sign in sign up
<<
Home , Brachyury

2613 Author Correction

The T-box Brachyury mediates cartilage development in mesenchymal stem cell line C3H10T1/2 Hoffmann, A., Czichos, S., Kaps, C., Bachner, D., Mayer, H., Zilberman, Y., Turgeman, G., Pelled, G., Gross, G. and Gazit, D. J. Cell Sci. 115, 769-781.

In the printed version of this article, an author was missing from the title page. The correct list of authors is shown below. Andrea Hoffmann1,*, Stefan Czichos1,2,*, Christian Kaps1, Dietmar Bächner2, Hubert Mayer1, Basan Gowda Kurkalli3, Yoram Zilberman3, Gadi Turgeman3, Gadi Pelled3, Gerhard Gross1,‡ and Dan Gazit3 1Osteo-Angiogenesis Group, Gesellschaft für Biotechnologische Forschung (GBF), Mascheroder Weg 1, 38124 Braunschweig, Germany 2Institute of Cellbiochemistry and Clinical Neurobiology, University Hospital Eppendorf, 22529 Hamburg, Germany 3Skeletal Biotech. Laboratory, Hebrew University, Jerusalem, Israel *These authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Research Article 769 The T-box transcription factor Brachyury mediates cartilage development in mesenchymal stem cell line C3H10T1/2

Andrea Hoffmann1,*, Stefan Czichos1,2,*, Christian Kaps1, Dietmar Bächner2, Hubert Mayer1, Yoram Zilberman3, Gadi Turgeman3, Gadi Pelled3, Gerhard Gross1,† and Dan Gazit3 1Osteo-Angiogenesis Group, Gesellschaft für Biotechnologische Forschung (GBF), Mascheroder Weg 1, 38124 Braunschweig, Germany 2Institute of Cellbiochemistry and Clinical Neurobiology, University Hospital Eppendorf, 22529 Hamburg, Germany 3Skeletal Biotech. Laboratory, Hebrew University, Jerusalem, Israel *These authors contributed equally to this work †Author for correspondence (e-mail: [email protected])

Accepted 12 November 2001 Journal of Cell Science 115, 769-781 (2002) © The Company of Biologists Ltd

Summary The BMP2-dependent onset of osteo/chondrogenic chondrogenic lineage in vitro and in vivo after differentiation in the acknowledged pluripotent murine transplantation into muscle. A dominant-negative variant mesenchymal stem cell line (C3H10T1/2) is accompanied of Brachyury, consisting of its DNA-binding domain (T- by the immediate upregulation of Fibroblast Growth box), interferes with BMP2-mediated cartilage formation. Factor 3 (FGFR3) and a delayed response by These studies indicate that BMP-initiated FGF-signaling FGFR2. Forced expression of FGFR3 in C3H10T1/2 is induces a novel type of transcription factor for the onset of sufficient for chondrogenic differentiation, indicating an chondrogenesis in a mesenchymal stem cell line. A potential important role for FGF-signaling during the manifestation role for this T-box factor in skeletogenesis is further of the chondrogenic lineage in this cell line. Screening for delineated from its expression profile in various skeletal transcription factors exhibiting a chondrogenic capacity elements such as intervertebral disks and the limb bud at in C3H10T1/2 indentified that the T-box containing late stages (18.5 d.p.c.) of murine embryonic development. transcription factor Brachyury is upregulated by FGFR3- mediated signaling. Forced expression of Brachyury in Key words: Brachyury, BMP, Cartilage, Chondrocyte, FGFR, Signal C3H10T1/2 was sufficient for differentiation into the transduction

Introduction documented that SOX9, a member of the high-mobility-group The murine mesenchymal stem cell line C3H10T1/2 line (HMG) box superfamily, is required (Lefebvre and De presents many features of mesenchymal stem cells (MSCs). It Crombrugghe, 1998). Mutations in Sox9 cause abnormalities can differentiate into mesenchymal lineages such as muscle- (Campomelic Dysplasia) in cartilage-derived skeletal forming myoblasts, fat-storing adipocytes, cartilage-forming structures (Wagner et al., 1994; Foster et al., 1994). Several chondrocytes and bone-forming osteoblasts. Different BMP investigations, also involving chimeric mice, demonstrate that (Bone Morphogenetic Protein) family members are able SOX9 is a major regulator of cartilage-specific (collagen to mediate induction of the osteogenic, chondrogenic or II, XI) (Bridgewater et al., 1998; Lefebvre et al., 1998) and is adipogenic lineages, but obviously not the myogenic pathway crucially involved in chondrocyte formation (Bi et al., 1999). (Reznikoff et al., 1973; Taylor and Jones, 1979; Wang et al., Similarly, it could be also demonstrated that HLH-transcription 1993; Ahrens et al., 1993). factor –/– cells in chimeric mice are excluded from Different complex transcriptional control mechanisms regions of the embryo that are involved in the formation of regulate the initial commitment stage of mesenchymal stem skeletal structures (Brown et al., 1999). cell formation through to the final manifestation of the Recently, we and others found that in MSCs, BMP-signaling mesenchymal tissue type. It has been demonstrated that regulates differentiation to the osteogenic and the varying types of transcription factors govern such mechanisms. chondrogenic lineages in quite different ways. BMP-mediated For example basic helix-loop-helix factors (bHLH) (Myo-D, SMAD-signaling seems to be necessary during the entire Myf-5, MRF4 and ) regulate the differentiation of osteoblast-developmental sequence. In the case of skeletal muscle cells (Arnold and Winter, 1998). A member of chondrogenesis, BMPs are necessary for induction; however, the nuclear family (PPARγ2) determines the BMP-mediated SMAD signaling is not sufficient to adipocyte differentiation (Tontonoz et al., 1994), and the runt- significantly induce or promote chondrogenic differentiation in family member CBFA1 is required for osteoblast determination either the mesenchymal stem cell line C3H10T1/2 or in the and differentiation (Komori and Kishimoto, 1998). The exact prechondrogenic cell line ATDC5 (Fujii et al., 1999; Ju et al., transcriptional mechanisms that determine development into 2000). We now show that BMP2-mediated upregulation of the chondrogenic lineage are unknown, although it has been Fibroblast Growth Factor (FGF) receptor 3 (FGFR3) seems to 770 Journal of Cell Science 115 (4) be involved in the induction of chondrogenic differentiation of obtained by cotransfection with pSV2pac followed by selection with MSCs. This finding is with agreement with evidence that FGF- puromycin (2.5 µg/ml). FGFR3, Brachyury and the T-box domain signaling is intimately involved in skeletal development were polymerase chain reaction (PCR)-amplified and cloned into (Wilkie et al., 1995; Colvin et al., 1996; Deng et al., 1996). It expression vectors pMT7T3 and pMT7T3-pgk, which are under the is shown here that forced expression of FGFR3 in MSCs control of the LTR of the myeloproliferative virus or of the murine (C3H10T1/2) leads to the onset of the chondrogenic lineage. phosphoglycerate kinase promoter-1, respectively (Ahrens et al., 1993). The integrity of the constructs was confirmed by sequencing. We have also found the T-box containing transcription factor HA-tags were added to the carboxy terminus of full-length Brachyury Brachyury, which is capable of mediating the FGFR3- and its T-box domain by PCR with primers encoding the respective dependent onset of chondrogenesis in these MSCs, following peptide sequence. Stable expression of the DNA binding T-box screening for transcription factors exhibiting a chondrogenic domain (amino acids (aa) 1-229) and of the dominant-negative human capacity in C3H10T1/2. FGFR3 without the cytoplasmatic tyrosine kinase domains (aa 1-414) Brachyury, or T, is the founder member of a family of in the C3H10T1/2-BMP2 background was done by cotransfection transcription factors that share the T-box, a 200-amino-acid with pAG60, conferring resistance to G418 (750 µg/ml). Individual DNA-binding domain (reviewed in Smith, 1997; clones were picked, propagated and tested for recombinant FGFR3, Papaioannou, 1997). The mouse Brachyury is expressed dnFGFR3, Brachyury or T-box domain (dnBrachyury) expression by at high rates during and is required for reverse-transcription-coupled PCR (RT-PCR) (see below). Selected cell clones were subcultivated in the presence of puromycin or differentiation of the and the formation of puromycin/G418 and the selective pressure was maintained during during posterior development (Kispert et al., 1995). subsequent manipulations. C3H10T1/2 cells were cultured in DMEM Then Brachyury expression is downregulated at mid to late containing 10% FCS. The features of C3H10T1/2-BMP2 cells have gestation periods. Here we show that FGFR3-mediated been described (Ahrens et al., 1993; Hollnagel et al., 1997; Bächner signaling induces expression of Brachyury in mesenchymal et al., 1998). For assessment of in vitro osteo/chondrogenic stem cell line C3H10T1/2. Forced expression of Brachyury in development, cells were plated at a density of 5-7.5×103 cells/cm2 and MSCs in vitro and ectopically, in vivo, is sufficient to initiate after reaching confluence (arbitrarily termed day 0), ascorbic acid (50 chondrogenic development in these MSCs. Therefore, T-box µg/ml) and 10 mM β-glycerophosphate were added as specified by family members such as Brachyury may be factor(s) required Owen et al. (Owen et al., 1990). not only for patterning but also contributing to the determination of the chondrogenic lineage. BMP2 inductions For BMP2-stimulation studies, C3H10T1/2 cells were plated at a density of 1×104/cm2 in a 9-cm culture dish. After 48 hours cells were Materials and Methods washed 3× with phosphate-buffered saline (PBS) and then cells were DNA constructs and transient transfections starved for 24 hours in DMEM without serum. Before induction the For assessment of transcriptional activity a dimer of the double- medium was replaced with fresh DMEM without serum. Cells were stranded oligonucleotide of the Brachyury binding element (BBE) then treated for the indicated times using recombinant BMP2 from E. AATTTCACACCTAGGTGTGAAATT (Kispert et al., 1995) was coli (50 ng/ml). Cycloheximide (50 µg/ml) treatment started 30 incorporated in the BamHI site before the HSV thymidine kinase minutes prior to the addition of BMP2. minimal promoter fused to the cloramphenicol acetyltransferase (CAT)-reporter of pBLCAT5 (Boshart et al., 1992) to give reporter plasmid pBBE-CAT5. 20 hours before transfection, human embryonic RNA preparation and RT-PCR kidney HEK293T cells were plated at a density of 1×104/cm2 in 6- Total cellular RNAs were prepared by TriReagentLS according to the well plates and allowed to grow under normal culture conditions. For manufacturer’s protocol (Molecular Research Center Inc.). 5 µg of cotransfection experiments, we used (per well) 250 ng of Brachyury total RNA was reverse-transcribed and cDNA samples were subjected expression vector and 250, 500 or 750 ng of the expression vector to PCR. RT-PCR was normalized by the transcriptional levels of encoding dnBrachyury. Empty vector was added to adjust the amount hypoxanthine guanine phosphoribosyl transferase (HPRT). The of expression plasmids to 1 µg/ml. 260 ng of BBE-CAT reporter HPRT-specific 5′ and 3′ primers were GCTGGTGAAAAGGA- (pBBE-CAT5) were added in the presence of 140 ng of RSV-lacZ CCTCT and AAGTAGATGGCCACAGGACT, respectively. The vector using the DOSPER procedure (see below). Cells were allowed following 5′ and 3′ primers were used to evaluate osteo/chondrogenic to incubate for 48 hours. Then, cells were collected and β- differentiation: collagen 1a1: GCCCTGCCTGCTTCGTG, galactosidase assays performed using the chemiluminescent β-gal CGTAAGTTGGAATGGTTTTT; collagen 2a1: CCTGTCTGCTT- reporter gene assay (Roche Diagnostics, Mannheim, Germany) and CTTGTAAAAC, AGCATCTGTAGGGGTCTTCT; osteocalcin: CAT-assays using the CAT ELISA kit (Roche Diagnostics, GCAGACCTAGCAGACACCAT, GAGCTGCTGTGACATCCAT- Mannheim, Germany). β-gal assay results were used to normalize the AC; PTH/PTHrP-receptor: GTTGCCATCATATACTGTTTCTGC, CAT assay results for transfection efficiency. All DNA transfection GGCTTCTTGGTCCATCTGTCC; FGFR3: CCTGCGCAGTCC- experiments were repeated at least three times in triplicate. CCCAAAGAAG; CTGCAGGCATCAAAGGAGTAGT; FGFR2: TTGGAGGATGGGCCGGTGTGGTG, GCGCTTCATCTGCCTG- GTCTTG. The primer pairs for Brachyury and Sox9 have been Cell culture and stable transfections described (Johansson and Wiles, 1995; Zehentner et al., 1999), Human embryonic kidney cells HEK293T and murine C3H10T1/2 respectively. Vector-borne transcripts for Brachyury were evaluated progenitor cells were routinely cultured in tissue culture flasks in with nested primer sets using either vector-specific 5′- or 3′-primers: Dulbecco’s modified Eagle’s medium supplemented with 10% heat- TTAGTCTTTTTGTCTTTTATTTCA; GATCGAAGCTCAATTAAC- inactivated fetal calf serum (FCS), 0.2 mM L-glutamine and CCTCAC. antibiotics (50 i.u./ml penicillin, 50 mg/ml streptomycin). Cells were transfected using DOSPER according to the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany). C3H10T1/2 cells that Western blotting recombinantly express BMP2 (C3H10T1/2-BMP2) cells were Recombinant cells from Petri dishes (13.6 cm diameter) were Brachyury mediates cartilage development 771

