Yeast Genome-Wide Screen Reveals Dissimilar Sets of Host Genes Affecting Replication of RNA Viruses

Yeast genome-wide screen reveals dissimilar sets of host genes affecting replication of RNA viruses

Tadas Panavas, Elena Serviene, Jeremy Brasher, and Peter D. Nagy*

Department of Plant Pathology, University of Kentucky, Lexington, KY 40546

Communicated by George Bruening, University of California, Davis, CA, March 30, 2005 (received for review October 15, 2004) Viruses are devastating pathogens of humans, animals, and plants. acid, protein, and lipid metabolism, protein targeting͞transport, To further our understanding of how viruses use the resources of and general and stress metabolism or have unknown functions. Our infected cells, we systematically tested the yeast single-gene- results show that the replication of positive-strand RNA viruses of knockout library for the effect of each host gene on the replication different supergroups is influenced by distinct groups of genes and of tomato bushy stunt virus (TBSV), a positive-strand RNA virus of that TBSV replication is associated with sets of genes that also have plants. The genome-wide screen identified 96 host genes whose been associated with certain human disease states. absence either reduced or increased the accumulation of the TBSV replicon. The identified genes are involved in the metabolism of Materials and Methods nucleic acids, lipids, proteins, and other compounds and in protein Yeast Strains and Expression Plasmids. Yeast strain 4741 and the targeting͞transport. Comparison with published genome-wide YKO deletion series (10) were obtained from Open Biosystems screens reveals that the replication of TBSV and brome mosaic virus (Huntsville, AL). Yeast transformation was modified from the (BMV), which belongs to a different supergroup among plus-strand standard lithium acetate (LiOAc)͞polyethylene glycol (PEG) pro- RNA viruses, is affected by vastly different yeast genes. Moreover, tocol (16) to facilitate a 96-well plate format. Briefly, yeast strains a set of yeast genes involved in vacuolar targeting of proteins and were grown overnight in yeast extract͞peptone͞dextrose medium vesicle-mediated transport both affected replication of the TBSV supplemented with 200 mg͞liter geneticin G418. Cultures were replicon and enhanced the cytotoxicity of the Parkinson’s disease- then diluted to Ϸ0.3 OD600 in fresh medium (0.25 ml per well) and related ␣-synuclein when this protein was expressed in yeast. In cultured for an additional4hat30°C.Thecellswere pelleted, addition, a set of host genes involved in ubiquitin-dependent washed with sterile water, and resuspended in 0.1 M LiOAc. This protein catabolism affected both TBSV replication and the cyto- procedure was followed by repelleting and resuspending the cells in toxicity of a mutant huntingtin protein, a candidate agent in 100 ␮l of transformation mixture (34% PEG 3350, 0.1 M LiOAc, Huntington’s disease. This finding suggests that virus infection and 0.5 mg͞ml single-stranded salmon sperm DNA, and 10 mg͞ml each disease-causing proteins might use or alter similar host pathways of three plasmids) (Fig. 1). This mixture was incubated for 30 min and may suggest connections between chronic diseases and prior at 30°C and then for 40 min at 42°C. The yeast cells were then virus infection. pelleted and plated on minimal medium supplemented with G418. Each strain in the YKO library was cotransformed with plasmids host factors ͉ plus-stranded RNA virus ͉ tomato bushy stunt tombusvirus ͉ pGBK-His 33 and pGAD-His 92, which express p33 and p92 virus replication ͉ yeast-knockout strains replicase proteins separately from the constitutive ADH1 promoter (15), and pYC͞defective interfering (DI)-72, which expresses the he success of viruses as pathogens of humans, animals, and TBSV-derived DI-72 RNA replicon from an inducible GAL1 Tplants depends on the viruses’ ability to reprogram the promoter (13). host-cell metabolism to support the infection. The virus–host interaction is more complex than the term ‘‘reprogramming’’ RNA Analysis. Transformed yeast strains were incubated in 96-well suggests because host cells have antiviral defense mechanisms. deep-well plates containing 0.5 ml per well minimal synthetic Identifying host genes that can affect virus replication and the complete medium lacking uracil, leucine, and histidine and sup- infection process is central to understanding the complex role of plemented with 200 mg͞liter geneticin G418 (SC-ULH) containing the host in viral infections. The largest group of viruses, the galactose (2%) for 48 h at 23°C or for 40 h at 30°C, with shaking at positive-strand RNA viruses, which include the severe acute 525 rpm. After the cells were pelleted, the RNA was extracted by respiratory syndrome (SARS) coronavirus and hepatitis C and using a modified hot-phenol method (17). Briefly, 200 ␮l of sodium West Nile viruses, has virion RNAs that are directly translated acetate (NaOAc)-EDTAϩSDS buffer (50 mM NaOAc, pH 5.3͞10 in the infected cell. Synthesized viral proteins and recruited host mM EDTA͞1% SDS) and 200 ␮l of water-equilibrated phenol were proteins mediate processes that lead to efficient multiplication of added to each well, briefly vortexed, and incubated at 65°C for 4 the viral RNA (1, 2). RNA viruses are important not only as min, followed by incubation in ice-cold water. After centrifugation, infectious agents but also as tools in biotechnology and gene the total RNA samples (water phase) were transferred to a new therapy for expressing selected proteins in cells (3–5). plate and precipitated by using NaOAc and ethanol. Total RNA Yeast is a model eukaryotic cell that has been used extensively samples were visualized on 1.5% agarose gels. For the Northern to study the roles of individual genes in cellular processes based on blot analysis, the total RNA samples were diluted 100 times (except genome-wide screens (6–9). Many screens have been based on the for the detection of DI-72 transcripts, for which undiluted samples yeast single-gene-knockout (YKO) library, because the role of each were used) before electrophoresis, followed by transfer of RNA to nonessential yeast gene can be tested for selected functions (10). We membranes (18). RNA hybridization was done with a mixture of and others have developed systems for inducing yeast cells to two probes to detect DI-72(ϩ) RNA and 18S yeast ribosomal RNA. support the replication of certain positive-strand RNA viruses or The probes were tested for crosshybridization but none was de- their surrogates (11–14). Here, we apply our previously developed system for robust replication of a small RNA replicon of the tomato bushy stunt virus (TBSV) in yeast (13, 15) to screen the entire YKO Abbreviations: BMV, brome mosaic virus; DI, defective interfering; TBSV, tomato bushy library for genes influencing the efficiency of viral replication. A stunt virus; YKO, yeast knockout. total of 96 YKO strains were identified. The identified host genes *To whom correspondence should be addressed. E-mail: [email protected]. are either involved in many cellular processes, including nucleic © 2005 by The National Academy of Sciences of the USA

