stage of infection may be caused by the multiplication and development of phytoplasmas, resulting in damage to the phloem vessels. As a result, the turgor pressure in phloem may have forced the sap out of the damaged tissue.

Some primers have been developed for phytoplasma identification based on sequence differences in 16S-23S spacer region among phytoplasma species (Smart et al. 1996).

But it was difficult to develop specific primers to differentiate aster yellows phytoplasma strains, especially the strains from the same host since they shared 97-98% sequence homology. In addition, phytoplasmas contain two copies of rRNA operons (Schneider and Seemüller 1994; Jomantiene et al. 2002), that could further increase the difficulty of designing strain-specific primers based on rRNA sequences. This is because a pair of specific primers designed according to the sequence difference of one copy of the operons among different strains might generate PCR products from the other copy. To

develop the primers from other genomic regions is also troublesome due to the low GC content of phytoplasma genomes (Oshima et al. 2002; Fraser et al. 1995). Primers with less than 40% GC content usually show very low specificity in PCR amplification or do not work at all (Dieffenbach et al. 1995). Moreover, unique nucleotide(s) is/are often connected with low complexity genomic regions with poly-A or poly-T, further decreasing the chance of finding specific primer target sites (unpublished sequence data).

Therefore, sequence comparisons may be necessary to differentiate closely related aster yellows phytoplasma strains.

The phylogenetic analysis of the 16S rRNA gene partial sequences showed that the aster yellows phytoplasma strains infecting lettuce were closely related to each other and classified in one cluster although they caused different symptoms and distributed differently in lettuce plants. The phylogenetic relationship is basically consistent with the classification based on PCR-RFLP banding patterns for most of the aster yellows phytoplasmas (Lee et al. 1993; Jung et al. 2002). Based on sequence of the 16S-23S spacer region, aster yellows phytoplasma cluster was sorted into three subgroups, as a result of greater sequence variation among the phytoplasmas in the chromosomal region than the 16S rRNA gene. For example, TBB, a member of aster yellows group, was sorted into separate cluster. AY-BD2, a member of 16SrI-B subgroup, was sorted into the same group with AY-WB of the 16SrI-A subgroup and clover proliferation phyllody phytoplasma of the 16SrI-C subgroup. The disagreement at subgroup level between phylogenetic analysis of 16S rRNA gene partial sequences and PCR-RFLP analysis is due to the fact that the two classification methods were based on different sequence

information, RFLP analysis was based on restriction site differences and sequence analysis was based on sequence similarity among different aster yellows phytoplasma strains.

Existence of two copies of rRNA gene operons in phytoplasmas seems to be a problem for phylogenetic analysis based on sequence because sequence variation may exist between the two copies and some aster yellows phytoplasma subgroups were classified based on single nucleotide difference (Lee et al. 1993; Oshima et al. 2002).

This might not be a problem in classification in most cases because the difference between the two copies of rRNA operons in one phytoplasma strain could be less than the difference of the operons between two strains.

SUMMARY

Seven aster yellows phytoplasma strains were identified based on the symptoms they caused either in China aster or lettuce: AY-WB, AY-S, AY-SS, AY-DB3 AY-BW, AY-

SG and AY-BD2. The unique symptoms caused by AY-WB are wilting in lettuce and witches’-broom at the late stage of infection in aster plants infected at an early growth stage. The distinct symptoms caused by AY-S are stunting, clustering and phyllody. The strain does not cause bolting in aster. AY-SG is distinguished from the others by causing semi-geotropism of plants at late stage of infection and differs from AY-S in not causing clustering of leaves of aster plants. The distinct symptom for AY-BW infection is chlorosis of newly emerging leaves. Strain AY-BD2 causes the mildest symptoms among all the strains collected from lettuce. The main characteristic of this strain is causing leaf

and stem distortion in lettuce at late stage of infection. Based on phylogenetic analysis, aster yellows phytoplasma strains collected from lettuce in Ohio all belong to 16SrI group, although AY-WB belongs to 16SrI-A subgroup and the other strains belong to

16SrI-B subgroup based on 16S rDNA PCR-RFLP analysis. AY-WB can be easily distinguished from the other aster yellows phytoplasma strains by PCR with strain specific primers BF/BR. AY-S, AY-BW and AY-WB showed unique PCR-RFLP fingerprint(s) of PCR products amplified by AY19p/AY19m. Strains AY-BW, AY-WB,

AY-SS and AY-S can be distinguished from each other and from the other strains by multiplex PCR. Primer typing can be used to distinguish most of the strains except AY-

BW and AY-SG. Thus all the strains can be distinguished by using one or two of the identification methods.

REFERENCES

Chiykowski, L. N. 1987. Aster yellows in strawberry. (In) Virus Diseases of small fruits. (Ed) by Converse, R. H. U.S. Government Printing Office. Washington, D.C. 31- 34.

Chiykowski, L. N. 1973. The aster yellows complex in North America. Proc. North Central Branch. Entomol. Soc. Am. 28:60-66.

Chiykoski, L. N., and Sinha, R. C. 1989. Differentiation of MLO disease by means of symptomatology and vector transmission. Zentrabl. Bakteriol. Hyg. Suppl. 20:280-287.

Dieffenbach, C. W., Lowe, T. M. J. and Dveksler, G. S. 1995. General concepts for PCR primer design. (in) PCR Primer. A laboratory manual. (Ed.) by Dieffenbach, C. W. and Dveksler, G. S. Cold Spring Harbor Laboratory Press.

Errampalli, D. and Fletcher, J. 1991. Incidence of yellows in carrot and lettuce and characterization of mycoplasmalike organism isolates in Oklahoma. Plant Dis. 6:579-584.

Errampalli, D. and Fletcher, J. and Fastman, C. 1986. Natural occurrence of aster yellows in vegetable crop in Oklahoma. (Abstract). Phytopathology, 76:1084.

Fraser, C. M., Gocayne, J. D. and White, O. et al. 1995. Science. The minimal gene complement of Mycoplasma genitalium. 270:397-403.

Freifelder, D. 1987. The colicinogenic or col plasmids. (In) Microbial genetics. Jones and Bartlett Publishers Boston. Pp.274-277.

Jalouli, J., Sand, L., Gustavsson, B., Hirsch, J. M. and Larsson, P. A. 1999. High- throughput DNA extraction from old paraffin-embedded biopsies. BioTech. 27:334-338.

Jeanmougin, F., Thompson, J. D., Gouy, M., Higgind, D. G. and Gibson, T. J. 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23:403-405.

Jomantiene, R., R.E. Davis, D. Valiunas, A. Alminaite, and J. Staniulis. 2002. New group 16SrIII phytoplasma lineages in Lithuania exhibit rRNA interoperon sequence heterogeneity. European Journal of Plant Pathology 108:507-517.

Jung, H-Y., Sawayanagi, T., Kakizawa, S., Nishigawa, H., Miyata, S., Oshima, K., Ugaki, M., Lee, J-T. Hibi, T. and Namba, S. 2002. Candidatus phytoplasma taxon associated with chestnut witches’ broom diseases. Int. J. Syst. Eviron. Microbiol. 52: 1543-1549.

Kirkpatrick, B. C. and Smart, C. D. 1995. Phytoplasmas: can phylogeny provide the means to understand pathogenicity? Adv. Bot. Res. 21: 187-212.

Kirkpatrick, B., Smart, C., Gardner, S., Gao, J-L., Ahrens, U., Maurer, R., Schneider B., Lorenz, K-H., Seemüller, E., Harrison, N., Namda, S. and Daire, X. 1994. Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA spacer sequences. IOM letters 3:228-229.

Kunkel, L. O. 1926. Studies of aster yellows. Am. J. Botany. 13:646-705.

Lee, I-M. and Davis, R. E. 1988. Detection and investigation of genetic relatedness among aster yellows and other mycoplasmalike organisms by using cloned DNA and RNA probes. Mol. Plant-Microbe Interactions. 1:303-310.

Lee, I-M., Davis, R. E., and Dewitt, N. D. 1990. Nonradioactive screening method for isolation of disease-specific probes to diagnose plant disease caused by mycoplasmalike organisms. Appl. Environ. Microbiol. 56:1471-1475.

Lee, I-M., Hammond, R.W., Davis R. E. and Gundersen, D. E. 1993. Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology. 83:834-843.

Lee, I-M., Davis R. E. and Gundersen-Rindal, D. E. 2000. Phytoplasma: Phytopathogenic mollicutes. Ann. Rev. Microbiol. 54:221-255.

Marcone, C., Lee, I-M., Davis, R. E., Ragozzino, A. and Semüller E. 2000. Classification of aster yellows-group phytoplasmas based on combined analyses of rRNA and tuf gene sequences. Inter. J. Syst. Eviron. Microbiol. 50:1703-1713.

Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. and Seemüller, E. 1999. Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology. 89:805-810.

Murral, D. J., Nault L. R., Hoy, C. W., Madden, L. and Miller, S. A. 1996. Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper (Homoptera: Cicadellidae). J. Econ. Entomol. 89:1223-1232.

Palmano, S. and Firrao, G. 2000. Diversity of phytoplasmas isolated from insects, determined by a DNA heteroduplex mobility assay and a length polymorphism of the 16S—23 S rDNA spacer region analysis. J. Appl. Microbiol. 89:744-750.

Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12: 357-358.

Richardson, H. P. 1967. Host reactions to three strains of aster yellows virus from Manitoba. Can. J. Bot. 45:657-664.

Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning, A laboratory manual. A1, A6. Cold Spring Harbor Laboratory Press.

Schaff, D., Lee, I-M. and Davis, R. E. 1992. Sensitive detection and identification of mycoplasma-like organisms in plants by polymerase chain reactions. Biochemical and Biophysical Res. Communications. 186:1503-1509.

Schneider, B., Marcone, C., Kampmann, M., Ragozzino, A., Lederer, W., Cousin, M-T. and Seemüller, E. 1997. Characterization and classification of phytoplasmas from wild and cultivated plants by RFLP and sequence analysis of ribosomal DNA. European J. Plant Pathol. 103:675-686.

Schneider, B. and Seemüller, E. 1994. Presence of 2 set of ribosomal genes in phytopathogenic mollicutes. Appl. Environ. Microbiol. 60:3409-3412.

Smart, C. D. Schneider, B., Blomquist, C. L. Guerra, L. J., Harrison, N. A., Aherens, U., Lorenz, K.-H., Seemüller, E. and Kirkpartrick, B. C. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 62:2988-2993.

Smith, R. E. 1902. Growing China aster. Hatch Exp. Station. Mass. Agric. Coll. Bull. 79. 26 pp.

Uehara, T., Tanaka, M., Shiomi, T., Namba, S., Tsuchizaki, T. and Matsuda, I. 1999. Histopathological studies on two symptom types of phytoplasma associated with lettuce yellows. Ann. Phytopathology. Soc. Jpn. 65:465-469.

Wang, K. and Hiruki, C. 2000. Heteroduplex mobility assay detects DNA mutations for differentiation of closely related phytoplasma strains. J. Microbiol. Methods. 41:59-68.

Wang, H., Qi, M. and Culter, A. J. 1993. A simple method of preparing plant samples for PCR. Nucleic Acids Res. 21:4153-4154.

Wang, G. L., Holsten, T. E. Song, W. Y. Wang, H-P. and Ronald, P. C. 1995. Construction of a rice bacterial artificial chromosome library and identification of clones linked to the Xa-21 disease resistance locus. Plant J. 7:525-533.

Zhang, Y-P. Uyemoto, J. K. and Kirkpatrick, B. C. 1998. A small-scale procedure for extracting nucleic acids from woody plants infected with various phytopathogens for PCR assay. J. Virol. Methods. 71:45-50.

Figure 1.1 Polymerase chain reaction-restriction fragment length polymorphism banding patterns of aster yellows phytoplasma isolates before and after the strain purification processes. The gel on the left shows the banding patterns of field AYP isolates before purification with the names starting with “I”. The isolates highlighted showed the RFLP banding pattern segregation compared with purified strains that were highlighted and had the names lacking “I” on the right gel. IAY-BW lost an 850-bp band and IAY-SS lost an 850-bp and a 350-bp band after the purification process. Lanes with the same name contain DNA extracts from different plants infected by the same strain. DNA was amplified by PCR using primers AY19p/AY19m and the PCR product was digested with DraI.

Figure 1.2 Symptoms caused by aster yellows phytoplasma AY-WB in China aster. A, B) uninfected plants at the 10 (A) and 15 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage.

40 Inoc.20 30 Inoc.15 Inoc.10

Height (cm) 20

0 1234567 Treatments

Figure 1.3 Average height and standard error of the mean for aster yellows phytoplasma- infected and healthy aster plants 1) Healthy aster plants; 2-7) Plants infected with aster yellows phytoplasma strains: AY-WB (2); AY-S (3); AY-BD2 (4); AY-SG (5); AY-BD3 (6) and AY-BW (7). Dotted bars represent the average height of plants inoculated at 20- expanded leaf stage; slashed bars represent the average height of plants inoculated at 15- unfolded leaf stage and open bars represent the average height of plants inoculated at 10- unfolded-leaf stage.

Figure 1.4 Average length and standard error of the mean for internodes of healthy aster plants and aster plants infected by aster yellows phytoplasma strain AY-WB at the 20- expanded leaf stage

Figure 1.5 Symptoms caused by aster yellows phytoplasma AY-WB in lettuce A, B) Healthy plants at the 8 (A) and 12 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at the 8 (C) and 12 (D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at the 8 (E) and 12 (F) expanded leaf stage. .

Figure 1.6 Ooze caused by aster yellows phytoplasma infection in lettuce. The symptomatic leaf was from lettuce infected with aster yellows phytoplasma AY-WB. The symptoms usually occurred at the late stage of infection.

Figure 1.7 Symptoms caused by aster yellows phytoplasma AY-S in China aster. A, B) uninfected plants at the 10 (A) and 15 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage.

Figure 1.8 Symptoms caused by aster yellows phytoplasma AY-S in lettuce A, B) Healthy plants at the 8 (A) and 12 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at the 8 (C) and 12 (D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at the 8 (E) and 12 (F) expanded leaf stage.

Figure 1.9 Symptoms caused by aster yellows phytoplasma AY-SG in China aster. A, B) uninfected plants at the 10 (A) and 15 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage.

Figure 1.10 Symptoms caused by aster yellows phytoplasma AY-SG in lettuce A, B) Healthy plants at the 8 (A) and 12 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at the 8 (C) and 12 (D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at the 8 (E) and 12 (F) expanded leaf stage.

57 A B

E F

Figure 1.11 Symptoms caused by aster yellows phytoplasma AY-BW in China aster. A, B) uninfected plants at the 10 (A) and 15 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage.

Figure 1.12 Symptoms caused by aster yellows phytoplasma AY-BW in lettuce A, B) Healthy plants at the 8 (A) and 12 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at the 8 (C) and 12 (D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at the 8 (E) and 12 (F) expanded leaf stage.

Figure 1.13 Symptoms caused by aster yellows phytoplasma AY-BD2 in China aster. A, B) uninfected plants at the 10 (A) and 15 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at 10(C) and 15(D) expanded leaf stage. .

Figure 1.14 Symptoms caused by aster yellows phytoplasma AY-BD2 in lettuce A, B) Healthy plants at the 8 (A) and 12 (B) expanded-leaf stages; C, D) symptoms at the early stage of infection for plants inoculated at the 8 (C) and 12 (D) expanded leaf stage; E, F) symptoms at the late stage of infection for plants inoculated at the 8 (E) and 12 (F) expanded leaf stage. 61

Figure 1.15 Restriction fragment length polymorphism (RFLP) analysis of aster yellows phytoplasma 16S rDNA amplified by polymerase china reaction (PCR) using the primers F2/R2. The first six samples from the left in Gel A were digested with AluI and the following six were digested with RsaI. The first 7 samples from the left in Gel B were digested with HhaI and the following seven were digested with HaeIII. The digested PCR products were run in 5% polyacrylamide gel.

Figure 1.16 Heteroduplex mobility analysis of closely related aster yellows phytoplasma strains. Lanes 1-4 contain PCR products amplified by S10F/S10R from AY-BW, AY- BD3, AY-SG and AY-S, respectively. Lanes 5-10 contain the hybridizations of AY- BW×AY-BD3, AY-BW×AY-SG, AY-BW×AY-S, AY-SG×AY-BD3, AY-BD3×AY-S and AY-SG×AY-S, respectively. Lanes 11-14 represent self-hybridization of the PCR products in Lanes 1-4 in the same order.

Figure 1.17 Aster yellows phytoplasma strain identification by multiplex PCR using pooled primers S1/S2, 15F/15R, BWF/BWR and 21F/21R. DNA extracts are as follows: 1) lettuce, 2) AY-BW, 3) AY-BD2, 4) AY-BD3, 5) AY-SS, 6) AY-SG, 7) AY-WB and 8) AY-S.

Figure 1.18 Polymerase chain reaction (PCR) using aster yellows phytoplasma AY-WB strain specific primers BF/BR. The lanes contain PCR products from 1) AY-BW, 2) AY- BD2, 3) AY-BD3, 4) AY-SG, 5) AY-WB, 6) AY-S, 7) uninfected lettuce, 8) uninfected carrot, 9) uninfected celery, 10) Western X, 11) Grapevine yellows, 12) Beet leafhopper transmitted virescence agent and 13) uninfected leafhopper.

Figure 1.19 Phylogenetic analysis of phytoplasma strains based on partial sequences of the 16S rRNA gene. AY1, Maryland aster yellows; Ach, Acholeplasma; AYPB, aster yellows phytoplasma (AYP) B strain; AshY, Ash yellows; AYPW, Aster yellows western strain; BWLP, Bermudagrass white leaf phytoplasma; EYP, Elm yellows; Cph, Clover phyllody; TBB, Tomato big bud; PaWB, Paulownia witches’-broom; PWB, Peanut big bud phytoplasma; SAY, Aster yellows western strain; WX, Western X. AYP strains from lettuce are highlighted. Roman numerals show groups based on RFLP of 16S rDNA and Arabic numerals show groups based on partial sequences of the 16S rRNA genes. All members of the 16SrI group are in one cluster in which PaWB is in a separate subgroup. Bootstrap values are from 1000 bootstrap repetitions. Only bootstrap values greater than 500 are shown.

Figure 1.20 Phylogenetic analysis of phytoplasma strains based on partial sequences of the 16S-23S gene spacer regions. The abbreviation AY1 stands for aster yellows phytoplasma strain1; AYPB, aster yellows phytoplasma B strain; AYPW, aster yellows western strain; Cph, Clover phyllody; GYP, Grapevine yellows; EYP, Elm yellows; WX, Western X; TBB, Tomato big bud; AshY, Ash yellows. AYP, an aster yellows phytoplasma; AYP strains from lettuce are highlighted. Roman numerals show groups classified based on RFLP of 16S rDNA and Arabic numerals represent subgroups based on 16S-23S spacer sequences. Bootstrap values are from 1000 bootstrap repetitions. Most members of the 16SrI group are in one cluster, but TBB is classified into a separate cluster.

Figure 1.21 Symptoms of an aster plant infected by aster yellows phytoplasma AY-WB before flowering. The symptoms only appear in flower parts. The flowers are from the same plant.

Abbreviation Name of microorganism or Accession 16Sr group disease No. TBB Tomato big bud phytoplasma L33760 16SrI-A AYPW Aster yellows western strain M86340 16SrI-A AY1 Maryland aster yellows L33767 16SrI-B Cph Clover phyllody phytoplasma AF222065 16SrI-C SAY Aster yellows western severe AF222063 16SrI strain AYPB Aster yellows phytoplasma B AF268405 16SrI isolate PaWB Paulownia witches’-broom AF279271 16SrI-D BWLP Bermudagrass white leaf AF248961 16SrXIV phytoplasma PWB Peanut big bud phytoplasma L33765 16SrII WX Western X disease L04682 16SrIII-B EYP Elm yellows phytoplasma AF122912 16SrV Ashy Ash yellows phytoplasma L33759 16SrVII Ach Acholeplasma palmae L33734 Out-group

Table 1.1 16S rRNA gene sequences from the Genbank database used in the phylogenetic analysis

Abbreviation Name of microorganism or disease Accession No. 16Sr group TBB Tomato big bud phytoplasma AJ274640 16SrI-A AYPW Aster yellows western strain M36340 16SrI-A AY1 Aster yellows phytoplasma AY1 AF322645 16SrI-B Cph Clover phyllody AF222066 16SrI-C AYP Aster yellows phytoplasma AF029220 16SrI AYB Aster yellows phytoplasma B AF503568 16SrI WX Western X phytoplasma U54992 16SrIII-B EYP Elm yellows phytoplasma U54991 16SrV Ashy Ash yellows phytoplasma U54986 16SrVII GYP Grapevine yellows phytoplasma L76865 16SrXII Ach Acholeplasma laidlawii D13260 Out-group

Table 1.2 16S-23S gene spacer sequences from the Genbank database used in the phylogenetic analysis

Primers Aster yellows phytoplasma strains Healthy AY- AY- AY- AY- AY- AY- AY- lettuce BW BD2 BD3 SS SG WB S BF/BR - - - - - + - - 15F/15R + + + - + - - - S2/AY19m - - - + - + + - 015F/015R + - - - + + - - S10F/S10R + - + - + - + -

Table 1.3 Amplification of DNA from aster yellows phytoplasma strains collected from lettuce by PCR with different sets of primers. DNA extracted from healthy lettuce was used as a negative control.

