Isolation and Characterization of the Mating-Type Locus of the Barley

855

Isolation and characterization of the mating-type locus of the barley pathogen Pyrenophora teres and frequencies of mating-type idiomorphs within and among fungal populations collected from barley landraces

Domenico Rau, Frank J. Maier, Roberto Papa, Anthony H.D. Brown, Virgilio Balmas, Eva Saba, Wilhelm Schaefer, and Giovanna Attene

Abstract: Pyrenophora teres f. sp. teres mating-type genes (MAT-1: 1190 bp; MAT-2: 1055 bp) have been identified. Their predicted proteins, measuring 379 and 333 amino acids, respectively, are similar to those of other Pleosporales, such as Pleospora sp., Cochliobolus sp., Alternaria alternata, Leptosphaeria maculans, and Phaeosphaeria nodorum. The structure of the MAT locus is discussed in comparison with those of other fungi. A mating-type PCR assay has also been developed; with this assay we have analyzed 150 isolates that were collected from 6 Sardinian barley landrace populations. Of these, 68 were P. t e re s f. sp. teres (net form; NF) and 82 were P. t e re s f. sp. maculata (spot form; SF). Within each mating type, the NF and SF amplification products were of the same length and were highly similar in sequence. The 2 mating types were present in both the NF and the SF populations at the field level, indicating that they have all maintained the potential for sexual reproduction. Despite the 2 forms being sympatric in 5 fields, no intermediate isolates were detected with amplified fragment length polymorphism (AFLP) analysis. These results suggest that the 2 forms are genetically isolated under the field conditions. In all of the samples of P. t e re s , the ratio of the 2 mating types was consistently in accord with the 1:1 null hypothesis. This ratio is expected when segregation distortion and clonal selection among mating types are absent or asexual reproduction is rare. Overall, sexual reproduction ap- pears to be the major process that equalizes the frequencies of the 2 mating types within populations. Key words: Pyrenophora teres, mating-types, AFLPs, sexual reproduction, selection, barley.

Résumé : Les gènes déterminant le type sexuel (MAT-1 : 1190 pb ; MAT-2 : 1055 pb) chez le869Pyrenophora teres f. sp. teres ont été identifiés. Les protéines MAT prédites, de 379 et de 333 acides aminés respectivement, sont semblables à celles des autres pléosporales telles que Pleospora sp., Cochliobolus sp., Alternaria alternata, Leptosphaeria maculans et Phaeosphaeria nodorum. La structure du locus MAT est comparée à celle chez d’autres champignons. Un test PCR pour le type sexuel a aussi été mis au point permettant d’analyser 150 isolats provenant de 6 populations de variétés de pays d’orge de la Sardaigne. De ce nombre, 68 était du P. t e re s f. sp. teres (forme réticulée, NF) et 82 du P. t e re s f. sp. maculata (forme maculée, SF). Au sein de chaque type sexuel, les amplicons NF et SF étaient de même taille et très semblables quant à leur séquence. Les 2 types sexuels étaient présents au sein des populations NF et SF à l’échelle du champ, ce qui signifie qu’elles ont maintenu leur capacité à se reproduire sexuellement. Malgré la sym- patrie des 2 formes au sein de 5 champs, aucun isolat intermédiaire n’a été observé suite à une analyse AFLP (poly- morphisme de longueur des fragments amplifiés). Ces résultats suggèrent que les 2 formes sont isolées génétiquement au champ. Chez tous les échantillons du P. t e re s , le ratio des 2 types sexuels était constamment conforme à l’hypothèse nulle (1:1). Ce ratio est attendu lorsqu’il n’y a pas de distorsion de la ségrégation ou de sélection clonale ou encore

Received 25 August 2004. Accepted 25 April 2005. Published on the NRC Research Press Web site at http://genome.nrc.ca on 20 October 2005. Corresponding Editor: F. Belzile. D. Rau and R. Papa.1 Dipartimento di Scienze degli Alimenti, Facoltà di Agraria, Università Politecnica delle Marche, Via Brecce Bianche, 60131, Ancona, Italy. F.J. Maier and W. Schaefer. Department of Applied Molecular Biology of Plants III (AMPIII), Institute of General Botany, Universität Hamburg, Ohnhorststrasse 18, 22609 Hamburg, Germany. A.H.D. Brown. Centre for Plant Biodiversity Research, CSIRO Plant Industry, Canberra, ACT 2601, Australia. V. Balmas. Dipartimento di Protezione delle Piante, Università degli Studi di Sassari, Via E. de Nicola, 07100, Sassari, Italy. E. Saba and G. Attene. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria, Università degli Studi di Sassari, Via E. de Nicola, 07100, Sassari, Italy. 1Corresponding author (e-mail: [email protected]).

lorsque la reproduction asexuée est rare. Globalement, la reproduction sexuée semble le processus principal égalisant la fréquence des 2 types sexuels au sein de ces populations. Mots clés : Pyrenophora teres, types sexuels, AFLP, reproduction sexuée, sélection, orge. [Traduit par la Rédaction]

Introduction Rau et al. Net blotch is a barley disease with a worldwide distribu- infestans (Hammi et al. 2002), and Phaeosphaeria nodorum tion that can cause substantial yield losses (Jordan et al. (Halama 2002). However, this approach is very time con- 1985; Steffenson et al. 1991). The causal agent is the fungus suming, especially with P. teres.InP. teres, the mating pro- Pyrenophora teres Drechsler (anamorph: Drechslera teres cedure needs 7–15 months (Smedegård-Petersen 1978); (Sacc.) Shoemaker). To improve strategies of resistance therefore, an alternative indirect approach is needed to ex- breeding and to determine the correct management of resis- plore its population structure more efficiently. PCR-based tance genes for this pathogen, a better understanding of the determinations of mating types are reliable and less costly. evolutionary potential of the pathogen population would be For Cryphonectria parasitica, PCR-based markers for useful (McDonald and Linde 2002). In this regard, it would mating-type alleles correlate perfectly with the phenotypes be of particular interest to study fungal populations from ge- of individual isolates (Marra and Milgroom 2001). More re- netically variable barley landraces, that is, pathogen popula- cently, Zhan et al. (2002) used this technique to study the tions that are partners in a scenario of interactions with the distribution of mating-type idiomorphs in the wheat patho- host in a dynamic potentially coevolving relationship. In this gen Mycosphaerella graminicola over spatial scales from context, sexual reproduction is of fundamental importance in lesions to continents; their frequency never differed signifi- fungal pathogens, because it allows the generation of geno- cantly from a 1:1 ratio, as expected for unbiased meiotic typic diversity that can adapt to the shifting genetic makeup segregation at a single locus. of host populations. Two morphologically similar intraspecific formae speciales In ascomycetes, a single regulatory locus, referred to as of the net-blotch pathogen are known. The net form (NF) the mating-type (MAT) locus (Kronstad and Staben 1997; (P. teres f. sp. teres) produces elongated light-brown lesions Turgeon 1998), determines cross compatibility. This locus is with dark-brown necrotic reticulations, whereas the spot structurally unusual, because the 2 alternate forms (alleles) form (SF) (P. teres f. sp. maculata) produces ovoid dark- encode different transcription factors and consist of com- brown lesions that are surrounded by a distinct chlorotic area pletely unrelated sequences, even though they occupy the (Smedegård-Petersen 1971). Although these 2 forms can be same chromosomal position (Kronstad and Staben 1997). hybridized in the laboratory (Smedegård-Petersen 1971, 1976; Metzenberg and Glass (1990) proposed that such unorthodox Campbell et al. 1999), whether or not mating occurs be- alleles be named idiomorphs. In heterothallic fungi, the sex- tween them in the field is not clear. More recently, recombi- ual cycle is initiated only when 2 fungal strains of different nation between the forms has been seen to occur under field idiomorphs interact, after each detects the other through the conditions (Campbell et al. 2002). However, Williams et al. mating pheromones produced by the unlike mating types (2001) demonstrated that amplified fragment length poly- (Kronstad and Staben 1997). morphism (AFLP) assays distinguished between isolates of Despite the lack of significant homology between the 2 P. teres f. sp. teres and P. teres f. sp. maculata. Similarly, idiomorphs, each locus is flanked by (or contains) conserved Rau et al. (2003) showed that isolates from infected fields of sequences (Metzenberg and Glass 1990). This allows the use heterogeneous barley landraces clearly split into 2 strongly of PCR-based cloning approaches for the analysis of MAT defined clusters that correspond to the NF and the SF; no in- genes (Arie et al. 1997) and the design of idiomorph-specific termediate group was seen. Moreover, through both digenic primers for each species (e.g., Marra and Milgroom 1999; and multilocus linkage disequilibrium (IA test) analysis, Rau Steenkamp et al. 2000; Cozijnsen and Howlett 2003). MAT et al. (2003) found evidence for sexual reproduction in both genes have thus been studied to determine their molecular the NF and SF populations, and showed that the relative structures (Turgeon et al. 1995), to resolve phylogenetic re- contributions of sexual and asexual reproduction can vary. lationships among organisms (Turgeon 1998), and to under- These observations are consistent with previous data col- stand evolutionary trends in fungal mating systems (Yun et lected on a continental scale (Peever and Milgroom 1994). al. 1999). MAT genes have been identified and or character- Despite this indirect genetic evidence of regular cycles of ized in an increasing number of ascomycetes (Wirsel et al. sexual reproduction, the population genetic structure of the 1998; Arie et al. 2000; Yun et al. 2000; Waalwijk et al. mating-type gene has not yet been studied for this fungus. 2002; Bennet et al. 2003; Cozijnsen and Howlett 2003; Our main objectives were to characterize MAT idiomorphs Goodwin et al. 2003). of P. teres and to develop PCR primers for easy mating-type Mating-type surveys can be used to gauge the potential detection. Moreover, because farmers still grow variable for sexual recombination. One way to conduct a mating-type landraces of barley on the island of Sardinia (Attene et al. survey is to test sexual compatibility with standard mating- 1996; Papa et al. 1998), our second objective was to deter- type testers. Examples of this approach have been reported mine mating-type idiomorph distribution within the P. teres for Cochliobolus carbonum (Weltz and Leonard 1993), populations for both NF and SF isolates obtained from 6 Magnaporthe grisea (Dayakar et al. 2000), Phytophthora populations of Sardinian barley landraces. Equal mating-

