Development of a PCR-Based Method for Monitoring the Status of Alcaligenes Species in the Agricultural Environment

Home , Achromobacter piechaudii, Achromobacter ruhlandii, Achromobacter spanius, Advenella, Alcaligenes, Alcaligenes defragrans

Biocontrol Science, 2014, Vol. 19, No. 1, 23－31

Original Development of a PCR-Based Method for Monitoring the Status of Alcaligenes Species in the Agricultural Environment

MIYO NAKANO1, MASUMI NIWA2, AND NORIHIRO NISHIMURA1＊

1 Department of Translational Medical Science and Molecular and Cellular Pharmacology, Pharmacogenomics, and Pharmacoinformatics, Mie University Graduate School of Medicine, Mie University, 2-174 Edobashi, Tsu, Mie 514-8507, Japan 2 DESIGNER FOODS. Co., Ltd. NALIC207, Chikusa 2-22-8, Chikusa-ku, Nagoya, Aichi 464-0858, Japan

Received 1 April, 2013/Accepted 14 September, 2013

To analyze the status of the genus Alcaligenes in the agricultural environment, we developed a PCR method for detection of these species from vegetables and farming soil. The selected PCR primers amplified a 107-bp fragment of the 16S rRNA gene in a specific PCR assay with a detection limit of 1.06 pg of pure culture DNA, corresponding to DNA extracted from approximately 23 cells of Alcaligenes faecalis. Meanwhile, PCR primers generated a detectable amount of the amplicon from 2.2×102 CFU/ml cell suspensions from the soil. Analysis of vegetable phylloepiphytic and farming soil microbes showed that bacterial species belonging to the genus Alcaligenes were present in the range from 0.9×100 CFU per gram（ or cm2）（ Japanese radish: Raphanus sativus var. longipinnatus） to more than 1.1×104 CFU/g（ broccoli flowers: Brassica oleracea var. italic）, while 2.4×102 to 4.4×103 CFU/g were detected from all soil samples. These results indicated that Alcaligenes species are present in the phytosphere at levels 10–1000 times lower than those in soil. Our approach may be useful for tracking or quantifying species of the genus Alcaligenes in the agricultural environment.

Key words ： 16S rRNA PCR method / Alcaligenes species / Soil bacteria / Plant phylloepiphytic bacteria / Speciﬁc primer.

INTRODUCTION the immune homeostasis in the gut（ Ivanov et al., 2009, Gaboriau-Routhiau et al., 2009）. A recent study Humans and other animals play host to highly revealed some indigenous opportunistic bacteria, complex ecosystems of microbes on their skin and including Alcaligenes sp., that inhabit host Peyer’s mucosal surfaces. The intestine is frequently exposed patches（ PPs）. These bacteria are associated with to a large number of diverse environmental antigens, isolated lymphoid follicles, which are associated with including bacteria and food products. As a result, the preferential induction of antigen-specific mucosal indigenous bacteria create appropriate homeostatic IgA antibodies in the gastrointestinal（ GI） tract. In conditions for physiologic processes, such as vitamin K addition, the commensal microbiota inhabiting PPs production and the metabolism of dietary carbohydrates c o n t r i b u t e t o e s t a b l i s h i n g a n d m a i n t a i n i n g and polysaccharides（ Flint et al., 2008）. In addition, the immunological homeostasis in the host（ Obata et al., indigenous microbiota promote the immune function of 2010）. Another study has revealed that commensal intestinal epithelial cells（ Vaishnava et al., 2008）. bacteria in the lumen together with intestinal IgA create Segmented filamentous bacteria such as Clostridium natural cohabitation niches in the GI tract（ Macpherson species and Bacteroides fragilis are key contributors to et al., 2005）. Alcaligenes sp. are commonly found in soil, water, ＊Corresponding author. Tel: +81-59-231-5349, Fax: +81-59- and wastewater treatment plants, though their method 231-5405, E-mail : n-nishim（a）doc.medic.mie-u.ac.jp of adaptation and colonization of the phyllosphere, 24 M. NAKANO ET AL. rhizosphere, and soil microbial communities of from vegetable phylloepiphytic and agricultural soil cultivated plants remains unclear. It is also unknown microbes were performed. why Alcaligenes exclusively inhabit PPs. A study by Obata et al.（ 2010） determined that Alcaligenes sp. MATERIALS AND METHODS can change their morphology from rod- to coccoid- form. Physiological change by Alcaligenes sp. is a Bacterial strains prerequisite for effective transfer into PPs and the A total of 19 strains from 18 bacterial species were establishment of intra-tissue cohabitation. It has been used in this study, including two A. faecalis strains, hypothesized that opportunistic Alcaligenes bacteria are Alcaligenes-related taxa, and other unrelated bacteria introduced into their human and animal hosts via （Table 2）. The bacterial strains were routinely cultured ingestion of fruits and vegetables. at 25 or 30℃ in Luria-Bertan（i LB） broth supplemented

