Identification and Molecular Characterization of Castellaniella Ginsengisoli Isolated from Sugarcane-Wheat Cropping System
Total Page：16
File Type：pdf, Size：1020Kb
Int.J.Curr.Microbiol.App.Sci (2017) 6(10): 3509-3515 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 10 (2017) pp. 3509-3515 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.610.414 Identification and Molecular Characterization of Castellaniella ginsengisoli Isolated from Sugarcane-Wheat Cropping System Priyanka Chandra1 and Amaresh Chandra2* 1ICAR - Central Soil Salinity Research Institute, Karnal, Haryana, India 2ICAR - Indian Institute of Sugarcane Research, Lucknow, U.P., India *Corresponding author ABST RACT K e yw or ds An increasing int erest has emerged with respect to the importance of microbial diversity in Microbial diversity, soil habitats. The extent of the diversity of microorganisms in soil is seen to be critical to the maintenance of soil health and quality, as a wide range of microorganisms is involved 16SrRNA gene sequencing, in important soil functions. Most soil microorganisms are still unknown. A Gram- Phylogenetic analysis negative, rod-shaped, non-spore-forming bacterium, designated as strain P2, was isolated ,Castellaniella from the soil of the wheat ratooning field of ICAR-Indian Institute of Sugarcane Research, ginsengisoli . Lucknow, 16S rRNA gene sequence analysis showed that the isolate was closely related to Article Info species of the genus Castellaniella. Castellaniella ginsengisoli DCY36 was shown to be the most closely related (99% 16S rRNA gene sequence similarity), followed by Accepted: Castellaniella ginsengisoli strain MN ZOO (99%). Castellaniella ginsengisoli, RNA 28 September 2017 Available Online: secondary structure prediction was also been performed by RNA Vienna RNA Web Services. 10 October 2017 Introduction Soils typically contain 109 to its importance in nutrient cycling, and 1010 microorganisms per gram (dry weight), consequently in crop productivity. Soil which may represent more than a million bacteria and, in particular, rhizosphere bacterial species. However, characterization bacteria play an important role in many of the small fraction of microbes that has been processes, such as decomposition, cultivated provides only a glimpse of their mineralization, biological nitrogen fixation, potential physiological capacity and influence and denitrification. In addition, some bacteria on soil ecosystems. Soil is considered to be associate with plants and promote growth, the the richest environment, with a high diversity so-called plant growth-promoting bacteria of microorganisms belonging to the three (Singh et al., 2004). In the course of screening domains of life, Bacteria, Archaea and micro-organisms obtained from the soil of Eukarya. This diversity is extreme at the sugarcane-wheat cropping system, a Gram- species level, with approximately 50,000 negative strain, P2, was isolated. The bacterial species found in one soil sample. following study was carried out for the Investigation of bacterial diversity is an identification of the bacteria by 16s RNA important step to assess soil conditions due to techniques. 3509 Int.J.Curr.Microbiol.App.Sci (2017) 6(10): 3509-3515 Materials and Methods 1510R: 5′́-GGCTACCTTGTTACGA-3′́) in a reaction mixture (25 μl). The amplification The soil samples used for isolation of bacteria program for the full-length 16S rRNA gene was collected from the root-free soil of consisted of an initial denaturion at 94 °C for rhizosphere from after wheat ratooning field 2 min, followed by 30 cycles of denaturation of ICAR-Indian Institute of Sugarcane at 94 °C for 2 min, primer annealing at 55 °C Research, Lucknow. The sample of each for 1 min and primer extension at 72 °C for 2 varietal rhizosphere soil was mixed min, followed by a final extension at 72 °C thoroughly to make a composite soil. 10g of for 10 min, in a thermocycler. Amplified PCR dry and highly pulvirised soil sample is products of the 16S ribosomal gene were suspended in 90 ml of sterile distilled water separated on 1 % agarose gel in 0.5× TE considered as a stock solution then (Tris-EDTA) buffer containing 2 μl ethidium transferring 1ml of soil suspension into 9 ml bromide (20 mg/ml) (Chandra and Chandra, sterile distilled water with the help of a sterile 2016). The purified PCR product samples pipette to yield 10 dilution. Similarly, a series were sent for sequencing using universal 16S up 1 to 10 dilution was prepared under aseptic rRNA sequencing primers. condition. Bacteria are isolated by employing serial dilution plate technique using nutrient The sequence results were obtained from a agar. Then 0.1 ml soil suspension is BLAST search, and the sequences of all the introduced into sterilized nutrient agar media related species were retrieved to determine