© 2005 NRC Canada Rau et al. 857 type frequencies would support previous tests of linkage dis- 1 min, 52 °C for 1 min, and 72 °C for 1.5 min, with a final equilibrium (Rau et al. 2003) that indicated the prevalence extension step at 72 °C for 10 min. of sexual reproduction in the pathogen. TAIL-PCR was performed according to Liu and Whittier (1995). A total of 4 PCRs, using different combinations of arbitrary degenerated primers (AD2 and AD4) with nested Materials and methods specific primers (1, 2, 3, and 4), were performed (Table 1) (see Results). All PCR primers were synthesized at Carl Isolation of MAT idiomorphs Roth GmbH & Co (Karlsruhe, Germany).

Fungal isolates and media Cloning, sequencing, and analysis of PCR products The idiomorphs were obtained from the isolates 0-1 and PCR products a and b, as well as the products of primers 15A of P. teres f.sp. teres that were determined to be of op- PtMatfw and PtMatrev from P. teres isolates 15A and 0-1, posite mating types by performing classical crossing experi- representing the idiomorph and flanking regions, were cloned ments (Weiland et al. 1999). The P. teres strains were stored in pGEM-T Vector System I (Promega, Madison, Wis.). Se- as dried mycelium at room temperature or in 30 % glycerol quencing was supported by MWG Sequencing Service at –70 °C. For induction of conidiation, peanut leaf–oatmeal– (MWG-Biotech, Ebersberg, Germany) and AGOWA Se- agar medium was inoculated with a mycelium plug and in- quencing Service (AGOWA GmbH, Berlin, Germany). cubated at 18 °C under near UV light (Philips TLD 36W/08) Sequences were aligned using the ClustalW algorithm of and white light (Philips TL 40W/33RS), 12 h photoperiod, ClustalX (Thompson et al. 1997). Blastn and Blastp (http:// for 1 week. For extraction of DNA, mycelium was obtained www.ncbi.nlm.nih.gov/BLAST/) (Altschul et al. 1997) from cultures grown in complete medium in Erlenmeyer searches for nucleotide and peptide sequences, respectively, flasks on a rotary shaker at 150 rpm and 28 °C. were completed against the National Center for Biotechnol- ogy Information (NCBI)/GenBank database (http://www.ncbi. DNA extraction, isolation, and manipulation nlm.nih.gov/entrez/query.fcgi). The search for open reading Genomic DNA was extracted from P. teres mycelium us- frames (ORFs) on MAT-1 and MAT-2 sequences was per- ing a DNA Isolation Kit (Gentra Systems, Minneapolis, formed using the ORF Finder applet (http://www.ncbi. Minn.), in accordance with the instructions of the manufac- nlm.nih.gov/gorf/gorf.html). The identification of putative turer. If not indicated otherwise, all molecular standard tech- splicing sites and introns was also conducted by comparing niques were conducted according to Sambrook et al. (1989). our sequences with fungal mating-type genes that have al- ready been characterized, deposited in the NCBI/GenBank Cloning strategy database, and identified during Basic Local Alignment The strategy followed was essentially that proposed by Search Tool (BLAST) searches. To determine the 3′ end of Arie et al. (1997). As a starting point, genomic DNA of the idiomorphs (Bennet et al. 2003), sliding-window analysis P. teres f.sp. teres isolates 0-1 and 15A was used for stan- was performed with a window size of 10 nucleotides, a step dard PCR amplification, with Pt5 and Pt7 primer pairs (Ta- of 1 nucleotide, and using DnaSP ver. 4.00 (Rozas et al. ble 1), which identified the distal end of high-mobility group 2004). For this analysis, MAT-1 and MAT-2 sequences were (HMG) 3′ and 5′ flanks, respectively (Fig. 1) (Arie et al. aligned and trimmed. 1997). PCR amplification with Pt5 and Pt7 primers was successful only on isolate 0-1, suggesting that this isolate has Phylogenetic analysis the MAT-2 idiomorph. Additional flanking regions from the Representative MAT peptide sequences (of the alpha and MAT-2 isolate 0-1 were obtained using thermal asymmetric HMG-box regions) from different fungi available in interlaced (TAIL) PCR-mediated genomic walking in both GenBank were compared with P. teres MAT (Figs. 2 and 3). directions, using different combinations of specific and de- The sequences were aligned using the Profile Mode option generated primers (Fig. 1 and Table 1) (Arie et al. 1997). We (Goodwin and Zismann 2001; Goodwin et al. 2003) of then moved from flanking regions (assumed to be conserved ClustalX (Thompson et al. 1997). between the MAT idiomorphs) into the MAT-1 idiomorph se- Sequences from Schizosaccharomyces pombe were used quence by designing new specific primers for the conserved as the outgroup. Trees were obtained using the neighbor- MAT flanking regions (PtMat_fw and PtMAT_rev) (Table 1). joining method (Goodwin et al. 2003). The consistency of The products obtained by PCR amplification of the genomic each node of the trees was estimated using the bootstrap pro- DNA of both 0-1 and 15A isolates were then sequenced cedure (1000 replicates). ClustalX and neighbor-joining-plot (Fig. 1). (Perrière and Gouy 1996) software were used to construct and draw the trees, respectively. PCR conditions Standard PCR was carried out using the Pt5 and Pt7 and PCR idiomorph-specific assay PtMat_fw and PtMat_rev primer pairs (Table 1). These were The primers were designed to amplify both the P. teres performed in volumes of 50 µL, containing 1.5 mmol MAT-1 and MAT-2 idiomorph coding regions. Primers MAT- ′ ′ MgCl2/L, 0.2 mmol each deoxynucleoside triphosphate 1 forward (5 -AACAGACTCCTCTTGACAACCCG-3 ) and (dNTP)/L, 150 pmol of each primer, 100 ng of genomic MAT-1 reverse (5′-TGACGATGCATAGTTTGTAAGGGTC- DNA, 1 unit of Taq polymerase (Eppendorf), and 1× PCR 3′) amplify a fragment of ~1300 bp in MAT-1 isolates buffer (Eppendorf). The PCRs were initiated by denaturation (Fig. 4). Primers MAT-2 forward (5′-CAACTTTTCTCTACC- at 95 °C for 5 min, followed by 30 cycles of 94 °C for ACACGTATCCC-3′) and MAT-2 reverse (5′-TGTGGCGAT-

Table 1. Primers used to clone the mating-type idiomorphs of Pyrenophora teres. Name Sequence 5′→3′a References Pt5 AGCACCTTCGCCTGTAA Arie et al. 1997 Pt7 GGCGCATATGCAAGGGGGTTTC Arie et al. 1997 1 GTTCCCAGGAAATTCGAACA Present study 2 AGATAAAGGATATTGCGTAA Present study 3 AGTCCGCTAAGGAGGAGCAT Present study 4 CGTCAGCATCCCAACTACAA Present study AD2 AGWGNAGWANCAWAGG Liu and Whittier 1995 AD4 TCSTICGNACITWGGA Liu and Whittier 1995 PtMat_fw CAGGACGTTCGCCATCGCCAT Present study PtMat_rev TGTGTCAGTGTGAAAGCACCGTA Present study Note: I, inositol. aNucleotides N, S, W, according to IUPAC code (Cornish-Bowden 1985).