To our knowledge there are no experimental with MgSO4·7H2O（ 1 g/L）. approaches using the conventional PCR method for the Specific primer design for the genus Alcaligenes detection of Alcaligenes species from agricultural The 16S rRNA gene of A. faecalis subsp. faecalis environments. We aimed to develop a PCR method for NBRC 13111T was chosen as the target for primer detecting and quantifying species of the genus design. 16S rRNA gene sequences of 30 species Alcaligenes from environmental samples such as belonging to the genus Alcaligenes, 21 species vegetables and farming soil. Our first step was to belonging to Achromobacter, 43 species belonging to perform an extensive comparison of the 16S rRNA gene Bulkholderia, 15 species belonging to Bordetella, four sequences from Alcaligenes species, related taxa species belonging to Comamonas, and seven species including Achromobacter, Bordetella, Comamonas, belonging to the genus Ochrobactrum, along with other Bulkholderia, and Ochrobactrum, as well as sequences bacterial sequences, were obtained from the GenBank from other unrelated species. The family Alcaligenaceae nucleotide database at the National Center for encompasses the genera Alcaligenes, Achromobacter, Biotechnology Information（ http://www.ncbi.nlm.nih. and Bordetella. The genera Comamonas and gov/genbank/）, and NITE Biological Resource Center Bulkholderia belong to the families Comamonadaceae （http://www.nbrc.nite.go.jp/e/）. The sequence and Burkholderiaceae, respectively. All these genera are alignment analysis was performed using ClustalX classified as Betaproteobacteria. （Thompson et al., 1997）. Based on the alignment, four PCR primers were designed based on A. faecalis 16S primer pairs were selected using Primer3Plus rRNA sequences. The genus specificity of the primers （Untergasser et al., 2007）. Two primer pairs were was confirmed by testing two A. faecalis strains, eleven designed manually to target specific regions for Alcaligenes-related taxa, and six unrelated species. The Alcaligenes sp. Primer sequences are listed in Table 1. detection limit of the selected primers was also tested Primer positions on the A. faecalis 16S rRNA sequence against serially diluted A. faecalis cell suspension（ 2.2 are given in the footnote of Table 1. ×106 – 2.2×100 CFU/ml） added to A. faecalis-free soil PCR amplification samples prior to DNA extraction from soil microbes. The DNA was extracted using the G-NOME kit（ BIO 101, direct detection and quantification of Alcaligenes La Jolla, CA, USA）, following the manufacturer’s species in vegetables and farming soil was performed instructions. Genomic DNA concentrations were based on the results of this experiment. Finally, equivalent to the pure culture cell suspensions（ ~108 detection and quantification of PCR analysis in samples CFU/mL）. PCR amplifications were carried out using

TABLE 1. DNA sequence of primers used for PCR assay Positions in Positions in Forward primer Annealing Reverse primer Annealing the Alcaligenes the Alcaligenes temperature temperature faecalis 16S faecalis 16S Pair name Name Sequence（ 5'-3'）＊3 （℃） Name Sequence（ 5'-3'）＊3 （℃） rRNA gene rRNA gene 77f-r＊1 1f GGCGGACGGGTGAGTAATA 77-95 60 1r AGTGAGAGGTCTTGCGATCC 176-195 62 368f-r＊1 2f CCATCCCGCGTGTATGAT 368-385 56 2r CTGCAGATACCGTCAGCAGT 448-467 62 809f-r＊1 3f GGGCCGTTAGGCCTTAGTAG 809-828 64 3r CAAATCTCTTCGGCTTTCCA 973-992 58 182f-r＊2 4f CAAGACCTCTCACTATTGGAGC 182-203 66 4r GTTCCGGTTCTCTTGCGAGC 998-1017 60 448f-r＊2 5f ACTGCTGACGGTATCTGCAG 448-467 62 5r TACTAAGGCCTAACGGCCCC 808-827 64 ＊1 Primer design was carried out using Primer 3plus（ http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi）. ＊2 Primer design was performed manually. ＊3 Primer positions in the nucleotide sequence of the 16S rRNA gene of Alcaligenes faecalis strain NBRC 13111T. PCR METHOD FOR DETECTION AND QUANTIFICATION OF ALCALIGENES SPECIES 25

. n a - ＋＋－－－－－－－－－－－－－－－－－ 1 0 7 6 f - r a l t e r a n G e r m a n y ）＋＋－－－－－－－－－－－－－－－－－ 3 8 0 5 f - r i n o d u c t s . + a n ＋＋－－－－－－－－－－－－－－－－－ 6 4 4 f - 5 r n u m b e r ＋＋＋－－－－－－－－－－－－－－－－ 8 3 6 e n c 4 f - r （ B r a u n s c h w e i g , e s e f r r ＋＋＋－－－－＋－－－－－－－＋－－－ 8 1 4 f - 3 r C u l t r ＋＋＋－＋－－－－＋＋－－－＋＋－－－ C e l 2 8 6 4 f - 2 r e s p o n d i g a n d c o r ＋－－－－－－－－－－－－－－＋－－－ e s n t h a m p l i c o z f P C R r 2 0 9 3 f - 4 r t h e e p r ＋－－－－－－－－－－－－－－＋－－－ e s r 1 8 4 3 f - r o r g a n i s m i n d c a t e ＋＋＋＋－－－－－－－－－－－＋－－－ M i c r 6 5 0 2 f - 4 r o f A m p l i c o n s z e b P r i m e c o b n a t e n t h s ＋－－－＋－－－－－－－－－－＋－－－ 6 2 5 2 f - 3 r p a r i n C o l e c t i n ＋－－－－－－－－－－－－－－＋－－－ 1 0 a b l e 1 . T h o w r ﬁ g u 2 f - r e n c s ＋－－－－－－－－－－－－－－＋－－－ 7 5 1 G e r m a n 1 f - 5 r e f r r ＋＋＋＋＋－－－－－－－－－－＋－－－ D S M , 9 4 1 1 f - 4 r , s t r a i n ; e v r s p i m n T t y p e U S A ）＋＋＋＋－－－－－－－－－－－＋－－－ 9 1 6 , 1 f - 3 r T A . ; V d a n r ＋－－－－－－－－－－－－－－＋－－－ 3 9 1 1 f - 2 r J a p n ）＋＋＋＋＋＋－＋＋－－－－－－＋－－－ 1 9 1 f - r （ M a n s , C h i b a , ＊ 1 T T T T T T c e e s n t a i v r T T T T T T T T T e p r o d u c t s . C o l e c t i n e e s p o n d i g t h f r w a （ K i s a r z u , T C 8 7 5 0 ） T C 1 5 7 3 ） T C 2 7 0 6 1 ） T C 1 9 3 5 ） T C 9 7 ） T C 8 4 6 1 ） T C 1 3 0 ） T C 4 3 7 ） T C 4 9 1 8 ） T C 2 5 9 3 ） T C 1 4 6 0 ） T C 4 9 6 7 ） C u l t r N B R C 1 5 2 N B R C 1 0 6 3 8 N B R C 1 4 7 9 N B R C 1 5 2 6 N B R C 1 3 6 9 N B R C 1 0 7 8 5 N B R C 1 2 6 8 5 N B R C 1 4 9 8 N B R C 1 0 4 8 N B R C 1 5 8 9 N B R C 1 0 2 5 8 N B R C 1 0 2 4 6 5 N B R C 3 0 1 N B R C 1 3 2 7 6 N B R C 1 3 5 7 H e t 2 1 N B R C 1 3 7 9 N B R C 1 0 6 8 N B R C 1 3 C e n t r S t r a i n d s o u （ A （ A （ A （ A （ A （ A （ A （ D S M 2 1 8 4 ）（ A （ A （ D S M 1 7 4 ）（ A （ A （ A y p e c e T R e s o u r o p i e u s A m e r i c a n e s n t p r i m a c o C , e p r T C o n c h i s e p t a e s n c a d b o f P C R p r B i o l g c a A i a m o s r u S p e c i s N I T E o c u s a i n o b a c t r u m n h o b a c t r u m y z e o m b a c t e r d n i ﬁ s o m b a c t e r x y l s i d n d e t l a b r d e t l a p r u s i c o l e t i n , N B R C , A B L E 2 . P C R t e s o f d i g n p r m u R e l a t d x A c h r A l c a i g e n s f A c h r B o r B o r C o m a n s t e r i g C o m a n s q u t i c B u l k h o d e r B u l k h o d e r i a p n t O c h r O c h r D u g a n e l z o i d s O t h e r b a c i E s c h e r i a o l S t a p h y l o c u s r S e r a t i g m s P s e u d o m n a p . w i l t y B a c i l u s b t p . E n t e r A l c a i g e n s p . A l c a i g e n s f s u b p . f a e c l i T h e u p r a i s - i n d c a t e h p r t i v e T ＊ 1 26 M. NAKANO ET AL.

