Cloning and Analysis of the Mating-Type Idiomorphs from the Barley Pathogen Septoria Passerinii

Mol Gen Genomics (2003) 269: 1–12 DOI 10.1007/s00438-002-0795-x

ORIGINAL PAPER

S. B. Goodwin Æ C. Waalwijk Æ G. H. J. Kema J. R. Cavaletto Æ G. Zhang Cloning and analysis of the mating-type idiomorphs from the barley pathogen Septoria passerinii

Received: 15 April 2002 / Accepted: 5 December 2002 / Published online: 11 March 2003 Springer-Verlag 2003

Abstract The genus Septoria contains more than 1000 amplified polymorphic DNA markers revealed that each species of plant pathogenic fungi, most of which have no isolate had a unique genotype. The common occurrence known sexual stage. Species of Septoria without a known of both mating types on the same leaf and the high levels sexual stage could be recent derivatives of sexual species of genotypic diversity indicate that S. passerinii is almost that have lost the ability to mate. To test this hypothesis, certainly not an asexual derivative of a sexual fungus. the mating-type region of S. passerinii, a species with no Instead, sexual reproduction probably plays an integral known sexual stage, was cloned, sequenced, and com- role in the life cycle of S. passerinii and may be much pared to that of its close relative S. tritici (sexual stage: more important than previously believed in this (and Mycosphaerella graminicola). Both of the S. passerinii possibly other) ‘‘asexual’’ species of Septoria. mating-type idiomorphs were approximately 3 kb in size and contained a single reading frame interrupted by one Keywords Cochliobolus Æ Evolution Æ (MAT-2)ortwo(MAT-1) putative introns. The putative Loculoascomycetes Æ Multiplex PCR Æ Mycosphaerella products of MAT-1 and MAT-2 are characterized by graminicola alpha-box and high-mobility-group sequences, respectively, similar to those in the mating-type genes of M. graminicola and other fungi. The mating-type genes of Introduction S. passerinii and M. graminicola are evolving rapidly, approximately ten times faster than the internal tran- Many species of fungi have different binomial names for scribed spacer region of the ribosomal DNA, and are not their sexual and asexual life stages. Septoria is a genus closely related to those from Cochliobolus or other lo- that includes the asexual stages of more than 1000 species culoascomycetes in the order Pleosporales. Therefore, the of plant pathogenic fungi. Many economically important class Loculoascomycetes may be polyphyletic. Further- diseases are caused by species of Septoria, including cel- more, differences between the phylogenetic trees may ery leaf spot (caused by S. apiicola), azalea leaf scorch indicate separate evolutionary histories for the MAT-1 (S. azaleae), hard rot and leaf spot of gladiolus (S. glad- and MAT-2 idiomorphs. A three-primer multiplex-PCR ioli), and tomato leaf spot (S. lycopersici). Most species technique was developed that allowed rapid identifica- have a limited host range, but the genus as a whole infects tion of the mating types of isolates of S. passerinii.Both plants ranging from primitive (e.g., ferns and lycopods) mating types were present in approximately equal fre- to advanced (e.g., composites, grasses, and orchids) quencies and often on the same leaf in fields in Minnesota types, and with both herbaceous and arboreal growth and North Dakota. Analyses with isozyme and random forms. Most species have no known sexual stage. How- ever, for those species in which one has been identified, Communicated by E. Cerda´-Olmedo the sexual stage is placed in the genus Mycosphaerella (Hawksworth et al. 1995), another large and economi- S. B. Goodwin (&) Æ J. R. Cavaletto Æ G. Zhang cally important group of plant pathogenic fungi. To- USDA-ARS, Department of Botany and Plant Pathology, gether, the genera Septoria and Mycosphaerella contain Purdue University, 915 West State Street, more than 1500 species that infect most, if not all, of the West Lafayette, IN 47907-2054, USA E-mail: [email protected] major plant families. Fax: +1-765-494-0363 One species with no known sexual stage is Septoria C. Waalwijk Æ G. H. J. Kema passerinii, the cause of speckled leaf blotch of barley Plant Research International B.V., (Hordeum vulgare and closely related species). This P.O. Box 16, 6700 AA Wageningen, The Netherlands pathogen was first described more than 120 years ago, 2 but has never been associated with a sexual stage type sequences of M. graminicola could be used to clone (Cunfer and Ueng 1999). One possible explanation for the homologous region(s) from closely related species this could be that the sexual stage was lost during the such as S. passerinii. evolutionary process and no longer exists. If this is The purpose of this research was to use both direct correct, then the proliferation of the pathogen now oc- and indirect approaches to test the hypothesis that curs solely by asexual reproduction. Another possibility S. passerinii is a recently derived, asexual relative of is that the sexual structures may be small, ephemeral, or M. graminicola. A secondary goal was to estimate the produced only under specific conditions and, because of rates of change in the mating-type genes compared to this, have simply been overlooked. According to this the internal transcribed spacer (ITS) region of the rib- scenario the pathogen should undergo cycles of sexual osomal DNA, in order to test the hypothesis that the reproduction that have remained unobserved. mating-type genes in the Mycosphaerellaceae evolve Recent phylogenetic analyses of S. passerinii revealed rapidly, as they do in the genus Cochliobolus (Turgeon a close evolutionary relationship with the septoria tritici 1998). The final goal was to design primers for multiplex leaf blotch pathogen of wheat, Mycosphaerella gra- PCR that could be used to quickly determine the mating minicola (Goodwin and Zismann 2001). The asexual types of large numbers of isolates of S. passerinii. stage of M. graminicola, S. tritici, is quite similar to S. passerinii morphologically (Goodwin and Zismann 2001). However, the sexual stage of S. tritici has been Materials and methods known since 1972 (Sanderson 1972), and it appears to play an important part in the life cycle of this pathogen Fungal isolates and culture methods (Hunter et al. 1999; Kema et al. 1996; Shaw and Royle Diseased leaves were sampled from one barley field in Minnesota 1989; Zhan et al. 1998). If S. passerinii is truly asexual, it and three in North Dakota, by David Long (USDA-ARS, Cereal could be a recent derivative from the same evolutionary Disease Laboratory, St. Paul, Minn.) during 1995 (Table 1). Leaf lineage as M. graminicola. pieces were surface-sterilized by immersion in a 0.5% solution of In the absence of a known sexual stage, several ap- sodium hypochlorite for 30 s, then placed on glass microscope slides in petri dishes. The petri dishes were lined with filter paper proaches can be used to test for evidence of sexual re- saturated with sterile distilled water to provide humidity and were production (Milgroom 1996). Indirect methods analyze incubated at 20C for 2–4 days to induce sporulation of the fungus. the observed levels of genotypic diversity. Populations When spore masses became visible under a dissecting microscope, with regular cycles of sexual reproduction should have the conidia were diluted in sterile distilled water and transferred to potato dextrose agar (PDA, Difco Laboratories, Detroit, Mich.) many more genotypes, with consequently higher levels plates. After a few days, single germinated conidia were transferred of genotypic diversity, compared to those with only to fresh PDA plates. At least three germinated conidia were asexual reproduction. This type of genetic structure is transferred from different asexual spore structures on each leaf. seen in most populations of M. graminicola worldwide Following isolation, the cultures were maintained on yeast-malt agar (YMA) plates (4 g yeast extract, 4 g malt extract, 4 g sucrose, (McDonald et al. 1995). Other methods to test for the 15 g agar per liter, with 50 lg kanamycin per ml added after possibility of sexual reproduction involve assaying the autoclaving) at room temperature (22–24C). Three additional occurrence, frequency, or expression of the mating-type isolates were purchased from the American Type Culture Collec- genes directly. Populations of parasitic fungi in which tion (Accession Nos. 22585, 26515, and 26516). For long-term mating occurs by direct contact on the host substrate are storage, cultures were kept on lyophilized filter-paper pieces at )80C. expected to have both mating types in approximately Mycelia for isozyme and random amplified polymorphic DNA equal frequencies (Milgroom 1996). In contrast, asexual (RAPD) analyses were grown on YMA plates for 12 days at room fungi often have only one of the two mating types re- temperature. For medium-scale DNA extraction, mycelium was quired to initiate sexual reproduction (Christiansen et al. grown in yeast-malt broth on a shaking platform at room temperature, then harvested, lyophilized and stored as described 1998; Sharon et al. 1996), although some exceptions are previously (Goodwin et al. 2001a). known (Yun et al. 1999, 2000). A direct assay for possible sexual reproduction of species of Septoria became possible recently when both DNA extraction, library construction and Southern analyses mating-type genes were cloned from M. graminicola (Waalwijk et al. 2002). This species has an outcrossing Medium-scale DNA extraction from lyophilized mycelia was car- ried out as described by Biel and Parrish (1986), with major modi- mating system (Kema et al. 1996) with two mating-type fications. One gram of mycelium was frozen in liquid nitrogen and genes designated MAT1-1 and MAT1-2 (Waalwijk ground to a fine powder with a mortar and pestle. Approximately et al. 2002). Because only one mating-type locus is pre- 500 mg of the powder was transferred to a microcentrifuge tube, sent, these can be referred to as MAT-1 and MAT-2 suspended in 1 ml of lysis buffer (50 mM TRIS-HCl pH 7.5, 5 mM EDTA, 2% SDS, and 250 lg proteinase K per ml), and incubated at according to the informal nomenclature of Turgeon and 37C for 1 h. An equal volume of TE (10 mM TRIS-HCl pH 8.0, Yoder (2000). The two alleles at the mating-type locus of 1 mM EDTA)-saturated phenol:chloroform (1:1, v:v) was added to M. graminicola code for different products (Waalwijk each tube, mixed by inversion, and the tubes were centrifuged for et al. 2002). Therefore, as in other Ascomycetes, they are 20 min at 9900· g at room temperature. The aqueous phase was removed and extracted twice more as described above with an equal not alleles in the classical sense and instead can be re- volume of phenol:chloroform. RNA was removed by incubating the ferred to properly as idiomorphs (Metzenberg and Glass final aqueous phase with 100 lg of RNase A for 15 min at 37C, 1990). Waalwijk et al. (2002) predicted that the mating- followed by another phenol:chloroform extraction step. DNA was 3