Strains Symptoms on aster Symptoms on lettuce

AY- Vein clearing, yellowing, leaf Vein clearing, yellowing, WB petiole abnormal upright, stunting, stunting, wilting and necrosis in witches’- broom, pigment loss or plants infected at early growth sterile stage, bolting in plant infected of flowers, necrosis at late growth stage, ooze

AY-S Yellowing of new emerging Yellowing, stunting, loss of leaf leaves, stunting, clustering of blade, ooze, leaf and stem scar leaves, phyllody and virescence

AY- Vein clearing, leaf petiole Bolting, leaf abnormal BW abnormal upright, chlorosis, elongation, chlorosis, ooze stunting, flower sterile and loss of pigment

AY-SG Vein clearing, petiole abnormal Vein clearing, yellowing, stem upright, yellowing, stunting, stem bending (semi-geotropism), bending, flower sterile ooze

AY- Vein clearing, leaf petiole Bolting, light green, distortion BD2 abnormal upright, yellowing, of stem and leaves, ooze flower sterile

Table 1.4 Aster yellows symptoms caused by different aster yellows phytoplasma strains in lettuce and aster plants. The list of symptoms is in the order of occurrence.

CHAPTER 2

CHARACTERIZATION OF THE SPREAD OF TWO ASTER YELLOWS PHYTOPLASMA STRAINS WITHIN LETTUCE PLANTS

INTRODUCTION

The diversity of aster yellows symptoms in lettuce fields is related to several aster yellows phytoplasma strains (Errampalli and Fletcher 1991; Murral et al. 1996; Chapter

I). Beanland and coworkers (2000) showed that leafhoppers infected by aster yellows phytoplasma Bolt lay more eggs than those infected by Severe (Beanland et al. 2000).

Nymphs usually feed on infected plants and become infected before they move to other plants, suggesting that the Bolt strain might be more prevalent than the Severe strain in lettuce fields in Ohio (Beanland et al. 2000). This hypothesis was based on the relationship between the leafhopper vectors and aster yellows phytoplasmas—two of three main factors in vector-transmitted diseases. The relationship between host plants and aster yellows phytoplasmas may also affect the epidemics of aster yellows by affecting phytoplasma distribution within the host plants, thus influencing leafhopper acquisition.

Phytoplasma distribution was first investigated indirectly by observing symptom progression in infected plants. Kunkel (1926) observed asymmetric symptoms in China

73 aster (Callistephus chinensis) plants in which mature leaves were inoculated, but not in those in which immature leaves were inoculated by infectious leafhoppers. He postulated that asymmetric infection was due to the causal agents entering the stem at a distance from growing points and that stem growth was responsible for spread of the disease.

Non-uniform distribution was detected with DNA probes in walnut trees infected by walnut witches’-broom phytoplasmas (Chen et al. 1992). However, Kuske and

Kirkpatrick (1992), using DNA hybridization methodology and graft transmission, observed similar uniform colonization patterns for western aster yellows phytoplasma strains Severe (SAY) and Dwarf (DAY) in Catharanthus roseus even if SAY colonized periwinkle more rapidly than DAY. Ash yellows phytoplasmas were detected by DNA hybridization mainly in the phloem of the trunk base, and less in roots and leaves

(Sinclair et al. 1992).

Numerous methods have been used to study phytoplasma distribution within host plants. The movement of beet yellows particles was determined by removal of inoculated leaves (Bennett 1960). Bijan et al. (1988) showed, by using electron microscopy, densely packed phytoplasmas in sieve elements of symptomatic shoot terminals of Kirganellia reticulata and Averrhoa rustica. Schaper and Seemüller (1982) studied seasonal distribution of apple proliferation and pear decline phytoplasmas using 4, 6-diamidino-2- phenylindole staining (DAPI) and epifluorescence microscopy. Lherminier et al. (1994) determined the distribution and multiplication of Flavescence Dorée mycoplasmalike organisms (MLO) in Vicia faba using ELISA and immuno-cytochemistry. They detected the MLO first from roots then from growing points. More recently, highly sensitive 74 polymerase chain reaction (PCR) assays have been used to track phytoplasmas in host plants (Schaff et al. 1992; Kramer and Tsai 1994; Henson and French 1993; Lorenz et al.

1995). Sahashi et al. (1995) detected seasonal variation of phytoplasmas in paulownia trees with PCR and found a systemic movement pattern similar to other vector transmitted diseases (Leisner and Turgeon 1993; Gilbertson and Lucas 1996).

Kloepper et al. (1982) found that S. citri population in celery leaves decreased with increment of age of the leaves. Siddique et al. (1998) used PCR to detect phytoplasmas causing papaya dieback in immature leaves and roots, but failed to detect phytoplasmas from mature leaves at all the stages of infection. Tan and Whitlow (2001) found that periwinkle leaves formed before inoculation remained asymptomatic until senescence.

Fletcher and Eastman (1984) did not find spiroplasmas of S. citri in the oldest leaves of turnip plants. They speculated that this was because old leaves received little nourishment. This evidence implies that the systemic translocation of phytoplasmas may follow a source-sink pattern, possibly similar to photosynthate distribution.

Leafhopper acquisition is related to phytoplasma distribution within host plants. To date, the majority of investigations on phytoplasma distribution have been made on perennial plants. I am not aware of any report on distribution of aster yellows phytoplasmas within lettuce plants during symptom development. Lettuce is a small annual with a relatively short growing period. Lettuce plants infected with aster yellows phytoplasma usually show symptoms in about 2-3 weeks, but the pattern of phytoplasma spread within lettuce plants is still unclear. Therefore, the investigation of aster yellows 75 phytoplasma distribution in lettuce plants in time and space can provide not only information on the time when an infected lettuce plant becomes a source of inoculum, but also the probability that a leafhopper will acquire the disease by feeding on different parts of the infected plant. The information may lead to development of effective cultural disease control procedures. The objective of the experiment was to investigate the distribution within lettuce plants of two aster yellows phytoplasma strains AY-BD2 and

AY-S. Both strains belong to 16SrI-B subgroup and are common in vegetable production areas in Ohio, USA. The strain AY-BD2 causes symptoms in lettuce that are similar to those caused by Bolt (Murral et al. 1996).

MATERIALS AND METHODS

AY-BD2 and AY-S were maintained in aster and oats. Healthy leafhoppers were allowed a 4-day acquisition access period (AAP) on symptomatic aster plants. The leafhoppers were then removed and put on 3-week-old oat seedlings at 25 °C with a 16- hour light period for over 20 days to pass the incubation period. Presumed inoculative leafhoppers were allowed a 4-day inoculation access period (IAP) on 10-15 expanded- leaf healthy aster plants, then removed from the plants. Inoculated plants were kept in a greenhouse at 25/22±2°C (day/night) for symptom development (Murral et al. 1996).

Romaine lettuce ‘Parris Island cos’ seeds (ASGROW Vegetable Seeds, Gonzales,

CA 93926 USA) were planted in plastic pots 15 cm diameter × 20 cm deep. All pots were set in plastic trays with 0.5 cm water to protect them from water stress. Five plants

76 each were inoculated on Leaf 5 by four leafhoppers infected with aster yellows AY-BD2 or AY-S at the eight-expanded-leaf stage. Leafhoppers were put into a nylon net-sealed cage (3.0 cm in diameter and 1.0 cm thick). The side of the cage with nylon net was placed against the leaf surface and held in place with a clip, allowing leafhoppers to feed through the net holes (Figure 2.1). Five plants were inoculated for each strain. After a 2- day IAP, the leafhoppers were removed and the plants were sprayed with insecticide

1100 Pyrethrum TR (Whitmire Micro-Gen Research Laboratories Inc. St. Louis, MO) and set in greenhouse (day temperature 25±2°C and night temperature 20±2°C) for symptom development. For detection of aster yellows phytoplasmas in leaves, samples were taken on the 5th, 10th, 16th and 25th day after beginning the IAP. Two pieces of leaf tissue, each about 1 cm2, were sampled from the leaf margin of all the expanded leaves on a plant (15-30) − one at the tip and the other at the base of the leaves. The experiment was done twice. DNA was extracted using the CTAB method (Zhang, Y-P et al. 1998) and amplified by PCR or stored frozen at –20°C. Aster yellows phytoplasma was detected by PCR using aster yellows phytoplasma 16S rDNA primers F4/R1 (Davis and Lee 1993). The PCR mixture contained: 1X PCR buffer (200 mM Tris-HCl pH 8.4 and 500mM KCl), 2.0 mM MgCl2, 0.2 mM dNTPs, 0.5 µM each of primer F4/R1, 0.25

U DNA Taq polymerase and 0.5 µl 50ng/µl DNA in a final volume 10µl. The amplification was performed under the conditions: 94°C for 2 minutes followed by 30 cycles of 94°C for 30 seconds, 50°C for 30 seconds and 72°C for 1 minute with 10 minute extension at 72°C following the last cycle. The PCR product was electrophorized in 1.0% agarose gel, stained with ethidium bromide and visualized under UV light.

In another experiment, 20 lettuce plants at the eight expanded-leaves stage were inoculated on Leaf 5 by four inoculative leafhoppers carrying either AY-S or AY-BD2.

Ten plants were sampled randomly one week after initiation of the IAP (two days). The other plants were sampled two weeks after initiation of the IAP. DNA was extracted using the CTAB method from 0.2 g leaf tissue from the midrib down towards the stem from leafhopper feeding positions and the base and top margins of inoculated leaves, and tested with PCR using primer F4/R1. DNA was also extracted weekly from the cross sections of the middle position of the stems and the growing point tissues from five of the plants, starting from initiation of the IAP, and tested using PCR as described above.

Aster yellows phytoplasma distribution within a plant was described in two dimensions. The horizontal distribution was referred to as the distribution of phytoplasma- infected leaves around the stem of an infected plant. The leaves were arbitrarily divided into two equivalent sections with the stem as the core. Section 1 included the leaves within a 180° angle with the midrib of the inoculated leaf as bisector.

Section 2 included those within the 180° angle opposite Section 1. The angle between the midrib extension line of each leaf and the midrib extension line of the inoculated-leaf was measured. Each leaf was also marked with an ordinal number according to its emergence and the angles of the newly expanded leaves were continuously measured and marked until no more expanding leaves appeared. The number of aster yellows phytoplasma-positive leaves detected by PCR in either section was counted and

78 compared. Chi-square analysis was used to test the null hypothesis that the leaves infected by aster yellows phytoplasma were uniformly distributed in the two sections and a t test was used to compare the distribution difference between the two aster yellows phytoplasma strains.

The vertical distribution refers to the distribution of aster yellows phytoplasma- infected leaves from bottom to top of a plant. All expanded leaves (15-30) on an inoculated plant were tested by using PCR with primers F4/R1. The PCR products were run in a 1% agarose gel and the gel was stained with ethidium bromide and photographed under UV light. A running total of PCR positive leaves was counted using a sliding window covering five consecutive gel lanes (or leaves) from the bottom to the top of a plant (Figure 2.2). The window was moved one lane (to the right) for each step (Stryer

1995; Le et al. 2000; Takami, H. et al. 2000); the consecutive windows were overlapped by four leaves. When the same number of positive leaves appeared in more than one window, only the number in the window nearest the plant base was plotted against the ordinal number of the window in the coordinate. Fitting a regression line to the data points of the 16th and 25th day after initiation of the IAP represented the phytoplasma translocation trend of each strain within a lettuce plant.

RESULTS

Symptom development. Aster yellows symptoms were first observed in newly emerging leaves on the same side as the inoculated leaf for both strains two weeks after the beginning of the IAP. Lettuce plants infected by AY-S became chlorotic and then were 79 stunted. Progressively smaller leaves emerged until no more leaves were produced.

Leaves that were fully expanded (mature) at the time of inoculation showed a smooth surface compared with healthy leaves and these leaves usually curled under. Plants infected by AY-BD2 showed vein clearing in the newly emerging and expanding leaves, which gradually became light green, yellow and twisted. Leaves that were mature at the time of inoculation showed no symptoms 25 days after the initiation of the IAP. Plant growth was less suppressed by AY-BD2 infection than by AY-S infection.

Horizontal distribution of aster yellows phytoplasmas. Aster yellows phytoplasmas were first detected by PCR with primers F4/R1 from newly expanded asymptomatic leaves on the same side as the inoculated leaf 10 days (AY-S) and 16 days (AY-BD2) after beginning the IAP. Sixteen days after initiation of the IAP for AY-BD2, 66% of the aster yellows-positive leaves detected by PCR were distributed within the 180° section containing the inoculated leaf and 34% were in the opposite section (Figure 2.3). Similar results were observed in the plants inoculated by AY-S: 64% of aster yellows positive leaves detected by PCR were in the section containing the inoculated leaf, and 36% were in the opposite section. The differences between strains were not significant (P = 0.825 df = 5). A Chi-square test on pooled sectional aster yellows-positive leaves indicated that the number of aster yellows phytoplasma-infected leaves was not uniform around the stem of an infected plant (0.02

80 Vertical distribution of aster yellows phytoplasmas. Phytoplasmas of AY-S were detected by PCR from the third leaf in average up above the inoculated leaf 10 days after initiation of the IAP. Phytoplasmas of AY-BD2 were not detected in the expanded leaves until 16 days after the IAP, the fourth leaf in average above the inoculated leaf 16 days after inoculation. In AY-BD2-infected plants, the number of aster yellows phytoplasma- positive leaves detected by PCR in the sliding windows were not significantly different on the 16th and 25th days after initiation of the IAP. The number of aster yellows-positive leaves for these two dates was represented with one regression line (Figure 2.4). In AY-

S-infected plants, however, the number of aster yellows phytoplasma-positive leaves detected by PCR was significantly different between the 16th and 25th day after initiation of the IAP, and were fitted to two regression lines (Figure 2.5). On the 16 day sampling, most of the aster yellows-positive leaves for both strains were those that emerged and expanded after initiation of the IAP. On the 25th day after inoculation, Severe was detected in older leaves (closer to the inoculated leaves) including leaves that were expanded at the time of the inoculation while the phytoplasmas of AY-BD2 were not.

Unidirectional translocation of aster yellows phytoplasmas. Aster yellows phytoplasmas of both strains were detected by PCR from the midribs, but not from the tip and basal margins of inoculated leaves one week after initiation of the IAP. Two weeks after initiation of the IAP, phytoplasmas were detected from the midribs, stems and the growing points from weekly-collected samples. Most tip margin and basal margin samples were still negative and only one sample from base margin of an AY-S- inoculated leaf was detected aster yellows positive by PCR, suggesting that 81 phytoplasmas mainly (were) translocated unidirectionaly within the inoculated leaves

(Table 2.1). Although phytoplasmas were first detected from the midribs of the inoculated leaves, the leaves did not show symptoms until that late stage of infection.

DISCUSSION

Aster leafhoppers overwinter only as eggs in winter covering crops and perennial host plants in Ohio and transovarial transmission has not been observed in the vector species (Alma et al. 1997). The primary inoculum is introduced by immigrating aster yellows-infected leafhoppers early in the growing season (Hoy et al. 1992). Lettuce plants infected early in the growing season can serve as the secondary inoculum for subsequent plantings (Madden et al. 1995). The average longevity of adult leafhoppers is about five weeks (Murral et al. 1996), and the study of epidemics of aster yellows in lettuce largely depends on the number of infectious leafhoppers in new generations.

Aster yellows phytoplasmas of AY-S spread more quickly and widely within infected plants than those of AY-BD2, which implies that leafhoppers could acquire phytoplasmas more easily from the plants infected by aster yellows phytoplasma AY-S than by AY-BD2. Whether or not this would result in a higher frequency of AY-S in lettuce fields depends on several additional factors, including leafhopper-feeding preferences, effect of strains on leafhoppers longevity and fecundity and mortality of lettuce after infection. Stunting, necrosis and rapid mortality of AY-S-infected plants may negate any advantage to the phytoplasma of more extensive distribution within the plants. In addition, leafhoppers infected with AY-S produce fewer eggs than those infected with Bolt, a strain related to AY-BD2 (Beanland, 1998). With these conditions 82 in mind, as well as the fact that numerous strains may be involved (Chapter I), more work is needed on the influence of aster yellows phytoplasma strains on the epidemiology of aster yellows in lettuce. This is now possible with the development of strain specific primers for strain detection and differentiation (Chapter I).

Aster yellows phytoplasma strain AY-BD2 was not detected by PCR 25 days after initiation of the IAP from leaves that had expanded at the time of inoculation, which is consistent with results observed for phytoplasmas that cause papaya dieback and ash yellows phytoplasmas (Siddique et al. 1998; Tan and Whitlow 2001). However, the aster yellows phytoplasmas of AY-S did spread to the leaves that were fully expanded

(mature) at the time of inoculation. This result is consistent with the distribution and multiplication of western ‘Severe’ aster yellows phytoplasma in periwinkle plants inoculated by grafting in which the phytoplasmas were found to be distributed throughout infected plants (Kuske and Kirkpatrick 1992). Obviously, there are differences in phytoplasma distribution among aster yellows phytoplasma strains in host plants. While this result may have implications for leafhopper acquisition in the field, it may also affect sampling strategies for detection of phytoplasmas in lettuce. (Jarausch et al. 1999).

The detection of AY-S phytoplasmas in lettuce leaves that were expanded at the time of inoculation may be due to the severe suppression on plant growth caused by this strain. The growth suppression significantly reduces metabolic sinks (Tan and Whitlow

2001), such as newly emerging and expanding leaves, resulting in the redistribution of

83 photoassimilates. In the absence of these otherwise most competitive sinks, the phytoplasmas of AY-S may be redirected towards the expanded and mature leaves. The growth of plants infected by AY-BD2, on the other hand, was less suppressed than by

AY-S. Phytoplasmas of AY-BD2 may have been translocated, along with photoassimilates, into leaf petioles following a source-to-sink pattern as suggested by

Tan and Whitlow (2001). Starving China aster leaves by covering them with black paper envelopes for two days before their inoculation significantly retarded symptom development in inoculated plants. When the inoculated leaves were kept in the dark during the IAP and were cut off immediately after a 2-day IAP, some of the plants did not develop symptoms, suggesting that spread of aster yellows phytoplasma may be impeded by the lack or significant reduction of export of photosynthates (unpublished data). This postulate is consistent with systemic translocation of viruses that was correlated with food movement in plants (Bennett, 1927; Bennett 1960; Esau et al. 1966;

Cronshaw and Esau 1967). In light of the above observations, we expanded the postulate further that aster yellows phytoplasma long distance translocation is mainly passive in nature, as for viruses (Esau et al. 1967; Kennedy and Park 1971). However, the possibility of active movement, as found in other species of Mollicutes (Jacob et al.

1997), cannot be excluded. The filamentous form of phytoplasmas found predominantly in the early stage or middle stage of phytoplasmal infection (Lee and Davis 1983; Jacoli

1978 a, b) suggests that active movement could occur in the hosts. How much this kind of movement contributes to systemic infection remains unclear. It is also possible that the severe growth suppression by AY-S might result from rapid phytoplasma cell multiplication. 84

PCR detection results indicate that aster yellows symptoms are closely related to the presence of aster yellows phytoplasmas in the organs, suggesting that physical presence of the causal agents plays an important role in causing host symptoms, although infection may interrupt the plant hormone balance. Interference to plant hormones by phytoplasmal infection (Tian et al. 2001; Pecho et al. 1990) may be due to local interaction between the phytoplasma and host tissues.

SUMMARY

Aster yellows phytoplasma is a systemic plant pathogen transmitted by the phloem feeding vector, the aster leafhopper. Instead of causing the symptoms at the site of inoculation, the pathogen causes the symptoms at a distance from the inoculation sites.

The symptoms usually first appear in sink organs. In this study, phytoplasmas were detected by PCR seven days before aster yellows symptoms appeared at the growing points of lettuce plants, which indicates that aster yellows symptoms are closely related to the presence of phytoplasmas. There was a translocation (or distribution) difference between aster yellows phytoplasma strains. The phytoplasmas of AY-S spread faster than those of AY-BD2. Furthermore, the phytoplasmas of AY-S, but not AY-BD2 were detected from leaves already expanded at the time of inoculation. Aster yellows phytoplasmas were detected from the midrib, stem then growing point before symptom appearance but rarely from the margins of the inoculated leaves two weeks after initiation of the IAP, suggesting that the movement of aster yellows phytoplasmas in the leaves was mainly unidirectional. Since the phytoplasmas of AY-S spread faster and 85 more widely that those of AY-BD2, the leafhoppers could acquire the pathogen more readily from the lettuce plants infected by aster yellows phytoplasma AY-S. These distribution data are also important for reliable detection or diagnosis of this disease.

REFERENCES

Alma, A., Bosco, D., Danielli, A., Bertaccini, A., Vibio, A. and Arzone, A. 1997. Identification of phytoplasmas in eggs, nymphs and adults of Scaphoideus titanus Ball reared on healthy plants. Insect Molecular Biology. 6:115-121.

Beanland, L. Hoy, C. W. Miller, S. A. and Nault, L. R. 1999. Leafhopper (Homoptera: Cicadellidae) transmission of aster yellows phytoplamsa: Does gender matter? Environ. Entomol. 28:1101-1106.

Beanland, L., Hoy, C.W., Miller, S.A. and Nault, L.R. 2000. Influence of aster yellows phytoplasma on the fitness of aster leafhopper (Homoptera: Cicadellidae). Ann. Entomol. Soc. Am. 93:271-276.