EmeraldAmp PCR Master Mix（ Takara Bio Inc, Otsu, Preparation of samples and DNA extraction Japan）. Specific primers and template DNA were Samples of tomato（ Solanum lycopersicum）, added to each reaction. Reactions were carried out in cabbage（ Brassica oleracea var. capitata）, broccoli an iCycler Thermal Cycler（ Bio-Rad, Hercules, CA, （Brassica oleracea var. italic）, and Japanese radish USA）. Thermal cycler conditions were as follows: 95℃ （Raphanus sativus var. longipinnatus） were taken and for 4 min, 30–38 cycles of 95℃ for 30 s, 56–66℃ for then transported at 4℃. Soil samples（ 0–20 cm depth） 30 s, 72℃ for 1.5 min, followed by 72℃ for 7 min. were collected simultaneously from each plant field. The Amplification products were separated on 1%（ w/v） four plant samples were immediately washed with agarose gels and stained with ethidium bromide. sterile water to remove soil particles and dried using Specificity test of the primers paper towels. The Japanese radishes were separated To assess the genus specificity of the PCR primers in into the root portions and leaves, while the broccoli was Table 1, different combinations of forward and reverse separated into stems and flowers. We used 74.2 g of primers were examined. The genus specificity was tomato and 42.2 g of cabbage leaves. Flowers were evaluated using DNA extracted from pure cultures separated from the stems of broccoli A and broccoli B, （25–50 pg） of all the strains presented in Table 2. resulting in 69.4 g and 69.0g of flowers respectively. We Among the eight genus-specific primer pairs（ 1f-2r, used roots from samples of Japanese radish A（ 616.9 1f-5r, 2f-2r, 3f-3r, 3f-4r, 4f-5r, 5f-5r, 6f-6r）, the primer g, 10 cm below knot, approx. 277.9 cm2 surface area） pair 6f-6r was selected and further analyzed for and B（ 803.3 g, 20 cm below knot, approx. 339.1 cm2 sensitivity. surface area）, and 21.3 g of leaves from sample C in Sensitivity test of the primers our analyses. Individual samples were transferred into The sensitivity of the specific PCR amplification sterilized polyethylene bags（ 190×300 mm） and system for the detection of Alcaligenes sp. was submerged in sterilized PBS washing buffer（ phosphate determined using purified genomic DNA from the buffered saline, pH 7.4）, then sonicated for 4 min at representative A. faecalis NBRC 13111T strain. Genomic 25℃ to dislodge phylloepiphytic bacteria from samples. DNA from A. faecalis was extracted from undiluted cell Microbial pellets were collected from the plant material suspensions, purified, and then quantified. Genomic suspension by centrifugation at 17,800×g for 50 min at DNA concentrations were determined with a Beckman 4℃, then washed with 1×PBS buffer. Microbial DNA DU 650 spectrophotometer（ Beckman Instruments, was extracted using a bead crusher μT-01（ TAITEC, Fullerton, CA, USA）. A 10-fold serial dilution series with Koshigaya, Japan） with the PowerSoil DNA Isolation kit concentrations ranging from 106 ng to 106 fg/μl was （MO BIO Laboratories）, following the manufacturer’s prepared using sterile distilled water. Genomic DNA was instructions. Microbial DNA was also extracted from soil extracted in triplicate from undiluted cell suspension samples（ 0.25 g） using the same kit. Finally, bacterial samples and the DNA concentration was quantified. DNA was eluted in 30μl for vegetable samples and 100 The corresponding CFU of A. faecalis was determined μl for soil samples, respectively. by plating and counting colonies. Cloning and sequencing of PCR product In the next step, a serially diluted A. faecalis cell Amplicons from PCR analyses of soil samples suspension（ 2.2×106 – 2.2×100 CFU/ml） was added （tomato farming soil） were extracted with a QIAEX II to A. faecalis-free soil samples prior to DNA extraction Gel Extraction Kit（ Qiagen, Hilden, Germany）. Purified from soil microbes. Microbial DNA extraction in soil PCR product was ligated into the TOPO TA cloning samples（ 0.04g） was performed in this step. The direct vector（ Invitrogen, Carlsbad, CA, USA）, then detection and quantification of Alcaligenes species in transformed and screened for plasmid insertions vegetables and farming soils was done based on the according to the manufacturer’s instructions. Thirty-four results of this experiment. Quantification of the genus clones were randomly selected and sequenced with Alcaligenes was carried out based on the standard BigDye terminator cycle sequencing method with the curve which analyzed the luminance profiling with M13 forward primer and an ABI PRISM 3730-Avant imaging software NIS Elements ver. 3.2（ Nikon, Tokyo）. Genetic Analyzer（ Applied Biosystems, Foster City, CA, Furthermore, the quantification of species belonging to USA）. the genus Alcaligenes was carried out in the presence of non-target Bacillus subtilis DNA because the RESULTS environmental samples contained diverse bacterial communities. The dilution series（ 106 ng/μl to 106 fg/ Genus specificity of primers μl） of A. faecalis DNA was mixed with 100 ng of The effectiveness of the 16 primer pairs was genomic DNA extracted from B. subtilis prior to PCR examined using two strains of A. faecalis and 17 analysis. non-Alcaligenes reference strains from diverse PCR METHOD FOR DETECTION AND QUANTIFICATION OF ALCALIGENES SPECIES 27