7326–7331 ͉ PNAS ͉ May 17, 2005 ͉ vol. 102 ͉ no. 20 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0502604102 Downloaded by guest on September 30, 2021 transacting p33 and p92 proteins, which are part of the tombusvirus replicase (13, 15). The DI-72 RNA replicon, which is derived naturally from TBSV infections of plants, does not encode proteins, and high levels of DI-72 RNA were achieved without artificial selection pressure to maintain this RNA in yeast cells. Yeast-based replication of DI-72 RNA replicon mimics its replication in plant cells (13, 15).

Identification of 96 Yeast Genes Affecting Accumulation of TBSV Replicon. We found that, of the 4,848 strains present in the YKO library (which covers Ϸ80% of all of the predicted yeast genes), we were unable to transform 71 strains, and an additional 229 strains did not grow on galactose-containing media. The remaining 4,548 YKO strains were tested individually (four samples per strain) for their ability to support DI-72 RNA replication by measuring the accumulation level of DI-72 RNA in total yeast RNA extracts, as described in Materials and Methods. Measurements of DI-72 RNA replication products in samples should give easily interpretable data Fig. 1. A schematic presentation of expression of tombusvirus replicase on replication when compared with more complex virus-based genes and an RNA replicon (DI-72 RNA) in the YKO library. p33 and p92 reporter-protein assays, which depend not only on replication but replicase proteins are expressed constitutively from separate plasmids by on translation of the reporter gene (20). We found that 90 YKO using the ADH1 promoter (PADH1), whereas the precursor for DI-72 RNA is strains (Ͻ2% of total genes) supported the accumulation of DI-72 under the control of inducible GAL1 promoter (PGAL1). 6ϫ His, 6ϫ His-tag at RNA replicon at Ͻ50% of the level observed in the parental yeast the amino terminus of p33 and p92. The self-cleaving tobacco ringspot virus strain (Table 1 and Fig. 2). On the contrary, six YKO strains (0.1% satellite ribozyme (Rz sat) produces an authentic 3Јend in DI-72 RNA after the of total genes) supported the accumulation of DI-72 RNA replicon ͞ transcription of DI-72 precursor from pYC DI-72 plasmid. at Ͼ150% of the parental yeast level (Fig. 3). The low number of yeast strains with an increased level of DI-72 RNA replication might tected (data not shown). The RNA probes were prepared by in vitro be due to the originally high level of DI-72 RNA accumulation in the parental strain, which could make further increase of replication transcription with T7 RNA polymerase from appropriate PCR difficult. Analysis of transcription levels of DI-72 RNA in the products (18). The DI-72 probe was made by using primers 15 identified YKO strains revealed the lack of direct correlation (GTAATACGACTCACTATAGGGCATGTCGCTTGTTT- between transcription and replication levels (see Fig. 5, which is GTTGG) and 20 (GGAAATTCTCCAGGATTTCTC) and DI-72 published as supporting information on the PNAS web site). For as a template (13). The 18S rRNA probe was amplified from the example, in SIN3 and RPL1B strains (Fig. 2, lane 2, and Fig. 3, lane yeast genome with primers 1251 (GGTGGAGTGATTTGTCT- 6), transcription of DI-72 RNA was Ϸ50%, but replication of DI-72 GCTT) and 1252 (TAATACGACTCACTATAGGTTTGTC- RNA was Ϸ5% and 200%, respectively, when compared with the CAAATTCTCCGCTCT). The template for the probe to detect ͞ parental strain. Thus, it seems that the initial transcription of DI-72 transcription of DI-72 transcript from pYC DI-72 was obtained by might have only a limited effect on the subsequent robust replica- PCR with primers 1289 (AAGTATCAACAAAAAATTGTTA- tion process. The amounts of p92 and p33 replicase