Fig. 1. Thermal asymmetric interlaced (TAIL)-PCR-mediated genomic walking to clone the Pyrenophora teres MAT-2 idiomorph flanking regions, and the use of these regions to clone the P. teres MAT-1 idiomorph. Arrows indicate the primers used (see Table 1 for the sequences). Box, stretch of MAT-2 idiomorph detectable with the Pt5 and Pt7 primer pair; black, HMG box; gray, regions of the idiomorph flanking the HMG box. Primers 1, 2, 3, and 4 are defined in Table 1. a and b indicate the fragments amplified with TAIL- PCR.

GCATAGTTCGTAC-3′) generate a fragment of ~1150 bp in onal (1 leaf per plant) from plants at least 10 m apart. Only MAT-2 isolates (Fig. 4). These specific primers were used in 1 isolate per infected leaf was obtained, to a total of 150 PCR assays to determine mating types (MAT-1 or MAT-2)in monoconidial isolates. Each was designated as P. teres f. sp. a collection of 150 isolates. teres (NF) or P. teres f. sp. maculata (SF) on the basis of the morphology of the originating lesion (following Smedegård- Mating-type frequency survey Petersen 1971), the AFLP analysis, and the controlled reinoculation tests on third-leaf seedlings and on detached Collection of isolates leaves (Rau et al. 2003). Of these 150 monoconidial isolates, Leaf samples infected with P. teres were collected from 68 were NF and 82 were SF. The isolates were labeled using each of 6 fields of the barley landrace S'orgiu sardu (Attene a 3-letter code for each population (SEC, PIR, TER, SIR, et al. 1996; Papa et al. 1998), growing in 5 agro-ecological BAC, and SES), followed by an identifier number (e.g., PIR areas of Sardinia (see Table 1 of Rau et al. 2003). The fields 19). For further details about the collection, monoconidial were of similar size (2–4 ha) and the sampling strategy was culturing, DNA extraction, and reinoculation tests, see Rau the same in each field: leaves were collected along the diag- et al. (2003). Three other barley pathogens were also in-

Fig. 2. Protein alignment of the alpha-box (A) and high-mobility group (HMG)-box regions (B) of P. t e re s with those of other sequences of Ascomycetes from NCBI/GenBank. All alpha and HMG sequences possess an intron, denoted by a black vertical arrow. Only Mycosphaerella graminicola and Septoria passerinii possess an additional intron in the alpha-box regions, denoted by a white vertical arrow. Asterisks indicate amino acids that are conserved among all species; single and double dots (: and .) indicate full conservation of strong and weak groups of amino acids, respectively, as defined by ClustalX. Amino acid positions are indicated below each alignment. Species names (on the left) and accession code (on the right) are also given. Pyrenophora teres_1, sequences from isolates 15A (A) and 0-1 (B); Pyrenophora teres_2, sequences from isolates PIR b2n (A) and BAC 25 (B).

cluded in the analysis: Pyrenophora graminea Ito & dNTP/L (Promega), 1 µmol of each primer/L, 1 U Taq poly- Kuribay. (anamorph: Drechslera graminea (Rabenh. ex merase (Promega), and 20 ng genomic DNA. Samples of Schlecht.) Shoemaker), Cochliobolus sativus Ito & Kuribay. DNA were subjected to 94 °C for 5 min and 30 cycles of the (anamorph: Bipolaris sorokiniana (Sacc.) Shoemaker) and following thermal profile: denaturation at 94 °C for 60 s, an- Rhynchosporium secalis (Oud.) Davis. nealing at 55 °C for 60 s, and extension at 72 °C for 90 s; this was followed by 72 °C for 10 min. All amplifications Mating-type amplification of field isolates were performed in a PE-9700 thermal cycler (Perkin Elmer PCR amplifications were performed independently for each Corp., Wellesley, Massachusetts). The amplicons were sepa- specific primer pair. Each 20-µL PCR reaction contained 1× rated by 1.2% agarose gel electrophoresis in 0.5× Tris– PCR buffer (Promega), 2.5 mmol MgCl2/L, 0.2 mmol of each borate–EDTA (TBE) buffer (pH 8.0) at 100 V for 3 h. After

© 2005 NRC Canada 860 Genome Vol. 48, 2005 e. Fa, the family; Or, the ellales; Dia, Diaporthales; ceae; M, Mycosphaerellaceae; (HMG-box; B) protein se- cation on the basis of the Index MAT-2 (alpha-box; A) and MAT-1 and other Ascomycetes both for the P. t e re s Neighbor-joining trees showing the relationships between Fig. 3. quences. The consistency oforder; each CI, node class. is FamilyV, indicated codes: Valsaceoe; by Le, Sc, bootstrap Leptosphaeriaceae; Schizosaccharomycetaceae.Sch, values Ph, Order Schizosaccharomycetales. (>60%) Phaeosphaeriaceae; code: Class (1000 La, Ple, code: replicates).Fungorum Lasiosphariaceae; Pleosporales; X, Branch is S, Sor, Dothideomicetidae; lengths available Sordariaceae; Sordariales; O, are at: N, Hyp, Sordariomycetidae; proportional http://www.indexfungorum.org. Nectriaceae; Hypocreales; +, to D, Hel, Leotiomycetidae; genetic Dermata Helotiales; §, distanc My, mitosporic Mycosphaer ascomycete. Classifi

Fig. 4. Organization of MAT-1 (A) and MAT-2 (B) idiomorphs of P. teres. Boxes bordered by a thin black continuous line, idiomorphs; white underlined by arrow, coding regions; hatched, introns; gray, 5′ and 3′noncoding ends. Thick black lines, near identical 3′ flanking regions. Braces, positions of the alpha and HMG boxes of the MAT-1 and MAT-2 idiomorphs, respectively. Short arrows, approximate annealing sites of primers for selective amplification of MAT idiomorphs. Primer names and sequences are given in the Materials and methods. White boxes bordered by a black interrupted line and underlined by an arrow represent the ORF1 stretches.

staining with ethidium bromide, the images were captured Statistical analysis with a Polaroid camera (Kodak 667). To compare the The sample sizes for each single collection field are simi- lengths of the amplicons at higher resolution, a sample of 12 lar to those of other studies (e.g., Table 3 in Douhan et al. isolates (6 NF and 6 SF, comprising both mating types) was (2002a); Table 4 in Douhan et al. (2002b); Table 4 in Linde also tested on silver-stained denaturing polyacrylamide gels: et al. (2003); Table 4 in Zhan et al. (2002)). The application 6% acrylamide-bisacrylamide (19:1), 8 mol urea/L in TBE of the same statistical methods thus allows direct compari- buffer (pH 8.3), at constant power (80 W) for 1.5 h. To sons to be made. The null hypothesis of the 1:1 ratio of the 2 check for the reproducibility of the PCR reaction, the com- mating types for each forma specialis of the fungus, both at plete experiments were conducted twice. the regional level and within each field, was evaluated using Four amplicons, obtained from isolates PIR b2n and the χ2 test (Douhan et al. 2002a, 2000b; Zhan et al. 2002; BAC 25N (NF with the MAT-1 and MAT-2 idiomorph, re- Linde et al. 2003). As it is still not clear whether the 2 spectively) and SIR 4s and PIR 24s (SF with the MAT-1 and formae can hybridize in nature (Campbell et al. 1999, 2002; MAT-2 idiomorph, respectively) were purified with GFX PCR Williams et al. 2001; Rau et al. 2003), we conducted tests DNA and Gel Purification Kit (Amersham Biosciences), and pooling NF and SF isolates at both the regional and field 2 directly sequenced with Qiagen Sequencing Service (Single levels. The χ values are measures of departure from the 1:1 Read Long). For each isolate, 2 sequences were obtained expectation, but significance tests were performed only on (forward and reverse), each of ≈600–700 bp. Forward and sample sizes ≥10 (Lewontin and Felsenstein 1965; Douhan et reverse sequences were aligned using ClustalX (Thompson al. 2002a). In addition, an exact binomial test for goodness- et al. 1997) and trimmed to obtain a final reliable fragment of-fit was performed. When sample sizes are small, the exact 2 of 1158 bp for the MAT-1 sequence and 1068 bp for the MAT- binomial test is more accurate than the χ test (Sokal and 2 sequence. The 4 sequences were deposited in GenBank Rolhf 1995; Linde et al. 2003). Finally, we calculated the with the following codes: AY950581 (PIR b2n), AY950583 minimum mating-type ratio bias detectable for each given α (BAC 25n), AY950582 (SIR 4s), and AY950584 (PIR 24s). sample size, with a significance level of = 0.05 and a β To confirm their identity, putative P. teres MAT-1 and MAT-2 power (1 – ) of 0.80. Approximating the binomial distribu- idiomorph fragments were then subjected to queries using tion to a normal distribution, we applied the approximate µ µ 2 σ2 Blastn and Blastp (Altschul et al. 1997). formula: n =[(zα + zβ)/( 1 – 0) ] , where n is the sample size, zα and zβ are the standardized z values for α = 0.05 β µ µ (1.64) and = 0.20 (0.84); 1 and 0 are the means of suc- AFLP analysis cess for the alternative and the null hypothesis, respectively; σ2 µ µ Field isolates were also genotyped using AFLPs (Vos et is the variance calculated as p(1– p), where p =( 1 + 0)/ al. 1995), as described elsewhere (Rau et al. 2003). Rau et 2. The similarities of mating-type frequencies among the 6 al. (2003) reported the results for 2 primer combinations, us- different fields, among the 2 NF populations, among the ing 2 EcoRI (E) primers with 2 selective nucleotides (E-AC 3 SF populations, and among the 5 NF and SF populations and E-GC) and 1 MseI (M) primer with a selective nucleo- with larger sample sizes were also evaluated, using the con- tide (M-C). Our study extends the analysis, with data from 2 tingency χ2 test with JMP 3.1.5 software (SAS Institute other primer combinations (E-AC/M-A and E-GC/M-A), to 1995). Clone correction before the analysis of idiomorph check whether the isolates studied by Rau et al. (2003) that frequencies (Douhan et al. 2002b; Zhan et al. 2002; Linde et shared the same multilocus genotype are true clones. al. 2003) was unnecessary, because all the isolates had dis-

