Human Mutation
Clinical and functional characterization of two novel ZBTB20 mutations causing Primrose syndrome
Journal: Human Mutation Manuscript ForID Draft Peer Review Wiley - Manuscript type: Brief Report
Date Submitted by the Author: n/a
Complete List of Authors: Stellacci, Emilia; Istituto Superiore di Sanità, Oncologia e Medicina Molecolare Steindl, Katharina; Institute of Medical Genetics, University of Zurich Joset, Pascal; Institute of Medical Genetics, University of Zurich Mercurio, Laura; Istituto Superiore di Sanità, Oncologia e Medicina Molecolare Anselmi, Massimiliano; Università di Roma 'Tor Vergata', Dipartimento di Scienze e Tecnologie Chimiche Cecchetti, Serena; Istituto Superiore di Sanità, Servizio grandi strumentazioni e core facilities Gogoll, Laura; Institute of Medical Genetics, University of Zurich Zweier, Markus; Institute of Medical Genetics, University of Zurich Hackenberg, Annette; University Children's Hospital Zürich, Division of Pediatric Neurology Bocchinfuso, Gianfranco; Università di Roma 'Tor Vergata', Dipartimento di Scienze e Tecnologie Chimiche Stella, Lorenzo; Universita' "Tor Vergata", Dipartimento di Scienze e Tecnologie Chimiche Tartaglia, Marco; Bambino Gesù Children’s Hospital, IRCCS, Division of Genetic Disorders and Rare Diseases Rauch, Anita; University of Zurich, Institute of Medical Genetics
Primrose syndrome, ZBTB20, 3q13.31 microdeletion syndrome, Key Words: mutation spectrum, functional analyses
John Wiley & Sons, Inc. Page 1 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 1 1 2 3 Clinical and functional characterization of two novel ZBTB20 mutations causing Primrose 4 5 syndrome 6 7 8 9 Emilia Stellacci1*, Katharina Steindl2*, Pascal Joset2, Laura Mercurio1, Massimiliano Anselmi3, 10 11 Serena Cecchetti4, Laura Gogoll2, Markus Zweier2, Annette Hackenberg5, Gianfranco 12 13 3 3 6§ 2,7,8,9§ 14 Bocchinfuso , Lorenzo Stella , Marco Tartaglia , Anita Rauch 15 16 17 1 18 Dipartimento di Oncologia e Medicina Molecolare, Istituto Superiore di Sanità, Rome, Italy; 19 2 Institute of Medical Genetics,For University Peer of Zurich, Review Schlieren Zurich, Switzerland; 20 21 3 Dipartimento di Scienze e Tecnologie Chimiche, Universita` di Roma ‘‘Tor Vergata’’ Rome, 22 23 Italy; 24 4 Servizio grandi strumentazioni e core facilities, Istituto Superiore di Sanità, Rome, Italy; 25 26 5 Division of Paediatric Neurology, University Children’s Hospital Zurich, Zürich, Switzerland; 27 6 28 Genetics and Rare Diseases Research Division, Ospedale Pediatrico Bambino Gesù, Rome, Italy; 29 7 radiz—Rare Disease Initiative Zürich, Clinical Research Priority Program for Rare Diseases 30 31 University of Zurich, Zurich, Switzerland 32 8 Neuroscience Center Zurich, University of Zurich and ETH Zurich, Zurich, Switzerland 33 34 9 Zurich Center for Integrative Human Physiology, University of Zurich, Zurich, Switzerland 35 36 37 *These authors equally contributed to this work. 38 39 §These authors jointly coordinated this work. 40 41 42 43 *Corresponding authors: 44 45 Emilia Stellacci, 46 Department of Oncology and Molecular Medicine, 47 48 Istituto Superiore di Sanità, 49 Viale Regina Elena, 299, Rome 00161, Italy. 50 Phone: +390649903197; e mail: [email protected] 51 52 Katharina Steindl, 53 Institute of Medical Genetics, 54 University of Zurich, 55 Wagistrasse 12, 8952 Schlieren Zurich, Switzerland. 56 Phone: +41445563300; e mail: [email protected] 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 2 of 22
Stellacci, Steindl, et al. Pag. 2 1 2 3 4 5 Disclosure statement: 6 7 8 The authors declare no conflict of interest. 9 10 11 12 13 Acnowledgements 14 15 16 We are grateful to the families who contributed to this study. We thank Serenella Venanzi for 17 18 technical support. This study was supported by grants from the University of Zurich clinical 19 For Peer Review 20 research priority program radiz (rare disease initiative Zurich), Fondazione Bambino Gesù (Vite 21 22 coraggiose) and Fondazione Umberto Veronesi. 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 3 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 3 1 2 3 ABSTRACT 4 5 Primrose syndrome (PS) is a rare disorder characterized by macrocephaly, tall stature, intellectual 6 7 disability, autistic traits, and disturbances of glucose metabolism with insulin resistant diabetes and 8 9 distal muscle wasting occurring in adulthood. The disorder is caused by functional dysregulation of 10 11 ZBTB20, a transcriptional repressor controlling energetic metabolism and developmental programs. 12 13 14 ZBTB20 maps in a genomic region that is deleted in the 3q13.31 microdeletion syndrome, which 15 16 explains the partial clinical overlap between the two disorders. A narrow spectrum of amino acid 17 18 substitutions in a restricted region of ZBTB20 encompassing the first and second zinc finger motifs 19 For Peer Review 20 have been reported thus far. Here, we characterize clinically and functionally the first truncating 21 22 mutation (c.1024delC; p.Gln342Serfs*42) and a missense change affecting the third zinc finger 23 24 motif of the protein (c.1931C>T; p.Thr644Ile). Our data document that both mutations have 25 26 27 dominant negative impact on wild type ZBTB20, providing further evidence of the specific 28 29 behavior of PS causing mutations on ZBTB20 function. 30 31 32 33 34 35 Keywords: Primrose syndrome, ZBTB20, 3q13.31 microdeletion syndrome, mutation spectrum, 36 37 functional analyses. 38 39