proteins also ATATACCT) and 1290 (TAATACGACTCACTATAGGAA- varied in the identified YKO strains, and we did not find close GCTTAATATTCCCTATAGT). correlation between the amounts of p33͞p92 and the level of DI-72 RNA replication (Fig. 2, and see Fig. 6, which is published as Protein Analysis. For protein analysis, yeast strains were grown as for ␮ supporting information on the PNAS web site). We should point RNA extraction. Pelleted cells were resuspended in 200 lof0.1M out, however, that almost half (43 of 96) of the YKO strains NaOH and incubated at 23°C for 10 min. NaOH was aspirated after identified showed reduced amounts (Յ50%) of p33 and͞or p92 ͞ a short centrifugation, and the samples were resuspended in SDS proteins (Table 1). Based on this observation, we predict that Ϸ45% PAGE buffer and boiled for 5 min. The supernatant was used for of the identified host genes, which reduced DI-72 RNA accumu- ͞ SDS PAGE and Western blot analysis as described in refs. 13 and lation, might affect virus replication by reducing accumulation ϫ 15. The primary antibodies were anti-6 His (Invitrogen), and the levels of the replicase proteins in cells. The identified genes, based secondary antibodies were alkaline-phosphatase-conjugated anti- on their known cellular functions, were placed into 12 groups (Table mouse IgG (Sigma) (15). 1), albeit several genes might have multiple direct and indirect functions in both TBSV replication and cellular processes. MICROBIOLOGY Results and Discussion Tests of Single Yeast Genes for Effects on Accumulation of a TBSV Functional Grouping of the Identified Host Genes. The first group of Replicon. Each strain in the YKO library was transformed with host genes that affected DI-72 RNA replication includes five genes three plasmids simultaneously to induce replication of a TBSV involved in protein biosynthesis either by being part of the ribosome replicon (termed DI-72 RNA). As shown in Fig. 1, two of the (MRPL32, RPL1B, RPL7A, and RPS21B) or by acting as a trans- plasmids expressed the essential tombusvirus replicase proteins, lation-elongation factor (TEF4)(Saccharomyces Genome Data- p33 and p92, constitutively from ADH1 promoters, whereas the base, www.yeastgenome.org). Interestingly, DI-72 RNA accumula- third plasmid directed transcription of DI-72 RNA replicon from tion increased in the absence of three ribosomal proteins, suggesting the GAL1 promoter. After induction with galactose, the transcribed that these proteins might bind to a host protein that is also needed DI-72 RNA was cleaved by a cis-ribozyme to generate an authentic for DI-72 RNA replication, resulting in competition between 3Ј terminus in DI-72 RNA in yeast cells (Fig. 1). We found that the regular cellular processes and viral replication. These genes do not autonomously replicating DI-72 RNA accumulated to ribosomal seem to inhibit p33͞p92 translation, because the amounts of RNA levels in yeast cells, comparable with the virus replication p33͞p92 did not increase in the absence of these ribosomal proteins level in plant cells (15, 19). We also confirmed that, similar to plant (Figs. 2 and 3). An interesting gene in this group is TEF4, which infections, replication of DI-72 RNA replicon in yeast depends on codes for translation-elongation factor EF-1␥, which binds to the L cis-acting regulatory sequences in the RNA template and the replicase protein of vesicular stomatitis virus (21). In addition, the

Panavas et al. PNAS ͉ May 17, 2005 ͉ vol. 102 ͉ no. 20 ͉ 7327 Downloaded by guest on September 30, 2021 Table 1. Functional grouping of identiﬁed host genes affecting Table 1. (continued) TBSV DI-72 RNA replication Gene* Replication† p33‡ Transcription† Function Gene* Replication† p33‡ Transcription† Function