TABLE 3. PCR conditions for the qualitative assay of the genus Alcaligenes Primer pair Thermal cycler program 95℃ for 4 min; 30 cycles of 95℃ for 30 2f-2r sec, 65℃ for 30 sec decreasing 0.2℃ by 1 1f-2r cycle, and 72℃ for 1.5 min; and a 7-min final 1f-5r extension. 95℃ for 4 min; 34 cycles of 95℃ for 30 s, 3f-3r 64℃ for 30 sec, and 72℃ for 1.5 min; and a 3f-4r 7-min final extension. 95℃ for 4 min; 30 cycles of 95℃ for 30 s, 5f-5r 63℃ for 30 sec, and 72℃ for 1.5 min; and a 7-min final extension. FIG. 1. Sensitivity test of 6f-6r primer pair with Alcaligenes 95℃ for 4 min; 30 cycles of 95℃ for 30 faecalis 13111T. A, Lanes 1-7: 10.6 ng, 1.06 ng, 106 pg, 10.6 sec, 63℃ for 30 sec decreasing 0.1℃ by 1 pg, 1.06 pg, 106 fg, 10.6 fg, negative control. B, Genomic 4f-5r cycle, and 72℃ for 1.5 min; and a 7-min final DNA extracted from soils seeded with various amounts of extension. Alcaligenes faecalis 13111T cell suspension. Lanes 9-16: no 6 5 95℃ for 4 min; 30 cycles of 95℃ for 30 s, DNA from Alcaligenes faecalis（ CFU/ml）, 2.2×10 , 2.2×10 , 4 3 2 1 0 6f-6r 60℃ for 30 sec, and 72℃ for 1.5 min; and a 2.2×10 , 2.2×10 , 2.2×10 , 2.2×10 , 2.2×10 . 7-min final extension. Quantification of the genus Alcaligenes was performed based on the standard curve（ y=2.1369e0.065x, R2=0.9861） which analyzed the luminance profiling. C, Lanes 18-24: a serial （） phylogenetic groups Table 2 . Among the 16 primer dilutions of genomic DNA mixed with genomic DNA extracted pairs tested, eight primer pairs（ 1f-2r, 1f-5r, 2f-2r, 3f-3r, from Bacillus subtilis strain. M, 100-bp DNA ladder marker; 3f-4r, 4f-5r, 5f-5r, 6f-6r） yielded a single amplicon lanes 8, 17, and 25 represent negative control. All amplifica- corresponding with the expected size of the A. faecalis tion reactions were run in triplicate. 16S rRNA gene sequence（ data not shown）. These results demonstrated that the primers were able to soil microbes. These results showed the detection limit distinguish Alcaligenes from other phylogenetic groups, of A. faecalis cells was 2.2×102 CFU/ml（ Fig. 1B）. including closely related taxa. Primer pairs 6f-6r and Uninoculated soil did not produce a PCR amplification 1f-2r produced bands with the greatest intensity product, validating the PCR assay for the specific and compared to the other primer pairs. The 1f-5r and 4f-5r sensitive detection of Alcaligenes sp. in the soil primers amplified a secondary weak product in addition samples. Therefore, the direct detection and to the single amplicon of the expected size. Primer pairs quantification of Alcaligenes species in vegetables and 3f-3r and 3f-4r amplified a weak secondary band farming soil was performed based on the results of the slightly larger than the expected product. The 2f-2r and latter experiment. Similar results were obtained when 5f-5r primers produced a relatively weak single band, the serial dilutions of genomic DNA from A. faecalis though the band was visible and distinguishable from were mixed with the genomic DNA of 100 ng extracted the absence of a band for non-Alcaligenes strains. from B. subtilis cells（ Fig. 1C）, which was equivalent to Consequently, the 6f-6r pair showed the best capacity approximately 2×107 CFU/ml, assuming 5 fg of DNA to distinguish the genus Alcaligenes, and 1f-5r, 2f-2r, per cell. The other primer pairs did not allow the 3f-3r, 3f-4r, 4f-5r, and 5f-5r may have limited use for detection of inoculant numbers below an estimated 105 quantification purposes. The most successful programs CFU/ml. and PCR conditions are listed in Table 3. Detection and quantification of the genus Detection limit of Alcaligenes in soil and in Alcaligenes in plant and soil samples non-Alcaligenes genomic DNA using the 6f-6r We used this system to estimate counts of the genus primer pair Alcaligenes in a variety of farming soil and vegetable To estimate the sensitivity of the PCR amplification samples. Positive amplification results were observed system for detection of A. faecalis, several PCR for all farming soil samples, indicating the presence of reactions were performed using varying amounts of the approximately 2.4×10 3 to 4.4×10 3 CFU/g of DNA template. A PCR product was present when 1.06 Alcaligenes species（ Fig. 2）. Positive reactions were pg of A. faecalis genomic DNA was used as a template also observed in four plant flowers and roots. The （Fig. 1A）. In addition, the sensitivity assay was highest intensity of PCR amplification was observed in evaluated using a 10-fold serial dilution of A. faecalis the flowers of broccoli A. The Alcaligenes bacterial load cells（ 2.2×106 – 2.2×100 CFU/ml） added to A. in each sample was estimated as follows（ CFU/g or faecalis-free soil samples prior to DNA extraction from cm2）:＞8.2×100（ Tomato）,＞7.6×100（ Cabbage）, ＞ 28 M. NAKANO ET AL.