Bennett, C. W. 1927. Virus diseases of raspberries. Mich. Agr. Expt. Sta. Tech. Bull. 80.

Bennett, C. W. 1960. Sugar beet yellows diseases in the United States. U.S. Dept. Agr. Tech. Bull. 1281:1-63.

Bijan, K. G., Misra, S. and Muniyappa, V. 1998. Comparative morphology of mycoplasma-like organisms. (In) Mycoplasma diseases of crops – Basic and applied aspects (ed.) by Maramorosch, K. and Raychaudhuri, S. P. Springer- Verlag. New York.

Chen, J., Chang, C. J. and Jarret, R. E. 1992. DNA probes as molecular markers to monitor the seasonal occurrence of walnut witches’-broom mycoplasmalike organisms. Plant Dis. 76:1116-1119.

Cronshaw, J. and Esau, K. 1967. Tubular and fibrillar components of mature and differentiating sieve elements. J. Cell Biol. 34:801-816.

Davis, R. E., and Lee, I-M. 1993. Cluster-specific polymerase chain reaction amplification of 16S rDNA sequences for detection and identification of mycoplasmalike organisms. Phytopathology 83:1008-1011.

Errampalli D. and Fletcher J. 1991. Incidence of yellows in carrot and lettuce and characterization of mycoplasmalike organism isolates in Oklahoma. Plant disease, 6:579-584.

Esau, K., Cronshaw, J. and Hoefert, L.L. 1967. Relation of beet yellows to the phloem and to movement in the sieve tube. J. Cell Biol. 32:71-87.

87 Esau, K., Cronshaw, J. and Hoefert, L.L. 1966. Organization of beet yellows-virus inclusions in leaf cells of beta. Proc. Natl. Acad. Sci. U.S. 55:486-493.

Fletcher, J. and Eastman, C.E. 1984. Translocation and multiplication of Spiroplasma citri in turnip (Bassica rapa). Current Microbiol. 11:289-292.

Gibertson, R.L. and Lucas, W.J. 1996. How do viruses traffic on the ‘vascular highway’? Trands Plant Sci. 1:260-268.

Henson, J.M. and French, R. 1993. The polymerase chain reaction and plant disease diagnosis. Ann Review of Phytopathology 31:81-109.

Hoy, C. W., Heady, S. E. and Koch, T. A. 1992. Species comparison, phenology, and possible origins of leafhoppers (Cicadellidae) in Ohio vegetable crops. Hort. Entomol. 85:2336-2343.

Jacoli, G.G.1978 (a). Early phases of degeneration of mycoplasma-like bodies in plant tissue cultures infected with Mycoplasma hominis. Can. Microbiol. 24:1053- 1057.

Jacoli,G.G.1978 (b). Sequential degeneration of mycoplasma-like bodies in plant tissue cultures infected with aster yellows. Can.J. Bot. 56:133-140.

Jacob, C., Nouzieres, F., Duret, S. Bove, J.-M. and Renaudin, J. 1997. Isolation, characterization, and complementation of a motility mutant of Spiroplasma citri. J. Bacteriol. 179:4802-4810.

Jarausch, W., Lansac, M. and Dosba, F. 1999. Seasonal colonization pattern of European stone fruit yellows phytoplasmas in different Prunus species detected by specific PCR. J. Phytopathology 147:47-54.

Kramer, J.B., and Tsai, J.H. 1994. Detection of the mycoplasma-like organism associated with lethal yellowing disease of palms in Florida by polymerase chain reaction. Plant pathology 998-1008.

Kennedy, D. and Park, R. B. 1971. Virus Movement. (in) Phloem Transport in Plants, A Series of Books in Biology. WH Freeman and Co. pp.203-215.

Kloepper, J.W., Garrott, D.G. and Oldfield, G.N. 1982. Quantification of plant pathogenic spiroplasmas from infected plants. Phytopathology 72:577-581.

Kunkel, L.O. 1926. Study on aster yellows. Am. J. Botany 13:646-705.

Kunkel, L. O. 1955. Cross protection between strains of yellows-type viruses. Adv. Virus Res. 3:251-273. 88

Kuske, C. R. and Kirkpatrick, B. C. 1992. Distribution and multiplication of western aster yellows mycoplasmalike organisms in Catharanthus roseus as determined by DNA hybridization analysis. Phytopathology 82:457-462.

Le, Q.H., Wright, S., Yu, Z. and Buteau, T. 2000. Transposon diversity in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 79:7376-7381.

Lee, I.-M. and Davis, R. E. 1983. Phloem-limited prokaryotes in sieve elements isolated by enzyme treatment of disease plant tissues. Phytopathology 73:1540-1543.

Leisner, S.M. and Turgeon, R. 1993. Movement of virus and photoassimilate in the phloem: a comparative analysis. Bioassays 15:741-748.

Lherminier, J., Curtois, M. and Caudwell, A. 1994. Determination of the distribution and multiplication sites of Flavescence Dorée mycoplasma-like organisms in the host plant Vicia faba by ELISA and immunocytochemistry. Physiol. Mol. Plant Pathol. 45:125-138.

Lorenz, K-H., Schneider, B., Ahrens, U., Seemüller, E. 1995. Detection of the apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopathology 85:771-6.

Madden, L. V., Nault, L. R., Murral, D. J. and Apelt, M. R. 1995. Spatial pattern analysis of the incidence of aster yellows disease in lettuce. Res. Popul. Ecol. 37(2):279- 289.

Murral, D. J., Nault, L. R. Hoy, C. W. Madden, L. V. and Miller, S. A. 1996. Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper (Homoptera: Cicadellidae). J. Economic Entomol. 89:1223-1232.

Pecho, L. and Vizarova, G. 1990. Plant hormones in the tissues of healthy and mycoplasma-infected currants. Sbornik UVTIZ (Ustav Vedeckotechnickych Informaci pro Zemedelstvi) Ochrana Rostlin. 26:181-186. (English abstr.)

Sahashi, N., Nakamura, H., Yashikawa, N., Kubono, T., Shoji, T. and Takahashi, T. 1995. Distribution and seasonal variation in detection of phytoplasma in bark phloem tissues of single paulownia trees infected with witches’ broom. Ann. Phytopathology Soc. Jpn. 61:481-484.

Sato, M., Wei, W., Kawakita, H. and Sato, Y. 2001. Horizontal and vertical movements of mulberry dwarf-phytoplasmas in mulberry trees. 101st general meeting of the American society for microbiology. Orlando, FL, USA. May 20-24.

89 Schaff, D. Lee, I.-M. and Davis R.E. 1992. Sensitive detection and identification of Mycoplasma-like organism in plants by polymerase chain reactions. Biochem. and Biophys. Res. Commun. 186:1503-1509.

Schaper, U. and Seemüller 1982. Conditions of the phloem and persistence of mycoplasmalike organisms associated with apple proliferation and pear decline. Phytopathology 72:736-742.

Schneider, I. Introduction, translocation, and distribution of viruses in plants. Advan. Virus Res. 11:163-221.

Siddique, A. B., Guthrie, J. N., Walsh, K. B., White, D. T. and Scott, P. T. 1998. Histopathology and within plant distribution of the phytoplasma associated Australian papaya dieback. Plant Dis. 82(10): 1112-1120.

Sinclair, W. A., Griffiths, H. M., Davia, R. E. and Lee I-M. 1992. Detection of ash yellows mycoplasmalike organisms in different tree organs and in chemically preserved specimens by a DNA probe vs. DAPI. Plant Dis. 76:154-158.

Stryer, L. 1995. Biochemistry, 4th edition. pp. 284. W. H. Freeman and Company. New York.

Takami, H., Nakasone, K., Takaki, Y., Maeno, G., Sasaki, R., Masui, N., Fuji, F., Hirama, C., Nakamura, Y., Ogasawara, N., Kuhara, S. and Horikoshi, K. 2000. Complete genome sequence of the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis. Nucleic Acids Res. 28:4317-4331.

Tan, P.Y. and Whitlow, T. 2001. Physiological responses of Cathranthus roseus (periwinkle) to ash yellows phytoplasmal infection. New Phytologist, 150:757- 769.

Tian, G-Z., Zhu, S-F., Luo, F., Li, H-F. and Qiu, W-F. 2001. Effects of Agrobacterium tumefaciens on the symptoms of Paulownia sp. plantlet in vitro cultured. Forest Res. 14:258-264.

Zhang, Y-P. Uyemoto, J, K. and Kirkpatrick, B. C. 1998. A small-scale procedure for extracting nucleic acids from woody plants infected with various phytopathogens for PCR assay. J. Virol. Methods, 71: 45-50.

Figure 2.1 Illustration of inoculation of lettuce using inoculative leafhoppers (Macrosteles quadrilineatus Forbes). Four leafhoppers were allowed to feed on the plant through a nylon net-sealed cage.

Figure 2.2 Schematic representation of a sliding window superimposed on a gel image. Each frame covered five lanes (i.e. five leaves) and two constitutive frames overlapped by four lanes (the window sliding one lane for each step). M: 1kb DNA ladder. The number above the gel represents ordinal number of each leaf on a plant. The positive control is represented by “+”.

Figure 2.3 Aster yellows-positive leaves detected by PCR in two sections around the stem of lettuce plants. Inoculated side contains leaves in 180° with midrib of inoculated leaf as the bisector. Opposite side contains leaves in the opposite section. Strain names followed by I show leaves in inoculation side and by O in opposite side.

Figure 2.4 Detection of aster yellows phytoplasma in lettuce by PCR 16 and 25 days after the beginning of inoculation access period (IAP) with BD-2 inoculative leafhoppers. The data points (three plants) represent the number of aster yellows-positive leaves within each window (five consecutive leaves) detected by PCR using primers F4/R1. Two consecutive windows overlap by four leaves (gel lane). Only the first windows are plotted if more than one consecutive window contains the same number of aster yellows- positive leaves. Fitted regression line Y=-0.629+0.541X with P=0.000, where Y is the number of aster yellows positive leaves in a window and X is the window number.

Figure 2.5 Detection of aster yellows phytoplasma in lettuce by PCR 16 and 25 days after the beginning of inoculation access period (IAP) with AY-Severe inoculative leafhoppers. The data points represent the number of aster yellows-positive leaves within each window (five consecutive leaves) detected by PCR using primers F4/R1. Two consecutive windows overlap by four leaves (gel lane) Only the first windows are plotted if more than one consecutive windows contain the same number of aster yellows-positive leaves. The fitted lines Y=-3.22+0.405X with P=0.001 (for 8/22) and Y=-1.37+0.514 with P=0.000 (for 8/30), where Y is the number of aster yellows positive leaves in a window and X is the window number.

Weeks after AY-S AY-BD2 inoculation Midrib Tip Base Stem Growing Symptom Midrib Tip Base Stem Growing Symptom point Point

1 + - - - - Y * * - - - N + * - - - Y + - - - - Y - - - - - Y - + - - - Y - - - - - N + - - - - Y - - - - - N + - - - - Y + - - * * Y + - - * * Y + - - * * Y + - * * * N - - - * * Y - - - * * Y + - - * * N + * - * * Y

96 * * * * * * - - - * * N

2 - * - + + Y - * - + + Y + - - + + Y + - - + + Y + - - + + Y + * - + + Y - - - + + Y * - - + + Y + - - - - N - - - - - N + - -/+ * * Y + - - * * Y * * * * * Y * * - * * N - - - * * N + - - * * Y + * + * * Y + - - * * Y * * * * * Y - - * * * Y

Table 2.1 Aster yellows phytoplasmas AYP-S and AY-BD2 detected at different positions of inoculated leaves by polymerase chain reaction with primers F4/R1. Positive samples are represented with +, negative with - and missed data with *. Plants showed symptoms at the end of the experiment are shown as Y and symptom-less plants as N. A possible positive sample was represented as -/+. DNA was extracted with 0.2 g tissue sampled at the tip margin, midrib and base margin of the inoculated leaves.

CHAPTER 3 CHARACTERIZATION OF ASTER YELLOWS PHYTOPLASMA STRAIN AY- WB AND SEQUENCING OF ITS 800 KB GENOME

INTRODUCTION

Phytoplasmas belong to the Class Mollicutes, characterized by small AT-rich genomes and lack of cell walls. Other mollicutes are spiroplasmas, mycoplasmas, ureaplasmas and acholeplasmas. The 580.073 kb genome of the human pathogen

Mycoplasma genitalium was the second bacterial genome sequenced to completion

(Fraser et al. 1995). To date, full genome sequences are available from the human pathogens M. pneumoniae (Himmelreich et al. 1996), Ureaplasma urealyticum and M. penetrans (Glass et al. 2000; Sasaki et al. 2002), and the murine pathogen M. pulmonis

(Chambaud et al. 2001). Genome sequencing of several plant pathogenic mollicutes are ongoing (Kamoun and Hogenhout 2001; Oshima et al. 2002), but none have been completed.

Within the Class Mollicutes, all phytoplasmas and three Spiroplasma species are plant pathogens and transmitted by insect vectors in which they replicate. After acquisition by insects, these mollicutes traverse the gut epithelial cell layer, replicate in various insect tissues including the salivary glands, and are introduced into the plant with

insect saliva during feeding. In the plant, they replicate intracellularly in phloem tissues.

Although phytoplasmas and spiroplasmas occupy similar habitats, they are only distantly related within the class Mollicutes (Kuske and Kirkpatrick 1992; Gundersen et al. 1994).

Further, spiroplasmas have a unique helical shape, and spiroplasmas but not phytoplasmas can be cultured in vitro.

Phytoplasmas cannot be cultured and mixed phytoplasma infections are common in nature (Schneider et al. 1998; Lee et al. 1995; Errampalli and Fletcher 1991). The inability being cultured in vitro hindered genomic DNA purification and genomics study.

Therefore, phytoplasmas were classified based on restriction fragment length polymorphism (RFLP) of 16S rDNA and elongation factor TU (tuf gene) amplified products (Gardner et al. 1996; Jomantiene et al. 1998; Lee et al. 1998; Marcone et al.

2000). The aster yellows group is the largest among phytoplasmas and was assigned to

16SrI based on PCR-RFLP analysis of 16S rDNA (Lee et al. 1993, 1998). More than 100 isolates have been described worldwide (Marcone et al. 2000). Aster yellows phytoplasmas cause disease in over 300 species of broad-leaf, herbaceous plants and several woody fruit crops (McCoy et al. 1989). In the United States, aster yellows phytoplasma is primarily transmitted by aster leafhoppers (Macrosteles quadrilineatus

Forbes).

The aster yellows phytoplasma group is relatively homogeneous, differing on average in 2.6% of the 16S rDNA nucleotide positions, but can be subdivided into several subgroups. Thus far, 10 subgroups have been described based on RFLP analysis 98

of the 16S rDNA, and the same aster yellows phytoplasma isolates clustered into eight subgroups based on RFLP analysis of the tuf gene sequences (Marcone et al. 2000).

Despite the low sequence variation in 16S rRNA gene sequences among aster yellows phytoplasmas, their genome size varies considerably, from 660 to 1,185 kb (Neimark and

Kirkpatrick 1993; Marcone et al. 1999). Extensive genome variations were also observed among isolates from the Stolbur phytoplasma group (8601,350 kb), and in various other mollicute genera, including Mycoplasma spp. (580 1,380 kb) and Spiroplasma spp. (780 2,220 kb) (Marcone et al. 1999, Razin et al. 1998).

Several methods for the isolation of phytoplasma DNA have been reported, including discontinuous gradient centrifugation and affinity chromatography (Jiang et. al. 1987;

1988; Kollar et al. 1990; Sears et al. 1989). Pulse field gel electrophoreses (PFGE) has been used for characterization of phytoplasma genome sizes and content in ground plant tissues (Marcone et al. 1999; Neimark and Kirkpatrick 1993; Firrao et. al. 1996). In this chapter, I report the process of isolation using PFGE and cloning of the genome of AYP strain AY-WB, construction of a shotgun library and the preliminary characterization of the AYP genome.

MATERIALS AND METHODS

Leafhopper colony establishment and maintenance. Leafhopper colonies were maintained in 40×40×20 cm nylon cages containing oat (Avena sativa) plants, and reared at 25 °C and 16-hour light period (Murral et al. 1996). An aster yellows

phytoplasma-free leafhopper colony was established from leafhoppers collected in a vegetable field in Celeryville, Ohio in 1998. Adult leafhoppers were placed on seedlings of oat a host of aster leafhopper but not of aster yellows phytoplasmas, to allow oviposition. The 2-3 instar nymphs were transferred to a new cage containing oat seedlings and reared as described. Leafhoppers of the first two/three generations were randomly sampled from the cages and tested by PCR with aster yellows phytoplasma specific primers F4/R1 to investigate whether leafhoppers were free from aster yellows phytoplasma infection (Miller et al. 1997).

Aster yellows phytoplasma strain isolation and maintenance. Aster yellows phytoplasma AY-WB was isolated from a symptomatic lettuce plant collected from a commercial lettuce production field in Celeryville, OH in 1998. To acquire AYP, infected symptomatic lettuce plants were exposed to healthy aster leafhoppers for a 4-day acquisition access period (AAP) in a nylon net cage. Leafhoppers were then transferred to 3-week-old oat plants for a 4-week latent period (Murral et al., 1996). Inoculative leafhoppers were individually transferred into nylon net sealed round leaf cages of 3 cm diameter and 1 cm height to allow inoculation of 3-week-old healthy aster plants

‘Matsumoto Red’ (Stokes Seeds Ltd. Buffalo, NY, U.S.A.) for a 12-hour inoculation access period (IAP). The inoculated plants were sprayed with insecticide 1100 Pyrethrum

TR (Whitmire Micro-Gen Research Laboratories Inc. St. Louis, MO) and transferred to an insect-free greenhouse at 25/20±2°C (day/night) for symptom development. Plants were categorized based on symptom type. Plants in each category were exposed individually to a few healthy leafhoppers for a 12–hr AAP after which leafhoppers were 100

transferred to oats for a 4-week latent period and to aster for a 12-hour IAP. This cycle was completed until no segregation of host symptoms and PCR-RFLP banding patterns.

AYP strains were maintained on aster and oat plants as described above, but the AAP and IAP were extended to 4 days. Alternatively, leafhoppers were transferred to Romaine lettuce (Lactuca sativa) ‘Parris Island Cos’ (ASGROW Vegetable Seeds, Gonzales, CA.

U.S.A.) at the 8-10 expanded-leaf stage for a 4-day IAP. The purity of the strain was monitored periodically both by plant symptom evaluation and by PCR-RFLP in the following transfers (every two to three transfers). After inoculation, leafhoppers were stored at –80°C to maintain the AYP strain because extracts of infected leafhoppers can be used for injection of non-infected leafhoppers, which will subsequently transmit injected phytoplasmas to plants.

PCR analysis. Aster yellows phytoplasma DNA was extracted from sap collected of symptomatic lettuce by using the Cetytrimethylammonium bromide (CTAB) method

(Zhang et al. 1998) and amplified using primers AY19p/AY19m (Schaff et al. 1992),

F4/R1 (Davis and Lee 1993) or F2/R2 (Davis and Lee 1993). The PCR reaction mixture contain 1X PCR buffer (200 mM Tris-HCl pH 8.4 and 500 mM KCl), 2.0 mM MgCl2,

0.2mM dNTPs, 0.5µM each of primers AY19p/AY19m, F4/R1 or F2/R2 and 1.25 unit

Taq DNA polymerase in a final volume of 50 µl. PCR was conducted under the following conditions: 94°C for 2 min, 30 cycles of 94°C for 30 sec, 47ûC (for

AY19p/AY19m) or 50ûC (for F4/R1 or F2/R2) for 30 sec, and 72°C for 1 min with a 10

101

minute extension at 72ûC after the last cycle. To detect AYP genomic DNA, the purified

AYP genomic DNA with PFGE was tested with AYP primers S1 (5’-

CGCTAACAAATGTAAAGGCAAG-3’) and S2 (5’-CTTTAATAGGACTATGAGGG-

3’) that generate a 493 bp fragment. The purified AYP genomic DNA was also detected for chloroplast DNA contamination using two pairs of chloroplast primers, CF (5’-

TCCTGCACTTGCTATTAAGGC-3’) and CR (5’-TCACGATAAGCAGCAACTGG-

3’), designed based on sequence information of Lactuca sativa photosystem I subunit III

(psaF) mRNA partial coding sequence (the Genbank Acc. No. AF162201) that generate a 318 bp PCR product, or ChaptF (5’-CGTATTACCAAATCACGCTCC-3’) and ChaptR

(5’-CACCTACTGGTTATGAAATCGC-3’), designed based on ATPase epsilon mRNA gene (the Genbank Acc. No. AF162208) that generated a 319 bp PCR product from plant

DNA extracts.

PCR-RFLP analysis. The 1.1-kb PCR product amplified from isolated AYP DNA with primers AY19p/AY19m was digested with DraI. The 1.2-kb PCR product amplified with primers F2/R2 was digested with AluI, RsaI, HhaI and HaeIII (Lee et al. 1993). The digested products were electrophorated in a 5% polyacrylamide gel at 3.5V/cm gel in 1X

TBE buffer (pH8.0) at room temperature and stained with ethidium bromide.