Group 1: Protein biosynthesis VPS4¶ 46 70 50 ATPase͞late endosome to MRPL32§¶ 162 100 111 Protein biosynthesis vacuole transport RPL1B§¶ 192 100 39 Protein biosynthesis VPS41 14 50 90 Rab guanyl-nucleotide RPL7A§¶ 192 120 97 Protein biosynthesis exchange factor RPS21B§¶ 33 50 70 Protein biosynthesis VOS9 30 30 130 Protein transporter͞ER to Golgi TEF4 15 100 68 Translation elongation factor transport Group 2: Protein metabolism, posttranslation modiﬁcation Group 6: Protein-vacuolar targeting ARO1࿣ 38 40 50 Aromatic amino acid synthesis DID2¶†‡ 30 50 144 Protein-vacuolar targeting BRE1§ 20 30 20 Ubiquitin-protein ligase MON1¶†‡ 42 80 54 Protein-vacuolar targeting DOA4** 22 30 50 Protein deubiquitination STP22¶†‡ 33 30 22 Protein-vacuolar targeting LGE1** 30 80 48 Protein monoubiquitination VPS28࿣‡‡ 20 70 10 Protein-vacuolar targeting MAK3 17 50 10 Protein amino acid acetylation VPS51¶‡‡ 24 70 59 Protein-vacuolar targeting MET1§ 33 100 95 Uroporphyrin-methyltransferase VPS61¶‡‡ 31 100 58 Protein-vacuolar targeting RAD6§ 23 70 22 Ubiquitin conjugating enzyme VPS69¶‡‡ 17 50 10 Protein-vacuolar targeting SIW14** 50 100 61 Protein tyrosine phosphatase Group 7: Membrane associated Group 3: RNA metabolism MSP1 33 30 105 ATPase͞mitochondrial BUD21 184 150 51 snoRNA binding translocation CCR4 45 100 46 3Ј-5Ј exoribonuclease OPT1 25 30 106 Oligopeptide transporter KEM1 40 80 65 5Ј-3Ј exoribonuclease SAC1 23 100 101 Inositol͞phosphatidylinositol NPL3 21 80 49 mRNA binding phosphatase MSR1 153 100 43 RNA binding rRNA processing SNF4 40 60 70 Protein kinase activator Group 4: Lipid metabolism STE14 48 50 147 Isoprenylcysteine- ERG4 18 30 55 ␦24 (24-1) sterol reductase methyltransferase INO2¶ 29 100 70 Phospholipid biosynthesis STV1 16 50 90 Hydrogen-transporting ATPase MCT1 49 60 51 S-malonyltransferase͞fatty acid TOK1 15 40 80 Potassium channel metabolism Group 8: Stress-related POX1࿣ 29 30 55 Acyl-CoA oxidase͞fatty acid GRE3‡‡ 32 40 138 Aldehyde reductase beta-oxidation GTT1࿣ 29 60 106 Glutathione transferase TGL2 20 50 105 Triacylglycerol lipase͞lipid IRA2 24 50 70 Ras GTPase activator metabolism UGA2 24 30 88 Glutamate catabolism Group 5: Vesicle-mediated transport WHI3 29 40 90 Phosphatase activator ARL3࿣ 19 100 82 Small monomeric GTPase Group 9: General metabolism BRE5 17 70 90 Vesicle-mediated transport BEM4 15 100 22 Rho protein signal transduction GOS1 23 30 59 v-SNARE activity͞intra-Golgi COX12 25 100 41 Cytochrome-c oxidase transport DSE1 25 100 94 Cell-wall organization and MCH5 40 100 96 Transporter͞membrane biogenesis associated GLO2††¶ 28 100 91 Hydroxyacylglutathione PEP3 17 60 30 Transporter͞vacuolar hydrolase membrane associated GPH1 37 50 69 Glycogen phosphorylase RIC1 5 100 22 Guanyl-nucleotide exchange HAP3 12 40 123 Regulation of carbohydrate factor metabolism SNF7 16 100 59 Late endosome to vacuole MSB1 27 50 67 Establishment of cell polarity transport PHD1 33 100 75 Pseudohyphal growth TLG2 14 50 105 t-SNARE, v-SNARE͞nonselective RMD7 37 100 19 Cell-wall organization and vesicle fusion biogenesis VPS24࿣ 44 50 38 Late endosome to vacuole THI3 31 100 89 Carboxy-lyase͞thiamin transport biosynthesis VPS29 19 30 100 Retrograde (endosome to Golgi) YIL064W 20 50 93 S-adenosylmethionine- transport methyltransferase

bacterial homologue of EF-1 was shown to play a direct role in virus, in yeast (20), suggesting that similar host genes are involved replication of Q beta bacteriophage RNA (22, 23), suggesting in posttranslational modification of either the viral replicase pro- possible evolutionary conservation of replication strategies in these teins or shared host factors of BMV and TBSV. Two genes (ARO1 viruses. Several other RNA viruses are proposed to use EF-1␣ for and MET1) play a role in aromatic amino acid biosynthesis and replication (24–29), which might play a role comparable to that of methionine metabolism, respectively. Deletion of ARO1 and MET1 EF-1␥ for the above viruses. genes might affect virus replication indirectly through a 50–80% The second group includes eight genes involved in protein reduction of p33 replicase protein levels in these YKO strains when metabolism and posttranslational modification (Table 1). The lack compared with the parental strain (Table 1). of these genes decreased replication of DI-72 RNA in yeast. Four The third group contains five RNA-metabolism genes with genes (BRE1, DOA4, RAD6, and LGE1) are part of the ubiquiti- known RNA-binding (BUD21, NPL3, and NSR1) and͞or ribonu- nation pathway, whereas one gene (SIW14) codes for a protein clease activities (CCR4 and KEM1) (Table 1). Deletion of two of tyrosine phosphatase, and another (MAK3) is responsible for these genes increased the accumulation of DI-72 RNA, whereas N-terminal protein amino acid acetylation, suggesting that post- deletion of three decreased it. Based on their cellular functions, translational modification and͞or protein turnover is important for these genes might affect the transport͞turnover of DI-72 RNA tombusvirus replication. Interestingly, three of these genes (DOA4, and͞or host mRNAs, which code for host factors critical for DI-72 LGE1, and SIW14) also affected the replication of the distantly RNA replication. related brome mosaic virus (BMV), another plus-strand RNA The fourth group of genes are involved in lipid metabolism.

