The Androgen and Progesterone Receptors Regulate Distinct Gene Networks and Cellular Functions in Decidualizing Endometrium

Total Page:16

File Type:pdf, Size:1020Kb

Load more

View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by St George's Online Research Archive 0013-7227/08/$15.00/0 Endocrinology 149(9):4462–4474 Printed in U.S.A. Copyright © 2008 by The Endocrine Society doi: 10.1210/en.2008-0356 The Androgen and Progesterone Receptors Regulate Distinct Gene Networks and Cellular Functions in Decidualizing Endometrium Brianna Cloke, Kaisa Huhtinen, Luca Fusi, Takeshi Kajihara, Maria Yliheikkila¨, Ka-Kei Ho, Gijs Teklenburg, Stuart Lavery, Marius C. Jones, Geoffrey Trew, J. Julie Kim, Eric W.-F. Lam, Judith E. Cartwright, Matti Poutanen, and Jan J. Brosens Institute of Reproductive and Developmental Biology (B.C., L.F., T.K., S.L., M.C.J., G.T., J.J.B.), Imperial College London, Hammersmith Hospital, London W12 ONN, United Kingdom and Department of Physiology (K.H., M.Y., M.P.), Institute of Biomedicine, University of Turku, 20520 Turku, Finland; Department of Obstetrics and Gynecology (T.K.), Saitama Medical School, Moroyama, Saitama, Japan; Cancer Research UK Labs (K.-K.H., E.W.-F.L.), Department of Oncology, Imperial College London, London W12 ONN, United Kingdom; Department of Reproductive Medicine and Gynecology (G.T.), University Medical Center Utrecht, 3508 GA Utrecht, The Netherlands; Department of Obstetrics and Gynecology (J.J.K.), Division of Reproductive Biology Research, Northwestern University, Chicago, Illinois 60611; and Division of Basic Medical Sciences (J.E.C.), St. George’s, University of London, London SW17 0BZ, United Kingdom Progesterone is indispensable for differentiation of human formation and promoted motility and proliferation of de- endometrial stromal cells (HESCs) into decidual cells, a pro- cidualizing cells. In comparison, PR depletion perturbed cess that critically controls embryo implantation. We now the expression of many more genes, underscoring the im- show an important role for androgen receptor (AR) signal- portance of this nuclear receptor in diverse cellular func- ing in this differentiation process. Decreased posttransla- tions. However, several PR-dependent genes encode for sig- tional modification of the AR by small ubiquitin-like modifier naling intermediates, and knockdown of PR, but not AR, (SUMO)-1 in decidualizing cells accounted for increased compromised activation of WNT/␤-catenin, TGF␤/SMAD, responsiveness to androgen. By combining small interfer- and signal transducer and activator of transcription (STAT) ing RNA technology with genome-wide expression profil- pathways in decidualizing cells. Thus, the nonredundant ing, we found that AR and progesterone receptor (PR) reg- function of the AR in decidualizing HESCs, centered on ulate the expression of distinct decidual gene networks. cytoskeletal organization and cell cycle regulation, implies Ingenuity pathway analysis implicated a preponderance of an important role for androgens in modulating fetal-mater- AR-induced genes in cytoskeletal organization and cell mo- nal interactions. Moreover, we show that PR regulates tility, whereas analysis of AR-repressed genes suggested HESC differentiation, at least in part, by reprogramming involvement in cell cycle regulation. Functionally, AR de- growth factor and cytokine signal transduction. (Endocri- pletion prevented differentiation-dependent stress fiber nology 149: 4462–4474, 2008) ROGESTERONE IS A pleiotropic hormone that reg- transformation of endometrial stromal fibroblast into se- P ulates all aspects of female reproduction, from ovu- cretory, epithelioid-like decidual cells (2–4). In addition to lation and embryo implantation to parturition. The actions the morphological changes, decidualization bestows some of progesterone (P4) on reproductive target tissues are unique functional properties on human endometrial stro- mediated predominantly by its cognate nuclear receptors, mal cells (HESCs), including the ability to modulate local P4 receptor (PR)-A and PR-B, members of the superfamily immune cells, to resist environmental stress signals, and of ligand-dependent transcription factors. In the uterus, to modulate trophoblast invasion (2–4). Mice deficient in the postovulatory rise in P4 levels induces differentiation PR fail to mount a decidual response and are sterile (1). of the endometrial mucosa in preparation for pregnancy However, activation of PR is in itself insufficient to induce (1). A cardinal event in this remodeling process is the decidualization in mice or humans. Initiation of HESC differentiation is strictly dependent upon elevated cAMP First Published Online May 29, 2008 levels and sustained activation of the protein kinase A Abbreviations: AR, Androgen receptor; DHT, dihydrotestosterone; pathway, which in turn sensitize the cells to P4 (5, 6). Once EGFP, enhanced