Nor Hawani Salikin

Characterisation of a novel antinematode agent produced by the marine epiphytic bacterium Pseudoalteromonas tunicata and its impact on Caenorhabditis elegans

Nor Hawani Salikin

A thesis in fulfilment of the requirements for the degree of

Doctor of Philosophy

School of Biological, Earth and Environmental Sciences

Faculty of Science

August 2020

Thesis/Dissertation Sheet

Surname/Family Name : Salikin Given Name/s : Nor Hawani Abbreviation for degree as give in the University : Ph.D. calendar Faculty : UNSW Faculty of Science School : School of Biological, Earth and Environmental Sciences Characterisation of a novel antinematode agent produced Thesis Title : by the marine epiphytic bacterium Pseudoalteromonas tunicata and its impact on Caenorhabditis elegans

Abstract 350 words maximum: (PLEASE TYPE)

Drug resistance among parasitic nematodes has resulted in an urgent need for the development of new therapies. However, the high re-discovery rate of antinematode compounds from terrestrial environments necessitates a new repository for future drug research. Marine epiphytic bacteria are hypothesised to produce nematicidal compounds as a defence against bacterivorous predators, thus representing a promising, yet underexplored source for antinematode drug discovery. The marine epiphytic bacterium Pseudoalteromonas tunicata is known to produce a number of bioactive compounds. Screening genomic libraries of P. tunicata against the nematode Caenorhabditis elegans identified a clone (HG8) showing fast-killing activity. However, the molecular, chemical and biological properties of HG8 remain undetermined. A novel Nematode killing protein-1 (Nkp-1) encoded by an uncharacterised gene of HG8 annotated as hp1 was successfully discovered through this project. The Nkp-1 toxicity appears to be nematode-specific, with the protein being highly toxic to nematode larvae but having no impact on nematode eggs. A putative carbohydrate binding module was identified at the N-terminus of Nkp-1 protein sequence which is suggested to bind to a yet unknown nematode glycoconjugate receptor. This study also provides the first insights into the mode of action of Nkp-1 and the nematode response towards its toxicity. The Nkp-1 expressing clones; HG8 and HP1 (expressing respectively either the original 13.8 kb genomic insert of HG8 or the hp1 gene only) colonised C. elegans intestine, in addition exposure to both strains and protein extracts resulted in multiple physical damages and necrosis. As a defence, C. elegans utilised its innate and associative learned avoidance behaviour to prevent contact with the Nkp-1 strains. Further I found evidence for the involvement of daf-2/daf-16 ILR and sek-1 p38_MAPK immune pathways in response to Nkp-1 exposure and the subsequent expression of genes involved in lysozyme, superoxide dismutase production and dar (deformed anal region) formation. Moreover, this study revealed the impact of different gut microbiota has on nematode survival and the resulting physical damages upon exposure to the Nkp-1. The outcome of these studies not only kickstart the development of Nkp-1 as a future antinematode drug but has re-affirmed the potential of marine epiphytic bacteria as a new source of novel antinematode drugs.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents a non-exclusive licence to archive and to make available (including to members of the public) my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known. I acknowledge that I retain all intellectual property rights which subsist in my thesis or dissertation, such as copyright and patent rights, subject to applicable law. I also retain the right to use all or part of my thesis or dissertation in future works (such as articles or books).

13 August 2020 ………………………………………………… ……….……………………...…….… Signature Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years can be made when submitting the final copies of your thesis to the UNSW Library. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

13 August 2020 Date ……………………………………………......

INCLUSION OF PUBLICATIONS STATEMENT

UNSW is supportive of candidates publishing their research results during their candidature as detailed in the UNSW Thesis Examination Procedure.

Publications can be used in their thesis in lieu of a Chapter if: • The candidate contributed greater than 50% of the content in the publication and is the “primary author”, ie. the candidate was responsible primarily for the planning, execution and preparation of the work for publication • The candidate has approval to include the publication in their thesis in lieu of a Chapter from their supervisor and Postgraduate Coordinator. • The publication is not subject to any obligations or contractual agreements with a third party that would constrain its inclusion in the thesis

Please indicate whether this thesis contains published material or not:

This thesis contains no publications, either published or submitted for ☒ publication

Some of the work described in this thesis has been published and it ☐ has been documented in the relevant Chapters with acknowledgement

This thesis has publications (either published or submitted for publication) incorporated into it in lieu of a chapter and the details are ☐ presented below

CANDIDATE’S DECLARATION I declare that: • I have complied with the UNSW Thesis Examination Procedure • where I have used a publication in lieu of a Chapter, the listed publication(s) below meet(s) the requirements to be included in the thesis. Candidate’s Name Signature Date (dd/mm/yy)

Nor Hawani Salikin 13 August 2020

iii

‘I hereby grant the University of New South Wales or its agents a non-exclusive licence to archive and to make available (including to members of the public) my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known. I acknowledge that I retain all intellectual property rights which subsist in my thesis or dissertation, such as copyright and patent rights, subject to applicable law. I also retain the right to use all or part of my thesis or dissertation in future works (such as articles or books).’

‘For any substantial portions of copyright material used in this thesis, written permission for use has been obtained, or the copyright material is removed from the final public version of the thesis.’

Signed ……………………………………………......

13 August 2020 Date ……………………………………………......

AUTHENTICITY STATEMENT ‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis.’

Signed ……………………………………………......

13 August 2020 Date ………………………………………………………………….

ABSTRACT

Drug resistance among parasitic nematodes has resulted in an urgent need for the development of new therapies. However, the high re-discovery rate of antinematode compounds from terrestrial environments necessitates a new repository for future drug research. Marine epiphytic bacteria are hypothesised to produce nematicidal compounds as a defence against bacterivorous predators, thus representing a promising, yet underexplored source for antinematode drug discovery. The marine epiphytic bacterium Pseudoalteromonas tunicata is known to produce a number of bioactive compounds. Screening genomic libraries of P. tunicata against the nematode Caenorhabditis elegans identified a clone (HG8) showing fast-killing activity. However, the molecular, chemical and biological properties of HG8 remain undetermined. A novel Nematode killing protein-1 (Nkp-1) encoded by an uncharacterised gene of HG8 annotated as hp1 was successfully discovered through this project. The Nkp-1 toxicity appears to be nematode- specific, with the protein being highly toxic to nematode larvae but having no impact on nematode eggs. A putative carbohydrate binding module was identified at the N-terminus of Nkp-1 protein sequence which is suggested to bind to a yet unknown nematode glycoconjugate receptor. This study also provides the first insights into the mode of action of Nkp-1 and the nematode response towards its toxicity. The Nkp-1 expressing clones; HG8 and HP1 (expressing respectively either the original 13.8 kb genomic insert of HG8 or the hp1 gene only) colonised C. elegans intestine, in addition exposure to both strains and protein extracts resulted in multiple physical damages and necrosis. As a defence, C. elegans utilised its innate and associative learned avoidance behaviour to prevent contact with the Nkp-1 strains. Further I found evidence for the involvement of daf-2/daf-16 ILR and sek-1 p38_MAPK immune pathways in response to Nkp-1 exposure and the subsequent expression of genes involved in lysozyme, superoxide dismutase production and dar (deformed anal region) formation. Moreover, this study revealed the impact of different gut microbiota has on nematode survival and the resulting physical damages upon exposure to the Nkp-1. The outcome of these studies not only kickstart the development of Nkp-1 as a future antinematode drug but has re-affirmed the potential of marine epiphytic bacteria as a new source of novel antinematode drugs.

TABLE OF CONTENT

THESIS / DISSERTATION SHEET……………………………………………………..i ORIGINALITY STATEMENT …………………………………………………………ii INCLUSION OF PUBLIC STATEMENT ……………………………………………..iii COPYRIGHT & AUTHENTICITY STATEMENT ……………………………………iv ABSTRACT …………………………………………………….……...………………..v TABLE OF CONTENT ……...………………………………………………………....vi ACKNOWLEDGEMENT ………...…………………………………………………..xiii LIST OF PUBLICATION AND PRESENTATIONS …..…………………………...…xv LIST OF ABREVIATIONS AND SYMBOLS.……………………………………….xvi LIST OF FIGURES ……………………………………………………………...... xviii LIST OF TABLES ...…………………………………….…………………………...xxiv

CHAPTER 1. General Introduction and thesis aims ……………………….…....….1 1.1 What is nematode? ……………………..………………………………….…….…2 1.2 Nematodes as human parasites ……………………………..…………..…………..3 1.3 Parasitic nematodes; a significant threat to agriculture, fisheries and livestock industries ………………………………………………………………...…………4 1.4 The increasing trend of drug resistance among the parasitic nematodes; an urgent need for new antinematode treatments ………………………………………….….6 1.5 Caenorhabditis elegans as a model organism for antinematode drug discovery ……8 1.5.1 Characterising the mode of action of antinematode compound using C. elegans……………………………………………………………………11 1.5.2 Understanding nematode behavioural response and innate immunity regulation towards antinematode compounds ………..…………………. 13 1.6 C. elegans gut microbiota ………………………..………………………………. 18 1.7 Antinematode drug discovery; transition from terrestrial to marine-derived microbial compounds …..………………………………………………………... 19 1.8 Surface associated marine bacteria; a reservoir of novel antimicrobial and antinematode drugs discovery …………………………………………………… 23

1.9 Pseudoalteromonas tunicata; a model of marine surface associated bacterium …………………………………………………...……………………. 30 1.10 Aims of study………………………………………..………………….………...36 1.11 REFERENCES…...……………………………………………………………….38

CHAPTER 2. Characterisation of the fast nematode-killing activity of the marine epiphytic bacterium Pseudoalteromonas tunicata D2 ……………………………….59

2.1 INTRODUCTION …………………...……………………………………………60 2.2 MATERIALS AND METHODS…………………………………………...... 62 2.2.1 Bacterial strains and culture condition ……………………...……………62 2.2.2 Maintenance and synchronisation of nematode C. elegans……………….64 2.2.3 DNA sequence analysis and annotation …………………………...……..65 2.2.4 Generation of HG8 mutant libraries ……………………...………………65 2.2.4.1 Transposon library screening ………………………………….66 2.2.5 Sequencing analysis ……………………………………...………………67 2.2.6 Cloning of P. tunicata gene inserts into the pBAD24 vector………….…67 2.2.6.1 Transformation of pBAD24 recombinant vector into EPI300 and 7C8 E. coli strains and screening against C. elegans ………….68 2.2.7 Protein extraction ……………………………...…………………………71 2.2.8 SDS PAGE, mass spectrometry and protein modelling …………………..71 2.2.9 Nematode killing assay …………………...……………………………...72 2.2.10 Preparation of heat-killed bacterial clones …………………...…………..73 2.2.11 Nematode egg hatching assay………………………...…………………..73 2.2.12 Nematode brood size assay……………………………...………………..74 2.2.13 Nematode killing assay using 24-well microtiter plates……………..…...74 2.2.14 Antibacterial and antifungal assay…………...…………………………...75 2.3 RESULTS………………...………………………………………………………. 76 2.3.1 Annotation of the 13.8 kb P. tunicata D2 DNA fragment encoded in the HG8 fosmid……………………………...…………………………………….. 76 2.3.2 Generation of transposon mutants in HG8 with attenuated nematode killing activity…………………………...………………………………………..86 2.3.3 Attenuated activity of the 7C8 mutant is restored upon complementation with hp1………………...…………………………………………………88 vii

2.3.4 Expression of hp1 gene in E. coli results in reduced C. elegans survival …89 2.3.5 Exposure to E. coli HP1 and HG8 does not affect C. elegans egg hatching efficiency but decreases the brood size ……...……………………………91 2.3.6 Heat-killing treatment significantly reduces the toxic activity of E. coli HP1 and HG8…………………………………………………………………...93 2.3.7 E. coli HP1 and HG8 bioactivities are nematode specific………..……….94 2.3.8 The antinematode compound produced by E. coli HP1 and HG8 is not secreted extracellularly……………………….………………………….. 97 2.3.9 E. coli HP1 and HG8 protein extracts are toxic against C. elegans……….98 2.3.10 SDS PAGE, mass spectrometry analysis and 3D protein modelling of the Nematode killing protein-1 (Nkp-1)………...…………………………….99 2.4 DISCUSSION……...……………………………………………………………. 103 2.4.1 The gene hp1 is responsible for the expression of Nkp-1; a novel nematode killling protein with a putative carbohydrate binding module……………103 2.4.2 Different expression system and heterologous recombinant cell background effects Nkp-1 expression level in E. coli HG8 and HP1 strains………….107 2.4.3 The products of other genes in HG8 might have an indirect effect on Nkp-1 toxicity against C. elegans………...……………………………………..108 2.4.4 E. coli HP1 and HG8 strains appear to be specifically toxic to nematodes………………………………………………………………..112 2.4.5 High temperature diminished E. coli HP1 and HG8 toxic activity against C. elegans…………………...……………………………………………... 112 2.5 CONCLUSION……………………...………………………………………...... 113 2.6 REFERENCES …………..………………………...……………………………. 114 SUPPLEMENTARY MATERIALS ………………………………………...………. 124

CHAPTER 3. Investigation of the putative mode of action and nematode response to Nkp-1……………………………………………..………………………………..132

3.1 INTRODUCTION ………………………………………………...……………..133 3.2 MATERIALS AND METHODS……………..…………………………………..135 3.2.1 Bacterial strains and culture condition ……..…………………………...135 3.2.2 Cultivation and manipulation of Caenorhabditis elegans………..……..137 3.2.3 C. elegans exposure to the liquid culture of Nkp-1 expressing clones…..137 viii

3.2.4 Tagging E. coli strains with GFP-expressing plasmid…………..……….137 3.2.5 Bacterial colonisation assay……………………………………….....…. 137 3.2.6 Assessment of C. elegans damage due to the Nkp-1 exposure…………..138 3.2.7 Determination of E. coli clones HP1 and HG8 killing mechanism against C. elegans ……………………...…………………………………………...139 3.2.7.1. Enzymatic assays…………………...……………………...….139 3.2.7.2. Necrosis assay…………………………………...…………….140 3.2.8 Microscopy imaging…………………………………...………………...140 3.2.9 C. elegans avoidance behaviour and aversive olfactory learning against the Nkp-1 and HG8 strains………………………………...………………...141 3.2.10 C. elegans RNA isolation and cDNA synthesis………………...………..143 3.2.11 Quantitative Polymerase Chain Reaction (qPCR)……………...………..144 3.3 RESULTS ………………………………………………...……………………...148 3.3.1 E. coli strains expressing Nkp-1 are able to colonise and persist in the gastrointestinal lumen of C. elegans………………………………..…...148 3.3.2 Exposure to E. coli strains HP1::GFP and HG8::GFP resulted in morphological changes in C. elegans…………………………………….151 3.3.3 Total protein fraction of E. coli strains expressing Nkp-1 resulted in morphological changes on C. elegans……………………………………156 3.3.4 E. coli HP1 and HG8 bacterial strains and their protein extracts do not show any evidence of hydrolytic enzyme activity……………………………..161 3.3.5 Exposure to E. coli strains expressing Nkp-1 results in loss of C. elegans cell membrane integrity…………………………………...………………… 162 3.3.6 C. elegans has an innate and associative learned avoidance behaviour against E. coli strains HP1 and HG8……………………………………………...165 3.3.7 Exposure to E. coli HP1 resulted in differential expression of innate immunity genes in C. elegans…………………...……………………….167 3.3.8 Exposure to E. coli HP1 downregulates the sod-3 and upregulates the lys-8 gene expression in C. elegans……………………………...…………….169 3.4 DISCUSSION……………………………………………...……………………. 170 3.4.1 Nkp-1 expressing E. coli clones kill C. elegans via a step by step mode of action (MOA)……………………………………………………………170

3.4.1.1. Stage 1: Ingestion and digestion of Nkp-1 expressing bacteria by C. elegans…………………..………………………………… 170 3.4.1.2. Stage 2: Nkp-1 triggers cellular level (necrosis) damage in C. elegans………………………...……………………………… 171 3.4.1.3. Stage 3: Nkp-1 expressing bacteria cause a range of physical damages in C. elegans…………………………….……………172 3.4.1.4. Stage 4: Enhanced Nkp-1 expressing bacterial colonisation…..173 3.4.2 C. elegans response against Nkp-1 expressing bacteria……..…………..176 3.4.2.1. C. elegans avoids Nkp-1 expressing clones and shows associative learning behaviour………...…………………………………...176 3.4.2.2. C. elegans internal hatching and dar formation………………...177 3.4.2.3. The daf-2/daf-16 genes control the downstream genes sod-3 and lys-8 maybe essential for C. elegans immune defence against the Nkp-1 expressing strains………………………………………………………..... 178 3.4.2.4. sek-1 maybe important for the dar phenotype in C. elegans exposed to E. coli HP1…………………………………………………..180 3.5 CONCLUSION…………………………...……………………………………... 182 3.6 REFERENCES………...…………...…………………………………………….183 SUPPLEMENTARY MATERIALS…………………………………...…………….. 191

CHAPTER 4. The presence of a defined gut microbiota in Caenorhabditis elegans alleviates toxicity of the antinematode protein Nkp- 1………………………………………………………………………...…….……….206

4.1 INTRODUCTION……………………...………………………………………...207 4.2 MATERIALS AND METHODS……………………………...………………… 209 4.2.1 Bacterial strains and culture conditions………………………………….209 4.2.2 Maintenance and manipulation of C. elegans …………………………...211 4.2.3 Enriched soil preparation ……………………...………………………..211 4.2.4 Establishment of C. elegans N2 with an undefined gut microbiota from enriched soil …………………………………………………………….212

4.2.5 Isolation and identification of the cultivable C. elegans N2_UGM gut microbiota …………………………………..…………………………..214 4.2.6 Establishment of C. elegans N2 with a defined gut microbiota …………215 4.2.7 Nematode killing assay ………………………………………..………..216 4.2.8 E. coli HP1::GFP and HG8::GFP bacterial colonisation assay and microscopy imaging …………………………………………………….216 4.2.9 16S rRNA gene amplicon sequencing analysis of enriched soil and C. elegans samples ………………………………………………………...217 4.2.9.1. DNA isolation ……………………………………………...….217 4.2.9.2. 16S rRNA gene amplification and sequencing ………………..217 4.2.10 16S rRNA gene sequencing analysis ……………………………………218 4.2.11 Microbial community analysis …………………………………...……..219 4.2.11.1. Detection of sequences corresponding to individual gut bacteria and the differentially abundant bacterial communities in the N2_DGM gut microbiota ……………………………………220 4.3 RESULTS ……………………………………………………………...………...221 4.3.1 Establishment of an undefined gut microbiota (UGM) in C. elegans N2..221 4.3.2 C. elegans with an undefined gut microbiota (N2_UGM) showed a reduced survival compared to the N2 monoxenic nematodes ……………………225 4.3.3 Isolation of bacterial cultures from C. elegans N2 UGM and establishment of C. elegans N2 with a defined gut microbiota (DGM)…………………227 4.3.4 A defined gut microbiota provides resistance to E. coli HP1 compared to monoxenic nematodes …………………………………………………..232 4.3.5 Reduction of Nkp-1 expressing E. coli colonisation in C. elegans with a defined gut microbiota compared to the N2 monoxenic nematodes …….234 4.3.6 Morphology of C. elegans N2_DGM with a defined gut microbiota was less affected by E. coli HP1::GFP and HG8::GFP compared to the N2 monoxenic nematodes …………………………………………………..236 4.4 DISCUSSION…………………...………………………………………………..242 4.4.1 Establishment of potentially detrimental gut microbiota reduce C. elegans survival ………………...………………………………………………. 242 4.4.2 The high relative abundance of potentially beneficial gut bacteria may improve C. elegans survival against the toxic Nkp-1 expressing clones...243

4.4.3 An increased proportion of potentially beneficial gut microbiota diminish physical damages caused by the Nkp-1 expressing strains………………245 4.5 CONCLUSION………………………………………………………………...... 247 4.6 REFERENCES...... ……………………………………………………………….248 SUPPLEMENTARY MATERIALS ………………………………………………….254

CHAPTER 5. General Discussion…………………………………………………...282

5.1 Climate change; an inevitable factor that escalates parasitic nematode infection…………………………………………………………………………..283 5.2 Blue gold from the ocean; a new antinematode compound from the surface associated marine bacterium Pseudoalteromonas tunicta D2 ………………………………..284 5.3 Nematode behaviour and innate immunity regulation against Nkp-1…………….287 5.4 Native nematode gut microbiota; a neglected factor in antinematode drug development ……………………………………………………………………...289 5.5 Conclusion, research limitation and future perspective ……………………………………………………………………….293 5.6 REFERENCES….………………………...……………………………………...295 APPENDIX I ………………………………………………………………………….302 APPENDIX II ………………………………………………………………………...314 APPENDIX III ……………………………………………………………………...... 318 APPENDIX IV…………………………………………………………...…………... 319

xii

ACKNOWLEDGEMENT

Completing a PhD study is an incredible adventure but yet, a strong everlasting friendship and memories have been inspired from this journey. So, as it happens in life, there were times when it was challenging. In those moments, few inspiring and wonderful people help me to believe that everything is possible. I am blessed to have them always by my side during my laugh and tears.

My first special person was my Supervisor Associate Professor Suhelen Egan. Su, you were always beside me during my good and bad. You believed in me, and were always being patient to guide me in this journey. You are a great Mentor, an incredible Woman and Scientist that I admire and will always consider as an example to follow. Thank you so much for being an extraordinary Supervisor and friend to me. I also would like to convey my highest appreciation to my Co-Supervisor Associate Professor Belinda Ferrari. Thank you so much for your comforting words and kind motivation that you gave me. Also, appreciation goes to Professor Torsten Thomas. Torsten, I always remember the time when you introduced me to Su. Thank you so much for the opportunity and your help during my PhD journey. I will never forget that definitely!

I also would like to convey a special appreciation to Helen and Associate Professor Christopher Marquis from the UNSW Recombinant Products Facility for providing precious guidance and equipment for my study. A hearty thanks also goes to the BABS and BEES people and also for Anneli from the GRS who were always being nice and supportive. Thank you so much for your kind help and I will never forget you!

Utmost appreciation is also extended to these wonderful people; Jadi, Marwan, Jen and Priscila. Guys, you were always there next to me, always supported me and helped me during my PhD journey. I am blessed to have you as my friends and I hope that this friendship will be everlasting. To Mika, Willis, Shan, David, Jess, Syukur, Irene, Eve, Ale, Alex, Hung, Vicky, Mansura, Tahsin, Zillur, Jerome, Miera, Rabeya, Kate, Sally and

xiii

Manue, thank you so much for the friendship that we have and you guys make me feel that I am having a big family in Australia. Thank you so much!

Highest appreciation also goes to my sponsors University of Science Malaysia (USM) and Ministry of Higher Education Malaysia. Thank you so much for sponsoring my study and allow me to have the opportunity to learn from great scientists and wonderful people in UNSW. I also would like to thank the teachers and staffs of the Eastlakes Public School and SMOOSH who were always being nice and supportive to me and my children. We will always miss all of you.

To my beloved family, my mum and my late father, thank you so much for your prayers, unconditional love, support and sacrifice. To my beloved husband Hasrul Hafizan and my sweet brilliant children; Iman, Fawwaz and Muaz, thank you so much for your understanding, your supports, patience, sacrifice and love. This PhD is yours!

THANK YOU

xiv

LIST OF PUBLICATION AND PRESENTATION

PUBLICATION

Wu, Z., Palanimuthu, D., Braidy, N., Salikin, N. H., Egan, S., Huang, M. L., & Richardson, D. R. (2020). Novel multifunctional iron chelators of the aroyl nicotinoyl hydrazone class that markedly enhance cellular NAD+/NADH ratios. British Journal of Pharmacology, 177(9), 1967-1987.

In preparation; *Salikin, N. H., Nappi, J., Majzoub, E. M. and Egan, S. Marine microbial biofilms; A reservoir for anti-parasites drug discovery. (Review article)

*Salikin, N. H., Daim, M. F. and Egan, S. Novel Nematode Killing Protein-1 from a marine bacterium Pseudoalteromonas tunicata and the resulting Caenorhabditis elegans responses

*Salikin, N. H., Majzoub, E. M. and Egan, S. Caenorhabditis elegans native gut microbiota alleviates the toxicity of Nematode Killing Protein-1 produced by marine bacterium Pseudoalteromonas tunicata

PRESENTATION

*Salikin, N. H., Daim, M. F. and Egan, S. Genetic analysis of antinematode activity in a marine epiphytic bacterium; Pseudoalteromonas tunicata. Marine Biotechnology Convention. Tauranga, New Zealand, 2017. (Oral presentation)

*Salikin, N. H. and Egan, S. Characterisation of antinematode activity by a marine epiphytic bacterium Pseudoalteromonas tunicata. 3rd Australia New Zealand Marine Biotechnology Society Conference. Sydney, Australia, 2019. (Oral presentation)

*Salikin, N. H. and Egan, S. Nematode killing activity by a marine epiphytic bacterium Pseudoalteromonas tunicata against Caenorhabditis elegans. 8th Congress of European Microbiologists (FEMS), 2019. Glasgow, Scotland. (Poster presentation)

*Publications or presentations relevant to this thesis.