Table 1 Collection information, mating type, and haplotype oﬁsolates of Septoria passerinii from Minnesota and North Dakota, USA

No. of isolate Locationa Leaf-isolateb Mating type Isozyme haplotypec RAPD haplotyped

ATCC 22585 - e - MAT-1 -- ATCC 26515 MN (-) - MAT-1 -- ATCC 26516 MN (-) - MAT-1 -- P78 MN (Marshall) 1-1 MAT-2 1132 110011100 P81 MN (Marshall) 1-2 MAT-2 1132 999999999 P83 ND (Foster) 2-1 MAT-2 2131 100010010 P84 ND (Foster) 2-2 MAT-2 1221 000000010 P85 ND (Foster) 2-3 MAT-2 1221 999999999 P79 ND (Walsh) 3-1 MAT-2 1321 999991001 P62 ND (Walsh) 3-2 MAT-1 1111 110011000 P63 ND (Walsh) 3-3 MAT-1 1112 100011000 P64 ND (Walsh) 4-1 MAT-1 1111 110010001 P65 ND (Walsh) 4-2 MAT-1 3112 110011000 P66 ND (Walsh) 4-3 MAT-2 1111 100100010 P67 ND (Walsh) 5-1 MAT-2 1112 111001001 P68 ND (Walsh) 5-2 MAT-1 1131 111000100 P69 ND (Walsh 5-3 MAT-2 1111 999990000 P73 ND (Ward) 6-1 - f 1121 999991001 P70 ND (Ward) 6-2 MAT-2 1111 110111000 P74 ND (Ward) 7-2 MAT-1 1121 999991100 P75 ND (Ward) 8-1 MAT-1 2121 111000101 P76 ND (Ward) 8-2 MAT-2 1231 100011000 P71 ND (Ward) 9-1 MAT-1 1111 100010000 P72 ND (Ward) 9-2 MAT-2 1139 999990000 P77 ND (Ward) 9-3 MAT-2 2121 999990001 aSamples were collected in theindicated counties in Minnesota dRAPD alleles are designated by 1for presence and 0 for absence of (MN) and North Dakota (ND) a band at each presumptive locus. Missingdata are indicated by 9. bThe first number refers to theleaf, the number after the hyphen is Scores for the RAPD loci OPM 14-1, OPM 14-2, OPM 14-3,OPM the number of the isolate on that leaf;e.g., 8-2 indicates the second 14-4, OPM 14-5, OPM 17-1, OPM 20-1, OPM 20-2, and OPM 20-3 isolate from leaf 8 are indicatedfrom left to right. Isolates P81 and P85 werenot scored cIsozyme alleles are numberedsequentially in decreasing order of for RAPD polymorphisms frequency, with 1 indicating the mostcommon allele. Possible null eNot known or not determined alleles are indicated by 9. Scores for the fourpolymorphic isozyme fThis isolate was lost before itsmating type could be determined loci peptidase, phosphoglucomutase, glucose-6-phosphatedehy- drogenase, and mannose-6-phosphate isomerase are indicated from left to right precipitated by adding 0.1 vol of 3 M NaCl and 2.5 vols of cold automated DNA sequencer (Amersham Pharmacia Biotech, Pis- 100% ethanol. The precipitated DNA was pelleted by centrifuga- cataway, N.J.) as described previously (Goodwin et al. 2001a, tion at 9900· g for 20 min at 4C. The DNA pellet was washed in 2001b). PCR products were cloned with the TA cloning kit (Invi- cold 70% ethanol, air dried, suspended in 75 ll of distilled water, trogen), and several clones were sequenced at each step to minimize and quantified with a Hoefer DyNAQuant 2000 fluorometer errors introduced through imperfect amplification. Therefore, each (Hoefer Scientific Instruments, San Francisco, Calif.). region was sequenced a minimum of 3 to 5 times. The individual A subgenomic library was constructed by digesting 10 lgof segments were assembled into the complete sequence with the DNA from S. passerinii isolate P78 to completion with the re- Contig Manager of MacDNASIS (Hitachi Software, San Francis- striction enzyme EcoRI, and fractionating the fragments on a 1% co, Calif.). agarose gel. DNA fragments of 3.5–4.5 kb in size were excised from The primers used to amplify the MAT-1 idiomorph from the gel and purified from the agarose with the GeneClean spin kit S. passerinii were designed by aligning sequences from the (BIO 101, Carlsbad, Calif.), then ligated to Eco RI-digested flanking regions of both mating types of M. graminicola pBluescript DNA (Stratagene, La Jolla, Calif.) and transformed (Waalwijk et al. 2002) with that of the MAT-2 clone (see below) into the Escherichia coli strain INVaF’ according to protocols from S. passerinii. Primers were designed to lie within the regions provided with the TA cloning kit (Invitrogen, San Diego, Calif.). of identity among all three sequences with PrimerPremiere 4.1 Following blue-white color selection, 1920 white colonies were (Premier Biosoft International, Palo Alto, Calif.). Additional transferred onto nylon membranes and hybridized sequentially primers for multiplex PCR and for DNA sequencing were cho- with a 338-bp fragment from the MAT-1 gene and a 656-bp sen based on the analysis of single DNA sequences with fragment from the MAT-2 gene of M. graminicola (Waalwijk et al. PrimerPremiere. Primers were purchased from MWG-Biotech 2002). Methods of hybridization and autoradiography for library (High Point, N.C.). screening were as described elsewhere (Goodwin et al. 2001a). All PCRs were performed in a Perkin-Elmer 9600 (Perkin Additional Southern analyses were performed according to stan- Elmer, Foster City, Calif.) or an MJ PTC 100 (MJ Research, dard protocols (Sambrook et al. 1989). Waltham, Mass.) thermal cycler. Cycling parameters were 94C for 1 min, 45 cycles of 94C for 1 min, annealing temperature for 1 min, and 72C for 2 min, followed by a final extension of 7 min DNA sequencing, primer design and PCR analysis at 72C. The lowest annealing temperature indicated by the man- ufacturer for any member of a pair or trio of primers was chosen All DNA sequencing was done with the ThermoSequenase fluo- for initial experiments, and this was subsequently adjusted as rescence-labeled primer cycle-sequencing kit, on an ALFexpress necessary for optimal resolution of specific amplicons. 4

