Quantitative and Qualitative Estimation of Bacteria Contaminating Human Hairs

Journal of Bacteriology and Virology 2010. Vol. 40, No. 1 p.11 – 18 DOI 10.4167/jbv.2010.40.1.11 Original Article

* Aram Yun1, Eun Jin Yang1, Young Mi Lee1, Seon Sook Chae1, Ha Na Seo2 and Doo Hyun Park2

1Department of Beauty Arts, 2Department of Biological Engineering, Seokyeong University, Seoul, Korea

Human hairs have been known to be easily contaminated with microorganisms. This study was performed in order to measure what bacterial species and how much microorganisms contaminate human hairs in specific place. Virgin human hairs were left at 6 positions in inside corner and beside window in a laboratory for 7 days. The number of viable bacterial cells, which were determined by most probable number method, contaminating the human hairs was measured at a maximum of 106/g hair and a minimum of 103/g hair in inside corner and maximum of 106/g hair and a minimum of 103/g hair beside window. The bacterial cells-contaminating human hairs were observed via fluorescence light microscopy after 4',6-diamino-2-phenylindole (DAPI) staining. The bacterial community contaminating human hairs was analyzed via the thermal gradient gel electrophoresis (TGGE) technique, based on the diversity of the 16S-rDNA variable region. In total, approximately 20 bacterial species were detected from 12 groups of hair samples. In this study, general experimental methods-fluorescence staining, TGGE and MPN-were combined to develop new method for observation and estimation of bacteria contaminating human hairs. Key Words: Human hair, Bacterial community, Most Probable Number, DAPI-staining, TGGE

transfer, either minimally from one local region to another, INTRODUCTION or maximally from one country to another country; during such activities, a variety of microscopic particles containing Not all airborne microorganisms exert adverse effects on bacteria may migrate through these translocation routes. human health, but some of them may cause infectious Humans have been identified as the primary source of diseases (1, 2), allergic or irritant responses (3, 4), respiratory microbial contaminants within industrial clean rooms and problems (5, 6), or hypersensitivity reactions (7, 8). Airborne hospital operating rooms (11, 12). The majority of airborne microorganisms have been identified and enumerated via a contaminants containing bacteria has been associated with broad variety of aerobiological sampling methods (9, 10). the hair, skin, and respiratory tracts of humans (13). Certain air sampling techniques may prove effective in the Microbial contaminants evaluated in hospital operating detection and identification of airborne microorganisms in rooms have been associated largely with humans, rather a specific location, but may be not appropriate for the than dust and soil particles (14, 15). Human hairs may characterization of their relevant mediators and transfer function as an air-collecting agent for micro-contaminants, routes. General human activities involve movement and because the hairs are constantly exposed to air and can readily adsorb a variety of airborne particles via electrostatic

Received: December 23, 2009/ Revised: January 5, 2010 attraction, grooved surfaces, thin and long structures, and Accepted: January 11, 2010 *Corresponding author: Doo Hyun Park. Department of Biological biochemical affinity (16). The cultivation technique for the Engineering, Seokyeong University, Seoul 136-704, Korea. identification of airborne microorganisms is limited to Phone: +82-2-940-7190, Fax: +82-2-919-0345 e-mail: [email protected] cultivable microorganisms on a specific culture medium,