Fig. 1. FGFR3 mediates chondrocytic differentiation in mesenchymal stem cell line C3H10T1/2. (A) RT-PCR analyses of BMP2-dependent expression of FGF- and PTH/PTHrP-receptors in mesenchymal stem cell line C3H10T1/2 incubated for various times in the presence or absence of recombinantly expressed BMP2. (B) Cycloheximide pretreatment of C3H10T1/2 cells does not prevent BMP-induction of the FGFR3 gene. Cells were mock-treated (Control) or treated with BMP2 (50 ng/ml) for various times. Preincubation with cycloheximide (CHX) was for 30 minutes (50 µg/ml). RT- PCR analyses of FGFR3 mRNA levels were as described in Materials and Methods. (C) Western immunoblotting for the detection of BMP2- dependent FGFR3 and FGFR2 expression in cellular extracts of C3H10T1/2 lines. Immunoblotting was performed with polyclonal antibodies SC-123 (FGFR3; Santa Cruz, left) and SC-122 (FGFR2; Santa Cruz, right). (D) (Left) Western immunoblotting to document the forced expression of FGFR3 in mesenchymal progenitors C3H10T1/2. (Right) The recombinant expression of FGFR3 in C3H10T1/2 leads to enhanced levels of activated MAP-kinases pERK-1 and pERK-2 during cultivation (New England Biolabs MAPK Detection Kit 9100). Cell lysates were prepared (at confluence/0) and 4 days post-confluence. (E) The forced expression of FGFR3 in parental C3H10T1/2 cells is sufficient for the induction of the chondrogenic lineage. (Bottom) RT-PCR analyses of expression levels of chondrogenic and ostesteogenic markers were performed as described in Materials and Methods. Collagen 1a1 and osteocalcin are markers predominantly for osteogenic and collagen 2a1 for chondrogenic differentiation, respectively. The PTH/PTHrP-receptor is a marker for early osteogenic and late chondrogenic development. HPRT was used to standardize PCR conditions. (Top) Osteoblast-like cells stably expressing BMP2 or FGFR3 were identified by alkaline phosphatase staining (6 days post-confluence). (Middle) Chondrocyte-like cells secreting proteoglycans were histologically stained with Alcian Blue (12 days post-confluence). Cellular confluence has been arbitrarily termed day 0. harvested at different time points before (day B2), at (day 0) and after Histological methods and verification of cellular phenotypes (days 2, 4, 7) confluence. Lysis was in RIPA buffer (1% (v/v) Nonidet Osteoblasts exhibit stellate morphology and display high levels of P-40, 0.1% SDS (w/v), 0.5% sodium deoxycholate in PBS, alkaline phosphatase, which was visualized by cellular staining with containing 100 µg/ml phenyl methyl sulfonyl fluoride (PMSF), 2 Sigma Fast BCIP/NBT (Sigma, St Louis, MO, USA). Proteoglycan- µg/ml aprotinin and 1 mM Na3VO4). Lysates were centrifuged (30 secreting chondrocytes were identified by staining with Alcian minutes, 10,000 g, 4°C) and the supernatants were stored at –70°C Blue at pH 2.5 and staining with Safranin O (Sigma, St. Louis, until analysis. Protein concentration of the lysates was determined MO, USA). For collagen-immunohistochemistry cells were using Coomassie Brilliant Blue staining. Protein was precipitated washed with PBS and fixed with methanol for 15 minutes at with ethanol, resuspended in reducing (containing dithiothreitol –20°C. Primary antibodies were diluted with 1% goat serum (DTT)) or non-reducing sample buffer and subjected to SDS-gel in PBS. Monoclonal anti-collagen II antibodies (Quartett electrophoresis in 12.5%T polyacrylamide gels (20 µg/lane). Immunodiagnostika, Berlin, Germany, # 031502101) were diluted were transferred to nitrocellulose membranes by semidry-blotting. 1:50 (v/v) and monoclonal anti-collagen X antibodies (Quartett Protein transfer was checked by staining the membranes with Immunodiagnostika, Berlin, Germany, # 031501005) 1:10 (v/v), Ponceau S. After blocking, membranes were incubated incubated respectively. Incubation was for 1 hour at room temperature overnight at 4°C with a polyclonal antibody to the HA-tag (SC-805, followed by staining with Zymed HistoStain SP kit (Zymed Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted 1:200 (v/v) Laboratories Inc., San Francisco, CA, USA), applying the in blocking solution. FGFR3 and FGFR2 antibodies were from Santa manufacturer’s protocol. A positive signal is indicated by a red Cruz Biotechnology (#SC-123, #SC-122; Santa Cruz, CA, USA). precipitate of aminoethylcarbazole (AEC). The secondary antibody (Dianova, Hamburg) was applied at 1:5000 (v/v) dilution in blocking solution for 2 hours at room temperature. Color development was performed with 4-chloro-1-naphthol and In vivo transplantation 6 H2O2. Before in vivo transplantation, samples (2-3×10 cells) were mounted 772 Journal of Cell Science 115 (4)