40 41 42 43 44 45 46 47 48 49 50 51 52
53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 4 of 22
Stellacci, Steindl, et al. Pag. 4 1 2 3 MAIN TEXT 4 5 Recognized as a nosologic entity for the first time over 35 years ago (Primrose, 1982), Primrose 6 7 syndrome (PS; MIM #259050) is a rare genetic condition characterized by cognitive deficits often 8 9 associated with autism spectrum disorder, macrocephaly, tall stature, truncal obesity, and a 10 11 distinctive pattern of ectopic calcification. With age, deafness, atrophy of the muscles of the limbs, 12 13 14 disturbed glucose metabolism and onset of diabetes in adults is commonly observed in affected 15 16 individuals (Collacott et al, 1986; Lindor et al, 1996; Battisti et al, 2002; Dalal et al, 2010; Posmyk 17 18 et al, 2011; Carvalho et al, 2011). The assumption of autosomal dominant inheritance of this 19 For Peer Review 20 sporadic condtion was confirmed by the identification of heterozygous de novo missense mutations 21 22 in ZBTB20 as the molecular event underlying the trait (Cordeddu et al, 2014). Consistent with the 23 24 occurrence of intellectual disability, behavioral issues and altered energetic metabolism in PS 25 26 27 patients, ZBTB20 is a transcriptional repressor involved in the control of brain development and 28 29 glucose metabolism (Sutherland et al, 2009; Mitchelmore et al, 2002; Nielsen et al, 2007). The 30 31 protein is a member of the broad complex tramtrack bric a brac (BTB) zinc finger family (Zhang et 32 33 al, 2001; Zhang et al, 2012; Zhang et al, 2015), and is characterized by an N terminal BTB domain 34 35 that is involved in protein protein interaction, and five C2H2 zinc fingers at the C terminus 36 37 mediating protein binding to regulatory sites within promoters of target genes. So far, all mutations 38 39 causing PS have been reported to be missense and affect amino acid residues within a region of the 40 41 42 protein encompassing the first and second zinc finger (ZnF) motifs (Cordeddu et al, 2014; Mattioli 43 44 et al, 2016) (Figure 1A). ZBTB20 maps in a relatively small region containing a few additional 45 46 protein coding genes (DRD3, ZNF80, and TIGIT) that is deleted in the 3q13.31 microdeletion 47 48 syndrome (del3q13.31, MIM #615433), a complex condition clinically overlapping PS and 49 50 characterized by postnatal growth in the upper normal range, hypotonia, intellectual disability (ID), 51 52 developmental delay, disturbed behavior and dysmorphic features (Hervé et al, 2016). Of note, we 53 54 55 previously provided evidence for a dominant negative impact of PS causing mutations, indicating 56 57 that PS and del3q13.31 syndrome may represent allelic disorders resulting from variably impaired 58 59 60 John Wiley & Sons, Inc. Page 5 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 5 1 2 3 ZBTB20 function (Cordeddu et al, 2014). Here, we report on the clinical and functional 4 5 characterization of two novel ZBTB20 mutations, a truncating frameshift (c.1024delC; 6 7 p.Gln342Serfs*42) and a missense substitution (c.1931C>T; p.Thr644Ile) affecting the third ZnF 8 9 motif, identified by whole exome sequencing (WES) in two young individuals with ID, 10 11 macrocephaly and syndromic features. We document that both changes result in stable but 12 13 14 dysfunctional proteins characterized by impaired/defective binding to DNA, and provide further 15 16 evidence for their dominant negative impact on ZBTB20 function. 17 18 The study was approved by the University Children’s Hospital of Zurich, and written 19 For Peer Review 20 informed consent was obtained from each participant for DNA storage and genetic analyses. 21 22 Patient 1 (P1) was an 8.5 year old boy with mild developmental delay and macrocephaly born to 23 24 non consanguineous healthy parents from the Dominican Republic (Figure 1B upper panels and 25 26 27 Suppl. Table 1). He was born at 35 + 3/7 weeks of gestation by Caesarean section with a weight of 28 th th th th 29 2465 g (25 centile), length of 44 cm (5 centile), and head circumference of 34.8 cm (75 90 30 31 centile).The new born hearing assessment was reported to be normal and confirmed by formal 32 33 testing at 8.5 years. Motor development was delayed with unsupported sitting at 11 months, and 34 35 independent walking at 18 months. He had macrocephaly, and brain MRI at 19 months revealed 36 37 prominent subarachnoid spaces, and hypoplastic corpus callosum and a small pituitary pars 38 39 intermedia cyst. At 3 years the SON R 2.5 7 test evidenced an IQ of 77 and a higher performance in 40 41 42 analogical reasoning. At 5 years, bilingual speech development and social skills were considered 43 44 within the normal limits. Sleeping apnoea was successfully treated by tonsillectomy, and 45 46 orchidopexy was performed at age 6 years. Truncal ataxia, which had previously been reported 47 48 when the child was 18 months, remained only minimal at the age of 6 years. At the age of 7.5 years, 49 50 his height was 132 cm (90th centile), weight was 32.3 kg (97th centile), and head circumference was 51 52 59 cm (>97th centile; +4.3 SDS) with prominent occiput. He had convergent strabismus (left eye). 53 54 55 His facial features included a narrow forehead, underdeveloped supraorbital ridges, medial flaring 56 57 and laterally sparse eyebrows, narrow palpebral fissures, malar flattening, wide and depressed nasal 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 6 of 22