Pulse field gel electrophoresis. Phytoplasmas were isolated from lettuce plants about 2 weeks after the appearance of symptoms. The stem was cut at several places with a sharp razor blade and phloem sap running from the cut area was collected with a pipet tip. For preparation of gel plugs, about 200 µl sap was immediately mixed with 800 µl 102

pre-cooled 30% glucose-1X TE (pH 8.0) buffer. This cell suspension was centrifuged at

16000 ×g for 20 minutes at 4°C, and the pellet was mixed with 80 µl 1% pre-melted low melting agarose (45°C) in 0.5X TBE (pH 8.0). The plugs solidified at 4°C were subjected to proteinase K digestion at 50°C for 48 hours (Wang, G. L. et. al. 1995). After digestion, the plugs were rinsed with 1X TE buffer (pH 8.0) three times before PFGE or stored in digestion buffer at 4°C for later use. DNA was separated in a 1% agarose gel by PFGE with a running time of 18 hours, 60−120 second switch time ramp, voltage of 6V/cm and an included angle of 120° (CHEF-DR III Pulse Field Electrophoresis Systems, Bio-Rad).

Gel plugs prepared from phloem sap of healthy lettuce were used as negative controls.

Saccharomyces cerevisiae genomic DNA marker (New England BioLabs Inc.) was run along with the samples for DNA size determination. The image of PFGE gel stained with ethidium bromide was captured with NightHawkTM system (pdi, 405 Oakwood Road,

Huntington Station, New York 11746).

Genomic DNA elution. PFGE gels that were used for DNA extraction were exposed to weak UV light no longer than two seconds. The image of the gel was printed at the original gel size. The 800-kb chromosomal band of aster yellows phytoplasma AY-WB was excised by laying the gel on a transparent plastic tray, which was put on top of the printout. After excision of bands, gels were put back onto the UV illuminator to verify whether the 800 kb bands were removed. DNA was eluted from the gel blocks with

Elutrap (Schleicher & Schuell Inc.) using the manufacturer’s instructions, however excised gel blocks were placed directly into a collection chamber because the AYP

103

chromosome was too large to pass through the Elutrap T2 membrane. Elution took 15 hours at 106 V and 4 ûC. DNA was ethanol precipitated using standard procedures and resuspended in deionized distilled water.

Southern blotting. DNA of healthy lettuce was extracted with CTAB method as above.

Undigested and AluI digested 0.26µg pulse field gel purified AYP AY-WB genomic

DNA and 2.0 µg DNA extracted from healthy lettuce plants were run on a 1% agarose gel, and the gel was transferred onto a Hybond-N+ nylon membrane (Amersham

Pharmacia Biotech Inc. Pisscataway, N. J. USA) by capillary blotting method according to instructions provided by the manufacturer. Spot blots with 0.8 ng, 0.16 ng, 0.032 ng and 0.0064 ng of the S1/S2 phytoplasma and CF/CR chloroplast PCR products were prepared on Hybond-N+ membranes and hybridized along with Southern blots. Probes were generated of purified PCR products (QIAGEN Inc. Valencia CA, USA) by random labeling with α-32P-dATP and Random Primers DNA labeling system (GIBCO BRL,

Rockville, Maryland, USA). Membranes were hybridized to probes at 65°C overnight, washed with 1X SSC-0.5% SDS buffer at 55°C for 10 min, and 0.5X SSC-0.5% SDS for

15 min. (Sambrook et al. 1989), and exposed to phosphoimager screens overnight. The hybridization signal image was scanned with Storm 840 scanner (Molecular Dynamics,

Inc. Sunyvale, CA, USA). Relative amounts of phytoplasma and chloroplast DNA in pulse field isolated DNA samples was determined by extrapolation of the hybridization signals of Southern blots on a regression curve made from hybridization signals of PCR product spot blots.

104

Genomic DNA library construction. To construct a shotgun library, the purified AY-

WB DNA was sent to Integrated Genomics Inc (2201 W Campbell Park, Chicago, IL

60612). The 5 µg DNA was sheared using a computer-controlled shearing device

(GeneMachines) set to achieve DNA fragments of 2 kb in average. Sheared DNA was loaded onto 0.7% agarose gels and DNA fractions corresponding to 2-2.5 kb were extracted from the agarose gel. Single-stranded ends of the DNA were cleaved by T4 polymerase and then filled with Klenow. Size-selected 2-2.5 kb DNA fragments were cloned into the pGEM-3Z vector and then introduced into Escherichia coli strain DH5α.

Sequencing. At Integrated Genomics Inc., colonies were picked using a robotic colony picker and placed into 96-well microtiter plates for overnight growth. The cultures were processed for DNA mini-preps utilizing custom-built robots for plasmid extraction and purification steps. Subsequently, the DNA samples were transferred to 384-well plates to perform the sequencing reactions using the ET MegaBACE Dye Terminator Kit (Applied

Biosystems). A standard ethanol precipitation was used for PCR cleanup. Reactions were loaded onto a park of capillary sequencing machines (32 MegaBACE 1000 DNA sequencers and four ABI3700 sequencers). The samples were sequenced from both ends using standard forward and reverse primers specific for the plasmid and cosmid vectors.

Sequence data handling and genome assembly. Chromatographic files containing the raw sequence data were collected and sequence qualities and consistencies were evaluated via ReadStat software developed at Integrated Genomics (2201 W Campbell 105

Park, Chicago, IL 60612) to monitor, track, and analyze the quality of the sequences being produced from each of the 96 samples in a 96-well sequencing plate and of each nucleotide of individual sequence reads. Basecalling of trace data, screening out vector sequences, removal of unreliable data, and assembly of individual reads into contigs was performed with the Phred/Cross_match/Phrap package developed by Phil Green and coworkers at the University of Washington in Seattle (Ewing et al. 1998; Ewing and Green

1998). Shotgun sequences and automated assemblies continued until saturation of the shotgun library. Manual editing of the reads and contig sequences, as well as manipulations with the layout were performed using the Consed editing software. Primer walking method was used to fill the gaps.

Phylogenetic analysis. Sequence alignments of AYP AY-WB tuf gene and a few AYP tuf genes from the Genbank database were conducted with ClustalX 1.81 (Jeanmougin et al. 1998). The following tuf gene sequences were obtained from the National Center for

Biotechnology Information (NCBI) Genbank database: KVM (AYE271318), KVF

(AYE271317), SAY (AYE271323), IOWB (AYE271315), HYDP (AYE271313), Irap

(AYE271316), BB (AYE271309), AYA (AYE271308), AV2192 (AYE271306), PVM

(AYE271321), CVB (AYE271311). The tuf gene sequence of Apple proliferation phytoplasma (APP-AT) (APR011104) was used as outgroup. Phylogenetic tree was drawn using neighbor-joining method of Phylogenetic Analysis Using Parsimony

(PAUP) 4.0 software written for Macintosh by David Swofford (Sinauer Associates Inc.

Publishers. Sunderland, Massachusetts).

106

RESULTS

PCR-RFLP characterization of aster yellows phytoplasma AY-WB. Field –collected

AYP isolates could be mixed by more than one aster yellows phytoplasma strain, thus, they underwent several rounds of purification. A lettuce plant with symptoms of yellowing and wilting was collected from a heavily infected lettuce field in Celeryville,

Ohio in 1998. Amplification of DNA isolated from the infected plant with aster yellows specific primer AY19p/AY19m and F4/R1 confirmed that the lettuce plant was infected with a member of aster yellows phytoplasma 16SrI group. After three rounds of acquisition and inoculation with 12-hr AAP/IAP in aster, no symptom segregation was observed. For molecular characterization of the AYP isolate by PCR-RFLP, DNA extracted from symptomatic aster plants was amplified with primers AY19p/AY19m or

F2/R2. The AY19p/AY19m-amplified PCR fragment was digested with DraI. Two DNA fragments were observed in which the summed molecular weights of the fragments equaled that of the original PCR product (Figure 3.1A). Digestion of F2/R2-amplified

1200-bp product with AluI, RsaI, HhaI and HaeIII indicated that it belongs to 16SrI-A subgroup of aster yellows phytoplasma (Figure 3.1B). Identical RFLP fingerprints were generated after each cycle in the strain isolation process, indicating the presence of a single phytoplasma strain and it was named AY-WB.

Description of symptoms caused by AY-WB infection of aster and lettuce.

Typically, aster plants exposed to insects carrying AY-WB at the 10 expanded-leaf stage showed vein clearing and yellowing after about two weeks and abnormal leaf 107

petiole upright about three weeks after the exposure. After three weeks, the infected plants showed stunting. Witches’-broom symptom was observed after about six weeks.

Infected aster plants failed to produce flowers, or flower buds produced before infection lost pigment and became sterile (Figure 3.2). In lettuce, AY-WB caused vein clearing.

Lettuce plants exposed to inoculative insects at the eight expanded-leaf stage, showed vein clearing of new leaves two weeks after exposure and successive emerging leaves were smaller than leaves that emerged prior to infection. Within six week after inoculation, whole plants were yellow and wilted. Lettuce plants exposed to insects carrying AY-WB at about the 12-expanded-leaf stage usually showed symptoms on newly emerging leaves and the leaves that matured after inoculation, whereas leaves that were mature before inoculation rarely become symptomatic. Milky white then turning to brown ooze emerged from top leaves and stems of older AY-WB infected lettuce plants.

Leaf deformation was also observed.

Size determination of the AY-WB chromosome. The approximate genome size of AY-

WB was determined by collection of phytoplasmas from phloem sap of infected plants and subsequent pulse field gel electrophoresis (PFGE). On average, 1600 µl sap was collected from each symptomatic lettuce plant, which was used for the preparation of eight gel plugs for PFGE. Aster yellows phytoplasma DNA formed a single 800-kb band in the PFGE gel, and no bands were observed in the lanes with healthy plant sap extracts

(Figure 3.3). Low molecular weight fragments less than 50kb were also observed and might correspond to extrachromosomal DNA elements of AY-WB. The 800-kb fragment was excised from multiple lanes of the PFGE gel and eluted DNA was tested 108

by PCR with primer pairs F4/R1 and AY19p/AY19m. Fragments of expected size were amplified (data not shown) indicating that the 800-kb fragments were derived from aster yellows phytoplasma.

Library construction, sequencing and assembly of genome sequences. At Integrated

Genomics, a shotgun library with an average insert size of 2 kb was constructed with 5

µg of AYP chromosomal DNA, and sequenced to saturation. Sequence quality and subsequent assembly were performed at 2,069, 3,069, 7,009, 10,116, 11,216, 12,282, and

13,425 sequence reads (Table 3.1). A contig coverage of 8.6-fold was reached at 13,425 reads in which the last one-fold coverage resulted in only 1.3% new sequence information. At 8.6-fold contig coverage, a total of 13,339 sequence reads were determined to be of good quality and 12,414 reads were assembled into 182 contigs of a total sequence of 0.887 Mbp.

The majorities of gaps were sequence gaps (i.e. missing sequences present in the shotgun library) and were closed by primer walking. Contigs were reassembled into 17 contigs by primer walking. Sequences were submitted to the ERGO-database of

Integrated Genomics Inc. for automated annotation. This revealed that predicted open reading frames of 16 contigs (adding up to a total of 700 kb) (Table 3.2) had significant similarity to genes annotated from phytoplasmas, mycoplasmas, ureaplasmas, spiroplasmas and/or Gram-positive bacteria from the Bacillus/Clostridium group. The average GC content of the sequences was 26.9% (Table 3.1) and similar to the GC contents of other mollicute genomes that have been sequenced so far (Oshima et al. 109

2002; Himmelreich et al. 1996). One contig of 128,839 bp contained sequences of chloroplast genomic DNA. The contaminating chloroplast sequences were easily identified because they assembled into a separate contig with the average 36.5% GC content, which is significantly higher than the GC contents of contigs 1 to 16. The 16

AYP contigs and the single contig of lettuce chloroplast sequence can be obtained from website http://www.oardc.ohio-state.edu/phytoplasma

Determination of chloroplast DNA contamination in pulse field gel isolated AYP

DNA. Since clones containing chloroplast DNA fragment were found in AYP AY-WB genomic DNA library, the presence of chloroplast DNA in pulse field gel isolated DNA preparations were investigated by PCR and subsequently by Southern blot hybridization.

First, specific primers were developed for detection of AYP. S1/S2 were developed from an AY19p/AY19m PCR product. BLAST search of the Genbank database did not have significant hit and PCR with the primers only generated 493 bp DNA fragment from aster yellows phytoplasma infected plants and leafhoppers.

Two primer pairs were used to detect chloroplast DNA in pulse field gel purified

DNA preparations. PCR with CF/CR primers that amplify the chloroplast psaD gene generated the expected 318 bp fragment from isolated DNA of healthy lettuce tissues but not from pulse field gel isolated AYP AY-WB genomic DNA. However, PCR with

ChatpF/ChatpR primers that amplify the chloroplast ATPase epsilon gene generated the expected 319 bp fragment from both purified AYP AY-WB genomic DNA and isolated

DNA of healthy lettuce tissues. Further, no hybridization signal was detected when the 110

Southern blot was hybridized to the CF/CR chloroplast DNA probe. In conclusion, these results indicate that close to 100% of the pulse field gel isolated DNA was derived from

AY-WB, and that the pulse field gel isolated DNA contains low levels of chloroplast

DNA.

The level of chloroplast DNA contamination of the shotgun library was also assessed by calculating the number of reads that assembled into each contig. However, the result indicated that 6,725 reads assembled into contigs 1 to 16, and 6,700 reads assembled into contig 17. Thus, these data indicate that approximately 50% of the clones of the shotgun library contained chloroplast DNA. With an average read length of 400 bp, this converts to a 3.4-fold coverage of the 800 kb AY-WB genome and a 20.6-fold coverage of the ~

130 kb lettuce chloroplast genome.

Verification of genome assembly using known genes. Sequences encoding the elongation factor TU (tuf gene) and 16S rRNA were used to verify whether the obtained sequences were derived from the AY-WB chromosome. The complete tuf gene sequence was found in one of the 16 contigs (Contig0246), and was aligned with available tuf gene sequences from other phytoplasmas for subsequent phylogenetic analysis. This revealed that AY-WB appears to be different from all other aster yellows phytoplasmas described so far but is most similar to tomato big bud (BB) phytoplasma (from Arkansas, USA),

Virescence Plantago coronopus (PVM) phytoplasma (from Germany) of and

Hydrangea phyllody (HYDP) phytoplasma (from Belgium) (Figure 3.4). All these phytoplasmas belong to the aster yellows phytoplasmas 16SrI-A subgroup (Marcone et 111

al. 2000). Further, the chromosome size of PWM is 810 kb (Marcone et al. 1999), which is close to the estimated chromosome size of 800 kb of AY-WB, and the PCR-RFLP described herein demonstrated that AY-WB belongs to subgroup A cluster in the 16SrI taxonomic group aster yellows phytoplasma.

Aster yellows phytoplasma AY-WB genome possibly contain two copies of rRNA operons. One complete operon was found on Contig0248. With intergenic spacer containing a tRNA-Ile gene, which is typical for phytoplasma genomes (Schneider and

Seemüller 1994; Jomantiene et al. 2002) but not for mycoplasma genomes (Sawada et al.

1981; Fraser et al. 1995; Himmelreich et al. 1996). Another rRNA operon 5’ end partial sequence of 488 bp was found on Contig0242. The 16S rRNA gene partial sequences from both contigs shared 99% sequence similarity with that of BB, confirming phylogenetic analysis based on the tuf gene sequence (Figure 3.4). Further, in in silico digestion analysis of the 16S rDNA amplification product from the complete rRNA operon of Contig0248 with primer pair F2/R2 showed the expected pattern as illustrated in Figure 1B. Therefore, both the tuf gene and the 16S rDNA analysis demonstrate that the sequences are derived from AY-WB.

DISCUSSION The results presented herein show the molecular characterization of a new aster yellows phytoplasma strain, AY-WB. PCR-RFLP analysis of 16SrDNA and phylogenetic analysis of 16S rDNA and tuf gene sequences demonstrated that this strain

112

belongs to the 16SrI-group subgroup A cluster of aster yellows phytoplasmas, and is most closely related to a the tomato pathogenic phytoplasma BB. This strain was selected for sequencing because both host symptom and PCR-RFLP banding pattern stability in several rounds of transfers suggested that plants were infected with one or closely related phytoplasmas. In addition, the AY-WB chromosome was relatively small compared to chromosome sizes of other phytoplasmas in the aster yellows phytoplasma group, ranging from 660 to 1185 kb (Neimark and Kirkpatrick, 1993; Neimark et al. 1999).

Further, AY-WB had one distinct DNA fragment, whereas multiple high molecular weight chromosomal DNA fragments were found in other phytoplasma members of

16SrI group (Neimark and Kirkpatrick 1993). Although no large extrachromosomal

DNA fragments were detected on pulse field gels, smaller extrachromosomal DNA fragments may be presented as evidenced by the lower molecular weight fragments of ~

50 kb on pulse field gels. Indeed, at least three extrachromosomal DNA fragments of

7,005 bp, 5,580 bp and 3,933 bp were sequenced from onion yellows (OY) phytoplasma

(Oshima et al., 2002), and interestingly, some of them appear to encode genes that are required for insect transmission (Nishigawa et al. 2002). Whether AY-WB has extrachromosomal DNA fragments remains to be investigated.

Phytoplasmas cannot be cultured, and therefore purification of phytoplasmas and/or phytoplasma DNA directly from plant or insect hosts is required. As evidenced herein, lettuce appears to be an excellent host for phytoplasma isolation. Phytoplasmas are phloem-limited (Doi et al. 1967; Lee et al. 2000), and relatively large amounts of phloem sap were collected from lettuce plants by cutting stems with a sharp razor blade. 113

Further, lettuce phloem contained sufficient titers of phytoplasmas for detection of aster yellows phytoplasma genomic DNA on pulse field gels and subsequent isolation for sequencing. Indeed, pulse field gel isolated DNA contained small amount of chloroplast

DNA that could not be detected by Southern blotting but could be detected by PCR using one of the two primer pairs. However sequencing of the shotgun library showed that ~50

% of the clones contained chloroplast DNA. The bias in cloning efficiency can be explained by differences in AT contents of AYP and chloroplast DNA. AYP DNA is very AT rich (72.4%) and chloroplast DNA has a lower AT content (63%). Fortunately, the chloroplast sequences assembled into one contig and therefore was easily recognized and removed. Further, several genome projects have been completed in spite of contamination form extra chromosomal DNA. For example, chromosome 2 of

Plasmodium falciparum was sequenced to completion whereas the DNA was 85% pure

(Gardner et al. 1998).

This is the first study that describes shotgun sequencing of a plant-pathogenic mollicute. We have sequenced the AY-WB chromosome near completion as we have obtained 87.5%, 700 kb of 800 kb. Recently, 750 kb out of 1 Mbp (Oshima et al., 2001),

75% of the chromosome sequence of a Japanese onion yellows (OY) phytoplasma was published (Oshima et al. 2002). OY DNA was partially digested, and DNA fragments of

15 kbp were cloned into lambda phage vectors, sequenced and assembled into 20 contigs.

OY also belongs to the aster yellows phytoplasma group, but unlike AY-WB is a subgroup B phytoplasma based on its 16S rRNA gene sequence (the Genbank Acc. No.

D12569, Namba et al., 1993). Comparison of genome sequences of two phytoplasmas 114

that belong to different subgroups in the aster yellows pytoplasma group and differ in chromosome size should proof interesting. Further, the genome of five animal and human pathogenic mollicutes, including M. genitalium, M. pneumoniae, U. urealyticum,

M. pulmonis and M. penetrans were sequenced to completion (Glass et al. 2000; Fraser et al. 1995; Himmelreich et al. 1996). Comparisons of genome sequences among insect- transmitted plant-pathogenic and animal and human pathogenic mollicutes are expected to elucidate genes involved in pathogenesis and host specificity.

SUMMARY

The aster yellows phytoplasma (AYP) group is the largest among the phytoplasmas and cause systemic diseases that affect over 300 species in 38 plant families worldwide.

All phytoplasmas are obligate parasites transmitted to plants by phloem-feeding insects, mainly leafhoppers. In order to gain a basic understanding of phytoplasma pathogenesis and develop improved phytoplasma control strategies, we initiated the sequencing and annotation of the 800-kb genome of AY-WB. Characterization of this strain by PCR-

RFLP analysis revealed that AY-WB belongs to the 16SrI-A subgroup, and pulse field gel electrophoresis experiments of isolated DNA from lettuce showed that AY-WB has an 800 kb chromosome. A shotgun library was constructed with 5µg pulse-field gel isolated aster yellows phytoplasma chromosomal DNA and randomly sequenced.

Saturation was reached at 8.6-fold contig coverage when sequences assembled into 186 contigs totaling 898 kb. The number of contigs decreased to 17 after two rounds of primer walking of which contigs 1 to 16 contained 698,862 bp of the AYP genome, and

1 contig of 128,839 bp contained the near complete genome sequence of lettuce 115

chloroplast. AYP sequences have a G/C content of 26.9%, whereas that of the chloroplast contig is 36.7 %. One AYP contig contained the phytoplasma elongation factor TU (tuf) and another contig the rDNA sequences. In silico RFLP analysis of the

16S rDNA sequences confirmed the PCR-RFLP analysis that classified AY-WB as a

16SrI-A phtytoplasma. Further, phylogenetic analysis of the elongation factor TU (tuf) gene showed that AY-WB is most closely related to Tomato Big Bud (BB) phytoplasma, which is a member of the 16SrI-A cluster. This is the first report on shotgun cloning of a phytoplasma genome. The sequence data are available for downloading from website http://www.oardc.ohio-state.edu/phytoplasma

116

REFERENCES

Chang, C. J. 1989. Nutrition and cultivation of spiroplasmas. pp.201-241. In Whitecomb R. F. and Tully, J. G. (ed.), The mycoplasmas Vol. 5. Academic Press, New York.