Phylogenetic analyses and calculation of relative rates was loaded onto cellulose-acetate plates (Helena Laboratories, of evolution Beaumont, TX, USA) and electrophoresis was performed according to the protocol outlined in Goodwin et al. (1995). Represen- Additional sequences for phylogenetic analyses (Table 2) were tative isolates of S. passerinii were tested for 29 enzyme activities identified by blastx (Altschul et al. 1997) searches with the MAT-1 (aspartate amino transferase, aconitate hydratase, aldehyde dehy- and MAT-2 gene sequences from S. passerinii as query sequences drogenase, alcohol dehydrogenase, adenylate kinase, alkaline in the GenBank non-redundant protein database. Sequences of phosphatase, aldehyde oxidase, arginine kinase, carbonate MAT-1 (alpha-box-containing genes only) and MAT-2 genes were dehydratase, carboxylesterase, fumarate hydratase, galactosidase, downloaded in Fasta format and maintained in separate databases. glucose dehydrogenase, glycerol-3-phosphate dehydrogenase, glu- The sequences were trimmed so that only the regions near the cose-6-phosphate dehydrogenase, glucose-6-phosphate isomerase, alpha-box and HMG sites of the MAT-1 and MAT-2 genes, hexokinase, isocitrate dehydrogenase, leucine aminopeptidase, respectively, were retained for phylogenetic analyses. lactate dehydrogenase, malate dehydrogenase, malate dehydro- Alignments of protein and DNA sequences were performed genase NADP, mannose-6-phosphate isomerase, peptidase, with the Profile Mode of ClustalX (Thompson et al. 1997) as de- 6-phosphogluconate dehydrogenase, phosphoglucomutase, super- scribed previously (Goodwin et al. 2001b). Alignments were veri- oxide dismutase, a,a-trehalase, and xanthine dehydrogenase) using fied visually and modified manually if necessary after each profile the enzyme staining recipes described by Hebert and Beaton (1993). step. Neighbor-joining trees were constructed and bootstrap anal- All enzymes were tested on the two buffer systems (CAAPM and ysis (1000 replications) was performed with the Bootstrap N-J Tree TG) described by Hebert and Beaton (1993). Seven enzyme-buffer option of ClustalX. Trees were plotted and manipulated with combinations that gave clearly resolved, repeatable bands were NJplot (Perrie` re and Gouy 1996). then used to analyze the entire set of isolates. Rates of evolution were estimated relative to those of the in- For RAPD analysis, DNA was extracted from mycelia and ternal transcribed spacer (ITS) regions of the ribosomal DNA. For spores of S. passerinii according to the method of Biel and Parrish each genomic region (MAT-1, MAT-2, and ITS) the number of (1986) with minor modifications (Goodwin and Zismann 2001). differences between the DNA sequence of S. passerinii and that of PCR amplification was as described by Jones and Dunkle (1993) on M. graminicola was calculated. The number of differences was a Perkin Elmer GeneAmp PCR System-9600. divided by the length of the region to obtain the % difference Diversity of multilocus haplotypes was calculated with the (average number of nucleotide differences per 100 bp). Percent Shannon information statistic as described elsewhere (Goodwin et al. difference for each mating-type gene was divided by that for the ITS 1993). Because some data points for a few isolates were missing, the region to obtain the average rate of evolution relative to that of the Shannon diversity values were normalized by dividing by ln (n), the ITS region. Values lower than 1 indicate a slower rate of change maximum possible value (Sheldon 1969), to facilitate comparisons. compared to the ITS region, numbers higher than 1 indicate a faster The maximum value of the normalized Shannon diversity statistic of rate of evolution. Separate values were calculated for introns and 1.0 occurs when each individual has a unique haplotype. exons. Only the more conserved regions of the mating-type genes were used for this comparison as other regions were too divergent to permit meaningful comparisons. Similar analyses were performed Results for species of Cochliobolus by dividing the percent divergence rates for the mating-type genes calculated by Turgeon (1998) by that for Cloning, sequencing, and analysis of the mating-type the corresponding ITS region. idiomorphs from S. passerinii

Isozyme and RAPD analyses Southern analysis of PstI-digested DNA from ten isolates of M. graminicola and three of S. passerinii with Mycelia and conidia of S. passerinii were collected by scraping the 338-bp alpha-box sequence from M. graminicola 12-day-old YMA plates with the edge of a glass microscope slide. Fungal material was ground immediately using a tissue homoge- revealed the expected 2.4-kb band in the MAT-1 isolates nizer attached to a variable-speed electric drill, then mixed with a of M. graminicola but no hybridization with MAT-2 small amount of sterile water. Between 0.25 and 1 ll of each sample (HMG-box containing) isolates of M. graminicola,or

Table 2 Additional species included in phylogenetic analyses of mating-type protein sequences