12 A Y, et al.

A B

Figure 1. Fixation of hair bundle in an opened square box, by which human hairs can be naturally moved and contact with air (A). Six of them were placed in inside corner and another six were placed beside window (B). according to research data showing that less than 20% of bacteria in the environment were cultivable (17, 18). MATERIALS AND METHODS The diameter of human hair ranges between 50 to 150 Viable cell count μm (circumference, 157 to 470 μm), and thus any bacterium could theoretically be attached to human hairs (19, 20). Virgin hairs (21) obtained from young woman (15 years Light microscopy is a very useful technique for the old) were cleaned, rinsed and dried according to general observation of microorganisms on slide glasses-however, it hair cleaning habit. One end of 15 cm-long hair bundles is not possible to observe bacteria contaminating hair (about 200 pieces) was fixed in an opened square box (200 surfaces, because the human hair is too thick for light to × 150 × 100 mm) as shown in Figure 1A, by which pass through it from the lamp to the objective glass. other part of hairs was freely moved by air flow. The fixed In this study, we have quantitatively estimated and hair bundles were put at 6 positions in inside corners or taxonomically analyzed bacterial cells contaminating human beside windows in our laboratory as is shown in Figure 1B, hair via the most probable number (MPN) method and which is located on the 4th floor of the Department of thermal gradient gel electrophoresis (TTGE) technique, Biological Engineering building for 7 days, from July 29th respectively, and have applied the 4',6-diamino-2- to August 5th of 2009. Four of outside windows (width 3 m phenylindole (DAPI) staining method to hair in an effort to × height 1.5 m) and 6 of corridor windows (width 2 m × observe microorganisms contaminating human hair. This height 0.6 m) were installed on each side of 15 m of window research may not prove to be meaningful for environ- wall; however, no window was installed on 9 m of side mental or clinical evaluations of bacterial contamination; wall. Distance from bottom to outside window and corridor however, our results may prove to be useful in estimates of window was 1.1 m and 2.2 m, respectively, as shown in the amount and species of micro-contaminants that are Figure 1B. Eleven students were doing experiments about transferred and transmitted via human hairs. microbiology, biochemistry and molecular biology from 9 am to 6 pm. Outside windows were closed during daytime from 7 am to 8 pm under air-conditioning and opened after

Estimation of Bacteria Contaminating Hairs 13 work during night-time from 8 pm to 7 am; however, (Zeiss, Axioskop 50, München, German). corridor windows were constantly closed and outside Fluorescent staining of bacteria contaminated hair windows were closed conditionally during even night-time surfaces in rainy day. Hair bundles were disposed on laboratory tables (height 0.8 m) that were located in front of the DAPI solution (0.5 μg/mL) was dropped on the hairs for outside windows. Distance from window to hair bundle 60 min at room temperature. The fluorescence-stained hairs was adjusted to 0.6 m and interval between hair bundles were rinsed with autoclaved double-distilled water and was controlled to be 2 m. Other 6 hair bundles were located dried in a drying oven for 10 min at 60℃, and immersion on the bottom under corridor windows. Distance from wall oil was dropped onto the dried hairs and covered with a to hair bundle was adjusted to 0.2 m and interval between cover glass. The oil immersion objective of the fluorescence hair bundles was controlled to be 1.5 m. microscope (Zeiss, Axioskop 50) was used under UV light Some of the hairs were sampled for microscopic (23). observation right after placed in specific positions for the Thermal gradient gel electrophoresis (TGGE) control test. The laboratory temperature was maintained naturally from 25℃ to 30℃, but moisture was uncontrolled. Ten grams of human hairs, which were placed into contact The hairs (0.1 g) cut from the hair bundles were put into with airborne microorganisms for 7 days, were suspended test tubes containing 9 ml of a complex medium after in 100 ml of filtered distilled water with pre-sterilized slicing with autoclaved scissors under aseptic conditions. membrane filters (pore size 0.22 μm, Millipore, Billerica, The hair-suspended medium was serially diluted with the MA, USA) under aseptic conditions, and subsequently identical medium via 10-fold dilution. The complex medium, shaken at 200 rpm for 3 h at room temperature. The which was optionally prepared based on the nutritional hair-suspended water was filtered with a pre-sterilized conditions required for aerobic bacterial growth, was membrane filter and the membrane filter was utilized for composed of 1 g/L of glucose, 2 g/L of lactate, 3 g/L of DNA extraction. Total DNA was extracted from the bacterial acetate, 1 g/L of yeast extract, 1 g/L of peptone, 25 mM of cells attached to the membrane filters using an AccuPrep phosphate buffer (pH 7.0) and 1 ml/L of trace mineral stock Genomic DNA Extraction Kit (Bioneer, Daejeon, Korea) solution. The trace mineral stock solution contained 0.01 according to the manufacturer's protocols. The 16S-rDNA g/L of MnSO4, 0.01 g/L of MgSO4, 0.01 g/L of CaCl2, amplified from chromosomal DNA was utilized as a