marsh sediment, have been described. Among the 16 PCR primer pairs tested, more than half of the primer pairs amplified a product from closely related species Achromobacter spp. and/or Bordetella spp.（ data not shown）. The amplicon was observed as a single DNA band that corresponded to the expected product size. Based on phylogenetic analyses of 16S rDNA sequences, the species Alcaligenes denitrificans, FIG. 2. Detection of Alcaligenes sp. from farming soil and A. xylosoxidans, and A. piechaudii have been plant surfaces by PCR using the 6f-6r primer pair. reclassified, as Achromobacter xylosoxidans subsp. Quantification of Alcaligenes species was performed based denitrificans, Achromobacter xylosoxidans subsp. on the standard curve which was previously determined xylosoxidans, and Achromobacter piechaudii, because shown in Fig. 1 B. A lanes: M, DNA marker; 1, tomato taxonomic confusion arose from the phylogenetic farming soil; 2, cabbage farming soil ; 3, broccoli A farming soil; 4, broccoli B farming soil; 5, Japanese radish farming clustering of species within the family. Meanwhile, A. soil, 6, negative control. B lanes: 7, tomato; 8, cabbage; 9, piechaudii is more closely related to the type species of broccoli B (flowers); 10, Japanese radish A (root); 11, the genus Bordetella than to A. faecalis, the type Japanese radish B (root); 12, Japanese radish C (leaves); 13, species of the genus Alcaligenes（ Yabuuchi et al., negative control. All amplification reactions were run in 1998）. Although the species A. defragrans and A. latus duplicate. were not tested in this experiment, both are considered to be members of the genus, even of the family. 1.1×104（ Broccoli B）,＞4.3×100（ Japanese radish Meanwhile, for novel isolated subspecies A. faecalis A）,＞0.9×10 0（ Japanese radish B）,＞1.5×101 subsp. phenolicus, and species Alcaligenes aquatilis, （Japanese radish C）. Overall, these results indicated 16S rRNA gene sequences were compared with that of that Alcaligenes species were present in the Alcaligenes sp. A. aquatilis was found to show 99.6 % phytosphere, including root surfaces, and in flowers at similarity to A. faecalis subsp. parafaecalis, 98.3 % levels 10–1000 fold lower than levels found in soil similarity to A. faecalis subsp. faecalis, and 96.4 % except for the sample of broccoli B. Interestingly, similarity to A. defragrans（ Van Trappen et al., 2005）. Alcaligenes species were not detected in any of the Consequently the primer pair 6f-6r is suitable for use in vegetable samples purchased from a supermarket the specific detection and quantification of the genus （data not shown）. Sequence analysis of the 34 clones Alcaligenes. Some strains such as DQ001152 and from tomato farming soil showed a 100% sequence JQ045805 recorded as Rhodobacter sphaeroides in the homology with the 107-bp fragment of the 16S rRNA database showed close matching with this primer pair. gene of A. faecalis. Results showed that the primer pair However, because the sequence analysis of these two 6f-6r accurately distinguished Alcaligenes from strains showed close relationship to A. faecalis non-Alcaligenes species in the conventional PCR assay. （1394/1410, 98% identity） and relationship to A. faecalis（ 1339/1443, 92% identity） rather than to any DISCUSSION other species belong to the genus Rhodobacter, it is possible these species belong to the genus Alcaligenes. Species of the genus Alcaligenes are characterized This assay could be of use in studies in microbial as Gram-negative, obligate aerobes, possessing a ecology, bioremediation, and wastewater treatment. In strictly aerobic metabolism with oxygen as the terminal these instances, removal of the humic compounds or electron acceptor. However, some strains are capable other PCR inhibitors from DNA extracts is important of anaerobic respiration in the presence of nitrate or （Tsai and Olsen, 2005）. nitrite. The genus Alcaligenes has undergone several A. latus is considered distinct from all genera within changes since it was first described in 1919, and is now the family Alcaligenaceae, and recent data have shown limited to the species Alcaligenes faecalis（ type strain）, t h a t t h i s o r g a n i s m b e l o n g s t o t h e f a m i l y which has been subdivided into A. faecalis subsp. Comamonadaceae（ Coenye et al., 2003）. This species faecalis and A. faecalis subsp. parafaecalis（ Schroll et is most closely related to Rubrivivax gelatinosus and al., 2001）, Alcaligenes latus（ Palleroni and Palleroni Leptothrix discophora（ Willems et al., 1991）, based on 1978）, and Alcaligenes defragrans（ Foss et al., 1998）. a DNA-rRNA hybridization study. A. defragrans strains Recently, novel subspecies A. faecalis subsp. have been isolated from soil and are capable of using phenolicus（ Rehfuss and Urban 2005）, isolated from a alkenoic monoterpens as sole carbon sources（ Foss et greywater bioprocessor, and novel species Alcaligenes al., 1998）. According to Bergey’s manual, A. defragrans aquatilis（ Van Trappen et al., 2005）, isolated from salt will be reclassified as a member of a new genus within PCR METHOD FOR DETECTION AND QUANTIFICATION OF ALCALIGENES SPECIES 29