Species Family Order MAT-1 MAT-2

Cochliobolus sativus Pleosporaceae Pleosporales AF275373b AF275374 Cochliobolus heterostrophus Pleosporaceae Pleosporales AF029913 AF027687 Cochliobolus kusanoi Pleosporaceae Pleosporales AF129742 AF129742 Cochliobolus ellisii Pleosporaceae Pleosporales AF129746 AF129747 Alternaria tenuissima Pleosporaceae Pleosporales AY004675 AAG00832 Alternaria alternata Pleosporaceae Pleosporales AB009451 BAA75903 Neurospora crassa Sordariaceae Sordariales P19392 M54787 Sordaria macrospora Sordariaceae Sordariales Y10616 Y10616 Sordaria brevicollis Sordariaceae Sordariales CAB63927 AJ133042 Podospora anserina Lasiosphaeriaceae Sordariales S22448 X64195 Gibberella zeae Nectriaceae Hypocreales AF318048 AAG42810 Gibberella fujikuroi Nectriaceae Hypocreales AF236759 AAC71056 Fusarium oxysporum Nectriaceae Hypocreales AB011379 BAA28611 Pyrenopeziza brassicae Mollisiaceae Helotiales AJ006073 CAA06843 Mycosphaerella graminicola Mycosphaerellaceae - a AF440399 AF440398 Cryphonectria parasitica Valsaceae Diaporthales AF380365 AF380364 Schizosaccharomyces pombe Schizosaccharomycetaceae Schizosaccharomycetales AAA35306 AL035065 aConsidered as incertaesedis by Eriksson andWinka (1998) b Accession numbers of the Gen Bank data base 5 with those of S. passerinii (data not shown). Probing the other enzyme/isolate combinations tested. Probing a same blot with the 656-bp HMG gene sequence from subgenomic library from isolate P78 containing EcoRI M. graminicola revealed the expected 2.1-kb band in the fragments of about 3.5–4.5 kb with the HMG-box clone MAT-2 isolates of M. graminicola and a faint 7-kb band from M. graminicola identified four positive colonies in S. passerinii isolate P78, but no hybridization with containing inserts of approximately 4 kb. A fifth positive the other isolates tested. This indicated that S. passerinii colony had the 4-kb insert plus two additional bands, isolate P78 probably contained the MAT-2 idiomorph. and was not analyzed further. Sequences of the ends of To clone the MAT-2 idiomorph, DNA of S. pass- the 4-kb band from two clones were identical. When one erinii isolates P71, P78, and P26515 was digested with six of the positive clones, 12H11, was used to probe restriction enzymes (EcoRI, HhaI, MboI, NlaIII, PstI, Southern blots of DNA digested with PstI, two patterns and PvuII), blotted and probed with the 656-bp HMG- were evident among 12 isolates of S. passerinii tested box clone from M. graminicola. The EcoRI digest of (Fig. 1). Five isolates (P66, P67, P72, P76, and P77) had isolate P78 yielded a single faint band of about 4.2 kb a single band of approximately 7.4 kb, while the (data not shown). No bands were detectable with the remaining isolates had two bands of 4.1 and 2.9 kb. Isolates with the 7.4-kb band also hybridized weakly with the HMG-box clone from M. graminicola (data not shown) and were assumed to be mating type MAT-2, while those with two bands were assumed to be MAT-1. Complete sequence analysis of clone 12H11 revealed an insert size of 4176 bp containing a complete MAT-2 idiomorph of 2898 bp (Table 3), plus 535 and 743 bp of sequence 5¢ and 3¢ to the idiomorph, respectively. The MAT-2 idiomorph contained a single putative gene coding for a 234-amino-acid product with high similarity to ) the MAT1-2 gene of M. graminicola (E=4·10 84), and lower similarity to MAT-2 genes of Cryphonectria par- ) asitica (E=1·10 5), Sordaria brevicollis and S. sclero- ) genia (both at E=5·10 5) on the basis of a blastx search. This reading frame contained a single putative intron of 49 bp that began after the first base of codon 53 (Fig. 2). A lariat sequence of ACTGAC started 16 nt upstream from the likely 3¢ splice site. A blastp analysis of the putative translation product confirmed the high similarity to )84 Fig. 1 Southern analysis of DNA from 12 isolates of Septoria the HMG-box protein of M. graminicola (E=4·10 ; passerinii, digested with the restriction enzyme PstI and probed 57% identical, 64% positive matches), with lower simi- ) with MAT-2 clone 12H11 from isolate P78. MAT-1 isolates P62, larities to those of Penopegiga brassicae (E=4·10 11; P63, P64, P65, P68, P74, and P75 have two hybridizing fragments 39% identical, 49% positive), C. parasitica (E=1·10-9; of 2.9 and 4.1 kb. MAT-2 isolates P66, P67, P72, P76, and P77 have 39% identical, 48% positive), and Neurospora crassa a single hybridizing fragment of approximately 7.4 kb. The )9 approximate size of each fragment is indicated (in kb) on the right (E=3·10 ; 33% identical, 49% positive).

Table 3 Comparisons of the a mating-type idiomorphs of the Region Septoria passerinii Mycosphaerella Diﬀerence Septoria passerinii isolates P65 graminicola and P78 with those from Mycosphaerella graminicola MAT-1 idiomorph 3049 2842 207 5’ end 1681 1589 92 MAT-1 gene coding region 1038 995 43 Exon I 181 319 )138 Intron I 52 55 )3 Exon II 94 94 0 Intron II 53 49 4 Exon III 658 478 180 Predicted number of amino acids 310 296 14 3’ end 330 258 72 MAT-2 idiomorph 2898 2774 124 5’ end 1825 1376 449 ) a MAT-2 gene coding region 754 1233 479 The size of the S. passerinii Exon I 157 634 )477 sequence minus thatof its ho- Intron 49 48 1 molog from M. graminicola. Exon II 548 551 )3 Negative numbers indicate that Predicted number of amino acids 234 394 –160 the sequence from M. gra- 3’ end 319 165 154 minicola is the larger 6

Fig. 2A, B Organization of the two mating-type idiomorphs of S. The PCR product from isolate P65 was 3637 bp long. passerinii. A MAT-1. B MAT-2. Near-identical flanking regions A search with blastx identified high similarity to the are indicated by thin, solid black lines to the left and right of the -72 idiomorph sequences. Idiomorphs are denoted by boxes. The 5¢ and MAT1-1 protein of M. graminicola (E=2·10 ). Lower 3¢ noncoding ends of each idiomorph are shaded gray. Unshaded similarity was identified to the alpha-1 domain protein boxes underlined by long horizontal arrows indicate reading frames. of Pyrenopeziza brassicae (E=2·10-6), and the MAT-1 Introns are indicated by hatching. Approximate locations of the proteins of Alternaria alternata (E=6·10-5), A. tenu- alpha and HMG boxes of the MAT-1 and MAT-2 idiomorphs, issima (E=6·10-5), and Cochliobolus heterostrophus respectively, are indicated by brackets above each reading frame. -3 Locations of the six primers used for multiplex PCR are denoted by (E=2·10 ). Comparison of the sequence from isolate short horizontal arrowheads. Primer names are as listed in Table 5 P65 to that of clone 12H11 with the blast 2 Sequences algorithm (Tatusova and Madden 1999) identified a To clone the MAT-1 idiomorph, approximately MAT-1 idiomorph of 3049 bp (Table 3). This idiomorph 800 bp of sequence from each end of clone 12H11 was contained a single putative gene of 1038 bp, most compared to the mating-type idiomorph sequences of probably interrupted by two introns (Fig. 2) of 52 and M. graminicola (GenBank Accession Nos. AF440398 53 bp (introns I and II), respectively. Introns were and AF440399). The ends of the 12H11 clone corre- identified by comparison with other sequences identified sponded to the flanking regions of the M. graminicola during the blastx search. Probable 5¢ and 3¢ splice sites mating-type idiomorph. A multiple alignment revealed were deduced from the consensus sequences for introns regions of identity among the sequences from both in Neurospora (Bruchez et al. 1993) and began at the species (data not shown). Two primers based on se- second (intron I) or third (intron II) bases of codons 61 quences within these flanking regions, MT-F and MT-R and 92, respectively. Each putative intron within the (Table 4), amplified the mating-type region from both MAT-1 coding region of S. passerinii contained a lariat mating types of M. graminicola and most isolates of S. sequence (RCTRAC), ACTGAC, beginning 17 nt up- passerinii (data not shown). The complete mating-type stream from the deduced 3¢ splice site, in accord with region was then amplified and cloned from isolate P65 of known introns in Neurospora (Bruchez et al. 1993). A S. passerinii, which was assumed to represent MAT-1 blastp search of the deduced 310-amino-acid MAT-1 because it showed two bands when hybridized with clone protein from S. passerinii revealed very high similarity 12H11 (Fig. 1). to the MAT1-1 alpha-box proteins of M. graminicola