0.002 g/L of NiCl2, 0.002 g/L of CoCl2, 0.002 g/L of template for the preparation of the TGGE samples (16S-

SeSO4, 0.002 g/L of WSO4, 0.002 g/L of ZnSO4, 0.002 g/L rDNA variable region). A variable region of 16S-rDNA was of Al2(SO4)3, 0.0001 g/L of TiCl3, 0.002 g/L of MoSO4, amplified with the forward primer (eubacteria, V3 region) and 10 mM EDTA. 341f 5'-CCTACGGGAGGCAGCAG-3' and reverse primer The number of viable cells was estimated on the basis of (universal, V3 region) 518r 5'-ATTACCGCGGCTGCTGG- the MPN method according to standard protocols (22). 3'. GC clamp (5'-CGCCCGCCGCGCGCGGCGGGCGGG- GCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG Observation of microorganisms contaminating human -3') was attached to the 5'-end of the GC341f primer (24). hair The procedures for PCR and DNA sequencing were The human hairs, which were left in inside corner and identical to the 16S-rDNA amplification conditions except beside windows without any handling for 7 days, were for the annealing temperature of 53℃. The TGGE system fixed on a slide glass. Immersion oil was dropped on the (Bio-Rad, DcodeTM, Universal Mutation Detection System, dried hairs and covered with a cover glass. The oil Hercules, CA, USA) was operated as specified by the immersion objective was assessed under a bright field manufacturer. Aliquots (45 μl) of PCR products were

14 A Y, et al.

Table 1. Most probable number (MPN) of bacteria contaminated shown in Table 1. Viable cell number was significantly on hair surface. Hairs were left in inside corner or beside windows in a laboratory for 7 days variable according to the position. These results may be an indicator that human hair may be randomly contaminated Disposition Gropus MPN/g hair by air-floating bacteria in any place and the air-floating I 1.1 × 104 bacterial cells may have chance to more stably contact to II 8.5 × 105 hair in inside corner than beside window. III 4.5 × 104 Inside corner Observation of human hair by light microscopy IV 5.5 × 104 V 7.0 × 103 Human hair surface is difficult to be observed with a light VI 1.1 × 106 microscope under the bright field, as the optical density of I 3.0 × 105 hair structure is too high to transmit light. The contours of II 1.0 × 102 the sides of hairs can, however, be observed as shown in Figure 2A, 2B and 2C, in which fungal hyphae and conidia- III 1.3 × 105 Beside window contaminated hair surfaces could be visualized under bright IV 8.5 × 103 field (× 400). Some spots (arrow marks) on hair surfaces V 1.0 × 104 (Fig. 2D) were noted with the hair cuticle grooves. However, × 4 VI 1.1 10 these spots differed from morphology generated by microorganisms. Accordingly, bacterial cells contaminating hair electrophoresed in gels containing 8% acrylamide, 8 M surface cannot be visualized via bright-field light microscopy. urea, and 20% formamide with a 1.5 × TAE buffer system Observation of bacterial cells by fluorescence light at a constant voltage of 100 V for 12.5 h and then for 0.5 h microscopy at 40 V, with an applied thermal gradient of 39 to 52℃. Prior to electrophoresis, the gel was equilibrated to the In order to obtain clear images of the bacterial cell- temperature gradient for 30 to 45 min. contaminated hair, the hair was stained with a fluorescent dye (DAPI), which is selectively bound to DNA but also Amplification and identification of TGGE band bound to hair surface as shown in Figure 3. Hair cuticles DNA was extracted from the TGGE band and purified were distinctly observed and some microorganisms were using a DNA gel purification kit (Accuprep, Bioneer). The detected on the hair surface, even though the hairs were purified DNA was amplified with the same primers and sampled for control test at the time when the hair bundle procedures utilized for TGGE sample preparation, in which was placed in 12 positions. The microscopic image of the GC clamp was not attached to the forward primer. The cleaned hairs was significantly different from that of the species-specific identity of the amplified variable 16S-rDNA contaminated hairs for 7 days. As shown in Figure 4A, clear was determined on the basis of the sequence homology images displaying bacterial cell-contaminated hair cuticles reported in the GenBank database system. were obtained. The bigger fluorescent spots (marked with arrows) than the bacteria spots were thought to be developed RESULTS by fungal cells contaminating hair as shown in Figure 4B. Some fluorescent clots were noted in the hair cuticle grooves MPN of viable bacteria contaminating hairs as shown in Figure 4C. The clots may be developed by the Number of bacterial cells contaminating human hairs mixture of various microorganisms grown in the cuticle determined by MPN was 103 to 106 in hair samples in grooves, which constitute compelling evidence that the inside corner and 102 to 105 in them beside window as grooves between hair cuticles may be an appropriate habitat