LIST OF ABBREVIATIONS AND SYMBOLS

% percent oC degree Celcius ± plus minus µ micro (10-6) aa amino acid Amp ampicillin ANOVA analysis of variance BLAST Basic Local Alignment Search Tool bp basepair(s) CBM6 Carbohydrate binding module 6 CBM35 Carbohydrate binding module 35 CFU colony forming units cm centimetre(s) Cm chloramphenicol df degree of freedom CMSI Centre for Marine Scince and Innovation DGM Defined gut microbiota DNA deoxyribonucleic acid EDTA ethylene diamine tetra acetic acid, trisodium salt F F-test Fw forward primer g gram GFP green fluorescent protein GLM generalized linear model h hour(s) hp hypothetical protein IMG Integrated Microbial Genomes Kan Kanamycin kb kilobase(s) kDa kilodalton(s) L litre(s) L4 C. elegans larval stage 4 LB10 Lysogeny Broth (medium) m Milli (10-3) M molar MA DifcoTM Marine Broth 2216 solidified with 1.5% agar MB DifcoTM Marine Broth 2216 min minute(s) mL millilitre xvi mol Mole n number of replicates N2_DGM C. elegans N2 with a defined gut microbiota N2_UGM C. elegans N2 with an undefined gut microbiota NGM Nematode growth media nMDS non-metric multidimensional scaling OD Optical density ORF Open reading frame zOTU zero-radius operational taxonomic unit p Pico (10-12) PBS Phosphate Buffer Saline PCR Polymerase Chain Reaction PERMANOVA Permutational Multivariate Analysis of Variance PFT Pore forming toxin q q-value rpm revolutions per minute Rv reverse primer s second(s) SDS PAGE Sodium dodecyl sulfate–polyacrylamide gel electrophoresis sp. species spp. several species TAE Tris-acetate-EDTA buffer Tn transposon UGM undefined gut microbiota V Volt v/v volume per volume vs versus wt wild type strain w/v weight per volume x g gravitational force

xvii

LIST OF FIGURES

Figure 1.1 C. elegans lifecycle and body anatomy.………………………….….…...9

Figure 1.2 Schematic diagram representing C. elegans functional role as a model nematode for the development of antinematode drugs……...………………………….12

Figure 1.3 Schematic diagram representing the daf-2/daf-16 ILR signalling and p38- MAPK pathways in C. elegans.…………………………………………………………17

Figure 1.4 Surface associated marine bacteria live on the nutrient-rich marine surfaces for example macroalgae or cnidarian in a form of biofilms.………………….26

Figure 1.5 Bioactive compounds produced by the surface associated marine bacterium Pseudoalteromonas tunicata D2.………………….…………………...……31

Figure 2.1 Schematic diagram of the gene cloning protocol…………….…………70

Figure 2.2 Schematic diagram of 13.8 kb P. tunicata D2 insert encoded in the HG8 fosmid.……………………………………………………………...…………………..78

Figure 2.3 HG8 transposon mutant generation ………………………….…………87

Figure 2.5 C. elegans survival on E. coli clones HP1, HP2 and HP1/HP2………………………………………………………..………………………90

Figure 2.6 Effect of E. coli clones HP1, HG8 and the negative control BD24 exposure on (A) C. elegans egg hatching efficiency and (B) C. elegans brood size.……………………………………………………………………………………..92

Figure 2.7 C. elegans survival on live and heat-killed E. coli clones HP1 and HG8 and the negative control E. coli BD24 bacterial strains……..…………………………………………………………………………….93

xviii

Figure 2.8 C. elegans survival on E. coli HP1, HG8, BD24 and their corresponding cell-free supernatants.……………….……………….…………………………………97

Figure 2.9 C. elegans survival in the soluble and insoluble protein fractions of E. coli clones HP1, HG8 and BD24 using the 24-well microtiter plates……………………………………………………………………………………98

Figure 2.10 SDS Polyacrylamide gel (12%) showing soluble and insoluble protein fraction of E. coli clones HP1, HG8 and the control strains; BD24 and EPI300…………………………………………….….……………………………….100

Figure 2.11 Multiple sequence alignment of Nkp-1 protein sequence and closely related protein sequences………………………………...……………………………101

Figure 2.12 Schematic diagrams representing Nkp-1 protein sequence and the 3D protein models generated by different software……….………………………………102

Figure 2.13 Characterised protein templates showing resemblance to Nkp-1 3D protein models.………………………………….….………………………………….106

Figure 2.14 Schematic diagram representing the proposed function of key genes encoded on HG8 that are involved in involved in antinematode activity.……………………………………………….………………………….……111

Figure S2.2 Nkp-1 protein bands expressed by E. coli BL21 (λDE3) transformed with the pET28b(+)hp1 vector.……………………..………………………………………131

Figure 3.2 E. coli HP1::GFP and HG8::GFP bacterial colonisation within C. elegans gastrointestinal system.………………………………………….…………………….149

xix

Figure 3.3 Relative fluorescence representing the colonisation of E. coli strains HP1::GFP, HG8::GFP and the negative control BD24::GFP within C. elegans body.…………………………………………………………..………………………150

Figure 3.4 Bacterial colonisation assay of E. coli HP1::GFP, HG8::GFP and BD24::GFP against C. elegans.………………………..………………………………150

Figure 3.5 Examples of C. elegans body structure after exposure to the Nkp-1 expressing clones (E. coli HP1::GFP and HG8::GFP) and the negative control strain BD24::GFP.………………………………………………..………………………….152

Figure 3.6 Proportion of C. elegans with evidence of morphological changes after exposure to different GFP-tagged E. coli clones.………...…………………………… 155

Figure 3.7 Examples of physical appearances observed on C. elegans treated with the total insoluble protein fractions of E. coli HP1, HG8 and the negative control BD24 strains.…………………………………………………………………………………157

Figure 3.8 Proportion of C. elegans with morphological changes after exposure to the protein fractions of strains HP1 and HG8.…………...………………………………...159

Figure 3.9 Propidium iodide (PI) staining on C. elegans exposed to E. coli strains HP1, HG8 and BD24 strains.………………………………….……………………….163

Figure 3.10 Proportion of C. elegans with loss of cell membrane integrity after 48 hours of exposure to E. coli HP1 and HG8 bacteria.………………………………….164

Figure 3.12 C. elegans genes expression of different immunity cascades including the (A) daf-2/daf-16 ILR signalling, (B) p38-MAPK pathway and (C) ERK-MAPK pathway………………………………………………...………….…………………168

Figure 3.13 The expression level of several downstream genes that are important for C. elegans protective response against bacterial toxicity………….………………….169

Figure 3.14 Schematic diagram representing the proposed mode of action (MOA) of Nkp-1 expressing bacteria (E. coli HP1 and HG8) against C. elegans.…………………………………………………………………………….….175

Figure 3.15 Schematic diagram representing the proposed C. elegans response to the toxicity of Nkp-1 expressing clones and their protein extracts.…………………………………………………………………………...…...181

Figure S3.1 Example of size reduction observed on C. elegans upon exposure to soluble and insoluble protein fractions of different E. coli clones…………………….199

Figure S3.2 Example of internal organ damage observed on C. elegans upon exposure to soluble and insoluble protein fractions of different E. coli clones………………….200

Figure S3.3 Example of pharynx distortion observed on C. elegans upon exposure to soluble and insoluble protein fractions of different E. coli clones……………………..201

Figure S3.4 Example of vacuole formation observed on C. elegans upon exposure to soluble and insoluble protein fractions of different E. coli clones…………………….202

Figure S3.5 Example of internal hatching observed on C. elegans upon exposure to soluble and insoluble protein fractions of different E. coli clones……………………..203

Figure S3.6 Melt curves of the amplified qPCR products of C. elegans innate immunity genes.…………………………………………………………...………………...…...204

Figure 4.1 Schematic diagram representing the preparation of enriched soils and establishment of C. elegans undefined gut microbiota.……………………………………………...………………………...…...213

Figure 4.2 Schematic diagram representing the establishment of C. elegans N2_DGM with a defined gut microbiota.…………………………………………………….………………………215

Figure 4.3 Comparison of Shannon diversity and richness (zOTU counts) of bacterial communities between SOIL and C. elegans N2_UGM microbial samples……………………...…………………..…………………………………….221

Figure 4.4 Taxonomic profiles of bacterial communities shown at the genus level of all SOIL and N2_UGM samples.…………………..………………………………….224

xxi

Figure 4.5 C. elegans N2 monoxenic and N2_UGM survival against E. coli HP1, HG8 and the non-toxic control BD24 bacterial strains.……………………………………………………………...………………….226

Figure 4.6 Morphology of C. elegans N2 after the establishment of a defined gut microbiota (DGM).………………………………...………………………………….228

Figure 4.8 Survival of C. elegans N2_DGM and N2 monoxenic when exposed to E. coli HP1, HG8 and the non-toxic control BD24 bacterial strains………………………233

Figure 4.10 Proportion of C. elegans N2 monoxenic and N2_DGM with pharynx distortion………………………………………...…………………………………….237

Figure 4.11 Proportion of C. elegans N2 monoxenic and N2_DGM with internal hatching.………………………………………………………………………………238

Figure 4.12 Proportion of C. elegans N2 monoxenic and N2_DGM with internal organ (intestine or gonad) damage.……………………….….………………………………239

Figure 4.13 Proportion of C. elegans N2 monoxenic and N2_DGM with deformed anal region (dar).……………………………...…...……………………………………….240

Figure S4.1 Rarefaction curve (A) before and (B) after normalisation………………………………………….………………………………274

Figure S4.2 NMDS ordination of the SOIL and C. elegans N2_UGM bacterial communities using Bray-Curtis dissimilarity of transformed rarefied zOTU data (stress: 9.096333e-05).………………………………………………………………….….….275 Figure S4.3 Taxonomic profiles of bacterial communities shown at the class level of all SOIL and N2_UGM samples.…………...…………………………………………276

xxii

Figure S4.4 Taxonomic profiles of bacterial communities shown at the family level of all SOIL and N2_UGM samples.……...………………………………………………277

Figure S4.5 Microscopic examination on C. elegans N2_UGM after the establishment of an undefined gut microbiota from the enriched SOIL.…………………………….278

Figure S4.6 Morphology of C. elegans N2 after the establishment of an undefined gut microbiota (UGM).……………………………...…………………………………….279

Figure S4.7 E. coli HP1::GFP, HG8::GFP and non-toxic control BD24::GFP bacterial colonisation in C. elegans N2.…………………………………………………………280

Figure S4.8 E. coli HP1::GFP, HG8::GFP and non-toxic control BD24::GFP bacterial colonisation in in C. elegans N2_DGM………………………….……………………281

Figure 5.1 Schematic diagram representing the antinematode drug discovery pipeline from the marine environment………………………………………………………….292

xxiii

LIST OF TABLES

Table 1A (in APPENDIX I) Example of parasitic nematode infection in human and clinical symptoms ………………………………………………………………….….302

Table 2A (in APPENDIX I) Example of plants parasitic nematodes, the associated host and clinical symptoms…………………………………………………………………304

Table 3A (in APPENDIX I) Example of fish parasitic nematodes, associated fish host and clinical symptoms ………………………………………….………………….….306

Table 4A (in APPENDIX I) Example of livestock parasitic nematodes, associated animal host and clinical symptoms ……………………………………………………307

Table 1.1 Nematicidal compounds produced by bacteria isolated from terrestrial environments and their mode of actions (MOAs) against the target nematodes ……….21

Table 1.2 Examples of anthelmintic or nematicidal bioactivities isolated from marine bacteria …………………………………………………………………………27

Table 1.3 Examples of anthelmintic or nematicidal bioactivities isolated from marine eukaryotic organisms …………………………………………………………..29

Table 2.1 Bacterial strains, vectors and P. tunicata ORFs used in this study……..62

Table 2.2 List of primer pairs used in this study…………………………………………………………………………………….69

Table 2.3 Homologs and predicted conserved domains of the 17 ORFs in the 13.8 kb P. tunicata HG8 insert ………...………………………………….…………………79

Table 2.4 Antimicrobial assay of E. coli clones HP1, HG8 and BD24 on human and marine bacterial strains……………………...………………………………………….95

Table 2.5 Antifungal assay of E. coli clones HP1, HG8 and BD24 on marine fungal and yeast isolates………….….………………………...……………………………….96

Table S2.1 C. elegans survival on 7C8 mutants complemented with P. tunicata D2 uncharacterised hypothetical proteins (hp) wild type (wt) ……………….…...……….124

xxiv

Table S2.2 C. elegans survival on E. coli clones expressing individual P. tunicata D2 hypothetical proteins……………………………………………………………….….125

Table S2.3 C. elegans eggs hatching competency and brood size on E. coli clones expressing individual P. tunicata D2 hypothetical proteins ………………………….126

Table S2.4 C. elegans survival on live and heat-killed E. coli clones expressing individual P. tunicata D2 hypothetical proteins ……...……………………………….127

Table S2.5 C. elegans survival on E. coli HP1, HG8 and BD24 cells and cell-free supernatants…………………………………………………………………….……..128

Table S2.6 C. elegans survival on E. coli HP1, HG8 and BD24 soluble and insoluble protein fractions.………………………………………………………………………129

Table 3.1 Bacterial strains and vectors used in this study...….……………….…. 136

Table 3.2 List of C. elegans genes and primer pairs used in qPCR reaction ….….146

Table 3.3 Summary of morphological changes for C. elegans resulting from exposure to different E. coli bacterial cells, their soluble or insoluble protein fractions.………………………………………………………………...………….…160

Table 3.4 Assay on potential hydrolysis enzymatic activity of E. coli strains HP1 and HG8 bacterial culture and their protein extracts against the different substrates.…………………………….……………………………………………….162

Table S3.1 qPCR efficiency and R2 value of C. elegans genes tested in this study…………………………………………………………………………………...191

Table S3.2 Relative fluorescence quantification indicating E. coli HP1::GFP, HG8::GFP and BD24::GFP colonisation in C. elegans gastrointestinal system…….………………………………………………………………………..….192

Table S3.3 Bacterial colonisation assay of E. coli HP1::GFP, HG8::GFP and BD24::GFP colonisation in C. elegans gastrointestinal system ………………………………………………………………………….……..193

Table S3.4 Morphological changes on C. elegans resulted from E. coli HP1::GFP and HG8::GFP bacterial colonisation ……………………………………………………..194

xxv

Table S3.5 Morphological changes on C. elegans resulted from E. coli HP1 and HG8 total protein fraction exposure …………………………………………………….….196 Table S3.6 Proportion of C. elegans with membrane loss of integrity (necrosis) resulted from E. coli HP1 and HG8 bacterial exposure ………………………………………………...…………………………….197

Table S3.7 Innate and associative learned avoidance behaviour of C. elegans against E. coli HP1 and HG8 ………………………………………………………………….198

Table S3.8 Differential expression of innate immunity genes in C. elegans resulted from E. coli HP1 exposure …………………………………………………………….197

Table 4.1 Bacterial strains and vectors used in this study …………………….….210

Table 4.2 List of isolated gut bacteria from C. elegans N2_UGM previously raised in the enriched SOIL that were detected in the N2_DGM nematodes ………………...229

Table S4.1 Assessment on the bacterial community structure in SOIL and nematodes samples; C. elegans N2_UGM and N2_DGM …………………………………….….254

Table S4.2 Comparison of diversity and richness of bacterial communities in SOIL and N2_UGM microbial DNA samples.……………………………………….……...254

Table S4.3 PERMANOVA based on Bray-Curtis (BC) dissimilarity measure for square-root transformed abundances of bacterial communities in SOIL and C. elegans N2_UGM.……...………………………………………….….……………………….255

Table S4.4 Relative abundance of zOTUs found to be significantly affected by the sample types; SOIL or N2_UGM microbial samples (ANOVA with p adjusted < 0.05).……………………………………………………………...…...………………256

Table S4.5 C. elegans N2 monoxenic and N2_UGM survival on E. coli strains HP1, HG8 and the non-toxic control BD24 …………………………………………………269

xxvi

Table S4.6 The difference of bacterial taxonomy abundance between the starting bacterial communities and the defined gut microbiota of C. elegans N2_DGM at the genus level….……….…………………………………………………………..…….270

Table S4.7 Survival of C. elegans N2 with a defined gut microbiota (N2_DGM) upon exposure to the Nkp-1 expressing E. coli clones ………………………………………271

Table S4.8 Comparison of fluorescence intensity of GFP-tagged E. coli clones colonising C. elegans monoxenic N2 and N2_DGM with defined gut microbiota ……272

Table S4.9 Proportion of morphological changes observed on N2 monoxenic and N2_DGM nematodes following exposure to GFP-tagged E. coli strains …………….273

xxvii

CHAPTER 1

General introduction and thesis aims

1.1 What are nematodes?

Nematodes are moulting roundworms classified under the phylum Nematoda (Kingdom Metazoa) with the body size ranging from 0.2 mm to 6 m (Blaxter and Koutsovoulos, 2015). Nematodes are referred to as ‘animals with a tube within a tube’ representing the gastrointestinal tube extending from mouth (at the anterior end) to anus (at the posterior region) which is located in a long-round shaped body cavity with fluid-filled pseudocoelom (Basyoni and Rizk, 2016). The nematode body is built on approximately 1000 somatic cells and equipped with digestive, reproductive, nervous and excretory systems, however without a distinct respiratory or circulatory function (Basyoni and Rizk, 2016). The animals also lack a well-defined head, eyes and appendages and rely on their chemosensory and mechanosensory neurons embedded in the thick cuticle of the outer covering of the body to respond to various environmental stimuli (Kaplan and Horvitz, 1993; Goodman and Sengupta, 2019).

Nematodes are ubiquitous in nature and can be found in terrestrial, freshwater and marine environments (Bik et al., 2010). Approximately, more than 14 000 nematode species are distributed on the earth, representing more than 80% of metazoans diversity in the soil (Hodda et al., 2009; Kergunteuil et al., 2016). While in the deep-sea, more than 90% of metazoan abundance on the ocean floor consists of nematodes (Dell’Anno et al., 2015). However, the true nematode species level diversity is predicted to be at least 1 million (Lambshead, 1993; Blaxter and Koutsovoulos, 2015).

From an ecological perspective, nematodes play an important role in balancing the food web (Ferris, 2010) due to their role in nutrient mineralisation resulting in increasing plant biomass and productivity (Gebremikael et al., 2016). However, some nematodes are also considered facultative or obligate parasites (reviewed in (Blaxter and Koutsovoulos, 2015)), causing infectious diseases in humans and major economic constrain in agricultural and livestock sectors (Tang et al., 2014; Rashid et al., 2019).

1.2 Nematodes as human parasites

Humans are vulnerable to infectious diseases caused by parasitic helminths (nematodes) resulting in morbidity and mortality within the population (Cox, 2004; Bañuls et al., 2013; Viney, 2017). There are almost 300 nematodes associated with zoonotic diseases that are able to infect humans, including some of the most devastating parasites such as Ascaris lumbricoides (roundworm), Ancylostoma duodenale (hookworm), Gnathostoma spinigerum, Halicephalobus gingivalis and Trichinella spiralis (Trichina worm) (Table 1, Appendix I) (Ashford and Crewe, 2003; Cox, 2004). While some parasitic nematodes (e.g. Ancylostoma duodenale, Strongyloides stercoralis and Halicephalobus gingivalis) can penetrate human skin or invade through the existing skin lesion (Papadi et al., 2013; Bryant et al., 2018), several parasites infect humans via ingestion of food products contaminated with the embryonated eggs (e.g. Ascaris lumbricoides and Trichuris trichiura) (Jourdan et al., 2018; Bundy et al., 2020) or from eating raw or undercooked freshwater fish, birds, frogs or reptiles contaminated with the parasitic nematode larvae (e.g. Gnathostoma spinigerum, Dracunculus medinensis, Eustrongylides sp. and Trichinella spiralis) (Magnino et al., 2009; Eberhard et al., 2016; Frean, 2020). Some parasites e.g. Wuchereria bancrofti, Brugia malayi, Brugia timori and Onchocerca volvulus infect humans via vector transmission involving mosquitoes (Culex quinquefasciatus) (Rai et al., 2019) or black fly (Simulium damnosum), resulting in debilitating neglected tropical diseases including lymphatic filariasis or river blindness (Hendy et al., 2018; Rai et al., 2019).

Despite more than a century of effort to control parasitic infections, disease remains a major and growing public health and economic threat particularly for developing and low- income countries. Approximately 24% of the global human population, corresponding to 1.5 billion people are suffering from parasitic helminth infections (WHO, 2020) (Garcia- Bustos et al., 2019). Apart from causing diseases (see Table 1A, Appendix I), high nematode burden also reduces human fecundity (Persson et al., 2019) and affects children through malnutrition, stunted development and cognitive delay (Ezeamama et al., 2005). Moreover, infections also impose a major socioeconomic burden, leaving people in a poverty trap, low rate of employment, poor education and unsanitary conditions (Kiani et al., 2016; Gadisa and Jote, 2019)

1.3 Parasitic nematodes; a significant threat to agriculture, fisheries and livestock industries

Supplying food for the growing global population is one of societies major challenges, with over 2 billion people already living with insufficient food supply (Hassan et al., 2013). Unfortunately, diseases caused by parasitic nematodes pose a substantial threat to the food industry and the situation is predicted to worsen with an estimated 35% increase in the human population by 2050 (Shaheerah Alsounosi Alshareef and Mohamed, 2019; Ramos, 2020) (World Bank Report, 2008).

There are approximately 4 100 plant-parasitic nematodes (PPNs) (Table 2A, Appendix I) that cause disease (Abad et al., 2008; Bernard et al., 2017) either through damage to the root system, retarding the plant development or by exposing plants to secondary bacterial, fungal or viral infections (Villate et al., 2012; Jones et al., 2013; Liu and Park, 2018; Kassie et al., 2020). It is estimated that damages caused by PPNs result in >12% loss in global crop productivity and an average annual loss of ~ US$ 215 billion (Askary and Martinelli, 2015). In Australia for example, root-lesion PPNs e.g. Pratylenchus thornei is estimated to be responsible for losses of 85% and 25% in the expected wheat and chickpea productivity respectively (Thompson et al., 2000; Smiley, 2010; Zwart et al., 2019). Until now, eradicating the PPNs infestation remains a major challenge given their microscopic size and the often long evolutionary history that they share with the plants (Dutta et al., 2019).

Parasitic nematodes also impede the productivity of fisheries and aquaculture industries (Table 3A, Appendix I), resulting in worldwide economic losses and health hazards to the consumers (Shinn et al., 2015; Mehrdana and Buchmann, 2017). For example, global financial loss in the finfish industry due to parasitic infection is estimated to be as large as US$ 134 million per annum (Shinn et al., 2015). Major fish products such as Atlantic mackerel, herring, European hake, Atlantic cod and anchovy are commonly associated with parasitic nematodes e.g. Anisakis sp. and Pseudoterranova sp. (Levsen et al., 2018) and transmitted to human via ingestion of undercooked or raw fish (Aibinu et al., 2019; Shamsi, 2019). While causing zoonotic diseases, parasitic nematodes also can cause 4 allergies to hypersensitive individuals due to heat-resistant allergenic peptides produced by the nematodes (Moneo et al., 2005; Mehrdana and Buchmann, 2017), resulting in 56 million of reported cases related to allergic response to parasite nematode-contaminated fish products (WHO, 2012).

Lungworm and/or gastrointestinal parasitic nematodes of livestock are devastating, causing different pathophysiological symptoms, reduced meat quality and animal mortality (Table 4A, Appendix I) (Mushonga et al., 2018; Elseadawy et al., 2019). In Australia, economic loss due to parasite infection (e.g. Ostertagia sp. and Trichostrongyfus sp.) and the cost of control management is estimated to be ~ AU$ 1 billion (McLeod, 1995; Sackett et al., 2006; Roeber et al., 2013) whereas in Kenya, South Africa and India, ~ US$ 26, 46 and 103 million are spent just to control the Haemonchus contortus nematode infection of livestock (McLeod, 2004; Maqbool et al., 2017). Apart from causing diseases and reduced animal fecundity nematode parasites such as Ostertagia ostertagi (brown stomach worm) and Dictyocaulus viviparus (lungworm) reduce dairy production levels (~ 1.25 L/day/animal or 1.6 L/day/cow respectively) (May et al., 2018; Rashid et al., 2019). Furthermore, parasitic nematodes impose food safety concern due to the potential of transmitted zoonotic diseases to consumers (Lopes et al., 2015). Unfortunately, the economic loss attributed to nematode infection and the prevalence of antinematode drug resistance are predicted to escalate due to increasing temperature, extended parasite nematode transmission period and increasing animal host susceptibility to parasite diseases as a result of climate change. (GLOWORM Project Report; https://cordis.europa.eu/project/id/288975/reporting) (Fox et al., 2015; Verschave et al., 2016; Morgan et al., 2019).

1.4 The increasing trend of drug resistance among the parasitic nematodes; an urgent need for new antinematode treatments

Currently, infection control strategies for parasitic nematodes rely predominantly on water, sanitation and hygiene intervention (WASH) (Haldeman et al., 2020). However, WASH improvement is often a challenge in profoundly affected low-income countries (Hutton and Bartram, 2008; Nery et al., 2015). Vaccine development is ongoing, however current research focuses only on a narrow spectrum of target organisms and long-term protection from a vaccine is still under debate (Hawdon, 2014; Diemert et al., 2017; Haldeman et al., 2020). Thus, arguably the most promising longer-term control strategy is dependent on pharmaceutically-derived chemotherapeutic treatments to kill parasitic nematodes and/or mitigate the spread of infection (Abongwa et al., 2017; Zajíčková et al., 2020).

For the community antinematode treatment, single-dose albendazole or mebendazole drug tablet is recommended by the World Health Organisation (WHO) to reduce parasitic nematode burden in high-risk individuals i.e. children and pregnant women (WHO, 2017). Antinematode drugs are also widely used in aquaculture and livestock industries for deworming activities of the animals (Buchmann and Bjerregaard, 1990; Enejoh and Suleiman, 2017; Orobets et al., 2019). This is performed either by oral administration, injection or drenching the infected animals with different regimes of antinematodal drug treatments (Beuvry et al., 2003; Melville et al., 2016; Orobets et al., 2019). Unfortunately, long-term single drug consumption and the application of sub-optimal dosages are resulting in increasing prevalence of drug resistance among parasitic nematodes (Geerts and Gryseels, 2000).

Increasing cases of antinematode drug resistance has been reported across the global livestock sector (Kaplan and Vidyashankar, 2012). For example, in year 2000, about 40% of sheep farms in Western Australia (WA) were diagnosed with avermectin-resistance involving nematode parasite Teladorsagia circumcincta (Besier and Love, 2003). However, resistance increased to 60% after five years and it is estimated that more than 80% of WA sheep farms had cases of avermectin-resistant T. circumcincta in 2012 (Love,

2007; Kaplan and Vidyashankar, 2012). The current prevalence of drug resistance is not only limited to the older classes of antinematode drugs but also those introduced in recent years. For example, monepantel resistance in T. circumcincta, Trichostrongylus colubriformis and H. contortus has been reported in New Zealand and the Netherlands within just five years of launching the drug (Scott et al., 2013; Van den Brom et al., 2015). Even worse, multiple drug resistance cases have been reported in Brazil when treatments using ivermectin, albendazole, levamisole, trichlorfon, moxidectin, closantel and a combination of levamisole, ivermectin and albendazole against sheep infected with parasites Haemonchus sp., Trichostrongylus sp., Strongyloides sp., Oesophagostomum sp. and Cooperia sp were ineffective (Sczesny-Moraes et al., 2010). Multiple antinematode drug resistance against the combinations of derquantel and abamectin or abamectin, albendazole, levamisole and closantel against H. contortus was also detected in sheep farms in New South Wales (NSW), Australia (Lamb et al., 2017). An increase of 47% resistance cases from 2012 to 2018 was also reported in domestic dogs in the US (Drake and Carey, 2019). The increasing prevalence of resistance cases in livestock or domestic animals is intimidating since those parasites can also be transmitted to humans, resulting in devastating zoonotic diseases (see examples in Table 4A, Appendix I) (Geerts and Gryseels, 2000; Ngcamphalala et al., 2020). Alarmingly, there are also reports of drugs resistance in parasitic nematodes that cause human neglected tropical diseases (NTD) i.e. lymphatic filariasis and onchocerciasis (river blindness) (Cobo, 2016; Akinsolu et al., 2019).

Drug resistance is often linked to genetic mutation in those parasites. Such mutations can include those that result in a reduction of the nematode drug-target receptor, affinity of the drug with the receptor or the absence of enzymes for the drug activation (Gilleard, 2006). Almost all of the currently available anthelmintic drugs and nematicides classes including Piperazine, Benzimidazoles, Levamisole, (pyrantel and morantel), Paraherquamide, Ivermectin (macrocylic lactones and milbemycins), Emodepside (cyclodepsipeptides, PF1022A) and Nitaz0oxanide have been reported with antinematode drug cases (Holden-Dye and Walker, 2014). Unfortunately, drugs from similar classes or possessing the same mode of action are prone to have side or cross parasitic resistance (Gilleard, 2006). Given the impacts of resistant parasitic nematodes in human and economic growth, a novel antinematode chemotherapeutic agent is urgently needed as a

7 preventive control against parasite infestation (Elfawal et al., 2019; Garcia-Bustos et al., 2019).