green fluorescent protein; F-actin, filamentous actin; decidualized, the endometrium becomes inextricably de- HESC, human endometrial stromal cell; IGFBP-1, insulin-like growth factor-binding protein-1; MLC2, light chain of myosin 2; MPA, me- pendent upon continuous P4 signaling for homeostasis, droxyprogesterone acetate; NT, nontargeting; P4, progesterone; PIAS1, and in the absence of pregnancy, falling P4 levels trigger protein inhibitor of activated STAT1; PR, P4 receptor; PRL, prolactin; RB, a cascade of events that results in apoptosis, proteolytic retinoblastoma protein; RTQ, real-time quantitative; siRNA, small in- breakdown of the superficial endometrium, focal bleed- terfering RNA; STAT3, signal transducer and activator of transcription 3; SUMO, small ubiquitin-like modifier. ing, and menstrual shedding (7). Endocrinology is published monthly by The Endocrine Society (http:// HESCs also abundantly express the androgen receptor www.endo-society.org), the foremost professional society serving the (AR) (8, 9), yet little is known about the function of this endocrine community. nuclear receptor family member in the decidual process. AR 4462 Cloke et al. • AR Function in Decidual Cells Endocrinology, September 2008, 149(9):4462–4474 4463 and PR are phylogenetically closely related and share 54 and are higher in secretory than proliferative endometrium (15). 80% sequence homology in their ligand- and DNA-binding Moreover, a rise in circulating androgen levels in the late domains, respectively (10). AR expression, which is confined luteal phase is associated with a conception cycle and levels to the stroma in cycling endometrium, decreases during the continue to rise in early pregnancy (16). Interestingly, both secretory phase, although the receptor remains detectable in lack and excess of circulating androgens in premature ovar- the decidua of early pregnancy (11, 12). Serum androgen ian failure and polycystic ovary syndrome, respectively, are levels fluctuate throughout the menstrual cycle, with levels associated with increased risk of early fetal loss and late peaking around ovulation (13, 14). However, tissue andro- obstetric complication due to impaired placental function, gen levels and conversion of androstenedione to testosterone such as preeclampsia (17–19). A B 345 6 cAMP/DHT/P4 * 5 cAMP/DHT 340 4 cAMP/P4 * 335 3 185 PRL P4 180 mIU/L/µg RNA) 2 cAMP * 3 175 1 170 (x10 0 250 secretion PRL 60 40 (relative to cAMP/P4) 200 20 150 0 DHT: 100 Days:2468 IGFBP-1 50 (ng/ml/10 µg RNA) 0 E Day: 0 2 4 6 8 6 cAMP+P4+DHT+CDX * cAMP+P4+DHT C 10 4 cAMP+P4 * 8 PRL ) 3 6 2 3 (x10 4 2 (x10 0 PRL/L19 mRNA PRL/L19 0 Days: 02468 cAMP: - + + + + P4: - - + - + DHT: - - - + + F 250 200 * * D dPRL luc -3000 -1 120 150 100 100 80 60 effect Relative 50 40 (%) secretion on PRL 20 0 (fold induction) (fold promoter activity 0 NT siRNA: --++-- cAMP: - + + + + AR siRNA: ----++ P4: - - + - + cAMP/P4: ++++++ DHT: - - - + + DHT: - + - + - + FIG. 1. DHT selectively enhances decidual PRL expression in a time-dependent manner. A, Primary HESCs were cultured in the presence of 8-br-cAMP, P4, and DHT as indicated. The medium was collected and cells harvested every 48 h. The data represent the mean PRL (upper panel) and IGFBP-1 (lower panel) concentrations (ϮSD) in the supernatant, with normalization for RNA content at each time point, of triplicate cultures. Significant differences were found in terms of PRL secretion between cultures treated with cAMP/P4 and cAMP/P4/DHT at 4, 6, and 8 d (*, P Ͻ 0.05). B, Primary HESCs were decidualized with 8-Br-cAMP, P4, and increasing concentrations of DHT (0.001, 0.01, 0.1, and 1 ␮M). The medium was collected and assayed for PRL concentration. The data are expressed as percentage increase over cAMPϩP4 alone (mean ϮSD). C, RTQ-PCR analysis was carried out for PRL mRNA levels in cultures treated as in A. The results show mean PRL mRNA levels (ϮSD) normalized to L19 mRNA of three independent cultures. D, HESCs were treated as in A for 48 h followed by transfection with dPRL-3000/Luc. Subsequently, the cells were maintained in the same culture conditions for 24 h. Luciferase and galactosidase assays were performed, and the results represent the mean (ϮSD) of triplicate measurements of one representative experiment. E, Primary HESCs were cultured in the presence of 8-br-cAMP, P4, DHT, and bicalutamide (Casodex; CDX) as indicated and PRL secretion determined as described above. PRL secretion was significantly different between cAMP/P4/DHT- and cAMP/P4/DHT/CDX-treated cultures (*, P Ͻ 0.05). F, HESCs, decidualized with a combination of 8-Br-cAMP, P4, and DHT for 48 h, were either mock-transfected or transfected with NT or AR siRNAs. The treatments were continued for 72 h and the supernatants assayed for PRL. The data represent
Recommended publications
  • TGF-Β1 Signaling Targets Metastasis-Associated Protein 1, a New Effector in Epithelial Cells