Table 4 Summary of nucleotide sequence comparisons between the mating-type idiomorphs of Septoria passeriniii and Mycosphaerella graminicola and their rates of change relative to the ITS region of rDNA

Region Length Number of diﬀerences Percent diﬀerence Rate of change relative to ITS

MAT-1 genea 756 158 20.9 10.0 Alpha-box region 168 29 17.3 8.2 Intron I 55 22 40.0 19.0 Intron II 53 23 43.4 20.7 MAT-2 geneb 825 206 25.0 11.9 HMG-box region 213 36 16.9 8.0 Intron 49 12 24.5 11.7 ITS regionc 473 10 2.1 1.0 aBases 1730 to 2589 of the S. passerinii isolate P65 MAT-1 se- compared withcoding sequence from the corresponding region in quence (GenBank Accession no. AF483193) M.graminicola b Bases 2250 to 3114 of the S. passerinii isolate P78 MAT-2 se- c Bases 45 to 514 of the S. passerinii isolate P78 ITSsequence quence (GenBank Accession no. AF483194). This includes (GenBank Accession no. AF181699) 106bases of the 5’ leader of the MAT-2 gene from S. passerinii 7

(E=3·10-63; 65% identical, 81% positive matches), P. alpha- and HMG-box regions of the MAT-1 and brassicae (E=2·10-18; 28% identical, 42% positive), MAT-2 genes, respectively. However, even within the Gibberella zeae (E=4·10-18; 37% identical, 51% posi- conserved regions the protein sequences encoded by the tive), and G. fujikuroi (E=6·10-17; 42% identical, 59% S. passerinii and M. graminicola mating-type genes were positive). Sequences of the two mating-type clones from quite different from others in the databases (Fig. 3). For S. passerinii were submitted to GenBank under the Ac- comparisons between Cochliobolus heterostrophus and cession Nos. AF483193 and AF483194 for the MAT-1 13 related species, the mating-type genes evolved from and MAT-2 idiomorphs, respectively. 2.4 (between C. heterostrophus and C. peregianensis)to 10.3 (C. heterostrophus versus C. sativus) times faster than the ITS regions, with a mean rate of 4.24. Rates of evolution and comparisons to other species Phylogenetic analyses of the alpha-box region of the MAT-1 coding sequences indicated that this region from The MAT-1 idiomorph of S. passerinii was 207 bp S. passerinii and M. graminicola is most closely related to longer than that from its close relative M. graminicola that of the discomycete P. brassicae (order Helotiales) (Table 3). This increase in length is distributed through- and to fungi in the sexual genus Gibberella (order Hyp- out the idiomorph: the S. passerinii sequence was 92 bp ocreales) (Fig. 4A) with 79% bootstrap support. The al- longer in the region 5¢ to the MAT-1 gene; 135 bp longer pha-box regions of M. graminicola and S. passerinii were in the coding region; and 72 bp longer in the region 3¢ to very different from those of four species of Cochliobolus, the coding region. The overall lengths of the predicted the other loculoascomycetes included in the analysis. proteins in both species are similar (Table 3), but the sizes Similar results were obtained for the HMG-box re- of the exons varied greatly. Exon I of the S. passerinii gion, except that S. passerinii and M. graminicola did MAT-1 gene was 138 bp shorter than its counterpart in not cluster closely with any other species (Fig. 4B). All M. graminicola, but the S. passerinii exon III sequence of the Sordariomycetes (orders Hypocreales and Sor- was 180 bp longer than that in M. graminicola. Exon II is dariales) formed a cluster with 61% bootstrap support, located in the middle of the alpha-box region of the but in this analysis P. brassicae clustered near the protein and is 94 bp long in both species. Pleosporales rather than near Mycosphaerella. The MAT-2 idiomorph of S. passerinii was also longer than the corresponding sequence in M. graminicola (Table 3). All of the increase in length is restricted to Multiplex PCR of field isolates the 5¢ and 3¢ noncoding regions of the idiomorph, which together were 603 bp longer than the corresponding re- Tests with two mixtures of three primers each (Table 5) gions in M. graminicola (449 bp for the 5¢ region, 154 bp for multiplex PCR identified one combination [primers for the 3¢ region). In contrast, the MAT-2 coding se- MT-F, Alpha(1594)R, and HMG(849)R] that gave a quence was much longer (by 479 bp) in M. graminicola 1594-bp product from MAT-1 isolates and an 849-bp than in S. passerinii (Table 3). This increase was virtu- product from MAT-2 isolates of S. passerinii (Fig. 5). ally confined to exon I; the sizes of exon II and the intron This combination of primers was used to analyze the were almost identical in the two species. mating-type frequency in field populations of S. pass- The rate of evolution within the mating-type idiom- erinii from North Dakota and Minnesota. Both mating orphs of S. passerinii and M. graminicola was extremely types occurred usually on the same leaf and in approx- high compared to the ITS region (Table 4). Within the imately equal frequencies in each of the locations sam- MAT-1 gene sequence, S. passerinii and M. gramini- pled (Table 1). Overall, both mating types were found cola averaged almost 21 differences every 100 bases. This together on five of the seven leaves from which two or number was slightly lower in the alpha-box region but three isolates were scored for mating type (Table 1). was almost doubled in the introns (Table 4). These Among the five isolates analyzed from Minnesota, three values were similar for the MAT-2 genes, with an were MAT-1 and two were MAT-2. Isolate P26515, overall difference between the species of 25%. By com- from the wild barley H. jubatum, appeared to be MAT-1, parison, the difference within the ITS region was only but the band was slightly larger than that for the other 2.1 per 100 nt. The mating-type genes of S. passerinii isolates of S. passerinii tested (Fig. 5). and M. graminicola have diverged from each other 8 to 21 times faster than their ITS regions, with the lowest rate of divergence in the alpha- and HMG-box regions, Isozyme and RAPD analyses and the highest in the introns (Table 4). Rates of divergence in the idiomorph regions flanking the coding Of the 29 enzyme systems tested, 10 gave distinct, easily sequences were too high to permit meaningful analyses. scorable bands for at least some of the 22 field isolates Comparison of the mating-type genes from S. pass- analyzed. For three systems, malic enzyme, alkaline erinii and M. graminicola to those from other fungi phosphatase (ALP), and 6-phosphogluconate dehydro- revealed an extremely high rate of divergence over most genase (6PGDH), a clear band was obtained for less of the coding regions (data not shown). As expected, the than half of the isolates scored. Unfortunately, it was regions of highest conservation corresponded to the not possible to determine whether absence of a band 8