1.5 Caenorhabditis elegans as a model organism for antinematode drug discovery

Antinematode drug research is impeded by several challenges. These include (i) similarity of biochemical reaction between parasitic nematodes and the infected host, (ii) complex parasite life cycles that involve infections in multiple hosts, (iii) different parasite geographical location and (iv) rapid development of resistant phenotypes. Therefore, an easily maintained nematode model with the capability for rapid screening of potential antinematode compounds represents a solution to some of these challenges (Mathew et al., 2016; Blasco-Costa and Poulin, 2017).

Sydney Brenner and colleagues first introduced the free-living soil nematode C. elegans in 1965 as an animal model for research including anti-infective and antinematode drug studies (Riddle et al., 1997; Leung et al., 2008; Burns et al., 2015; Kong et al., 2016; Wang et al., 2018; Queirós et al., 2019). Owing to its small size (1-1.5 mm-adult length, 80 µm-diameter), transparency, rapid life cycle (~ 3 days) and diet based on a simple bacterial culture E. coli OP50, C. elegans has emerged as a valuable animal model (Riddle et al., 1997; Artal‐Sanz et al., 2006; Frézal and Félix, 2015). C. elegans undergoes two simple life cycles, depending on the surrounding condition. In an environment with sufficient food, the nematode eggs hatch and pass through the L1, L2, L3 and L4 stage larvae to become an adult (Figure 1.1). However, in an adverse environment, for example with inadequate food, heat stress or overwhelmed population, the L1 larvae will enter different developmental route into a predauer larvae (L2d), followed by a dauer stage of which the larvae stop feeding and become stress-resistant (Frézal and Félix, 2015). Upon exposure to favourable condition (e.g. sufficient food supply), the dauer larvae develop to the L4 stage and become an adult nematode (Karp, 2018) (Figure 1.1).

B Eggs Vulva Pharyngeal grinder Pharynx Gonad Tail

Intestinal lumen Terminal bulb Intestinal cell Anus

Figure 1.1 C. elegans lifecycle and body anatomy. (A) C. elegans undergoes two different lifecycles depending on the environment. The eggs are developed in the uterus and excreted through the vulva. Under favourable conditions, the nematode eggs hatch and pass through the L1, L2, L3 and L4 stage larvae to become an adult. However, in stressed conditions i.e. inadequate food, excessive heat or overwhelmed population, the L1 larvae will enter different developmental route to a predauer larvae (L2d), followed by a dauer stage. When food is sufficient, the dauer larvae develop to the L4 stage and become adult nematodes. (B) Visualisation of C. elegans body under the microscope using the DIC filter at 10x magnification. A healthy gravid C. elegans adult hermaphrodite demonstrates an intact pharynx, body structure and internal organs i.e. intestine and gonad as indicated in (B). Scale bar indicates 100 µm. Figure A was designed using Biorender at https://biorender.com/

C. elegans possess several features which make the organism an efficient and low-cost surrogate organism for antinematode drug discovery. Unlike parasitic nematodes which require vertebrate hosts for reproduction and maintenance (Holden-Dye and Walker, 2014; Lok and Unnasch, 2018), synchronised C. elegans can be easily propagated at the desired life stage on Nematode Growth Media (NGM) ready to be used for antinematode drug studies (Stiernagle, 2006). The earliest antinematode drug testing using synchronised C. elegans individuals was performed by exposing the animals to the nematicidal agents incorporated into the agar media (Brenner, 1974). After a few years, the screening protocol evolved rapidly with the development of high throughput screening methods employing micro-fluidic systems or high-content screening (HCS) technologies, allowing for fast and large-scale drug testing (~ 14 000 to 360 000 of compounds) using C. elegans as the model organism (Figure 1.2) (Fraietta and Gasparri, 2016; Midkiff and San-Miguel, 2019). As a result, important drug discoveries such as Benzimidazoles (Driscoll et al., 1989), ivermectin and its analogues; moxidectin, milbemycin oxime, doramectin, selamectin, abamectin, eprinomectin (Haber et al., 1991) and the nematicidal activity of crystal protein insecticide Cry5B, Cry21A from Bacillus thuringiensis (Marroquin et al., 2000; Wei et al., 2003) can be attributed to the use of C. elegans as an effective animal model (Holden-Dye and Walker, 2014).

C. elegans shares many conserved genes and protein functions with parasitic nematodes. Analysis of the intestinal parasite Strongyloides stercoralis genetic sequences showed 85% of protein homologs to C. elegans genes. The infective stage of S. stercoralis (L3i/dauer) also shows an increased proportion of protein homologs to C. elegans dauer larvae (Mitreva et al., 2004). Genetic manipulation and RNA interference (RNAi) studies have been widely performed on C. elegans to provide a better understanding of the nematode response against the nematicidal drugs at the molecular level (Figure 1.2). Quantitative polymerase chain reaction (qPCR) and ‘omic’ technologies, i.e. transcriptomic profiling and proteomics are also being used to provide a global snapshot of the molecular response of C. elegans to drug exposure (Kumarasingha et al., 2019; Mir and Krishnaswamy, 2019). Given the conserved gene homologs and protein function among the members of phylum Nematoda, these studies provide insight into the possible mechanisms used by parasitic nematodes against similar drug exposure (Holden-Dye and Walker, 2014).

1.5.1 Characterising the mode of action of antinematode compound using C. elegans

The majority of drugs used to treat parasitic nematode infection target proteins that regulate neuromuscular activity including neurotransmitter receptors and ion channels (Holden-Dye and Walker, 2014). Utilisation of C. elegans as a model organism confers a better understanding of the mode of action (MOA) of potential nematicidal drugs (Figure 1.2). Studies have shown that C. elegans’ neuromuscular system, its major neurotransmitters GABA (4-aminobutyric acid) and glutamate and its enzyme choline acetyltransferase responsible for the synthesis of the neurotransmitter acetylcholine display strong similarities to parasitic roundworms Ascaris suum and Ascaris lumbricoides (Johnson and Stretton, 1985; Johnson and Stretton, 1987; Angstadt et al., 1989; Davis, 1998; Holden-Dye and Walker, 2014). Therefore, exposure of C. elegans to antinematode compounds which target the neurotransmitter receptor and ion channels has enabled the discovery of the target binding molecule and the resulting toxicity to parasitic nematodes (Weeks et al., 2018). For example, observations of body muscle contraction and spastic paralysis in C. elegans exposed to levamisole led Lewis and colleagues (Lewis et al., 1980) to determine that binding to the muscle acetylcholine receptors was key to its activity. The initiation of amino-acetonitrile derivatives (AAD) toxic activity against nematode by binding to a nicotinic acetylcholine receptor was also revealed via forwards genetic screening using C. elegans mutants (Kaminsky et al., 2008). More recently, the MOA of paraherquamide; a broad-spectrum nicotinic nematicidal alkaloid isolated from Penicillium paraherquei (Yamazaki et al., 1981) and antinematode plant-derived compounds (Hernando et al., 2019) were also elucidated using C. elegans (Schaeffer et al., 1992; Ruiz-Lancheros et al., 2011; Hernando et al., 2019).

In addition, while the insecticidal activity of B. thuringiensis Cry toxin was known (Vadlamudi et al., 1995; Zhao et al., 2020), the use of C. elegans as a model allowed the nematicidal properties and MOA of these toxins to be revealed (Marroquin et al., 2000; Griffitts et al., 2005). Cry toxins for example Cry5B binds to the glycolipid and cadherin receptors of C. elegans’ intestinal cell prior to oligomerisation and insertion into the cell membrane to form pore leading to necrosis and nematode mortality (Griffitts et al., 2005; Peng et al., 2018).

Figure 1.2 Schematic diagram representing C. elegans functional role as a model nematode for the development of antinematode drugs. The propagation and handling methods of the human, animal or plant-parasitic nematodes in the laboratory are always challenging. Given the conserved genetic sequence and protein function to those parasites, C. elegans is used as a surrogate nematode for the initial screening against the potential compounds or microorganisms with nematotoxic properties either via the conservative agar plate method or through high throughput screening technologies. C. elegans-based research offers several advantages including nematode genetic manipulation, determination of drug MOA, evaluation of the resulting nematode responses and a large-scale initial drug screening due to easy nematode maintenance and propagation in the laboratory. Figure was designed using Biorender at https://biorender.com

Some microbial products are also toxic to C. elegans due to their lytic degradative properties towards nematode body structures that are predominantly composed of chitin, collagen and lipids (Page and Johnstone, 2007). For example, Pseudomonas aeruginosa produce chitinase which can hydrolyse C. elegans cuticle and eggshell (Chen et al., 2015). Pseudomonas aeruginosa and some other Rhizobacteria i.e. Paenibacillus polymyxa, Bacillus subtilis, Bacillus cereus, Lysinibacillus sphaericus and Achromobacter xylosoxidans secrete chitinase and protease resulting in the degradation of plant parasitic nematode Meloidogyne incognita’s eggs and death (Soliman et al., 2019). There is also evidence that shows the nematicidal activity of Chryseobacterium nematophagum against C. elegans and other important veterinary nematodes; Haemonchus contortus and Ostertagia ostertagi is due to the bacterial collagenase activity (Page et al., 2019). Further analysis of the Chryseobacterium nematophagum genome led to the identification of collagenase and chitinase expressing genes that may potentially act as novel virulence factors (Page et al., 2019).

1.5.2 Understanding nematode behavioural response and innate immunity regulation towards antinematode compounds

Owing to the conserved sensory anatomy, C. elegans also serves as a powerful model to study the behaviour of parasitic nematodes (Figure 1.2) (Rengarajan and Hallem, 2016). C. elegans’ avoidance behaviour is controlled by chemosensory neurons with ciliated projections exposed to the environment to detect different molecular cues (Meisel and Kim, 2014). C. elegans are predominantly attracted to bacteria, however some bacteria can repel the nematode via the production of molecules that results in the nematode avoidance behaviour (Meisel and Kim, 2014). For example, C. elegans avoid the pathogenic bacterium Serratia marcescens due to its bacterial surfactant serrowettin W2 (Pradel et al., 2007). Interestingly, nematode avoidance behaviour can be learnt upon subsequent bacterial encounters. The response is known as induced associative learning avoidance behaviour (Zhang et al., 2005) and involves a neuronal circuit that is different from the initial innate avoidance behaviour. Taking advantage of this innate protective mechanism, the behaviour of nematodes against nematicidal compounds/drugs could be

13 determined via food choice or lawn-leaving assays on agar media (Zhang et al., 2005; Meisel and Kim, 2014).

There is evidence that the daf-2/daf-16 ILR (insulin like receptor) signalling pathway controls both the innate avoidance and associative aversive learning behaviour in C. elegans (Vellai et al., 2006; Hasshoff et al., 2007). The daf-2/daf-16 ILR signalling is a general C. elegans stress response towards heat shock (Singh and Aballay, 2006), oxidative stress (Chávez et al., 2007) and toxic microorganisms such as Pseudomonas aeruginosa, Bacillus thuringiensis, Salmonella typhimurium, Enterococcus faecalis and Coxiella burnetii (Garsin et al., 2003; Evans et al., 2008; Jia et al., 2009; Wang et al., 2012; Battisti et al., 2017). This signalling pathway is also important for C. elegans longevity by regulating the arrested development of L1 stage larvae to dauer during starvation (Lakowski and Hekimi, 1998; Hu, 2018). This pathway comprises a series of highly conserved proteins including the insulin-like receptor DAF-2 (a transmembrane tyrosine kinase) and the transcription factor DAF-16 (a FOXO/forkhead family transcription factor that is negatively regulated by DAF-2) (Figure 1.3). In the presence of antagonist ligand (insulin-like peptides) such as INS-1 or downregulation/mutation in daf-2, the AGE-1 (a phosphatidylinositol‐3‐OH kinase), PIP3 (phosphatidyl‐inositol trisphosphate), PDK‐1 (a 3‐phos‐phoinositide‐dependent kinase 1), AKT‐1 and AKT‐2 (protein‐Ser/Thr kinases) are not activated thus resulting in non-phosphorylation of DAF- 16. The non-phosphorylated DAF-16 is then translocated into the nucleus which eventually results in subsequent transcriptional regulation of multiple downstream genes expressing antimicrobial effectors, metabolic and stress response and toxin detoxification (Figure 1.3) (Murphy et al., 2003; McElwee et al., 2004; Halaschek-Wiener et al., 2005; Oh et al., 2006). Two lysozyme encoding genes; lys-7 and lys-8, the mitochondrial superoxide dismutase gene sod-3 and the dual oxidase 1 gene bli-3 are part of the downstream genes regulated by the DAF-16 transcription factor in response to ageing and/or microbial infection (Murphy et al., 2003; Zou et al., 2013; Bai et al., 2014). Furthermore, the detoxification gene B0213.15 encoding cytochrome P450 enzyme is activated in response to toxic molecules such as xenobiotics (e.g. nematicidal drugs) via daf-2/daf-16 signalling (Murphy et al., 2003; Laing et al., 2013). Cytochrome P450 enzyme has been linked to the drug resistance in insect parasites (Amenya et al., 2008) and was largely found in parasitic nematode Haemonchus contortus intestine suggesting

14 a possible underlying reason for antinematode drug resistance in the parasite (Laing et al., 2013).

The p38-MAPK (mitogen activated protein kinase) that involves NSY-1, SEK-1 and PMK-1 proteins signalling is another highly conserved immune pathway in plants and animals including in C. elegans (Figure 1.3). The p38-MAPK cascade is activated by TIR-1 (a Toll-Interleukin-1 receptor) upon exposure to different external stimuli for example the microbial pathogen-associated molecular patterns (PAMPs) i.e. lipopolysaccharide or peptidoglycan (Liberati et al., 2004). The activation of PMK-1 in the cell nucleus results in the regulation of the downstream genes that are indispensable for stress response (Berman et al., 2001; Mertenskötter et al., 2013) and defence against pathogens for example antimicrobial or antifungal peptides i.e. caenacins, lysozymes and C-type lectins (Troemel et al., 2006; Pujol et al., 2008). Loss-of-function mutations in nsy-1, sek-1 or pmk-1 result in increased nematode susceptibility to toxic bacteria for example Pseudomonas aeruginosa, Staphylococcus aureus, Mycobacterium marinum and Salmonella enterica (Aballay et al., 2003; Sifri et al., 2003; Troemel et al., 2006; Galbadage et al., 2016). A study also showed that sek-1 expression was associated with dar (deformed anal region) and important for C. elegans survival against Coxiella burnetii as mutation in sek-1 reduced the dar phenotype as well as the nematode survival (Battisti et al., 2017). The p38-MAPK pathway is also pivotal for defence against pathogenic fungi Drechmeria coniospora through the induction of wound healing response encoded by the downstream gene nlp-29 in the nematode epidermis (Pujol et al., 2008). Studies also showed that PMK-1 of the p38-MAPK and DAF-16 of the daf-2/daf-16 ILR pathways act in parallel to contribute to enhanced C. elegans daf-2 mutant longevity upon exposure to toxic bacterium Pseudomonas aeruginosa (Troemel et al., 2006) indicating a highly complex C. elegans innate immunity system.

In addition to the aforementioned pathways, C. elegans possess several other conserved distinct immune cascades including the ERK-MAPK, TGF-β, FSHR-1, ZIP-2, Wnt/Hox, UPR and autophagy (Engelmann and Pujol, 2010; Ermolaeva and Schumacher, 2014). Despite its simplicity as a model organism, C. elegans immune system is highly specific

15 in which different microorganisms will elicit a distinct immune pathway (Irazoqui et al., 2010).

Figure 1.3 Schematic diagram representing the daf-2/daf-16 ILR signalling and p38- MAPK pathways in C. elegans. Upon exposure to pathogenic microorganisms or toxic compounds (for example an antinematode drug), several immunity cascades are activated including the daf-2/daf-16 ILR signalling and p38-MAPK pathways. In the presence of antagonist ligand (for example INS-1), expressed in C. elegans neurons or intestine) that binds to the DAF-2 receptor, the following AGE-1, PIP3, PDK-1 and AKT 1/AKT 2 are not activated (indicated by the red x) resulting in no phosphorylation activity of DAF-16, hence allowing the translocation of non-phosphorylated DAF-16 into the nucleus. The DAF-16 FOXO/forkhead family transcription factor subsequently coordinates the expression of downstream genes that are important for defence, stress response, detoxification and longevity. Upon detection of different external stimuli (for example microbial pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide or peptidoglycan), the toll-receptor TIR-1 and the following protein cascades in the p38- MAPK pathway (NSY-1, SEK-1 and PMK-1) are activated (indicated by tick mark). The PMK-1 is translocated into the cell nucleus, leading to the coordination of downstream genes expression encoding for stress response and the production of different antimicrobial and/or antifungal peptides.

1.6 C. elegans gut microbiota

In nature, C. elegans are commonly found in soil with decomposed plant materials and are always in close contact with highly diverse set of microorganisms (Schulenburg and Félix, 2017). The continuous microbial interaction enables the association and persistence of distinct soil microorganisms in the C. elegans gut environment. However, the synchronisation and maintenance of C. elegans in the laboratory has resulted in the majority of studies being performed on nematodes without their native gut microbiota (Stiernagle, 2006; Dirksen et al., 2016; Samuel et al., 2016; Zhang et al., 2017).

Extensive studies to unravel C. elegans natural gut microbiota have been implemented recently using 16S rRNA gene amplicon sequencing methods resulting in the discovery of Gammaproteobacteria (Enterobacteriaceae, Pseudomonaceae, Xanthomonodaceae) and Bacteroidetes (Sphingobacteriaceae, Weeksellaceae, Flavobacteriaceae) among of the main C. elegans gut bacterial taxa (Berg et al., 2016; Dirksen et al., 2016; Samuel et al., 2016; Zhang et al., 2017). The understanding of the dynamic interaction between C. elegans and its gut microbiota, including the role of these interactions on nematode fitness, is still in its infancy. However, several studies have shown that the gut microbiota confers various advantages to the nematode. This includes increased survival of C. elegans upon exposure to pathogenic microorganisms, for example, P. aeruginosa, Bacillus thuringiensis and Chryseobacterium sp. (Montalvo-Katz et al., 2013; Kissoyan et al., 2019). This increased survival may result from an enhanced host innate immunity and/or vitamin provided to the host by the gut bacteria (Montalvo-Katz et al., 2013; Samuel et al., 2016; Zimmermann et al., 2020). However, there is also evidence that colonisation with certain gut bacteria can result in the demise of C. elegans fitness and survival (Samuel et al., 2016).

Establishment of the gut microbiota is believed as pivotal for parasitic nematodes (White et al., 2018). For example, the gut microbiota of Trichuris muris support the nematode development and fitness as well as shaping the control for future parasite infection levels to maintain nematode persistence and survival in the associated host (White et al., 2018).

Furthermore, a study by Whittaker et al (Whittaker et al., 2016) also found that co- incubation of C. elegans or adult ascarid with members of the Enterobacteriaceae successfully increased nematode survival upon exposure to benzimidazole and albendazole respectively. Interestingly, those bacterial isolates can use the benzimidazole-drug compound as a carbon source to support growth, thus suggesting a mechanism by which gut microbiota protect nematodes from toxic compounds (Whittaker et al., 2016). Understanding the interactions between nematodes and their native microbiota may open up new avenues for therapeutics and drug resistance studies and this can be achieved via the utilisation of C. elegans as a versatile model organism (Gerbaba et al., 2017; Hogan et al., 2019).

1.7 Antinematode drug discovery; transition from terrestrial to marine-derived microbial compounds

Terrestrial plants and plant extracts have been documented as an ancient therapeutic treatment against parasitic nematodes (Monaghan and Tkacz, 1990) and today, extensive studies to isolate plant-derived nematicidal compounds are still ongoing (Spiegler et al., 2017; Giovanelli et al., 2018). However, the re-discovery rate of bioactive metabolites is high (Garcia-Bustos et al., 2019), reducing the number of novel compounds in the drug discovery pipeline (Gaudêncio and Pereira, 2015). Moreover, external factors e.g. specific planting season, environmental temperature and humidity may also affect the compounds reproducibility by the plant producers (Garcia-Bustos et al., 2019). Given those inevitable challenges, microbial-derived anthelmintic compounds offer a promising solution (Shalaby et al., 2020).

Extensive exploration of terrestrial microbial compounds for therapeutic drug development was initiated in the 20th century (Monaghan and Tkacz, 1990). Since then, more than 50 000 of beneficial bioactive metabolites had been successfully identified (Bérdy, 2005; Xiong et al., 2013) some of which having potent nematotoxicity via distinct mode of actions (MOAs) (Table 1.1). Unfortunately, after almost 50 years of drug screening, few novel compounds have been identified from terrestrial-borne microorganisms (Xiong et al., 2013) hence requiring a new source for antinematode drug 19 discovery to combat the rapidly growing nematode resistance. Here, the underexplored marine ecosystem with highly diverse unidentified macro and microorganism represent a new repository for novel nematicidal drug researches (Xiong et al., 2013). In fact, marine bioactive compounds have been acknowledged as having substantial chemical novelty compared to the terrestrial metabolites (Kong et al., 2010).

“We are not marine organisms. So, until about 1970, no one even thought of the ocean. It was left as a deep secret. It seemed ridiculous to me that the ocean – with such a vast habitat – had escaped anyone’s notice. But there are good reasons. People fear the ocean; it has been considered a very hostile, inhospitable place” (Marris, 2006).

The marine environment represents the largest biome on the earth (70% of the earth surface; ~ 361 million kilometers2 with average depth of 3730 meters) and provide a habitat for a wide diversity of life that outnumbers terrestrial environments (Fenical and Jensen, 2006; Costello et al., 2010; Kanase and Singh, 2018; Flemming and Wuertz, 2019). Microorganisms are abundant in this ecosystem (105 to 106 of cells per millilitre), reaching an average of 1028 to 1029 number of cells either in the open ocean, deep sea, sediment or on subsurface (Bar-On et al., 2018; Magnabosco et al., 2018; Flemming and Wuertz, 2019). However, the majority of marine bacteria remain unrecognised or uncultivable (Pascoal et al., 2020). Given the enormous diversity and untapped bioactive potential, marine microorganisms are likely to produce novel of novel bioactive compounds with a well-defined molecular architecture and biological function including the nematicidal activity (Blockley et al., 2017; Zhang et al., 2019).

Table 1.1 Nematicidal compounds produced by bacteria isolated from terrestrial environments and their mode of actions (MOAs) against the target nematodes

Affected Microbial producer Compound Mode of action Target nematode Reference nematode region Bacillus Crystal toxin Toxin binds to nematode glycoconjugate Ancylostoma Gastrointestinal (Wei et al., 2003; thuringiensis Cry5B, Cry21A receptor and disrupt the intestinal cells ceylanicum, Ascaris system Conlan et al., 2012; membrane integrity. This action causes fall suum, C. elegans Urban Jr et al., of nematode brood size and mortality 2013) Streptomyces Avermectin and Compounds exposure resulted in Haemonchus Neuromuscular (Burg et al., 1979; avermectinius Ivermectin (semi- pharyngeal paralysis and nematode death contortus, Brugia system Omura, 2008; synthetic) malayi, C. elegans Holden-Dye and Walker, 2014) Serratia Prodigiosin Compound is toxic against juveniles larvae Radopholus similis, Unknown (Rahul et al., 2014) marcescens and inhibit egg hatching competency Meloidogyne javanica Pseudomonas Phenazine toxin Phenazine-1-carboxylic shows fast killing C. elegans Neuromuscular (Cezairliyan et al., aeruginosa (phenazine-1- activity against C. elegans in acidic system, cell 2013; Ray et al., carboxylic , environment while pyocyanin is toxic in mitochondria and 2015) pyocyanin and 1- neutral or basic pH. The toxicity of 1- protein folding hydroxyphenazine) hydroxyphenazine is not depending on environmental pH. Continuous exposure to phenazine affects protein homeostasis and cause neurodegeneration

Table 1.1 (Continue) Nematicidal compounds produced by bacteria isolated from terrestrial environments and their mode of actions (MOAs) against the target nematodes

Affected Microbial producer Compound Mode of action Target nematode Reference nematode region Pseudomonas aeruginosa Exotoxin A and other Slow-killing activity against C. elegans C. elegans Gastrointestinal (Tan et al., 1999) undetermined effectors is based on infection-like process thus system resulting in accumulation of bacteria in the gut. Continuous exposure leads to ceased pharyngeal pumping, nematode immobility and death.

Pseudomonas Glycolipid Reduction of nematode development, C. elegans Unknown (Devaraj et al., plecoglossicida biosurfactant survival and fecundity 2019)

Bacillus simplex, B. Volatile organic VOCs reduce nematode motility and Panagrellus Unknown (Gu et al., 2007) subtilis, B. compound (VOC) i.e. cause death redivivus, weihenstephanensis, benzaldehyde, Bursaphelenchus Microbacterium oxydans, benzeneacetaldehyde, xylophilus Stenotrophomonas decanal, 2-nonanone, maltophilia, Streptomyces 2-undecanone, lateritius and Serratia cyclohexene and marcescens dimethyl disulfide

Pseudomonas aeruginosa Chitinase enzyme Chitinase degrades nematode cuticle, C. elegans Cuticle, eggs, (Chen et al., intestine and egg shell leading to the gastrointestinal 2015) animal death system

1.8 Surface associated marine bacteria; a reservoir of novel antimicrobial and antinematode drugs discovery

Marine inhabitants, particularly the microorganisms, are continuously exposed to multiple detrimental or interactions (Rao et al., 2005; Welsh et al., 2016) and different physical-chemical variables such as fluctuating temperature, pH, UV exposure, salinity, toxic compounds, and desiccation particularly in the intertidal zone (Figure 1.4) (Chiu et al., 2005; Ortega-Morales et al., 2010; de Carvalho, 2018). As a survival strategy, some of marine bacteria adhere to each other and/or surfaces and embedded in enclosed matrix to form a biofilm (Vlamakis et al., 2013; Antunes et al., 2019).

The continuous development of biofilm on marine surfaces leads to epibiosis, which involves multispecies biofilm formation (Egan et al., 2013; Katharios-Lanwermeyer et al., 2014). Macroalgal surfaces for example are a hot-spot for colonization by opportunistic epibionts such as algal spores, invertebrate larvae, diatoms, fungi and other bacteria (Steinberg and De Nys, 2002; de Carvalho, 2018) mostly due to the accumulation of nutrients and macroalgal exudates composed of organic carbon and nitrogen particles (Armstrong et al., 2001; Haas and Wild, 2010; Dang and Lovell, 2016). Consequently, the competition among marine microorganisms to reserve a space within the biofilm community is tremendously intense and bacterial strains that are equipped with broad-spectrum inhibitory phenotypes are likely to be successful epibiotic colonizers (Figure 1.4) (Rao et al., 2005; Thomas et al., 2008).