© 2005 NRC Canada 862 Genome Vol. 48, 2005 tinct AFLP genotypes in all cases, except the SF isolatess rae (E=2×10–21). Other matches, such as those with from PIR population, where only 2 individuals shared the Gibberella sp., Fusarium sp., R. secalis, and Phaeosphaeria same genotype (see Results). avenaria, were also found (E = 10–5 ÷10–20).

Results Sequence from P. teres isolate 15A The analysis of the ~2.7-kb fragment revealed a MAT-1 Isolation of MAT idiomorphs idiomorph of 1865 bp (or 1919 bp when the degenerated C Extending the HMG box flanks by TAIL-PCR terminus of ORF1 is considered, see later in the text), as As expected (Arie et al. 1997), PCR amplification with well as 455 bp (or 401 bp, not including the degenerated C the Pt5 and Pt7 primer pairs produced a fragment of 1611 bp terminus of ORF1, see later in the text) and 353 bp of se- ′ ′ of genomic DNA only on isolate 0-1. The first TAIL-PCR quence 5 and 3 to the idiomorph, respectively (Fig. 4A). resulted in fragment a (Fig. 1). The PCR for the primary re- The MAT-1 idiomorph contained a single putative gene of action was conducted using the specific primer1 in combina- 1190 bp. A putative intron of 53 bp separated exon I tion with arbitrary degenerated primer AD2, and the secondary (249 bp) from exon II (888 bp). The intron contained a per- reaction was conducted with the specific nested primer2 in fect lariat sequence, RCT-RAC, beginning 21 nucleotides combination with primer AD2. A second TAIL-PCR resulted upstream of the 3′ splice site. Removal of the intron results in fragment b (Fig. 1). This was conducted for the primary in an ORF of 1137 bp encoding a protein of 379 amino acids reaction using the specific primer3 in combination with arbi- (exonI=83amino acids; exon II = 296 amino acids). The trary degenerated primer AD4, and the secondary reaction MAT-1 sequence includes the alpha-box motif (Fig. 4A). The was conducted with the specific nested primer4 in combina- introns disrupted the alpha-box domain of MAT-1 after tion with primer AD4. codon 83, at a position corresponding to a cysteine, as in other ascomycetes, such as Pleospora spp., Stemphylium sp., Cloning the MAT gene Cochiobolus spp., and Alternaria alternata and L. maculans Fragments a and b were sequenced. Primers PtMat_fw (Fig. 2A). and PtMat_rev (Table 1), nested with respect to the 5′ and 3′ The Blastp search showed that our entire MAT-1 putative limits of the a and b amplified regions, were then designed peptide has a strong homology with several MAT-1 mating-type to amplify both mating-type idiomorphs (Fig. 1). Using these proteins of other fungi, such as Pleospora sp., Stemphylium sp. primers, PCR amplification was successful in both tester iso- (E=10–74 ÷10–79), Cochliobolus heterostrophus (E=5×10–77), lates 0-1 and 15A. The amplicons were cloned, sequenced, Cochliobolus luttrelli (E=4×10–65), A. alternata (E=10–69), and analyzed. The cloned PCR fragment was 2830 bp in iso- A. tenuissima (E=10–66), L. maculans (E=10–57), and late 0-1 (GenBank accession No. AY950586) and 2673 bp in P. nodorum (E=10–39). Other matches, such as those with isolate 15A (GenBank acc No. AY950585) (Fig. 1). Gibberella sp., Potentilla anserina, Septoria passerinii, Fusarium sp. Sordaria sp., and M. graminicola, were also Sequence from P. teres isolate 0-1 found (E = 10–5 ÷10–20). The ~2.8-kb fragment obtained from isolate 0-1 contained the MAT-2 idiomorph of 2028 bp (or 2076 bp when the de- Thus, our molecular analysis confirmed that P. teres iso- generated C terminus of ORF1 is considered, see below), as lates 0-1 and 15A have opposite mating types, as predicted well as 449 bp (or 401 bp, not including the degenerated C by classical crossing experiments (Weiland et al. 1999), and terminus of ORF1, see later in the text) and 353 bp of se- that they have MAT-2 and MAT-1 idiomorphs, respectively. quence 5′ and 3′ to the idiomorph, respectively (Fig. 4B). Alignment of sequences of MAT-1 with MAT-2 idio- The MAT-2 idiomorph contained a single putative gene of morphs demonstrated that the idiomorphs are highly dissimi- 1055 bp. A putative intron of 56 bp was identified that sepa- lar (similarity of 48.1% and 42.7% excluding and including rated exon I (456 bp) from exon II (542 bp). A lariat se- gaps, respectively) in contrast to the 5′ (similarity of 96.3%) quence, ACTGAC (Brutchez et al. 1993), was found within and 3′ (similarity of 98.0%) flanking regions (no gaps ob- the intron, beginning 16 nucleotides upstream of the 3′ splice served). Sliding-window analysis revealed an abrupt transi- site. After removing the intron, the MAT-2 gene results in an tion between the flanking regions and the idiomorphs, with ORF of 999 bp encoding a protein of 333 amino acids (exon no gradual trend (increase of similarity) toward either the 5′ I = 152 amino acids; exon II = 180 amino acids). The MAT-2 or the 3′ ends of the idiomorphs (Fig. 5). sequence contained the HMG motif (Fig. 4B). The intron Open reading frames of 150 amino acids in MAT-1 and disrupted the HMG domain of MAT-2 after the first base of 148 amino acids in MAT-2 were found in the 455 bp and codon 153 at the same position (serine) as in the HMG do- 449 bp of sequence 5′ of the idiomorphs, respectively. This mains of all other fungal MAT loci sequenced so far is very similar to a stretch of the ORF1 protein, a homolog (Fig. 2B). of a Saccharomyces cerevisiae gene (YLR456W), for which a The Blastp search showed that our entire putative MAT-2 function is not known. In the BLAST search, the best match peptide has a strong homology with several MAT-2 mating- was with ORF1 of Pleospora tarda (E=10–52) for both type proteins of other fungi, such as Cochliobolus sp. (E = MAT-1 and MAT-2. Overall, the P. teres ORF1 ortholog is 4×10–78 ÷4×10–60), Pleospora sp., Stemphylium sp. (E = strongly conserved between MAT-1 and MAT-2, except for 5×10–77 ÷2×10–72), Alternaria sp. (E=7×10–57 ÷2× the last 17 (MAT-1) and 15 (MAT-2) amino-acidic positions. 10–21), Leptosphaeria maculans (E = 3×10–52), Phaeo- The similarity of the 2 ORF1 sequences degenerates and sphaeria nodorum (E=3×10–35), and Leptosphaeria kor- marks the 5′ border of the idiomorph region (Bennet et al.