Fig. 2. The T-box transcription factor Brachyury mediates chondrogenic differentiation in MSCs in vitro and ectopically in vivo. (A) Schematic representation of Brachyury according to Kispert et al. (Kispert et al., 1995). Western immunoblotting of recombinant HA-tagged Brachyury (aa 1-436) in cellular extracts of C3H10T1/2 (C3H10T1/2-Brachyury) with HA-antibody SC-805 (Santa Cruz) Brachyury is constitutively expressed under the control of the murine PGK-promoter. Expression of Brachyury is indicated (triangle). The molecular mass marker (M) shown is ovalbumin (43 kDa). NLS, nuclear localization signal. (B) Histological characterization of C3H10T1/2-Brachyury cells in culture. Top: at day 4 post-confluency cells develop alkaline-phosphatase-positive osteoblast-like cells. Below right: Alcian Blue histology of C3H10T1/2 cells stably expressing Brachyury show secreted proteoglycans and efficient differentiation into the chondrogenic lineage. Below left: Collagen-immunohistochemistry of C3H10T1/2-Brachyury cells in culture 7 days post-confluency was performed as described in Materials and Methods. Monoclonal anti-collagen 2 antibodies and anti-collagen X antibodies were used for collagen histology. The red precipitate of AEC (aminoethylcarbazole) indicates a positive signal. Cells secrete chondrocyte-specific collagen 2 but not collagen X, which is specific for hypertrophic chondrocytes. (C) RT-PCR analysis of the expression at various time intervals of chondrogenic and osteogenic marker genes in C3H10T1/2 cells recombinantly expressing Brachyury. (D) The forced expression of the T-box factor Brachyury in C3H10T1/2 cells leads to differentiation into chondrocytes and cartilage development at murine ectopic sites after intramuscular transplantation. Transplantations were performed as outlined in Materials and Methods. C3H10T1/2-Brachyury cells differentiate into chondrocytes after ectopic implantation at murine intramuscular sites (10 days and 20 days after implantation; HE, Alcian Blue and Safranin O staining). C3H10T1/2-Brachyury cells develop chondrocytes (20 days after implantation). Day 0, 1st day of cellular confluency. on individual type I collagen sponges (Colastat7 #CP-3n, Vitaphore RNA in situ hybridization Corp., 2×2×4 mm) and transplanted into the abdominal muscle of Embryos were isolated from pregnant NMRI mice at day 18.5 post female nude mice (4-8 weeks old). Before transplantation animals conception (d.p.c.). The embryos were fixed overnight with 4% were anaesthetized intraperitoneally (i.p.) with ketamine-xylazine paraformaldehyde in PBS at 4°C. 10 µm cryosections were mounted mixture (30 µl/per mouse) and injected i.p. with 5 mg/mouse of on aminopropyltriethoxysilane-coated slides and non-radioactive RNA Cefamzolin (Cefamezin7, TEVA). Skin was swabbed with in situ hybridizations were done as described (Bächner et al., 1998) chlorhexidine gluconate 0.5% and cut in the middle abdominal area; and by following the instructions of the manufacturer (Roche, an intramuscular pocket was formed in a rectal abdominal muscle and Mannheim). Briefly for hybridization, sense- and antisense RNA filled with the collagen sponge containing cells. Skin was sutured with probes from a 1.8 kb murine Brachyury cDNA were used. For the surgical clips. For the detection of engrafted C3H10T1/2 cells the generation of collagen 1a1 or collagen 2a1 the vector pMT7T3 mice were killed at 10 days and 20 days after transplantation. was used, harbouring specific probes (Metsäranta et al., 1991). Operated transplants were fixed in 4% paraformaldehyde Hybridization was performed with 0.5-2 µg denatured riboprobe/ml) cryoprotected with 5% sucrose overnight, embedded and frozen. overnight at 65°C in a humid chamber. For digoxygenin (DIG)- Sections were prepared with a cryostat (Bright, model OTF) and detection, slides were blocked in 5× SSC, 0.1% Triton, 20% FCS for stained with Haematoxylin and Eosin (HE), Alcian Blue and Safranin 30 minutes following two washes with DIG-buffer 1 (100 mM Tris, O. 150 mM NaCl, pH 7.6) for 10 minutes. Slides were incubated in anti- Brachyury mediates cartilage development 773

Fig. 3. Dominant-negative Brachyury (dnBrachyury; T-box domain) blocks BMP2-mediated chondrogenic development in C3H10T1/2 MSCs in vitro and ectopically in vivo. (A) Brachyury’s T-box domain interferes with the transcriptional activity of full-length Brachyury. For the assessment of Brachyury’s transcriptional activity, the Brachyury Binding Element (BBE) (see Materials and Methods) was placed twice in front of an HSV TK minimal promoter fused to a chloramphenicol-acetyltransferase reporter gene. These constructs were transfected into HEK293T cells with a full-length Brachyury expression construct and increasing amounts of an expression construct encoding the T-box domain (dnBrachyury). The total amount of Brachyury expression constructs was kept constant or filled up with empty vector (control). The ratios of full-length Brachyury/dnBrachyury were increasing from 1:1 to 1:2 and 1:3, as indicated. Values represent -fold activation in relation to an empty vector and are the average of at least three experiments done in triplicate. (B) Expression of dnBrachyury (T-box domain) in C3H10T1/2-BMP2 during cultivation (day 0; cellular confluence) The T-box domain (aa 1-229) was subcloned and HA-tagged in expression vector pMT7T3 and constitutively expressed in C3H10T1/2-BMP2 cells. Western immunoblotting was with HA-antibody SC-805 (Santa Cruz). The recombinantly expressed T-box domain (dnBrachyury) is indicated (triangle). The marker was carbonic anhydrase (29 kDa). (C) RT-PCR experiments with osteo/chondrogenic marker genes show that T-box domain (dnBrachyury) expression in C3H10T1/2-BMP2 cells interferes with the BMP2-dependent FGFR2 but not FGFR3 expression. (D) dnBrachyury (T-box) interferes with BMP2-mediated FGFR2 expression, as analyzed by western immunoblotting with antiFGFR3 and antiFGFR2 antibodies, as described Fig. 1. (E) The forced expression of the dominant-negative acting T-box domain in C3H10T1/2-BMP2 cells interferes with BMP-2 mediated osteo/chondrogenic development. dnBrachyury interferes with expression of alkaline phosphatase-positive and with Alcian Blue-positive matrix synthesis of chondrocyte-like cells at days 6 and 11 post-confluence, respectively. dnBrachyury also interferes with BMP2-dependent osteo/chondrogenic development at murine ectopic sites after intramuscular transplantation (20 days after implantation; HE-staining) resulting in connective tissue formation at intramuscular sites, only.

DIG-alkaline-phosphatase-coupled antibodies diluted 1:500 (v/v) in Results DIG-buffer 1 overnight in a humid chamber. Slides were washed with BMP2-dependent chondrogenic development in 0.1% Triton in DIG-buffer 1 for 2 hours with several changes of the C3H10T1/2 MSCs involves FGF-Receptor 3 washing solution and equilibrated in DIG-buffer 2 (100 mM Tris, 100 The mesenchymal stem cell line C3H10T1/2 has the mM NaCl, 50 mM MgCl2). Detection was performed using BM-purple capacity to undergo differentiation into all mesenchymal substrate (Roche, Mannheim) in DIG-buffer 2 with 1 mM levamisole lineages, including osteogenesis and chondrogenesis. The for 1-6 hours, depending on the probe. The reaction was stopped in responsiveness of C3H10T1/2 progenitors towards treatment TE-buffer and slides were incubated in 3% paraformaldehyde in PBS β for 3 minutes, followed by 0.1 M glycine in PBS for 3 minutes, and with TGF- and BMPs is often used to investigate washed three times in PBS for 3 minutes. Slides were counterstained mesenchymal cell determination and differentiation (e.g. Wang with 0.5% Methylene Green in PBS for 1 minute, dehydrated in a et al., 1993; Gazit et al., 1993; Ahrens et al., 1993; Hollnagel graded alcohol series, air dried and mounted with Eukitt. et al., 1997; Bächner et al., 1998). During a substractive screen 774 Journal of Cell Science 115 (4) levels (Fig. 1A,C, respectively). These two receptor types exhibit different induction kinetics. FGFR3 is upregulated during early stages of cultivation in the stable C3H10T1/2- BMP2 line while FGFR2 shows a delayed response (Fig. 1A,C). The fast upregulation of FGFR3 seems to be due to an immediate response to BMP2, since exogenously added BMP2 mediated FGFR3 transcription in wild-type C3H10T1/2 cells in the presence of cycloheximide (Fig. 1B). In contrast to FGFR3 and FGFR2, FGFR1 is constitutively expressed in wild-type and C3H10T1/2-BMP2 cells (Fig. 1A) while FGFR4 does not show any significant rates of expression (data not shown). Since FGFs and their receptors are crucial modulators of chondrogenic development, we investigated whether the immediate BMP2-dependent upregulation of FGFR3 in C3H10T1/2 is involved in the onset of chondrogenic differentiation. Indeed, forced expression of the wild-type FGFR3 (FGFR3WT) was sufficient for the development of morphologically distinct chondrocytes in C3H10T1/2- FGFR3WT cells (Fig. 1D,E). Moreover, the constitutively active mutant FGFR3 (Ach, G380R) possesses the same capacity (data not shown). The forced expression of FGFR3WT in MSCs stimulates MAPK signaling in these cells, as documented by enhanced levels of ERK1 and ERK2 phosphorylation (Fig. 1D), leads to the development of histologically distinct chondrocytes and induces or increases expression of chondrogenic marker genes such as collagen 2a1, the PTH/PTHrP receptor and transcription factor Sox9 (Fig. 1E). In C3H10T1/2 cells Sox9 is already expressed at substantial levels that are further upregulated by BMP2- and Fig. 4. Dominant-negative FGFR3 (dnFGFR3) interferes with FGFR3, which is consistent with recent observations (Fig. 1E) osteo/chondrogenic development, with FGFR2 and with Brachyury (Zehentner et al., 1999; Murakami et al., 2000). expression in C3H10T1/2-BMP2. (A) Forced expression of The immediate BMP2-dependent upregulation of FGFR3 in dnFGFR3 in C3H10T1/2-BMP2 cells interferes with BMP-2- MSCs (C3H10T1/2) and the inherent capacity of this receptor mediated development of alkaline phosphatase-positive and Alcian to initiate chondrogenic development in these cells, prompted Blue-positive chondrocyte-like cells, respectively. (B) dnFGFR3 the development of a screen for FGFR3-regulated transcription interferes with BMP2-dependent FGFR2 and Brachyury but not with factors. Among the transcription factors tested we observed FGFR3 expression in C3H10T1/2-BMP2 cells. FGFR3, dnFGFR3, that the T-box transcription factor Brachyury was upregulated FGFR2 and Brachyury mRNA levels in mesenchymal progenitors in FGFR3-expressing C3H10T1/2 cells (see also Fig. 5A). C3H10T1/2-BMP2 and C3H10T1/2-BMP2 with forced expression of dnFGFR3 were analysed by RT-PCR. Vector-borne transcripts Furthermore, we noticed that Brachyury possesses a encoding dnFGFR3 were analyzed by primer pairs for vector- and chondrogenic potential after recombinant expression in wild- FGFR3-specific sequences. type C3H10T1/2 cells (see below). for BMP-regulated genes in recombinant BMP2-expressing Forced expression of the T-box Factor Brachyury leads C3H10T1/2 (C3H10T1/2-BMP2) cells, we noted the to chondrogenic development in C3H10T1/2 upregulation of the Fibroblast Growth Factor Receptors 3 and mesenchymal stem cells 2 (FGFR3, FGFR2) at both the transcriptional and protein Brachyury was originally described as the first member of a