In addition, predation by heterotrophic protozoa and bacterivorous nematodes also represent as another biotic stress resulting in major mortality for both planktonic and surface associated bacteria in the marine habitat (Figure 1.4) (Matz et al., 2008; de Carvalho, 2018). Protozoans for example Rhynchomonas nasuta and Cafeteria roenbergensis are among the most abundant ubiquitous species in the ocean and the major controller of the food web in the marine environment through their function as bacterial predators (Moestrup, 2000; Hisatugo et al., 2014; De Corte et al., 2019). Whereas nematodes such as Pareudiplogaster pararmatus are among the natural

23 consumers of organic biomass in benthic habitats actively grazing bacterial mats and the biofilms of biotic surfaces (Moens et al., 2006; Weitere et al., 2018).

The omnipresence of inter- and intra-species interactions supports the evolution of diverse defence strategies by surface associated marine bacteria. Such defence mechanisms include the production of diverse industrially or pharmacologically important bioactive compounds showing antibacterial, antifungal, antitumor, antifouling, antiprotozoal and antinematode activities (Table 1.2) (Penesyan et al., 2010; Adnan et al., 2018). Interestingly, the physical-chemical properties, molecular structure and functional features of those marine microbial compounds are believed to be shaped by the naturally harsh conditions of marine environment (Rocha-Martin et al., 2014). Moreover, it is speculated that bioactive metabolites originally attributed to marine invertebrates such as sponges, tunicates, bryozoans and molluscs are actually produced by their associated microorganisms (Proksch et al., 2002; Thomas et al., 2010). For example, the antibiotics peptide andrimid and trisindoline isolated from the sponge Hyatella sp and Hyrtios altum are believed to be produced by symbiotic Vibrio sp. (Kobayashi et al., 1994; Oclarit et al., 1994). An antitumor cyclic peptide leucamide A isolated from the sponge Leucetta microraphis is closely related to compounds produced by cyanobacterial symbionts (König et al., 2006). In addition, a commercialised antitumor drug Didemnin B initially isolated from the tunicate Trididemnum solidum (Rinehart et al., 1981) was recently demonstrated to be produced by symbioic bacteria Tistrella mobilis and T. bauzanensis (Tsukimoto et al., 2011; Xu et al., 2012). These observations also hold true for numerous antinematode compounds that have been successfully isolated from the marine eukaryotes (Table 1.3), with production of many now attributed to host-associated microorganisms (Romano et al., 2017; Sekurova et al., 2019).

The potential for marine surface associated microorganisms to be repositories of unusual gene functions and bioactivities is further corroborated by global biodiversity studies such as the Tara Oceans (Sunagawa et al., 2015; Zhang et al., 2019) and the Global Ocean Sampling (GOS) expedition (Venter et al., 2004; Rusch et al., 2007). These and other studies continue to reveal unprecedented level of information on

24 microbial diversity, which has subsequently led to investigations on underexplored bacterial diversity in various marine ecosystems. Furthermore, abundant and novel biosynthetic gene clusters encoding rare non-ribosomal peptides (NRPS), polyketides (PKS), and NRPS-PKS hybrids and CRISPR-Cas systems were discovered from marine biofilm samples (Zhang et al., 2019), indicating the potential of marine environment as a new source of extraordinary bioactive compounds for industries and novel drug development. (Blockley et al., 2017).

Figure 1.4 Surface associated marine bacteria live on the nutrient-rich marine surfaces for example macroalgae or cnidarian in a form of biofilms. However, the marine biofilms are exposed to biotic (intra and/or interspecies interaction with other microorganisms or predators i.e. protozoa and nematodes) and abiotic physical-chemical stressors. The predator-prey interaction leads to the production of novel nematicidal metabolites by the surface associated marine bacteria while the harsh environmental condition enhances the chemical, molecular and functional property of the produced microbial compounds. Figure was designed using Biorender at https://biorender.com/

Table 1.2 Examples of anthelmintic or nematicidal bioactivities isolated from marine bacteria

Associated Marine microbial producer Compound Mode of action Responsible gene(s) Reference surface/host Microbulbifer sp. D250 Violacein Algae Delisea Facilitate bacterial accumulation VioA-VioE (Ballestriero et al., pulchra accompanied by tissue damage 2014) and apoptosis

Pseudoalteromonas tunicata Tambjamine Algae Ulva Slow-killing activity by a heat TamA-TamT (Ballestriero et al., D2 australis resistance tambjamine and 2010) substantial bacterial colonisation in the nematode gut

Pseudoalteromonas tunicata Unknown Algae Ulva Fast-killing activity by a heat Unknown (Ballestriero et al., D2 australis sensitive unknown compound 2010) through colonisation independent manner Uncultured alpha- Unknown Algae Ulva Undetermined Possibly NRPS genes (Penesyan et al., 2013) proteobacterium, JN874385 australis cluster (strain U95)

Pseudovibrio sp. Pv348, Unknown Algae Delisea Undetermined Unknown (Penesyan et al., 2013) 1413, HE818384 (strain pulchra D323) Heterologous clone jj117 Unknown Ulva australis Undetermined ATP-grasp (Nappi, 2019) (NCBI Accession number metagenomic protein/alpha-E SRX4339430) library protein/transglutamina se protein/protease

Table 1.2 (Continue) Examples of anthelmintic or nematicidal bioactivities isolated from marine bacteria

Responsible Marine microbial producer Compound Associated surface/host Mode of action Reference gene(s) Aequorivita sp. Unknown Antartic marine sediment Undetermined Unknown (Palma Esposito et al., 2018) Vibrio atlanticus strain S- Volatile organic Scallop Argopecten irradians Undetermined Unknown (Yu et al., 2015) 16 compounds (VOC)

Pseudoalteromonas rubra Unknown Marine organisms (copepod or Undetermined Unknown (Gram et al., 2010; Neu et fish) or environmental samples al., 2014)

Pseudoalteromonas Unknown Marine organisms (copepod or Undetermined Unknown (Gram et al., 2010; Neu et piscicida fish) or environmental samples al., 2014)

Arthrobacter davidanieli Unknown Marine environmental samples Undetermined Unknown (Wietz et al., 2012; Neu et al., 2014) Pseudoalteromonas Unknown Marine organisms (copepod or Undetermined Unknown (Gram et al., 2010; Neu et luteoviolacea fish) or environmental samples al., 2014)

Photobacterium Unknown Marine organisms (copepod or Undetermined Unknown (Gram et al., 2010; Neu et halotolerans fish) or environmental samples al., 2014)

Table 1.3 Examples of anthelmintic or nematicidal bioactivities isolated from marine eukaryotic organisms

Marine eukaryotic producer Compound Mode of Action Tested nematode Reference Sponge Trachycladus Onnamide F Undetermined Haemonchus contortus (Vuong et al., 2001) laevispirulifer Sponge Oceanapia sp. Thiocyanatins Undetermined Haemonchus contortus (Capon et al., 2004) Sponge Echinodictyum sp (−)-echinobetaine A Undetermined Haemonchus contortus (Capon et al., 2005)

Sponge Phoriospongia sp. Phorioadenine A Undetermined Haemonchus contortus (Farrugia et al., 2014)

Sponge Jaspis sp Jasplakinolide Undetermined Nippostrongylus brasiliensis (Crews et al., 1986) Sponge Monanchora Fromiamycalin and Inhibition of nematode motility and Haemonchus contortus (Herath et al., 2019) unguiculata larval development Sponge Haliclona sp Halaminol A Inhibition of nematode motility and Haemonchus contortus (Herath et al., 2019) larval development Algae Laurencia scoparia Terpene Undetermined Nippostrongylus brasiliensis (Davyt et al., 2006) Algae Chondria atropurpurea Chondriamide C Undetermined Nippostrongylus brasiliensis (Davyt et al., 1998) Algae Notheia anomala Tetrahydrofurans Inhibition of parasites eggs Haemonchus contortus and (Capon et al., 1998) development to the third stage of Trichostrongylus colubriformis infective larvae Bryozoan Bugula neritina Bryostatin-1 Causing defective morphological Syphacia muris (Harras et al., 2017) changes of parasite mouth, anus and cuticle

1.9 Pseudoalteromonas tunicata; a model of surface associated marine bacterium

P. tunicata is a dark-green-pigmented epiphytic bacterium with strong antifouling activity that was originally isolated from an adult tunicate Ciona intestinalis on western coast of Sweden (Holmstrom et al., 1998). Additional strains of P. tunicata exhibiting the same potent antifouling properties have subsequently been isolated from the surface of the green seaweed Ulva australis off the east coast of Australia (Egan et al., 2000). Furthermore, 16S rRNA gene sequences corresponding to P. tunicata have been found in sea ice samples from Antarctic and Artic (Brown and Bowman, 2001), from the Nullarbor Caves, Australia (Holmes et al., 2001) and in association with dinoflagellate blooms in a temperate Australian Estuary (Skerratt et al., 2002). Likewise, based on real-time quantitative PCR (RTQ-PCR) and genus-specific denaturing gradient gel electrophoresis (PCR-DGGE), P. tunicata has been detected colonising the surface of green alga Ulvaria fusca, Ulva lactuca as well as the tunicate C. intestinalis sampled around Aarhus, Denmark (Skovhus et al., 2004; Skovhus et al., 2007). Taxonomically related strains were also found on diverse marine surfaces in Sydney Harbour, Australia (Wilson et al., 2010). Taken together, these studies indicate that P. tunicata is likely to be ubiquitous in the marine environment and predominantly found in association with surfaces.

P. tunicata has arguably become one of the best studied marine surface associated bacterial species due to its production of bioactive compounds with broad spectrum antifouling and antimicrobial activities. These include a purple pigmented indole- based violacein (Matz et al., 2008), tambjamine YP1 (Franks et al., 2005), autolytic protein Pseudoalteromonas (AlpP) (James et al., 1996), formyl-tyrosine compounds with unknown bioactivity (Blasiak and Clardy, 2010) and uncharacterised antidiatom (Holmström et al., 1996; Kumar et al., 2011), antialgal, antilarval (Egan et al., 2001) and fast killing antinematode compounds (Ballestriero et al., 2010) (Figure 1.5).

Figure 1.5 Bioactive compounds produced by the surface associated marine bacterium Pseudoalteromonas tunicata D2. The uncharacterised antinematode compound (indicated by asterisks and coloured in blue box) showing fast killing activity against C. elegans is the subject of this thesis. Figure was designed using Biorender at https://biorender.com/

Violacein, is produced by P. tunicata and other pigmented bacterial species such as Chromobacterium violaceum (Lozano et al., 2020), Pseudoalteromonas byunsanensis, P. shioyasakiensis, P. arabiensis, P. gelatinilytica (Wu et al., 2017) and Microbulbifer sp. (Won et al., 2017). In P. tunicata, the expression of violacein corresponds to its potent antiprotozoal activity against different species of flagellates, ciliates and amoebas (Matz et al., 2008). The expression of violacein is encoded by an 8 kb biosynthetic gene cluster containing five open reading frames (ORFs) (Matz et al., 2008) showing strong sequence similarity to violacein operon vioABCDE in C. violaceum (August et al., 2000; Matz et al., 2008; Kothari et al., 2017). Antiprotozoal effect of violacein produced by P. tunicata has been studied through transposon mutation of the vioA gene which results in defective violacein biosynthesis allowing subsequent degradation of P. tunicata mutant (∆vioA) biofilm by flagellate Rynchomonas nasuta (Matz et al., 2008). Matz et al. observed that violacein accumulates in the periplasm and outer membrane of P. tunicata and proposed that “eating” P. tunicata causes apoptosis and inevitable death of the protozoa (Matz et al., 2008). Violacein production appears to be more prominent in P. tunicata biofilms relative to planktonic growth, which likely represents the underlying mechanism behind biofilm resistance to predatory protozoans (Matz et al., 2008). In addition to the antiprotozoal effect, violacein also shows other bioactivities including antiviral (Andrighetti-Fröhner et al., 2003), anti-dinoflagellates (Matz et al., 2004), antitumor (Queiroz et al., 2012), antinematode (Ballestriero et al., 2014), antibacterial (Aruldass et al., 2018) and antifungal (Sasidharan et al., 2015).

Tambjamine YP1 produced by P. tunicata is a 4-methoxypyrrole molecule possessing a 2,2’-bipyrrole ring system (Franks et al., 2005; Burke et al., 2007; Marchetti et al., 2018). This small molecule (356 Da) is responsible for the inhibitory activity against several fungal and yeast strains (Franks et al., 2006) and in part the antinematode activity of P. tunicata against C. elegans (Ballestriero et al., 2010). Genomic analyses of P. tunicata revealed a 25 kb genomic region containing 21 open reading frames (ORFs) where 19 of the ORFs were designated as core components of the Tam cluster (TamA to TamT) which is responsible for the biosynthesis of the 4-methoxy-2-2’- bipyrrole-5-carbaldehyde (MBC) structure (Burke et al., 2007). Another gene outside of the core Tam cluster; afaA (“antifungal activity A”) produces an acyl-CoA

32 synthetase, which is proposed to activate the long-chain fatty acids CoA thioester (Franks et al., 2006). Both 4-methoxy-2-2’-bipyrrole-5-carbaldehyde (MBC) structure and the long-chain fatty acids (dodec-3-en-1-amine) are condensed together by TamQ (a putative gene expressing terminal condensing enzyme) to become Tambjamine YP1 (Burke et al., 2007). In addition to its antifungal and antinematode effect, tambjamine has been reported possessing other medicinal important activities such as antitumor (Pinkerton et al., 2010) and antimalaria (Kancharla et al., 2015).

P. tunicata also produce AlpP, a novel 190 kDa protein with antibacterial and autolytic activity. This protein consists of two different subunits (60 kDa and 80 kDa) that are combined together by noncovalent bonds (James et al., 1996). A wide range of Gram- positive and Gram-negative bacteria from different habitats including marine, soil, gastrointestinal environment and even the stationary-phase of P. tunicata bacterial cells itself are sensitive to the antibacterial activity of AlpP (James et al., 1996; Mai- Prochnow et al., 2004). While the precise mode of action for AlpP is yet to be determined, the protein itself has homology to marinocine produced by the melanogenic marine bacterium; Marinomonas mediterranea (Lucas-Elío et al., 2006). Further analyses of AlpP and its homolog LodA from M. mediterranea (Lucas-Elio et al., 2005) have demonstrated that both proteins are able to catalyse the oxidation of L- lysine to produce hydrogen peroxide, which eventually causes cell death. Studies on biofilm formation and differentiation in P. tunicata have shown that the production of hydrogen peroxide by AlpP plays an important role in facilitating localised cell death (i.e. autolytic activity) and dispersal stage of the established biofilm (Mai-Prochnow et al., 2004; Mai-Prochnow et al., 2008). The AlpP mediated cell death and biofilm dispersal are thought to be an efficient strategy of P. tunicata to protect the host (i.e. U. lactuca and C. intestinalis) from unrestrained biofilm formation and fouling problem by the P. tunicata cell itself (Mai-Prochnow et al., 2004). As both macroalgae and tunicate hosts are reported to be free from fouling, the controllable biofilm formation by P. tunicata by AlpP is thought to be important in addition to the secretion of antifouling metabolites by P. tunicata, thereby preventing other microfouler settlement (Holmström et al., 1992).

P. tunicata cells also show potent growth inhibition against a number of marine benthic diatoms including Amphora sp. (Holmström et al., 1996) and Cylindrotheca fusiformis (Kumar et al., 2011). While the exact nature of the compound responsible for this activity remains unknown, preliminary evidence suggests the involvement of a non-ribosomal peptide (Stelzer et al., 2006; Kumar, 2008). Transposon mutagenesis of P. tunicata identified a strain (designated DM4) that was no longer able to inhibit diatom growth and was found to be disrupted in a gene (PTD2_0056) located within a large (64 kb) putative non-ribosomal peptide synthetase (NRPS) gene cluster (Kumar, 2008). NRPSs are large multienzyme complexes with assembly-line organisations, which function independently from ribosomal pathway during protein construction. NRPS clusters are found in a range of bacterial and fungal genomes and are responsible for producing peptides with a broad range of activities including antibiotic, immunomodulating and antitumor activities (Caboche et al., 2010; Klapper et al., 2018; Rischer et al., 2018).

A small (3 to 10 kDa), extracellular and polar compound which demonstrates inhibitory activity against algal spores (green alga Ulva lactuca and red alga Polysiphonia sp.) is another bioactive metabolite produced by P. tunicata (Egan et al., 2001). This uncharacterised antialgal compound is water soluble and is believed to be extracellularly secreted by P. tunicata, hence preventing settlement and germination of any potential macroalgal spore on the host surface. A polar antilarval compound (< 500 Da in size) is also produced by P. tunicata which is toxic against barnacle larvae Balanus Amphitrite and ascidian larvae Ciona intestinalis. However, until now, both the active molecule and the genes responsible for the activities remain unknown.

Research conducted in the laboratory of Blasiak and Clardy (Blasiak and Clardy, 2010) resulted in the discovery of two new P. tunicata metabolites identified as 3- formyl-L-tyrosine-L-threonine dipeptide (C14H19N2O6) and 3-formyl-L-tyrosine, both with yet unknown functions. Both compounds are derived from the expression of biosynthetic genes cluster in P. tunicata during the search of sequence homologous to ATP-grasp enzymes in the marine bacterium. A cluster of fty (formyl tyrosine) genes were found on the genome of P. tunicata where the ATP-grasp enzyme FtyB in P. tunicata genome exhibited 30% of similarity to an ATP-grasp-type amide ligase in

34 dapdiamide biosynthesis (DdaF) found in the human pathogen Pantoe agglomerans (Delétoile et al., 2009; Hollenhorst et al., 2009). These new compounds do not possess inhibitory effect against Escherichia coli, Bacillus subtilis and Saccharomyces cerevisiae, however are speculated to have antihypertensive and appetite suppressant properties based on characteristic depicted by similar synthetic compound (Blasiak and Clardy, 2010). Until now, the gene regulation and biosynthetic pathway remain unclear. Ongoing analysis would determine the specific features of these newly isolated compounds.

Additionally, high throughput screening of genomic clone libraries against the model nematode C. elegans revealed two antinematode clones with inserts derived from the genome of P. tunicata (Ballestriero et al., 2010). The activity of one of these antinematode clones (E. coli AA1) was attributed to the yellow pigment tambjamine YP1 (as discussed above) and resulted in 70% death of C. elegans within 5 days exposure to the tambjamine producing clone. Whereas exposure of C. elegans to the second E. coli clone (designated as HG8) killed 70% of the nematodes only within 24 hours and was therefore designated the fast killing activity (Ballestriero et al., 2010). Unlike the heat-stable tambjamine compound produced by the AA11 clone, the cytotoxicity effect of antinematode activity produced by HG8 diminishes after one hour of 65o-heat-treatment, suggesting the denaturation of the unidentified antinematode activity in high environmental temperature (Ballestriero et al., 2010). In order to characterise the nematicidal activity of clone HG8, transposon mutagenesis on the HG8 fosmid was performed and successfully identified a mutant designated as H10 fosmid mutant exhibiting attenuated antinematode activity, resulting from the disruption of an uncharacterised gene (NCBI GenBank accession number ZP_01132244) (Ballestriero et al., 2010). Complementation of mutant Tn::ZP_01132244 with a plasmid carrying P. tunicata wild type gene ZP_01132244 resulted in the restoration of fast killing antinematode activity (Ballestriero et al., 2010). However, expression of ZP_01132244 gene alone did not result in antinematode activity (Ballestriero et al., unpublished data), suggesting other gene(s) located elsewhere on the HG8 fosmid were required for this antinematode activity.

1.10 Aims of study

The increasing prevalence of drug-resistant parasitic nematode infection in humans, animals and plants has been recognised as a global health issue. Current control strategies on parasitic nematodes predominantly rely on drug treatments. Unfortunately, genetic mutations develop in those parasites due to prolonged exposure to a single drug and inappropriate dosage treatment, rendering the parasite drug- resistant. New antinematode drugs are urgently needed, however, the re-discovery rate of bioactive compounds from the terrestrial environment is high and represents a bottleneck for novel antinematode drug development. Owing to the highly diverse macro and microorganisms, the marine environment and particularly surface associated bacteria, provide a promising habitat for antinematode compound discovery and drug research. The surface associated marine bacterium Pseudoalteromonas tunicata D2 has arguably become one of the best studied marine surface associated bacterial species due to the production of compounds with commercially and pharmaceutically-related functions (see section 1.9, Figure 1.5) including the fast killing antinematode activity (Ballestriero et al., 2010). However, this antinematode activity including its mode of action remains uncharacterised. Given the maintenance of parasitic nematodes in the laboratory is challenging and hazardous, Caenorhabditis elegans represent as a powerful model to be used for antinematode compound identification and characterisation. Furthermore, given soil-dwelling and host- associated parasitic nematodes are associated with a natural gut microbiota, utilisation of C. elegans associated with its natural gut microbiota is likely to provide greater insight into the efficacy of antinematode compounds under near-natural conditions.

Therefore, this research project was designed to provide fundamental understanding of the characteristics of the novel fast killing antinematode activity of P. tunicata D2, its mode of action and the impact of gut microbiota association on C. elegans survival upon exposure to the compound toxicity. These goals were achieved using a previously characterised E. coli clone HG8 carrying the 13.8 kb P. tunicata D2 DNA insert that showed the fast killing antinematode activity against C. elegans. The specific aims of this research project were;

1.0 To characterise and identify the bioactive agent responsible for antinematode activity of the clone HG8 (Chapter 2).

2.0 To elucidate the mode of action (MOA) employed by the nematicidal agent producing E. coli clones i.e. HP1 and HG8 against C. elegans and to determine any cellular damage, behavioural and/or immunity responses of the nematode as a result of the clones’ toxic activity (Chapter 3).

3.0 To establish a native gut microbiota in C. elegans N2-laboratory cultures and subsequently determine what impact this microbiota has on the sensitivity of C. elegans to the E. coli clones HP1 and HG8 (Chapter 4).

4.0 To summarise and provide comprehensive discussion of the major discoveries in this study and highlight the future perspective for subsequent research development (Chapter 5).

1.11 REFERENCES

Abad, P., Gouzy, J., Aury, J.-M., Castagnone-Sereno, P., Danchin, E. G. J., Deleury, E., Perfus-Barbeoch, L., Anthouard, V., Artiguenave, F., Blok, V. C., Caillaud, M.- C., Coutinho, P. M., Dasilva, C., De Luca, F., Deau, F., Esquibet, M., Flutre, T., Goldstone, J. V., Hamamouch, N., Hewezi, T., Jaillon, O., Jubin, C., Leonetti, P., Magliano, M., Maier, T. R., Markov, G. V., McVeigh, P., Pesole, G., Poulain, J., Robinson-Rechavi, M., Sallet, E., Ségurens, B., Steinbach, D., Tytgat, T., Ugarte, E., van Ghelder, C., Veronico, P., Baum, T. J., Blaxter, M., Bleve-Zacheo, T., Davis, E. L., Ewbank, J. J., Favery, B., Grenier, E., Henrissat, B., Jones, J. T., Laudet, V., Maule, A. G., Quesneville, H., Rosso, M.-N., Schiex, T., Smant, G., Weissenbach, J., & Wincker, P. (2008). Genome sequence of the metazoan plant- parasitic nematode Meloidogyne incognita. Nature Biotechnology, 26(8), 909- 915. Aballay, A., Drenkard, E., Hilbun, L. R., & Ausubel, F. M. (2003). Caenorhabditis elegans innate immune response triggered by Salmonella enterica requires intact LPS and is mediated by a MAPK signaling pathway. Current Biology, 13(1), 47- 52. Abongwa, M., Martin, R. J., & Robertson, A. P. (2017). A brief review on the mode of action of antinematodal drugs. Acta Veterinaria, 67(2), 137-152. Adnan, M., Alshammari, E., Patel, M., Ashraf, S. A., Khan, S., & Hadi, S. (2018). Significance and potential of marine microbial natural bioactive compounds against biofilms/biofouling: necessity for green chemistry. PeerJ, 6, e5049. Aibinu, I. E., Smooker, P. M., & Lopata, A. L. (2019). Anisakis nematodes in fish and shellfish- from infection to allergies. International Journal for Parasitology. Parasites and wildlife, 9, 384-393. Akinsolu, F. T., Nemieboka, P. O., Njuguna, D. W., Ahadji, M. N., Dezso, D., & Varga, O. (2019). Emerging resistance of neglected tropical diseases: a scoping review of the literature. International Journal of Environmental Research and Public Health, 16(11). Amenya, D. A., Naguran, R., Lo, T. C., Ranson, H., Spillings, B. L., Wood, O. R., Brooke, B. D., Coetzee, M., & Koekemoer, L. L. (2008). Over expression of a cytochrome P450 (CYP6P9) in a major African malaria vector, Anopheles funestus, resistant to pyrethroids. Insect Molecular Biology, 17(1), 19-25. Andrighetti-Fröhner, C., Antonio, R., Creczynski-Pasa, T., Barardi, C., & Simões, C. (2003). Cytotoxicity and potential antiviral evaluation of violacein produced by Chromobacterium violaceum. Memórias do Instituto Oswaldo Cruz, 98(6), 843- 848. Angstadt, J. D., Donmoyer, J. E., & Stretton, A. O. (1989). Retrovesicular ganglion of the nematode Ascaris. The Journal of Comparative Neurology, 284(3), 374-388. Antunes, J., Leão, P., & Vasconcelos, V. (2019). Marine biofilms: Diversity of communities and of chemical cues. Environmental Microbiology Reports, 11(3), 287-305. Armstrong, E., Yan, L., Boyd, K. G., Wright, P. C., & Burgess, J. G. (2001). The symbiotic role of marine microbes on living surfaces. Hydrobiologia, 461(1-3), 37-40.