Chambaud, I. and Heilig, R. et al. 2001. The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis. Nucleic Acids Res. 29:2145-2153.

Errampalli D. and Fletcher J. 1991. Incidence of yellows in carrot and lettuce and characterization of mycoplasmalike organism isolates in Oklahoma. Plant Dis. 6:579-584.

Ewing, B., Hillier, L., Wendl, M. C. and Green, P. 1998. Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Res. 8:175-185.

Ewing, B. and Green, P. 1998. Base-calling of automated sequencer traces using Phred. II. Error probabilities. Genome Res. 8:186-194.

Fraser C. M., Gocayne, J. D. and White, O. et al. 1995. The minimal gene complement of Mycoplasma genitalium. Science 270: 397-403.

Firrao, G., Smart, C. D. and Kirkpatrick, B. C. 1996. Physical map of the western X- disease phytoplasma chromosome. J. Bacteriol. 178:3985-3988.

Freitag, J. H. 1964. Interaction and mutual suppression among three strains of aster yellows virus. Virol. 24:401-413.

Gardner, M. J., Tettelin, H., Carucci, L., Cummings, L. M., Aravind, L., Koonin, E. V., Shallom, S., Mason, T., Yu, K., Fujii, C., Pederson, J., Shen, K., Jing, J., Aston, C., Lai, Z., Schwartz, D. C., Pertea, M., Salzberg, S., Zhou, L., Sutton, G. G., Clayton, R., White, O., Smith, H. O., Fraser, C. M., Hoffman, S. L. et al. 1998. Chromosome 2 sequence of the human malaria parasite Pleasmodium

falciparus. Science. 282:1126-1132.

117

Glass, J. I., Lefkowitz, E. J., Glass, J. S., Heiner, C. R. Chen, E. Y. and Cassell, G. H. 2000. The complete sequence of the mucosal pathogen Ureaplasma urealyticum. Nature 407:757-762.

Gundersen, D E., Lee, I-M., Rehner, S. A., Davis, R. E. and Kingsbury D. T. 1994. Phylogeny of mycoplasmalike organisms (Phytoplasmas): a basis for their classification. J. Bacteriol. 176: 5244-5254.

Gundersen, D. E., Lee, I-M., Schaff, D. A., Harrison, N. A., Chang, C. J., Davis, R. E. and Kingsbury, D. T. 1996. Genomc diversity and differentiation among phytoplasma strains in 16S rRNA group I (aster yellows and related phytoplasmas) and III (X-disease and related phytoplasmas). Int. J. Syst. Bacteriol. 46:64-75.

Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B-C. and Herrmann, R. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24:4420-4449.

Jeanmougin, F., Thompson, J. D., Gouy, M., Higgind, D. G. and Gibson, T. J. 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23:403-405.

Jomantiene, R., Davis, R. E., Maas, J. and Dally, E. L. 1998. Classification of new phytoplasmas associated with diseases of strawberry in Florida, based on analysis of 16S rRNA and ribosomal protein gene operon sequences. Int. J. Syst. Bacteriol. 48. Pt 1:269-77.

Jomantiene, R., Davis, R. E., Valiunas, D., Alminaite, A. and Staniulis J. 2002. New group 16SrIII phytoplasma lineages in Lithuania exhibit rRNA interoperon sequence heterogeneity. European J. Plant Pathology 108:507-517.

Jiang, Y. P. and Chen, T. A. 1987. Purification of mycoplasma-like organisms from lettuce with aster yellows disease. Phytopathology 77: 949-953.

Jiang, Y. P., Lei, J. D. and Chen, T. A. 1988. Purification of aster yellows agent from diseased lettuce using affinity chromatography. Phytopathology 78: 828-831.

Kamoun, S and Hogenhout S. A. 2001. Agricultural microbes genome 2: The first glimpses into the genomes of plant-associated microbes. Plant Cell, 13:451-458.

Kollar, A., Seemüller, E., Bonnet, F., Saillard, C. and Bove, J. M. 1990. Isolation of the DNA of various plant pathogenic mycoplasmalike organisms from infected plants. Phytopathology 80: 233-237.

Kirkpatrick, B., Smart C. D., Gardner, S., Gao J-L., Ahrens, U., Maurer, R., Schneider B., Lorenz, K-H., Seemüller, E., Harrison, N., Namda, S., Daire, X. 1994. 118

Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA spacer sequences. IOM letters 3: 228-229.

Kuske, C. R. and Kirkpatrick, B. C. 1992. Phylogenetic relationships between the western aster yellows mycoplasmalike organism and other prokaryotes established by 16S rRNA gene sequence. Int. J. Syst. Bacteriol. 42: 226-233.

Lee, I-M., and Davis, R. E. 1986. Prospects for in vitro culture of plant pathogenic mycoplasmalike organisms. Ann. Rev. Phytopathology 24:339-354.

Lee, I-M., Hammond, R. W., Davis, R. E. and Gundersen, D. E. 1993. Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology 83: 834-842.

Lee, I-M., Bertaccini, A. Vibio, M. and Gundersen, D. E. 1995. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85(6): 728-735.

Lee, I-M., Davis, R. E. and Gundersen-Rindal, D. E. 2000. Phytoplasma: Phytopathogenic mollicutes. Annu. Rev. Microbiol. 54:221-255.

Lee, I-M., Gundersen-Rindal, D. E. Davis, R. E. and Bartoszyk, I. M. 1998. Revised classification scheme of phytoplasmas based on RFLP analysis of 16S rRNA and ribosomal protein gene sequences. Int. J. Syst. Bacteriol. 48:1153-1169.

Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. and Seemüller E. 1999. Chromosome sizes of phytoplasmas composing major phytogenetic groups and subgroups. Phytopathology 89:805-810.

Marcone, C., Lee, I-M., Davis, R. E. Ragozzino, A. and Seemüller, E. 2000. Classification of aster yellows –group phytoplasmas based on combined analyses of rRNA and tuf gene sequences. Int. J. Syst. Evol. Microbiol. 50 Pt 5:1703-13.

McCoy, R. E., Caudwell, A., Chang, C. J., Chen, T. A., Chiykowski, L. N., Cousin, M. T., Dale, J. L., Leeuw. G. T. N. de., Golino, D. A., Hackett, K. J., Kirkpatrik, B. C., Marwitz, R., Petzold, H., Sinha, R. C., Sugiura, M., Whitecomb, R. F., Yang, I. L., Zhu, B. M. and Seemüller, E. 1989. Plant diseases associated with mycoplasma-like organisms, p. 545-640. In Whitecomb, R.F. and Tully J.G. (ed.) The mycoplasmas Vol. V. Academic Press, New York.

Miller, S. A., Zhang, J., Hoy, C.W. and Nault, L.R. “Monitoring aster yellows

infectivity in leafhoppers during the vegetable growing season by the polymerase chain reaction” Phytopathology 87,S66 (1997).

119

Namba, S., Oyaizu, H., Kato, S., Iwanami, S. and Tsuchizaki, T. 1993. Phylogenetic diversity of phytopathogenic mycoplasmalike organisms. Int. J. Syst. Bacteriol. 43:461-467.

Neimark, H., and Kirkpatrick B. C. 1993. Isolation and characterization of full-length chromosomes from non-culturable plant pathogenic mycoplasma-like organism. Mol. Microbiol. 7:21-28.

Nishigawa, Hisashi; Oshima, Kenro; Kakizawa, Shigeyuki; Jung, Hee-Young; Kuboyama, Tsutomu; et. al. 2002. A plasmid from a non-insect-transmissible line of a phytoplasma lacks two open reading frames that exist in the plasmid from the wild-type line. Gene. 298:195-201

Razin, S., Yogev, D. and Naot, Y. 1998. Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev. 62:1094-1156.

Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning, A laboratory manual. 9.31-9.62. Cold Spring Harbor Laboratory Press.

Sasaki, Y., Ishikawa, J., Yamashita, A., Oshima, K., Kenri, T., Furuya, K., Yoshino, C., Horino, A., Shiba, T., Sasaki, T. and Hattori, M. 2002. The complete genomic sequence of Mycoplasma penetrans, an intracellular bacterial pathogen in humans. Nucleic Acids Res. 30:5293-5300.

Sato, S., Nakamura, Y., Kaneko, T., Asamizu, E. and Tabata, S. 1999. Complete structure of the chloroplast genome of Arabidopsis thaliana. DNA Res. 6:283- 290.

Sawada, M., Osawa, S., Kobayashi, H., Hori, H. and Muto, A. 1981. The number of ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 182: 502-4.

Schneider, B., Padovan, A., De La Rue, S., Sdoodee, R., Suseno, R., Mutaqin, K., Lum, K. Y., Davis, R., Eichner, R. and Gibb, K. S. 1998. Detection and characterization of phytoplasma in Australian and Southeast Asia. The 12th Int. Org. Mycoplasmol. Conf. Sydney, Australia.

Schneider, B. and Seemüller, E. 1994. Presence of 2 set of ribosomal genes in phytopathogenic mollicutes. Appl. Environ. Microbiol. 60:3409-3412.

Sears, B. B., Lim. P-O., Holland, N. Kirkpatrick, B. C. and Klomparens, K. 1989. Isolation and characterization of DNA from a mycoplasmalike organism. Molecular Plant-Microbe Interactions. 2(4):175-180.

Smart, C. D., Schneider, B., Blomquist, C. L., Guerra, L. J., Harrison, N. A., Ahens, U., Lorenz, K-H., Seemüller E., and Kirkpatrick, B. C., 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S spacer region. Appl. Environ. Microbiol. 62:2988-2993.

Turmel, M., Otis, C. and Lemieux, C. 2002. The chloroplast and mitochondrial genome sequences of the charophyte Chaetosphaeridium globosum: Insights into the timing of the events that restructured organelle DNAs within the green algal lineage that led to land plants. Proc. Natl. Acad. Sci. U.S.A. 99: 11275-11280.

Turmel, M., Otis, C. and Lemieux, C. 1999. The complete chloroplast DNA sequence of the green alga Nephroselmis olivacea: insights into the architecture of ancestral chloroplast genomes. Proc. Natl. Acad. Sci. U.S.A. 96:10248-10253

Wang, G. L., Holsten, T. E., Song, W-Y. , Wang, H-P. and Ronald, P. C. 1995. Construction of a rice bacterial artificial chromosome library and identification of clones linked to the Xa-21 disease resistance locus. Plant J. 7:525-533.

Zhu, B. M. and Seemüller, E. 1989. Plant diseases associated with mycoplasmalike organisms. pp.545-640. (In) The Mycoplasmas Vol. 5. Spiroplasmas, Acholeplasmas and Mycoplasmas of Plant and Arthropods. Withcomb R. F. and Tully, J. G. (ed.) Academic Press, New York.

121

A B

Figure 3.1 Polymerase chain reaction-restriction fragment length polymorphism analysis demonstrating that aster yellows phytoplasma AY-WB belongs to 16SrI-A subgroup. (A) Genomic DNA fragment amplified with primers AY19p/AY19m (lane 1) was digested with DraI (lane 2). (B) 16S rDNA fragments amplified with primers F2/R2 were digested with RsaI (lane 1), AluI (lane 2), HhaI (Lane 3) and HaeIII (lane 4). M, DNA marker. The molecular weights of DNA fragments are indicated to the left of the gels.

122

Figure 3.2 Symptoms of lettuce and aster caused by aster yellows phytoplasma AY-WB infection. (A) Uninfected Romaine lettuce plant; (B) AY-WB infected lettuce plant exposed to inoculative leafhoppers at eight leaf stage with yellowing symptoms that appeared 50 days after the first day of inoculation; (C) Uninfected China aster; (D) Infected China aster exposed to inoculative leafhoppers at 10 leaf stage showing witches’-broom symptoms that appeared 50 days after the first day of inoculation.

123

Figure 3.3 Pulse field gel showing the 800 kb chromosome of AY-WB. Phytoplasmas isolated from lettuce phloem sap were used for plug preparation and subsequent pulse field gel electrophoresis. M, marker. Molecular weigths of DNA fragments are indicated in kb to the left of the pulse field gel.

124

Figure 3.4 Phylogenetic analyses of tuf gene sequences of various aster yellows phytoplasma strains and apple proliferation (APP-AT). Sequences were aligned using Clustal X, and the Neighbor Joining method was used for tree construction with the APP- AT (APR011104) tuf gene sequence as an outgroup. Bootstrap values (out of a 1000) are indicated at the branches. The 16SrI-A phytoplasmas are boxed, and the AY-WB characterized in this study is highlighted. This tree is similar to the phylogenetic tree constructed by parsimony analysis of tuf gene sequences published elsewhere (Marcone et al. 2000).

125

Number of reads Total Number Coverage GC sequence in of in contigs % Total Good Assembled Mbp contigs quality

2026 2023 1666 0.377 256 3.4 32 3069 3066 2616 0.504 369 4.0 31 7009 7006 6369 0.757 329 5.7 30 10116 10080 9263 0.834 259 7.2 30 11216 11180 10291 0.859 241 7.7 30 12282 12246 11300 0.875 215 8.1 30 13425 13389 12414 0.887 182 8.6 30 After two rounds of primer walking 0.895 17* 9.0 30

Table 3.1 Sequence results derived from aster yellows phytoplasma AY-WB shotgun library. Contig 1-16 (700 kb; GC content of 26.9%) contains the near complete genome of AY-WB (Fig 4), Contig 17 (130 kb; GC content of 36.5%) contains the complete lettuce chloroplast genome.

126

Contig ID Contig length (bp) Number of ORFs

Contig 0219 1,213 2 Contig 0225 1,759 2 Contig 0234 3,614 5 Contig 0235 3,214 3 Contig 0236 8,272 11 Contig 0238 13,307 9 Contig 0239 11,582 10 Contig 0240 18,499 24 Contig 0241 30,927 22 Contig 0242 42,380 53 Contig 0243 46,993 39 Contig 0244 70,671 53 Contig 0245 86,914 66 Contig 0246 90,128 69 Contig 0247 95,810 84 Contig 0248 173,579 166 Total 698,862 618

Table 3.2 Contigs containing sequences of the aster yellows phytoplamsa AY-WB 800 kb genome. Contig ID Contig Length (

127

CHAPTER 4

TRANSPOSASE GENES OF THE ASTER YELLOWS PHYTOPLASMA GENOME

INTRODUCTION

Phytoplasmas have small genomes, but their genome sizes are extremely variable.

Genome sizes of members of aster yellows phytoplasma group range from 530 kb of

Bermuda grass white leaf phytoplasma to 1350 kb of Tomato stolbur phytoplasma

(Schneider et al. 1993; Neimark and Kirkpatrick 1993; Marcone et al. 1997). Aster yellows phytoplasmas, the largest group in phytoplasmas, cause diseases in hundreds of plant species worldwide (McCoy et al. 1989). They colonize phloem tissues including sieve tube and companion cells of their plant hosts. They replicate intracellularly in plants and leafhoppers and are transmitted by phloem feeding insects, mainly leafhoppers in a persistent, propagative manner. Two different niches render phytoplasmas to undergo high selective pressures. The diversity in phytoplasma genome size suggests frequent recombination events, and these recombination events may allow selection of new individuals adapted to survive in various environments. Thus, it may prove important to investigate sequences that contribute to the recombination events in phytoplasma genomes.

128 Transposable sequences frequently contribute to recombination events (Jordan et al.

1968; Shapiro 1969), and are common in the genomes of all organisms studied to date

(Dai and Zimmerly 2002; Feschotte et al. 2002; Meyers et al. 2001). In fact, 45-80% of eukaryotic genomes was found to be transposable elements (Feschotte et al. 2002;

Lander et al. 2001; Meyers et al. 2001; Vicient et al. 1999). In some Bacillus species, the most closely related walled bacteria of mollicutes, 112 putative transposase genes were found (Takami et al. 2000). Insertion sequences (IS) are transposable elements composed of a transposase gene flanked by inverted repeats (IR) and the promoter often partially locates within the upstream inverted repeat. Transposases bind to the inverted repeats resulting in subsequent excision of the insertion sequences. Insertion sequences vary in lengths from 0.8 to 2.5 kb (Mahillon and Chandler 1998; Saedler and Gierl 1996) and they are also found in the small genomes of mollicutes. Mycoplasma genomes contain insertion sequences of the IS3 family IS150 group (Bhugra, and Dybvig 1993; Zheng, J. and McIntosh, M. A. 1995), spiroplasmas contain insertion sequences of the family IS30, and two Tra5 transposase genes were found in the onion yellows phytoplasma chromosome (Oshima et al. 2002).

Insertion sequences of IS3 family contain two out-of-phase ORFs. The first ORF encodes a protein OrfA that can act as transposition inhibitor by competing with the transposase for binding to the inverted repeats. The second ORF codes for protein OrfB that enhances OrfA activity (Saedler and Gierl 1996). The transposase is the product of a fusion protein of OrfA and OrfB upon a translational frameshift event. This organization of the insertion sequences keeps the transposase synthesis at a low level thereby avoiding 129 frequent transpositions. Most of the transposases are synthesized by a –1 frameshift

(Sekine et al. 1992; Sekine and Ohtsubo 1992; Vögele et al. 1991) but +1 and +2 frameshifts were also reported for the transposases of IS231V and W of Bacillus thuringiensis subsp. Israelensis (Rezsöhazy et al. 1993). Secondary structures in the mRNA is thought to enhance the frameshift event, (Jack 1989; Weiss et al. 1987), however some studies show that mRNA secondary structures is not necessary (Sekine et al. 1992; Sekine and Ohtsubo 1992). Upon insertion, ISs usually generate direct repeats

(DRs) due to staggered cleavage by transposases, which usually left behind as a

“footprint” after excision. In this paper, we present an analysis of putative transposase coding regions in the aster yellows phytoplasma ‘AY-WB’ genome and most of them have an high sequence similarity with transposase of IS3 family insertion sequences. The presence of similar insertion sequences among various aster yellows phytoplasma strains was investigated by polymerase chain reaction (PCR).

MATERIALS AND METHODS

Sequencing of the AY-WB chromosome

Aster yellows phytoplasma genomic DNA was isolated from phloem sap of greenhouse lettuce and the genomic DNA was isolated using pulse field electrophoresis

(PFGE) and collected with Elutrap (Schleicher & Schuell Inc.). The shotgun library was constructed using five µg purified aster yellows phytoplasma AY-WB genomic DNA at

Integrated Genomics, Inc. (2201 W Campbell Park, Chicago, IL 60612). The whole genome was sequenced with sequence saturation up to 8.6-fold coverage of the genome and 16 contigs were constructed that cover 87.5% of the AY-WB genome (Chapter 3). 130

Automatic annotation procedure of AY-WB sequence data

The sequence data of aster yellows phytoplasma AY-WB were sent to the Integrated

Genomics Inc. database and software suite, ERGO, for sequence annotation. CRITICA

(Badger and Olsen 1999) and IG-proprietary tools were used for open reading frame

(ORF) identification. ORF function annotation was conducted by a number of IG- proprietary algorithms that automatically predict the function of ORFs based on comparative analysis with the 30,000 orthologues clusters in ERGO.

Analysis of insertion sequences

Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1990) was used to look for transposase homologues in the AY-WB database, and the program “einverted” at http://www.hgmp.mrc.ac.uk/software/EMBOSS/ was used searching for inverted repeats with either default setting or at threshold 33. Frameshifting structures were identified with Amplify 1.2 software (http://engels.genetics.wisc.edu/amplify/), and DNA strider

1.2 was used for amino acid sequence translation and ORF analysis. GC content of transposase genes was determined with Amplify 1.2.

PCR detection of putative transposase genes

DNA of healthy and AYP-infected lettuce plants was extracted using the

Cetytrimethylammonium bromide (CTAB) method (Zhang et al. 1998). DNA of healthy and AYP-infected leafhoppers was extracted using modified NaOH method (Miller et al. 131 1997). Phytoplasma DNA of Beet leafhopper transmitted virescence agent (BLTVA) and

Western X were kindly provided by Lia Liefting and Bruce Kirkpatrick (University of

California, Davis). Primer sequences are listed in Table 4.1.

The PCR mixture contained the following ingredients: 1X PCR buffer (200 mM Tris-

HCl pH 8.4 and 500 mM KCl), 2.0 mM MgCl2, 0.2 mM dNTPs, 0.5 µM each of the primers for detection of transposase coding regions of insertion sequences, 1.25 unit of

Taq DNA polymerase in a final volume of 25 µl. PCR was conducted in the following conditions: 94°C for three minutes, 30 cycles of 94°C for 30 sec, 50ûC for 45 sec, and

72°C for one minute (for PCR products < 1kb) or two minutes (for PCR products >1kb) with 10 minute extension at 72ûC after the last cycle.

Phylogenetic analysis of the putative transposase coding regions

DNA sequences of the putative transposase coding regions were aligned using

ClustalX 1.81. The phylogenetic tree was drawn by using neighbor-joining method of the computer program PAUP* 4.0 (phylogenetic analysis using parsimony) for Macintosh written by David Swofford (Sinauer Associates Inc. Publishers. Sunderland,

Massachusetts). The transposase genes from the Genbank database are as follows:

NC002758, Staphylococcus aureus; U00039, E. coli; AP004305, Oryza sativa; Z67739,

Streptococcus pneumoniae; Z67739, S. pneumoniae; U01217, Mycoplasma hyorhinis and L33925, M. hyorhinis. The branch length value shows fraction of substitution between the nodes that define the branch.