Fig. 5. FGFR3 and Brachyury are involved in an autoregulatory loop. (A) RT-PCR analyses of FGFR3 and Brachyury mRNA levels in mesenchymal progenitors C3H10T1/2 expressing recombinant FGFR3 (C3H10T1/2-FGFR3) or Brachyury (C3H10T1/2-Brachyury). (B) Smad1- signaling is not sufficient for Brachyury and FGFR3 but is sufficient for osteocalcin expression, as shown by RT-PCR analyses of FGFR3 and Brachyury mRNA levels in mesenchymal progenitors C3H10T1/2 expressing the biologically active Smad1-MH2 domain (C3H10T1/2-Smad1- MH2). Brachyury mediates cartilage development 775 family of transcription factors that harbors a T-box as the Major marker genes of chondrogenic and osteogenic DNA-binding domain. In addition, it has been reported that development show a transient (collagen 2a1, PTH/PTHrP- FGF and/or TGF-β ligand-induced expression levels of T-box receptor) or permanent (osteocalcin gene and the genes appear to be critical for their biological effects chondrogenic transcription factor Sox9) upregulation in (O’Reilly et al., 1995; Tada et al., 1997). To investigate C3H10T1/2-Brachyury, in comparison with C3H10T1/2 whether the FGFR3-dependent upregulation of the T-box cells, that were stably transfected with an empty expression factor Brachyury in C3H10T1/2 might play a role in vector (Fig. 2C). Although induction of the osteocalcin gene chondrogenesis, we expressed Brachyury cDNA under the indicates an osteogenic potential for C3H10T1/2-Brachyury, control of the murine phosphoglycerate kinase-1 (PGK-1) in ectopic transplantation of these cells in murine intramuscular the mesenchymal stem cell line C3H10T1/2 to allow sites results exclusively in the massive formation of moderate expression levels of Brachyury (C3H10T1/2- proliferating chondrocytes and cartilage (Fig. 2D). These Brachyury). The recombinant expression of Brachyury cDNA ectopic transplantations were performed three times and in all under the control of the murine phosphoglycerate kinase-1 cases the transplants developed chondrocytes and cartilage. (PGK-1) in MSCs (Fig. 2A) gave rise to efficient After both 10 and 20 days, transplants exhibit the histological chondrogenic differentiation, resulting in alkaline presence of proteoglycans (Alcian Blue, Safranin O) while phosphatase-positive cells (beginning at day 4) and Alcian bony elements or mineralized particles are not observed (Fig. Blue-positive chondrocyte-like cells (at day 10 post- 2D). After 20 days the ectopic implants show areas of confluence; Fig. 2B). Three individual C3H10T1/2 clones extensive extracellular matrix production as visualized by were investigated for their chondrogenic potential and gave histological analyses (Fig. 2D). The use of stronger viral similar results. Immunohistochemistry confirmed the promoters such as the LTR of the myeloproliferative virus presence of the chondrocyte-specific collagen 2 but not of (see Materials and Methods) resulted in increased cellular collagen X, which is typical of late stages of chondrocytic proliferation without the apparent formation of histologically differentiation (hypertophic chondrocytes) (Fig. 2B, left). distinct mesenchymal cell types (not shown).