Stellacci, Steindl, et al. Pag. 6 1 2 3 bridge, broad nasal tip, short and deep philtrum, thick and everted upper and lower lip vermillion, 4 5 hypotonic open mouth appearance, and overfolded helices and posteriorly angulated ears with large, 6 7 forward facing lobes. He had mild upper incisor diastema and delayed eruption of teeth. At age of 8 9 8.5 years, he attended a special education school due to reduced short term memory and short 10 11 attention span. He showed no obvious behavioural issue, and was described as very sensitive. 12 13 14 Daytime urinary continence was achieved at almost 4 years, but nighttime toilet training was still 15 16 not completed at 8.5 years. At the age of 9 years, ankle contractures were noticed. High resolution 17 18 chromosomal microarray testing using an Affymetrix Cytoscan HD array at a 20kb resolution 19 For Peer Review 20 showed normal results. 21 22 Patient 2 (P2) was a 3 year old girl with global developmental delay and macrocephaly born 23 24 to a healthy non consanguineous couple of Swiss origin (Figure 1B lower panel and Suppl. Table 25 26 27 1). Polyhydramnios and increased head circumference were noted prenatally. Delivery took place at 28 29 41 + 3/7 weeks of gestation and required vacuum extraction. Her birthweight was 3320 g (25 50th 30 31 centile), birth length 53 cm (50 75th centile) and the head circumference 37 cm (90th centile). The 32 33 newborn screening test for hearing failed. Formal testing confirmed a bilateral hypoacusis, more 34 35 pronounced on the right side, treated with hearing aids. A cranial MRI was performed at 10 months 36 37 of age showing partial agenesis of the corpus callosum. An EEG showed no abnormalities. The 38 39 patient was referred to the genetic clinic at 14 month of age for macrocephaly, developmental delay 40 41 42 and muscular hypotonia. Her anthropometric measurements were: weight 10 kg (50 75th centile), 43 44 length 79.5 cm (75 90th centile) and head circumference 50.5 cm (> 97th centile). She had a broad 45 46 face and forehead, high anterior hairline, full and curly hair, long ears with increased posterior 47 48 angulation, short palpebral fissures with deeply set eyes, convergent strabismus, underdeveloped 49 50 supraorbital ridges, medial flaring of eyebrows with lateral thinning, malar flattening, full cheeks, 51 52 prominent nasal bridge with wide nasal base, short columella, mildly thickened alae nasi, deep 53 54 55 philtrum, thin upper lip vermillion and mildly everted lower lip vermillion, slightly downturned 56 57 angles of the mouth, and a diastema of the upper central incisors. She had short hands, broadened 58 59 60 John Wiley & Sons, Inc. Page 7 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 7 1 2 th 3 thumbs, short terminal phalanges of the 5 fingers bilaterally, deep palmar creases, and bilateral 4 5 sandal gaps. She had hypertrichosis of the back and a café au lait spot on her left forearm. The girl 6 7 was followed in the neurodevelopmental clinic for her global psychomotor development delay. She 8 9 sat unsupported at 19 months and walked independently at 24 months. At 3 years and 4 months, her 10 11 speech was still confined to a few simple words, and the mother described her as stubborn and not 12 13 14 able to follow commands. Neurologic exam revealed muscular hypotonia of the extremities and the 15 16 trunk. High resolution chromosomal microarray testing using an Affymetrix Cytoscan HD array at 17 18 a 20 kb resolution showed normal results. 19 For Peer Review 20 WES was performed in both affected individuals (Supplemental Methods) obtaining an 21 22 average depth of coverage of 282x (P1) and 196x (P2), with 97.2% and 96.1% of the targeted bases 23 24 with ≥20 reads, respectively. In P1, data filtering and prioritization allowed to identify the 25 26 27 unreported heterozygous c.1024delC (NM_001164342.2) variant within exon 4 of the ZBTB20 gene 28 29 as the best disease causing candidate. The single base deletion was predicted to cause premature 30 31 translational termination (p.Gln342Serfs*42, NP_001157814.1), resulting in a protein lacking the 32 33 entire C terminal ZnF domain and having disrupted DNA binding capacity. Sanger sequencing 34 35 confirmed the variant and provided evidence for its de novo occurrence (Suppl. Fig. 1A). In P2, trio 36 37 analysis revealed 4 putative de novo variants, including an unreported missense variant in exon 5 of 38 39 ZBTB20 (c.1931C>T, p.Thr644Ile), affecting a residue highly conserved among ZBTB20 orthologs 40 41 42 and located within the third ZnF motif. The variant was predicted to be deleterious (CADD score: 43 44 29.2), and was confirmed in the patient and excluded in the parents by Sanger sequencing, 45 46 demonstrating its de novo origin (Suppl. Fig. 1B). In this subject, three additional de novo variants 47 48 were identified as de novo events. A previously unreported missense change (c.1927G>A 49 50 [NM_002047.2], p.Val643Ile [NP_002038.2]) in GARS was not considered causative for the trait 51 52 because of the relatively poor predicted impact (CADD score: 14.5) and based on the consideration 53 54 55 that mutations in this gene cause distal hereditary motor neuronopathy (MIM #600287) and 56 57 Charcot Marie Tooth disease type 2D (MIM #601472). . Similarly, the private intronic variant 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 8 of 22