7328 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0502604102 Panavas et al. Downloaded by guest on September 30, 2021 Table 1. (continued)

Gene* Replication† p33‡ Transcription† Function

Group 10: RNA transcription CDC50** 42 30 50 Transcription regulator ROX3 9 100 10 RNA polymerase II transcription mediator SRB8 35 50 68 RNA polymerase II transcription mediator SWI3 24 100 40 General RNA polymerase II transcription factor TEA1†† 25 100 140 Transcription regulator UME6 39 100 41 Transcription regulator Group 11: DNA remodeling, metabolism ADA2§ 8 70 62 Chromatin modiﬁcation, histone acetylation DPB4 18 100 53 Epsilon DNA polymerase HEX3 26 30 44 DNA recombination HUR1 32 100 55 DNA replication NGG1§ 27 100 18 Chromatin modiﬁcation, histone acetylation Fig. 2. Comparison of viral RNA and replicase protein levels in selected YKO SAS3†† 27 80 158 Acetyltransferase͞chromatin strains with the parental yeast strain. (A) Ethidium-bromide-stained agarose silencing gel of total RNA obtained from selected YKO strains showing a reduced level SIN3§ 4 100 50 Histone deacetylase of DI-72 RNA accumulation. The ribosomal rRNA and DI-72 RNA bands are SLX8 22 80 71 DNA metabolism indicated with arrows. Each strain was transformed with three plasmids (see SLX9 151 100 107 DNA metabolism Fig. 1). (B and C) Northern blot analysis of total RNA extracts for DI-72 RNA (B) SNF6 16 30 70 Chromatin modeling͞SWI–SNF with the 3Ј end of DI-72 as a probe and for DI-72 RNA transcript (C) with a complex probe for the 5Ј plasmid-borne leader sequence, which is deleted in the Group 12: Function unknown replicating DI-72 RNA (13). (D and E) Western analysis of p33 and p92 replicase BSC2 49 50 90 Unknown proteins in total protein samples with anti-His-tag antibody. LDB7 25 50 10 Unknown YBR007C 26 100 106 Unknown YBR032W 32 50 36 Unknown which affects intracellular transport (31). All of these 13 host genes YCR099C 37 80 91 Unknown might be involved in transporting either the viral replicase proteins͞ YFL043C 31 50 87 Unknown RNA or important host factors to the site of replication or YGL140C 17 60 90 Unknown posttranslational modifications. The large number of genes in this YGR064W 16 30 10 Unknown group (Ͼ10% of the total genes affecting DI-72 RNA replication) YHR029C 31 50 122 Unknown ͞ YIL090W 24 50 100 Unknown suggests that protein RNA transport in the cytoplasm has signifi- YJL175W 13 30 69 Unknown cant influence on TBSV replication. YLR358C 39 100 24 Unknown The sixth group contains seven genes with known functions in the YNL321W 29 100 150 Unknown vacuolar targeting of proteins (Table 1). Deletion of these genes YPR050C 10 30 53 Unknown inhibited TBSV accumulation, a finding that is unexpected because

*A plant orthologue of the given gene (underlined) has been found by BLAST the viral replicase proteins are targeted to the peroxisome and not search. to the vacuoles in TBSV infections of plants (T.P. and P.D.N., †Relative level of DI-72 RNA (100% in parental strain). unpublished data). Four strains in this group (STP22, DID2, VPS51, ‡Relative p33 level. and VPS69) (Table 1 and Fig. 2, lanes 5 and 13) showed decreased §Similar in BMV. steady-state levels of p33 in cells, suggesting that these genes could ¶ Similar in ␣-synuclein. be involved in maintaining high levels of the replicase proteins. ࿣ ␣ Same in -synuclein. The seventh group consists of seven gene products broadly **Same in BMV. ††Same in huntingtin. defined as membrane-associated (Table 1). SNF4 is a protein ‡‡Similar in huntingtin. kinase activator involved in peroxisome biogenesis, which could be important for assembling the replicase complexes on peroxisomal

membranes. The other six genes code for integral membrane MICROBIOLOGY Deletion of each of the five genes in this group inhibited the proteins, which might indirectly influence DI-72 RNA replication. accumulation of DI-72 RNA (Table 1). It is possible that the lack The eighth group contains five genes involved in response to of these genes affected membrane composition used by TBSV for replication, i.e., peroxisomal membrane in both plants (30) and yeast (T.P. and P.D.N., unpublished data). These changes could inhibit the assembly͞functionality of the replicase complex. The fifth group includes 13 genes implicated in vesicle-mediated transport, the deletion of which reduced accumulation of DI-72 RNA (Table 1). These proteins are proposed to affect transport to endoplasmic reticulum (ARL3), Golgi (GOS1, RIC1, VSP29, and YOS9), or vacuole (SNF7, VSP24, and VPS4), or they act in membrane fusions (TLG2 and VSP41) or as transporters across membranes (MCH5, PEP3, and YOS9). Although BRE5 has been annotated as a protein with unknown function in the Saccharomyces Genome Database, BRE5 has been implicated in intracellular Fig. 3. Increased viral RNA replication in six YKO strains. Northern blot and transport because of the sensitivity of the bre5 strain to brefeldin A, Western analyses were performed as described in the legend to Fig. 2.