Fig. 6. Brachyury is expressed at skeletal sites during late murine embryonic development (18.5 d.p.c.). Comparative expression analysis of murine Brachyury (Bra), Collagen 1a1 (Col 1a1) and Collagen 2a1 (Col 2a1) in embryonic development 18.5 d.p.c. (A) Intervertebral disc development. Consecutive sagittal (a-g) and transverse (h-j) sections of 18.5 d.p.c. mouse embryos were hybridized with riboprobes as indicated. Expression of Brachyury is enhanced in the nucleus pulposus (np) (a,d), Col 1a1 in the outer annulus (oa) (arrowheads in b,e), and Col 2a1 in the cartilage primordium (cp) of the vertebrae (c,f). No signals were obtained using RNase pre-incubated sections (g). With transverse sections at the level of the upper lumbar vertebra, expression of Brachyury is also detectable in distinct cells of the neural arch (h), whereas Col 1a1 is expressed in the outer annulus (i) and Col 2a1 in the cartilage primordium (j). (B) Limb bud development. Consecutive transverse sections of an 18.5 d.p.c. mouse hind limb at the level of the metatarsals, hybridized with riboprobes as indicated. Expression of Brachyury is evident in distinct chondrogenic cells of the forming metatarsal bones (a), better visible at higher magnification (b,c). In contrast Col 1a1 is expressed in the outer periosteal layer (d-f) and Col 2a1 expression is enhanced in differentiating chondrocytes (g-i). As was evident for the intervertebral disc formation, expression of Brachyury is only seen in chondrocyte-like cells that do not express Col 2a1. Bar, 100 µm. 776 Journal of Cell Science 115 (4) Dominant-negative Brachyury interferes with BMP2- (Fig. 4B) and interferes with the histological manifestation of dependent chondrogenic development in MSCs alkaline phosphatase- or Alcian Blue-positive chondrocyte-like We expected that Brachyury’s DNA-binding domain (T-box, aa cells (Fig. 4A). 1-229) without the associated regulatory domains (aa 230-436) should dominant-negatively (dn) interfere with endogenous Brachyury-mediated events in C3H10T1/2-BMP2 cells. A FGFR3 and the T-box factor Brachyury are involved in partial nuclear localization signal (NLS), which has been an autoregulatory loop for chondrogenic development in attributed to the T-box domain, should allow a substantial C3H10T1/2 progenitors nuclear accumulation (Kispert et al., 1995). We confirmed the During amphibian gastrulation, mesodermal Brachyury is dominant-negative nature of the T-box domain in DNA involved in an autoregulatory loop with FGF that is present in cotransfection assays performed in HEK293 T cells. We used the embryo (Kim et al., 1998). In C3H10T1/2 cells several FGF this particular cell line because expression levels are, in genes tested (FGF2, 4 and 9) were not Brachyury- or FGFR3- general, considerably higher in these cells than in C3H10T1/2. regulated (data not shown) and, therefore, are unlikely to be This cell line does not express Brachyury (data not shown). members of such a loop. However, a loop does seem to exist Exogenous Brachyury transactivated a construct containing between FGFR3 and Brachyury, since forced expression of two copies of the consensus Brachyury binding element (BBE) either one leads to the induction of the other in C3H10T1/2 oligonucleotide fused to a minimal HSV thymidine kinase (Fig. 5A). These experiments indicate that after BMP2- (TK)-minimal promoter-CAT chimeric gene, pBBE(2×)-CAT5 mediated initiation of the chondrogenic lineage, the (Fig. 3A). Indeed, cotransfection of pBBE(2×)-CAT5 with a chondrogenic differentiation may advance for some time in a recombinant Brachyury-expressing vector resulted in a 25-fold BMP2-independent fashion, maintained by the autoregulatory activation, whereas an empty expression vector had no effect loop between FGFRs and FGF-regulated transcription factors (Fig. 3A). Cotransfection of full-length Brachyury (Brachyury such as the T-box factor Brachyury. wt) with increasing amounts of an expression vector expressing In an earlier study (Ju et al., 2000) we showed that BMP- the T-box domain (dnBrachyury) (1:1, 1:2, 1:3) led to a clear mediated R-Smad signaling alone is not sufficient for cartilage decrease in CAT (sevenfold). Exogenous dnBrachyury alone development in C3H10T1/2 cells. Forced expression of Smad1 transactivated pBBE(2×)-CAT5 (BBE) only threefold. or the biologically active Smad1-MH2 domain is thereby able The forced expression of the HA-tagged T-box domain to mimic BMP2-mediated onset of osteogenic differentiation (dnBrachyury) is observed throughout in vitro cultivation (Fig. (Takeuchi et al., 2000). However, in contrast to osteogenic 3B) and strongly interfered with the BMP2-mediated marker genes such as the osteocalcin gene, Smad1-MH2 formation of alkaline phosphatase-positive osteoblast-like and domain-signaling is not sufficient to mimic BMP2-dependent Alcian Blue-stained chondrocyte-like cells in vitro (Fig. 3E). FGFR3- and the concomitant Brachyury-gene induction (Fig. In vivo, in ectopic transplantations of C3H10T1/2-BMP2 in 5B). Other BMP-activated R-Smads such as Smad5 and Smad8 intramuscular sites, dnBrachyury allowed the development of are also unable to mediate or to mimic BMP2-dependent connective tissue only (Fig. 3E). In addition, the chondrocyte- FGFR3-induction in C3H10T1/2 cells (data not shown), specific collagen 2a1 mRNA levels are more sensitive to the indicating the existence of R-Smad-MH2-independent pathways presence of dnBrachyury than mRNA levels of the distinct for FGFR3 induction or, alternatively, cooperative activities of osteogenic marker osteocalcin. The latter is hardly affected, R-Smads with other transcription factors (Mazars et al., 2000). consistent with the idea that Brachyury possesses a predominantly chondrogenic capacity in this particular cell type. Interestingly, the BMP2-mediated transcriptional The T-box factor Brachyury is expressed in maturing upregulation of FGFR3 in C3H10T1/2 is not obstructed by cartilage during murine embryonic development dnBrachyury, indicating that the immediate BMP2-mediated From the results in mesenchymal stem cell line C3H10T1/2 we FGFR3 induction is independent of Brachyury or other T-Box concluded that Brachyury might also play a role in factors (Fig. 3C,D). However, FGFR2-expression, which skeletogenesis in vivo. Brachyury is expressed at high levels exhibits a delayed response in C3H10T1/2-BMP2 cells (Figs early in vertebrate embryonic development and is involved in 1, 3), displays a high sensitivity to dnBrachyury. BMP- gastrulation and in the dose-dependent determination of mediated FGFR2 expression is almost completely suppressed mesodermal cell fates (see Introduction and Discussion). After by the dominant-negative acting T-box domain (Fig. 3C,D). gastrulation, Brachyury expression is downregulated and This may indicate that that the presence of FGFR2 seems persists in the notochord to the end of embryogenesis (Kispert necessary for the osteo/chondrogenic differentiation in this and Herrmann, 1994). Comparative mRNA expression analysis mesenchymal progenitor line (Fig. 3C,D). of murine Brachyury (Bra), collagen 1a1 (col 1a1) and collagen Furthermore, this suggests a hierarchy of FGFR-mediated 2a1 (col 2a1) in skeletal development (18.5 d.p.c.) indicates signaling for chondrogenic development. FGFR3-dependent that Brachyury is expressed at significant levels in cartilage- signaling is induced at first by BMP2 and, as a consequence, forming cells of the intervertebral disks and in limb bud FGFR2-mediated signaling becomes active. Such a model is development (Fig. 6). Expression of Brachyury is enhanced in proposed in Fig. 7. This model predicts that a forced expression intervertebral disc development in the nucleus pulposus in 18.5 of dominant-negative FGFR3 would interfere with BMP2- d.p.c. mouse embryos (Fig. 6Aa,d) confirming earlier reports mediated chondrogenesis and with FGFR2 and Brachyury (Wilkinson et al., 1990). Collagen 1a1 is expressed in the outer expression. Indeed, an FGFR3-variant without the annulus (arrowheads in Fig. 6Ab,e), and collagen 2a1 in the cytoplasmatic tyrosine-kinase domains downregulates BMP2- cartilage primordium of the vertebrae (Fig. 6Ac,f). In dependent mRNA expression levels of FGFR2 and Brachyury transverse sections made at the level of the upper lumbar Brachyury mediates cartilage development 777 vertebra, expression of Brachyury is also detectable in distinct chondrogenic cells of the neural arch (Fig. 6Ah) whereas collagen 1a1 expression is maintained in the outer annulus (Fig. 6Ai), as is collagen 2a1 in the cartilage primordium (Fig. 6Aj). In murine limb bud development (18.5 d.p.c.; hind limb) expression of Brachyury is evident in distinct chondrogenic cells of the forming metatarsal bones (Fig. 6Ba-c). In contrast, collagen 1a1 is expressed in the outer periosteal layer (Fig. 6Bd-f) and collagen 2a1 expression is enhanced in differentiating chondrocytes (Fig. 6Bg-i). Interestingly, like in intervertebral disc formation, the expression of Brachyury is only evident in chondrocyte-like cells that do not express Col 2a1 indicating that Brachyury expression is upregulated in chondrogenic cells before or after collagen 2 expression.