Artal‐Sanz, M., de Jong, L., & Tavernarakis, N. (2006). Caenorhabditis elegans: a versatile platform for drug discovery. Biotechnology Journal: Healthcare Nutrition Technology, 1(12), 1405-1418. Aruldass, C. A., Masalamany, S. R. L., Venil, C. K., & Ahmad, W. A. (2018). Antibacterial mode of action of violacein from Chromobacterium violaceum UTM5 against Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA). Environmental Science and Pollution Research, 25(6), 5164- 5180. Ashford, R., & Crewe, W. (2003). Parasites of Homo sapiens: An Annotated Checklist of the Protozoa, Helminths and Arthropods for which we are Home: CRC Press. Askary, T. H., & Martinelli, P. R. P. (2015). Biocontrol agents of phytonematodes: CABI. August, P., Grossman, T., Minor, C., Draper, M., MacNeil, I., Pemberton, J., Call, K., Holt, D., & Osburne, M. (2000). Sequence analysis and functional characterization of the violacein biosynthetic pathway from Chromobacterium violaceum. Journal of Molecular Microbiology and Biotechnology, 2(4), 513-519. Bai, Y., Zhi, D., Li, C., Liu, D., Zhang, J., Tian, J., Wang, X., Ren, H., & Li, H. (2014). Infection and immune response in the nematode Caenorhabditis elegans elicited by the phytopathogen Xanthomonas. Journal of Microbiology and Biotechnology, 24(9), 1269-1279. Ballestriero, F., Daim, M., Penesyan, A., Nappi, J., Schleheck, D., Bazzicalupo, P., Di Schiavi, E., & Egan, S. (2014). Antinematode activity of Violacein and the role of the insulin/IGF-1 pathway in controlling violacein sensitivity in Caenorhabditis elegans. PloS One, 9(10), e109201-e109201. Ballestriero, F., Thomas, T., Burke, C., Egan, S., & Kjelleberg, S. (2010). Identification of compounds with bioactivity against the nematode Caenorhabditis elegans by a screen based on the functional genomics of the marine bacterium Pseudoalteromonas tunicata D2. Applied and Environmental Microbiology, 76(17), 5710-5717. Bañuls, A.-L., Thomas, F., & Renaud, F. (2013). Of parasites and men. Infection, Genetics and Evolution, 20, 61-70. Bar-On, Y. M., Phillips, R., & Milo, R. (2018). The biomass distribution on Earth. Proceedings of the National Academy of Sciences, USA 115(25), 6506-6511. Basyoni, M. M., & Rizk, E. M. (2016). Nematodes ultrastructure: complex systems and processes. Journal of Parasitic Diseases, 40(4), 1130-1140. Battisti, J. M., Watson, L. A., Naung, M. T., Drobish, A. M., Voronina, E., & Minnick, M. F. (2017). Analysis of the Caenorhabditis elegans innate immune response to Coxiella burnetii. Innate immunity, 23(2), 111-127. Bérdy, J. (2005). Bioactive microbial metabolites. The Journal of Antibiotics, 58(1), 1- 26. Berg, M., Stenuit, B., Ho, J., Wang, A., Parke, C., Knight, M., Alvarez-Cohen, L., & Shapira, M. (2016). Assembly of the Caenorhabditis elegans gut microbiota from diverse soil microbial environments. The ISME Journal, 10(8), 1998-2009. Berman, K., McKay, J., Avery, L., & Cobb, M. (2001). Isolation and characterization of pmk-(1-3): three p38 homologs in Caenorhabditis elegans. Molecular Cell Biology Research Communications : MCBRC, 4(6), 337-344. Bernard, G. C., Egnin, M., & Bonsi, C. (2017). The impact of plant-parasitic nematodes on agriculture and methods of control. In Shah, M. M. and Mahamood, M. (Ed.), Nematology-Concepts, Diagnosis and Control, IntechOpen, doi: 10.5772/intechopen.68958.

Besier, R., & Love, S. (2003). Anthelmintic resistance in sheep nematodes in Australia: the need for new approaches. Australian Journal of Experimental Agriculture, 43(12), 1383-1391. Beuvry, V., Bufala, G., & Derrieu, G. (2003). Injectable anthelmintic compositions and methods for using same. U.S. Patent No. US6653288B1. Washington, DC: U.S. Patent and Trademark Office. Bik, H. M., Lambshead, P. J. D., Thomas, W. K., & Lunt, D. H. (2010). Moving towards a complete molecular framework of the Nematoda: a focus on the Enoplida and early-branching clades. BMC Evolutionary Biology, 10(1), 353. Blasco-Costa, I., & Poulin, R. (2017). Parasite life-cycle studies: a plea to resurrect an old parasitological tradition. Journal of Helminthology, 91(6), 647-656. Blasiak, L. C., & Clardy, J. (2010). Discovery of 3-formyl-tyrosine metabolites from Pseudoalteromonas tunicata through heterologous expression. Journal of the American Chemical Society, 132(3), 926-927. Blaxter, M., & Koutsovoulos, G. (2015). The evolution of parasitism in Nematoda. Parasitology, 142(S1), S26-S39. Blockley, A., Elliott, D. R., Roberts, A. P., & Sweet, M. (2017). Symbiotic microbes from marine invertebrates: driving a new era of natural product drug discovery. Diversity, 9(4), 49. Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71-94. Brown, M. V., & Bowman, J. P. (2001). A molecular phylogenetic survey of sea-ice microbial communities (SIMCO). FEMS Microbiol Ecology, 35(3), 267-275. Bryant, A. S., Ruiz, F., Gang, S. S., Castelletto, M. L., Lopez, J. B., & Hallem, E. A. (2018). A critical role for thermosensation in host seeking by skin-penetrating nematodes. Current Biology, 28(14), 2338-2347.e2336. Buchmann, K., & Bjerregaard, P. (1990). Effect of ivermectin, pyrantel and morantel on the European eel and its monogenean parasites. Bulletin-European Association of Fish Pathologists, 10(5), 146-148. Bundy, D. A., de Silva, N., Appleby, L. J., & Brooker, S. J. (2020). Intestinal Nematodes: Ascariasis. In Hunter's Tropical Medicine and Emerging Infectious Diseases (pp. 840-844): Elsevier. Burg, R. W., Miller, B. M., Baker, E. E., Birnbaum, J., Currie, S. A., Hartman, R., Kong, Y. L., Monaghan, R. L., Olson, G., Putter, I., Tunac, J. B., Wallick, H., Stapley, E. O., Oiwa, R., & Omura, S. (1979). Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrobial Agents and Chemotherapy, 15(3), 361-367. Burke, C., Thomas, T., Egan, S., & Kjelleberg, S. (2007). The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata. Environmental Microbiology, 9(3), 814-818. Burns, A. R., Luciani, G. M., Musso, G., Bagg, R., Yeo, M., Zhang, Y., Rajendran, L., Glavin, J., Hunter, R., Redman, E., Stasiuk, S., Schertzberg, M., Angus McQuibban, G., Caffrey, C. R., Cutler, S. R., Tyers, M., Giaever, G., Nislow, C., Fraser, A. G., MacRae, C. A., Gilleard, J., & Roy, P. J. (2015). Caenorhabditis elegans is a useful model for anthelmintic discovery. Nature Communications, 6, 7485-7485. Caboche, S., Leclère, V., Pupin, M., Kucherov, G., & Jacques, P. (2010). Diversity of monomers in nonribosomal peptides: towards the prediction of origin and biological activity. Journal of Bacteriology, 192(19), 5143.

Capon, R. J., A Barrow, R., Rochfort, S., Jobling, M., Skene, C., Lacey, E., H Gill, J., Friedel, T., & Wadsworth, D. (1998). Marine nematocides: Tetrahydrofurans from a southern Australian brown alga, Notheia anomala. Tetrahedron, 54(10), 2227-2242. Capon, R. J., Skene, C., Liu, E. H.-T., Lacey, E., Gill, J. H., Heiland, K., & Friedel, T. (2004). Nematocidal thiocyanatins from a southern Australian marine sponge Oceanapia sp. Journal of Natural Products, 67(8), 1277-1282. Capon, R. J., Vuong, D., McNally, M., Peterle, T., Trotter, N., Lacey, E., & Gill, J. H. (2005). (+)-Echinobetaine B: isolation, structure elucidation, synthesis and preliminary SAR studies on a new nematocidal betaine from a southern Australian marine sponge, Echinodictyum sp. Organic & Biomolecular Chemistry, 3(1), 118- 122. Cezairliyan, B., Vinayavekhin, N., Grenfell-Lee, D., Yuen, G. J., Saghatelian, A., & Ausubel, F. M. (2013). Identification of Pseudomonas aeruginosa phenazines that kill Caenorhabditis elegans. PLoS Pathogens, 9(1), e1003101. Chávez, V., Mohri-Shiomi, A., Maadani, A., Vega, L. A., & Garsin, D. A. (2007). Oxidative stress enzymes are required for DAF-16-mediated immunity due to generation of reactive oxygen species by Caenorhabditis elegans. Genetics, 176(3), 1567-1577. Chen, L., Jiang, H., Cheng, Q., Chen, J., Wu, G., Kumar, A., Sun, M., & Liu, Z. (2015). Enhanced nematicidal potential of the chitinase pachi from Pseudomonas aeruginosa in association with Cry21Aa. Scientific Reports, 5, 14395. Chiu, J. M. Y., Thiyagarajan, V., Tsoi, M. M. Y., & Qian, P. Y. (2005). Qualitative and quantitative changes in marine biofilms as a function of temperature and salinity in summer and winter. Biofilms, 2(3), 183-195. Cobo, F. (2016). Determinants of parasite drug resistance in human lymphatic filariasis. Revista Española de Quimioterapia, 29(6), 288-295. Conlan, J. V., Khamlome, B., Vongxay, K., Elliot, A., Pallant, L., Sripa, B., Blacksell, S. D., Fenwick, S., & Thompson, R. C. (2012). Soil-transmitted helminthiasis in Laos: a community-wide cross-sectional study of humans and dogs in a mass drug administration environment. The American Journal of Tropical Medicine and Hygiene, 86(4), 624-634. Costello, M. J., Cheung, A., & De Hauwere, N. (2010). Surface area and the seabed area, volume, depth, slope, and topographic variation for the world’s seas, oceans, and countries. Environmental Science & Technology, 44(23), 8821-8828. Cox, F. E. G. (2004). History of human parasitic diseases. Infectious Disease Clinics of North America, 18(2), 171-188. doi:https://doi.org/10.1016/j.idc.2004.01.001 Crews, P., Manes, L. V., & Boehler, M. (1986). Jasplakinolide, a cyclodepsipeptide from the marine sponge, Jaspis sp. Tetrahedron Letters, 27(25), 2797-2800. Dang, H., & Lovell, C. R. (2016). Microbial surface colonization and biofilm development in marine environments. Microbiology and Molecular Biology Reviews, 80(1), 91-138. Davis, R. (1998). Neurophysiology of glutamatergic signalling and anthelmintic action in Ascaris suum: pharmacological evidence for a kainate receptor. Parasitology, 116(5), 471-486. Davyt, D., Entz, W., Fernandez, R., Mariezcurrena, R., Mombrú, A. W., Saldana, J., Domínguez, L., Coll, J., & Manta, E. (1998). A new indole derivative from the red alga Chondria atropurpurea. Isolation, structure determination, and anthelmintic activity. Journal of Natural Products, 61(12), 1560-1563.

Davyt, D., Fernandez, R., Suescun, L., Mombrú, A. W., Saldaña, J., Domínguez, L., Fujii, M. T., & Manta, E. (2006). Bisabolanes from the Red Alga Laurencia scoparia. Journal of Natural Products, 69(7), 1113-1116. de Carvalho, C. C. (2018). Marine biofilms: a successful microbial strategy with economic implications. Frontiers in Marine Science, 5, 126. De Corte, D., Paredes, G., Yokokawa, T., Sintes, E., & Herndl, G. J. (2019). Differential response of Cafeteria roenbergensis to different bacterial and archaeal prey characteristics. Microbial Ecology, 78(1), 1-5. Delétoile, A., Decré, D., Courant, S., Passet, V., Audo, J., Grimont, P., Arlet, G., & Brisse, S. (2009). Phylogeny and identification of Pantoea Species and typing of Pantoea agglomerans strains by multilocus gene sequencing. Journal of Clinical Microbiology, 47(2), 300. Dell’Anno, A., Carugati, L., Corinaldesi, C., Riccioni, G., & Danovaro, R. (2015). Unveiling the biodiversity of deep-sea nematodes through metabarcoding: are we ready to bypass the classical taxonomy? PloS One, 10(12), e0144928. Devaraj, S., Amirthalingam, M., Sabapathy, P. C., Govindan, S., Palanisamy, S., & Kathirvel, P. (2019). Anthelmintic efficacy of glycolipid biosurfactant produced by Pseudomonas plecoglossicida: an insight from mutant and transgenic forms of Caenorhabditis elegans. Biodegradation, 30(4), 203-214. Diemert, D. J., Freire, J., Valente, V., Fraga, C. G., Talles, F., Grahek, S., Campbell, D., Jariwala, A., Periago, M. V., & Enk, M. (2017). Safety and immunogenicity of the Na-GST-1 hookworm vaccine in Brazilian and American adults. PLoS Neglected Tropical Diseases, 11(5), e0005574. Dirksen, P., Marsh, S. A., Braker, I., Heitland, N., Wagner, S., Nakad, R., Mader, S., Petersen, C., Kowallik, V., Rosenstiel, P., Félix, M.-A., & Schulenburg, H. (2016). The native microbiome of the nematode Caenorhabditis elegans: gateway to a new host-microbiome model. BMC Biology, 14(1), 38. Drake, J., & Carey, T. (2019). Seasonality and changing prevalence of common canine gastrointestinal nematodes in the USA. Parasites & Vectors, 12(1), 430. Driscoll, M., Dean, E., Reilly, E., Bergholz, E., & Chalfie, M. (1989). Genetic and molecular analysis of a Caenorhabditis elegans beta-tubulin that conveys benzimidazole sensitivity. Journal of Cell Biology, 109(6 Pt 1), 2993-3003. Dutta, T. K., Khan, M. R., & Phani, V. (2019). Plant-parasitic nematode management via biofumigation using brassica and non-brassica plants: Current status and future prospects. Current Plant Biology, 17, 17-32. Eberhard, M. L., Cleveland, C. A., Zirimwabagabo, H., Yabsley, M. J., Ouakou, P. T., & Ruiz-Tiben, E. (2016). Guinea Worm (Dracunculus medinensis) Infection in a wild-caught frog, Chad. Emerging Infectious Diseases, 22(11), 1961-1962. Egan, S., Harder, T., Burke, C., Steinberg, P., Kjelleberg, S., & Thomas, T. (2013). The seaweed holobiont: understanding seaweed–bacteria interactions. FEMS Microbiology Reviews, 37(3), 462-476. Egan, S., James, S., Holmstrom, C., & Kjelleberg, S. (2001). Inhibition of algal spore germination by the marine bacterium Pseudoalteromonas tunicata. FEMS Microbial Ecology, 35(1), 67-73. Egan, S., Thomas, T., Holmström, C., & Kjelleberg, S. (2000). Phylogenetic relationship and antifouling activity of bacterial epiphytes from the marine alga Ulva lactuca: brief report. Environmental Microbiology, 2(3), 343-347. Elfawal, M. A., Savinov, S. N., & Aroian, R. V. (2019). Drug screening for discovery of broad-spectrum agents for soil-transmitted nematodes. Scientific Reports, 9(1), 12347. 42

Elseadawy, R., Abbas, I., Al-Araby, M., Hildreth, M. B., & Abu-Elwafa, S. (2019). First evidence of Teladorsagia circumcincta infection in sheep from Egypt. Journal of Parasitology, 105(4), 484-490. Enejoh, O., & Suleiman, M. (2017). Anthelmintics and their application in veterinary medicine. Research in Medical & Engineering Sciences, 2(3). RMES.000536. Engelmann, I., & Pujol, N. (2010). Innate immunity in C. elegans. In Invertebrate Immunity (pp. 105-121): Springer. Ermolaeva, M. A., & Schumacher, B. (2014). Insights from the worm: the C. elegans model for innate immunity. Seminars in Immunology, 26(4), 303-309. Evans, E. A., Chen, W. C., & Tan, M. W. (2008). The DAF-2 insulin-like signaling pathway independently regulates aging and immunity in C. elegans. Aging Cell, 7(6), 879-893. Ezeamama, A. E., Friedman, J. F., Acosta, L. P., Bellinger, D. C., Langdon, G. C., Manalo, D. L., Olveda, R. M., Kurtis, J. D., & McGarvey, S. T. (2005). Helminth infection and cognitive impairment among Filipino children. The American Journal of Tropical Medicine and Hygiene, 72(5), 540-548. Farrugia, M., Trotter, N., Vijayasarathy, S., Salim, A. A., Khalil, Z. G., Lacey, E., & Capon, R. J. (2014). Isolation and synthesis of N-acyladenine and adenosine alkaloids from a southern Australian marine sponge, Phoriospongia sp. Tetrahedron Letters, 55(43), 5902-5904. Fenical, W., & Jensen, P. R. (2006). Developing a new resource for drug discovery: marine actinomycete bacteria. Nature Chemical Biology, 2(12), 666-673. Ferris, H. (2010). Contribution of nematodes to the structure and function of the soil food web. Journal of Nematology, 42(1), 63-67. Flemming, H.-C., & Wuertz, S. (2019). Bacteria and archaea on Earth and their abundance in biofilms. Nature Reviews Microbiology, 17(4), 247-260. Fox, N. J., Marion, G., Davidson, R. S., White, P. C., & Hutchings, M. R. (2015). Climate- driven tipping-points could lead to sudden, high-intensity parasite outbreaks. Royal Society Open Science, 2(5), 140296. Fraietta, I., & Gasparri, F. (2016). The development of high-content screening (HCS) technology and its importance to drug discovery. Expert Opinion on Drug Discovery, 11(5), 501-514. Franks, A., Egan, S., Holmström, C., James, S., Lappin-Scott, H., & Kjelleberg, S. (2006). Inhibition of fungal colonization by Pseudoalteromonas tunicata provides a competitive advantage during surface colonization. Applied and Environmental Microbiology, 72(9), 6079-6087. Franks, A., Haywood, P., Holmstrom, C., Egan, S., Kjelleberg, S., & Kumar, N. (2005). Isolation and structure elucidation of a novel yellow pigment from the marine bacterium Pseudoalteromonas tunicata. Molecules, 10(10), 1286-1291. Frean, J. (2020). Gnathostomiasis acquired by visitors to the Okavango Delta, Botswana. Tropical Medicine and Infectious Disease, 5(1), 39. Frézal, L., & Félix, M.-A. (2015). C. elegans outside the Petri dish. eLife, 4, e05849. Gadisa, E., & Jote, K. (2019). Prevalence and factors associated with intestinal parasitic infection among under-five children in and around Haro Dumal Town, Bale Zone, Ethiopia. BMC Pediatrics, 19(1), 385. Galbadage, T., Shepherd, T. F., Cirillo, S. L. G., Gumienny, T. L., & Cirillo, J. D. (2016). The Caenorhabditis elegans p38 MAPK gene plays a key role in protection from mycobacteria. MicrobiologyOpen, 5(3), 436-452.

Garcia-Bustos, J. F., Sleebs, B. E., & Gasser, R. B. (2019). An appraisal of natural products active against parasitic nematodes of animals. Parasites & Vectors, 12(1), 306. Garsin, D. A., Villanueva, J. M., Begun, J., Kim, D. H., Sifri, C. D., Calderwood, S. B., Ruvkun, G., & Ausubel, F. M. (2003). Long-lived C. elegans daf-2 mutants are resistant to bacterial pathogens. Science, 300(5627), 1921. Gaudêncio, S. P., & Pereira, F. (2015). Dereplication: racing to speed up the natural products discovery process. Natural Product Reports, 32(6), 779-810. Gebremikael, M. T., Steel, H., Buchan, D., Bert, W., & De Neve, S. (2016). Nematodes enhance plant growth and nutrient uptake under C and N-rich conditions. Scientific Reports, 6, 32862-32862. Geerts, S., & Gryseels, B. (2000). Drug Resistance in Human Helminths: Current situation and lessons from livestock. Clinical Microbiology Reviews, 13(2), 207. Gerbaba, T. K., Green-Harrison, L., & Buret, A. G. (2017). Modeling host-microbiome interactions in Caenorhabditis elegans. Journal of Nematology, 49(4), 348-356. Gilleard, J. S. (2006). Understanding anthelmintic resistance: the need for genomics and genetics. International Journal for Parasitology, 36(12), 1227-1239. Giovanelli, F., Mattellini, M., Fichi, G., Flamini, G., & Perrucci, S. (2018). In vitro anthelmintic activity of four plant-derived compounds against sheep gastrointestinal nematodes. Veterinary Sciences, 5(3), 78. Goodman, M. B., & Sengupta, P. (2019). How Caenorhabditis elegans senses mechanical stress, temperature, and other physical stimuli. Genetics, 212(1), 25-51. Gram, L., Melchiorsen, J., & Bruhn, J. B. (2010). Antibacterial activity of marine culturable bacteria collected from a global sampling of ocean surface waters and surface swabs of marine organisms. Marine Biotechnology, 12(4), 439-451. Griffitts, J. S., Haslam, S. M., Yang, T., Garczynski, S. F., Mulloy, B., Morris, H., Cremer, P. S., Dell, A., Adang, M. J., & Aroian, R. V. (2005). Glycolipids as receptors for Bacillus thuringiensis crystal toxin. Science, 307(5711), 922-925. Gu, Y.-Q., Mo, M.-H., Zhou, J.-P., Zou, C.-S., & Zhang, K.-Q. (2007). Evaluation and identification of potential organic nematicidal volatiles from soil bacteria. Soil Biology and Biochemistry, 39(10), 2567-2575. Haas, A. F., & Wild, C. (2010). Composition analysis of organic matter released by cosmopolitan coral reef-associated green algae. Aquatic Biology, 10(2), 131-138. Haber, C. L., Heckaman, C. L., Li, G. P., Thompson, D. P., Whaley, H., & Wiley, V. (1991). Development of a mechanism of action-based screen for anthelmintic microbial metabolites with avermectinlike activity and isolation of milbemycin- producing Streptomyces strains. Antimicrobial Agents and Chemotherapy, 35(9), 1811-1817. Halaschek-Wiener, J., Khattra, J. S., McKay, S., Pouzyrev, A., Stott, J. M., Yang, G. S., Holt, R. A., Jones, S. J., Marra, M. A., & Brooks-Wilson, A. R. (2005). Analysis of long-lived C. elegans daf-2 mutants using serial analysis of gene expression. Genome Research, 15(5), 603-615. Haldeman, M. S., Nolan, M. S., & Ng'habi, K. R. N. (2020). Human hookworm infection: Is effective control possible? A review of hookworm control efforts and future directions. Acta Tropica, 201, 105214. Harras, S. F., Mona, M. H., Abdalla, A. G., & Salim, E. I. (2017). Effect of bryostatin-1 as an anthelmintic drug on adult Syphacia muris infection in rats. The Journal of Basic and Applied Zoology, 78(1), 8.

Hassan, M. A., Pham, T. H., Shi, H., & Zheng, J. (2013). Nematodes threats to global food security. Acta Agriculturae Scandinavica, Section B — Soil & Plant Science, 63(5), 420-425. Hasshoff, M., Böhnisch, C., Tonn, D., Hasert, B., & Schulenburg, H. (2007). The role of Caenorhabditis elegans insulin-like signaling in the behavioral avoidance of pathogenic Bacillus thuringiensis. The FASEB Journal, 21(8), 1801-1812. Hawdon, J. M. (2014). Controlling soil-transmitted helminths: time to think inside the box? Journal of Parasitology, 100(2), 166-188. Hendy, A., Krüger, A., Pfarr, K., De Witte, J., Kibweja, A., Mwingira, U., Dujardin, J.- C., Post, R., Colebunders, R., O’Neill, S., & Kalinga, A. (2018). The blackfly vectors and transmission of Onchocerca volvulus in Mahenge, south eastern Tanzania. Acta Tropica, 181, 50-59. Herath, H. M. P. D., Preston, S., Jabbar, A., Garcia-Bustos, J., Taki, A. C., Addison, R. S., Hayes, S., Beattie, K. D., McGee, S. L., Martin, S. D., Ekins, M. G., Hooper, J. N. A., Chang, B. C. H., Hofmann, A., Davis, R. A., & Gasser, R. B. (2019). Identification of Fromiamycalin and Halaminol A from Australian marine sponge extracts with anthelmintic activity against Haemonchus contortus. Marine Drugs, 17(11), 598. Hernando, G., Turani, O., & Bouzat, C. (2019). Caenorhabditis elegans muscle Cys-loop receptors as novel targets of terpenoids with potential anthelmintic activity. PLOS Neglected Tropical Diseases, 13(11), e0007895. Hisatugo, K. F., Mansano, A. S., & Seleghim, M. H. (2014). Protozoans bacterivory in a subtropical environment during a dry/cold and a rainy/warm season. Brazilian Journal of Microbiology, 45(1), 145-151. Hodda, M., Peters, L., & Traunspurger, W. (2009). Nematode diversity in terrestrial, freshwater aquatic and marine systems. Nematodes as Environmental Indicators. CAB International, 45-93. Hogan, G., Walker, S., Turnbull, F., Curiao, T., Morrison, A. A., Flores, Y., Andrews, L., Claesson, M. J., Tangney, M., & Bartley, D. J. (2019). Microbiome analysis as a platform R&D tool for parasitic nematode disease management. The ISME Journal, 13(11), 2664-2680. Holden-Dye, L., & Walker, R. (2014). Anthelmintic drugs and nematocides: studies in Caenorhabditis elegans. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at http://www.wormbook.org/chapters/www_anthelminticdrugs.2/anthelminticdrug s.2.html. Hollenhorst, M. A., Clardy, J., & Walsh, C. T. (2009). The ATP-dependent amide ligases DdaG and DdaF assemble the fumaramoyl-dipeptide scaffold of the dapdiamide antibiotics. Biochemistry, 48(43), 10467-10472. Holmes, A. J., Tujula, N. A., Holley, M., Contos, A., James, J. M., Rogers, P., & Gillings, M. R. (2001). Phylogenetic structure of unusual aquatic microbial formations in Nullarbor caves, Australia. Environmental Microbiology, 3(4), 256-264. Holmström, C., James, S., Egan, S., & Kjelleberg, S. (1996). Inhibition of common fouling organisms by marine bacterial isolates ith special reference to the role of pigmented bacteria. Biofouling, 10(1-3), 251-259. Holmstrom, C., James, S., Neilan, B. A., White, D. C., & Kjelleberg, S. (1998). Pseudoalteromonas tunicata sp. nov., a bacterium that produces antifouling agents. International Journal of Systematic Bacteriology, 48(4), 1205-1212.