Stellacci, Steindl, et al. Pag. 8 1 2 3 c.2573 5G>A in JAG1 (NM_000214.2) did not fulfill criteria for pathogenicity because in silico 4 5 predictions did not indicate a relevant impact on transcript processing. Finally, the missense change 6 7 c.1288G>A (NM_001258428.1; p.Ala454Thr, NP_001245357.1) in SLC4A9 was reported once in 8 9 the ExAC database (rs766993747) and did not have any available evidence for pathogenicity 10 11 (CADD score: 0.20) and clinical relevance, being SLC4A9 a member of the Slc4a family of Cl( 12 13 14 )/HCO3 ( ) exchangers and Na(+) HCO3 ( ) cotransporters. In both subjects, no gene with biallelic 15 16 private/rare variants with predicted functional impact was retained after filtering. DNA from saliva 17 18 was available for the two probands, and genotyping confirmed the presence of the mutations in 19 For Peer Review 20 both, providing evidence for the likely germline origin of both mutations. 21 22 We previously generated a model of the ZnF region of ZBTB20 complexed with DNA to 23 24 explore the structural and functional impact of the PS causing amino acid substitutions on DNA 25 26 27 binding properties of the domain (Cordeddu et al, 2014). By using this model, we inspected the 28 29 impact of the Thr644Ile amino acid substitution, and observed that Thr644 directly participates in 30 31 non specific interactions with DNA, forming a hydrogen bond with the phosphate group of the 32 33 DNA backbone (Fig. 1C, upper box). Its substitution by the branched, non polar isoleucine residue 34 35 removes the H bond, possibly causing also unfavorable interactions with both nearby residues and 36 37 DNA, affecting protein DNA interaction (Fig. 1C, bottom box). 38 39 To assess further the functional relevance of the novel ZBTB20 variants, we performed 40 41 42 biochemical studies in transiently transfected HEK293 cells. Western blot analysis documented that 43 44 both the Xpress tagged ZBTB20 mutants were efficiently expressed, and that they were more stable 45 46 compared to the wild type protein (Fig. 2A). This finding, which was unexpected for truncating 47 48 mutantion, is in line with the collected data for a panel of PS causing ZBTB20 mutants (Cordeddu et 49 50 al, 2014). Similarly to what was previously observed for the other ZBTB20 mutants, confocal 51 52 microscopy analysis documented the nuclear localization of the two mutants. Differently from wild 53 54 55 type ZBTB20, however, both proteins showed a non homogeneous distribution pattern (Fig. 2B 56 57 upper panels). Moreover, as observed by treatment with cytoskeleton (CSK) buffer, which allows 58 59 60 John Wiley & Sons, Inc. Page 9 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 9 1 2 3 removal of nuclear proteins weakly bound to chromatin, both mutants appeared to not stably bind to 4 5 chromatin, differently from what observed for the wild type protein (Fig. 2B lower panels). Of note, 6 7 co expression of FLAG tagged wild type ZBTB20 with each of the Xpress tagged mutants showed 8 9 co localization of wild type and mutant ZBTB20 proteins in untreated cells (Fig. 2C, upper panels) 10 11 and a significant reduction of the wild type protein after CSK treatment, indicating a dominant 12 13 14 impact of the two mutants, probably mediated by heterodimerization (Fig. 2C, lower panels). To 15 16 further confirm the impaired/defective interaction of mutants with DNA, DNA binding assays were 17 18 performed in transiently transfected HEK293 cells using biotinylated oligos encompassing the AFP 19 For Peer Review 20 promoter minimal responsive sequence (Zhang et al, 2015). A strongly reduced DNA binding of the 21 22 Thr644Ile mutant and, as expected, complete absence of binding of the p.Gln342fs*42 truncated 23 24 ZBTB20 protein were observed (Fig. 2D, lane 3 and 5 left panel). Consistent with the previously 25 26 27 collected data, cells co expressing wild type ZBTB20 and each of the two disease causing mutants 28 29 showed a less efficient binding to the AFP promoter (Fig. 2D, lane 2 and 4 left panel), providing 30 31 additional evidence for the dominant negative impact of both mutations. 32 33 PS is a rare and multisystem disorder whose prevalence is possibly underestimated. So far, a 34 35 bunch of missense heterozygous mutations affecting the first two ZnF motifs of the protein have 36 37 been described. Here, we report on two novel germline mutations in young patients resembling PS. 38 39 While both mutations affected the functional domain of the repressor mediating DNA binding, one 40 41 42 of the two variants, c.1024delC, substantially differed from the previously reported disease causing 43 44 ZBTB20 mutations (Cordeddu et al, 2014) since it is truncating and is predicted to result in a protein 45 46 lacking the entire region mediating binding to DNA. Similarly, the second pathogenic variant, 47 48 c.1931C>T, affects a residue located within the third ZnF motif of the protein, a portion of the 49 50 DNA binding domain that was not previously reported to be affected. Functional data underlined 51 52 that both mutations perturb ZBTB20’s function by impairing proper binding of the repressor to 53 54 55 DNA, with a dominant negative effect. This report also offers new information on the clinical 56 57 characterization and natural history of PS, providing detailed data on this disorder during childhood. 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 10 of 22