Discussion FGFR3 signaling and cartilage formation Fig. 7. Model of BMP2-dependent osteo/chondrogenic development As documented in this investigation, FGFR3-mediated in mesenchymal stem cells. BMP2 predominantly determines osteo/chondrogenic development via BMPR-IA, while BMPR-IB signaling is sufficient for the onset of chondrogenesis in the only exerts maturing functions on osteoblast development in mesenchymal stem cell line C3H10T1/2. This evidence is C3H10T1/2 cells (in preparation). Therefore, Smad1 is a signaling surprising since FGF signaling is better known for exerting mediator of osteogenesis rather than of chondrogenesis (Ju et al., negative influences on endochondral bone formation. In vivo, 2000). Osteogenesis is controlled by R-Smad-signaling during the FGFR3 is expressed in the epiphyseal growth plate and in entire osteoblast-developmental sequence, also by recruiting CBFA1 FGFR3–/– mice, the zone of hypertrophic cartilage is enlarged into an heteromeric complex (Hanai et al., 1999). BMP2-dependent by excessive bone elongation (Colvin et al., 1996; Deng et al., determination of chondrogenesis in mesenchymal progenitors 1996). Similar studies with FGFR1, which in vivo is expressed C3H10T1/2 seems to involve the immediate upregulation of FGFR3 in osteoblasts and hypertrophic chondrocytes, or with FGFR2, by an R-Smad-independent mechanism. After this triggering event, which in vivo is expressed in the perichondrium, have not been chondrogenesis is then predominantly controlled by BMP- independent mechanisms. Therefore, FGF-mediated signaling leads performed since targeted –/– mutations are embryonic lethal to MAPK-activation and upregulation of T-box factor (Brachyury) before bones form. Moreover, several investigations have expression that is sufficient for de novo chondrogenesis in demonstrated that FGFR3-mediated signaling interferes with mesenchymal progenitors C3H10T1/2. Brachyury is able to maintain chondrocytic proliferation and/or differentiation (Naski et al., FGFR3 and FGFR2 expression in an autoregulatory loop. FGFR- 1998; Sahni et al., 1999; Henderson et al., 2000; Segev et mediated MAPK-signaling also upregulates mRNA levels of al., 2000). These reports, however, are in contrast with transcription factor Sox9, which is necessary for chondrogenic investigations indicating that FGF treatment stimulates development (Murakami et al., 2000). proliferation and/or differentiation in chondrocytes (Kato and Iwamoto, 1990; Hill et al., 1991; Wroblewski and Edwall- Arvidsson, 1995; Legeai-Mallet et al., 1998). Consistent with differentiation in mesenchymal stem cell line C3H10T1/2, and the latter observations, overexpression of sprouty, an antagonist the T-box containing transcription factor Brachyury fulfilled of FGF signaling in mice, is responsible for the development the requirements as a target for FGF-mediated chondrogenesis of chondrodysplasia and not for excessive bone growth, as (Figs 1-5). Although expression of Brachyury in C3H10T1/2 would have been expected from the FGFR3–/– phenotype upregulates mRNA levels of osteocalcin, which is a specific (Minowada et al., 1999). This could be explained by the marker for late osteogenesis, bony centers or mineralized necessity of FGF-signaling for chondrocytic cell determination. particles have never been observed in ectopic implantations. Moreover, other studies indicate that inhibitory influences This might indicate that Brachyury expression is sufficient for on chondrocytic proliferation/differentiation by FGFR3- chondrogenesis rather than for osteogenesis. However, dependent signaling predominantly occur in postnatal rather Brachyury could mediate differentiation of bipotential than in embryonic skeletal development (Naski et al., 1998). osteo/chondrogenic progenitors where the chondrogenic Also, a decisive involvement of FGFR3- or MAPK-signaling lineage prevails, eventually. In addition we noted the absence with osteo/chondrogenic development has been observed of enchondral bone formation in ectopic transplants, which is recently in other studies (Lou et al., 2000; Murakami et al., in contrast to transplanted C3H10T1/2 cells expressing BMPs. 2000). Therefore, the in vivo or in vitro developmental state of It is known that BMPs may contribute to enchondral bone chondrocytic cells or cell lines may define whether FGF exerts formation by their ability to induce VEGF. This may stimulate a stimulatory or an inhibitory potential on chondrocyte angiogenesis and vasculogenesis, which are prerequisites for proliferation and/or differentiation. the presence of phagocytic and osteogenic cells to replace hypertrophic cartilage by bone (Yeh and Lee, 1999; Kozawa et al., 2001). It seems that Brachyury is not involved in these Brachyury’s role during chondrogenic differentiation of events. MSCs The model of BMP2-dependent osteo/chondrogenic FGFR3-mediated signaling initiated chondrogenic development in mesenchymal stem cells C3H10T1/2 suggests 778 Journal of Cell Science 115 (4) that BMP2 predominantly initiates and determines osteo/ One way of Brachyury induction that has been discussed is chondrogenic development via BMPR-IA (Fig. 7). In a synergism between FGF-signaling cascades and SRF (Serum C3H10T1/2 cells BMPR-IB only exerts minor functions (our Response Factor), because SRF is downstream of the MAPK unpublished observations). Then, the BMP2-mediated R-Smad signaling cascade and mouse embryos lacking functional SRF signaling regulates predominantly osteogenesis and not protein do not form mesoderm and do not express Brachyury chondrogenesis (Ju et al., 2000). R-Smad-signaling seems to (Arsenian et al., 1998). However, a constitutively active form be required during the entire osteoblast developmental of SRF does not induce expression of (Panitz et al., 1998) sequence, possibly also by recruiting Cbfa1 into a heteromeric and therefore SRF activity in expression of Brachyury seems complex with activated Smad proteins (Hanai et al., 1999). In to be indirect. Also, based on in vitro and in vivo studies it has contrast, BMP2-dependent determination of chondrogenesis in been suggested that Brachyury induction may be mediated by the mesenchymal stem cell line C3H10T1/2 seems to involve Wnt-signaling (Arnold et al., 2000; Smith et al., 2000). the immediate upregulation of FGFR3 by an R-Smad- However, it has recently been documented that Wnt-signaling independent mechanism. is involved in the maintenance but not in the induction of The signaling pathway for this BMP2-dependent immediate Brachyury and mesoderm synthesis (Galceran et al., 2001). induction of FGFR3 is not clear; however, recently it has been So we think that among the likely mechanisms leading demonstrated that TGF-β signaling activates MAPK-pathways to the early upregulation of Brachyury in mesenchymal through the small GTP binding proteins Cdc42 and Rac1, progenitors, C3H10T1/2 may be the derepression of members which leads to a cooperative effect between Smad2/3 and AP1 of the δEF1 family of transcriptional repressors. It has been for gene activation. Similar mechanisms may play a role for demonstrated that point mutations disrupting δEF1 binding- BMP2-mediated activation of FGFR3 (Mazars et al., 2000; sites in the Xbra promoter (Remacle et al., 1999) change the Dennler et al., 2000). mesodermal expression of reporter constructs and result in As discussed above, after this triggering event, widespread ectodermal and endodermal misexpression chondrogenesis seems to be predominantly controlled by (Lerchner et al., 2000). Of the δEF1 family members, SIP1 is BMP-independent mechanisms. The interference of dominant- able to interact with activated Smad proteins and to interfere negative Brachyury (i.e. the T-box domain) with BMP2- with transcription of endogenous Xbra (Verschueren et al., mediated FGFR2- but not with FGFR3- expression indicates 1999). that FGFR2 expression is dependent on Brachyury, and that an It seems highly conceivable that SIP1 is bound to its binding autoregulatory loop may be initiated by FGFR3, and seems to sites in the Brachyury promoter in C3H10T1/2 since SIP1 has be maintained between FGFR3/FGFR2 and Brachyury (Fig. high basal levels of expression (data not shown). Although not 3A). In contrast, mRNA-levels for the transcription factor Sox9 yet entirely clear, SIP-1 could dissociate from DNA when are not significantly altered by dnBrachyury expression. Since associated with an activated Smad molecule. This would call both factors, Sox9 and Brachyury, are regulated by FGF for two signaling cascades involved in the early induction of signaling (Fig. 1, Fig. 2C) it is conceivable that different FGF- Brachyury, one of which is involved in BMP/Smad-mediated mediated signalling pathways activate Brachyury or Sox9, derepression of the Brachyury promoter and the other for the since FGFR-mediated MAPK-signaling also upregulates onset of Brachyury transcription. Since FGF-signaling alone mRNA levels of the chondrogenic transcription factor Sox9 seems to be sufficient for Brachyury induction in C3H10T1/2, (Murakami et al., 2000). This suggests that FGFs and FGF- one might envisage that endogenously expressed TGF-β family receptors, the MAPK pathway, Sox9 and T-box factor(s) are members might be sufficient to enable a significant essential components for the BMP-dependent onset of derepression of the Brachyury promoter but that additional (i.e. chondrogenesis (Fig. 7). Consequently, a block of the FGFR3- FGF-)signaling cascades are needed to elicit a significant mediated signaling cascade should interfere with BMP2- Brachyury synthesis. mediated FGFR2 and Brachyury induction as well as with Also not seen during the cultivation of recombinant cartilage formation. Forced expression of dominant-negative C3H10T1/2-FGFR3 cells, a downregulation of Brachyury FGFR3 (dnFGFR3) in C3H10T1/2-BMP2 cells fulfils these transcription in vivo could be mediated by an FGFR3- criteria, indeed. Osteo/chondrogenic differentiation is severely dependent upregulation of sprouty gene expression. The latter reduced on a histological basis (Fig. 4A) as well as on inhibits FGFR-mediated signalling (Minowada et al., 1999; expression levels of FGFR2 and Brachyury (Fig. 4B). Wakioka et al., 2001) and would interfere with FGFR3- Interestingly, a role for another T-box factor (Tbx2) in skeletal mediated Brachyury gene expression, eventually. cell development was postulated recently (Chen et al., 2001). Brachyury’s function in skeletal development FGF-mediated Brachyury induction Does Brachyury, which has been extensively characterized in Brachyury expression in vivo is induced and carefully early embryonic development, also play a role later in the controlled during gastrulation. Thereafter Brachyury determination/differentiation of chondrogenic tissue in vivo? It expression is downregulated but persists in the tailbud and the has been shown that Brachyury is highly expressed during notochord. Brachyury expression in vivo is controlled by FGF, gastrulation, where it plays a decisive role in the generation Wnt- and activin signaling pathways. Here in C3H10T1/2 an of undifferentiated mesoderm, and, thereafter, Brachyury FGFR3-dependent induction of Brachyury transcription is expression is downregulated (reviewed in Papaioannou and monitored. What could be the mechanism for FGF-dependent Silver, 1998; Smith, 1999). Here, we show that in situ activation of the Brachyury gene in the C3H10T1/2 cellular hybridizations detect substantial levels of Brachyury mRNA in system? maturing chondrogenic tissue at late stages of embryonic Brachyury mediates cartilage development 779 development (18.5 d.p.c.) during spine formation and targets in Xenopus and ascidians involved in gastrulation and especially in the intervertebral discs (Fig. 6). The part of the switching on the notochord (Tada et al., 1998; Takahashi et al., disc structure that appears to play an important role in its 1999; Saka et al., 2000). Interestingly, mRNAs have been function is the nucleus pulposus, which is an avascular identified that seem to be upregulated by ectopic Brachyury gelatinous tissue located between the endplates of the vertebral expression such as cartilage-specific collagen 2a1 and collagen bodies and the inner lamellae of the annulus fibrosus. The 11a1 (Takahashi et al., 1999). integrity of the gelatinous matrix of the nucleus pulposus It has been suggested that a hypothetical competence factor seems to be essential for the load bearing of the discs. The (CF) acts to promote the chondrogenic response to BMP nucleus pulposus cells generate only poorly developed signaling during the generation of axial and appendicular cartilage, with low amounts of collagens 2a1 and 1a1 but a high cartilage (Murtaugh et al., 1999). In the absence of such a concentration of aggrecan. In situ analyses showed that signal, presomitic mesoderm assumes a lateral plate fate as its collagen 2a1 is expressed in chondrocytes surrounding the response to BMPs. Sonic hedgehog (Shh) can provide the nucleus pulposus while collagen 1a1 is expressed in the competence to respond to BMP by differentiating into flanking outer annulus (Fig. 6). Brachyury is highly expressed chondrocytes. Also limb bud mesenchymal cells assume the in the nucleus pulposus cells that are of notochordal origin, competence to convert to chondrocytes upon BMP treatment, consistent with it being a marker gene for axial (notochordal) otherwise exogenous BMPs induce apoptosis. As in the mesoderm. Notochordal expression of Brachyury is regulated somite, it is suggested that a hypothetical factor (CF) acts to by an enhancer that is not yet mapped (Lerchner et al., 2000). promote chondrogenic response to BMP signalling. The In the notochord-derived nucleus pulposus cells it cannot be nature of signal which induces competence in the limb bud is excluded that a similar element is used for driving T-gene unclear. expression. The high level of Brachyury expression and its Although the nature of the CF is unknown it might be potential chondrogenic capacity might indicate that this temptative to speculate that transcription factors of the T-box ensures the cartilaginous character of the nucleus pulposus. In family could exert a CF-like role on transcriptional level. contrast to the fibrous nature of the inner annulus, Brachyury Brachyury is expressed in axial/paraxial mesodermal structures is also significantly upregulated in distinct chondrocytes, during early embryonic development while others that could forming hyaline cartilage of the vertebral body (Fig. 6A). An exert such a role are expressed later in the limb bud. The upregulation of Brachyury expression in chondrocytes of the finding mentioned above, that in somite/notochord hind limb metatarsals is also observed. There, Brachyury cocultivation experiments cartilage formation may be induced seems to be upregulated in a set of chondrogenic cells at an in normal but not in somites from T/T embryos (Bennett, early state of maturation, i.e. in cells where collagen 2a1 is not 1958), could indicate a CF-like role for Brachyury. It would yet expressed (Fig. 6B). Alternatively, these cells could be pre- also be consistent with the skeletal phenotypes in Brachyury hypertrophic chondrocytes. Expression of Brachyury in pre- mutant mice described above. hypertrophic chondrocytes would be consistent with the suggestion that this gene is upregulated in response to FGFR3, The authors are indebted to Drs B. Herrmann (Max-Planck- whose gene is expressed at high levels before chondrocytes Institute, Freiburg) for proving Brachyury cDNA and A. Yayon undergo hypertrophy. It would also be consistent with the (Weizmann Institute, Rehovot, Israel) for FGFR3 cDNA. We would observations that ectopic expression of Brachyury in like to thank Drs D. Huylebroeck and P. Tylzanowski (Celgen, Leuven, Belgium) for intensive and stimulating discussions and for C3H10T1/2 cells resulted in production of alkaline editing the manuscript. phosphatase, and activation of the genes for PTH/PTHrP- receptor and osteocalcin. Are there then genetic indications that Brachyury is involved References in the differentiation/patterning of skeletal elements? Ahrens, M., Ankenbauer, T., Schröder, D., Hollnagel, A., Mayer, H. and Interestingly, Bennett (Bennett, 1958) demonstrated that Gross, G. (1993). Expression of Human Bone Morphogenetic Proteins -2 cartilage formation is not induced in somites from T/T or -4 in Murine Mesenchymal Progenitor C3H10T1/2 Cells Induces embryos. In addition, Brachyury mutant alleles have been Differentiation into Distinct Mesenchymal Cell Lineages. DNA Cell Biol. 12, 871-880. described that counteract the activity of the wild-type protein Arnold, H. H. and Winter, B. (1998). Muscle differentiation: more (Kispert, 1995). These mutations carry truncations in the C complexity to the network of myogenic regulators. Curr. Opin. Genet. Dev. terminus and appear to act as dominant-negatives. Consistent 8, 539-544. with the in situ expression analyses here (Fig. 6A), Arnold, S. J., Stappert, J., Bauer, A., Kispert, A., Herrmann, B. G. and Kemler, R. (2000). Brachyury is a target gene of the Wnt/beta-catenin heterozygous dominant-negative Brachyury-mutant mice signaling pathway. Mech. Dev. 91, 249-258. exhibit skeletal phenotypes such as complete or near-complete Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and Nordheim, absence of the tail, absence of the odontoid process of the axis, A. (1998). is essential for mesoderm formation absence of the nuclei pulposi of the intervertebral discs, a during mouse embryogenesis. EMBO J. 17, 6289-6299. tendency for rib and vertebral fusions, and an occasional Bächner, D., Ahrens, M., Schroder, D., Hoffmann, A., Lauber, J., Betat, N., Steinert, P., Flohe, L. and Gross, G. (1998). Bmp-2 downstream targets absence of presacral vertebrae and ribs, suggesting a later role in mesenchymal development identified by subtractive cloning from for the Brachyury gene in morphogenesis and function of recombinant mesenchymal progenitors (C3H10T1/2). Dev. Dyn. 213, 398- notochord-derived tissue (Wilkinson et al., 1990; Kispert and 411. Herrmann, 1994). Bennett, D. (1958). In vitro Study of Cartilage Induction in T/T mice. Nature 181, 1286 A key step to understanding Brachyury function is the Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and De Crombrugghe, B. identification of target genes. Two major cloning strategies (1999). Sox9 is required for cartilage formation. Nat. Genet. 22, 85-89. have led to the isolation of Brachyury-regulated downstream Boshart, M., Kluppel, M., Schmidt, A., Schütz, G. and Luckow, B. (1992). 780 Journal of Cell Science 115 (4)