Holmström, C., Rittschof, D., & Kjelleberg, S. (1992). Inhibition of settlement by larvae of Balanus amphitrite and Ciona intestinalis by a surface-colonizing marine bacterium. Applied and Environmental Microbiology, 58(7), 2111. Hu, P. J. (2018). Dauer. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at http://www.wormbook.org/chapters/www_dauer/dauer.html. Hutton, G., & Bartram, J. (2008). Global costs of attaining the Millennium Development Goal for water supply and sanitation. Bulletin of the World Health Organization, 86, 13-19. Irazoqui, J. E., Urbach, J. M., & Ausubel, F. M. (2010). Evolution of host innate defence: insights from Caenorhabditis elegans and primitive invertebrates. Nature Reviews Immunology, 10(1), 47. James, S. G., Holmström, C., & Kjelleberg, S. (1996). Purification and characterization of a novel antibacterial protein from the marine bacterium D2. Applied and Environmental Microbiology, 62(8), 2783-2788. Jia, K., Thomas, C., Akbar, M., Sun, Q., Adams-Huet, B., Gilpin, C., & Levine, B. (2009). Autophagy genes protect against Salmonella typhimurium infection and mediate insulin signaling-regulated pathogen resistance. Proceedings of the National Academy of Sciences of the USA, 106(34), 14564-14569. Johnson, C. D., & Stretton, A. O. (1985). Localization of choline acetyltransferase within identified motoneurons of the nematode Ascaris. The Journal of Neuroscience, 5(8), 1984-1992. Johnson, C. D., & Stretton, A. O. (1987). GABA-immunoreactivity in inhibitory motor neurons of the nematode Ascaris. The Journal of Neuroscience, 7(1), 223. Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T., Manzanilla‐López, R., Palomares‐Rius, J. E., & Wesemael, W. M. (2013). Top 10 plant‐parasitic nematodes in molecular plant pathology. Molecular Plant Pathology, 14(9), 946-961. Jourdan, P. M., Lamberton, P. H. L., Fenwick, A., & Addiss, D. G. (2018). Soil- transmitted helminth infections. The Lancet, 391(10117), 252-265. Kaminsky, R., Ducray, P., Jung, M., Clover, R., Rufener, L., Bouvier, J., Weber, S. S., Wenger, A., Wieland-Berghausen, S., & Goebel, T. (2008). A new class of anthelmintics effective against drug-resistant nematodes. Nature, 452(7184), 176. Kanase, H., & Singh, K. N. (2018). Marine pharmacology: Potential, challenges, and future in India. Journal of Medical Sciences, 38(2), 49-53. Kancharla, P., Kelly, J. X., & Reynolds, K. A. (2015). Synthesis and structure–activity relationships of tambjamines and B-ring functionalized prodiginines as potent antimalarials. Journal of Medicinal Chemistry, 58(18), 7286-7309. Kaplan, J. M., & Horvitz, H. R. (1993). A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the USA, 90(6), 2227-2231. Kaplan, R. M., & Vidyashankar, A. N. (2012). An inconvenient truth: Global worming and anthelmintic resistance. Veterinary Parasitology, 186(1), 70-78. Karp, X. (2018). Working with dauer larvae. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at https://www.ncbi.nlm.nih.gov/books/NBK535516/. Kassie, Y. G., Yesuf, Ebrahim, A. S. & Mohamed, M. Y. (2020). Interaction effect between Meloidogyne incognita and Fusarium oxysporum f. sp. lycopersici on selected tomato (Solanum lycopersicum L.) genotypes. African Journal of Agricultural Research, 15(3), pp. 330-342. 46

Katharios-Lanwermeyer, S., Xi, C., Jakubovics, N., & Rickard, A. (2014). Mini-review: microbial coaggregation: ubiquity and implications for biofilm development. Biofouling, 30(10), 1235-1251. Kergunteuil, A., Campos-Herrera, R., Sánchez-Moreno, S., Vittoz, P., & Rasmann, S. (2016). The abundance, diversity, and metabolic footprint of soil nematodes is highest in high elevation alpine grasslands. Frontiers in Ecology and Evolution, 4, 84. Kiani, H., Haghighi, A., Rostami, A., Azargashb, E., TABAEI, S. J. S., Solgi, A., & Zebardast, N. (2016). Prevalence, risk factors and symptoms associated to intestinal parasite infections among patients with gastrointestinal disorders in Nahavand, Western Iran. Revista do Instituto de Medicina Tropical de São Paulo, 58:42. Kissoyan, K. A. B., Drechsler, M., Stange, E.-L., Zimmermann, J., Kaleta, C., Bode, H. B., & Dierking, K. (2019). Natural C. elegans microbiota protects against infection via production of a cyclic lipopeptide of the viscosin group. Current Biology, 29(6), 1030-1037.e1035. Klapper, M., Braga, D., Lackner, G., Herbst, R., & Stallforth, P. (2018). Bacterial alkaloid biosynthesis: structural diversity via a minimalistic nonribosomal peptide synthetase. Cell Chemical Biology, 25(6), 659-665. Kobayashi, M., Aoki, S., Gato, K., Matsunami, K., Kurosu, M., & Kitigawa, I. (1994). Marine natural products. XXXIV. Trisindoline, a new antibiotic indole trimer, produced by a bacterium of Vibrio sp. separated from the marine sponge Hyrtios altum. Chemical and Pharmaceutical Bulletin, 42(12), 2449-2451. Kong, C., Eng, S.-A., Lim, M.-P., & Nathan, S. (2016). Beyond traditional antimicrobials: A Caenorhabditis elegans model for discovery of novel anti-infectives. Frontiers in Microbiology, 7, 1956. Kong, D.-X., Jiang, Y.-Y., & Zhang, H.-Y. (2010). Marine natural products as sources of novel scaffolds: Achievement and concern. Drug Discovery Today, 15(21- 22):884-6. König, G. M., Kehraus, S., Seibert, S. F., Abdel‐Lateff, A., & Müller, D. (2006). Natural products from marine organisms and their associated microbes. ChemBioChem, 7(2), 229-238. Kothari, V., Sharma, S., & Padia, D. (2017). Recent research advances on Chromobacterium violaceum. Asian Pacific Journal of Tropical Medicine, 10(8), 744-752. Kumar, V., Rao, D., Thomas, T., Kjelleberg, S., & Egan, S. (2011). Antidiatom and antibacterial activity of epiphytic bacteria isolated from Ulva lactuca in tropical waters. World Journal of Microbiology and Biotechnology, 27(7), 1543-1549. Kumar, V. N. (2008). Inhibition of primary colonizers by marine surface-associated bacteria. Master dissertation, University of the South Pacific, Fiji. Kumarasingha, R., Young, N. D., Yeo, T.-C., Lim, D. S., Tu, C.-L., Palombo, E. A., Shaw, J. M., Gasser, R. B., & Boag, P. R. (2019). Transcriptional alterations in Caenorhabditis elegans following exposure to an anthelmintic fraction of the plant Picria fel-terrae Lour. Parasites & Vectors, 12(1), 181. Laing, R., Kikuchi, T., Martinelli, A., Tsai, I. J., Beech, R. N., Redman, E., Holroyd, N., Bartley, D. J., Beasley, H., & Britton, C. (2013). The genome and transcriptome of Haemonchus contortus, a key model parasite for drug and vaccine discovery. Genome Biology, 14(8), 1-16.

Lakowski, B., & Hekimi, S. (1998). The genetics of caloric restriction in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the USA, 95(22), 13091-13096. Lamb, J., Elliott, T., Chambers, M., & Chick, B. (2017). Broad spectrum anthelmintic resistance of Haemonchus contortus in Northern NSW of Australia. Veterinary Parasitology, 241, 48-51. Lambshead, P. J. D. (1993). Recent developments in marine benthic biodiversity research. Oceanis, 19:5–24 Leung, M. C. K., Williams, P. L., Benedetto, A., Au, C., Helmcke, K. J., Aschner, M., & Meyer, J. N. (2008). Caenorhabditis elegans: An emerging model in biomedical and environmental toxicology. Toxicological Sciences, 106(1), 5-28. Levsen, A., Svanevik, C. S., Cipriani, P., Mattiucci, S., Gay, M., Hastie, L. C., Bušelić, I., Mladineo, I., Karl, H., Ostermeyer, U., Buchmann, K., Højgaard, D. P., González, Á. F., Pascual, S., & Pierce, G. J. (2018). A survey of zoonotic nematodes of commercial key fish species from major European fishing grounds—Introducing the FP7 PARASITE exposure assessment study. Fisheries Research, 202, 4-21. Lewis, J. A., Wu, C. H., Levine, J. H., & Berg, H. (1980). Levamisole-resitant mutants of the nematode Caenorhabditis elegans appear to lack pharmacological acetylcholine receptors. Neuroscience, 5(6), 967-989. Liberati, N. T., Fitzgerald, K. A., Kim, D. H., Feinbaum, R., Golenbock, D. T., & Ausubel, F. M. (2004). Requirement for a conserved Toll/interleukin-1 resistance domain protein in the Caenorhabditis elegans immune response. Proceedings of the National Academy of Sciences of the USA, 101(17), 6593-6598. Liu, W., & Park, S.-W. (2018). Underground mystery: Interactions between plant roots and parasitic nematodes. Current Plant Biology, 15, 25-29. Lok, J. B., & Unnasch, T. R. (2018). Transgenesis in animal parasitic nematodes: Strongyloides spp. and Brugia spp. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at http://www.wormbook.org/chapters/www_transgenesis/transgenesis.html. Lopes, L., Nicolino, R., Capanema, R., Oliveira, C., Haddad, J., & Eckstein, G. (2015). Economic impacts of parasitic diseases in cattle. CAB Reviews, 10(051), 1-10. Love, S. (2007). Primefact 478, drench resistance and sheep worm control. NSW Department of Primary Industries: Sydney. Lozano, G. L., Guan, C., Cao, Y., Borlee, B. R., Broderick, N. A., Stabb, E. V., & Handelsman, J. (2020). A chemical counterpunch: Chromobacterium violaceum ATCC 31532 produces violacein in response to translation-inhibiting antibiotics. mBio, 11(3), e00948-00920. Lucas-Elío, P., Gómez, D., Solano, F., & Sanchez-Amat, A. (2006). The antimicrobial activity of marinocine, synthesized by Marinomonas mediterranea, is due to hydrogen peroxide generated by its lysine oxidase activity. Journal of Bacteriology, 188(7), 2493-2501. Lucas-Elio, P., Hernandez, P., Sanchez-Amat, A., & Solano, F. (2005). Purification and partial characterization of marinocine, a new broad-spectrum antibacterial protein produced by Marinomonas mediterranea. Biochim Biophys Acta, 1721(1-3), 193- 203. Magnabosco, C., Lin, L.-H., Dong, H., Bomberg, M., Ghiorse, W., Stan-Lotter, H., Pedersen, K., Kieft, T., Van Heerden, E., & Onstott, T. C. (2018). The biomass and biodiversity of the continental subsurface. Nature Geoscience, 11(10), 707- 717. 48

Magnino, S., Colin, P., Dei-Cas, E., Madsen, M., McLauchlin, J., Nöckler, K., Prieto Maradona, M., Tsigarida, E., Vanopdenbosch, E., & Van Peteghem, C. (2009). Biological risks associated with consumption of reptile products. International Journal of Food Microbiology, 134(3), 163-175. Mai-Prochnow, A., Evans, F., Dalisay-Saludes, D., Stelzer, S., Egan, S., James, S., Webb, J. S., & Kjelleberg, S. (2004). Biofilm development and cell death in the marine bacterium Pseudoalteromonas tunicata. Applied and Environmental Microbiology, 70(6), 3232. Maqbool, I., Wani, Z. A., Shahardar, R. A., Allaie, I. M., & Shah, M. M. (2017). Integrated parasite management with special reference to gastro-intestinal nematodes. Journal of Parasitic Diseases, 41(1), 1-8. Marchetti, P. M., Kelly, V., Simpson, J. P., Ward, M., & Campopiano, D. J. (2018). The carbon chain-selective adenylation enzyme TamA: the missing link between fatty acid and pyrrole natural product biosynthesis. Organic & Biomolecular Chemistry, 16(15), 2735-2740. Marris, E. (2006). Drugs from the deep. Nature 443, 904–905. Marroquin, L. D., Elyassnia, D., Griffitts, J. S., Feitelson, J. S., & Aroian, R. V. (2000). Bacillus thuringiensis (Bt) toxin susceptibility and isolation of resistance mutants in the nematode Caenorhabditis elegans. Genetics, 155(4), 1693-1699. Mathew, M. D., Mathew, N. D., Miller, A., Simpson, M., Au, V., Garland, S., Gestin, M., Edgley, M. L., Flibotte, S., & Balgi, A. (2016). Using C. elegans forward and reverse genetics to identify new compounds with anthelmintic activity. PLoS Neglected Tropical Diseases, 10(10). Matz, C., Deines, P., Boenigk, J., Arndt, H., Eberl, L., Kjelleberg, S., & Jurgens, K. (2004). Impact of violacein-producing bacteria on survival and feeding of bacterivorous nanoflagellates. Applied and Environmental Microbiology, 70(3), 1593-1599. Matz, C., Webb, J. S., Schupp, P. J., Phang, S. Y., Penesyan, A., Egan, S., Steinberg, P., & Kjelleberg, S. (2008). Marine biofilm bacteria evade eukaryotic predation by targeted chemical defense. PloS One, 3(7), e2744. May, K., Brügemann, K., König, S., & Strube, C. (2018). The effect of patent Dictyocaulus viviparus (re)infections on individual milk yield and milk quality in pastured dairy cows and correlation with clinical signs. Parasites & Vectors, 11(1), 24. McElwee, J. J., Schuster, E., Blanc, E., Thomas, J. H., & Gems, D. (2004). Shared transcriptional signature in Caenorhabditis elegans Dauer larvae and long-lived daf-2 mutants implicates detoxification system in longevity assurance. Journal of Biological Chemistry, 279(43), 44533-44543. McLeod, R. (1995). Costs of major parasites to the Australian livestock industries. International Journal for Parasitology, 25(11), 1363-1367. McLeod, R. (2004). Worm control of small ruminants in tropical Asia. Australian Centre for International Agricultural Research 2004 at https://aciar.gov.au/publication/books-and-manuals/worm-control-small- ruminants-tropical-asia Mehrdana, F., & Buchmann, K. (2017). Excretory/secretory products of anisakid nematodes: biological and pathological roles. Acta Veterinaria Scandinavica, 59(1), 42. Meisel, J. D., & Kim, D. H. (2014). Behavioral avoidance of pathogenic bacteria by Caenorhabditis elegans. Trends in Immunology, 35(10), 465-470.

Melville, L. A., McBean, D., Fyfe, A., Campbell, S.-J., Palarea-Albaladejo, J., & Kenyon, F. (2016). Effect of anthelmintic treatment strategy on strongylid nematode species composition in grazing lambs in Scotland. Parasites & Vectors, 9, 199- 199. Mertenskötter, A., Keshet, A., Gerke, P., & Paul, R. J. (2013). The p38 MAPK PMK-1 shows heat-induced nuclear translocation, supports chaperone expression, and affects the heat tolerance of Caenorhabditis elegans. Cell Stress & Chaperones, 18(3), 293-306. Midkiff, D., & San-Miguel, A. (2019). Microfluidic technologies for high throughput screening through sorting and on-chip culture of C. elegans. Molecules, 24(23), 4292. Mir, D. A., & Krishnaswamy, B. (2019). Global proteomic response of Caenorhabditis elegans against PemKSa toxin. Frontiers in Cellular and Infection Microbiology, 9, 172. Mitreva, M., McCarter, J. P., Martin, J., Dante, M., Wylie, T., Chiapelli, B., Pape, D., Clifton, S. W., Nutman, T. B., & Waterston, R. H. (2004). Comparative genomics of gene expression in the parasitic and free-living nematodes Strongyloides stercoralis and Caenorhabditis elegans. Genome Research, 14(2), 209-220. Moens, T., Traunspurger, W., & Bergtold, M. (2006). Feeding ecology of free-living benthic nematodes. Freshwater Nematodes. Ecology and Taxonomy. CAB International Publishing, 105-131. Moestrup, Ø. (2000). The flagellates: unity, diversity and evolution. London, UK, Taylor &Francis. Monaghan, R. L., & Tkacz, J. S. (1990). Bioactive microbial products: focus upon mechanism of action. Annual Review of Microbiology, 44(1), 271-331. Moneo, I., Caballero, M. L., González-Muñoz, M., Rodríguez-Mahillo, A. I., Rodríguez- Perez, R., & Silva, A. (2005). Isolation of a heat-resistant allergen from the fish parasite Anisakis simplex. Parasitology Research, 96(5), 285-289. Montalvo-Katz, S., Huang, H., Appel, M. D., Berg, M., & Shapira, M. (2013). Association with soil bacteria enhances p38-dependent infection resistance in Caenorhabditis elegans. Infection and Immunity, 81(2), 514. Morgan, E. R., Aziz, N.-A. A., Blanchard, A., Charlier, J., Charvet, C., Claerebout, E., Geldhof, P., Greer, A. W., Hertzberg, H., & Hodgkinson, J. (2019). 100 questions in livestock helminthology research. Trends in Parasitology, 35(1), 52-71. Murphy, C. T., McCarroll, S. A., Bargmann, C. I., Fraser, A., Kamath, R. S., Ahringer, J., Li, H., & Kenyon, C. (2003). Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature, 424(6946), 277-283. Mushonga, B., Habumugisha, D., Kandiwa, E., Madzingira, O., Samkange, A., Segwagwe, B. E., & Jaja, I. F. (2018). Prevalence of Haemonchus contortus infections in sheep and goats in Nyagatare District, Rwanda. Journal of Veterinary Medicine, 2018. Nappi, J. (2019). Discovery of novel bioactive metabolites from marine epiphytic bacteria and assessment of their ecological role. Unpublished Doctoral dissertation, University of New South Wales, Australia. Nery, S. V., McCarthy, J. S., Traub, R., Andrews, R. M., Black, J., Gray, D., Weking, E., Atkinson, J.-A., Campbell, S., Francis, N., Vallely, A., Williams, G., & Clements, A. (2015). A cluster-randomised controlled trial integrating a community-based water, sanitation and hygiene programme, with mass distribution of albendazole to reduce intestinal parasites in Timor-Leste: the WASH for WORMS research protocol. BMJ Open, 5(12), e009293. 50

Neu, A. K., Månsson, M., Gram, L., & Prol-García, M. J. (2014). Toxicity of bioactive and probiotic marine bacteria and their secondary metabolites in Artemia sp. and Caenorhabditis elegans as eukaryotic model organisms. Applied and Environmental Microbiology, 80(1), 146-153. Ngcamphalala, P., Lamb, J., & Mukaratirwa, S. (2020). Molecular identification of hookworm isolates from stray dogs, humans and selected wildlife from South Africa. Journal of Helminthology, 94. Oclarit, J. M., Okada, H., Ohta, S., Kaminura, K., Yamaoka, Y., Iizuka, T., Miyashiro, S., & Ikegami, S. (1994). Anti-bacillus substance in the marine sponge, Hyatella species, produced by an associated Vibrio species bacterium. Microbios, 78(314), 7-16. Oh, S. W., Mukhopadhyay, A., Dixit, B. L., Raha, T., Green, M. R., & Tissenbaum, H. A. (2006). Identification of direct DAF-16 targets controlling longevity, metabolism and diapause by chromatin immunoprecipitation. Nature Genetics, 38(2), 251-257. Omura, S. (2008). Ivermectin: 25 years and still going strong. International Journal of Antimicrobial Agents, 31(2), 91-98. Orobets, V., Lisovets, E., Zabashta, S., & Ermakov, A. (2019). Control of fish parasites in aquaculture. IOP Conference Series: Earth and Environmental Science, 403, 012065. Ortega-Morales, B. O., Chan-Bacab, M. J., De la Rosa-García, S. d. C., & Camacho- Chab, J. C. (2010). Valuable processes and products from marine intertidal microbial communities. Current Opinion in Biotechnology, 21(3), 346-352. Page, A. P., & Johnstone, I. (2007). The cuticle. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at http://www.wormbook.org/chapters/www_cuticle/cuticle.html. Page, A. P., Roberts, M., Félix, M.-A., Pickard, D., Page, A., & Weir, W. (2019). The golden death bacillus Chryseobacterium nematophagum is a novel matrix digesting pathogen of nematodes. BMC Biology, 17(1), 10. Palma Esposito, F., Ingham, C. J., Hurtado-Ortiz, R., Bizet, C., Tasdemir, D., & de Pascale, D. (2018). Isolation by Miniaturized Culture Chip of an Antarctic bacterium Aequorivita sp. with antimicrobial and anthelmintic activity. Biotechnology Reports, 20, e00281. Papadi, B., Boudreaux, C., Tucker, J. A., Mathison, B., Bishop, H., & Eberhard, M. E. (2013). Halicephalobus gingivalis: a rare cause of fatal meningoencephalomyelitis in humans. The American Journal of Tropical Medicine and Hygiene, 88(6), 1062-1064. Pascoal, F., Magalhães, C., & Costa, R. (2020). The link between the ecology of the prokaryotic rare biosphere and its biotechnological potential. Frontiers in Microbiology, 11 (231), 1-8. Penesyan, A., Ballestriero, F., Daim, M., Kjelleberg, S., Thomas, T., & Egan, S. (2013). Assessing the effectiveness of functional genetic screens for the identification of bioactive metabolites. Marine Drugs, 11(1), 40-49. Penesyan, A., Kjelleberg, S., & Egan, S. (2010). Development of novel drugs from marine surface associated microorganisms. Marine Drugs, 8(3), 438-459. Peng, D., Wan, D., Cheng, C., Ye, X., & Sun, M. (2018). Nematode-specific cadherin CDH-8 acts as a receptor for Cry5B toxin in Caenorhabditis elegans. Applied Microbiology and Biotechnology, 102(8), 3663-3673.

Persson, G., Ekmann, J. R., & Hviid, T. V. F. (2019). Reflections upon immunological mechanisms involved in fertility, pregnancy and parasite infections. Journal of Reproductive Immunology, 136, 102610. Pinkerton, D. M., Banwell, M. G., Garson, M. J., Kumar, N., de Moraes, M. O., Cavalcanti, B. C., Barros, F. W., & Pessoa, C. (2010). Antimicrobial and cytotoxic activities of synthetically derived tambjamines C and E - J, BE-18591, and a related alkaloid from the marine bacterium Pseudoalteromonas tunicata. Chemistry & Biodiversity, 7(5), 1311-1324. Pradel, E., Zhang, Y., Pujol, N., Matsuyama, T., Bargmann, C. I., & Ewbank, J. J. (2007). Detection and avoidance of a natural product from the pathogenic bacterium Serratia marcescens by Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the USA 104(7), 2295-2300. Proksch, P., Edrada, R. A., & Ebel, R. (2002). Drugs from the seas - current status and microbiological implications. Applied Microbiology and Biotechnology, 59(2-3), 125-134. Pujol, N., Cypowyj, S., Ziegler, K., Millet, A., Astrain, A., Goncharov, A., Jin, Y., Chisholm, A. D., & Ewbank, J. J. (2008). Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Current Biology, 18(7), 481- 489. Queirós, L., Pereira, J., Gonçalves, F., Pacheco, M., Aschner, M., & Pereira, P. (2019). Caenorhabditis elegans as a tool for environmental risk assessment: emerging and promising applications for a “nobelized worm”. Critical Reviews in Toxicology, 49(5), 411-429. Queiroz, K. C. S., Milani, R., Ruela-de-Sousa, R. R., Fuhler, G. M., Justo, G. Z., Zambuzzi, W. F., Duran, N., Diks, S. H., Spek, C. A., Ferreira, C. V., & Peppelenbosch, M. P. (2012). Violacein induces death of resistant leukaemia cells via kinome reprogramming, endoplasmic reticulum stress and golgi apparatus collapse. PloS one, 7(10), e45362. Rahul, S., Chandrashekhar, P., Hemant, B., Chandrakant, N., Laxmikant, S., & Satish, P. (2014). Nematicidal activity of microbial pigment from Serratia marcescens. Natural Product Research, 28(17), 1399-1404. Rai, P., Bharati, M., Subba, A., & Saha, D. (2019). Insecticide resistance mapping in the vector of lymphatic filariasis, Culex quinquefasciatus Say from northern region of West Bengal, India. PloS One, 14(5), e0217706. Ramos, P. (2020). Parasites in fishery products - Laboratorial and educational strategies to control. Experimental Parasitology, 211, 107865. Rao, D., Webb, J. S., & Kjelleberg, S. (2005). Competitive interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata. Applied and Environmental Microbiology, 71(4), 1729-1736. Rashid, M., Rashid, M. I., Akbar, H., Ahmad, L., Hassan, M. A., Ashraf, K., Saeed, K., & Gharbi, M. (2019). A systematic review on modelling approaches for economic losses studies caused by parasites and their associated diseases in cattle. Parasitology, 146(2), 129-141. Ray, A., Rentas, C., Caldwell, G. A., & Caldwell, K. A. (2015). Phenazine derivatives cause proteotoxicity and stress in C. elegans. Neuroscience letters, 584, 23-27. Rengarajan, S., & Hallem, E. A. (2016). Olfactory circuits and behaviors of nematodes. Current Opinion in Neurobiology, 41, 136-148. doi:10.1016/j.conb.2016.09.002 Riddle, D., Blumenthal, T., Meyer, B., & Priess, J. (1997). The biological model. C elegans. C. elegans II. 2nd edition. Cold Spring Harbor, New York. Available at https://www.ncbi.nlm.nih.gov/books/NBK20086/ 52

Rinehart, K. L., Gloer, J. B., Hughes, R. G., Renis, H. E., McGovren, J. P., Swynenberg, E. B., Stringfellow, D. A., Kuentzel, S. L., & Li, L. H. (1981). Didemnins: antiviral and antitumor depsipeptides from a Caribbean tunicate. Science, 212(4497), 933-935. Rischer, M., Raguž, L., Guo, H., Keiff, F., Diekert, G., Goris, T., & Beemelmanns, C. (2018). Biosynthesis, synthesis, and activities of Barnesin A, a NRPS-PKS hybrid produced by an anaerobic Epsilonproteobacterium. ACS Chemical Biology, 13(8), 1990-1995. Rocha-Martin, J., Harrington, C., Dobson, A. D., & O'Gara, F. (2014). Emerging strategies and integrated systems microbiology technologies for biodiscovery of marine bioactive compounds. Marine Drugs, 12(6), 3516-3559. Roeber, F., Jex, A. R., & Gasser, R. B. (2013). Impact of gastrointestinal parasitic nematodes of sheep, and the role of advanced molecular tools for exploring epidemiology and drug resistance - an Australian perspective. Parasites & Vectors, 6(1), 153. Romano, G., Costantini, M., Sansone, C., Lauritano, C., Ruocco, N., & Ianora, A. (2017). Marine microorganisms as a promising and sustainable source of bioactive molecules. Marine Environmental Research, 128, 58-69. Ruiz-Lancheros, E., Viau, C., Walter, T. N., Francis, A., & Geary, T. G. (2011). Activity of novel nicotinic anthelmintics in cut preparations of Caenorhabditis elegans. International Journal for Parasitology, 41(3), 455-461. Rusch, D. B., Halpern, A. L., Sutton, G., Heidelberg, K. B., Williamson, S., Yooseph, S., Wu, D., Eisen, J. A., Hoffman, J. M., Remington, K., Beeson, K., Tran, B., Smith, H., Baden-Tillson, H., Stewart, C., Thorpe, J., Freeman, J., Andrews-Pfannkoch, C., Venter, J. E., Li, K., Kravitz, S., Heidelberg, J. F., Utterback, T., Rogers, Y.- H., Falcón, L. I., Souza, V., Bonilla-Rosso, G., Eguiarte, L. E., Karl, D. M., Sathyendranath, S., Platt, T., Bermingham, E., Gallardo, V., Tamayo-Castillo, G., Ferrari, M. R., Strausberg, R. L., Nealson, K., Friedman, R., Frazier, M., & Venter, J. C. (2007). The Sorcerer II Global Ocean Sampling Expedition: Northwest Atlantic through Eastern Tropical Pacific. PLOS Biology, 5(3), e77. Sackett, D., Holmes, P., Abbott, K., Jephcott, S., & Barber, M. (2006). Assessing the economic cost of endemic disease on the profitability of Australian beef cattle and sheep producers. MLA (Meat and Livestock) Report AHW, 87. Samuel, B. S., Rowedder, H., Braendle, C., Félix, M.-A., & Ruvkun, G. (2016). Caenorhabditis elegans responses to bacteria from its natural habitats. Proceedings of the National Academy of Sciences of the USA 113(27), E3941. Sasidharan, A., Sasidharan, N. K., Amma, D. B. N. S., Vasu, R. K., Nataraja, A. V., & Bhaskaran, K. (2015). Antifungal activity of violacein purified from a novel strain of Chromobacterium sp. NIIST (MTCC 5522). Journal of Microbiology, 53(10), 694-701. Schaeffer, J. M., Blizzard, T. A., Ondeyka, J., Goegelman, R., Sinclair, P. J., & Mrozik, H. (1992). [3H] Paraherquamide binding to Caenorhabditis elegans: Studies on a potent new anthelmintic agent. Biochemical Pharmacology, 43(4), 679-684. Schulenburg, H., & Félix, M.-A. (2017). The natural biotic environment of Caenorhabditis elegans. Genetics, 206(1), 55-86. Scott, I., Pomroy, W., Kenyon, P., Smith, G., Adlington, B., & Moss, A. (2013). Lack of efficacy of monepantel against Teladorsagia circumcincta and Trichostrongylus colubriformis. Veterinary Parasitology, 198(1-2), 166-171.