Stellacci, Steindl, et al. Pag. 10 1 2 3 Both affected individuals exhibited postnatal growth in the upper range, macrocephaly, hypoplasia 4 5 of the corpus callosum, hypotonia, variable intellectual disability and distinctive facial features. 6 7 They did not present disturbed glucose metabolism, cataracts and ectopic calcification of the ears 8 9 and brain, which probably occur in PS later during puberty or early adulthood. Distal muscle 10 11 wasting leading to progressive contractures was not yet evident in the young P2, but in P1 ankle 12 13 14 contractures were noticed at age 9 years. Notably, these data suggest that both the dominant 15 16 negative acting mutations underlying PS and haploinsufficiency of ZBTB20 associated with the 17 18 3q13.31 microdeletion result in a similar clinical phenotype during childhood despite the apparent 19 For Peer Review 20 difference in pathomechanism. It should be noted that currently available description of the clinical 21 22 phenotype associated with the 3q13.31 microdeletion and PS do not allow to assess accurately 23 24 possible genotype phenotype associations as well as to compare the natural history of the two 25 26 27 disorders. Of note, muscle wasting, joint contractures and disturbed glucose metabolism were never 28 29 reported in patients with the microdeletion syndrome and therefore we might expect a differential 30 31 perturbing effect of the two classes of defects later during adulthood, even though a more detailed 32 33 and systematic analysis of the clinical features characterizing the two disorders should be performed 34 35 to verify this hypothesis. 36 37 In conclusion, our findings further strengthen the genetic link between PS and the 3q13.31 38 39 microdeletion syndrome, widen the molecular spectrum of ZBTB20 mutations and confirm the 40 41 42 dominant negative impact of PS causing mutations on ZBTB20 function. 43 44 45 46 SUPPORTING INFORMATION 47 48 Additional supporting information may be found in the online version of this article at the 49 50 publisher’s web site. 51 52
53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 11 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 11 1 2 3 REFERENCES 4 5 Battisti C, Dotti MT, Cerase A, Rufa A, Sicurelli F, Scarpini C, Federico A. 2002. The Primrose 6 7 syndrome with progressive neurological involvement and cerebral calcification. J Neurol 8 9 249:1466 1468. 10 11 Carvalho, D. R., Speck Martins, C. E. 2011. Additional features of unique Primrose syndrome 12 13 14 phenotype. Am J Med Genet 155A:1379 1383. 15 16 Collacott RA, O'Malley BP, Young ID. 1986. The syndrome of mental handicap, cataracts, muscle 17 18 wasting and skeletal abnormalities: report of a second case. J Ment Defic Res 30:301 308. 19 For Peer Review 20 Cordeddu V, Redeker B, Stellacci E, Jongejan A, Fragale A, Bradley TE, Anselmi M, Ciolfi A, 21 22 Cecchetti S, Muto V, Bernardini L, Azage M, et al. 2014. Mutations in ZBTB20 cause 23 24 Primrose syndrome. Nat Genet 46(8):815–817. 25 26 27 Dalal P, Leslie ND, Lindor NM, Gilbert DL, Espay AJ. 2010. Motor tics, stereotypies, and self 28 29 flagellation in primrose syndrome. Neurology 75(3):284–286. 30 31 Hervé B, Fauvert D, Dard R, Roume J, Cognard S, Goidin D, Lozach F, Molina Gomes D, Vialard 32 33 F. 2016. The emerging microduplication 3q13.31: Expanding the genotype phenotype 34 35 correlations of the reciprocal microdeletion 3q13.31 syndrome. Eur J Med Genet 59(9):463 36 37 469. 38 39 Lindor NM, Hoffman, AD, Primrose DA. 1996. A neuropsychiatric disorder associated with dense 40 41 42 calcification of the external ears and distal muscle wasting: 'Primrose syndrome'. Clin 43 44 Dysmorph 5:27 34. 45 46 Mattioli F, Piton, A, Gerard B, Superti Furga A, Mandel JL, Unger S. 2016. Novel de novo 47 48 mutations in ZBTB20 in Primrose syndrome with congenital hypothyroidism. Am J Med Genet 49 50 170A:1626 1629. 51 52 Mitchelmore C, Kjaerulff KM, Pedersen HC, Nielsen JV, Rasmussen TE, Fisker MF, Finsen B, 53 54 55 Pedersen KM, Jensen NA. 2002. Characterization of two novel nuclear BTB/POZ domain zinc 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 12 of 22