this family（ Brenner et al., 2005）. experiment aimed at studying the sensitivity of a 16S The effectiveness of the eight PCR primer pairs rRNA gene PCR method for the detection of P. durus. （1f-2r, 1f-5r, 2f-2r, 3f-3r, 3f-4r, 4f-5r, 5f-5r, 6f-6r） Inoculums exceeding 102 cells or spores per gram of demonstrated that there is enough sequence soil were detected in this PCR assay. The same level of divergence between the genus Alcaligenes and related specificity was obtained by Briglia et al.（ 1996） for genera to assure specific amplification. Among these detection of Mycobacterium chlorophenolicum in soil. primer sets, 5f-2r and 3f-5r are located in nearly the The sensitivity of these assays for environmental same region in the 16S rRNA gene sequence. Both samples may vary due to differences in the diversity in a regions appear to be highly specific for A. faecalis; no natural habitat. Likewise, humic substances sequence displaying any similarities with this region co-extracted with nucleic acids from soil or sediment could be found in other related taxa or unrelated samples may inhibit PCR reactions, which may affect bacteria. Thus, this region is an appropriate target for the detection limit. PCR assays, and may also prove useful for fluorescent Another important approach is to elucidate whether genus-specific oligonucleotide probes for fluorescence Alcaligenes sp. can survive in the sampling sites such in situ hybridization（ FISH） analysis. These seven as the phylloepiphytic and endophytic environment of primer pairs contained either forward primer or reverse vegetables, fruits, soil, and water. FISH and PCR primer, or both. Therefore, the primer set 5f-5r was techniques do not allow discrimination between dead expected to be the most specific primers. and viable cells（ Okoh et al., 2007）. A direct viable The real-time quantitative PCR assay has been used count FISH procedure（ DVC-FISH） has been proposed to quantify bacterial gene or transcript numbers in for monitoring viable microbial cells in different environmental samples. In our previous study we environments（ Baudart et al., 2002, Piqueres et al., developed a quantitative real-time PCR assay for 2006）. This technique may be useful for detecting and specific detection and quantification of the genus tracing viable phylloepiphytic and endophytic microbial Alcaligenes in the agricultural environment（ Nakano et cells in cultivated plants and farming soil. al., 2013）. The primer pair 5f-5r was the suitable primer Our current approach could be useful for tracking or set for a quantitative real-time PCR assay. Meanwhile, quantifying Alcaligenes in ecological studies, e.g. for the selected PCR primers 6f-6r was appropriate for monitoring the populations in various environments conventional PCR assay, 1.06 pg to 10.6 ng of template such as vegetables, fruits, soil, and water. We plan to DNA from pure culture was reliably detected, which is extend the current research by using FISH analysis to equivalent to approximately 2.3×101 to 2.3×105 A. help understand the physiological behavior of faecalis cells. Thus, the minimum detection sensitivity in Alcaligenes sp. within the rhizosphere and phyllosphere the conventional PCR assay was lower than that of that may allow for their adaptation, colonization and results from real-time PCR assay. In addition, the persistence in the environment. Biological insights sensitivity test in soil samples using the 6f-6r primer pair regarding microbe-microbe and plant-microbe showed that cell inoculum densities exceeding 2.2×102 interactions engaged in this process are essential to cells were readily detectable via PCR. In our additional understand the pathway leading to the transfer of preliminary study, the 6f-6r pair was used to assay Alcaligenes sp. to humans and animals. agricultural soil and vegetable bodies to estimate the localization of the genus Alcaligenes. These results ACKNOWLEDGEMENT indicated that Alcaligenes species are present in the We thank Dr. Tanaka（ Marine Microbiology, Faculty of phytosphere at levels 10–1000 times lower than those Bioresources, Mie University） for providing the facilities, in soil. Our approach may be useful for tracking or and giving us invaluable advice. We are grateful as well quantifying species of the genus Alcaligenes in the to Dr. Yuko Kobayashi for providing us with technical agricultural environment. support in cloning and DNA sequencing（ Plant Taken together, the specificity and sensitivity of primer Functional Genomics, Center for Molecular Biology and pair 6f-6r were highly satisfactory for the detection of Genetics, Mie University）. species belonging to the genus Alcaligenes, even in complex environmental materials, indicating their REFERENCES applicability to the identification and traceability assessment of Alcaligenes from agricultural samples. In Baudart, J., Coallier, J., Laurent, P., and Prevost, M.（ 2002）（） Rapid and sensitive enumeration of viable diluted cells of a previous study Rosado et al., 1996 , vegetative cells members of the family Enterobacteriaceae cells in fresh- or spores of Paenibacillus durus were introduced to water and drinking waters. Appl. Environ. Microbiol. 68, Flevo silt loam soil at different concentrations（ 102 – 106 5057-5063. CFU/g dry soil）. This study was a short-term Brenner, D.J., Krieg, N.R., Staley, J.T., Garrity, G.M., Boone, 30 M. NAKANO ET AL.