    TGF-Β1 Signaling Targets Metastasis-Associated Protein 1, a New Effector in Epithelial Cells

    Oncogene (2011) 30, 2230–2241 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE TGF-b1 signaling targets metastasis-associated protein 1, a new effector in epithelial cells SB Pakala1, K Singh1,3, SDN Reddy1, K Ohshiro1, D-Q Li1, L Mishra2 and R Kumar1 1Department of Biochemistry and Molecular Biology and Institute of Coregulator Biology, The George Washington University Medical Center, Washington, DC, USA and 2Department of Gastroenterology, Hepatology and Nutrition, The University of Texas MD Anderson Cancer Center, Houston, TX, USA In spite of a large number of transforming growth factor b1 gene chromatin in response to upstream signals. The (TGF-b1)-regulated genes, the nature of its targets with TGF-b1-signaling is largely mediated by Smad proteins roles in transformation continues to be poorly understood. (Massague et al., 2005) where Smad2 and Smad3 are Here, we discovered that TGF-b1 stimulates transcription phosphorylated by TGF-b1-receptors and associate with of metastasis-associated protein 1 (MTA1), a dual master the common mediator Smad4, which translocates to the coregulator, in epithelial cells, and that MTA1 status is a nucleus to participate in the expression of TGF-b1-target determinant of TGF-b1-induced epithelial-to-mesenchymal genes (Deckers et al., 2006). Previous studies have shown transition (EMT) phenotypes. In addition, we found that that CUTL1, also known as CDP (CCAAT displacement MTA1/polymerase II/activator protein-1 (AP-1) co-activator protein), a target of TGF-b1, is needed for its short-term complex interacts with the FosB-gene chromatin and stimu- effects of TGF-b1 on cell motility involving Smad4- lates its transcription, and FosB in turn, utilizes FosB/histone dependent pathway (Michl et al.,2005).
  • Targeting Hedgehog Signalling Through the Ubiquitylation Process: the Multiple Roles of the HECT-E3 Ligase Itch