Stellacci, Steindl, et al. Pag. 12 1 2 3 finger isoforms. Association with differentiation of hippocampal neurons, cerebellar granule 4 5 cells, and macroglia. J Biol Chem 277(9):7598–7609. 6 7 Nielsen JV, Nielsen FH, Ismail R, Noraberg J, Jensen NA. 2007. Hippocampus like 8 9 corticoneurogenesis induced by two isoforms of the BTB zinc finger gene Zbtb20 in mice. 10 11 Development 134:1133 1140. 12 13 14 Posmyk R, Lesniewicz R, Chorązy M, Wołczynski S. 2011. New case of Primrose syndrome with 15 16 mild intellectual disability. Am J Med Genet Part A 155A:2838–2840. 17 18 Primrose DA. 1982. A slowly progressive degenerative condition characterized by mental 19 For Peer Review 20 deficiency, wasting of limb musculature and bone abnormalities, including ossification of the 21 22 pinnae. J Ment Defic Res 26:101–106. 23 24 Sutherland AP, Zhang H, , Michaud M, Xie Z, Patti ME, Grusby MJ, Zhang WJ. 2009. Zinc finger 25 26 27 protein Zbtb20 is essential for postnatal survival and glucose homeostasis. Mol. Cell Biol 28 29 29(10):2804 2815. 30 31 Zhang W, Mi J, Li N, Sui L, Wan T, Zhang J, Chen T, Cao X. 2001. Identification and 32 33 characterization of DPZF, a novel human BTB/POZ zinc finger protein sharing homology to 34 35 BCL6. Biochem Biophys Res Commun 282(4):1067–1073. 36 37 Zhang Y, Xie Z, Zhou L, Li L, Zhang H, Zhou G, Ma X, Herrera PL, Liu Z, Grusby MJ, Zhang WJ. 38 39 2012. The zinc finger protein ZBTB20 regulates transcription of fructose 1,6 bisphosphatase 1 40 41 42 and β cell function in mice. Gastroenterology 142:1571–80. 43 44 Zhang H, Cao D, Zhou L, Zhang Y, Guo X, Li H, Chen Y, Spear BT, Wu JW, Xie Z, Zhang WJ. 45 46 2015. ZBTB20 is a sequence specific transcriptional repressor of alphafetoprotein gene. Sci 47 48 Rep 5, 11979; doi:10.1038/srep11979. 49 50 51 52
53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 13 of 22 Human Mutation
Stellacci, Steindl, et al. Pag. 13 1 2 3 FIGURE TITLES AND LEGENDS 4 5 6 7 Figure 1. Location of ZBTB20 mutations causing Primrose syndrome, facial features of the 8 9 two affected individuals, and homology model of the ZBTB20-DNA complex. A) ZBTB20 10 11 domain structure (BTB domain, red box; ZnFs, green boxes) and location of residues affected by 12 13 the present (red) and previously reported (blue [Cordeddu et al. 2014] and green [Mattioli et al, 14 15 2016]) mutations. B) Facial features of P1 at the age of 5 years and 3 months (upper panel) and 7 16 17 years and 5 months (medium panel), and those of P2 at the age of 3 years and 4 months (lower 18 19 For Peer Review 20 panel). C) Homology model of the DNA bound ZBTB20 region encompassing the ZnF motifs 1 to 21 22 4 (brown ribbon, with residues affected by previously reported mutations colored in blue or green, 23 24 as in panel A). DNA backbone (gold ribbon), bases (sticks) and phosphates (dotted spheres) are also 25 26 shown. Thr644 (reported in sticks representation) forms a hydrogen bond (shown as a green dashed 27 28 line) with a phosphate group (sticks) of the DNA backbone (upper box), which is lost with 29 30 substitution to Ile (lower box). 31 32 33 34 35 Figure 2. Impact of the two identified disease-causing mutations on ZBTB20 function. A) 36 37 Levels of X press tagged wild type and mutant ZBTB20 proteins. Fifty micrograms of whole cell 38 39 extract where analyzed by western blot using an anti Xpress antibody. Images are representative of 40 41 three experiments performed. B) Subcellular localization of ZBTB20 proteins. ZBTB20 mutants 42 43 display nuclear localization but appear not stably bound to chromatin. Confocal microscopy 44 45 46 analysis was performed in cells expressing wild type ZBTB20 or the two disease causing mutants 47 48 (green), without or with treatment with CSK buffer prior fixation. Nuclei are DAPI stained (blue). 49 50 Bars correspond to µm indicated in the figure. C) ZBTB20 proteins co localization. X press tagged 51 52 ZBTB20 mutants co localized with FLAG tagged wild type ZBTB20. A substantial reduction of 53 54 ZBTB20 localizing into nuclei after CSK treatment is observed. Only 20 25% of cells maintains a 55 56 57 nuclear double staining. Confocal microscopy analysis was performed in cells expressing wild type 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 14 of 22
Stellacci, Steindl, et al. Pag. 14 1 2 3 ZBTB20 (green) and the two disease causing mutants (red), without or with treatment with CSK 4 5 buffer prior fixation. Nuclei are DAPI stained (blue). Bars correspond to 10 µm. D) DNA binding 6 7 assay performed on lysates from cells transfected with ZBTB20 constructs as indicated using 8 9 biotinylated oligos covering the minimal responsive sequence of the AFP promoter. Reduced DNA 10 11 12 binding is observed in extracts from cells overexpressing each of the two ZBTB20 mutants, and is 13 14 also documented in extracts from cells co expressing each mutant with the wild type protein (left). 15 16 Western blots of a representative experiment of three performed are shown. 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Page 15 of 22 Human Mutation
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Figure 1. Location of ZBTB20 mutations causing Primrose syndrome, facial features of the two affected 34 individuals, and homology model of the ZBTB20-DNA complex.
35 150x120mm (300 x 300 DPI) 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 16 of 22
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 Figure 2. Impact of the two identified disease-causing mutations on ZBTB20 function. 31 32 180x128mm (300 x 300 DPI) 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc.