Estimation of Bacteria Contaminating Hairs 15

Figure 3. Microscopic image of hair, which was not contaminated with microorganisms.

Figure 2. Hair contaminated with various fungal hyphae and conidia (A, B and C), as observed under bright-field light microscopy (× 400). Bacterial cells at grooves on the hair surfaces were not noted, but round spots were seen on the hair cuticles (D); however, these stains cannot be conclusively identified as fungal B cells. for microorganisms and a good place for the collection of organic compounds.

Diversity of bacterial species contaminating hair surface C

The variable region of 16S-rDNA, which was amplified Figure 4. Microscopic image of human hair surface contaminated with microorganisms. Bacterial cells (A), fungal (yeast) cells (B, with DNA extracted from bacterial cell-contaminated hair arrow marks) and communities of microorganisms (C) made surfaces, was separated via TGGE as shown in Figure 5. The fluorescent by DAPI staining. DNAs extracted from the TGGE band were more than 90% homologous with a variety of bacterial species that were Stenotrophomonas sp. (FJ897489) isolated from industrial more than 20 species. Janthinobacterium sp. (FJ605429) estate, Erwinia sp. (FJ816023) related to antibacterial was recorded to be isolated from spider mite, Bacillus sp. immunity of Anopheles gambiae lysozyme, Bacillus sp. (FJ941090) was recorded to be an endophytic bacterium, (AM292066) isolated from soil, Oxalobacter sp. (AV-

16 A Y, et al.

database. These results demonstrate that various bacterial species can be floated freely through air flow and attached to hair without making direct contact with the carrier or vectors.