in Petri dishes and spread it thoroughly on the the exact nomenclature of the isolates. The media incubated at 37°C for 24-48 hours and tree is created using Weighbor with alphabet for each dilution the plates are taken in size 4 and length size 1000. triplicates. After incubation period, visual morphological characterization of the Results and Discussion bacterial colonies isolated on the agar petri plates is observed on the basis of colour, The ribosomal operons mainly 16S rRNA has shape, size, elevation etc. of the bacterial proven to be a stable and specific molecular colonies. Colonies exhibiting prolific growth marker for the identification of bacteria. The are selected for further streaking on fresh agar copy number of 16S rDNA genes may plates for purification and multiplication of fluctuate from 1 to 15 among different the isolates is done by streak plate methods. bacterial genomes. The 16S rDNA is present in scattered form in the entire genome of The isolate was grown on nutrient agar plates bacteria. These ribosomal sequences are at 37oC for 24-48 h and was maintained on useful for the phylogenetic analysis and nutrient agar slants and stored at 4°C as well molecular taxonomy of bacteria. The 16S as at -80°C by making their suspensions in rDNA is a common target for the taxonomical 10% (v/v) glycerol. purpose, mainly due to the mosaic composition of phylogenetically conserved Identification of bacterial strain was done and variable region within the gene (Pontes et using 16SrRNA gene sequencing. The DNA al., 2007). The aligned sequence data of template was prepared by picking an isolate was 1382bp. 16S rRNA gene individual colony of bacterial strain , and sequences were compared with the available amplification of the 16S rRNA gene was sequences in the databank with help of carried out by the PCR . PCR amplification of BLAST homology search and the isolate was DNA was performed using universal primers found to be Castellaniella ginsengisoli (9F: 5′́-GAGTTTGATCCTGGC TCAG -3′; (Figure 1). Homology tree based on sequence 3510 Int.J.Curr.Microbiol.App.Sci (2017) 6(10): 3509-3515 alignment of 16S rDNA of bacterial isolates CGGCCGATATCGGATTAGCTAGTTGGT permitted rapid phylogenetic analysis. GGGGTAAAGGCCTACCAAGGCAACGA However, strains isolated from different geo- TCCGTAGCTGGTTTGAGAGGACGACCA graphic location shared similar DNA GCCACACTGGGACTGGACACGGCCCA homology. Phylogenetic analysis on the basis GACTCCTACGGGAGGCAGCAGTGGGG of 16S rDNA sequences provided better AATTTTGGACAATGGGGGCAACCCTGA understanding in evaluation of genetic TCCAGCCATCCCGCGTGTGCGATGAAG diversity of bacteria isolated from same and GCCTTCGGGTTGTAAAGCACTTTTGGC different ecological niche; phylogenetic AGGGAAGAAACAGCCCGGGCTAATAT analysis of 500 bp of terminal region of 16S CCCGGGTCAATGACGGTACCTGCAGA rDNA from cultivated strain has been found ATAAGCACCGGCTAACTACGTGCCAGC to show existence of large bacterial diversity. AGCCGCGGTAATACGTAGGGTGCAAG A phylogenetic tree or evolutionary tree is a CGTTAATCGGAATTACTGGGCGTAAAG branching diagram or tree showing the CGTGCGCAGGCGGTTCGGAAAGAAAG inferred evolutionary relationships among GTGTGAAATCCCAGGGCTTAACCTTGG various biological species or other entities AACTGCACTTTTAACTACCGGGCTAGA based upon similarities and differences in GTACGTCAGAGGGGGGTAGAATTCCA their physical and/or genetic characteristics. CGTGTAGCAGTGAAATGCGTAGAGAT The taxa joined together in the tree are GTGGAGGAATACCGATGGCGAAGGCA implied to have descended from a common GCCCCCTGGGATGATACTGACGCTCAT ancestor. Unrooted trees illustrate the GCACGAAAGCGTGGGGAGCAAACAGG relatedness of the leaf nodes without making ATTAGATACCCTGGTAGTCCACGCCCT assumptions about ancestry at all. In the case AAACGATGTCAACTAGCTGTTGGGGTT of unrooted trees, branching relationships TATTAACCTTAGTAGCGCAGCTAACGC between taxa are specified by the way they GTGAAGTTGACCGCCTGGGGAGTACG are connected to each other, but the position GCGCAAGATTAAAACTCAAAGGAATT of the common ancestor is not (Mooers GACGGGGACCCGCACAAGCGGTGGAT and Heard, 2004). The Microbe was found to GATGTGGATTAATTCGATGCAACGCGA be most similar Castellaniella ginsengisoli AAAACCTTACCTACCCTTGACATGTCT strain DCY36 16S ribosomal RNA gene, GGAATCCTTTAGAGATAGAGGAGTGCT partial sequence Sequence ID: CGCAAGAGAACCGGAACACAGGTGCT ref|NR_116482.1 and the next closest GCATGGCTGTCGTCAGCTCGTGTCGTG homologue was found to be Castellaniella AGATGTTGGGTTAAGTCCCGCAACGAG ginsengisoli strain MNzoo 16S ribosomal CGCAACCCTTGCCATTAGTTGCTACAT RNA gene, complete sequence Sequence ID: TCAGTTGGGCACTCTAATGGGACTGCC gb|KM275476.1 (Table 1). The sequences of GGTGACAAACCGGAGGAAGGTGGGGA strain were submitted to NCBI Gene Bank TGACGTCAAGTCCTCATGGCCCTTATG database under accession numbers GGTAGGGCTTCACACGTCATACAATGG KY606683. The sequence is as follows: TCGGGACAGAGGGTTGCCAAACCGCG AGGTGGAGCCAATCTCAGAAACCCGA