Fig. 5. P. teres MAT-1 and MAT-2 were aligned with ClustalX and analyzed with DnaSP ver. 4.00 to view a 10-bp sliding window (step of 1 nucleotide, excluding gap) of the MAT locus.

Fig. 6. Alignment of MAT-1 and MAT-2 open reading frame (ORF)1 peptide sequences of Phaeosphaeria nodorum, P. t e re s , and Cochliobolus heterostrophus. White arrow, beginning of the P. nodorum idiomorph. Black arrow, beginning of the P. teres idiomorph. *, amino acids that are conserved among all 3 species; : and., full conservation of strong and weak groups of amino acids, respectively, as defined by ClustalX. Amino acid positions are indicated below each alignment. Species names (on the left) and accession codes (on the right) are also given.

2003) (Fig. 6). We did not find any significant ORFs in the sphaeriaceae) on one side, and from a group that 353 bp of sequence 3′ of the idiomorph. includes L. maculans (Leptosphaeriaceae), A. alternata, Cochliobolus sp., Pleospora sp., and Stemphylium sp. (all Phylogenetic analysis Pleosporaceae) on the other. Similar results were obtained The phylogenetic analysis of the alpha-box region indi- for the HMG-box region (Fig. 3B), except R. secalis (mito- cated that the group of Pleosporales is well separated from sporic ascomycete) and Pyrenopeziza brassicae (Derma- the other fungi, and that P. teres fits into this group taceae), which are quite similar to each other and which both (bootstrap value of 99%). (Fig. 3A). Within the Pleosporales belong to Helotiales, clustered with the Pleosporales (boot- considered, P. teres is well separated from P. nodorum (Phaeo- strap value of 66%; Fig. 3B) rather than with M. gram-

Fig. 7. Ethidium-bromide-stained agarose gels (1.2%, 100 W for 3 h) showing PCR products from P. teres f.sp teres (a) and P. t e re s f. sp. maculata (b) total genomic DNA amplified with mating-type-specific primers. Fungal isolates with MAT-1 produce, as expected, an amplicon of ~1300 bp in size, whereas those with MAT-2 produce, as expected, an amplicon of ~1150 bp. The fungal strains shown were from BAC-NF and TER-NF (a) populations and SIR-SF (b) populations.

inicola and S. passerinii (Mycosphaerellaceae) (bootstrap with larger sample sizes (–≥10), the proportion of the 2 value of 66%; Fig. 3A). mating types did not deviate significantly from the 1:1 null hypothesis (Table 2). Here, the sample sizes were large Mating-type frequency survey enough to detect, with α = 0.05 mating-type bias, from ≥2.4:1 (BAC-NF) to 3.9:1 (PIR-NF), with a power of 1 – β = AFLP analysis 0.80. When all 147 P. teres isolates were combined, the pro- Considering all 4 primer combinations, 113 polymorphic portion of the 2 mating types was again in accord with the markers were considered within the SF and 103 within the 1:1 null hypothesis (χ2 = 1.53, P = 0.22; exact binomial test, NF of the pathogen. All the isolates had distinct AFLP geno- PB = 0.25) (Table 3), as was that within each barley landrace types in all cases, except the PIR-SF population, where field (Table 3). Again, there were no differences in the dis- PIR 24s(2) (MAT-2) was indistinguishable from PIR 18s tributions of the 2 mating-type idiomorphs among the NF (MAT-2). and SF isolates at the regional level, among the 6 fields sampled, among the 2 NF populations, among the 3 SF popula- Mating-type frequency surveys tions, and among the 5 populations (2 NF and 3 SF) A total of 150 Sardinian P. teres isolates were assayed, us- (Table 4). Of note, both mating types were always also ing PCR amplification with mating-type-specific primers, found within the remaining NF and SF populations with and 147 (66 NF and 81 SF) gave unambiguous results; small sample sizes (Table 2), indicating their presence different primer-pairs never gave 2 different amplification throughout the island of Sardinia. products on the same isolate (Fig. 7). As expected, no amplification products were obtained with R. secalis and B. soro- Discussion kiniana. However, an amplicon (the same length as that for P. teres) was obtained with the MAT-2 primer pairs and the Isolation of MAT idiomorphs I2 isolates of P. graminea (not shown). Two NF isolates (BAC 2n and BAC 14n) and 1 SF isolate (PIR 20s) yielded We isolated and characterized both MAT-1 and MAT-2 no amplification products. These 3 isolates were excluded idiomorphs of P. teres. The molecular organization of the from subsequent analyses. MAT-1 of P. teres is similar to that of other Dothideo- The mating-type alleles of the 2 formae speciales of the mycetidae (Loculoascomycetes) belonging to Pleosporales, fungus were the same size on both agarose (Fig.7) and poly- such as C. heterostrophus (Wirsel et al. 1998), A. alternata acrylamide (not shown) gels. The sequencing of 2 MAT-1 (Arie et al. 2000), L. maculans (Cozijnsen and Howlett and MAT-2 genes (1 NF and 1 SF per mating type) con- 2003), and P. nodorum (Bennet et al. 2003), where only an firmed that the stretches of the same mating effectively cor- alpha-containing protein is encoded as well. This organiza- respond to MAT genes, that they have the same lengths tion is different from Sordariomycetidae (Pyrenomycetes) (MAT-1 = 1158 bp; MAT-2 = 1068 bp), and that they have a (Turgeon and Yoder 2000) and Leotideomycetidae (Disco- high degree of similarity (>99.6%). Tables 2–4 summarize mycetes) (Singh and Ashby 1998), which have 3 MAT-read- the observed distribution of mating-type idiomorphs across ing frames, only 1 of which is homologous to the alpha- Sardinia. At the regional (metapopulation) level (Table 2), domain protein of P. teres. Moreover, the size of the MAT-1 the proportion of the 2 mating types was in accord, with the idiomorph of P. teres (~1900 bp) is similar to that of 1:1 null hypothesis in both the NF (χ2 = 2.18, P = 0.14; ex- A. alternata (1942 bp), significantly bigger than that of χ2 act binomial test, PB = 0.18) and the SF ( = 0.17, P = C. heterostrophus (1297 bp), and less than half that of 0.69; exact binomial test, PB = 0.82). At this level, the sam- P. nodorum (4282 bp). ple sizes were large enough to detect, with α = 0.05 mating- In all the ascomycetes studied so far, all MAT-2 genes type bias, ≥1.9:1 (with a power of 1 – β = 0.80). These re- contain only a single gene encoding a protein with the HMG sults were also confirmed at the population level (Table 2). box as the DNA-binding motif (Turgeon 1998). This is also Indeed, within each of the 2 NF and the 3 SF populations the case with MAT-2 of P. teres, where its size (2028 bp) is

Table 2. Chi-square (χ2) values for the distribution of mating-type idiomorphs within each net form (NF) and spot form (SF) population. Deviation from the 1:1 ratio was calculated as χ2 =(a – b)×(a – b)/(a + b), where a and b are the number of MAT-1 and MAT-2 genes, respectively. The last column shows the minimum detectable bias of mating-type ratios with α = 0.05 (significance level), 1 – β (power) = 0.80. Minimum detectable χ2 P Population NMAT-1:MAT-2 (a:b) χ2 PB bias of mating type SEC-NF 2 1:1 0 na 1 — SEC-SF 29 15:14 0.03 0.85 1 2.6:1 PIR-NF 16 7:9 0.25 0.62 0.8 3.9:1 PIR-SF 7a,b 1:6 3.57 na 0.13 — TER-NF 6 2:4 0.67 na 0.69 — TER-SF 20 10:10 0 1 1 3.3:1 SIR-NF 3 2:1 0.33 na 1 — SIR-SF 18 11:7 0.89 0.35 0.48 3.6:1 BAC-NF 34c 13:21 1.88 0.17 0.23 2.4:1 SES-NF 5 2:3 0.2 na 1 — SES-SF 7 2:5 1.29 na 0.45 — All NF isolates 66 27:39 2.18 0.14 0.18 1.9:1 All SF isolates 81 39:42 0.17 0.69 0.82 1.8:1 χ2 χ2 Note: Pχ2, probability value for with 1 degree of freedom (df); na, test not (a:b) applicable owing to small sample size (–<10) (Lewontin and Felsestein 1965); PB, likelihood of obtaining the observed result or a more discrepant result, given that the true ratio is 1:1; N, the number of isolates with detectable mating-type idiomorphs. aOne isolate of the 8 originally sampled gave no scorable amplification product for MAT idiomorph. bTwo MAT-2 isolates of the 7 SF isolates of the PIR population have the same multilocus genotype, that is, 2 isolates are putative clones. After clone-correction, the 1:1 ratio is 1:5. cTwo isolates of the 36 originally sampled gave no scorable amplification product for MAT idiomorph.