Fig. 3A, B Protein sequence alignments of the approximate regions containing the alpha and high-mobility group (HMG) box regions isozyme loci (Table 1). In total, 12 haplotypes were of S. passerinii with those from other Ascomycetes. A Alpha-box identified among the 22 isolates tested. The most fre- sequences of MAT-1 idiomorphs. B HMG-box sequences of quent haplotype, which contained the most common MAT-2 idiomorphs. Locations of introns are indicated by vertical allele at each locus, occurred six times in the sample. arrows above each alignment. Conservation of amino acids is indicated above each alignment: asterisks denote amino acids that Five other haplotypes occurred twice each, while the are absolutely conserved among all species, colons and periods remaining six haplotypes were detected only once each. indicate full conservation of strong and weak groups of amino Overall Shannon genotypic diversity was 2.29, which acids, respectively, as defined by ClustalX (Thompson et al. 1997). was 74% of the maximum possible value. Amino acid positions are indicated below each alignment Among the 20 RAPD primers tested, three (OPM- 14, OPM-17, and OPM-20) produced clear, consistent indicated a null allele or was simply due to inconsistent banding patterns. These were scored with ‘‘0’’ indicat- staining. Therefore, those systems were not analyzed ing absence and ‘‘1’’ indicating presence of the band. further, even though both ALP and 6PGDH had two Missing data were scored as ‘‘9’’. A multilocus RAPD clear alleles each in addition to a possible null allele. haplotype was constructed by combining the data for All isolates were assayed for variation at the re- all nine markers scored (five for RAPD primer OPM- maining seven isozyme loci. Three loci (glucose-6-phos- 14, one for OPM-17, and three for OPM-20). Two phate isomerase, malate dehydrogenase, and isocitrate isolates (P81 and P85) were not scored for RAPD dehydrogenase) were monomorphic, one (mannose- polymorphisms. phosphate isomerase) had two alleles, and the remaining In total, 16 RAPD haplotypes were identified among three (peptidase, phosphoglucomutase, and glucose- the 20 isolates analyzed (Table 1). Four haplotypes were 6-phosphate dehydrogenase) had three alleles each. At detected twice each, while each of the remaining 12 was each locus, the most common allele was coded as ‘‘1’’, detected only once. The overall Shannon genotypic di- the next most common as ‘‘2’’, and the rarest as ‘‘3’’. versity for the RAPD data set was 2.72, which when Possible null alleles were coded as ‘‘9’’. normalized was 91% of the maximum possible diversity. A multilocus haplotype was constructed for each When the isozyme and RAPD data were combined, isolate by combining data for the four polymorphic each isolate had a unique 16-locus haplotype. Shannon 9

Fig. 4A, B Neighbor-joining trees based on phylogenetic analyses nation in the field. This could explain why each isolate had of the mating-type genes from S. passerinii, Mycosphaerella a unique haplotype for the molecular markers tested, even graminicola and other Ascomycetes. A Analysis of MAT-1 (alpha- box) gene sequences. B Analysis of MAT-2 (HMG-box) gene when multiple isolates originated from the same leaf. The sequences. Orders are indicated by brackets to the right of each sexual stage of S. passerinii is probably similar morpho- dendrogram with four-letter abbreviations: Pleo, Pleosporales; logically to that of its close relative M. graminicola Sord, Sordariales; Hypo, Hypocreales; Helo, Helotiales; Diap, (Goodwin and Zismann 2001), and it may be one of the Diaporthales; and Sciz, Schizosaccharomycetales. All bootstrap two species of Mycosphaerella reported on barley (Corlett values above 60% (1000 replications) are indicated at the appropriate nodes. Branch lengths are proportional to genetic 1991) for which no asexual stage is known. Alternatively, distance, which is indicated by a bar at the upper left of each it simply may have been overlooked. Our results suggest dendrogram that S. passerinii probably does have a sexual stage that should be produced on barley leaves. Hopefully, this in- genotypic diversity was 3.09, which was the maximum formation will facilitate its identification in the future. possible value, giving a normalized diversity of 100%. Although our data do not prove that the mating-type genes of S. passerinii are functional, several lines of evidence support the hypothesis that they do function Discussion properly. First of all, it seems highly unlikely that both mating types would persist at near-equal frequencies The high level of genotypic diversity and the common within field populations unless the genes were func- occurrence of both mating types together on the same tional. Second, both mating-type sequences contained leaves indicate that S. passerinii is probably not a recently long ORFs that were not interrupted by stop codons, as derived asexual fungus. Instead, it seems highly likely that expected for functional genes. Third, the rate of evolu- S. passerinii undergoes regular cycles of sexual recombi- tion was much higher in the introns compared to the

Table 5 Primer sequences and expected sizes of ampliﬁcationproducts for mating type and multiplex-PCR analysis of Septoria passerinii

Primer no. Name Sequence Primer combination MAT-1a MAT-2a

1 MT-F CTTCTTGCCTGCGCCACAGG 1+2 3637 3580 2 MT-R GGTCGTCAACTCTGGTCCTTGCTG 1+4+6 1594 849 3 Alpha (1881) F AGAGGTTGGTGCGGAGCAG 2+3+5 1881 796 4 Alpha (1594) R CGGTATGTGGATGGAAGAAAGG 5 HMG (796) F TCTGGCGAAAGAACAAACTACC 6 HMG (849) R TAGTCGGGACCTGAAGGAAGTG a Expected sizes of ampliﬁcation products in base pairs 10