Sczesny-Moraes, E. A., Bianchin, I., da Silva, K. F., Catto, J. B., Honer, M. R., & Paiva, F. (2010). Anthelmintic resistance of gastrointestinal nematodes in sheep, Mato Grosso do Sul, Brazil. Pesquisa Veterinária Brasileira, 30(3), 229-236. Sekurova, O. N., Schneider, O., & Zotchev, S. B. (2019). Novel bioactive natural products from bacteria via bioprospecting, genome mining and metabolic engineering. Microbial Biotechnology, 12(5), 828-844. Shaheerah Alsounosi Alshareef, A. M. A. R. A. A. E. S. S., & Mohamed, C. (2019). Parasitic Contamination of raw vegetables sampled from different farm locations in Brack Al-Shati, Libya. Journal of Pure and Applied Sciences, 18(4), 210-214. Shalaby, H., Ashry, H., Saad, M., & Farag, T. (2020). In vitro effects of Streptomyces tyrosinase on the egg and adult worm of Toxocara vitulorum. Iranian Journal of Parasitology, 15(1), 67-75. Shamsi, S. (2019). Seafood-borne parasitic diseases: a “one-health” approach is needed. Fishes, 4(1), 9. Shinn, A. P., Pratoomyot, J., Bron, J. E., Paladini, G., Brooker, E. E., & Brooker, A. J. (2015). Economic costs of protistan and metazoan parasites to global mariculture. Parasitology, 142(1), 196-270. Sifri, C. D., Begun, J., Ausubel, F. M., & Calderwood, S. B. (2003). Caenorhabditis elegans as a model host for Staphylococcus aureus pathogenesis. Infection and Immunity, 71(4), 2208-2217. Singh, V., & Aballay, A. (2006). Heat-shock transcription factor (HSF)-1 pathway required for Caenorhabditis elegans immunity. Proceedings of the National Academy of Sciences of the USA, 103(35), 13092. Skerratt, J., Bowman, J., Hallegraeff, G., James, S., & Nichols, P. (2002). Algicidal bacteria associated with blooms of a toxic dinoflagellate in a temperate Australian estuary. Marine Ecology Progress Series, 244, 1-15. Skovhus, T. L., Holmström, C., Kjelleberg, S., & Dahllöf, I. (2007). Molecular investigation of the distribution, abundance and diversity of the genus Pseudoalteromonas in marine samples. FEMS Microbiology Ecology, 61(2), 348- 361. Skovhus, T. L., Ramsing, N. B., Holmström, C., Kjelleberg, S., & Dahllöf, I. (2004). Real-time quantitative PCR for assessment of abundance of Pseudoalteromonas species in marine samples. Applied and Environmental Microbiology, 70(4), 2373-2382. Smiley, R. W. (2010). Root-lesion nematodes: Biology and management in Pacific Northwest wheat cropping systems. Available from https://catalog.extension.oregonstate.edu/pnw617. Soliman, G. M., Ameen, H. H., Abdel-Aziz, S. M., & El-Sayed, G. M. (2019). In vitro evaluation of some isolated bacteria against the plant parasite nematode Meloidogyne incognita. Bulletin of the National Research Centre, 43(1), 171. Spiegler, V., Liebau, E., & Hensel, A. (2017). Medicinal plant extracts and plant-derived polyphenols with anthelmintic activity against intestinal nematodes. Natural product reports, 34(6), 627-643. Steinberg, P. D., & De Nys, R. (2002). Chemical mediation of colonisation of seaweed surfaces. Journal of Phycology, 38(4), 621-629. Stelzer, S., Egan, S., Larsen, M. R., Bartlett, D. H., & Kjelleberg, S. (2006). Unravelling the role of the ToxR-like transcriptional regulator WmpR in the marine antifouling bacterium Pseudoalteromonas tunicata. Microbiology, 152(5), 1385- 1394.

Stiernagle, T. (2006). Maintenance of C. elegans. In C. elegans Research Community (Ed.), WormBook: The Online Review of C. elegans Biology, WormBook. Available at http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html. Sunagawa, S., Coelho, L. P., Chaffron, S., Kultima, J. R., Labadie, K., Salazar, G., Djahanschiri, B., Zeller, G., Mende, D. R., Alberti, A., Cornejo-Castillo, F. M., Costea, P. I., Cruaud, C., Ovidio, F., Engelen, S., Ferrera, I., Gasol, J. M., Guidi, L., Hildebrand, F., Kokoszka, F., Lepoivre, C., Lima-Mendez, G., Poulain, J., Poulos, B. T., Royo-Llonch, M., Sarmento, H., Vieira-Silva, S., Dimier, C., Picheral, M., Searson, S., Kandels-Lewis, S., Bowler, C., de Vargas, C., Gorsky, G., Grimsley, N., Hingamp, P., Iudicone, D., Jaillon, O., Not, F., Ogata, H., Pesant, S., Speich, S., Stemmann, L., Sullivan, M. B., Weissenbach, J., Wincker, P., Karsenti, E., Raes, J., Acinas, S. G., & Bork, P. (2015). Structure and function of the global ocean microbiome. Science, 348(6237), 1261359. Tan, M.-W., Mahajan-Miklos, S., & Ausubel, F. M. (1999). Killing of Caenorhabditis elegans by Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proceedings of the National Academy of Sciences of the USA, 96(2), 715. Tang, Y. T., Gao, X., Rosa, B. A., Abubucker, S., Hallsworth-Pepin, K., Martin, J., Tyagi, R., Heizer, E., Zhang, X., Bhonagiri-Palsikar, V., Minx, P., Warren, W. C., Wang, Q., Zhan, B., Hotez, P. J., Sternberg, P. W., Dougall, A., Gaze, S. T., Mulvenna, J., Sotillo, J., Ranganathan, S., Rabelo, E. M., Wilson, R. K., Felgner, P. L., Bethony, J., Hawdon, J. M., Gasser, R. B., Loukas, A., & Mitreva, M. (2014). Genome of the human hookworm Necator americanus. Nature Genetics, 46(3), 261-269. Thomas, T., Evans, F. F., Schleheck, D., Mai-Prochnow, A., Burke, C., Penesyan, A., Dalisay, D. S., Stelzer-Braid, S., Saunders, N., Johnson, J., Ferriera, S., Kjelleberg, S., & Egan, S. (2008). Analysis of the Pseudoalteromonas tunicata genome reveals properties of a surface-associated life style in the marine environment. PloS One, 3(9), e3252. Thomas, T. R. A., Kavlekar, D. P., & LokaBharathi, P. A. (2010). Marine drugs from sponge-microbe association--a review. Marine Drugs, 8(4), 1417-1468. Thompson, J., Greco, N., Eastwood, R., Sharma, S., & Scurrah, M. (2000). Integrated control of nematodes of cool season food legumes. In Linking Research and Marketing Opportunities for Pulses in the 21st Century (pp. 491-506): Springer. Troemel, E. R., Chu, S. W., Reinke, V., Lee, S. S., Ausubel, F. M., & Kim, D. H. (2006). p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genetics, 2(11), e183. Tsukimoto, M., Nagaoka, M., Shishido, Y., Fujimoto, J., Nishisaka, F., Matsumoto, S., Harunari, E., Imada, C., & Matsuzaki, T. (2011). Bacterial production of the tunicate-derived antitumor cyclic depsipeptide didemnin B. Journal of Natural Products, 74(11), 2329-2331. Urban Jr, J. F., Hu, Y., Miller, M. M., Scheib, U., Yiu, Y. Y., & Aroian, R. V. (2013). Bacillus thuringiensis-derived Cry5B has potent anthelmintic activity against Ascaris suum. PLoS Neglected Tropical Diseases, 7(6), e2263. Vadlamudi, R. K., Weber, E., Ji, I., Ji, T. H., & Bulla, L. A. (1995). Cloning and expression of a receptor for an insecticidal toxin of Bacillus thuringiensis. Journal of Biological Chemistry, 270(10), 5490-5494. Van den Brom, R., Moll, L., Kappert, C., & Vellema, P. (2015). Haemonchus contortus resistance to monepantel in sheep. Veterinary Parasitology, 209(3-4), 278-280. 55

Vellai, T., McCulloch, D., Gems, D., & Kovács, A. L. (2006). Effects of sex and insulin/insulin-like Growth Factor-1 signaling on performance in an associative learning paradigm in Caenorhabditis elegans. Genetics, 174(1), 309. Venter, J. C., Remington, K., Heidelberg, J. F., Halpern, A. L., Rusch, D., Eisen, J. A., Wu, D., Paulsen, I., Nelson, K. E., Nelson, W., Fouts, D. E., Levy, S., Knap, A. H., Lomas, M. W., Nealson, K., White, O., Peterson, J., Hoffman, J., Parsons, R., Baden-Tillson, H., Pfannkoch, C., Rogers, Y.-H., & Smith, H. O. (2004). Environmental genome shotgun sequencing of the Sargasso Sea. Science, 304(5667), 66. Verschave, S. H., Charlier, J., Rose, H., Claerebout, E., & Morgan, E. R. (2016). Cattle and nematodes under global change: transmission models as an ally. Trends in Parasitology, 32(9), 724-738. Villate, L., Morin, E., Demangeat, G., Van Helden, M., & Esmenjaud, D. (2012). Control of Xiphinema index populations by fallow plants under greenhouse and field conditions. Phytopathology, 102(6), 627-634. Viney, M. (2017). How can we understand the genomic basis of nematode parasitism? Trends in Parasitology, 33(6), 444-452. Vlamakis, H., Chai, Y., Beauregard, P., Losick, R., & Kolter, R. (2013). Sticking together: building a biofilm the Bacillus subtilis way. Nature Reviews Microbiology, 11(3), 157-168. Vuong, D., Capon, R. J., Lacey, E., Gill, J. H., Heiland, K., & Friedel, T. (2001). Onnamide F: A new nematocide from a southern Australian marine sponge, Trachycladus laevispirulifer. Journal of Natural Products, 64(5), 640-642. Wang, H., Park, H., Liu, J., & Sternberg, P. W. (2018). An efficient genome editing strategy to generate putative null mutants in Caenorhabditis elegans using CRISPR/Cas9. G3: Genes|Genomes|Genetics, 8(11), 3607. Wang, J., Nakad, R., & Schulenburg, H. (2012). Activation of the Caenorhabditis elegans FOXO family transcription factor DAF-16 by pathogenic Bacillus thuringiensis. Developmental & Comparative Immunology, 37(1), 193-201. Weeks, J. C., Robinson, K. J., Lockery, S. R., & Roberts, W. M. (2018). Anthelmintic drug actions in resistant and susceptible C. elegans revealed by electrophysiological recordings in a multichannel microfluidic device. International Journal for Parasitology: Drugs and Drug Resistance, 8(3), 607- 628. Wei, J.-Z., Hale, K., Carta, L., Platzer, E., Wong, C., Fang, S.-C., & Aroian, R. V. (2003). Bacillus thuringiensis crystal proteins that target nematodes. Proceedings of the National Academy of Sciencesof the USA, 100(5), 2760. Weitere, M., Erken, M., Majdi, N., Arndt, H., Norf, H., Reinshagen, M., Traunspurger, W., Walterscheid, A., & Wey, J. K. (2018). The food web perspective on aquatic biofilms. Ecological Monographs, 88(4), 543-559. Welsh, R. M., Zaneveld, J. R., Rosales, S. M., Payet, J. P., Burkepile, D. E., & Thurber, R. V. (2016). Bacterial predation in a marine host-associated microbiome. The ISME Journal, 10(6), 1540-1544. White, E. C., Houlden, A., Bancroft, A. J., Hayes, K. S., Goldrick, M., Grencis, R. K., & Roberts, I. S. (2018). Manipulation of host and parasite microbiotas: Survival strategies during chronic nematode infection. Science Advances, 4(3), eaap7399. Whittaker, J. H., Robertson, A. P., Kimber, M. J., Day, T. A., & Carlson, S. A. (2016). Intestinal Enterobacteriaceae that protect nematodes from the effects of benzimidazoles. Journal of Bacteriology & Parasitology, 7(5).

Wietz, M., Månsson, M., Bowman, J. S., Blom, N., Ng, Y., & Gram, L. (2012). Wide distribution of closely related, antibiotic-producing Arthrobacter strains throughout the Arctic Ocean. Applied and Environmental Microbiology, 78(6), 2039. Won, N.-I., Lee, G.-E., Ko, K.-B., Oh, D.-C., Na, Y.-H., & Park, J.-S. (2017). Identification of a bioactive compound, violacein, from Microbulbifer sp. isolated from a marine sponge Hymeniacidon sinapium on the west coast of Korea. Microbiology and Biotechnology Letters, 45(2), 124-132. Wu, Y.-H., Cheng, H., Xu, L., Jin, X.-B., Wang, C.-S., & Xu, X.-W. (2017). Physiological and genomic features of a novel violacein-producing bacterium isolated from surface seawater. PloS one, 12(6), e0179997. Xiong, Z.-Q., Wang, J.-F., Hao, Y.-Y., & Wang, Y. (2013). Recent advances in the discovery and development of marine microbial natural products. Marine Drugs, 11(3), 700-717. Xu, Y., Kersten, R. D., Nam, S.-J., Lu, L., Al-Suwailem, A. M., Zheng, H., Fenical, W., Dorrestein, P. C., Moore, B. S., & Qian, P.-Y. (2012). Bacterial biosynthesis and maturation of the didemnin anti-cancer agents. Journal of the American Chemical Society, 134(20), 8625-8632. Yamazaki, M., Okuyama, E., Kobayashi, M., & Inoue, H. (1981). The structure of paraherquamide, a toxic metabolite from Penicillium paraherquei. Tetrahedron Letters, 22(2), 135-136. Yu, J., Du, G., Li, R., Li, L., Li, Z., Zhou, C., Chen, C., & Guo, D. (2015). Nematicidal activities of bacterial volatiles and components from two marine bacteria, Pseudoalteromonas marina strain H-42 and Vibrio atlanticus strain S-16, against the pine wood nematode, Bursaphelenchus xylophilus. Nematology, 17(9), 1011- 1025. Zajíčková, M., Nguyen, L. T., Skálová, L., Raisová Stuchlíková, L., & Matoušková, P. (2020). Anthelmintics in the future: current trends in the discovery and development of new drugs against gastrointestinal nematodes. Drug Discovery Today, 25(2), 430-437. Zhang, F., Berg, M., Dierking, K., Félix, M.-A., Shapira, M., Samuel, B. S., & Schulenburg, H. (2017). Caenorhabditis elegans as a model for microbiome research. Frontiers in Microbiology, 8, 485. Zhang, W., Ding, W., Li, Y.-X., Tam, C., Bougouffa, S., Wang, R., Pei, B., Chiang, H., Leung, P., & Lu, Y. (2019). Marine biofilms constitute a bank of hidden microbial diversity and functional potential. Nature Communications, 10(1), 1-10. Zhang, Y., Lu, H., & Bargmann, C. I. (2005). Pathogenic bacteria induce aversive olfactory learning in Caenorhabditis elegans. Nature, 438(7065), 179-184. Zhao, X.-D., Zhang, B.-W., Fu, L.-J., Li, Q.-L., Lin, Y., & Yu, X.-Q. (2020). Possible insecticidal mechanism of Cry41-related toxin against Myzus persicae by enhancing Cathepsin B activity. Journal of Agricultural and Food Chemistry, 68(16), 4607-4615. Zimmermann, J., Obeng, N., Yang, W., Pees, B., Petersen, C., Waschina, S., Kissoyan, K. A., Aidley, J., Hoeppner, M. P., & Bunk, B. (2020). The functional repertoire contained within the native microbiota of the model nematode Caenorhabditis elegans. The ISME Journal, 14(1), 26-38. Zou, C. G., Tu, Q., Niu, J., Ji, X. L., & Zhang, K. Q. (2013). The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity. PLoS Pathogens, 9(10), e1003660.

Zwart, R. S., Thudi, M., Channale, S., Manchikatla, P. K., Varshney, R. K., & Thompson, J. P. (2019). Resistance to plant-parasitic nematodes in chickpea: Current status and future perspectives. Frontiers in plant science, 10, 966. WHO (World Health Organization) (2012). Soil-transmitted helminth infections. Available at https://www.who.int/news-room/fact-sheets/detail/soil-transmitted-helminth infections. Accessed on 2 July 2020 WHO (World Health Organization) (2017). Guideline: preventive chemotherapy to control soil-transmitted helminth infections in at-risk population groups. Geneva, World Health Organization. Available at https://www.who.int/nutrition/publications/guidelines/deworming/en/. Accessed on 2 June 2020. WHO (World Health Organization) (2020) Soil-transmitted helminth infections. Available at https://www.who.int/news-room/fact-sheets/detail/soil-transmitted-helminth infections. Accessed on 30 June 2020. World Bank Report (2008) World Development Report 2008: Agriculture for Development. Available at https://documents.worldbank.org/en/publication/documents reports/documentdetail/587251468175472382/world-development-report 2008-agriculture-for-development. Accessed on 29 May 2020.

CHAPTER 2

Characterisation of the fast nematode-killing activity of the marine epiphytic bacterium Pseudoalteromonas tunicata D2

2.1 INTRODUCTION

Diseases resulting from parasitic helminth (i.e. nematode) infections are a global concern but especially for resource-limited countries with poor hygiene and inadequate clean water supply (Ziegelbauer et al., 2012; Mahmud et al., 2015). Globally approximately, 1.5 billion people suffer from parasitic helminth infections with the majority of cases occurring in East Asia, sub-Saharan Africa, America and China (WHO, 2016). In humans, parasitic nematode infections are associated with malnutrition, anaemia, growth retardation, diminishing fitness, reduced cognition and result in numerous fatalities per year (Stephenson et al., 2000; Mahmud et al., 2015; Plummer et al., 2016). In addition to human illness, parasitic nematodes can also infect agricultural crops and aquaculture products, hence reducing yield and threatening food security (Nicol et al., 2011; Coyne et al., 2018).

For the past 40 years, strategies to control parasitic nematodes have almost exclusively relied on intensive chemotherapy to relieve symptoms and diminish transmission. However, overuse and frequent parasite exposure to single broad-spectrum therapeutic drugs can increase the prevalence of anthelmintic resistance among the harmful parasites (Wolstenholme et al., 2004; Shalaby, 2013; Geurden et al., 2015; Ballesteros et al., 2018; Becker et al., 2018). There is now evidence of parasitic nematode resistance to all of the currently available nematicides including Piperazine, Benzimidazoles, Imidazothiazole, Spiroindoles, macrocyclic lactones, Cyclooctadepsipeptides, Thiazolide (nitazoxanide) and Amino-acetonitrile derivatives (monepantel) (Holden-Dye and Walker, 2014). Therefore, finding a new anthelmintic compound has become a global urgency.

Whilst the search for new candidate anthelmintic drugs is ongoing, marine derived bioactive compounds particularly from the surface-associated microbiota are a promising resource (Penesyan et al., 2010; Romano et al., 2017). Bacteria from the genus Pseudoalteromonas have been recognised for their ability to produce a range of commercial and pharmaceutical-relevant bioactivities against micro- and macrofoulers (Holmstrom and Kjelleberg, 1999; Bernbom et al., 2011; Paulsen et al., 2019) (see section 1.9, Chapter 1). P. tunicata D2 is arguably the most comprehensively studied microorganism within the genus owing to its low and high-molecular weight compounds

60 that are toxic against a wide spectrum of environmentally and medicinally-relevant organisms including nematodes (Egan et al., 2002; Franks et al., 2006; Ballestriero et al., 2010) (see section 1.8, Chapter 1). Functional screening of a P. tunicata D2 genomic fosmid library discovered a heterologous clone (designated HG8) that was toxic against the nematode C. elegans (Ballestriero et al., 2010). Genetic characterisation of HG8 revealed that a gene of unknown function (NCBI GeneBank Accession Number ZP_01132244.1) was partly responsible for its antinematode activity (Ballestriero et al., 2010). However, heterologous expression of ZP_01132244.1 alone did not show significant antinematode activity (Ballestriero et al., unpublished data), suggesting that other genetic determinants are required for the nematode killing activity.

Given the need for new antinematode drugs, this chapter aims to further characterise and identify the bioactive agent responsible for the antinematode activity of the clone HG8. Screening of the HG8 transposon mutant library identified a mutant of the HG8 clone (designated 7C8) showing attenuated antinematode activity due to the disruption of an uncharacterised gene designated hp1 (NCBI GeneBank Accession Number ZP_01132246.1). A 25.17 kDa Nematode killing protein-1 (Nkp-1) was expressed by the hp1 gene and abundantly produced by the HG8 clone. I further show that activity of Nkp- 1 is likely to be specific in targeting nematodes as exposing the Nkp-1 expressing clones to a range of microorganisms did not impact their growth. The discovery of this novel antinematode protein will hopefully contribute to the development of new therapies that can be applied to parasitic nematode control management in the future.

2.2 MATERIALS AND METHODS

2.2.1 Bacterial strains and culture condition

All bacterial strains and vectors used in this study are listed in Table 2.1. Unless otherwise stated, E. coli strains and human bacterial isolates were grown in Lysogeny Broth (also known as Luria Bertani broth (LB10, Appendix II) and Nematode Growth Media (Brenner, 1974) (also known as NGM, Appendix II) at 37°C. Marine bacteria were cultivated in Marine Broth 2216 (Difco Laboratories, Maryland) at 25°C. Yeast and fungal isolates were grown on Potato Dextrose Agar (Oxoid, Australia) at 25°C. Solid media was prepared with the addition of 1.5% (w/v) of agar (Oxoid, Australia). For long term storage, all bacterial strains were kept in 30% (v/v) glycerol at -80°C. Where required, L-(+)-Arabinose (0.2% w/v) and antibiotics such as chloramphenicol (12.5 µg/mL), ampicillin (50 µg/mL) and kanamycin (50 µg/mL) were incorporated into the media.

Table 2.1 Bacterial strains, vectors and P. tunicata ORFs used in this study

HP1/HP2 EPI300 transformed with pBAD24hp1/hp2 (NCBI Accession: This study ZP_01132246.1/ZP_01132245.1) BD24 EPI300 transformed with empty pBAD24 vector This study HG8 EPI300-T1R transformed with pCC1FOS™ :: (Ballestriero et ZP_ 01132230.1 to ZP_ 01132246.1 al., 2010) 20G8 Clone isolated from a metagenomic library that (Penesyan et was non-toxic to nematodes and produced purple al., 2013) pigmentation under L-(+)-Arabinose induction 7C8 HG8 transposon mutant library showing mutation (Daim, 2012) at hp1 7C8::hp1 HG8 transposon mutant in hp1 complemented This study with pBAD24hp1 7C8::hp2 HG8 transposon mutant in hp1 complemented This study with pBAD24hp2 7C8::hp1/hp2 HG8 transposon mutant in hp1 complemented This study with pBAD24hp1/hp2 7C8::pBAD24 HG8 transposon mutant in hp1 complemented This study with empty pBAD24 vector Human bacterial isolates Staphylococcus Clinical isolate SOVS, UNSW epidermidis 019 Staphylococcus Clinical isolate SOVS, UNSW aureus 6538 Escherichia coli Clinical isolate SOVS, UNSW 008

Serratia Clinical isolate American marcescens Type Culture ATCC 13880 Collection (ATCC®) Pseudomonas Clinical isolate American aeruginosa Type Culture ATCC 9027 Collection (ATCC®) Marine bacterial isolates Aquimarina sp.AD1 Marine bacterium isolated from seaweed CMSI, UNSW Aquimarina sp.BL5 Marine bacterium isolated from seaweed CMSI, UNSW Nautella italica Marine bacterium isolated from seaweed CMSI, UNSW R11 Phaeobacter Marine bacterium isolated from seaweed CMSI, UNSW gallaeciensis LSS9 Alteromonas sp. Marine bacterium isolated from seaweed CMSI, UNSW BL110 Agarivorans sp. Marine bacterium isolated from seaweed CMSI, UNSW BL7

Fungal or yeast isolatesb Penicillium sp. Marine fungal isolate CMSI, UNSW Aspergillus unguis Marine fungal isolate CMSI, UNSW

Galactomyces Marine fungal isolate CMSI, UNSW geotrichum Bloxamia sp. Marine fungal isolate CMSI, UNSW Pleosporales sp. Marine fungal isolate CMSI, UNSW Unknown yeast Marine yeast isolate CMSI, UNSW Vectors pCC1FOS™ :: ZP_ Fosmid backbone for genomic library of (Burke et al., 01132230.1 to Pseudoalteromonas tunicata D2 carrying a wild 2007; ZP_01132246.1a type D2 insert (13.8 kb) expressing putative Ballesteriero et antinematode activity, Cmr al., 2010) pCC1FOS™ :: ZP_ 01132230.1 to HG8 fosmid mutated by EZ-Tn5™ transposon on (Daim, 2012) ZP_01132246.1 P. tunicata wild type gene ZP_01132246.1, Cmr, with EZ-Tn5™ Δ Kanr ZP_01132246.1a

pBAD24a F-, Δ(argF-lac)169, (Guzman et φ80dlacZ58(M15), glnX44(AS), λ- al., 1995) , rfbC1, gyrA96(NalR), recA1, endA1, spoT1, thiE 1, hsdR17, pBAD24 pBAD24hp1a P. tunicata D2 wild type gene hp1 (NCBI This study Accession: ZP_01132246.1) cloned downstream the pBAD promoter, Ampr pBAD24hp2a P. tunicata D2 wild type gene hp2 (NCBI This study Accession: ZP_01132245.1) cloned downstream the pBAD promoter, Ampr pBAD24hp1/hp2a P. tunicata D2 wild type genes hp1 and hp2 This study (NCBI Accession: ZP_01132246.1 and ZP_01132245.1) cloned downstream the pBAD promoter, Ampr

a Inducible expression with the presence of L-Arabinose 0.2% (w/v) b Fungal strains were isolated by Ms. Juliana Ferrari, School of Biological, Earth and Environmental Sciences (BEES), University of New South Wales (UNSW), Sydney, Australia CMSI denotes the Centre for Marine Science and Innovation, UNSW SOVS denotes the School of Optometry and Vision Science, UNSW

2.2.2 Maintenance and synchronisation of the nematode C. elegans

C. elegans N2 strain Bristol (Brenner, 1974) were maintained on NGM seeded with E. coli OP50 as the food source (Brenner, 1974) and synchronised according to Stiernagle (2006) with modifications as described by Ballestriero et al. (2010). NGM plates containing mixed population of C. elegans with gravid hermaphrodite adults were washed

64 with M9 buffer (Appendix II) and pooled. Next, 5 mL of this nematode solution were transferred to a new tube and 4 mL of fresh bleaching solution (Appendix II) were added to release the eggs from the gravid nematodes. After five minutes, the reaction was stopped by adding 50 mL of S-basal buffer (Appendix II) and centrifuging at 1300 x g for 3 minutes. The supernatant was removed and the pelleted eggs were washed twice using an equal volume of S-basal buffer (Appendix II). After the final wash, the eggs were transferred onto the NGM plates and incubated at 25°C until L1 larvae hatched. Then, 100 µL of E. coli OP50 bacterial culture was supplemented to the NGM plates to support the growth of C. elegans L1 larvae to the L4 stage.