Reporter constructs with low background activity utilizing the cat gene. Kispert, A. and Herrmann, B. G. (1994). Immunohistochemical analysis of Gene 110, 129-130. the Brachyury protein in wild-type and mutant mouse embryos. Dev. Biol. Bridgewater, L. C., Lefebvre, V. and De Crombrugghe, B. (1998). 161, 179-193. Chondrocyte-specific enhancer elements in the Col11a2 gene resemble the Kispert, A., Koschorz, B. and Herrmann, B. G. (1995). The T protein Col2a1 tissue-specific enhancer. J. Biol. Chem. 273, 14998-15006. encoded by Brachyury is a tissue-specific transcription factor. EMBO J. 14, Brown, D., Wagner, D., Li, X., Richardson, J. A. and Olson, E. N. (1999). 4763-4772. Dual role of the basic helix-loop-helix transcription factor scleraxis in Komori, T. and Kishimoto, T. (1998). Cbfa1 in bone development. Curr. mesoderm formation and chondrogenesis during mouse embryogenesis. Opin. Genet. Dev. 8, 494-499. Development 126, 4317-4329. Kozawa, O., Matsuno, H. and Uematsu, T. (2001). Involvement of p70 S6 Chen, J., Zhong, Q., Wang, J., Cameron, R. S., Borke, J. L., Isales, C. M. kinase in bone morphogenetic protein signaling: Vascular endothelial and Bollag, R. J. (2001). Microarray analysis of Tbx2-directed gene growth factor synthesis by bone morphogenetic protein-4 in osteoblasts. J. expression: a possible role in osteogenesis. Mol. Cell Endocrinol. 177, 43- Cell Biochem. 81, 430-436. 54. Lefebvre, V. and De Crombrugghe, B. (1998). Toward understanding SOX9 Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, function in chondrocyte differentiation. Matrix Biol. 16, 529-540. D. M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast Lefebvre, V., Li, P. and De Crombrugghe, B. (1998). A new long form of growth factor receptor 3. Nat. Genet. 12, 390-397. Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and Deng, C., Wynshaw-Boris, A., Zhou, F., Kuo, A. and Leder, P. (1996). cooperatively activate the type II collagen gene. EMBO J. 17, 5718-5733. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Legeai-Mallet, L., Benoist-Lasselin, C., Delezoide, A. L., Munnich, A. and Cell 84, 911-921. Bonaventure, J. (1998). Fibroblast growth factor receptor 3 mutations Dennler, S., Prunier, C., Ferrand, N., Gauthier, J. M. and Atfi, A. (2000). promote apoptosis but do not alter chondrocyte proliferation in C Jun inhibits TGFbeta-mediated transcription by repressing smad3 thanatophoric dysplasia. J. Biol. Chem. 273, 13007-13014. transcriptional activity. J. Biol. Chem. (in press). Lerchner, W., Latinkic, B. V., Remacle, J. E., Huylebroeck, D. and Smith, Foster, J. W., Dominguez-Steglich, M. A., Guioli, S., Kowk, G., Weller, P. J. C. (2000). Region-specific activation of the Xenopus brachyury promoter A., Stevanovic, M., Weissenbach, J., Mansour, S., Young, I. D. and involves active repression in ectoderm and endoderm: a study using Goodfellow, P. N. (1994). Campomelic dysplasia and autosomal sex transgenic frog embryos. Development 127, 2729-2739. reversal caused by mutations in an SRY-related gene. Nature 372, 525-530. Lou, J., Tu, Y., Li, S. and Manske, P. R. (2000). Involvement of ERK in Fujii, M., Takeda, K., Imamura, T., Aoki, H., Sampath, T. K., Enomoto, BMP-2 induced osteoblastic differentiation of mesenchymal progenitor cell S., Kawabata, M., Kato, M., Ichijo, H. and Miyazono, K. (1999). Roles line C3H10T1/2. Biochem. Biophys. Res. Commun. 268, 757-762. of bone morphogenetic protein type I receptors and proteins in Mazars, A., Tournigand, C., Mollat, P., Prunier, C., Ferrand, N., osteoblast and chondroblast differentiation. Mol. Biol. Cell 10, 3801-3813. Bourgeade, M. F., Gespach, C. and Atfi, A. (2000). Differential roles of Galceran, J., Hsu, S. C. and Grosschedl, R. (2001). Rescue of a Wnt JNK and Smad2 signaling pathways in the inhibition of c--induced cell mutation by an activated form of LEF-1: regulation of maintenance but not death by TGF-beta. Oncogene 19, 1277-1287. initiation of Brachyury expression. Proc. Natl. Acad. Sci. USA 98, 8668- Metsäranta, M., Toman, D., De Crombrugghe, B. and Vuorio, E. (1991). 8673. Specific hybridization probes for mouse type I, II, III and IX collagen Gazit, D., Ebner, R., Kahn, A. J. and Derynck, R. (1993). Modulation of mRNAs. Biochim. Biophys. Acta 1089, 241-243. expression and cell surface binding of members of the transforming growth Minowada, G., Jarvis, L. A., Chi, C. L., Neubuser, A., Sun, X., Hacohen, factor-β superfamily during retinoic acid-induced osteoblastic N., Krasnow, M. A. and Martin, G. R. (1999). Vertebrate Sprouty genes differentiation of multipotential mesenchymal cells. Mol. Endocrinol. 7, are induced by FGF signaling and can cause chondrodysplasia when 189-198. overexpressed. Development 126, 4465-4475. Hanai, J., Chen, L. F., Kanno, T., Ohtani-Fujita, N., Kim, W. Y., Guo, W. Murakami, S., Kan, M., McKeehan, W. L. and deCrombrugghe, B. (2000). H., Imamura, T., Ishidou, Y., Fukuchi, M., Shi, M. J., Stavnezer, J., Up-regulation of the chondrogenic Sox9 gene by fibroblast growth factors Kawabata, M., Miyazono, K. and Ito, Y. (1999). Interaction and functional is mediated by the mitogen-activated protein kinase pathway. Proc. Natl. cooperation of PEBP2/CBF with Smads. Synergistic induction of the Acad. Sci. USA 97, 1113-1118. immunoglobulin germline Calpha promoter. J. Biol. Chem. 274, 31577- Murtaugh, L. C., Chyung, J. H. and Lassar, A. B. (1999). Sonic hedgehog 31582. promotes somitic chondrogenesis by altering the cellular response to BMP Henderson, J. E., Naski, M. C., Aarts, M. M., Wang, D. S., Cheng, L., signaling. Genes Dev. 13, 225-237. Goltzman, D. and Ornitz, D. M. (2000). Expression of FGFR3 with the Naski, M. C., Colvin, J. S., Coffin, J. D. and Ornitz, D. M. (1998). G380R achondroplasia mutation inhibits proliferation and maturation of Repression of hedgehog signaling and BMP4 expression in growth plate CFK2 chondrocytic cells. J. Bone Miner. Res. 15, 155-165. cartilage by fibroblast growth factor receptor 3. Development 125, 4977- Hill, D. J., Logan, A. and De Sousa, D. (1991). Stimulation of DNA and 4988. protein synthesis in epiphyseal growth plate chondrocytes by fibroblast O’Reilly, M.-A. J., Smith, J. C. and Cunliffe, V. (1995). Patterning of the growth factors. Interactions with other peptide growth factors. Ann. NY mesoderm in Xenopus: Dose-dependent and synergistic effects of Brachyury Acad. Sci. 638, 449-452. and Pintallavis. Development 121, 1351-1359. Hollnagel, A., Ahrens, M. and Gross, G. (1997). Parathyroid hormone Owen, T. A., Aronow, M., Shalhoub, V., Barone, L. M., Wilming, L., enhances early and suppresses late stages of osteogenic and chondrogenic Tassinari, M. S., Kennedy, M. B., Pockwinse, S., Lian, J. B. and Stein, development in a BMP-dependent mesenchymal differentiation system G. S. (1990). Progressive development of the rat osteoblast phenotype in (C3H10T1/2). J. Bone Miner. Res. 12, 1993-2004. vitro, reciprocal relationships in the expression of genes associated with Johansson, B. M. and Wiles, M. V. (1995). Evidence for involvement of osteoblast proliferation and differentiation during formation of the bone activin A and bone morphogenetic protein 4 in mammalian mesoderm and extracellular matrix. J. Cell. Physiol. 143, 420-430. hematopoietic development. Mol. Cell. Biol. 15, 141-151. Panitz, F., Krain, B., Hollemann, T., Nordheim, A. and Pieler, T. (1998). Ju, W., Hoffmann, A., Verschueren, K., Tylzanowski, P., Kaps, C., Gross, The Spemann organizer-expressed zinc finger gene Xegr-1 responds to the G. and Huylebroeck, D. (2000). The bone morphogenetic protein 2 MAP kinase/Ets-SRF signal transduction pathway. EMBO J. 17, 4414- signaling mediator Smad1 participates predominantly in osteogenic and not 4425. in chondrogenic differentiation in mesenchymal progenitors C3H10T1/2. J. Papaioannou, V. E. (1997). T-box family reunion. Trends Genet. 13, 212-213. Bone Miner. Res. 15, 1889-1899. Papaioannou, V. E. and Silver, L. M. (1998). The T-box gene family. Kato, Y. and Iwamoto, M. (1990). Fibroblast growth factor is an inhibitor of BioEssays 20, 9-19. chondrocyte terminal differentiation. J. Biol. Chem. 265, 5903-5909. Remacle, J. E., Kraft, H., Lerchner, W., Wuytens, G., Collart, C., Kim, J., Lin, J. J., Xu, R. H. and Kung, H. F. (1998). Mesoderm induction Verschueren, K., Smith, J. C. and Huylebroeck, D. (1999). New mode of by heterodimeric AP-1 (c-Jun and c-Fos) and its involvement in mesoderm DNA binding of multi-zinc finger transcription factors: delta EF1 family formation through the embryonic fibroblast growth factor Xbra autocatalytic members bind with two hands to two target sites. EMBO J. 18, 5073-5084. loop during the early development of Xenopus embryos. J. Biol. Chem. 273, Reznikoff, C. A., Brankow, D. W. and Heidelberger, C. (1973). 1542-1550. Establishment and characterization of a cloned cell line of C3H mouse Kispert, A. (1995). The Brachyury protein: a T-domain transcription factor. embryo cells sensitive to postconfluence inhibition of division. Cancer Res. Semin. Dev. Biol. 6, 395-403. 33, 3231-3238. Brachyury mediates cartilage development 781