Table 3. Chi-square (χ2) values for the distribution of mating-type idiomorphs within all collection fields without splitting the 2 forms. Deviation from the 1:1 ratio (χ2) was calculated as described in Table 2. χ2 Field NMAT-1:MAT-2 Pχ2 PB SEC 31 16:15 0.03 0.86 1 PIR 23a 8:15 2.13 0.14 0.21 TER 26 12:14 0.15 0.7 0.85 SIR 21 13:8 1.19 0.28 0.38 BAC 34b 13:21 1.88 0.17 0.23 SES 12 4:8 1.33 0.25 0.39 All isolates (NF + SF) 147 66:81 1.53 0.22 0.25 χ2 Note: Pχ2, probability value for with 1 degree of freedom (df); PB, likelihood of obtaining the observed result or a more discrepant result, given that the true ratio is 1:1; N, the number of isolates with detectable mating-type idiomorphs. aOne isolate of the 24 originally sampled gave no scorable amplification product for MAT idiomorph. bTwo isolates of the 36 originally sampled gave no scorable amplification product for MAT idiomorph.

χ2 Table 4. Chi-square ( ) values for the distri- between that of C. heterostrophus (1171 bp) and P. nodorum bution of mating-type idiomorphs among pop- (4505 bp), and closer to that of A. alternata (2256 bp). ulations and collection fields. The MAT-1 (1137 bp) and MAT-2 (999 bp) ORFs and their χ2 respective putative encoded proteins (of 379 and 333 amino Region df Pχ2 acids, respectively) were also similar to those of all the All NF isolates ver- 1.05 1 0.3 abovementioned fungi for both MAT-1 (genes: 1035 ÷ sus all SF isolates 1323 bp; proteins: 344 ÷ 441 amino acids) and MAT-2 Fields — — — (genes: 1026 ÷ 1191 bp; proteins 342 ÷ 397 amino acids). All 6 fields 5.25 5 0.39 The P. teres mating type is similar to that examined in Populations — — — other Pleosporales, but some differences in MAT locus orga- NF 0.14 1 0.71 nization have also been found. SF 0.55 2 0.76 Unlike P. nodorum, where there is a gradual transition NF and SF 2.85 4 0.58 from idiomorph to common flanking region at the 3′ end, as χ2 Note: Pχ2, probability value for with 1 degree also reported for Cryphonectria parasitica (McGuire et al. of freedom (df). 2001) and Neurospora crassa (Randall and Metzemnberg 1998), the transition is as abrupt for P. teres, as it is, for

© 2005 NRC Canada 866 Genome Vol. 48, 2005 example, for C. heterostrophus (Dothideonycetidae, Pleo- a high AFLP genotypic diversity (78% of unique genotypes) sporales) and M. graminicola (Dothideonycetidae, Myco- (Rau et al. 2003). In this study, we found only 2 isolates sphaerellales). with the same AFLP genotype; they also have the same mat- The P. teres idiomorph extended further into the 5′ flanking type, suggesting that they are likely true clones. We ing region, into the neighboring upstream ORF1 gene. In- found a higher genotypic diversity than Rau et al. (2003) be- deed, the P. teres ORF1 ortholog is not conserved for the last cause the resolution power of this study was higher. 15 (MAT-1)or17(MAT-2) amino acids at the 3′ end. Com- paring P. teres and other Pleosporales, this is more similar to Mating-type frequency surveys the case of P. nodorum (Bennet et al. 2003) and L. maculans For sexual reproduction to be possible in P. teres, both (Cozijnsen and Howlett 2003), where the degeneration of the mating types must co-occur. Their relative frequencies and 3′ part of ORF1 is more extended, and includes 2 regions distribution among populations is thus an indicator of the within the last 84–84 (MAT-1) and 85–80 (MAT-2) amino ac- likely prevalence of sexual reproduction within and among ids of the C termini, respectively. In A. alternata, the populations. In Sardinia, both mating types were found in all idiomorph extended toward ORF1, but they do not overlap field populations of both P. teres f. sp. teres and P. teres f. (they are separated by 4 bp), and in C. heterostrophus, the sp. maculata. Moreover, for both NF and SF at the regional idiomorph and the ORF1 are separated by 1079 bp. The level, no general trend of mating-type ratios away from the ORF1s of both these mating types have a similarity of 100% 1:1 null hypothesis was apparent. These results parallel (see Fig. 6 in Bennet et al. 2003). those of other ascomycete pathogens: of barley, such as In contrast to the situation observed in C. heterostrophus, C. sativus (Zhong and Steffenson 2001), R. secalis (Linde et where the 5′ flanking region of the ORF1 is highly similar in al. 2003), and S. passerinii (Goodwin et al. 2003); of wheat, sequence between mating types, in L. maculans, ORF1 is such as C. parasitica (Liu et al. 1996; Marra and Milgroom part of the idiomorph (see Fig. 3 in Cozijnsen and Howlett 2001), M. graminicola (Zhan et al. 2002), and Tapesia yal- 2003). As consequence, both sides of ORF1 (5′ and 3′) are lundae and T. acuformis (Douhan et al. 2002a, 2002b); and divergent in opposite mating types. We only sequenced of maize, such as C. carbonum (Weltz and Leonard 1993). stretches of the P. teres ORF1; therefore, the degree of These are all cases where the impact of sexual reproduction homology between the 2 mating types of the region up- has been either hypothesized or well documented. stream of the ORF1 (i.e., if the idiomorph extended beyond the 5′ end of the ORF1) remains unknown. The role of evolutionary forces on mating-type As pointed out by Cozijnsen and Howlett (2003), the distributions phylogenetic significance of such differences in genomic or- Because of the cropping cycles, fungal plant-pathogen ganization is not clear. Indeed, as noted by these authors, the populations in an agricultural field are often founded by a picture can vary even within 1 genus, as is evident from a small fraction of the total population. Moreover, many of the comparison of 3 Cochliobolus species: C. kusanoi, C. lut- previously mentioned fungi, including P. teres, are capable trelli, and C. homomorphus (Yun et al. 1999). Moreover, of both sexual and asexual reproduction. The relative contri- other Dothideomycetidae, such as M. graminicola, contain butions of these 2 reproduction modes can vary, depending DNase upstream (5′)ofMAT (Waalwijk et al. 2002) instead on the environment. In some cases, there are local popula- of ORF1. Again, in C. heterostrophus, it has been shown tions or geographic areas that exhibit significant inequalities that the deletion of ORF1 is not relevant for fertility (Wirsel in mating types, such as for the field populations of T. yal- et al. 1998), the same as for the YLR456 ORF1 homolog in lundae (12:34) and T. acuformis (12:24) sampled in Wash- S. cerevisiae (http://sequence-www.stanford.edu/group/yeast_ ington state in the US or, on a larger scale, for the counties deletion_project). of Grant (7:17) and Lincoln (10:21) (Douhan et al. 2002a). Phylogenetic analysis revealed that P. teres fits into the The same applies to field populations of R. secalis sampled Pleosporales group, as expected with the current systematic in Australia (17:4), Switzerland (25:6), Finland (33:18), and classification (Index Fungorum; http://www.indexfungorum. California (6:18) (Linde et al. 2003). So why should the org). Moreover, the P. teres that is attributed to the Pleo- mating-type ratio be “buffered” against any strong variation sporaceae family, despite being well separated, tends to be in from the 1:1 ratio within our P. teres samples at the regional a position between P. nodorum (Phaeosphaeriaceae) and and field levels? L. maculans (Leptosphaeriaceae). The clear-cut separation The mating-type frequencies determine the probability that between P. teres and the Cochliobolus subsp. observed in 2 random isolates will be compatible. If sexual reproduction this study is consistent with the observation based on internal is operating, the approximate 1:1 ratio between mating types transcribed spacers and glyceraldehyde-3-phosphate dehydro- can be maintained by negative-frequency-dependent selection, genase DNA sequences (Zhang and Berbee 2001). Some in- a kind of balancing selection (Richman 2000). Under such consistencies between the alpha-box- and the HMG-box- conditions, a rare allele confers an advantage in encounter- based trees have also been observed, such as the position of ing compatible matings within a population, so that its fre- P. brassicae and R. secalis. This could be the result of the quency tends to increase in succeeding generations, and vice different evolutionary histories of MAT-1 and MAT-2 (but see versa (May et al. 1999; Richman 2000). Moreover, it seems Goodwin et al. 2003). unlikely that both mating types would persist at near-equal frequencies within field populations unless the genes were Mating-type frequency survey functional, i.e., sexual reproduction occurs (Goodwin et al. 2003). AFLP analysis Gene flow that spreads the 2 mating types over the re- Previous analysis of these P. teres fungal populations showed gional territory could also explain the observed even distri-