    Targeting Hedgehog Signalling Through the Ubiquitylation Process: the Multiple Roles of the HECT-E3 Ligase Itch

    cells Review Targeting Hedgehog Signalling through the Ubiquitylation Process: The Multiple Roles of the HECT-E3 Ligase Itch Paola Infante 1,†, Ludovica Lospinoso Severini 2,† , Flavia Bernardi 2, Francesca Bufalieri 2 and Lucia Di Marcotullio 2,3,* 1 Center for Life NanoScience@Sapienza, Istituto Italiano di Tecnologia, 00161 Rome, Italy; [email protected] 2 Department of Molecular Medicine, University of Rome La Sapienza, 00161 Rome, Italy; [email protected] (L.L.S.); fl[email protected] (F.B.); [email protected] (F.B.) 3 Istituto Pasteur-Fondazione Cenci Bolognetti, University of Rome La Sapienza, 00161 Rome, Italy * Correspondence: [email protected]; Tel.: +39-06-49255657 † These authors contributed equally to this work. Received: 28 December 2018; Accepted: 26 January 2019; Published: 29 January 2019 Abstract: Hedgehog signalling (Hh) is a developmental conserved pathway strongly involved in cancers when deregulated. This important pathway is orchestrated by numerous regulators, transduces through distinct routes and is finely tuned at multiple levels. In this regard, ubiquitylation processes stand as essential for controlling Hh pathway output. Although this post-translational modification governs proteins turnover, it is also implicated in non-proteolytic events, thereby regulating the most important cellular functions. The HECT E3 ligase Itch, well known to control immune response, is emerging to have a pivotal role in tumorigenesis. By illustrating Itch specificities on Hh signalling key components, here we review the role of this HECT E3 ubiquitin ligase in suppressing Hh-dependent tumours and explore its potential as promising target for innovative therapeutic approaches. Keywords: Hedgehog; cancer; ubiquitylation; Itch; Numb; β-arrestin2; GLI1; SuFu; Patched1 1.
  • Table S1| Differential Expression Analysis of the Atopy Transcriptome

    Table S1| Differential Expression Analysis of the Atopy Transcriptome

    Table S1| Differential expression analysis of the atopy transcriptome in CD4+ T-cell responses to allergens in atopic and nonatopic subjects Probe ID S.test Gene Symbol Gene Description Chromosome Statistic Location 7994280 10.32 IL4R Interleukin 4 receptor 16p11.2-12.1 8143383 8.95 --- --- --- 7974689 8.50 DACT1 Dapper, antagonist of beta-catenin, homolog 1 14q23.1 8102415 7.59 CAMK2D Calcium/calmodulin-dependent protein kinase II delta 4q26 7950743 7.58 RAB30 RAB30, member RAS oncogene family 11q12-q14 8136580 7.54 RAB19B GTP-binding protein RAB19B 7q34 8043504 7.45 MAL Mal, T-cell differentiation protein 2cen-q13 8087739 7.27 CISH Cytokine inducible SH2-containing protein 3p21.3 8000413 7.17 NSMCE1 Non-SMC element 1 homolog (S. cerevisiae) 16p12.1 8021301 7.15 RAB27B RAB27B, member RAS oncogene family 18q21.2 8143367 6.83 SLC37A3 Solute carrier family 37 member 3 7q34 8152976 6.65 TMEM71 Transmembrane protein 71 8q24.22 7931914 6.56 IL2R Interleukin 2 receptor, alpha 10p15-p14 8014768 6.43 PLXDC1 Plexin domain containing 1 17q21.1 8056222 6.43 DPP4 Dipeptidyl-peptidase 4 (CD26) 2q24.3 7917697 6.40 GFI1 Growth factor independent 1 1p22 7903507 6.39 FAM102B Family with sequence similarity 102, member B 1p13.3 7968236 5.96 RASL11A RAS-like, family 11, member A --- 7912537 5.95 DHRS3 Dehydrogenase/reductase (SDR family) member 3 1p36.1 7963491 5.83 KRT1 Keratin 1 (epidermolytic hyperkeratosis) 12q12-q13 7903786 5.72 CSF1 Colony stimulating factor 1 (macrophage) 1p21-p13 8019061 5.67 SGSH N-sulfoglucosamine sulfohydrolase (sulfamidase) 17q25.3
  • Micrornas in Cardiovascular Disease: from Pathogenesis to Prevention and Treatment

    Micrornas in Cardiovascular Disease: from Pathogenesis to Prevention and Treatment