132

RESULTS AND DISCUSSION

Identification of insertion sequences in the AY-WB genome

Three ORFs with homology to transposase genes were annotated by Integrated

Genomics Inc. ORF763 and ORF199 showed high similarity with the putative transposase in plasmid PXO1-96 of Bacillus anthracis with e-values of 1e-31 and 2e-33 respectively. ORF015 has the best hit to putative transposase in Bacillus licheniformis with e-value of 1e-32. All the three ORFs also showed high sequence similarity with

IS861, a member of IS150 group in IS3 family with e-value from 2e-23 to 2e-24. Paralog searches of the AY-WB genome sequence database with these three ORFs resulted in the identification of 21 additional ORFs (e-value from 1.68e-11 to 1.06e-96) of which four short singular ORFs were considered incomplete as they contained less than 210 nucleotides and located at contig ends. Fourteen ORFs harbored into seven two-ORF- linked transposase-coding regions and other three ORFs harbored into one coding region.

Thus, eight additional transposase coding regions of insertions sequences were identified in addition to the three annotated in the ERGO database. These were AYP503-504,

AYP349-348, AYP316-315, AYP231-2-3, AYP167-166, AYP706-706, AYP207-206 and AYP266-265. The organization of all 11 transposase-coding regions of insertion sequences is depicted in Figure 4.1.

The transposase coding regions of the insertion sequences contained 237 to 963 nucleotides and some had inverted repeats and/or direct repeats (Figure 4.1). Insertion sequences with transposase coding regions AYP503-504, AYP167-166 and AYP207-206 133 have imperfect IRs and 2-bp DRs. Insertion sequences AYP349-348, AYP316-315,

AYP231-2-3 and AYP266-265 had imperfect IRs but no DRs. IRs and DRs were not detected for AYP706-705, AYP199, AYP763 and AYP015 (Figure 4.1 and Table 4.2).

However, AYP199 and AYP015 were near contig endings and therefore IRs and DRs could not be identified. All the transposase coding regions of the insertion sequences with IRs and DRs had more than one ORF in the sequence between the inverted repeats, whereas three out of four insertion sequences without IRs and DRs consisted of one ORF

(Figure 4.1 and Table 4.2). Most insertion sequences with more than one ORF had sequence similarity and arrangement to OrfA and OrfB, but only insertion sequences

AYP316-315 and AYP167-166 could synthesize the full-length transposases of 180 and

189 amino acids in lengths respectively upon single –1 frameshift events. In AYP316-

315, the two ORFs overlapped by 49 nucleotides. The frameshifting structure

AAAAAAG located at 74 nucleotides upstream the stop codon of ORF316 and 28 nucleotides upstream of the start codon of ORF315 (Figure 4.2). In AYP167-166, the same frameshifting structure was found at eight nucleotides upstream the stop codon of

ORF167 and 16 nucleotides upstream of the start codon of ORF166 (Figure 4.3).

PCR detection of insertion sequences among phytoplasma strains and groups

PCR primers were developed to confirm whether the described insertion sequences were from AY-WB and to investigate the presence of the insertion sequences among other AYP strains and phytoplasmas. For insertion sequences with IRs two primer pairs were designed of which one primer pair was located internally of the IRs and the other pair externally of the IRs. Single primer pairs were designed for insertion sequences 134 without IRs (Figure 4.1). Amplification products were generated from DNA isolated from AY-WB infected plants and leafhoppers that fed on AY-WB infected plants, but not of healthy plants and leafhoppers that fed on healthy plants, indicating that the insertion sequences are derived from AY-WB (Figures 4.4 and 4.5).

PCR was also used to investigate the distribution of homologues of the 16SrI-A phytoplasma AY-WB insertion sequences among the 16SrI-B subgroup aster yellows phytoplasmas, AY-BW, AY-BD2, AY-BD3, AY-SS, AY-SG and AY-S, the group

16SrVI phytoplasma Beet leafhopper transmitted virescence agent (BLTVA), and the

16SrIII phytoplasma Western X disease (WX). Insertion sequences AYP266-265,

AYP199, AYP763, and AYP706-705 are present in all 16SrI phytoplasmas (Table 4.2,

Table 4.3) of which the last three do not have IRs. AYP 015 was detected in strains AY-

WB, AY-BW, and AY-SG but not in AY-BD2, AY-BD3, AY-SS and AY-S. Insertion sequences AYP207-206, AYP316-315 and AYP503-504 appear to be unique to AY-WB.

PCR with internal primers 503INF/504INR of AYP503-504 generated the expected 199 bp fragment for AY-WB but generated ~2,000 bp large fragments for all other strains.

This suggests a deletion event of a region within the insertion sequence of AYP503-504 in AY-WB or an insertion event in other strains. Also, PCR with two internal primers of

AYP316-315 has not been done and therefore it is not known whether AYP316-315 is absent from other strains or whether AYP 316-315 is located at a different position in the

AY-WB genome. Insertion sequences AYP349-348 and AYP231-2-3 can be detected in all strains with the internal primers, but only in AY-WB with two external primers and/or with one internal and one external primer. Further, internal primers amplify DNA 135 fragment of AYP167-166 from AYP strains AY-WB, AY-BW, AY-SG and AY-S but not from AY-BD2, AY-BD3 and AY-SS, whereas the external primers only amplify the expected size band from AY-WB. This suggests that insertion sequences AYP349-348,

AYP231-2-3 and AYP167-166 are located in a different part of the AY-WB chromosome relative to other strains and that AYP167-166 is absent from strains AY-

BD2, AY-BD3 and AY-SS. In addition, AYP266-265 was amplified from BLTVA by primers 266-3/265R and AYP167-166 was amplified from WX by primers 166F/165R, however, this experiment was done one time. The other nine insertion sequences appear unique to AY-WB or phytoplasmas of the 16SrI group (Table 4.3, Figure 4.4).

GC content in the transposase coding regions

The GC content of the putative transposase coding regions in aster yellows phytoplasma AY-WB genome ranges from 23.4 – 27.4%, close to the content of rest genome sequence (26.9%). The GC contents of transposase genes in other bacterial genomes also show the closeness of their GC contents to the host genome sequences. For example, some transposase genes in E. coli contain 48% GC in average to compare with

51% in the host genome. The transposase genes in Streptococcus pyogenes M1 contain

37.3% GC in average compared with 38.5% in the genome sequence and the transposase genes in Staphylococcus aureus subsp aureus Mu 50 contain 31.5% GC while the host genome has 32% GC (Figure 4.6). This indicates that transposase genes in a genome had

GC content closer to GC content of the host genome than transposase genes from other bacterial species.

136 Phylogenetic analysis on the putative transposase coding sequences

Alignment of the 11 transposase-coding regions of insertion sequences revealed high sequence identity (Figure 4.7). AYP231-2-3 had a 41-bp deletion relative to other insertion sequences. The last 37 nucleotides of AYP706-705 were clearly different from those of other insertion sequences. Phylogenetic analysis showed that the sequences of transposase coding regions were closely related to one another and fall into one cluster

(Figure 4.8). In this cluster, AYP207-206 is separately from the others as a sub-cluster and is specific to AY-WB. Transposase coding regions AYP015, AYP167-166 and

AYP316-315 were in second sub-cluster of which AYP015 and AYP167-166 are found in AY-WB, AY-BW and AY-SG but are absent from other strains. AYP316-315 is specific to AY-WB, however, internal primers to the IRs have not been tested. All other insertion sequences form a separate sub-cluster and are detected in all the aster yellows phytoplasma strains except AYP503-504.

This study resulted in the discovery of 11 insertion sequences in the genome of AY-

WB, which belongs to 16SrI-A subgroup of aster yellows phytoplasma. Subsequent PCR analysis showed that six insertion sequences were conserved among the 16SrI-A and

16SrI-B aster yellows phytoplasmas, whereas two insertion sequences with putative transposase coding regions AYP015 and AYP167-166 are present in a subset of aster yellows phytoplasmas. Three insertion sequences with AYP316-315, AYP503-504 and

AYP207-206 are unique to AY-WB of which the insertion sequence with AYP316-315 has not been tested with two internal primers. These three insertion sequences contain transposase coding regions that have more nucleotide substitution than those insertion 137 sequences sheared by both AY-WB and 16S rDNA subgroup B strains as showed by the long branches of the phylogenetic tree (Figure 4.8). Interestingly, phylogenetic analysis of the transposase coding regions of insertion sequences separates these insertion sequences into three sub-clusters, and these sub-clusters match the phytoplasma groups based on the shared number of insertion sequences. Sub-cluster one contains the insertion sequences shared by all aster yellows phytoplasmas but insertion sequence AYP503-504.

Sub-cluster two contains the insertion sequences shared by AY-WB and/or the aster yellows phytoplasmas of 16S rDNA subgroup B, and Sub-cluster three contains one insertion sequence unique to AYP-WB. It remains to be investigated whether insertion sequence excision/insertion and recombination events result into phytoplasma diversification. However, these data show that insertion sequences can be used to detect and differentiate strains of the aster yellows phytoplasma group, which may lead to a better understanding of phytoplasma epidemiology, particularly because AYP strains vary in plant infection efficiency and symptom development thereby affecting feeding behavior of the leafhopper vector.

SUMMARY

Insertion sequence elements are involved in DNA recombination events and because phytoplasma genomes have extreme size variations, insertion sequences were identified in the near complete genome sequence of AY-WB. In total, 24 putative transposase coding ORFs of insertion sequences were identified and most of them had sequence similarity and ORF arrangements similar to the IS3 family, subgroup IS150 insertion sequences detected in mycoplasma species. Eleven transposase-coding regions were 138 closely investigated. The length of the putative transposase coding regions ranged from

237—963 bp, and GC content of the transposase genes of insertion sequences were similar to that of the rest of the AY-WB genome. AY-WB belongs to subgroup A of the aster yellows phytoplasma 16SrI group. Inverted repeats (IR) were found for seven of the transposase coding regions and direct repeats (DR) were found in three of the transposase coding regions with IRs. No IRs was found in single ORF coding regions. PCR with primers targeting on sequences flanking transposase-coding regions amplified DNA fragments only from DNA extracts of aster yellows symptomatic lettuce and aster yellows phytoplasma infected leafhoppers not from the extracts of healthy lettuce. PCR analyses show that insertion sequences can be used to detect and separate strains of the aster yellows phytoplasma group.

139

REFERENCES

Altschul, S. F., Gish, W., Miller, W., Meyers, E. W. and Lipman, D. J. 1990. Basic Local Alignment Search Tool. J. Mol. Biol. 215:403-410.

Badger, J. H. and Olsen, G. J. 1999. CRITICA: coding region identification tool invoking comparative analysis. Mol. Biol. Evol. 16:512-524.

Bhugra, B. and Dybvig, K. 1993. Identification and characterization of IS1138, a transposable element from Mycoplasma pulmonis that belongs to the IS3 family Mol. Microbiol. 7:577-584.

Dai, L. and Zimmerly, S. 2002. Compilation and analysis of group II intron insertions in bacterial genomes: evidence for retroelement behavior. Nucleic Acids Res. 30:1091-1102.

Dong, Q, Sadouk, A., van der Lelie, D., Taghavi, S., Ferhat, A., Nuyten, J. M., Borremans, B., Mergeay, M. and Toussaint, A. 1992. Cloning and sequencing of IS 1086, an Alcaligenes eutrophus insertion element related to IS30 and IS4351. J. Bacteriol. 174:8133-8138.

Farman, M. L. and Leong, S. A. 1998. Chromosome walking to the AVR1-CO39 avirulence gene of Magnaporthe grisea: Discrepancy between the physical and genetic maps. Genetics 150:1049-1058.

Fayet, O., Ramond, P., Polard, P., Prère, M. F. and Chandler, M. 1990. Functional similarities between retroviruses and the IS3 family of bacterial insertion sequences? Mol. Microbiol. 4:1771-1777.

Ferat, J. L and Michel, F. 1993. Group II self-splicing introns in bacteria. Nature, 364:358-361.

Feschotte, C., Jiang, N. and Wessler, S.R. Plant transposable elements: where genetics meets genomics. Nature Reviews. 3:1-14.

Firrao, G., Smart, C. D. and Kirkpatrick, B.C. 1996. Physical map of the western X- disease phytoplasma chromosome. J. Bacteriol. 178:3985-3988.

Freitag, J. H. 1964. Interaction and mutual suppression among three strains of aster yellows virus . Virol. 24:401-413.

Hill, F., Gemund, C., Benes, V., Ansorge, W. and Gibson, T.J. 2000. An estimate of large-scale sequencing accuracy. EMBo reports. 1:29-31.

140 Henderson,D. J., Lydiate, D. J. and Hopwood, D. A. 1989. Structural and functional analysis of the minicircle, a transposable element of Streptomyces coelicolor A3(2) Mol. Microbiol. 3:1307-1318.

Gundersen, D. E., Lee, I-M. Schaff, D. A., Harrison, N. A., Chang, C. J., Davis, R. E. and Kingsbury, D. T. 1996. Genomic diversity and differentiation among phytoplasma strains in 16S rRNA groups I (aster yellows and related phytoplasmas) and III (X-disease and related phytoplasmas). Intenational J. Syst. Bacteriol. 46:64-75.

Jiang , Y. P. and Chen T. A. 1987. Purification of mycoplasma-like organisms from lettuce with aster yellows disease. Phytopathol. 77:949-953.

Jiang, Y. P., Lei, J. D. and Chen, T.A. 1988. Purification of aster yellows agent form diseased lettuce using affinity chromatography. Phytopathol. 78:828-831.

Jordan, E., Saedler, H. and Starlinger, P. 1968. 0-zero and strong polar mutations in the gal operon are insertions. Mole Gen. Genet. 102:353-363.

Kirkpatrick, B., Smart, C., Gardner, S., Gao, J-L., Ahrens, U., Maurer, R., Schneider, B., Lorenz, K-H., Seemüller, E., Harrison, N., Namda, S., Daire, X. 1994. Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA spacer sequences. IOM letters 3:228-229.

Klaer, R., Küln, S., Tillman, E., Fritz, H-J. and Starlinger, P. 1981. The sequence of IS4. Mol. Gen. Genet. 181:169-175.

Kulkosky, J., Jones, K. S., Katz, R.A., Mack, J. P. G. and Skalka, A. M. 1992. Residues critical for retroviral integrative recombination in a region that is highly conserved among retrovial/retrotransposon integrases and bacterial insertion sequence transposases. Mol. Cell Biol. 12:2331-2338.

Kunkel, L. O. 1955. Cross protection between strains of yellows-type viruses. Adv. Virus Res. Vol. 3:251-273.

Lander, E. S. et al. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.

Le, Q. H., Weight, S., Yu, Z. and Bureau, T. 2000. Transposon diversity in Arabidopsis thaliana. PNAS. 97:7376-7381.

141 Madigan, M. T., Martinko, J. and Parker, J. 2003. Biology of microorganisms. pp195. Pearson Eduction Inc. Upper Saddle River, NJ.

Mahillon, J. and Chandler, M. 1998. Insertion Sequences. Microbiol. Mol. Biol. Rev. pp. 725-774.

Mandel, M. A., Wayne Crouch, V., Gunawardema, U. P., Harper, T. M. and Orbach, M. J. 1997. Physical mapping of the Magmaporthe grisea AVR1-MARA locus reveals the virulent allele contains two deletions. Mol. Plant-Microbe Interact. 10:1102-1105.

Marcone, C., Ragozzino, A. and Seemüller, E. 1997. Detection of Bermuda grass white leaf diseases in Italy and characterization of the associated phytoplasma by RFLP analysis. Plant Dis. 81:862-866.

Marcone, C. Neimark, H., Ragozzino, A., Lauer, U. and Seemüller. 1999. Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathol. 89:805-810.

McCoy, R. E., Caudwell, A., Chang, C. J., Chen, T. A., Chiykowski, L. N., Cousin, M. T., Dale, J. L., de Leeuw, G. T. N., Golino, D. A., Hackett, K. J., Kirkpatrick, B. C., Marwitz, R., Petzold, H., Sinha, R. C., Sugiura, M., Whitcomb, R. F., Yang, I. L., Zhu, B. M. and Seemüller, E. 1989. Plant diseases associated with mycoplasma-like organisms, p. 545-640. In Whitecomb, R.F. and Tully J.G. (ed.) The mycoplasmas Vol. V. Academic Press, New York.

Meyers, B. C., Tingery, S. V. and Morgante, M. 2001. Abundance distribution, and transcriptional activity of repetitive elements in the maize genome. Genome Res. 11:1660-1676.

Miller, S. A., Zhang, J., Hoy C.W. and Nault, L.R. “Monitoring aster yellows infectivity in leafhoppers during the vegetable growing season by the polymerase chain reaction” Phytopathology 87:S66 (1997).

Neimark, H. and Kirkpatrick B. C. 1993. Isolation and characterization of full-length chromosomes from non-culturable plant-pathogenic Mycoplasma-like organisms. Mol. Microbiol. 7:21-28.

Parker, J. 1989. Errors and alternatives in reading the universal genetic code. Microbiol. Rev. 53:273-298. 142

Rezsöhazy, R., Hallet, B., Mahillon, J. and Delcour, J. 1993. IS231Vand W from Bacillus thuringiensis subsp. Israelensis, two distant members of IS231 family of insertion sequences. Plasmid. 30:141-149.

Saedler, H. and Gierl, A. 1996. Transposable elements. (ed.) by Saedler, H. and Gierl, A. Springer-Verlag Berlin Heidelberg.

Schaff, D., Lee I-M. and Davis R. E. 1992. Sensitive detection and identification of mycoplasma-like organisms in plants by polymerase chain reactions. Biochemical and Biophysical Research Communications. Vol. 186:1503-1509.

Sekine, Y. and Ohtsubo, E. 1992. DNA sequence required for translational frameshifting in production of the transposase encoded by IS1. Mol. Gen. Genet. 235:325-332.

Sekine, Y., Nagasawa, H. and Ohtsubo, E. 1992. Identification of the site of translational frameshifting required for production of the transposase encoded by insertion sequence IS1. Mol. Gen. Genet. 235:317-324.

Sekino, N., Sekine, Y. and Ohtsubo, E. 1995. IS1-encoded proteins, InsA and the InsA- B’-InsB tansframe protein (transposase): functions deduced from their DNA- binding ability. Adv. Biophys. 31:209-222.

Selkov, E., Overbeek, R., Kogan, Y., Chu, L., Vonstein, V., Holmes, D., Silver, S., Haselkorn, R. and Fonstein, M. 2000. Functional analysis of gapped microbial genomes: Amino acid metabolism of Thiobacillus ferrooxidans. PNAS.97:3509- 3514.

Shapiro, J. A. 1969. Mutation caused by insertion of genetic material into the galactose operon of Eschichia coli. J. Mol. Biol. 40:93-105

Smart, C. D., Schneider, B., Blomquist C, L., Guerra, L. J., Harrison, N. A., Ahens, U., Lorenz, K-H., Seemüller, E., and Kirkpatrick, B. C., 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Applied and environmental Microbiology 62:2988-2993.

Takami, H., Nakasone, K., Takaki, Y., Maeno, G., Sasaki, R., Masui, N., Fuji, F., Hirama, C., Nakamura, Y. , Ogasawara, N., Kuhara, S. and Horikoshi, K. 2000. Complete genome sequence of the alkaliphilic bacterium Bacillus halodurans and

143 genomic sequence comparison with Bacillus subtillis. Nucleic Acid Res. 28: 4317-4331.

Vicient, C. M. Suoniemi, A., Anamthawat-Jónsson, K., Tanskanen, J., Beharav, A., Nevo, E. and Schulman, A. H. 1999. Retroposon BARE-1 and its role in genome evolution in the genome Hordum. Plant Cell. 11:1769-1784.

Vögele, K., Schwartz, E., Welz, C., Schiltz, E. and Rak, B. 1991. High-level ribosomal frameshifting directs the synthesis of IS150 gene products. Nucleic Acids Res. 19:4377-4385.

Wang, G. L., Holsten, T. E., Song, W-Y., Wang, H-P., and Ronald, P. C. 1995. Construction of a rice bacterial artificial chromosome library and identification of clones linked to the Xa-21 disease resistance locus. Plant J. 7:525-533

Weiss, R. B., Dunn, D. M., Atkins, J. F. M. and Gesteland, R. F. 1987. Slippery runs, shifty stops, backward steps and forward hops: -2, -1, +1, +2, +5 and +6 ribosomal frameshifting. Cold Spring Harb. Symp. Quant. Biol. 52:687-693.

Zuerner, R. L. 1994. Nucleotide sequence analysis of IS 1533 from Leptospria borgpetersenii: identification and expression of two IS-encoded proteins. Plasmid 31:1-11.