Fig. 5 Three-primer multiplex-PCR analysis for rapid determina- The areas of highest conservation between the mat- tion of the mating type of isolates of S. passerinii. The primers used ing-type idiomorphs of S. passerinii and M. graminicola were MT-F, Alpha (1594) R, and HMG (849) R. MAT-1 isolates P26516, P62, P63, P64, P74, P75, and P68 yield a single amplicon of corresponded to the alpha- and HMG-box regions of 1594 bp. The MAT-2 isolates P66, P67, P69, P72, P76, P77, and the MAT-1 and MAT-2 sequences, respectively. This P78 give rise to an amplification product of 849 bp. Isolate P26515, was expected, because these regions are conserved from the wild barley Hordeum jubatum, has a single amplicon that among all Ascomycetes analyzed to date (Coppin et al. is slightly larger than those produced by typical MAT-1 isolates of 1997; Turgeon 1998). Conservation within these regions S. passerinii. Sizes of the amplicons (in bp) are indicated on the right. Approximate sizes (in kb) of bands produced by a 1-kb includes the locations and sizes of introns, which were ladder are indicated on the left very similar between S. passerinii and M. graminicola. These similarities extended to the sequences of the pu- exons. This probably reflects differential selection on tative 5¢ and 3¢ splice sites of the introns and the oc- functional versus non-functional parts of the genes, and currence of lariat sequences at positions 15–17 nt would occur only if the genes play an important role in upstream of the presumptive 3¢ splice sites. the biology of the organism. If the genes were not active, Despite their structural similarity, the nucleotide se- it seems unlikely that the integrity of the coding sequences of the mating-type genes themselves evolve quences would be maintained by selection, and we rapidly, approximately 10 times faster than the ITS re- would expect equal rates of evolution in the exons and gions of the same species. Rapid evolution of mating- introns. The S. passerinii mating-type sequences could type genes has been reported in the genus Cochliobolus be tested directly for function by transformation into and related asexual genera (Turgeon 1998), but the rel- suitable strains of M. graminicola, for which an efficient ative divergence between S. passerinii and M. gra- crossing protocol is available (Kema et al. 1996). minicola is even greater, with a minimum percentage Alternatively, strains of opposite mating type could be divergence of approximately 17% in the alpha- and co-inoculated onto barley leaves in an attempt to gen- HMG-box regions of the MAT-1 and MAT-2 idiom- erate the unknown sexual stage of S. passerinii. orphs, respectively. By contrast, sequence divergence As predicted (Waalwijk et al. 2002) from their close between the ITS regions of S. passerinii and M. gra- phylogenetic relationship (Goodwin et al. 2001a), the minicola was only 2.1%, so that, overall, the coding re- organization of the mating-type loci of S. passerinii and gions of the mating-type idiomorphs of S. passerinii and M. graminicola is very similar. Both species appear to M. graminicola diverge at least ten times faster than the contain a single gene within each idiomorph. The MAT-1 ITS region. These rates are more than twice the mean gene of S. passerinii is highly similar (65% identical), and rate of divergence (4.24) between C. heterostrophus and almost certainly is homologous, to that of M. graminicola 13 related species calculated from the data of Turgeon (Waalwijk et al. 2002) and other fungi (Coppin et al. (1998). The fastest rate within Cochliobolus was 10.3 1997). As pointed out previously (Waalwijk et al. 2002), between C. sativus and C. heterostrophus, which is close the organization of the MAT-1 idiomorph with only a to that between S. passerinii and M. graminicola, ex- single gene is similar to that of other members of the cluding introns. Whether a more rapid rate of evolution Loculoascomycetes, but different from fungi in the Py- of mating-type sequences is representative of Mycosp- renomycetes or Discomycetes which have three MAT-1 haerella or specific to these two species must be tested by reading frames (Singh and Ashby 1998), only one of which sequencing the mating-type regions from additional is homologous to the alpha-box-containing genes of S. species and comparing them to ITS sequences published passerinii and M. graminicola. The MAT-2 idiomorph of previously (Goodwin et al. 2001b; Goodwin and S. passerinii has the same organization as that of most Zismann 2001). other Ascomycetes analyzed, coding for a single poly- Phylogenetic analyses of the conserved regions of the peptide with high similarity to HMG proteins from M. mating-type genes revealed that the class Loculoasco- graminicola and other fungal species (Coppin et al. 1997). mycetes may be polyphyletic. The mating-type sequences 11 of S. passerinii and M. graminicola clustered separately Advantages of this approach are that only three primers from those of the other Loculoascomycetes, such as are needed for each reaction and, because the expected species in the genus Cochliobolus. Therefore, even though product for each mating type has a different size, they the structure of the idiomorphs was similar between should act as codominant markers allowing identifica- Septoria / Mycosphaerella and Cochliobolus spp. (i.e., tion, for example, of mixed cultures of both mating each having a single reading frame in each idiomorph), types. Furthermore, successful amplification always the gene sequences were very different. This indicates that gives a product, unlike some other detection systems Mycosphaerella and Cochliobolus are not closely related that can be plus or minus. Similar three-primer, multi- and almost certainly belong in different orders. The ge- plex-PCR approaches have been developed for the nus Cochliobolus is related to Pleospora in the order Discomycetes Pyrenopeziza brassicae (Foster et al. Pleosporales (Berbee et al. 1999). The taxonomic posi- 2002) and Tapesia yallundae (Dyer et al. 2001). tion of Mycosphaerella is uncertain (Eriksson and The multiplex primers may also be suitable for Winka 1998) and the literature is contradictory. On the analysis of closely related species. For example, ampli- basis of morphological features, most taxonomists place fication of DNA from isolate ATCC 26515 of S. pass- Mycosphaerella in the order Dothideales (Barr 1979; erinii with the multiplex primers produced a single Luttrell 1973). However, molecular taxonomists some- product of approximately 1.75 kb, slightly larger than times include Mycosphaerella in the Pleosporales the typical amplicon from the MAT-1 idiomorph of (Silva-Hanlin and Hanlin 1999). One large-scale analysis S. passerinii. Analyses of ITS sequences (Goodwin and of 18S ribosomal RNA sequences included a single spe- Zismann 2001) and host specificity data (Green and cies of Mycosphaerella, M. mycopappi, which formed Dickson 1957; Shearer et al. 1977) revealed that isolate part of a large cluster with species of Pleospora and ATCC 26515 from Hordeum jubatum is reproductively Cochliobolus (Berbee 2001). However, analyses of ITS isolated from S. passerinii on H. vulgare and almost sequences (Goodwin et al. 2001b) indicated that certainly represents an undescribed species of Septoria. Mycosphaerella is related to Dothidea, which would place A slightly larger amplification product supports the it in the order Dothideales. The ITS results support those hypothesis that this isolate represents a new species and obtained with the mating-type sequences, indicating that confirms that the primers can amplify mating-type se- Mycosphaerella and Cochliobolus are only distantly re- quences from closely related species. lated and probably belong in different orders. The ability to amplify and sequence portions of the A curious result of the phylogenetic analyses was the mating-type genes from S. passerinii and related species difference in topology between the alpha- and HMG- of Septoria will make it possible to address many box trees. The major clusters corresponding to the questions about the biology of this large and important Pleosporales, Sordariales, and Hypocreales had the same genus of plant pathogenic fungi. In addition to S. pass- composition, with 100% bootstrap support, in both erinii, many other species in this genus may have both trees. However, relationships among these groups varied mating types and possible unobserved sexual cycles slightly. Analysis of the alpha-box sequences grouped which could be tested either by PCR or by heterologous M. graminicola and S. passerinii with Pyrenopeziza hybridization. The ability to identify mating types will brassicae (a discomycete in the Helotiales) and the facilitate experiments designed to induce the formation Hypocreales cluster with 79% bootstrap support. The of the sexual stage of S. passerinii on barley leaves. Two next most closely related group included the Sordario- species of Mycosphaerella have already been identified mycetes Neurospora and Podospora (order Sordariales), from barley (Corlett 1991), but whether either of these although bootstrap support for this grouping was lower represents the sexual stage of S. passerinii is unknown. at 65%. In contrast, analysis of the HMG-box sequences Previous attempts to initiate sexual reproduction by clustered P. brassicae with the Pleosporales group with pairwise inoculations were unsuccessful (S. B. Goodwin 60% bootstrap support, while S. passerinii and and G. H. J. Kema, unpublished), possibly because both M. graminicola were separated from all other species. isolates had the same mating type. The present method One possible interpretation of these results is that the for routine identification of mating types of S. passerinii MAT-1 and MAT-2 genes have had different evolu- can ensure that isolates of opposite mating type are tionary histories. It is possible that S. passerinii and M. chosen for such experiments. Generation of the sexual graminicola were derived from ancestors that possessed stage of S. passerinii would enable thorough genetic three genes in their MAT-1 idiomorph and that the analyses and could facilitate future experiments on the additional genes were lost or transferred to other loci. If comparative genomics of this species and its close rela- that is the case, then the similarity in overall structure tive M. graminicola. between the mating-type loci of Mycosphaerella and Cochliobolus may be due to convergent evolution rather Acknowledgements This work was supported by USDA CRIS than descent from a common ancestor. This hypothesis project 3602-22000-011-00D. We thank Dave Long (USDA-ARS, could be tested by analyzing additional genes and a Cereal Disease Laboratory) for providing S. passerinii-infected barley leaves from Minnesota and North Dakota. Larry Dunkle larger sample of species. and Jin-Rong Xu provided helpful comments on a previous draft of The multiplex primers provided a simple, fast method the manuscript. Published as paper 16941, Purdue University for identifying the mating type of isolates of S. passerinii. Agricultural Experiment Station. 12