Panavas et al. PNAS ͉ May 17, 2005 ͉ vol. 102 ͉ no. 20 ͉ 7329 Downloaded by guest on September 30, 2021 stress. Whether the effect of these genes on DI-72 RNA accumulation is direct or indirect is unknown. Because the robust replication of DI-72 RNA might cause stress in yeast, stress-induced genes might be important to help the cells cope with virus replication. It is possible that the number of stress-induced genes involved in DI-72 RNA replication is underestimated in this work because of the redundant nature of these genes in yeast and most other eukaryotes. The ninth group includes 11 genes with variable functions in general metabolism (Table 1). Despite their diverse functions, deletion of these genes decreased DI-72 RNA accumulation. This group of genes affects glycogen metabolism (GPH1), thiamin biosynthesis (THI3), cytochrome c oxidase biogenesis (COX12), cell wall biogenesis (DSE1 and RMD7), cell polarity (MSB1), and hyphal growth (PHD1), all of which might have an indirect affect on tombusvirus replication. Two genes involved in carbohydrate Fig. 4. Comparison of relative abundance of yeast genes with known metabolism (GLO2 and HAP3) might affect DI-72 RNA replica- functions within selected functional categories known to enhance the cyto- tion indirectly by affecting yeast growth on medium containing toxicity of ␣-synuclein (35) or mutated huntingtin and affect tombusvirus galactose. Deletion of YIL064W, a methyltransferase, might reduce replication. We included those genes from the three genome-wide screens, the efficiency of the capping of mRNAs, which could affect the which matched or were known to have similar functions. The data for com- translation of p33͞p92 or a critical host factor(s). The BEM4 parison are taken from ref. 35 and Table 1. YKO, the relative abundance of signal-transduction gene is involved in actin cytoskeleton organi- genes with given functions among nonessential genes in the YKO collection. zation, which might affect protein͞RNA trafficking and DI-72 The standard error is shown. RNA replication. The 10th and 11th groups contain genes involved in transcription identified host genes might affect the accumulation of DI-72 RNA and DNA remodeling. The deletion of these genes, except SLX9, by altering (i) the amount of p33͞p92 and͞or a critical host factor(s) reduced DI-72 RNA accumulation (Table 1). In general, deletions by altering the efficiency of their translation, (ii) cellular transport͞ of these genes are expected to affect the amount of mRNAs, which, targeting of replication factors, (iii) posttranslational modifications in turn, should influence the levels of p33͞p92 and͞or a critical host of replication factors, (iv) viral RNA͞protein turnover, (v) mem- factor(s) in cells. Not surprisingly, the genome-wide screen for brane structures͞biogenesis, and (vi) antiviral responses. Accord- BMV replication also found four related genes (20) belonging to ingly, purification of tombusvirus replicase complexes, followed by this group, as indicated in Table 1. Because many of the host in vitro replicase assays (15), revealed that the replicase showed proteins in this group bind to nucleic acids and͞or modify the either reduced template activity (from arl3⌬, ric1⌬, and yos9⌬ functions of other proteins, we cannot exclude the possibility that strains) or alteration in the ratio between plus- versus minus-strand several of these genes might be directly involved in DI-72 RNA ⌬ ⌬ replication. The 12th group contains 14 genes and hypothetical synthesis (from ric1 and did2 strains) (S. Serva, X. Lu, and ORFs. All of these genes inhibited DI-72 RNA replication (Table P.D.N., unpublished work). However, other events could also be 1). The genes of unknown function represent only Ϸ15% of the affected. For example, in the absence of a specific yeast protein, the genes identified in this screen. vacuoles or important membrane-containing vesicles might be damaged by the viral replicase or host proteins. If peroxisome Factors Influencing the Number of Identified Host Genes. The sys- membranes (the sites of TBSV replication) are altered, TBSV tematic genome-wide screen of yeast genes revealed that Ϸ2% of replication may be reduced. The host genes might also affect other the genes represented in the YKO library affected tombusvirus general factors such as the availability of ribonucleotides and amino replication. However, it is possible that the number of genes acids. involved in TBSV DI-72 RNA replication is underestimated in this work because of the redundant nature of some genes in yeast. The Connections of TBSV-Affecting Yeast Genes to Other Phenomena. 96 host genes identified might have direct or indirect roles in TBSV and BMV, which are members of two distinct supergroups tombusvirus replication. For example, some host proteins could of positive-strand RNA viruses, were each affected in their accu- Ϸ directly interact with viral replicase proteins and͞or the viral RNA mulation in yeast by 100 host genes (20). However, we found that during replication. Other host proteins, although not interacting only four of the yeast genes were in both of these sets. Three of these directly with p33͞p92 or the viral RNA, could be part of protein genes are in the protein metabolism group (ubiquitin pathway) complexes, such as those involved in p33͞p92 translation, metab- (Table 1), and the fourth is a transcription regulator. If we consider olism, and intracellular transport, which could affect TBSV repli- host genes with similar functions, the number of similar and cation by altering functional complexes and, thus, changing their identical host genes identified by both the BMV and TBSV systems contribution to virus replication. Moreover, the nature of the is 14. These genes mainly belong to three groups: (i) protein defects, either replication- or RNA-degradation-related, is un- biosynthesis, (ii) protein metabolism, and (iii) transcription͞DNA known. Our approach likely minimized the number of host factors remodeling (Table 1). Host genes present in the first two groups affecting TBSV DI-72 RNA replication indirectly because (i)we indicate that the dependence of BMV and TBSV on the protein measured DI-72 RNA replication levels in yeast cells that consti- translation and modification machinery of the host is somewhat tutively expressed the replicase proteins, (ii) we did not use selection similar. On the contrary, none of the host genes that affected the markers in the viral RNA, and (iii) we normalized DI-72 RNA replication of the TBSV replicon and are involved in protein accumulation in each sample based on ribosomal RNA levels, targeting, membrane association, vesicle-mediated transport, or which reflect on the availability of general factors for cell growth. lipid metabolism were found in the BMV set (20), suggesting YKO cells sickened by particular gene deletions that contained important differences for BMV and TBSV, which replicate in small amount of ribosomal RNAs were not included in Table 1. different cellular compartments [peroxisome and perinuclear endoplasmic reticulum for TBSV and BMV (32), respectively]. Possible Functions of Yeast Genes in RNA Replication. Based on the The largest group (Ϸ20%) of host genes identified in the TBSV known functions of the identified host genes, we predict that system consists of those genes likely to be involved in intracellular

