Development of a PCR-Based Method for Monitoring the Status of Alcaligenes Species in the Agricultural Environment

Biocontrol Science, 2014, Vol. 19, No. 1, 23－31 Original Development of a PCR-Based Method for Monitoring the Status of Alcaligenes Species in the Agricultural Environment MIYO NAKANO1, MASUMI NIWA2, AND NORIHIRO NISHIMURA1＊ 1 Department of Translational Medical Science and Molecular and Cellular Pharmacology, Pharmacogenomics, and Pharmacoinformatics, Mie University Graduate School of Medicine, Mie University, 2-174 Edobashi, Tsu, Mie 514-8507, Japan 2 DESIGNER FOODS. Co., Ltd. NALIC207, Chikusa 2-22-8, Chikusa-ku, Nagoya, Aichi 464-0858, Japan Received 1 April, 2013/Accepted 14 September, 2013 To analyze the status of the genus Alcaligenes in the agricultural environment, we developed a PCR method for detection of these species from vegetables and farming soil. The selected PCR primers amplified a 107-bp fragment of the 16S rRNA gene in a specific PCR assay with a detection limit of 1.06 pg of pure culture DNA, corresponding to DNA extracted from approxi- mately 23 cells of Alcaligenes faecalis. Meanwhile, PCR primers generated a detectable amount of the amplicon from 2.2×102 CFU/ml cell suspensions from the soil. Analysis of vegetable phylloepiphytic and farming soil microbes showed that bacterial species belonging to the genus Alcaligenes were present in the range from 0.9×100 CFU per gram（ or cm2）（ Japanese radish: Raphanus sativus var. longipinnatus） to more than 1.1×104 CFU/g（ broccoli flowers: Brassica oleracea var. italic）, while 2.4×102 to 4.4×103 CFU/g were detected from all soil samples. These results indicated that Alcaligenes species are present in the phytosphere at levels 10–1000 times lower than those in soil. Our approach may be useful for tracking or quantifying species of the genus Alcaligenes in the agricultural environment. Key words ： 16S rRNA PCR method / Alcaligenes species / Soil bacteria / Plant phylloepiphytic bacteria / Specific primer. INTRODUCTION the immune homeostasis in the gut（ Ivanov et al., 2009, Gaboriau-Routhiau et al., 2009）. A recent study Humans and other animals play host to highly revealed some indigenous opportunistic bacteria, complex ecosystems of microbes on their skin and including Alcaligenes sp., that inhabit host Peyer’s mucosal surfaces. The intestine is frequently exposed patches（ PPs）. These bacteria are associated with to a large number of diverse environmental antigens, isolated lymphoid follicles, which are associated with including bacteria and food products. As a result, the preferential induction of antigen-specific mucosal indigenous bacteria create appropriate homeostatic IgA antibodies in the gastrointestinal（ GI） tract. In conditions for physiologic processes, such as vitamin K addition, the commensal microbiota inhabiting PPs production and the metabolism of dietary carbohydrates c o n t r i b u t e t o e s t a b l i s h i n g a n d m a i n t a i n i n g and polysaccharides（ Flint et al., 2008）. In addition, the immunological homeostasis in the host（ Obata et al., indigenous microbiota promote the immune function of 2010）. Another study has revealed that commensal intestinal epithelial cells（ Vaishnava et al., 2008）. bacteria in the lumen together with intestinal IgA create Segmented filamentous bacteria such as Clostridium natural cohabitation niches in the GI tract（ Macpherson species and Bacteroides fragilis are key contributors to et al., 2005）. Alcaligenes sp. are commonly found in soil, water, ＊Corresponding author. Tel: +81-59-231-5349, Fax: +81-59- and wastewater treatment plants, though their method 231-5405, E-mail : n-nishim（a）doc.medic.mie-u.ac.jp of adaptation and colonization of the phyllosphere, 24 M. NAKANO ET AL. rhizosphere, and soil microbial communities of from vegetable phylloepiphytic and agricultural soil cultivated plants remains unclear. It is also unknown microbes were performed. why Alcaligenes exclusively inhabit PPs. A study by Obata et al.（ 2010） determined that Alcaligenes sp. MATERIALS AND METHODS can change their morphology from rod- to coccoid- form. Physiological change by Alcaligenes sp. is a Bacterial strains prerequisite for effective transfer into PPs and the A total of 19 strains from 18 bacterial species were establishment of intra-tissue cohabitation. It has been used in this study, including two A. faecalis strains, hypothesized that opportunistic Alcaligenes bacteria are Alcaligenes-related taxa, and other unrelated bacteria introduced into their human and animal hosts via （Table 2）. The bacterial strains were routinely cultured ingestion of fruits and vegetables. at 25 or 30℃ in Luria-Bertan（i LB） broth supplemented To our knowledge there are no experimental with MgSO4·7H2O（ 1 g/L）. approaches using the conventional PCR method for the Specific primer design for the genus Alcaligenes detection of Alcaligenes species from agricultural The 16S rRNA gene of A. faecalis subsp. faecalis environments. We aimed to develop a PCR method for NBRC 13111T was chosen as the target for primer detecting and quantifying species of the genus design. 