© 2005 NRC Canada Rau et al. 867 bution (Antolin et al. 2003). However, the NF populations tems for ‘in situ’ conservation of genetic resources of appeared to show more structure than the SF populations cultivated species”. (Rau et al. 2003). This difference in divergence was attributed to greater genetic drift (or founder effect), with more restricted migration in the NF than in the SF of P. teres (Rau References et al. 2003). Thus, under the hypothesis of absence of sexual reproduction, greater inequalities of mating types are expected Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., within and among NF populations than SF populations. Miller, W., and Lipman D.J. 1997. Gapped BLAST and PSI- However, no differences were observed between the NF and BLAST: a new generation of protein database search programs. SF in the mating-type ratios. Nucleic Acids Res. 25: 3389–3402. Finally, there was no evidence of strong selection (other Antolin, M.F., Ode, P.J., Heimpel, G.E., O'Hara, R.B., and Strand, than that essentially due to strict disassortative mating) for M.R. 2003. Population structure, mating system, and sex- determining allele diversity of the parasitoid wasp Habrobracon one or the other of the mating types of P. teres, at least under hebetor. Heredity, 91: 373–381. Sardinian field conditions. Indeed, if the mating-type idio- Arie, T., Christiansen, S.K., Yoder, O.C., and Turgeon, B.G. 1997. morphs (or closely linked loci) differed in viability or clonal Efficient cloning of ascomycete mating type genes by PCR am- fecundity, the mating-type ratio might deviate significantly plification of the conserved MAT HMG box. Fungal Genet. Biol. from the 1:1 null hypothesis (Brasier and Webber 1987), 21: 118–130. even though the population may be entirely sexual, as, for Arie, T., Kaneko, I., Yoshida, T., Noguchi, M., Nomura, Y., and example, in Microbotrym violaceum (Kaltz and Shykoff Yamaguchi, I. 2000. Mating-type genes from asexual phyto- 1999). The same can be applied to the wheat pathogen P. n o - pathogenic ascomycetes Fusarium oxysporum and Alternaria dorum, where 1 mating type unexpectedly predominated alternata. Mol. Plant–Microbe Interact. 13: 1330–1339. (92%; Halama 2002), despite a significant effect of sexual re- Attene, G., Ceccarelli, S., and Papa, R. 1996. The barley (Hordeum production on its genetic structure (Caten and Newton 2000). vulgare L.) of Sardinia, Italy. Genet. Resour. Crop Ev. 43: 385– The NF and SF can hybridize in the laboratory (Campbell 393. et al. 1999), although it is not clear if hybridization occurs in Bennet, R.S., Yun, S.H., Lee, T.Y., Turgeon, B.J., Arseniuk, E., the field, where there is evidence both in favor of (Campbell Cunfer B.M., et al. 2003. Identity and conservation of mating et al. 2002) and against (Williams et al. 2001; Rau et al. type genes in geographically diverse isolates of Phaeosphaeria 2003) such an event. In our system, isolates of both the NF nodorum. Fungal Genet. Biol. 40: 25–37. and SF with opposite mating types coexist within each field. Brasier, C.M., and Webber, J.F. 1987. Positive correlation between Thus, the opportunity for hybridization between the 2 in vitro growth rate and pathogenesis in Ophiostoma ulmi. Plant formae is potentially widespread. However, no intermediate Pathol. 36: 462–466. isolates were detected in the AFLP survey in Sardinia (Rau Brutchez, J.J.P., Eberle, J., and Russo, V.E.A. 1993. Regulatory se- et al. 2003), suggesting that hybridization does not occur, or quences in the transcription of Neurospora crassa genes: CAAT it is rare, between the 2 formae under field conditions. box, TATA box, introns, poly(A) tail formation sequences. Fun- gal Genet. Newsl. 40: 89–96. To conclude, previous analysis of the P. teres fungal popu- Campbell, G.F., Crows, P.W., and Lucas, J.A. 1999. Pyrenophora lations here analyzed for mating-type frequency were charac- teres f. maculata, the cause of Pyrenophora leaf spot of barley terized by high AFLP diversity and low or no disequilibrium in South Africa. Mycol. Res. 103: 257–267. (Rau et al. 2003). Here, we also observed that when 2 addi- Campbell, G.F., Lucas, J.A., and Crous, P.W. 2002. Evidence of re- tional AFLP primer combinations are used, only 2 individu- combination between net- and spot-type populations of Pyreno- als share the same multilocus genotype. The most likely phora teres as determined by RAPD analysis. Mycol. Res. 106: explanation for low linkage disequilibrium is sexual repro- 602–608. duction, whereas high pathogen diversity could be explained Caten, C.E., and Newton, A.C. 2000. Variation in cultural character- by selection in a highly variable landrace of a strictly selfing istics, pathogenicity, vegetative compatibility and electrophoretic host or with sexual reproduction. The main advance in this karyotype within field populations of Stagonospora nodorum. study is that both mating-type idiomorphs are present and Plant Pathol. 49: 219–226. coexist at similar frequencies in each field; sexual reproduc- Cornish-Bowden, A. 1985. Nomenclature for incompletely speci- tion in P. teres is therefore likely important in generating the fied bases in nucleic acid sequences: recommendations 1984. observed pathogen diversity. Nucleic Acids Res. 13: 3021–3030. Cozijnsen, A.J., and Howlett, B.J. 2003. Characterization of the mating-type locus of the plant pathogenic ascomycete Lepto- sphaeria maculans. Curr. Genet. 43: 351–357. Acknowledgements Dayakar, B.V., Narayanan, N.N., and Gnanamanickam, S.S. 2000. Cross-compatibility and distribution of mating type alleles of We thank Delphine Sicard for frequent discussions and the rice fungus Magnaporthe grisea in India. Plant Dis. 84: suggestions, and Bo Wang and Curt L. Brubaker for their 700–704. suggestions toward improving the manuscript. This work Douhan, G.W., Peever, T.L., and Murray, T.D. 2002a. Species and was supported by the Consiglio Nazionale delle Ricerche mating type distribution of Tapesia yallundae and T. acuformis (CNR), Progetto Giovani – Agenzia 2000, CNRG00FD33, and occurrence of apothecia in the U.S. Pacific Northwest. “Level and structure of the genetic variation in Pyrenophora Phytopathology, 92: 703–709. teres: implication in coevolution with Hordeum vulgare L.”, Douhan, G.W., Peever, T.L., and Murray, T.D. 2002b. Multilocus and by the Italian Government, Project MURST-Cofin99, population structure of Tapesia yallundae in Washington state. # 9907384522, “Evaluation of ‘species-environment’ sys- Mol. Ecol. 11: 2229–2239.