7330 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0502604102 Panavas et al. Downloaded by guest on September 30, 2021 transport͞targeting. Comparison of yeast genes, identified based on cated huntingtin forms protein aggregates and is a major compo- their sensitivity to brefeldin A with genes involved in tombusvirus nent of cytoplasmic and nuclear inclusion bodies found in Hun- replication, revealed six common genes, TLG2, MON1, ERG4, tington’s disease (35, 36). Ubiquitin-mediated protein catabolism BRE1, BRE5, and BRE3 (similar to CDC50), that represent 30% of and protein-vacuolar targeting might be part of a protein quality genes implicated for intracellular transport (31). control system to prevent aggregation of mutated forms of hun- We compared our TBSV results with published genome-wide tingtin (35). Therefore, it is possible that this efficient protein yeast screens for genes involved in vesicle-mediated transport and quality control system, which reduces the cytotoxicity of the mu- protein-vacuolar targeting, resulting in an intriguingly similar pair tated huntingtin, is also important during the replication of the of profiles (Fig. 4). ␣-Synuclein has been observed to be a major TBSV replicon in the parental yeast. A protein quality control ͞ component of inclusion bodies in the brains of Parkinson’s disease system might help in maintaining correctly folded p33 p92 repli- victims, where it assembles into fibrillar protein aggregates (33). case proteins or critical host factors, whereas in this set of deletion Because both replicase proteins and ␣-synuclein are membrane- strains, the protein quality control system is debilitated, leading to associated in cells, they might use common protein-trafficking cytotoxicity by the mutated huntingtin and reduced efficiency of pathways. In the absence of these host factors, the replicase proteins replication by the TBSV replicon. and ␣-synuclein may not be transported efficiently to their usual Our results advance the possibility of further characterization of locations, causing reduced viral replication and increased cytotox- the roles of host genes in tombusvirus replication and for testing the icity, respectively. An alternative explanation is that both relationships between pathways leading to virus replication and cytotoxicity of disease-causing proteins, possibly in the context of ␣-synuclein and the viral replicase proteins are sufficiently cytotoxic relationships between chronic diseases and prior virus infection as that factors such as GTT1 could protect the cell by facilitating suggested for the Japanese encephalitis (37), influenza A (38), export from cytoplasm to vacuoles (34). HIV-1, and simian immunodeficiency (39–41) viruses. Additional comparison with previously published genome-wide screens revealed that the deletion of host genes involved in ubiq- We thank Drs. Judit Pogany, Saulius Serva, and John Shaw for valuable uitin-mediated protein catabolism and protein-vacuolar targeting comments. This work was supported by the U.S. Department of Agri- affected the replication of TBSV replicon and was reported to clture National Research Initiative 2003-35319-13878 and the Kentucky enhance the cytotoxicity of mutant huntingtin (35) (Fig. 4). Trun- Tobacco Research and Development Center.