D.R., Brenner, D.J., De Vos, P., Goodfellow, M., Rainey, a new species of hydrogen-utilizing bacteria. Int. J. Syst. F.A., and Schleifer, K-H.（ 2005） The Proteobacteria Part Bacteriol. 28, 416-424. C The Alpha-, Beta-, Delta-, and Epsilonproteobacteria. Piqueres, P., Moreno, Y., Alonso, J.L., and Ferrus, M.A. Pp647-662. Bergey’s Manual of Systematic Bacteriology （2006） A combination of direct viable count and fluores- 2nd Edition Vol. Two. Springer, USA. cent in situ hybridization for estimating Helicobacter pylori Briglia, M., Eggen, R.I.L., de Vos, W.M., and van Elsas, J.D. cell viability. Res. Microbiol. 157, 345-349. （1996） Rapid and sensitive method for the detection of Rehfuss, M., and Urban, J.（ 2005） Alcaligenes faecalis Mycobacterium chlorophenolicum CPC-1 in soil based on subsp. phenolicus subsp. nov. a phenol-degrading, deni- 16S rRNA gene-targeted polymerase chain reaction. Appl. trifying bacterium isolated from a greywater bioprocessor. Environ. Microbiol. 62, 1478-1480. Syst. Appl. Microbiol. 28, 421-429. Coenye, T., Vancanneyt, M., Cnockaert, M.C., Falsen, E., Rosado, A.S., Selden, D., Wolters, A.C., and van Elsas, J.D. Swings, J., and Vandamme, P.（ 2003） Kerstersia gyiorum （1996） Quantitative 16S rDNA-targeted polymerase chain gen. nov., sp. nov., a novel Alcaligenes faecalis-like reaction and oligonucleotide hybridization for the detection organism isolated human clinical samples, and reclassifi- of Paenibacillus azotofixans in soil and the wheat rhizo- cation of Alcaligenes denitrificans Ruger and Tan 1983 as sphere. FEMS Microbiol. Ecology, 33, 117-121. Achomobacter denitrificans comb. nov. Int. J Syst. Evol. Schroll, G., Busse, H.-J., Parrer, G., Rolleke, S., Lubitz, W., Microbiol. 53, 1825-1831. and Denner, E.B.M.（ 2001） Alcaligenes faecalis subsp. Flint, H.J., Bayer, E.A., Rincon, M.T., Lamed, R. and White, parafaecalis subsp. nov., bacterium accumulating poly- B.A.（ 2008） Polysaccharide utilization by gut bacteria: beta-hydroxybutyrate from acetone-butanol bioprocess potential for new insights from genomic analysis. Nat. Rev. residues. Syst. Appl. Microbiol. 24, 37-43. Microbiol. 6, 121-131. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Foss, S., Heyen, U., and Harder, J.（ 1998） Alcaligenes defra- and Higgins, D.G.（ 1997） The clustal X windows interface: grans sp. nov., description of four strains isolated alkenoic flexible strategies for multiple sequence alignment aided by monoterpens（（+）-menthene,α-pinene, 2-carene, and quality analysis tools. Nucleic Acids Res. 25, 4876-4882. α-phellandrene） and nitrite. Syst. Appl. Microbiol. 21, Tsai, Y., and Olsen, B.H.（ 1991） Rapid method for direct 237-244 extraction of DNA from soil and sediments. Appl. Environ. Gaboriau-Routhiau, V., Rakotobe, S., Lecuyer, E., Mulder, Microbiol. 57, 1070-1074. I., Lan, A., Bridonneau, C., Rochet, V., Pisi, A., De Paspe, Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., M., Brandi, G., Eberl, G., Snel, J., Kelly, D., and Cerf- and Leunissen. J. A.（ 2007）. Primer3Plus, an enhanced Bensussan, N.（ 2009） The key role of segmented filamen- web interface to Primer3. Nucl. Acids Res. 35,（ Web tous bacteria in the coordinated maturation of gut helper T Server issue:W71-W74） cell responses. Immunity. 31, 677-389. Vaishnava, S., Behendt, C.L., Ismail, A.S., Eckmann, L., Ivanov, I.I., Atarashi, K., Manel, N., Brdie, E.L., Shima, T., and Hooper, L.V.（ 2008） Paneth cells directly sense gut Karaoz, U., Wei, D., Goldfarb, K.C., Santee, C.A., Lynch, commernsal and maintain homeostasis at the intestinal S.V., Tanoue, T., Imaoka, A., Otoh, K, Takeda, K., Honda, K., host-microbial interface. Proc. Natl. Acad. Sci. USA. 105, and Littman, D.R.（ 2009） Induction of intestinal Th17 cells 20858-20863. by segmented filamentous bacteria. Cell. 139, 485-498. Van Trappen, S., Tan, T-L., Samyn, E., and Vandamme, P. Macpherson, A.J., Geuking, M.B., and McCoy, K.D.（ 2005）（2005） Alcaligenes aquatilis sp. nov., a novel bacterium Immune responses that adapt the interstinal mucosa from sediments of the Weser Estuary, Germany, and a salt to commensal intestineinal bacteria. Immunology. 115, marsh on Shem Creek in Charleston Harbor, USA. Int. J. 153-162. Syst. Evol. Microbiol. 55, 2571-2575. Nakano, M., Niwa, M., and Nishimura, N.（ 2013） Specific Willems, A., Gillis, M., and De Ley, J.（ 1991） Transfer of and sensitive detection of Alcaligenes species from an agri- Rhodocyclus gelatinosus to Rubrivivax gelatinosus gen. cultural environment. Microbiol Immunol. 57, 240-245. nov., comb. nov., and phylogenetic relationships with Obata, T., Goto, Y., Kunisawa, J., Sato, S., Sakamoto, Leptothix, Sphaerotilus natans, Pseudomonas saccha- M., Setoyama, H., Matsuki, T., Nonaka, K., Shibata, N., rophila and Alcaligenes latus. Int. J. Syst. Bacteriol. 41, Gohda, and other 13 authors.（ 2010） Indigenus opportu- 65-73. nistic bacteria inhabit mammalian gut-associated lymphoid Yabuuchi, E., Kawamura, Y., Kosako, T., and Ezaki, T.（ 1998） tissues and share a mucosal antibody-mediated symbiosis. Emendation of genus Achromobacter and Achromobacter Proc. Natl. Acad. Sci. USA, 107, 7419-7424. xylosoxidans（ Yabuuchi and Yano） and proposal of Okoh, A. I., Odjadjare, E.E., Igbinosa, E.O., and Osode, A.N. Achromobacter ruhlandii（ Pacher and Vishniac） comb. （2007） Wastewater treatment plants as a source of micro- nov., Achromobacter piechaudii（ Kiredjian et al.） comb. bial pathogens in receiving watersheds. Afr. J. Biotechnol. nov., and Achromobacter xtlosoxidans subsp. denitrifi- 6, 2932-2944. cans（ Ruger and Tan） comb. nov. Microbiol. Immunol. 42, Palleroni, N.J., and Palleroni, A.V.（ 1978） Alcaligenes latus, 429-438.