Goodwin, S.B., and Zismann, V.L. 2001. Phylogenetic analyses of Randall, T.A., and Metzenberg, R.L. 1998. The mating type locus the ITS region of the ribosomal DNA reveal that Septoria pas- of Neurospora crassa: identification of an adjacent gene and serinii from barley is closely related to the wheat pathogen characterization of transcript surrounding the idiomorph. Mol. Mycosphaerella graminicola. Mycologia, 93: 934–946. Gen. Genet. 259: 615–621. Goodwin, S.B., Waalwijk, C., Kema, G.H., Cavaletto, J.R., and Rau, D., Brown, A.H.D., Brubaker, C.L., Attene, G., Balmas, V., Zhang, G. 2003. Cloning and analysis of the mating-type idio- Saba, E., et al. 2003. Population genetic structure of Pyreno- morphs from the barley pathogen Septoria passerinii. Mol. Gen. phora teres Drechs. the causal agent of net blotch in Sardinian Genomics, 269: 1–12. landraces of barley (Hordeum vulgare L.). Theor. Appl. Genet. Halama, P. 2002. Mating relationships between isolates of Phaeo- 106: 947–959. sphaeria nodorum, (anamorph Stagonospora nodorum) from Richman, A. 2000. Evolution of balanced genetic polymorphism. geographical locations. Eur. J. Plant Pathol. 108: 593–596. Mol. Ecol. 9: 1953–1963. Hammi, A., Msatef, Y., Bennati, A., Ismaili, A.E.L., and Serrhini, Rozas, J., Sánchez-DelBarrio, J.C., Messeguer, X., and Rozas, R. M.N. 2002. Mating type, metalaxyl resistance and aggressive- 2004. DnaSP ver 4.00, DNA sequence polymorphism. Bio- ness of Phytopthora infestans (Mont.) de Bary in Morocco. J. informatics, 19: 2496–2497. Phytopathol. 150: 289–291. Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular clon- Jordan, J.W.L., Best, G.R., and Allen, E.C. 1985. Effect of Pyreno- ing: a laboratory manual. 2nd ed. Cols Spring Harbor Labora- phora teres on dry matter production and yield component on tory Press, Cold Springs Harbor, N.Y. winter barley. Plant Pathol. 34: 200–206. SAS Institute Inc. 1995. JMP software. Version 3.1.5 [computer Kaltz, O., and Shykoff, J.A. 1999. Selfing versus outcrossing pro- program]. SAS Institute Inc. Cary, N.C. pensity of the fungal pathogen Microbotryum violaceum across Singh, G., and Ashby, A.M. 1998. Cloning of the mating type loci Silene latifolia host plants. J. Evol. Biol. 12: 340–349. from Pyrenopeziza brassicae reveals the presence of a novel Kronstad, J.W., and Staben, C. 1997. Mating type in filamentous mating type gene within a discomycete: MAT 1–2 locus encod- fungi. Annu. Rev. Genet. 31: 245–276. ing a putative metallothionen-like protein. Mol. Microbiol. 30: Lewontin, R.C., and Felsenstein, J. 1965. The robustness of homo- 799–806. geneity tests in 2×N table. Biometrics, 21:19–33. Smedegård-Petersen, V. 1971. Pyrenophora teres f.sp. maculata f. Linde, C.C., Zala, M., Ceccarelli, and McDonald, B.A. 2003. Fur- nov., and Pyrenophora teres f. teres on barley in Denmark. In ther evidence for sexual reproduction in Rhynchosporium secalis Yearbook of the Royal Veterinary and Agricultural University. based on distribution and frequency of mating-type alleles. Fun- DSR Verlag, Copenhagen, Denmark. pp. 124–144. gal Genet. Biol. 40: 115–125. Smedegård-Petersen, V. 1976. Pathogenesis and genetics of net-spot Liu, Y.C., Double, M.L., MacDonald, W.L., Cortesi, P., and blotch and leaf stripe of barley caused by Pyrenophora teres and Migroom, M.G. 1996. Diversity and multilocus genetic structure Pyrenophora graminea. In Yearbook of the Royal Veterinary and in populations of Criphonectria parasitica. Phytopathology, 86: Agricultural University. DSR Verlag, Copenhagen, Denmark. 1344–1351. pp. 1–76. Liu, Y.G. Whittier, R.F. 1995. Thermal asymmetric PCR: auto- Smedegård-Petersen, V. 1978. Genetics of heterothallism in Pyreno- matable amplification and sequencing of insert end fragments phora graminea and P. teres. Trans. Br. Mycol. Soc. 70: 99–102. from P1 and YAC clones for chromosome walking. Genomics, Sokal, R.R., and Rohlf, F.J. 1995. Biometry: the principles and 25: 674–681. practice of statistics in biological research. Freeman, New York. Marra, R.E., and Milgroom, M.G. 1999. PCR amplification of the Steenkamp, E.T., Wingfield, B.D., Coutinho, T.A., Zeller, K.A., mating-type idiomorphs in Cryphonectria parasitica. Mol. Ecol. Wingfield, M.J., Marasas, W.F.O., et al. 2000. PCR-based iden- 8: 1947–1950. tification of MAT-1 and MAT-2 in the Gibberella fujikuroi spe- Marra, R.E., and Milgroom, M.G. 2001. The mating system of the cies complex. Appl. Environ. Microbiol. 66: 4378–4382. fungus Cryphonectria parasitica: selfing and self-incompatibility. Steffenson, B.J., Webster R.K., and Jackson, L.F. 1991. Reduction Heredity, 86: 134–143. in yield loss using incomplete resistance to P. t e re s f. sp. teres in May, G., Shaw, F., Badrane, H., and Vekemans, X. 1999. The sig- barley. Plant Dis. 75: 96–100. nature of balancing selection: fungal mating compatibility gene Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Hig- evolution. Proc. Natl. Acad. Sci. U.S.A. 96: 9172–9177. gins, D.G. 1997. The CLUSTAL_X Windows interface: flexible McDonald, B.A., and Linde, C. 2002. Pathogen population genet- strategies for multiple sequence alignment aided by quality anal- ics, evolutionary potential and durable resistance. Annu. Rev. ysis tools. Nucleic Acids Res. 25: 4876–4882. Phytopathol. 40: 349–379. Turgeon, B.G. 1998. Application of mating-type gene technology to McGuire, I.C., Marra, R.E., Turgeon, B.G., and Milgroom, M.G. problems in fungal biology. Annu. Rev. Phytopathol. 36: 115–137. 2001. Analysis of mating-type genes in the chestnut blight fun- Turgeon, B.G., and Yoder, O.C. 2000. Proposed nomenclature for gus, Cryphonectria parasitica. Fungal Genet. Biol. 34: 131–144. mating type genes of filamentous Ascomycetes. Fungal Genet. Metzenberg, R.L., and Glass, N.L. 1990. Mating type and mating Biol. 31: 1–5. strategies in Neurospora. BioEssays, 12: 53–59. Turgeon, B.G., Sharon, A., Wirsel, S., Yamaguchi, K., Papa, R., Attene, G., Barcaccia, G., Ohgata, A., and Konishi, T. Christiansen, S.K., and Yoder, O.C. 1995. Structure and function 1998. Genetic diversity in landrace populations of Hordeum of mating type genes in Cochliobolus spp. and asexual fungi. vulgare L. from Sardinia, Italy, as revealed by RAPDs, isozymes Can. J. Bot. 73(Suppl. 1): 778–783. and morphophenological traits. Plant Breed. 117: 523–530. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van De Lee, T., Peever, T.L., and Milgroom, M.G. 1994. Genetic structure of Hornes, M., et al. 1995. AFLP: a new technique for DNA fin- Pyrenophora teres populations determined with random ampli- gerprinting. Nucleic Acids Res. 23: 4407–4414. fied polymorphic DNA markers. Can. J. Bot. 72: 915–923. Waalwijk, C., Mendes, O., Verstappen, E.C.P., Waard, M.A. de, Perrière, G., and Gouy, M. 1996. WWW-Query: an on-line re- and Kema, G.H.J. 2002. Isolation and characterization of the trieval system for biological sequence banks. Biochimie, 78: mating-type idiomorphs from septoria leaf blotch fungus 364–369. Mycosphaerella graminicola. Fungal Genet. Biol. 35: 277–286.

Weiland, J.J., Steffenson, B.J., Cartwright, R.D., and Webster, R.K. Evolution of self-fertile reproductive life style from self-sterile 1999. Identification of molecular genetic markers in Pyreno- ancestors. Proc. Natl. Acad. U.S.A. 96: 5592–5597. phora teres f. teres associated with low virulence on ‘Harbin’ Yun, S.H., Arie, T., Kaneko, I., Yoder, O.C., and Turgeon, B.G. barley. Phytopathology, 89: 176–181. 2000. Molecular organization of mating type loci in heterothallic, Weltz, H.G., and Leonard, K.J. 1993. Phenotypic variation and par- homothallic, and asexual Gibberella/Fusarium species. Fungal asitic fitness of races of Cochliobolus carbonum on corn in Genet. Biol. 31: 7–20. North Carolina. Phytopathology, 83: 593–601. Zhan, J., Keema, G.H.J., Waalwijk, C., and McDonald, B.A. 2002. Williams, K.J., Smyl, C., Lichon, A., Wong, K.J., and Wallwork, Distribution of mating type alleles in the wheat pathogen H. 2001. Development and use of an assay based on the poly- Mycosphaerella graminicola over spatial scales from lesions to merase chain reaction that differentiates the pathogens causing continents. Fungal Genet. Biol. 36: 128–136. spot form and the net form of net blotch of barley. Australas. Zhang, G., and Berbee, M.L. 2001. Pyrenophora phylogenetics in- Plant Pathol. 30: 37–44. ferred from ITS and glyceraldehyde-3-phosphate dehydrogenase Wirsel, S., Horwitz, B., Yamaguchi, K., Yoder, O.C., and Turgeon, gene sequence. Mycologia, 93: 1048–1063. B.G. 1998. Single mating type-specific genes and their 3′ UTRs Zhong, S., and Steffenson, B.J. 2001. Genetic and molecular char- control mating and fertility in Cochliobolus heterostrophus. acterization of mating type genes in Cochliobolus sativus. Mol. Gen. Genet. 259: 272–281. Mycologia, 93: 852–863. Yun, S.H., Berbee, M.L., Yoder, O.C., and Turgeon, B.G. 1999.