1. Ahlquist, P., Noueiry, A. O., Lee, W. M., Kushner, D. B. & Dye, B. T. (2003) 20. Kushner, D. B., Lindenbach, B. D., Grdzelishvili, V. Z., Noueiry, A. O., Paul, J. Virol. 77, 8181–8186. S. M. & Ahlquist, P. (2003) Proc. Natl. Acad. Sci. USA 100, 15764–15769. 2. Buck, K. W. (1996) Adv. Virus Res. 47, 159–251. 21. Das, T., Mathur, M., Gupta, A. K., Janssen, G. M. & Banerjee, A. K. (1998) 3. Gleba, Y., Marillonnet, S. & Klimyuk, V. (2004) Curr. Opin. Plant Biol. 7, Proc. Natl. Acad. Sci. USA 95, 1449–1454. 182–188. 22. Blumenthal, T. (1980) Proc. R. Soc. London Ser. B 210, 321–335. 4. Figlerowicz, M., Alejska, M. & Kurzynska-Kokorniak, A. (2003) Med. Res. Rev. 23. Brown, D. & Gold, L. (1996) Proc. Natl. Acad. Sci. USA 93, 11558–11562. 23, 488–518. 24. Cimarelli, A. & Luban, J. (1999) J. Virol. 73, 5388–5401. 5. Scholthof, K. B., Mirkov, T. E. & Scholthof, H. B. (2002) Genet. Eng. (N.Y.) 25. Blackwell, J. L. & Brinton, M. A. (1997) J. Virol. 71, 6433–6444. 24, 67–85. 26. Johnson, C. M., Perez, D. R., French, R., Merrick, W. C. & Donis, R. O. (2001) 6. Birrell, G. W., Giaever, G., Chu, A. M., Davis, R. W. & Brown, J. M. (2001) J. Gen. Virol. 82, 2935–2943. Proc. Natl. Acad. Sci. USA 98, 12608–12613. 27. De Nova-Ocampo, M., Villegas-Sepulveda, N. & del Angel, R. M. (2002) 7. Edmonds, D., Breitkreutz, B. J. & Harrington, L. (2004) Proc. Natl. Acad. Sci. Virology 295, 337–347. USA 101, 9515–9516. 28. Matsuda, D., Yoshinari, S. & Dreher, T. W. (2004) Virology 321, 47–56. 8. Marston, A. L., Tham, W. H., Shah, H. & Amon, A. (2004) Science 303, 29. Zeenko, V. V., Ryabova, L. A., Spirin, A. S., Rothnie, H. M., Hess, D., 1367–1370. Browning, K. S. & Hohn, T. (2002) J. Virol. 76, 5678–5691. 9. Page, N., Gerard-Vincent, M., Menard, P., Beaulieu, M., Azuma, M., Dijkgraaf, 30. Rubino, L. & Russo, M. (1998) Virology 252, 431–437. G. J., Li, H., Marcoux, J., Nguyen, T., Dowse, T., et al. (2003) Genetics 163, 31. Muren, E., Oyen, M., Barmark, G. & Ronne, H. (2001) Yeast 18, 163–172. 875–894. 32. Restrepo-Hartwig, M. A. & Ahlquist, P. (1996) J. Virol. 70, 8908–8916. 10. Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., 33. Conway, K. A., Lee, S. J., Rochet, J. C., Ding, T. T., Harper, J. D., Williamson, Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H., et al. (1999) R. E. & Lansbury, P. T., Jr. (2000) Ann. N.Y. Acad. Sci. 920, 42–45. Science 285, 901–906. 34. Choi, J. H., Lou, W. & Vancura, A. (1998) J. Biol. Chem. 273, 29915–29922. 11. Noueiry, A. O. & Ahlquist, P. (2003) Annu. Rev. Phytopathol. 41, 77–98. 35. Willingham, S., Outeiro, T. F., DeVit, M. J., Lindquist, S. L. & Muchowski, P. J. 12. Price, B. D., Roeder, M. & Ahlquist, P. (2000) J. Virol. 74, 11724–11733. (2003) Science 302, 1769–1772. 13. Panavas, T. & Nagy, P. D. (2003) Virology 314, 315–325. 36. Scherzinger, E., Lurz, R., Turmaine, M., Mangiarini, L., Hollenbach, B., 14. Pantaleo, V., Rubino, L. & Russo, M. (2003) J. Virol. 77, 2116–2123. Hasenbank, R., Bates, G. P., Davies, S. W., Lehrach, H. & Wanker, E. E. 15. Panaviene, Z., Panavas, T., Serva, S. & Nagy, P. D. (2004) J. Virol. 78, (1997) Cell 90, 549–558. 8254–8263. 37. Ogata, A., Tashiro, K., Nukuzuma, S., Nagashima, K. & Hall, W. W. (1997) 16. Gietz, R. D. & Woods, R. A. (2002) Methods Enzymol. 350, 87–96. J. Neurovirol. 3, 141–147. 17. Schmitt, M. E., Brown, T. A. & Trumpower, B. L. (1990) Nucleic Acids Res. 18, 38. Takahashi, M. & Yamada, T. (2001) Adv. Neurol. 86, 91–104. MICROBIOLOGY 3091–3092. 39. Jenuwein, M., Scheller, C., Neuen-Jacob, E., Sopper, S., Tatschner, T., ter 18. Pogany, J., Fabian, M. R., White, K. A. & Nagy, P. D. (2003) EMBO J. 22, Meulen, V., Riederer, P. & Koutsilieri, E. (2004) J. Neurovirol. 10, 163–170. 5602–5611. 40. Berger, J. R. & Arendt, G. (2000) J. Psychopharmacol. 14, 214–221. 19. White, K. A. & Nagy, P. D. (2004) Prog. Nucleic Acid Res. Mol. Biol. 78, 41. Mirsattari, S. M., Power, C. & Nath, A. (1998) Movement Disorders 13, 187–226. 684–689.

Panavas et al. PNAS ͉ May 17, 2005 ͉ vol. 102 ͉ no. 20 ͉ 7331 Downloaded by guest on September 30, 2021