Supporting information for Fig. 1. Image of primer positions in the nucleotide sequence of the 16S rRNA gene of Alcaligenes faecalis strain NBRC 13111T. PCR METHOD FOR DETECTION AND QUANTIFICATION OF ALCALIGENES SPECIES 31

TABLE S1. Sequence alignment of a 16S rRNA region in Alcaligenes faecalis and other species including the family Alcaligenaceas and other taxa. The sequences show the regions where the specific primer 6r was designed in this study. Species 6r（ 5'-3'） V4 region Alcaligenes faecalis subsp. faecalis NBRC 13111 G G A - - - G N T A C C T T T T C - T T C T C T G C Alcaligenes faecalis NBRC 14479 · · G - - - · A · · · · · · · · · - · · · · · · · · Alcaligenes faecalis AY959943 · · · - - - · A · · · · · · · · · - · · · · · · · · Alcaligenes faecalis GQ438851 · · · - - - · G · · · · · · · · · - · · · · · · · · Alcaligenes subsp. parafaecalis · · · - - - · G · · · · · · · · · - · · · · · · · · Alcaligenes subsp. phenolicus - - - · A · · · · · · · · · - · · · · · · · · Alcaligenes aquatilis · · · - - - · A · · · · · · · · · - · · · · · · · · Alcaligenes latus · C C T C A A G A · G A · · · C · T · C · C T · · A Alcaligenes defragrans · C C - - - C G C G · · G · · · · - · · · C · · · · Achromobacter cholinophagum A C T - - - A C G C A · C C · · · - C · · A · C T · Achromobacter denitrificans A C C - - - C A C G A · G · · · · - · · T C · · · · Achromobacter xylosoxidans A C C - - - C G C G A · G · · · · - · · T C · · · · Achromobacter insolitus A C C - - - C A C G A · G · · · · - · · T C · · · · Achromobacter marplatensis A C C - - - C A · G A · G · · · · - · · T C · · · · Achromobacter piechaudii · C C - - - C A · G A · G · · · · - · · T C · · · · Achromobacter ruhlandii A C C - - - C A C G A · G · · · · - · · T C · · · · Achromobacter spanius · C C - - - C A · G A · G · · · · - · · T C · · · · Advenella faeciporci · C C - - - A G A · · · · · · · · - · · · C · · · A Advenella incenata T C C - - - · A A · · · · · · · · - · · · C · · · A Advenella kashmirensis T C C - - - · A C - · · · · · · · - · · · C · · · A Advenella mimigardefordensis T C C - - - · A A · · · · · · · · - · · · C · · · A Azohydromonas australica · C C C - - · G C G T A · · · C - - · · · C · C · A Azohydromonas lata · C T C - - A G A - G A · · · C - - · · · C · · · A Bordetella ansorpii T C C - - - · G A G · · G · · · · - · · T C · · · · Bordetella avium · C C - - - T G C G · · · · · · · - · · T C · · · · Bordetella bronchiseptica · C C - - - · C · G · · G · · · · - · · T C · · · · Bordetella hinzii · C C - - - T G C G · · G · · · · - · · T C · · · · Bordetella holmesii · C C - - - C G · G · · G · · · · - · · T C · · · · Bordetella parapertussis · C C - - - C G · G · · G · · · · - · · T C · · · · Bordetella pertussis · C C - - - C G · G · · G · · · · - · · T C · · · · Bordetella petrii · C C - - - A G A G · · G · · · · - · · T C · · · · Bordetella trematum C · T - - - · G C G · · G · · · · - · · T C · · · · Brackiella oedipodis T C C - - - T G · - G · · · · · · - · · · C · · · A Candidimonas humi A C C - - - A · C G · · G · · · · - · · · C · · · · Candidimonas nitroreducens A C C - - - A · C G · · G · · · · - · · · C · · · · Castellaniella caeni T C C - - - C G G G · · · · · · · - · · · C · · · · Castellaniella defragrans · C C - - - C G C G · T G · · · · - · · · C · · · · Castellaniella denitrificans T C C - - - C A G G · T G · · · · - · · · C · · · · Castellaniella ginsengisoli · C C - - - · C G G · T G · · · · - · · · C · · · · Derxia gummosa T C C - - - A G C G · · G · · · · - G · T C T C · · Kerstersia gyiorum T C C - - - · C G G G G A · · · · - · · T C · · · A Oligella ureolytica · C C - - - T A A G A · · · · · · - · · · G T · · A Paenalcaligenes hominis · C C - - - · G · G · T G · · · · - · · · C · · · T Paralcaligenes ureilyticus A A · - - - · G · G · · G · · · · - · · · C · · · · Pelistega europaea A C · - - - C C · G A · · · · · · - · · · C · · A A Pigmentiphaga daeguensis · C C - - - · G C G · · G · · · · - · · T C · · · · Pigmentiphaga kullae T C C - - - · G C G · · G · · · · - · · T C · · · · Pigmentiphaga litoralis T C C - - - · G C · · · G · · · · - G · T C · · · · Pusillimonas noertemanni A C C - - - C G C G · · · · · · · - · · · C · · · · Pusillimonas terrae · C C - - - - G C G · · · · · · · - · · · C · · · · Taylorella asinigenitalis T C C - - - T A A · A · · · · · · - · · · C · · · A Taylorella equigenitalis A C · - - - C A A · · · · · · · · - · · · C · · · A Comamonas terrigena A C C - - - C C A · G · · · · · · G · · · C G · A · Comamonas aquatica A C C - - - C A G G G · · · · · · G · · · C G · A · Burkholderia caledonia A C C - - - A C G · G G · · · · · - · · T C · G · A Burkholderia cepasia · A G - - - C C A · G G A · · · · - · · T C · G · A Burkholderia mimosarum A C C - - - C A G · G G A · · · · - · · T C · G · A Ochrobactrum anthropi ------· · A · · - · · · A · C · G Ochrobactrum oryzae ------· · A · · - · · · A · C · G Duganella zoogloeoides - A A - - - A A A C · · G · · · · - · · · C · · · A Escherichia coli A C T - - - T T A C T · C C · · · - C · · C · C · · Bacillus subtilis subsp. subtilis · A A C - - · G · · · T · G · · · - · · · C · · A A Serratia grimesii A C · - - - C A N N N · C C · · · - C · · C T C · · Staphylococcus aureus C T T A - - C A C A T A · G · · · - · · · C · · A A Enterococcus asini C T C T - - C A C C · T · G · · · - · · · · · · A A Rhodobacter sphaeroides ------· · A · · - · · · C · A C · Acinetobacter sp. T C T - - - A G A G T A G C C · · - C · · C T C · · Pseudomonas fluorecens · · T - - - T A A T G · C C · · · - C · · C · A A ·