2.2.3 DNA sequence analysis and annotation

The full HG8 fosmid sequence was downloaded from the NCBI (National Center for Biotechnology Information) database (Accession numbers: from ZP_01132230.1 to ZP_01132246.1) and analysed for homologous sequences against the NCBI, IMG/MER (Integrated Microbial Genomes & Microbiome Samples) (Chen et al., 2017) and UniProt (UniProt Consortium, 2018) using BLAST (Basic Local Alignment Search Tool) (Altschul et al., 1997). The conserved domain and family motifs of each gene were determined through the Conserved Domain Database (CDD NCBI) (Marchler-Bauer et al., 2017), the SMART database of protein domains, families and functional sites; (Schultz et al., 1998; Letunic et al., 2015) and the Pfam database (Finn et al., 2016). The multiple sequence alignment of the antinematode protein was analysed using T-Coffee (Di Tommaso et al., 2011) and displayed using Boxshade (ExPASy) (available at https://embnet.vital-it.ch/software/BOX_form.html).

2.2.4 Generation of HG8 mutant libraries1

Transposon mutagenesis of the HG8 fosmid clone was performed using the EZ- Tn5™ promoter Insert Kit (Epicentre) as per manufacturer’s instructions.

1 This section was performed by Ms. Malak Daim, Honours student, School of Biotechnology and Biomolecular Science (BABS), University of New South Wales (UNSW), Sydney, Australia. 65

Briefly, 0.01 pmol of EZ-Tn5™ transposon was mixed with 0.013 pmol HG8 fosmid DNA and electroporated into the electrocompetent E. coli Phage T1- Resistant TransforMax™ EPI300™-T1R (Epicentre) using the BioRad Micropulser. Cells were recovered in SOC media (Appendix II) for 2 hours at 37°C and screened for successful mutants on LB10 agar supplemented with chloramphenicol (12.5 µg/mL) and kanamycin (50 µg/mL). At least 800 mutant clones were screened to ensure the 3x coverage of all ORFs encoded on the HG8 fosmid. Selected mutants were grown overnight at 37°C, 60 rpm in 96-wells plates (Becton Dickinson Co Biosciences) containing LB10 broth with antibiotics. Glycerol (30 % v/v) was supplemented to each well and the 96-well plates were kept at -80°C.

2.2.4.1 Transposon library screening2

Frozen stocks of HG8 transposon mutant libraries were replicated onto omnitory plates (Nunc brand, Germany) containing LB10 agar with antibiotics and L-(+)-Arabinose (0.2% w/v) (Sigma-Aldrich) using a 96 Solid Pin Multi-Blot Replicator tool (V&P Scientific Inc.). After 48 hours of incubation at 25°C, the synchronized L4 stage C. elegans (30-40 worms) were transferred onto the plate for selective grazing against the mutant libraries in triplicate. Complete colony grazing after 4 days indicated the mutant as no longer toxic against the nematode and it was thereafter subjected to nematode killing assay as described in section 2.2.9. The HG8 clone and a randomly selected non-toxic strain from the original P. tunicata fosmid library (BG6) were used as the positive and negative control respectively as described by Ballestriero et al. (2010). Next, the HG8 mutants resulting in > 60 % C. elegans survival in the nematode killing assay (section 2.2.9) were sequenced bi-directionally for transposon mapping using the EZ-Tn5™ promoter Insert Kit (Epicentre) Forward (5’ ACCTACAACAAAGCTCTCATCAACC 3’) and Reverse (5’GCAATGTAACATCAGAGATTTTGAG 3’) primer pairs as described in section 2.2.5.

2 This section was performed by Ms. Malak Daim, Honours student, School of Biotechnology and Biomolecular Science (BABS), University of New South Wales (UNSW), Sydney, Australia.

2.2.5 Sequencing analysis

A standard protocol for Sanger sequencing by the Ramaciotti Centre for Genomics (University of New South Wales, Australia) (https://www.ramaciotti.unsw.edu.au/sequencing/sangersequencing/) was performed with exception to the PCR cycling condition. Briefly, sequencing reaction containing the DNA (~40 ng), Forward or Reverse primer (3.2 pmol), BigDye terminator V3.1 (1 µL), BigDye buffer (3.5 µL) and nuclease-free water up to 20 µL of reaction volume were run under the following thermocycler condition; 95°C for 5 minutes, 99 cycles of 95°C for 30 seconds, 55°C for 10 seconds and 60°C for 4 minutes. The PCR products were then purified by ethanol/EDTA precipitation method (Appendix II) and were vacuum dried for 5 minutes. DNA sequencing was performed by the Ramaciotti Centre for Genomics, UNSW using the Applied Biosystems 3730 DNA Analyser. All sequencing results were submitted for BLAST (Basic Local Alignment Search Tool) (Altschul et al., 1997) analysis and nucleotide alignment through NCBI (National Center for Biotechnology Information) and IMG/MER (Integrated Microbial Genomes & Microbiome Samples) servers (Chen et al., 2017).

2.2.6 Cloning of P. tunicata gene inserts into the pBAD24 vector

The cloning procedures of P. tunicata gene insert into the pBAD24 vector was performed as indicated in Figure 2.1A. In brief, P. tunicata DNA were generated through PCR using the HG8 fosmid as the template. PCR reactions containing Forward and Reverse primers pairs for each gene (10 µM, 1.25 µL of each) (Table 2.2), HG8 fosmid (40 ng), Phusion® High-Fidelity PCR Master Mix with HF Buffer (NEB) (25 µL) and nuclease-free water (Ambion®) up to 50 µL of reaction volume were run under the thermocycler condition of 98 ºC for 30 seconds, 30 cycles of initial denaturation at 98 ºC for 30 seconds, annealing at 60 ºC for 30 seconds and extension at 72 ºC for 30 seconds and a final extension at 72 ºC for 7 minutes. The amplicons were purified using the QIAquick® PCR Purification Kit (Qiagen) as per manufacturer’s protocol and quantified using Qubit ® 3.0 fluorometer (Thermo Fisher Scientific, Australia). The purified amplicons were

67 phosphorylated using the T4 Polynucleotide Kinase (NEB) prior to blunt-ended ligation to the pBAD24 vector. The vector was initially extracted from the overnight culture of E. coli DH5α using the Purelink Quick Plasmid Miniprep Kit (Invitrogen). The vector backbone was linearized using the NcoI restriction enzyme (NEB) through a unique cut at C▼CATGG (1318 bp to 1323 bp) restriction site, blunt-end repaired by the DNA Polymerase I, Large (Klenow) Fragment (NEB) and dephosphorylated at the 5’ end using the Shrimp Alkaline Phosphatase (rSAP) (NEB) as per manufacturer’s instructions. The phosphorylated amplicons were ligated alongside the pBAD24-NcoI-Klenow-rSAP treated vector using the T4 DNA Ligase (NEB) and used for DNA transformation in section 2.2.6.1.

2.2.6.1 Transformation of pBAD24 recombinant vector into EPI300 and 7C8 E. coli strains and screening against C. elegans

The pBAD24 recombinant vectors were transformed into the prepared electrocompetent E. coli EPI300 cells as described by Seidman et al. (1997) (Figure 2.1A). Transformants were recovered in SOC media for 45 minutes at 200 rpm, 37°C and screened for successful recombinant clones on LB10 agar with 50 µg/mL ampicillin. Positive clones with correct insert DNA orientation were established by colony pick PCR using the listed primer pairs (Table 2.2). A correct orientation of DNA insert was defined when the start codon was located downstream of the AraBAD promoter region (Figure 2.1B). The recombinant vectors were extracted and submitted for sequencing analysis by the Ramaciotti Centre for Genomics, UNSW, Australia as described in section 2.2.5. Following sequencing, the recombinant vectors were transformed into the initially prepared electrocompetent 7C8 mutant cells (Seidman et al., 1997) and recovered in SOC media as previously described. Successful transformants were screened on LB10 agar with chloramphenicol, kanamycin, and ampicillin and further validated by colony pick PCR using the primer pairs as described in Table 2.2. The successful EPI300 recombinants and the complemented 7C8 E. coli mutants were challenged against C. elegans using the nematode killing assay as described in section 2.2.9.

Table 2.2 List of primer pairs used in this study. The P. tunicata gene start codon within the primer sequence was underlined whilst the primers that bind to the pBAD24 vector were shown in bold.

Amplification Insert size of P. tunicata Gene size Forward primer (5' - 3') Reverse primer (5' - 3') (bp) target gene hp1 708 hp1_F; ATGAGTACTACAATTTG GAACGATG hp1_R; CTGGCTTGTTATCGCCATTT 753 hp2 831 hp2_F; CTAGTGTCGCCCTCATCG hp2_R; CCCCAATATGTTCGAATCCA 862 hp1/hp2 1539 hp1_F; ATGAGTACTACAATTTG GAACGATG hp2_R; CCCCAATATGTTCGAATCCA 1744

Determination of correct insert orientation hp1 708 hp1_F; ATGAGTACTACAATTTG GAACGATG pBAD24_R; CTGGCAGTTCCCTACTCTCG 995 pBAD24_F; ATGCCATAGCATTTTTATCCA hp1_R; CTGGCTTGTTATCGCCATTT 868 hp2 831 hp2_F; CTAGTGTCGCCCTCATCG pBAD24_R; CTGGCAGTTCCCTACTCTCG 1104 pBAD24_F; ATGCCATAGCATTTTTATCCA hp2_R; CCCCAATATGTTCGAATCCA 977 hp1/hp2 1539 hp1_F; ATGAGTACTACAATTTG GAACGATG pBAD24_R; CTGGCAGTTCCCTACTCTCG 1906 pBAD24_F; ATGCCATAGCATTTTTATCCA hp2_R; CCCCAATATGTTCGAATCCA 1780

P. tunicata gene amplification pBAD24 extraction

5’ 3’ pBAD24 E. coli DH5α Purification

Plasmid linearization

pBAD24 NcoI

Phosphorylation

5’ 3’ Blunt-end repair

5’ 3’ Ligation and transformation

Dephosphorylation pBAD24 5’ 3’

E. coli EPI300

B pBAD24 vector P. tunicata hp1

5’ 3’

3’ 5’

AraBAD promoter Start codon

Figure 2.1 Schematic diagram of the gene cloning protocol (A) The specific P. tunicata D2 gene of interest was amplified by PCR, purified and then phosphorylated using the T4 polynucleotide kinase. The extracted pBAD24 vector was linearized using the NcoI restriction enzyme, blunt-end repaired using the DNA polymerase and dephosphorylated using the Shrimp Alkaline Phosphatase (rSAP). P. tunicata D2 gene insert was then ligated alongside the pBAD24 backbone followed by transformation into the heterologous host E. coli EP300. (B) The correct orientation of the P. tunicata D2 gene insert with the start codon (highlighted in red box) located downstream of the AraBAD promoter (shaded in blue) was confirmed by PCR and sequencing.

2.2.7 Protein extraction

The E. coli clones HP1, HG8 and BD24 were cultured in 2 x Yeast Tryptone (2YT) broth (Appendix II) with appropriate antibiotics. The 2YT culture media was seeded with a 0.6% (v/v) bacterial overnight culture, grown shaking (200 rpm) at 37°C until the OD600nm reached 0.6 and thereafter heterologous gene expression induced with L- Arabinose shaking (200 rpm) at 25°C for 18 hours. Cells were harvested via centrifugation at 6000 x g for 7 minutes in 4oC, washed with equal volume of ice-cold phosphate buffer saline (PBS) (Appendix II) and kept in -80°C prior to the extraction. Each of the cell pellets (~1.5 g) were resuspended in 10 mL PBS and mechanically disrupted through ultra-sonication (Consonic, Australia) on ice for three minutes at 50% amplitude with 2 seconds on and off interval. The resulting cell lysate was spun at 10 000 x g for 30 minutes at 4°C. The supernatant containing soluble cell fraction was removed and stored at 4°C until further use. The remaining pellets (containing insoluble proteins) were washed twice each with ice cold Wash buffer A (Appendix II) and Wash buffer B (Appendix II) before the final wash twice with PBS at 4°C. The insoluble protein was resuspended in 10 mL PBS and assayed for antinematode activity using the 24-well microtiter plate assay method as described in section 2.2.13. Total protein content in each fraction was analysed using the Lowry method (Appendix II) (Waterborg, 2009) and quantified based on the standard curve generated from a serially diluted Bovine Serum Albumin (BSA) (Appendix III) (Waterborg, 2009).

2.2.8 SDS PAGE, mass spectrometry and protein modelling

SDS PAGE was performed according to Laemmli’s method (Laemmli and Favre, 1973; Cleveland et al., 1977). Briefly, the soluble and insoluble protein extracts of E. coli clones HP1, HG8 and BD24 were heated in 4x sample loading buffer (Appendix II) at 80°C for 10 minutes and cooled down to ambient temperature. Protein samples were run through a 12% Polyacrylamide precast gel (BioRad) in the Mini- PROTEAN® System Electrophoresis Cells (BioRad) containing the Running buffer (Appendix II) at 120 V for 90 minutes. Polyacrylamide gels were fixed and stained

71 using the Coomassie blue staining (Appendix II) and de-stained using acetic acid/methanol de-staining solution (Appendix II). Protein bands of interest were excised from the gel and sent to the Bioanalytical Mass Spectrometry Facility (BMSF), University of New South Wales, Australia for mass-spectrometry analysis and protein identification. Sequence obtained were analysed for protein BLAST (Basic Local Alignment Search Tool) (Altschul et al., 1997) and nucleotide alignment through NCBI (National Center for Biotechnology Information). Advanced protein modelling, prediction of ligand binding sites and intensive protein analysis by computational method was performed using Phyre2 (Kelley et al., 2015) and SWISS- MODEL (Waterhouse et al., 2018).

2.2.9 Nematode killing assay

Assay plates were prepared by spreading the overnight culture of test bacteria (30 µL) onto 35 mm × 10 mm plates (SARSTEDT) containing LB10 agar with appropriate antibiotics and L-(+)-Arabinose (0.2 % w/v). Plates were incubated at 25°C for four days. Following incubation, 30 to 40 synchronised L4 stage C. elegans individuals were transferred onto the test bacterial lawn and incubated at 25°C. The proportion of live nematodes were recorded every 24 hours under the dissecting stereomicroscope (Olympus SZ-CTV). Nematodes were considered dead when they showed no response to touch (using sterilised worm picker). A test bacterial strain was considered toxic to C. elegans when more than 50% of the assayed nematodes were killed within 3 days (Nappi, 2019). Experiments were performed in triplicates and monitored until the maximum lifespan of the non-toxic control either E. coli OP50, E. coli EP300 or E. coli BD24 was reached (usually 18 to 20 days). C. elegans exposed to E. coli HG8 were used as the positive control. Statistical analysis on nematode survival was performed using the log-rank (Mantel-Cox) method (Mantel, 1966; Harrington, 2005) with the GraphPad Prism software 8.3.0 (GraphPad Software, La Jolla, CA, USA). A One-way ANOVA followed by Tukey’s pairwise comparison test was used to determine the difference of C. elegans survival in the nematode killing assay. Results are presented as the means ± standard error from triplicate samples. A p-value < 0.05

72 was considered to be significant in line with other recent studies by Ballestriero et al. (2010), Souza et al. (2019) and Büchter et al. (2020).

2.2.10 Preparation of heat-killed bacterial clones

A nematode killing assay was performed as described in section 2.2.9 with the exception that the cultivated bacterial lawns on the assay plates were heat killed by exposing the bacterial lawns to 65°C for 1 hour and allowing them to cool down to 20°C prior to the experiment. To confirm non-viability of the heat-killed bacteria, cells were streaked onto LB10 agar with appropriate antibiotics before and on the last day of the assay. After the experiment, C. elegans were mechanically disrupted using sterilized pestle in 200 µL M9 buffer and the nematode lysate was spread plated onto the LB10 agar plates with appropriate antibiotics. The bacterial cells were confirmed as non-viable when there was no bacterial growth observed on the agar plate after 24 hours of incubation in 37°C.

2.2.11 Nematode egg hatching assay

Assessment of C. elegans egg hatching after exposure to E. coli clones HP1, HG8 and BD24 was performed according to Sant'anna et al. (2013). Nematode eggs were harvested using synchronisation of the gravid hermaphrodites (Stiernagle, 2006) (see section 2.2.2). After the final washing step, eggs were pelleted by centrifugation at 1000 x g for 10 minutes and resuspended in 1 mL of M9 buffer. Next, ~ 60 eggs were inoculated onto each assay plate (seeded with a test bacterial strain according to section 2.2.9) and incubated at 25°C for 7 hours. Numbers of L1 hatchlings on each plate were quantified under the dissecting microscope. The experiment was performed in triplicate. Results were analysed with Prism software version 8.3.0 (GraphPad Software, La Jolla, CA, USA) using a One-way ANOVA and Tukey’s pairwise comparison test. A p value < 0.05 was considered significant

2.2.12 Nematode brood size assay

Assessment of C. elegans brood size after exposure to E. coli clones HP1, HG8 and BD24 was performed according to Bischof et al. (2006). A single L4 stage C. elegans was transferred onto a nematode killing assay plate containing a lawn of the test bacterial strain (see section 2.2.9). After incubation at 25°C for 72 hours, the number of nematode progenies arising from an individual was quantified. The experiment was performed in triplicate (Bischof et al., 2006). Results were analysed with Prism software version 8.3.0 (GraphPad Software, La Jolla, CA, USA) using a One-way ANOVA and Tukey’s pairwise comparison test. A p value < 0.05 was considered significant.

2.2.13 Nematode killing assay using 24-well microtiter plates

C. elegans survival against the E. coli clones, the bacterial cell-free supernatant and the protein extracts (obtained from section 2.2.7) were carried out separately in 24- well microtiter plates as reported by Huang et al. (2014) and Wei et al. (2017) with modifications. Wells were incorporated with 90 µL of bacterial cells (washed with

PBS, re-dissolved in LB10 broth and standardised to OD600 nm = 2.0), appropriate antibiotics, L-(+)-Arabinose and M9 buffer up to 300 µL of final volume. To test activity of the cell-free supernatants, wells were incorporated with 90 µL of cell-free supernatant, 40 µL of concentrated E. coli OP50 (OD600nm = 2.0) and M9 buffer up to 300 µL. To test soluble and insoluble protein fractions,150 µL of each protein extract (equivalent to ~0.7 mg of total protein content) were placed in individual wells supplemented with 40 µL of concentrated E. coli OP50 (washed with PBS and re- dissolved in PBS, OD600nm = 2.0) and M9 buffer up to a final volume of 300 µL. Twenty to thirty L4 stage nematodes were transferred into each well of the 24-well microtiter plate and incubated in 25°C for 72 hours. The proportion of live nematodes were recorded every 24 hours. Nematodes were considered dead when they showed no response to touch (using sterilised worm picker). Experiment was conducted in triplicate and data was presented as the percentage of nematode survival over time of

74 assay. Statistical analysis on nematode survival was performed using the log-rank (Mantel-Cox) method (Mantel, 1966; Harrington, 2005) with the GraphPad Prism software 8.3.0 (GraphPad Software, La Jolla, CA, USA). A One-way ANOVA followed by Tukey’s pairwise comparison test was used to determine the difference of C. elegans survival in the nematode killing assay. Results are presented as the means ± standard error from triplicate samples. A p-value < 0.05 was considered to be significant (Huang et al., 2014).

2.2.14 Antibacterial and antifungal assay

Antibacterial and antifungal assays using a disc diffusion method (James et al., 1996; Puskarova et al., 2017) were performed to determine if the E. coli clones toxic to C. elegans had a broad spectrum of antimicrobial activity. Briefly, LB10 agar with L- Arabinose were seeded with the overnight culture of human bacterial isolates or fungal or yeast suspension (Table 2.1). For fungal or yeast isolates, suspension were prepared by scratching the 3-4 days-old fungal mycelia or yeast cells grown on the Potato Dextrose Agar (Oxoid) (Appendix II) and mixed with 10 mL sterilized water. The fungal spores and yeast suspension were adjusted to 1 x 106 conidia/mL using the Neubauer’s chamber and spread onto the LB10 agar plates added with antibiotics and L-(+)-Arabinose using sterilised cotton swabs. Blank discs (CTO998B, Oxoid) were overlaid onto the seeded LB10 agar. A 10 µL aliquot of the test bacterial suspension

(washed with PBS and resuspended in LB10 broth, OD600nm = 2.0) was inoculated onto each disc. For marine bacterial isolates that do not grow on LB10, a modified protocol was used. Briefly, fresh LB10 agar plates with L-Arabinose were overlaid with blank discs inoculated with the test bacterial suspension (10 µL). Soft marine agar 2216 (Difco™) (Appendix II) containing the marine target strains (Table 2.1) (0.4 mL bacteria/ 3 mL soft agar) was overlaid onto the LB10 agar (James et al., 1996) and solidified at room temperature. All of the assay plates were incubated at 25°C for 48 to 72 hours. Blank discs inoculated with chloramphenicol (50 µg/ mL) or ketoconazole (180 µg/mL) and LB10 broth were used as the positive and negative control respectively. E. coli clone 20G8 (Table 2.1) that produces a purple pigmentation under the control of the same inducible promoter was used as an indicator of successful L-

(+)-Arabinose induction. The antibacterial and antifungal activity of the test clones was assessed via the visualisation of growth clearing zone around the disc (James et al., 1996; Puskarova et al., 2017).

2.3 RESULTS

2.3.1 Annotation of the 13.8 kb P. tunicata D2 DNA fragment encoded in the HG8 fosmid

The majority of the predicted ORFs encoded in the 13.8 kb P. tunicata D2 DNA fragment (Figure 2.2, Table 2.3) were annotated as conserved hypothetical proteins. Only three of the 17 ORFs (namely NCBI Accession Number ZP_01132243.1, ZP_01132239.1 and ZP_01132234.1) encode gene products with a match to previously characterised proteins including a 2',3'-cyclic nucleotide 2'- phosphodiesterase/3'-nucleotidase bifunctional periplasmic precursor protein (ZP_01132243.1), probable outer membrane protein A (ompA) (ZP_01132239.1) and Transposase IS66 (ZP_01132234.1). The remaining 14 hypothetical proteins could not be assigned a known function.

However, further investigation identified several conserved domain that might be important for the gene function (Table 2.3). For example, the hypothetical protein ZP_01132244.1 harbours a conserved ABC_transp_aux domain that is found in a number of uncharacterised hypothetical proteins (e.g. hypothetical protein from Borrelia turicatae (strain 91E135) (NCBI Accession: WP_011772685.1) (Porcella et al., 2008) and proteins involved in membrane transport (e.g. ABC_transp_aux domain-containing protein from Pseudomonas aeruginosa MH27 (NCBI Accession: WP_023657096.1) (Tielen et al., 2014) and gliding motility (e.g. gliding motility- associated ABC transporter ATP-binding subunit GldA from Flavobacterium johnsoniae (NCBI Accession: WP_014164802.1) (Agarwal et al., 1997) and Intraflagellar transport protein IFT52 from Chlamydomonas reinhardtii (NCBI Accession: XP_001692161.1) (Taschner et al., 2014). In addition, the hypothetical

76 protein ZP_01132242.1 harbours conserved BON and OsmY domains that are found in other characterised BON-domain containing proteins in several microorganisms e.g. Paraglaciecola sp., Pseudomonas alcaligenes, Rheinheimera baltica, Acidobacteria bacterium and Xanthomonadales bacterium (NCBI Accession; NCT48573.1, WP_110682546.1, WP_027671440.1, RPH59456.1 and RPH96582.1 respectively) (Yeats and Bateman, 2003; Dalcin Martins et al., 2018; Probst et al., 2020). Other ORFs annotated as the hypothetical proteins (ZP_01132233.1, ZP_01132232.1 and ZP_01132231.1) contained conserved domains related to transposase function, including two with homology to predicted transposases encoded in P. ulvae. Additionally, six ORFs; ZP_01132244.1, ZP_01132243.1, ZP_01132242.1, ZP_01132241.1, ZP_01132240.1 and ZP_01132239.1 all showed homology to genes encoding putative membrane bound proteins. Further descriptions on each of the gene are listed in the Table 2.3.

HG8 fosmid

13.8 kb P. tunicata insert

Uncharacterised hypothetical protein 300 bp 2,3-cyclic nucleotide 2-phosphodiesterase / 3-nucleotidase bifunctional periplasmic Probable outer membrane protein (OmpA Family protein) Transposase IS66 Transposon mutation (Tn) Intergenic region

Figure 2.2 Schematic diagram of 13.8 kb P. tunicata D2 insert encoded in the HG8 fosmid. Previous transposon disruption of one of the hypothetical proteins (NCBI Accession Number ZP_01132244.1) diminished the nematode killing activity by HG8 clone (Ballestriero et al., 2010). 78

Table 2.3 Homologs and predicted conserved domains of the 17 ORFs in the 13.8 kb P. tunicata D2 HG8 insert

P. tunicata gene Protein Query Identified Nucleotide Signal Predicted gene % Accession size Closest homolog covered E-value conserved domain size (bp) peptide function Identity Number (aa) (%) and E-value

Uncharacterised Uncharacterised hypothetical protein ZP_01132246.1 708 235 No hypothetical Vibrio ordalii FS-238 85.53 100 3.1 e-149 No (denoted hp1) protein (IMG Locus Tag: A1QSDRAFT_00964)

Uncharacterised Uncharacterised hypothetical protein ZP_01132245.1 831 276 No hypothetical Vibrio ordalii FS-238 78.8 100 2.40E-159 No (denoted hp2) protein (IMG Locus Tag: A1QSDRAFT_00963)

ABC_transp_aux Uncharacterised (Accession: hypothetical protein pfam09822). E- Uncharacterised Pseudoalteromonas ZP_01132244.1 value: 6.63e-03 2175 724 Yes hypothetical luteoviolacea 79.06 100 0 (denoted hp3) protein DSM6061 (IMG P-loop_NTP Locus Tag: (Accession: Ga0128231_114841) cl21455). E-value: 9.18e-04