    MicroRNAs in cardiovascular disease: from pathogenesis to prevention and treatment Daniel Quiat, Eric N. Olson J Clin Invest. 2013;123(1):11-18. https://doi.org/10.1172/JCI62876. Review Series The management of cardiovascular risk through lifestyle modification and pharmacotherapy is paramount to the prevention of cardiovascular disease. Epidemiological studies have identified obesity, dyslipidemia, diabetes, and hypertension as interrelated factors that negatively affect cardiovascular health. Recently, genetic and pharmacological evidence in model systems has implicated microRNAs as dynamic modifiers of disease pathogenesis. An expanded understanding of the function of microRNAs in gene regulatory networks associated with cardiovascular risk will enable identification of novel genetic mechanisms of disease and inform the development of innovative therapeutic strategies. Find the latest version: https://jci.me/62876/pdf Review series MicroRNAs in cardiovascular disease: from pathogenesis to prevention and treatment Daniel Quiat and Eric N. Olson Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, Texas, USA. The management of cardiovascular risk through lifestyle modification and pharmacotherapy is paramount to the prevention of cardiovascular disease. Epidemiological studies have identified obesity, dyslipidemia, diabetes, and hypertension as interrelated factors that negatively affect cardiovascular health. Recently, genetic and pharmaco- logical evidence in model systems has implicated microRNAs
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name Nedd4 family interacting protein 2 Gene Symbol Ndfip2 Organism Mouse Gene Summary Description Not Available Gene Aliases 0710001O20Rik, 2810436B12Rik, 9130207N19Rik, N4wbp5a, mKIAA1165 RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.290669 Ensembl Gene ID ENSMUSG00000053253 Entrez Gene ID 76273 Assay Information Unique Assay ID qMmuCED0039954 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000181969, ENSMUST00000138283, ENSMUST00000136040 Amplicon Context Sequence AGCAGAGCCCAGTCCTGCTCGGTTACTCAGTGCTGATACAATTGGAGGAATTGG GTAACGAGCAGCCTTCCAGCACGTGACGCTTCCGACGTGGCCGTTAGCGTAATC AGAGTTACACTATTACTCTTGTCCAGTGCTTTACTTTCT Amplicon Length (bp) 117 Chromosome Location 14:105308153-105308299 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 99 R2 0.996 cDNA Cq 20.52 cDNA Tm (Celsius) 83.5 gDNA Cq 23.84 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ndfip2, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen

    PDF Hosted at the Radboud Repository of the Radboud University Nijmegen

    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/147462 Please be advised that this information was generated on 2021-10-11 and may be subject to change. Chromatin Regulatory Complexes from an Interaction Proteomics Perspective an Interaction Proteomics from Regulatory Complexes Chromatin Chromatin Regulatory Complexes from an Interaction Proteomics Perspective H. İrem Baymaz H. İrem Baymaz H. İrem Baymaz 2015 Chromatin Regulatory Complexes from an Interaction Proteomics Perspective H. İrem Baymaz printed by: Proefschriftmaken.nl || Uitgeverij BOXPress Copyright © 2015 H. İrem Baymaz Chromatin Regulatory Complexes from an Interaction Proteomics Perspective Chromatine-Regulerende Complexen vanuit een Interactie-Proteomics Perspectief Proefschrift ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. dr. Th.L.M. Engelen, volgens besluit van het college van decanen in het openbaar te verdedigen op donderdag 26 november 2015 om 12.30 uur precies door Hamdiye İrem Baymaz geboren op 8 maart 1986 te Ankara, Turkije Promoter: Prof. dr. M. Vermeulen Manuscriptcommissie: Prof. dr. J.H.L.M. van Bokhoven Prof. dr. H.T.M. Timmers (UMCU) Dr. L.M. Kamminga Anne ve Babama. Table of Contents List of Abbreviations 9 Chapter 1 11 Introduction Chapter 2 45 Identifying nuclear protein-protein interactions using GFP affinity purification
  • I3C & Hormone Positive Breast Cancer