144

0 250 500 750 1000 1250 1500 1750 2000 bp

AYP266-265

AYP316-315

AYP349-348 145

AYP706-705

AYP503-504

AYP231-2-3

Figure 4.1 Illustration of putative transposase coding regions and primer binding sites (For primer sequence information refer to Table 4.1). The upstram ORFs are shown as clear rectangles and the downstream ORFs are shown as dotted rectangle. IRs were presented with clear pentagons. External primers are arrows outside of IRs and internal primers are arrows inside of IRs. For some transposase coding regions, more than one pair of internal primers were used. (continued)

Figure 4.1 continued

0 250 500 750 1000 1250 1500 1750 2000bp

AYP167-166

AYP199

AYP015

AYP207-206

146 AYP763

GTG GGA AAG TTT CAA AAT GAT TTA AAT ATA ACC ACT ATT TTA AAA 45 V G K F Q N D L N I T T I L K

ACG ATT CAA ACT AAA AGG AGT ACT TAT TAT TAT TGG TTA AAA GTT 90 T I Q T K R S T Y Y Y W L K V

AAC CAT AAA ATT AAA CTA AAA CAA GAA AAA TAT CTT TTA CAA CAA 135 N H K I K L K Q E K Y L L Q Q

AAA CGT ATT GAA TCT TTA TGC AGA ATT CAT GAA TAT TTA TTT GGC 180 K R I E S L C R I H E Y L F G

CAT AGT AAA ATC ACT AAT TTA TAT CAA AAA AAT TTT AAT GAA ACC 225 H S K I T N L Y Q K N F N E T

ATC ACT AAG AAA AAA GTT TAT CAC ATC ATG AAA GAA AAG AGT ATT 270 I T K K K V Y H I M K E K S I K S L S H H E R K E Y L TGT TGT CGT TTA AGA ATC AAA AAA ATA AAT ATC ATT ACC AAC AGT 315 C C R L R I K K I N I I T N S L S F K N Q K N K Y H Y Q Q L

TA AAA TCT CAA TTA AAA ATA GTT CTT AAT TTA ATT AAC CAA GAT 359 * K S Q L K I V L N L I N Q D

TTT AAA ACC TAT GAA CCG ATG CAA AAA CTC TTC ACA GGC ATC ACT 404 F K T Y E P M Q K L F T G I T

TAT TTT AAA ACT CAA CAA GGT TTT TTA TAT TTT TAT TGT ATT ATC 449 Y F K T Q Q G F L Y F Y C I I

GAC TCT TTT AAC AAT CAA ATT GTC GCT TCT CAT GTT AAA GGT TTT 494 D S F N N Q I V A S H V K G F

TTA ATC AGC ATG TCC AGA AAA ACC ACT ACC CGT GAT AAC GCT GTC 539 L I S M S R K T T T R D N A V

ATT TAA 545 I *

Figure 4.2 A frameshifting structure in putative transposase coding region AYP316-315 of aster yellows phytoplasma AY-WB genome. The frameshifting structure is underlined. The start codons and stop codons are in bold.

147 TTG TCG TTT AAG AAG CAA AAA AAT AAA TAT CAT TAT CAA CAA TTA 45 L S F K K Q K N K Y H Y Q Q L

AAA TCT CAA TTA AAA ATA GTT CCT AAT TTA ATT AAT CAA GAT TTT 90 K S Q L K I V P N L I N Q D F

AAA ACT TAT AAA CCG ATG CAA AAA CTA TTT ACC GAC ATC ACT TAT 135 K T Y K P M Q K L F T D I T Y

TTT AAA ACT CCA CAA GGT TTT TTA TAT TTT TCA TGT ATT ATC GAC 180 F K T P Q G F L Y F S C I I D

TCT TTT AAC AAT CAA ATA GTC GCT TCT CAT ATT TCT AAT CAT CAA 225 S F N N Q I V A S H I S N H Q

AAT AAA AAT TTA GTT TTA AAT ACT ATC AAA AAA ATG CCA AAA CTA 270 N K N L V L N T I K K M P K L

AAA AAA CCT TGT ATT ATT CAC TCA GAT CAA GGA ACA GTT TAC CAA 315 K K P C I I H S D Q G T V Y Q

TCA CAA AAA GTC CAA CAA AAT TTA ACG AAA AAA GGG TTT TTT TAA 360 S Q K V Q Q N L T K K G F F * K R V F L TC ATC ATG CCG AGA AAA GCC GCC CCT CGT GAT AAC GCC GTC ATT 404

I I M P R K A A P R D N A V I

GAG AAC TTT TTC GGC CAA ATG AAA AGT ATT TTA TTT TAT CGC GAT 449 E N F F G Q M K S I L F Y R D

CCT TTT TTA TTT CAA AAT CCA ATG ACA AAA ATG AAA ACC ATC ATT 494 P F L F Q N P M T K M K T I I

AAC CAA TTT CCT GCT TTT TGG AAT AAA AAA TGG ATT TTA GCT AAA 539 N Q F P A F W N K K W I L A K

TTA AAC TAT CTT TCA CCT ATC CAA TAT GCG TAA 572 L N Y L S P I Q Y A *

Figure 4.3 A frameshifting structure of putative transposase coding region AYP166-165 in aster yellows phytoplasma AY-WB genome. Start codons and stop codons are in bold. The frameshifting structure is underlined.

148

Figure 4.4 Putative transposase gene fragments amplified by polymerase chain reaction from DNA extracts of lettuce infected by aster yellows phytoplasma strains. Under each primer pair, DNA was extracted from 1) healthy lettuce, 2) lettuce infected by AY-BW, 3) AY-BD2, 4) AY-BD3, 5) AY-SS, 6) AY-SG, 7) AY-WB and 8) AY-S respectively. Notice that lanes 9-10 are PCR products from beet leafhopper transmitted virescence agent (BLTVA), western X (WX) and negative control respectively. DNA ladder from bottom to top: 100, 200, 300, 400, 500, 650, 850, 1000, 1650, 2000, 3054, 4072, 5000 etc. (Continued) 149 (Figure 4.4 continued)

150

Figure 4.5 Putative transposase gene fragments amplified by PCR from DNA extracts of leafhoppers infected by aster yellows phytoplasma strains. Under each primer pair, DNA was extracted from 1) healthy leafhopper, and leafhoppers infected by 2) AY-BW, 3) AY-BD2, 4) AY-BD3, 5) AY-SG, 6) AY-WB and 7) AY-S respectively. DNA ladder from bottom to top: 100, 200, 300, 400, 500, 650, 850, 1000, 1650, 2000, 3054, 4072, 5000 etc.

151

Figure 4.6 A boxplot of GC contents of transposase genes in various organism genomes with different GC contents. SPT represents Streptococcus pyogenes M1 with 37.3%GC in the genome; SPL, Staphylococcus aureus subsp aureus Mu 50 with31.5% GC; Bacillus, Bacillus licheniformis with 34.5% and AYP, aster yellows phytoplasma AY- WB with 26.9% GC. E. coli. genome contains 51% GC. The transposase genes were randomly selected from the genomes in the Genbank database.

152

Figure 4.7 Sequence alignment of the putative transposase coding regions in the genome of aster yellows phytoplasma AY-WB. (Continued)

153

(Figure 4.7 continued)

(Figure 4.7 continued) 154

(Figure 4.7 continued)

155

(Figure 4.7 continued)

156 0.1

Figure 4.8 Phylogenetic analysis of putative transposase coding regions in aster yellows phytoplasma AY-WB genome. The sequences starting with AYP are the putative transposase genes from AY-WB genome. Accession numbers are used for transposase genes from the Genbank database in organism of: NC002758, Staphylococcus aureus; U00039, Escherichia coli; AP004305, Oryza sativa. Z67739, Streptococcus pneumoniae. Z67739, Streptococcus pneumoniae; U01217, Mycoplasma hyorhinis L33925, Mycoplasma hyorhinis. The branch length value is the fraction of substitution between the nodes that define the branch

157 Primers In IR (I)/ Upstream/ PCR Primer sequences downstream Products out IR (E) positions* (bp) 706F -16868 955 CTTTACACTATATAGTTAGG 705R AAACTCTAATGAAAAAAACC 763F -21143 1204 TGTGCAAAAAGGTAACCTC 763R CAAACACAATACCCTAACG 199F -3769 874 CGTAATTATGTTATTTTGGTC 199R TTATTATTGGTTGAAAGTCG 015F -2359 786 AGGCGCAATAAAGATACCC 015R ACGCATCCAAGCTTTGTGTC 167F I/I -118214 834 GAATATTTATTTGGCCATCG 166R AAAGTTAAAAAGTCGTCAAC 167-1 I/I 21 -100 381 AATAAATATCATTATCAAC 166-2 GCGTTATCACGAGGGGCG N167 E/E -136307 1863 GATAGCCCTGTTTATTTTTG 166-4 TTAATACAACTTTTGTCTC N167 E/I -958214 1674 GATAGCCCTGTTTATTTTTG 166R AAAGTTAAAAAGTCGTCAAC 207F E/E -681918 2079 TAAATGGGGTGCAGTTCG 206R TATACACTGATTTGACTTGG 207F E/E -3041918 2336 TAAATGGGGTGCAGTTCG 206-4 TCATCGATTATTTGGCG 207-1 I/I 0106 220 GTGCATTTGTGGGTTTCAACG 206-2 GCGACATACTAAAAAAACCTC 231F I/I -242 -13 968 TCAGAGTTATAATGGTTATG 233R CAATATTGTGAAGGTGATG N231 E/I -685440 1852 TTTGAACTTGGTTTGGAGTC N233 TTAATCGATCGTTGGTTAGG N231 E/E -685684 2096 TTTGAACTTGGTTTGGAGTC 233-4 TTCGTTTAATTCGTTTTG 266F I/E -39155 961 GTCATATTTTACCCTTACAC 265R GAAGCACTTATTATTATTGG 266-3 E/E -264155 1197 CAGAGTTATAATGGTTATG 265R GAAGCACTTATTATTATTGG 316F I/E -121161 815 TTGAGAATATTGAATTGGTG 315R GATACATTGGTGTTAAGATGC N316 E/E -516507 1320 CTAACTTTTGCCGTGTTCCG N315 CTGCCATACCAGTTATAGG 349F E/E -244143 790 AGGGAATATTGAGTTGGTG 348R GAAGCGATTATTATTATTGG 349-1 I/I 72 -132 211 ACTAAATTAAAAGTAGTAGAC 348-2 TTGATGGCGTTTAAAACC 503INF I/I 34 -4 199 CAATATTTAAAATCCCAACAAC 504INR TGTTCCAAAATTTAGAG 503F I/E -171146 549 AATAAAACCCTCCAAAACC 504R TTTGTCCTTACGTTATAC N503 E/E -252257 746 ATTACAACCCTGATCGAAG N504 TCCATATACGCTGTTCC

Table 4.1 Primers for detection of putative transposase coding regions in aster yellows phytoplasmas. In IR/out IR represent primer inside inverted repeats/outside inverted repeats. *: Upstream refers to start codons of ORF1 and downstream refers to stop codons of ORF2 or stop codon of ORF1 for one-ORF regions.

158

Tpase Position Possible IR Contig IR and DR sequences (DR in Bold) ORFs on contigs position Length (bp) 503-504 1103-1339 924-938 8479 5’-TTAAAGaaAtAAaaCCC-3’ 1441-1455 3’-TTTTTCacTtTTgaGGG-5’ 349-348 3986-3575 4103-3991 4564 5’-TAATgTgGcAATA-3’ 3565-3553 3’-ATTAaAgCtTTAT-5’ 316-315 1480-939 1618-1608 4630 5’-CTtAATATcAA-3’ 797-787 3’-GAgTTATAaTT-5’ 167-166 800-229 12-32 2492 5'-AATTTATATAATTTtaaAGTTTC-3' 1622-1602 3'-AAAAATATATTAAAcgaTCAAAG-5' 231-2-3 1267-2003 933-947 3873 5’- TTTTTTTtatCAAA -3’ 2350-2336 3’- AAAAAAAtctGTTT -5’ 207-206 2497-2240 662-682 2928 5’-AAAAATTAtTTTTTA-TAAAATTT-3 2576-2555 3’-AATTTAATaAAAAATgATTTTAAA-5' 266-265 1509-732 1631-1605 3812 5’-TTTTTTcaaTTTTTTcACcATTcTTTT-3’ 629-603 3’-AAAAAAaccAAAAAAcTGaTAAaAAAA-5’ 706-705 2962-2233 12695 No found

199 2210-1434 2220 Not found

763 2495-1533 16356 Not found

015 765-61 824 Not found

Table 4.2 Possible inverted repeats (IR) and direct repeats (DR) flanking putative transposase coding regions in aster yellows phytoplasma AY-WB. Bold letters show DRs.

159

Primers I/E. Aster yellows strains and phytoplasma species AY- AY- AY- AY- AY- AY- AY-S BLTVA WX BW BD2 BD3 SS SG WB 199F/199R + + + + + + + - - 763F/763R + + + + + + + - - 706F/705R + + + + + + + - - 015F/015R + - - - + + - - - N167/166R EI + - - - + + + 167F/166R II + - - + + + - + 167-1/166-2 II - - - - + - - - N167/166-4 EE - - - - - + - - - 207/206 IE - - - - - + - 207-1/206-2 II - - - - + - - - 207F/206-4 EE - - - - - + - - - 231F/233R II + + + + + + + - - N231/N233 EI - - - - - + - N231/233-4 EE - - - - - + - - - 266F/265R IE + + + + + + + - - 266-3/265R EE + + + + + + + - 316F/315R IE - - - - - + - N316/N315 EE - - - - + - 349F/348R EE + + + + + + + - - 349-1/348-2 II - - - - + - - - 503F/504R IE - - - - - + - 503IN/504IN II - - - - - + - N503/N504 EE - - - - - + - - -

Table 4.3 PCR detection of putative transposase coding regions in phytoplasmas. The internal and external primers are represented as E or I respectively. EI represents forward primer is external and reward primer is internal and IE is opposite. PCR result positive is shown as + and negative as -, The blank cells show no detection. The other phytoplasma species are beet leafhopper transmitted virescence agent (BLTVA), grapevine yellows (GY) and western X (WX).

160

BIBLIOGRAPHY

Agrios, G. N. 1997. Plant disease caused by mollecultes: phytoplasmas and spiroplasmas (In) Plant Pathology. Acad. Press. San Diego. pp.457-470.

Ahrens, U., Lorenz, K-H. and Seemüller, E. 1993. Genetic diversity among mycoplasmalike organisms associated with stone fruit diseases. Mol. Plant-Mcrobe Interact. 6:686-691.

Andersson, S. G., Zomorodipour, A., Andersson, J. O., Sicheriz-Ponten, T., Alsmark, U. C., Podowski, R. M., Naslund, A. K., Eriksson, A. S., Winkler, H. H. and Kurland, C. G. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature, 396:133-140.

Badger, J. H. and Olsen, G. J. 1999. CRITICA: coding region identification tool invoking comparative analysis. Mol. Biol. Evol. 16:512-524.

Beanland, L. 1998. Leafhopper gender and fitness as parameters in transmission of aster yellows phytoplasma. M.S. thesis. The Ohio State University. Cloumbus.

161 Beanland, L. Hoy, C. W. Miller, S. A. and Nault, L. R. 1999. Leafhopper (Homoptera: Cicadellidae) transmission of aster yellows phytoplamsa: Does gender matter? Environ. Entomol. 28:1101-1106.

Beanland, L., Hoy, C.W., Miller, S.A. and Nault, L.R. 2000. Influence of aster yellows phytoplasma on the fitness of aster leafhopper (Homoptera: Cicadellidae). Ann. Entomol. Soc. Am. 93:271-276.

Bennett, C.W. 1927. Virus diseases of raspberries. Mich. Agr. Expt. Sta. Tech. Bull. 80.

Bennett, C.W. 1960. Sugar beet yellows diseases in the United States. U.S. Dept. Agr. Tech. Bull. 1281:1-63.

Bhugra, B. and Dybvig, K. 1993. Identification and characterization of IS1138, a transposable element from Mycoplasma pulmonis that belongs to the IS3 family Mol. Microbiol. 7:577-584.

Bonnet, F., Saillard, C. Kollar, A. Seemüller, E. and Dosba, F. 1990. Molecular probes for the apple proliferation MLO. Zentralbl. Bakteriol. Suppl. 20: 908-909.

Chang, C. J. 1989. Nutrition and cultivation of spiroplasmas. pp.201-241. In Whitecomb R. F. and Tully, J. G. (ed.), The mycoplasmas Vol. 5. Academic Press, New York.

Chang, C. J. 1998. Pathogenicity of aster yellows phytoplasma and Spiroplasma Citri on periwinkle. Phytopathology 88:1347-1340.

Chen T-A., Lei, J. D. and Lin, C. P. 1992. Detection and identification of plant and insect mollicutes. (In) The mycoplasmas (ed.) Whitcomb, R. F., Tully, J .G. 5:393-424. New York: Academic.

162 Chen, J. C., Chang, C. J., Jarret, R. and Gawel, N. 1992. Isolation and cloning of DNA fragments from mycoplasmalike organism associated with walnut witches’- broom disease. Phytopathology 82:306-309.

Chen, J., Chang, C. J. and Jarret, R. E. 1992. DNA probes as molecular markers to monitor the seasonal occurrence of walnut witches’-broom mycoplasmalike organisms. Plant Dis. 76:1116-1119.

Chiykoski, L. N., and Sinha, R. C. 1989. Differentiation of MLO disease by means of symptomatology and vector transmission. Zentrabl. Bakteriol. Hyg. Suppl. 20: 280-287.

Chiykowski, L. N. 1973. The aster yellows complex in North America. Proc. North Central Branch. Entomol. Soc. Am. 28:60-66.

Chiykowski, L. N. 1987. Aster yellows in strawberry. (In) Virus Diseases of small fruits. (Ed) by Converse, R. H. U.S. Government Printing Office. Washington, D.C. pp.31-34.

Chiykowski, L. N. 1991. Vector-pathogen-host plant relationships of clover phyllody mycoplasmalike organism and the vector leafhopper Paraphlepsius irroratus. Can. J. Plant Pathol. 13:11-18.

Chu, G., Vollrath, D., Davis, R. W. 1986. Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science, New Series, 234:1582- 1585.

Cronshaw, J. and Esau, K. 1967. Tublar and fibrillar components of mature and differentiating sieve elements. J. Cell Biol. 34:801-816.

Dai, L. and Zimmerly, S. 2002. Compilation and analysis of group II intron insertions in bacterial genomes: evidence for retroelement behavior. Nucleic Acids Res. 30: 1091-1102.

163 Davis, M. J., Tsai, J. H., Cox, R. L., MaDaniel, L. L. and Harrison, N. A. 1988. Cloning of chromosomal and extrachromosomal DNA of the mycoplasma-like organism that causes maize bushy stunt disease. Mol. Plant Microbe Interact. 1:295-302.

Deeley, J., Stevens, W. A., and Fox, R. T. V. 1979. Use of Dienes' stain to detect plant diseases induced by mycoplasmalike organisms. Phytopathology 69:1169-1171.

Deng, S. and Hiruki, C. 1990. Enhanced detection of a plant pathogenic mycoplasma-like organism by polymerase chain reaction. Proc. Japanese Acad. 66:140-144.

Derbyshire, K. M., Kramer, M. and Grindley, N. S. 1990. Role of instability in the cis action of the insertion sequence IS903 transposase. Proc. Natl. Acad. Sci. U.S.A. 87: 4048-4052.

Doolittle, W. F., Kirkwood, T. B. and Dempster, M. A. 1984. Selfish DNAs with self- restraint. Nature. 307:501-502.

Eden-Green, S. J. 1982. Cultrue of other microorganisms from yellows-diseases plants. (In) Plant and insect mycoplasma techniques. (Ed.) M.J. Daniels, P.G. Markham, Book, London Croom Helm. pp. 201-239.

Errampalli D. and Fletcher J. 1991. Incidence of yellows in carrot and lettuce and characterization of mycoplasmalike organism isolates in Oklahoma. Plant Dis. 6:579-584.

Errampalli, D. and Fletcher, J. and Fastman, C. 1986. Natural occurrence of aster yellows in vegetable crop in Oklahoma. (Abstract). Phytopathology 76:1084.

Esau, K., Cronshaw, J. and Hoefert, L.L. 1966. Organization of beet yellows-virus inclusions in leaf cells of beta. Proc. Natl. Acad. Sci. U.S. 55:486-493.

Esau, K., Cronshaw, J. and Hoefert, L.L. 1967. Relation of beet yellows to the phloem and to movement in the sieve tube. J. Cell Biol. 32:71-87.

Ewing, B., Hillier, L., Wendl, M. C. and Green, P. 1998. Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Res. 8:175-185.

Ewing, B. and Green, P. 1998. Base-calling of automated sequencer traces using Phred. II. Error probabilities. Genome Res. 8:186-194.

Farman, M. L. and Leong, S. A. 1998. Chromosome walking to the AVR1-CO39 avirulence gene of Magnaporthe grisea: Discrepancy between the physical and genetic maps. Genetics 150:1049-1058.

Fayet, O., Ramond, P., Polard, P., Prère, M. F. and Chandler, M. 1990. Functional similarities between retroviruses and the IS3 family of bacterial insertion sequences? Mol. Microbiol. 4:1771-1777.

Ferat, J. L and Michel, F. 1993. Group II self-splicing introns in bacteria. Nature, 364:358-361.

Feschotte, C., Jiang, N. and Wessler, S.R. Plant transposable elements: where genetics meets genomics. Nature Rev. 3:1-14.

Firrao, G. and Locci, R. 1993. Rapid preparation of DNA from phytopathogenic mycoplasma-like organisms for polymerase chain reaction analysis. Letters in Appl. Microbiol. 17:280-281.

165 Firrao, G., Smart, C. D. and Kirkpatrick, B. C. 1996. Physical map of the western X- disease phytoplasma chromosome. J. Bacteriol. 178:3985-3988.