Hunter T, Coker RR, Royle DJ (1999) The teleomorph stage, References Mycosphaerella graminicola, in epidemics of Septoria tritici blotch on winter wheat in the UK. Plant Pathol 48:51–57 Altschul SF, Madden TL, Scha¨ffer AA, Zhang J, Zhang Z, Miller Jones MJ, Dunkle LD (1993) Analysis of Cochliobolus carbonum W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new races by PCR amplification with arbitrary and gene-specific generation of protein database search programs. Nucleic Acids primers. Phytopathology 83:366–370 Res 25:3389–3402 Kema GHJ, Verstappen ECP, Todorova M, Waalwijk C (1996) Barr ME (1979) A classification of the Loculoascomycetes. Myc- Successful crosses and molecular tetrad and progeny analyses ologia 71:935–957 demonstrate heterothallism in Mycosphaerella graminicola. Berbee ML (2001) The phylogeny of plant and animal pathogens in Curr Genet 30:251–258 the Ascomycota. Physiol Mol Plant Pathol 59:165–187 Luttrell ES (1973) Loculoascomycetes. In: Ainsworth GC, Sparrow Berbee ML, Pirseyedi M, Hubbard S (1999) Cochliobolus phy- FK, Sussman AS (eds) The fungi, an advanced treatise, vol logenetics and the origin of known, highly virulent pathogens, IVA. Academic Press, New York, pp 135–219 inferred from ITS and glyceraldehyde-3-phosphate dehydro- McDonald BA, Pettway RE, Chen RS, Boeger JM, Martinez JP genase gene sequences. Mycologia 91:964–977 (1995) The population genetics of Septoria tritici (teleomorph Biel SW, Parrish FW (1986) Isolation of DNA from fungal mycelia Mycosphaerella graminicola). Can J Bot 73: S292–S301 and sclerotia without use of density gradient ultracentrifuga- Metzenberg RL, Glass NL (1990) Mating-type and mating strate- tion. Anal Biochem 154:21–25 gies in Neurospora. Bioessays 12:53–59 Bruchez JJP, Eberle J, Russo VEA (1993) Regulatory sequences in Milgroom MG (1996) Recombination and the multilocus structure the transcription of Neurospora crassa genes: CAAT box, of fungal populations. Annu Rev Phytopathol 34:457–477 TATA box, introns, poly(A) tail formation sequences. Fungal Perrie` re G, Gouy M (1996) WWW-Query: an on-line retrieval Genet Newslett 40:89–96 system for biological sequence banks. Biochimie 78:364–369 Christiansen SK, Wirsel S, Yun S-H, Yoder OC, Turgeon BG Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a (1998) The two Cochliobolus mating type genes are conserved laboratory manual (2nd edn) Cold Spring Harbor Laboratory among species but one of them is missing in C. victoriae. Mycol Press, Cold Spring Harbor, N.Y. Res 102:919–929 Sanderson FR (1972) A Mycosphaerella species as the ascogenous Coppin E, Debuchy R, Arnaise S, Picard M (1997) Mating types state of Septoria tritici Rob ex Desm. N Z J Bot 10:707–709 and sexual development in filamentous Ascomycetes. Microbiol Sharon A, Yamaguchi K, Christiansen S, Horwitz BA, Yoder OC, Mol Biol Rev 61:411–428 Turgeon BG (1996) An asexual fungus has the potential for Corlett M (1991) An annotated list of the published names in sexual development. Mol Gen Genet 251:60–68 Mycosphaerella and Sphaerella. Mycol Mem 18:1–328 Shaw MW, Royle DJ (1989) Airborne inoculum as a major source Cunfer BM, Ueng PP (1999) Taxonomy and identification of of Septoria tritici (Mycosphaerella graminicola) infections in Septoria and Stagonospora species on small-grain cereals. Annu winter wheat crops in the UK. Plant Pathol 38:35–43 Rev Phytopathol 37:267–284 Shearer BL, Skovmand B, Wilcoxson RD (1977) Hordeum jubatum Dyer PS, Furneaux PA, Douhan G, Murray TD (2001) A multiplex as a source of inoculum of Septoria avenae f. sp. triticea and PCR test for determination of mating type applied to the plant S. passerinii. Phytopathology 67:1338–1341 pathogens Tapesia yallundae and Tapesia acuformis. Fungal Sheldon AL (1969) Equitability indices: dependence on the species Genet Biol 33:173–180 count. Ecology 50:466–467 Eriksson OE, Winka K (1998) Families and higher taxa of Asc- Silva-Hanlin DMW, Hanlin RT (1999) Small subunit ribosomal omycota. Myconet 1:17–24 RNA gene phylogeny of several loculoascomycetes and its Foster SJ, Ashby AM, Fitt BDL (2002) Improved PCR-based as- taxonomic implications. Mycol Res 103:153–160 says for pre-symptomatic diagnosis of light leaf spot and de- Singh G, Ashby AM (1998) Cloning of the mating type loci from termination of mating type of Pyrenopeziza brassicae on winter Pyrenopeziza brassicae reveals the presence of a novel mating oilseed rape. Eur J Plant Pathol 108:379–383 type gene within a discomycete MAT 1-2 locus encoding a Goodwin SB, Zismann VL (2001) Phylogenetic analyses of the ITS putative metallothionen-like protein. Mol Microbiol 30:799–806 region of ribosomal DNA reveal that Septoria passerinii from Tatusova TA, Madden TL (1999) BLAST 2 Sequences, a new tool barley is closely related to the wheat pathogen Mycosphaerella for comparing protein and nucleotide sequences. FEMS Mi- graminicola. Mycologia 93:934–946 crobiol Lett 174:247–250 Goodwin SB, Saghai Maroof MA, Allard RW, Webster RK (1993) Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins Isozyme variation within and among populations of Rhyn- DG (1997) The CLUSTAL_X windows interface: flexible chosporium secalis in Europe, Australia and the United States. strategies for multiple sequence alignment aided by quality Mycol Res 97:49–58 analysis tools. Nucleic Acids Res 25:4876–4882 Goodwin SB, Schneider RE, Fry WE (1995) Use of cellulose-ace- Turgeon BG (1998) Application of mating type gene technology to tate electrophoresis for rapid identification of allozyme geno- problems in fungal biology. Annu Rev Phytopathol 36:115–137 types of Phytophthora infestans. Plant Dis 79:1181–1185 Turgeon BG, Yoder OC (2000) Proposed nomenclature for mating Goodwin SB, Cavaletto JR, Waalwijk C, Kema GHJ (2001a) DNA type genes of filamentous Ascomycetes. Fungal Genet Biol 31: fingerprint probe from Mycosphaerella graminicola identifies an 1–5 active transposable element. Phytopathology 91:1181–1188 Waalwijk C, Mendes O, Verstappen ECP, de Waard MA, Kema Goodwin SB, Dunkle LD, Zismann VL (2001b) Phylogenetic GHJ (2002) Isolation and characterization of the mating-type analysis of Cercospora and Mycosphaerella based on the in- idiomorphs from the wheat septoria leaf blotch fungus My- ternal transcribed spacer region of ribosomal DNA. Phytopa- cosphaerella graminicola. Fungal Genet Biol 35:277–286 thology 91:648–658 Yun S-H, Berbee ML, Yoder OC, Turgeon BG (1999) Evolution of Green GJ, Dickson JG (1957) Pathological histology and varietal the fungal self-fertile reproductive life style from self-sterile reactions in septoria leaf blotch of barley. Phytopathology ancestors. Proc Natl Acad Sci USA 96:5592–5597 47:73–79 Yun S-H, Arie T, Kaneko I, Yoder OC, Turgeon BG (2000) Mo- Hawksworth DL, Kirk PM, Sutton BC, Pegler DN (1995) Ains- lecular organization of mating type loci in heterothallic, ho- worth and Bisby’s Dictionary of the fungi. CAB International, mothallic, and asexual Gibberella / Fusarium species. Fungal Wallingford, UK Genet Biol 31:7–20 Hebert PDN, Beaton MJ (1993) Methodologies for allozyme Zhan J, Mundt CC, McDonald BA (1998) Measuring immigration analysis using cellulose acetate electrophoresis. Helena Labo- and sexual reproduction in field populations of Mycosphaerella ratories, Beaumont, Tex. 32 pp graminicola. Phytopathology 88:1330–1337