DISCUSSION

Human hair can be readily contaminated by a variety of chemical compounds, which is useful for the hair- monitoring of organic pollutants in the atmospheric environment (25~28); however, research data and techniques for the hair-biomonitoring of microorganisms have yet to be developed. Fish scale-like hair cuticles may develop into variously sized gaps, which represent excellent sites for microorganismic contamination. However, what quantities of microorganisms and how many species of microorganisms contaminating human hair are issues that have yet to be Figure 5. TGGE patterns for bacterial communities contaminating thoroughly elucidated. the surfaces of human hairs left in inside corners (lane 1 to 6) and beside windows (lane 7 to 12) for 7 days. Sequencing of amplicons In this study, we first developed the DAPI staining generated from DNAs extracted from the numbered bands showed technique in order to observe the surfaces of hair contami- more than 90% identity with the followings: 1. Uncultured bacterium (GQ111303); 2. Janthinobacterium sp. (FJ605429); 3. nated with bacteria under light microscopy. The bacterial Bacillus sp. (FJ941090); 4, 25. Stenotrophomonas sp. (FJ897489); cells stained with DAPI are discriminated from the hair, as 5, 27. Erwinia sp. (FJ816023); 6. Bacillus sp. (AM292066); 7. Oxalobacter sp. (AV367035); 8, 26. Naxibacter sp. (FJ621304); DAPI binds selectively to DNA. The DAPI staining 9, 22. Deinococcus sp. (DQ223543); 10. Pseudomonas sp. (AB- technique has proven useful for the detection and obser- 461633); 11. Uncultured soil bacterium FACE.R5 (FJ621196); 12. Uncultured Stenotrophomonas sp. (FN428834); 13. Bacillus sp. vation of bacterial cell-contaminated hairs; however, this is (FJ981907); 14. Uncultured soil bacterium Kei21 (FJ184368); 15. limited to structural display (29). The TGGE technique uncultured Comamonas sp. (AM711890); 16. Uncultured bacterium clone (GQ101918); 17, 30. Pantoea ananat (AF491932); 18. may be an excellent method for the estimation of diversity Pantoea eucalypti (GQ169378); 19. Uncultured bacterium sp. of bacterial cells contaminating hairs. A variety of airborne (GQ114033); 20, 29. Endophytic bacterium C01 (FJ205678); 21. Uncultured bacterium sp. (FQ111303); 23. Uncultured bacterium microorganisms can be readily attached to or detached (EU438875); 24. Uncultured Actinobacterium sp. (EU810962). from human hair by transfer or the normal activities of community living. Pathogenic contagion or infection may 367035) related to house mouse, Naxibacter sp. (FJ621304) be mediated by the attachment of airborne microorganisms isolated from rhizosphere, Deinococcus sp. (DQ223543) to hairs, or their detachment from hairs. Any species of related to radiation resistant bacteria, Pseudomonas sp. bacteria can be attached to hair based on the diversity of (AB461633) related to nodulation-dependent communities, bacterial communities separated from human hairs and Bacillus sp. (FJ981907) related to marine environment, analyzed via the TGGE technique. Anyone residing in a Comamonas sp. (AM711890) was recorded to grow in locality contaminated with a specific pathogen makes it very wetland, Pantoea ananat (AF491932) was recorded to be a possible that pathogenic microorganisms will be transferred soil bacterium, Pantoea eucalypti (GQ169378) related to to another localities via the bacterial contamination of hair. soil environmental organism and Actinobacterium sp. Humans basically use two types of mobile polymers: (EU810962) was recorded to grow in cave in the GenBank clothes and hairs. Clothes can be readily and frequently

Estimation of Bacteria Contaminating Hairs 17 cleaned with detergents containing disinfectants or hot water, 7) Flaherty DK, Deck FH, Cooper J, Bishop K, by which the bacterial cells attached to cloth fibers can be Winzenburger PA, Smith LR, et al. Bacterial endotoxin sterilized effectively; however, human hair cannot be isolated from a water spray humidification system as a cleaned with disinfectants. Some bacterial cells may be not putative agent of occupationrelated lung disease. Infect cleaned completely using hair soap or shampoo by general Immun 1984;43:206-12. 8) Samson RA. Occurrence of moulds in modern living cleaning habit (Fig. 3). and working environments. Eur J Epidemiol 1985;1:54 In conclusion, we have developed, and presented herein, -61. a new technique by which microorganism-contaminated 9) Reynolds SJ, Striefel AJ, McJilton CE. Elevated airborne human hairs can be observed via light microscopy. Our concentrations of fungi in residential and office results represent that microorganisms contaminate human environments. Am Ind Hyg Assoc J 1990;51:601-4. hair may be observed and estimated effectively by 10) Thorne PS, Kiekhaefer MS, Whitten P, Donham KJ. combination of most probable number method, fluorescent Comparison of bioaerosol sampling methods in barns staining and TGGE technique but do not represent any new housing swine. Appl Environ Microbiol 1992;58:2543 discovery regarding the bacterial contamination of hair. We -51. found no evidence to suggest that bacterial cells attached to 11) Greene VW, Vesley D, Bond RG, Michaelsen GS. human hair mediate the transfer of epidemic disease by Microbiological contamination of hospital air. I. contagion; however, surgeons generally cover their hair in Quantitative studies. Appl Environ Microbiol 1962;10: surgical operating rooms for precisely this reason. Currently, 561-6. we are analyzing and comparing the bacterially-contaminated 12) Favoero MS, Puleo JR, Marshall JH, Oxborrow GS. Comparative levels and types of microbial contamination hairs of individuals working in hospitals, subways, and detected in industrial clean rooms. Appl Microbiol agricultural areas. 1966;14:539-51.