+ 3/6 3/6 0/4 0/4 4/7 4/7 0/4 NA NA NA NA NA NA NA 4/10 4/10 1/12 1/12 3/12 9/10 11/12 6M/6F 6M/6F >P50 8/11 >P50 syndrome syndrome 3q13.31 del del 3q13.31
3/4 3/4 0/8 0/8 7/8 7/8 5/7 5/7 8/8 8/8 4/8 6/8 7/8 4/8 4/8 NA NA NA NA NA 4M/4F 4M/4F 5+/3+++ >P50 8/8 >P50 >P90 6/8 6/8 >P90 3/9 >P90 Primrose Primrose syndrome syndrome 25.4 (mean) (mean) 25.4 (mean) 9.2
mutations. mutations.
) )
th th )
th
75 - th th
ew simple words simple ew
ZBTB20
f 90 ------++ ++ P2 P2 3.4 3.4 NA NA ; ; +3.5SD +++ 41 3/7 3/7 41 th 50-75 75 bilateral Thr644Ile Thr644Ile 24 months months 24 generalized 37 cm (90 cm 37 from GW 30 GW from >97 53 cm (50 cm 53 3.3 kg (25-50 3.3 kg + (partial agenesis) agenesis) (partial + peech limited to limited peech s
Human Mutation John Wiley & Sons, Inc.
) ) ) th th Clinical features patients features with of Clinical
th th term memory term
ild ------+ + + + + + - + M F 77 P1 P1 8.5 8.5 NA 97 90 ; ; +4.3SD m trunk 35 3/7 35 3/7 th 11 months months 11 months 18 months 19 44 cm (5 cm 44 + (left eye) (left eye) + convergent 2.4 kg (25 2.4 kg + (treated 6y) 6y) + (treated >97 Gln342Serfs*42 Gln342Serfs*42 34.8 cm (P75-90) (P75-90) cm 34.8 educed short educed For Peer Reviewr Supplemental Table 1. Supplemental
cyst
Individuals Individuals
pituitary pars intermedia pars pituitary at last evaluation last at
small small
prominent subarachnoid spaces spaces subarachnoid prominent callosum corpus hypoplastic Polyhydramnios birth at Length Stature last evaluation at circumference Head delay Developmental impairment Cognitive Autism imaging: brain Abnormal hypotonia Muscular loss Hearing ZBTB20 amioacid change change amioacid ZBTB20 (years) last investigation at Age Gender of gestation Week birth at Weight circumference Head evaluation last at Weight Macrocephaly age Sitting age Walking IQ movements hand Repetitive anomalies Seizures/EEG wasting muscle Distal contractures Joint dysplasia Hip Cryptorchidism Strabismus Page 17 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 18 of 22
NA NA 6/12 6/12 0/10 0/10
7/7 7/7 7/8 7/8 1/8 1/8 8/8 large large 8/8 large 4/12
, deep palmar palmar , deep
th
- - - + + + NA deep deep Mild Mild broad broad creases angulation angulation underdeveloped short with deep-set eyes eyes deep-set short with eyes 7/8 deep-set eyes 4/9 deep-set thin upper lip vermilion, vermilion, lip upper thin exaggerated cupid’s bow, bow, cupid’s exaggerated slightly downturned angles angles downturned slightly everted lower lip vermilion lower everted phalanx of the 5 of the phalanx hairline, hypertrichosis of the back back of the hypertrichosis hairline, short columella, thickened alae nasi alae thickened short columella, Human Mutation John Wiley & Sons, Inc.
- - - - - short thumbs, short broadened anterior high curly, full and initially gaps sandal bilateral + + + + + + + + + NA NA mild mild narrow narrow narrow narrow short and deep deep short and forward facing facing forward - underdeveloped delayed eruption delayed For Peer everted thick and Review Increased posterior angulation posteriorangulation Increased posterior increased with long medial flaring and lateral thinning thinning lateral and flaring medial thinning lateral with flaring medial
supraorbital ridges supraorbital teeth helices overfolded face and forehead forehead and face eyebrows fissures palpebral downslanted flattening malar bridge nasal wide bridge nasal depressed vermilion lip lower and upper mouth hypotonic diastema incisor Ears lobes broad nasal tip nasal broad prominent occiput occiput prominent fissures palpebral philtrum Disturbed glucose metabolism metabolism glucose Disturbed Tumors anomalies: Minor Hand Feet Hair NA, not assessed NA, 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 19 of 22 Human Mutation
1 2 3 Stellacci, Steindl et al., Clinical and functional characterization of two novel ZBTB20 mutations 4 causing Primrose syndrome. 5 6 7 8 9 SUPPORTING INFORMATION 10 11 12 13 14 SUPPLEMENTAL METHODS 15
16 17 18 Whole Exome Sequencing. Genomic DNA was extracted from leukocytes. Whole exome 19 sequencing (WES) of patientsFor and theirPeer parents was Review performed using the Agilent SureSelectXT 20 21 Clinical Research Exome Kit (V5) with paired end sequencing (HiSeq SBS Kit v4) on a HiSeq 22 2500 System (Illumina). Raw fastQ files were aligned to the hg19 reference genome using 23 24 NextGene (Softgenetics). Variants observed in at least 16% of reads with sufficient quality level 25 26 and minor allele frequency ≤ 2% were investigated in silico for deleterious effects using CADD. 27 Potentially deleterious variants in genes functionally linked to developmental processes implicated 28 29 in the patients’ phenotype were further evaluated for compatibility with the expected mode of 30 31 inheritance and for functionally annotated. Variant validation and segregation analyses were 32 performed by Sanger sequencing using an ABI Genetic Analyzer 3730 (Applied Biosystems, USA). 