    I3C & Hormone Positive Breast Cancer

    ARTICLE IN PRESS Journal of Nutritional Biochemistry xx (2006) xxx–xxx Estrogen receptor a as a target for indole-3-carbinol Thomas T.Y. Wanga,4, Matthew J. Milnerb, John A. Milnerc, Young S. Kimc aPhytonutrients Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD 20705, USA bDepartment of Biology, The Pennsylvania State University, University Park, PA, USA cNutritional Science Research Group, Division of Cancer Prevention, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA Received 8 June 2005; received in revised form 14 October 2005; accepted 22 October 2005 Abstract A wealth of preclinical evidence supports the antitumorigenic properties of indole-3-carbinol (I3C), which is a major bioactive food component in cruciferous vegetables. However, the underlying molecular mechanism(s) accounting for these effects remain unresolved. In the present study, estrogen receptor alpha (ER-a) was identified as a potential molecular target for I3C. Treating MCF-7 cells with 100 AM I3C reduced ER-a mRNA expression by approximately 60% compared to controls. This reduction in ER-a transcript levels was confirmed using real-time polymerase chain reaction. The I3C dimer, 3,3V-diindolylmethane (DIM), was considerably more effective in depressing ER-a mRNA in MCF-7 cells than the monomeric unit. The suppressive effects of 5 AM DIM on ER-a mRNA was comparable to that caused by 100 AM I3C. DIM is known to accumulate in the nucleus and is a preferred ligand for aryl hydrocarbon receptor (AhR) to I3C. The addition of other AhR ligands, a-naphthoflavone (a-NF, 10 AM) and luteolin (10 AM), to the culture media resulted in a similar suppression in ER-a mRNA levels to that caused by 5 AM DIM.
  • Taqman Probes ARF 5' Primer P16ink4a 5' Primer Exon 1/2

    Taqman Probes ARF 5' Primer P16ink4a 5' Primer Exon 1/2

    a b Exon 1β 1α 23 ARF p16INK4a MDM2 Cyclin D CDK4/6 p53 pRB TaqMan Probes ARF 5’ Primer p16INK4a 5’ Primer Exon 1/2 Common Primer Exon 2/3 Common Primers Defective p53 Intact p53 A. Melanoma cell lines clustered by expression of p53 targets and INK4a/ARF expression. The p53 response to ionizing radiation is indicated. Top cluster: Cells with intact p53 response show increased expression of the eight indicated p53 targets, and decreased expression of ARF. Bottom cluster: TaqMan and microarray results for the p16INK4- and ARF- specific transcripts. Cell lines that demonstrated increased p16INK4a expression either harbored RB deletion, p16INK4a point 2 mutation or CDK4 point mutation (Supp Table 1). Pair-wise variances (r ) for the log2 transformed CDKN2a microarray 2 2 2 results versus the log10 transformed TaqMan results are: vs. Exon 2/3 r =0.78; vs. Exon1α/2 r =0.32; vs. Exon 1β/2 r =0.38. Note all four WT lines (PMWK, Mel505, SKMEL187 and RPMI8322) lack evidence of p53 function by all assays. B. The INK4a/ARF locus and with TaqMan strategies. The ARF transcript originates from exon 1β while the p16INK4a transcript originates from exon 1α. Both transcripts splice to exon 2 but in alternate reading frames. ARF stabilizes p53 by inhibiting MDM2, while p16INK4a activates RB by inhibiting CDK4. Primers and TaqMan probes are shown for the real-time RT-PCR strategy. Shields et al., Supp Figure 1 SKMEL 28 U01 24h SKMEL WM2664 U01 48h WM2664 U01 24h 24 U01 48h SKMEL 24 U01 24h SKMEL 24 Untreated SKMEL 24 DMSO 48h SKMEL 24 DMSO 24h SKMEL WM2664 DMSO 24h WM2664 DMSO 48h WM2644 Untreated 28 Untreated SKMEL 28 DMSO 48h SKMEL 28 DMSO 24h SKMEL -3.00 -2.00 -1.00 0.00 1.00 2.00 3.00 relative to median expression Genes decreased by UO1 (863) HIF1A Hypoxia-inducible factor 1, alpha subunit NM_001530 RBBP8 Retinoblastoma binding protein 8 NM_002894 Homo sapiens, clone IMAGE:4337652, mRNA BC018676 EIF4EBP1 Eukaryotic translation initiation factor 4E binding protein EXOSC8 Exosome component 8 NM_181503 ENST00000321524 MCM7 MCM7 minichromosome maintenance deficient 7 (S.
  • Transcriptional Mechanisms of WNT5A Based on NF-Κb, Hedgehog, Tgfß, and Notch Signaling Cascades