13) Favoero MS, Puleo JR, Marshall JH, Oxborrow GS. REFERENCES Comparison of microbial contamination levels among hospital operating room and industrial clean rooms. 1) Bollin GE, Plouffe JF, Para MF, Hackman B. Aerosols Appl Microbiol 1968;16:480-6. containing Legionella pneumophila generated by shower 14) Greene VW, Vesley D, Bond RG, Michaelsen GS. heads and hot-water faucets. Appl Environ Microbiol Microbiological contamination of hospital air. II. 1985;50:1128-31. Qualitative studies. Appl Environ Microbiol 1962;10: 2) Sttar SA, Ijaz MK, Gerba CP. Spread of viral infection 567-71. by aerosols. Crit Rev Environ Sci Tech 1987;17:89-131. 15) Hall LB. Air sampling for hospitals. Hospital Topics 3) Bernstein IL, Safferman R. Clinical sensitivity to green Magazine 1962;40:97-100. algae demonstrated by nasal challenge and in vitro tests 16) Sperling LC. Hair anatomy for the clinician. J Am Acad of immediate hypersensitivity. J Allergy Clin Immunol Dermatol 1991;25:1-17. 1973;51:22-8. 17) Ward DM, Weller R, Bateson MM. 16S rRNA 4) Croft WA, Jarvis BB, Yatawara CS. Airborne outbreak sequences reveal numerous uncultured microorganisms of trichothecene toxicosis. Atmos Environ 1986;20:549 in a natural community. Nature 1990;345:63-5. -52. 18) Spratt DA, Weightman AJ, Wade WG. Diversity of oral 5) Castellan RM, Olenchock SA, Kinsley KB, Hankinson asaccharolytic Eubacterium species in periodontitis- JL. Inhaled endotoxin and decreased spirometric values. identification of novel phylotypes representing N Engl J Med 1987;317:605-10. uncultivated taxa. Oral Microbiol Immunol 1999;14: 6) Jacobs RR. Airborne endotoxins: an association with 56-9. occupational lung disease. Appl Ind Hyg 1989;4:50-6. 19) Headington JT. Transverse microscopic anatomy of the

18 A Y, et al.

human scalp. A basis for a morphometric approach to Sci Technol 2008;57:1191-7. disorders of the hair follicle. Arch Dermatol 1984;120: 25) Bencko V. Use of human hair as a biomarker in the 449-56. assessment of exposure to pollutants in occupational 20) Kim SH. A study on characteristics and amino acid and environmental settings. Toxicology 1995;101:29- composition of female hair according to age period. J 39. Kor Soc Cosm 2007;13:1111-1120. 26) Nakao T, Aozasa O, Ohta S, Miyata H. Assessment of 21) de Lacharriere O, Deloche C, Misciali C, Piraccini BM, human exposure to PCDDs, PCDFs and Co-PCBs Vincenzi C, Bastien P, et al. Hair diameter diversity: a using hair as a human pollution indicator sample I, clinical sign reflecting the follicle miniaturization. Arch development of analytical method for human hair and Dermatol 2001;137:641-6. evaluation for exposure assessment. Chemosphere 2002; 22) Greenberg, AE, Clesceri LS, Eaton AD, Franson MAH. 48:885-96. Standard methods for the examination of water and 27) Zhang H, Chai Z, Sun H. Human hair as a potential wastewater. 18th ed. Washington DC; American Public biomonitor for assessing persistent organic pollutants. Health Association; 1992. pp.9-49~9-50. Environ Int 2007;33:685-93. 23) Saby S, Sibille I, Mathieu L, Paquin JL, Block JC. 28) Schramm, KW. Hair-biomonitoring of organic pollutants. Influence of water chlorination on the counting of Chemosphere 2008;72:1103-11. bacteria with DAPI (4',6-diamindino-2-phenylindole). 29) Komaru A, Uchimura Y, Leyama H, Wada KT. Detection Appl Environ Microbiol 1997;63:1564-9. of induced triploid scallop, Chlamys nobilis, by DNA 24) Lee SJ, Lee YW, Chung J, Lee JK, Lee JY, Jahng D, et microfluorometry with DAPI staining. Aquaculture al. Reuse of low concentrated electronic wastewater 1988;69:201-9. using selected microbe immobilised cell system. Water