33 34 35 Structural analysis. Structural analysis of the possible effects of the Thr644Ile substitution was 36 37 performed using the VMD software (Humphrey et al, 1996), based on the homology model reported 38 39 in Cordeddu et al. (2014). 40 41 42 Plasmid construction 43 44 The entire coding sequence of human wild type ZBTB20 was cloned in the pcDNA6/HisC and 45 pFLAG CMV vectors (KpnI/XbaI sites) to generate an Xpress tagged and a FLAG tagged protein 46 47 (tags at the N terminus in both cases), respectively. The disease causing c.1024delC 48 (p.Gln342Serfs*42) and c.1931C>T (p.Thr644Ile) changes were introduced by using the 49 50 QuikChange Site Directed Mutagenesis Kit (Agilent Technologies, CA, USA). 51 52 53 Cell culture and DNA transfections. Human HEK293T kidney cells (from ATCC) were grown in 54 55 Dulbecco Modified Eagle’s Medium High Glucose (DMEM) containing 10% fetal bovine serum 56 57 (FBS), supplemented with Penicillin, Streptomycin and L Glutamine (all from Euroclone, Milan, 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 20 of 22
1 2 3 Italy). For transfection, polyethylenimine (PEI) reagent was obtained from Neo Transduction 4 Laboratories (Lexington, KY, USA). 5 6 7 8 DNA affinity binding assays. For cell based assays, HEK293T cells were transiently transfected 9 with PEI, following the manufacturer’s instructions. ZBTB20 expression data were obtained by 10 11 western blot analysis from at least three independent experiments. 12 For DNA affinity binding assays, a biotinylated oligonucleotide corresponding to the AFP sequence 13 14 containing the ZBTB20 specific DNA binding site was synthesized 15 16 (TTCAACCTAAGGAAATACCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTT, 17 forward strand). Processing of protein extracts from transfected cells and DNA affinity binding 18 19 assays were performed asFor previously Peer described (Fragale Review et al, 2011). Eluted material was separated 20 21 onto 7.5% SDS PAGE followed by immunoblotting with anti Xpress monoclonal antibody 22 (Invitrogen, Thermo Scientific, USA). Data were obtained from three independent experiments. 23 24 25 Confocal laser scanning microscopy. HEK293T cells were seeded on glass coverslips, maintained 26 27 in culture in complete medium (24 h), and transiently transfected with Xpress tagged ZBTB20 28 29 mutant cDNAs and/or wild type FLAG tagged ZBTB20. Forty eight hours post transfection, cells 30 were treated with CSK buffer, fixed with 3% paraformaldehyde (30 min, 4 °C) and permeabilized 31 32 with 0.5% Triton X 100 (10 min, room temperature). Cells were stained with anti Xpress mouse 33 34 monoclonal (1:100 dilution) and anti FLAG rabbit monoclonal (1:100 dilution, SIGMA) antibodies, 35 and Alexa Fluor 488 goat anti mouse secondary antibody and Alexa Fluor 594 goat anti rabbit 36 37 (1:100 dilution, Molecular Probes, Thermo Scientific). After staining, coverslips were extensively 38 rinsed and then mounted on the microscope slide by using Vectashield with DAPI mounting 39 40 medium (Vector Laboratories). Observations were performed twice (>300 cells observed in each 41 42 experiment) on a TCS SP2 AOBS apparatus (Leica Microsystems, Wetzlar, Germany), using 43 63X/1.4 NA oil objective and excitation spectral laser lines at 405 and 488 nm. Image acquisition 44 45 and processing were performed by using the Leica Confocal Software (Leica Lasertechnik GmbH). 46 47 Signals from different fluorescent probes were taken in sequential scanning mode. 48 49 50 REFERENCES 51 52 Schwede T, Kopp J, Guex N, Peitsch MC. SWISS MODEL: An automated protein homology 53 54 modeling server. Nucleic Acids Res. 2003: 31:3381 3385. 55 Cordeddu V, Redeker B, Stellacci E, et al. 2014. Mutations in ZBTB20 cause Primrose syndrome. 56 Nat Genet 46:815–817. 57 58 59 60 John Wiley & Sons, Inc. Page 21 of 22 Human Mutation
1 2 3 Humphrey W, Dalke A and Schulten K. VMD Visual Molecular Dynamics. 1996. J. Molec. 4 Graphics. Vol. 14, pp. 33 38. 5 Fragale A, Stellacci E, Ilari R, et al. Critical role of IRF 8 in negative regulation of TLR3 6 expression by Src homology 2 domain containing protein tyrosine phosphatase 2 activity in 7 human myeloid dendritic cells. 2011. J Immunol.186:1951 1962. 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc. Human Mutation Page 22 of 22
1 2 3 4 5
6 c.1024del p.Gln342Serfs*42 c.1931C>T p.Thr644Ile 7 8 C T T T G C T S C C S K W R K C G C T T C A Y C C A G A A G 9 10 11 12 Patient Patient 13
14 C T T T G C T G C C C G T A G C G C T T C A C C C A G A A G 15 16 17 18 19 Mother For Peer ReviewMother 20 21 C T T T G C T G C C C G T A G C G C T T C A C C C A G A A G 22 23 24 25 Father Father 26 27 28 29 30 31 32 Supplementary Figure 1. Germline ZBTB20 mutations causing Primrose syndrome. Sequence 33 chromatograms showing the de novo origin of the identified ZBTB20 missense changes in the two 34 sporadic affected subjects, P1 (A) and P2 (B), included in the study. 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons, Inc.