Fletcher, J. and Eastman, C.E. 1984. Translocation and multiplication of Spiroplasma citri in turnip (Bassica rapa). Current Microbiol. 11:289-292.

Fraser C. M., Gocayne, J. D. and White, O. et al. 1995. The minimal gene complement of Mycoplasma genitalium. Science 270:397-403.

Freifelder, D. 1987. The colicinogenic or col plasmids. (In) Microbial genetics. Jones and Bartlett Publishers Boston. pp.274-277.

Freitag, J. H. 1964. Interaction and mutual suppression among three strains of aster yellows virus. Virology. 24:401-413.

Gibertson, R.L. and Lucas, W.J. 1996. How do viruses traffic on the ‘vascular highway’? Trands Plant Sci. 1:260-268.

Glass, J. I., Lefkowitz, E. J., Glass, J. S., Heiner, C. R. Chen, E. Y. and Cassell G. H. 2000. The complete sequence of the mucosal pathogen Ureaplasma urealyticum. Nature 407: 757-762.

Grindley, N. D. and Joyce, C. M. 1981. Analysis of the structure and function of kanamycin resistance transposon Tn903. Cold Spring Harb. Symp. Quant. Biol. 45 Pt 1:125-133.

Gundersen, D. E. and Lee, I-M. 1995. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathology Mediterr. 35:144-151.

166 Gundersen, D. E., Lee, I-M., Schaff, D. A., Harrison, N. A., Chang, C. J., Davis, R. E. and Kingsbury, D. T. 1996. Genomc diversity and differentiation among phytoplasma strains in 16S rRNA group I (aster yellows and related phytoplasmas) and III (X-disease and related phytoplasmas). Int. J. Syst. Bacteriol. 46:64-75.

Harrison, N. A. 2001. Phytoplasma taxonomy. First internet conference on phytopathogenic Mollicutes. http://www.uniud.it/phytoplasma/pap/harr1810.html

Harrison, N. A., Richardson, P. A., Kramer, J. B. and Tsai, J. H. 1994. Detection of the mycoplasma-like organism associated with lethal yellowing disease of palms in Florida by polymerase chain reaction. Plant Pathology (Oxford) 43: 998-1008.

Henderson,D. J., Lydiate, D. J. and Hopwood, D. A. 1989. Structural and functional analysis of the minicircle, a transposable element of Streptomyces coelicolor A3(2) Mol. Microbiol. 3:1307-1318.

Henson, J.M. and French, R. 1993. The polymerase chain reaction and plant disease diagnosis. Ann. Rev. Phytopathology 31:81-109.

Hill, F., Gemund, C., Benes, V., Ansorge, W. and Gibson, T.J. 2000. An estimate of large-scale sequencing accuracy. EMBo Reports. 1:29-31.

Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B-C. and Herrmann, R. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24:4420-4449.

Hiruki, C. and Dijkstra, J. 1973. Light and electron microscopy of vinca plants infected with mycoplasma-like bodies of the sandal spike disease. 2nd Int. Cong. Plant Pathol. Abstract, 640.

Hirumi, H. and Maramorosch, K. 1973 (a). Intracytoplasmic mycoplasmalike bodies in phloem parenchyma cells of aster yellow-infected Nicotiana rustica. Phytopathology Z. 77:71-83.

Hirumi, H. and Maramorosch, K. 1973(b). Ultrastructure of the aster yellows agent: mycoplasmalike bodies in sieve-tube elements of Nicotina rustica. Ann. N.Y. Acad. Sci. 225:201-222.

Howard, R. J., Garland, A. J. and Seaman, L.W. 1994. Diseases and pests of vegetable crops in Canada. Can. Phytopathol. Soc. Entomol. Soc. Canada. pp. 144-157.

Hoy, C. W., Heady, S. E. and Koch, T. A. 1992. Species comparison, phenology, and possible origins of leafhoppers (Cicadellidae) in Ohio vegetable crops. Hort. Entomol. 85:2336-2343. 167

Ishiie, T., Doi, Y., Yora, K. and Asuyama, H. 1967. Suppressive effects of antibiotics of tetracycline group on symptom development of mulberry dwarf disease. Ann. Phytopathol. Soc. Jpn. 33:267-275.

Jacob, C., Nouzieres, F., Duret, S. Bove, J.-M. and Renaudin, J. 1997. Isolation, characterization, and complementation of a motility mutant of Spiroplasma citri. J. Bacteriol. 179: 4802-4810.

Jacoli, G. G. 1978 (a). Early phases of degeneration of mycoplasma-like bodies in plant tissue cultures infected with Mycopasma hominis. Can. Microbiol. 24:1053- 1057.

Jacoli, G. G. 1981. Attempts to culture in vitro mycoplasma-like organisms from plants. Phytopathol. Z.102:148-152.

Jacoli, G. G. and Ronald, W. P.1974. Electron microscopic studies of plant tissue cultures infected with aster yellows disease. J. Ultrastruc. Res. 46:34-42.

Jacoli, G. G.1978 (b). Sequential degeneration of mycoplasma-like bodies in plant tissue cultures infected with aster yellows. Can. J. Bot. 56:133-140.

Jalouli, J., Sand, L., Gustavsson, B., Hirsch, J. M. and Larsson, P. A. 1999. High- throughput DNA extraction from old paraffin-embedded biopsies. BioTech. 27:334-338.

Jeanmougin, F., Thompson, J. D., Gouy, M., Higgind, D. G. and Gibson, T. J. 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23:403-405.

Jiang , Y. P. and Chen T. A. 1987. Purification of mycoplasma-like organisms from lettuce with aster yellows disease. Phytopathology 77:949-953.

Jiang, Y. P., Lei, J. D. and Chen, T. A. 1988. Purification of aster yellows agent from diseased lettuce using affinity chromatography. Phytopathology 78:828-831.

168 Jomantiene, R., Davis, R. E., Maas, J. and Dally, E. L. 1998. Classification of new phytoplasmas associated with diseases of strawberry in Florida, based on analysis of 16S rRNA and ribosomal protein gene operon sequences. Int. J. Syst. Bacteriol. 48. Pt 1: 269-77.

Jordan, E., Saedler, H. and Starlinger, P. 1968. 0-zero and strong polar mutations in the gal operon are insertions. Mole Gen. Genet. 102:353-363.

Kennedy, D. and Park, R. B. 1971. Virus movement. (in) Phloem transport in plants, A series of books in biology. WH Freeman and Co. pp.203-215.

Khadhair, A. H., Kaw Chuk, L. M., Taillon, R. C. and Botar, G. 1998. Detection and molecular characterization of aster yellows phytoplasma in parsley. Can. J. Plant Pathol. 20:55-61.

Kirkpatrick, B. C. and Smart, C. D. 1995. Phytoplasmas: can phylogeny provide the means to understand pathogenicity? Adv. Bot. Res. 21: 187-212.

Kirkpatrick, B., Smart C. D., Gardner, S., Gao J-L., Ahrens, U., Maurer, R., Schneider B., Lorenz, K-H., Seemüller, E., Harrison, N., Namda, S., Daire, X. 1994. Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA spacer sequences. IOM letters 3:228-229.

Klaer, R., Küln, S., Tillman, E., Fritz, H-J. and Starlinger, P. 1981. The sequence of IS4. Mol. Gen. Genet. 181:169-175.

Kloepper, J.W., Garrott, D.G. and Oldfield, G.N. 1982. Quantification of plant pathogenic spiroplasmas from infected plants. Phytopathology 72:577-581.

Ko, H. C. and Lin, C. P. 1994. Development and application of cloned DNA probes for a mycoplasmalike organism associated with sweet potato witches’-broom. Phytopathology 84:468-473.

Kollar, A. and Seemüler, E. 1989. Base composition of the DNA of mycoplasma-like organism associated with various plant diseases. Phytopathol. Z. 127:177-186.

Kollar, A., Seemüller, E., Bonnet, F., Saillard, C. and Bove, J. M. 1990. Isolation of the DNA of various plant pathogenic mycoplasmalike organisms from infected plants. Phytopathology 80:233-237.

169 Kulkosky, J., Jones, K. S., Katz, R.A., Mack, J. P. G. and Skalka, A. M. 1992. Residues critical for retroviral integrative recombination in a region that is highly conserved among retrovial/retrotransposon integrases and bacterial insertion sequence transposases. Mol. Cell Biol. 12:2331-2338.

Kunkel, L. O. 1924. Insect transmission of aster yellows. (Abs.) Phytopathology 14:54.

Kunkel, L. O. 1925. Insect transmission and host range of aster yellows. (Abs.) Science. 62:524.

Kunkel, L. O. 1926. Studies of aster yellows. Am. J. Botany. 13:646-705.

Kunkel, L. O. 1937. Effect of heat on ability of Cicadula sexnotata (Fall.) to transmit aster yellows. Am. J. Botany. 24:316-327.

Kunkel, L. O. 1955. Cross protection between strains of yellows-type viruses. Adv. Virus Res. 3: 251-273.

Kunkel, L. O. 1957. Acquired immunity to infection by strains of aster yellows virus in aster leafhopper. Science 126:1233.

Lander, E. S. et al. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.

Le, Q. H., Weight, S., Yu, Z. and Bureau, T. 2000. Transposon diversity in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 97:7376-7381.

Lee I-M., Gundersen, D. E., Hammond, R.W., Davis, R. E.1994. Use of mycoplasmalike organism (MLO) group-specific oligotide primer for nested-PCR assays to detect mixed-MLO infections in a single host plants. Phytopathology 84:559-566.

170 Lee, I.-M. and Davis, R. E. 1983. Phloem-limited prokaryotes in sieve elements isolated by enzyme treatment of disease plant tissues. Phytopathology 73:1540-1543.

Lee, I-M., and Davis, R. E. 1986. Prospects for in vitro culture of plant pathogenic mycoplasmalike organisms. Ann. Rev. Phytopathol. 24:339-354.

Lee, I-M., Bertaccini, A. Vibio, M. and Gundersen, D. E. 1995. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85:728-735.

Lee, I-M., Davis R. E. and Gundersen-Rindal, D. E. 2000. Phytoplasma: Phytopathogenic mollicutes. Ann. Rev. Microbiol. 54:221-255.

Leisner, S.M. and Turgeon, R. 1993. Movement of virus and photoassimilate in the phloem: a comparative analysis. Bioassays 15:741-748.

Lherminier, J., Bonfiglioli, R.G., Daire, X., Symons, R.H. and Boudon-Padieu, E. 1999. Oligodeoxynucleotides as probes for in situ hybridization with transmission electron microscopy to specifically localize phytoplasma in plant cells. Mol. Cell Probes. 13:41-47.

Liefting, L.W., Andersen, M. T., Beever, R. E. and Gardner, R. C. 1996. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma. Appl. Environ. Microbiol. 62:3133-3139.

Lim, P.O. and Sears, B.B. 1989. 16S rRNA sequence indicates that plant-pathogenic mycoplasmalike organisms are evolutionarily distinct from animal mycoplasmas. J. Bacteriol. 171:5901-5906.

Littau, V. C. and Maramorosch, K. 1960. A study of the cytological effects of aster- yellows virus on its insect vector. Virology. 10:483-500.

Machida, Y., Machida, C., Ohtsubo, H. and Ohtsubo, E. 1982. Factors determining frequency of plasmid cointegration mediated by insertion sequence IS1. Proc. Natl. Acad. Sci. U.S.A. 79:277-281.

Madden, L. V., Nault, L. R., Murral, D. J. and Apelt, M. R. 1995. Spatial pattern analysis of the incidence of aster yellows disease in lettuce. Res. Popul. Ecol. 37:279-289.

Madigan, M. T., Martinko, J. and Parker, J. 2003. Biology of microorganisms. pp195. Pearson Eduction Inc. Upper Saddle River, NJ.

Mahillon, J. and Chandler, M. 1998. Insertion Sequences. Microbiol. Mol. Biol. Rev. p. 725-774.

Maramorosch, K. 1952. Studies on the nature of the specific transmission of aster- yellows and corn-stunt viruses. Phytopathology 42:663-668.

Marcone, C., Ragozzino, A. and Seemüller, E. 1997. Detection of Bermuda grass white leaf diseases in Italy and characterization of the associated phytoplasma by RFLP analysis. Plant Dis. 81:862-866.

172

Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. and Seemüller, E. 1999. Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology 89:805-810.

McCoy, R. E. 1976. Plant phloem sap: a potential mycoplasma growth medium. Proc. Soc. Gen. Microbiol. 3:155(Abstr.).

McCoy, R. E. 1977. Growth of mycoplasmas in phloem sap from lethal yellowing resistant Malayan dwarf coconut palm. Proc. Am. Phytoathol. Soc. 4:108 (Abstr.).

Meyers, B. C., Tingery, S. V. and Morgante, M. 2001. Abundance distribution, and transcriptional activity of repetitive elements in the maize genome. Genome Res. 11:1660-1676.

Miller, S. A., Zhang, J., Hoy, C.W. and Nault, L.R. 1997. “Monitoring aster yellows infectivity in leafhoppers during the vegetable growing season by the polymerase chain reaction” Phytopathology 87:S66.

Mitsuhashi, J. 1979. Artificial rearing and aseptic rearing of leafhopper vectors: Applications in virus and MLO research. (In) Leafhopper vectors and plant disease agents. (Ed.) Maramorosch, K. and Harris, K. F. pp. 369-412.

Morisato, D., Way, J. C., Kim, H. J. and Kleckner, N. 1983. Tn10 transposase acts preferentially on nearby transposon ends in vivo. Cell 39:181-190.

173

Murray, R. G. E. and Schleifer, K. H. 1994. Taxonomic notes: a proposal for recording the properties of putative taxa of prokaryotes. Int. J. syst. Bacteriol. 44:174-176.

Namba, S., Oyaizu, H., Kato, S., Iwanami, S. and Tsuchizaki. 1992. Phylogenetic diversity of phytopathologenic mycoplasmalike organisms. Int. J. Syst. Bacteriol. 43:461-467.

Nasu, S., Jensen, D. D., Richardson, J. 1974. Primary culturing of the western X mycoplasma-like organism rom Collasous montanus leafhopper vectors. Appl. Entomol. Zool. 9:115-126.

Neimark, H. and Kirkpatrick B. C. 1993. Isolation and characterization of full-length chromosomes from non-culturable plant-pathogenic Mycoplasma-like organisms. Mol. Microbiol. 7:21-28.

Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Appl. Biosci. 12:357-358.

Palmano, S. and Firrao, G. 2000. Diversity of phytoplasmas isolated from insects, determined by a DNA heteroduplex mobility assay and a length polymorphism of the 16S—23S rDNA spacer region analysis. J. Appl. Microbiol. 89:744-750.

Parker, J. 1989. Errors and alternatives in reading the universal genetic code. Microbiol. Rev. 53:273-298.

Peterson, A. G. 1973. Host plant and aster leafhopper relationships. Proc. North Cent. Branch Entomol. Soc. Am. 28:66-70.

Prentki, P., Pham, M. H., Gamas, P., Chandler, M. and Galas, D. J. 1987. Artificial transposable elements in the study of the ends of IS1. Gene 61:91-101.

Razin, S., Yogev, D. and Naot, Y. 1998. Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev. 62:1094-1156.

174 Rezsohazy, R., Hallet, B., Mahillon, J. and Delcour, J. 1993. IS231Vand W from Bacillus thuringiensis subsp. Israelensis, two distant members of IS231 family of insertion sequences. Plasmid. 30:141-149.

Richardson, H. P. 1967. Host reactions to three strains of aster yellows virus from Manitoba. Can. J. Bot. 45:657-664.

Saedler, H. and Gierl, A. 1996. Transposable elements. (ed) by Saedler, H. and Gierl, A. Springer-Verlag Berlin Heidelberg.

Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning, A laboratory manual. 9.31-9.62. Cold Spring Harbor Laboratory Press.

Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning, A laboratory manual. A1, A6. Cold Spring Harbor Laboratory Press.

Sato, S., Nakamura, Y., Kaneko, T., Asamizu, E. and Tabata, S. 1999. Complete structure of the chloroplast genome of Arabidopsis thaliana. DNA Res. 6:283- 290.

Sawada, M., Osawa, S., Kobayashi, H., Hori, H. and Muto, A. 1981. The number of ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 182: 502-4.

Schaff, D. Lee, I.-M. and Davis R.E. 1992. Sensitive detection and identification of Mycoplasma-like organism in plants by polymerase chain reactions. Biochemical and Biophysical Res. Commun. 186:1503-1509.

Schaper, U. and Seemüller 1982. Conditions of the phloem and persistence of mycoplasmalike organisms associated with apple proliferation and pear decline. Phytopathology 72:736-742.

Schneider, B. and Seemüller, E. 1994. Presence of 2 set of ribosomal genes in phytopathogenic mollicutes. Appl. Environ. Microbiol. 60:3409-3412.

175

Schneider, I. Introduction, translocation, and distribution of viruses in plants. Advan. Virus Res. 11:163-221.

Sears, B. B. and Kirpatrick, B. C. 1994. Unveiling the evolutionary relationships of plant-pathogenic mycoplasmalike organisms. Am. Soc. Microbiol. News. 60: 307-312.

Sears, B. B., Lim P. O., Holland, N. Kirkpatrick, B. C. and Klomparens, K. L.1989. Isolation and characterization of DNA from a mycoplasmalike organism. Mol. Plant-Microbe Interact. 2:175-180.

Sekine, Y. and Ohtsubo, E. 1992. DNA sequence required for translational frameshifting in production of the transposase encoded by IS1. Mol. Gen. Genet. 235:325-332.

176 Selkov, E., Overbeek, R., Kogan, Y., Chu, L., Vonstein, V., Holmes, D., Silver, S., Haselkorn, R. and Fonstein, M. 2000. Functional analysis of gapped microbial genomes: Amino acid metabolism of Thiobacillus ferrooxidans. Proc. Natl. Acad. Sci. USA. 97:3509-3514.

Shapiro, J. A. 1969. Mutation caused by insertion of genetic material into the galactose operon of Eschichia coli. J. Mol. Biol. 40:93-105

Shiomi, T. and Sugiura, M. 1984. Grouping of mycoplasma-like organisms transmitted by the leafhopper vector, Macrosteles orientalis Virvaster, based in host range. Ann. Phytopathol. Soc. Jpn. 50:149-157.

Sinha, R. C. 1974. Purification of mycoplasma-like organisms from China aster plants affected with clover phyllody. Phytopathology 64:1156-1158.

Sinha, R. C. 1979. Purification and serology of mycoplasma-like organisms from aster yellows-infected plants. Can. J. Plant Pathol. 1:65-70.

Sinha, R. C. 1983. Relative concentration of mycoplasma-like organisms in plants at various times after infection with aster yellows. Can. J. Plant Pathol. 5:7-10.

Smith, R. E. 1902. Growing China aster. Hatch Exp. Station, MA. Agric. Coll. Bul. 79:1- 26.

Stryer, L. 1995. Biochemistry, 4th edition. pp. 284. W. H. Freeman and Company. New York.

Takami, H., Han, C-G., Takaki, Y. and Ohtsubo, E. 2001. Identification and distribution of new insertion sequences in genome of alkaliphilic Bacillus halodurans C-125. J. Bacteriol. 183:4345-4356.

177 Takami, H., Nakasone, K., Takaki, Y., Maeno, G., Sasaki, R., Masui, N., Fuji, F., Hirama, C., Nakamura, Y., Ogasawara, N., Kuhara, S. and Horikoshi, K. 2000. Complete genome sequence of the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis. Nucleic Acids Res. 28:4317-4331.

Tan, P.Y. and Whitlow, T. 2001. Physiological responses of Cathranthus roseus (periwinkle) to ash yellows phytoplasmal infection. New Phytologist, 150:757- 769.

Thomas, D. L. and Norri, R. C. 1980. The use of electronmicroscope for lethal yellowing diagnosis. Proc. Florida State Hort. Soc. 93:196-199.

Tully, J. G., Whitcomb, R. F., Bove, J. M., Saglio P. 1973. Plant mycoplasmas: Serological relation between agents associated with citrus stubborn and corn-stunt diseases. Science 182:827-829.

Vögele, K., Schwartz, E., Welz, C., Schiltz, E. and Rak, B. 1991. High-level ribosomal frameshifting directs the synthesis of IS150 gene products. Nucleic Acids Res. 19:4377-4385.

Wang, H., Qi, M. and Culter, A. J. 1993. A simple method of preparing plant samples for PCR. Nucleic Acids Res. 21:4153-4154.

178 Wang, K. and Hiruki, C. 2000. Heteroduplex mobility assay detects DNA mutations for differentiation of closely related phytoplasma strains. J. Microbiol. Methods. 41:59-68.

Zhang, J., Hogenhout, S. A. and Miller, S. A. Isolation of aster yellows phytoplasma genomic DNA from lettuce. Phytopathology 91:S99 (2001).

Zhu, B. M. and Seemüller, E. 1989. Plant diseases associated with mycoplasmalike organisms. pp.545-640. (In) The Mycoplasmas Vol. 5. Spiroplasmas, Acholeplasmas and Mycoplasmas of Plant and Arthropods. Whitecomb R. F. and Tully, J. G. (ed.) Acad. Press, New York.

Zuerner, R. L. 1994. Nucleotide sequence analysis of IS 1533 from Leptospria borgpetersenii: identification and expression of two IS-encoded proteins. Plasmid 31:1-11.

179