16S rRNA gene sequences of 30 species Alcaligenes from environmental samples such as belonging to the genus Alcaligenes, 21 species vegetables and farming soil. Our first step was to belonging to Achromobacter, 43 species belonging to perform an extensive comparison of the 16S rRNA gene Bulkholderia, 15 species belonging to Bordetella, four sequences from Alcaligenes species, related taxa species belonging to Comamonas, and seven species including Achromobacter, Bordetella, Comamonas, belonging to the genus Ochrobactrum, along with other Bulkholderia, and Ochrobactrum, as well as sequences bacterial sequences, were obtained from the GenBank from other unrelated species. The family Alcaligenaceae nucleotide database at the National Center for encompasses the genera Alcaligenes, Achromobacter, Biotechnology Information（ http://www.ncbi.nlm.nih. and Bordetella. The genera Comamonas and gov/genbank/）, and NITE Biological Resource Center Bulkholderia belong to the families Comamonadaceae （http://www.nbrc.nite.go.jp/e/）. The sequence and Burkholderiaceae, respectively. All these genera are alignment analysis was performed using ClustalX classified as Betaproteobacteria. （Thompson et al., 1997）. Based on the alignment, four PCR primers were designed based on A. faecalis 16S primer pairs were selected using Primer3Plus rRNA sequences. The genus specificity of the primers （Untergasser et al., 2007）. Two primer pairs were was confirmed by testing two A. faecalis strains, eleven designed manually to target specific regions for Alcaligenes-related taxa, and six unrelated species. The Alcaligenes sp. Primer sequences are listed in Table 1. detection limit of the selected primers was also tested Primer positions on the A. faecalis 16S rRNA sequence against serially diluted A. faecalis cell suspension（ 2.2 are given in the footnote of Table 1. ×106 – 2.2×100 CFU/ml） added to A. faecalis-free soil PCR amplification samples prior to DNA extraction from soil microbes. The DNA was extracted using the G-NOME kit（ BIO 101, direct detection and quantification of Alcaligenes La Jolla, CA, USA）, following the manufacturer’s species in vegetables and farming soil was performed instructions. Genomic DNA concentrations were based on the results of this experiment. Finally, equivalent to the pure culture cell suspensions（ ~108 detection and quantification of PCR analysis in samples CFU/mL）. PCR amplifications were carried out using TABLE 1. DNA sequence of primers used for PCR assay Positions in Positions in Forward primer Annealing Reverse primer Annealing the Alcaligenes the Alcaligenes temperature temperature faecalis 16S faecalis 16S Pair name Name Sequence（ 5'-3'）＊3 （℃） Name Sequence（ 5'-3'）＊3 （℃） rRNA gene rRNA gene 77f-r＊1 1f GGCGGACGGGTGAGTAATA 77-95 60 1r AGTGAGAGGTCTTGCGATCC 176-195 62 368f-r＊1 2f CCATCCCGCGTGTATGAT 368-385 56 2r CTGCAGATACCGTCAGCAGT 448-467 62 809f-r＊1 3f GGGCCGTTAGGCCTTAGTAG 809-828 64 3r CAAATCTCTTCGGCTTTCCA 973-992 58 182f-r＊2 4f CAAGACCTCTCACTATTGGAGC 182-203 66 4r GTTCCGGTTCTCTTGCGAGC 998-1017 60 448f-r＊2 5f ACTGCTGACGGTATCTGCAG 448-467 62 5r TACTAAGGCCTAACGGCCCC 808-827 64 ＊1 Primer design was carried out using Primer 3plus（ http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi）. ＊2 Primer design was performed manually. ＊3 Primer positions in the nucleotide sequence of the 16S rRNA gene of Alcaligenes faecalis strain NBRC 13111T. TABLE 2. PCR test of designed primers using representative strains Primer combination Amplicon size bp Species Strain and source＊1 1f-1r 1f-2r 1f-3r 1f-4r 1f-5r 2f-2r 2f-3r 2f-4r 3f-3r 3f-4r 4f-2r 4f-3r 4f-4r 4f-5r 5f-5r 6f-6r 119 391 916 941 751 100 625 650 184 209 286 811 836 646 380 107 Alcaligenes spp. Alcaligenes faecalis NBRC 13111T ＋＋＋＋＋＋＋＋＋＋＋＋＋＋＋＋ subsp. faecalis （ATCC 8750） NBRC 14479 Alcaligenes faecalis ＋＋＋＋＋＋＋＋＋＋＋＋＋＋＋＋ P （ATCC 49677） C R Related taxa T M NBRC 15125 E Achromobacter denitrificans ＋－＋＋－－－＋－－＋＋＋－－－ T （ATCC 15173） H NBRC 15126T O Achromobacter xylosoxidans ＋－＋＋－－－＋－－＋＋－－－－ D （ATCC 27061） F NBRC 13691T O Bordetella bronchiseptica ＋－＋＋－－－＋－－－－－－－－ R （ATCC 19395） D T NBRC 107857 E Bordetella pertussis ＋－－＋－－＋－－－＋－－－－－ T （ATCC 9797） E T C NBRC 12685 T Comamonas terrigena ＋－－－－－－－－－－－－－－－ I （ATCC 8461） O T N NBRC 14918 Comamonas aquatica －－－－－－－－－－－－－－－－ A （ATCC 11330） N T D NBRC 106338 Bulkholderia mimosarum ＋－－－－－－－－－－＋－－－－ Q （DSM 21841） U T A NBRC 104884 N Bulkholderia plantarii ＋－－－－－－

Load more