Sahni, M., Ambrosetti, D. C., Mansukhani, A., Gertner, R., Levy, D. and Tontonoz, P., Hu, E. and Spiegelman, B. M. (1994). Stimulation of Basilico, C. (1999). FGF signaling inhibits chondrocyte proliferation and adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription regulates bone development through the STAT-1 pathway. Genes Dev. 13, factor. Cell 79, 1147-1156. 1361-1366. Verschueren, K., Remacle, J., Collart, C., Kraft, H., Baker, B. S., Saka, Y., Tada, M. and Smith, J. C. (2000). A screen for targets of the Tylzanowski, P., Nelles, L., Wuytens, G., Su, M.-T., Bodmer, R., Smith, Xenopus T-box gene xbra. Mech. Dev. 93, 27-39. J. C. and Huylebroeck, D. (1999). SIP1, a novel zinc finger/homeodomain Segev, O., Chumakov, I., Nevo, Z., Givol, D., MadarShapiro, L., Sheinin, repressor, interacts with Smad proteins and binds to 5′-CACCT sequences Y., Weinreb, M. and Yayon, A. (2000). Restrained chondrocyte in candidate target genes. J. Biol. Chem. 274, 20489-20498. proliferation and maturation with abnormal growth plate vascularization and Wagner, T., Wirth, J., Meyer, J., Zabel, B., Held, M., Zimmer, J., Pasantes, ossification in human FGFR-3(G380R) transgenic mice. Hum. Mol. Genet. J., Bricarelli, F. D., Keutel, J. and Hustert, E. (1994). Autosomal sex 9, 249-258 (Abstract). reversal and campomelic dysplasia are caused by mutations in and around Smith, J. (1997). Brachyury and the T-box genes. Curr. Opin. Genet. Dev. 7, the SRY-related gene SOX9. Cell 79, 1111-1120. 474-480. Wakioka, T., Sasaki, A., Kato, R., Shouda, T., Matsumoto, A., Miyoshi, Smith, J. (1999). T-box genes: what they do and how they do it. Trends. Genet. K., Tsuneoka, M., Komiya, S., Baron, R. and Yoshimura, A. (2001). 15, 154-158. Spred is a Sprouty-related suppressor of Ras signalling. Nature 412, 647- Smith, J. C., Conlon, F. L., Saka, Y. and Tada, M. (2000). Xwnt11 and the 651. regulation of gastrulation in Xenopus. Phil. Trans. R. Soc. Lond. B 355, 923- Wang, E. A., Israel, D. I., Kelly, S. and Luxenberg, D. P. (1993). Bone 930. Morphogenetic Protein causes commitment and differentiation in C3H10T_ Tada, M., Casey, E. S., Fairclough, L. and Smith, J. C. (1998). Bix1, a direct and 3T3 cells. Growth Factors 9, 57-71. target of Xenopus T-box genes, causes formation of ventral mesoderm and Wilkie, A. O., Morriss-Kay, G. M., Jones, E. Y. and Heath, J. K. (1995). endoderm. Development 125, 3997-4006. Functions of fibroblast growth factors and their receptors. Curr. Biol. 5, 500- Tada, M., O’Reilly, M. A. J. and Smith, J. C. (1997). Analysis of competence 507. and of Brachyury autoinduction by use of hormone-inducible Xbra. Wilkinson, D. G., Bhatt, S. and Herrmann, B. G. (1990). Expression pattern Development 124, 2225-2234. of the mouse T gene and its role in mesoderm formation. Nature 343, 657- Takahashi, H., Hotta, K., Erives, A., Di Gregorio, A., Zeller, R. W., Levine, 659. M. and Satoh, N. (1999). Brachyury downstream notochord differentiation Wroblewski, J. and Edwall-Arvidsson, C. (1995). Inhibitory effects of basic in the ascidian embryo. Genes Dev. 13, 1519-1523. fibroblast growth factor on chondrocyte differentiation. J. Bone Miner. Res. Takeuchi, S., Takeda, K., Oishi, I., Nomi, M., Ikeya, M., Itoh, K., Tamura, 10, 735-742. S., Ueda, T., Hatta, T., Otani, H., Terashima, T., Takada, S., Yamamura, Yeh, L. C. and Lee, J. C. (1999). Osteogenic protein-1 increases gene H., Akira, S. and Minami, Y. (2000). Mouse Ror2 receptor tyrosine kinase expression of vascular endothelial growth factor in primary cultures of fetal is required for the heart development and limb formation. Genes Cells 5, rat calvaria cells. Mol. Cell Endocrinol. 153, 113-124. 71-78. Zehentner, B. K., Dony, C. and Burtscher, H. (1999). The transcription Taylor, S. M. and Jones, P. A. (1979). Multiple new phenotypes induced in factor Sox9 is involved in BMP-2 signaling. J. Bone Miner. Res. 14, 1734- 10T1/2 and 3T3 cells treated with 5-azacytidine. Cell 17, 771-779. 1741.