    Transcriptional Mechanisms of WNT5A Based on NF-Κb, Hedgehog, Tgfß, and Notch Signaling Cascades

    763-769 23/4/2009 01:21 ÌÌ Page 763 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 23: 763-769, 2009 763 Transcriptional mechanisms of WNT5A based on NF-κB, Hedgehog, TGFß, and Notch signaling cascades MASUKO KATOH1 and MASARU KATOH2 1M&M Medical BioInformatics, Hongo 113-0033; 2Genetics and Cell Biology Section, National Cancer Center, Tokyo 104-0045, Japan Received March 5, 2009; Accepted April 2, 2009 DOI: 10.3892/ijmm_00000190 Abstract. WNT5A is a cancer-associated gene involved in were found to upregulate WNT5A expression directly through invasion and metastasis of melanoma, breast cancer, pancreatic the Smad complex, and also indirectly through Smad- cancer, and gastric cancer. WNT5A transduces signals through induced CUX1 and MAP3K7-mediated NF-κB. Together Frizzled, ROR1, ROR2 or RYK receptors to ß-catenin-TCF/ these facts indicate that WNT5A is transcribed based on LEF, DVL-RhoA-ROCK, DVL-RhoB-Rab4, DVL-Rac-JNK, multiple mechanisms, such as NF-κB, Hedgehog, TGFß, and DVL-aPKC, Calcineurin-NFAT, MAP3K7-NLK, MAP3K7- Notch signaling cascades. NF-κB, and DAG-PKC signaling cascades in a context- dependent manner. SNAI1 (Snail), CD44, G3BP2, and YAP1 Introduction are WNT5A target genes. We and other groups previously reported that IL6- or LIF-induced signaling through JAK- WNT signaling cascades are involved in a variety of cellular STAT3 signaling cascade is involved in WNT5A upregulation processes during embryogenesis and carcinogenesis (1-4). (STAT3-WNT5A signaling loop). Here, refined integrative Because biological functions of human genes and those of genomic analyses of WNT5A were carried out to elucidate model-animal orthologs are not always conserved due to other mechanisms of WNT5A transcription.
  • Tumor Microenvironment: Driving Forces and Potential Therapeutic Targets for Breast Cancer Metastasis

    Tumor Microenvironment: Driving Forces and Potential Therapeutic Targets for Breast Cancer Metastasis

    Xie et al. Chin J Cancer (2017) 36:36 DOI 10.1186/s40880-017-0202-y Chinese Journal of Cancer REVIEW Open Access Tumor microenvironment: driving forces and potential therapeutic targets for breast cancer metastasis Hong‑Yan Xie1,2,3, Zhi‑Min Shao1,2,3,4,5* and Da‑Qiang Li1,2,3,4* Abstract Distant metastasis to specific target organs is responsible for over 90% of breast cancer-related deaths, but the underlying molecular mechanism is unclear. Mounting evidence suggests that the interplay between breast cancer cells and the target organ microenvironment is the key determinant of organ-specific metastasis of this lethal disease. Here, we highlight new findings and concepts concerning the emerging role of the tumor microenvironment in breast cancer metastasis; we also discuss potential therapeutic intervention strategies aimed at targeting compo‑ nents of the tumor microenvironment. Keywords: Breast cancer, Invasion and metastasis, Tumor microenvironment Background investigated extensively. Recently, several laboratories In terms of its molecular characteristics and clinical phe- screened and identified a batch of breast cancer metas- notypes, breast cancer is a highly heterogeneous malig- tasis-related genes using well-established animal mod- nancy. Like other solid tumor cells, breast cancer cells els of metastatic breast cancer in combination with tend to metastasize to distant organs, such as the lung [1, high-throughput genomic analysis (Table 1). For exam- 2], liver [2], bone [3], and brain [4], through local invasion ple, it has been
  • Williams Syndrome As a Model for Elucidation of the Pathway Genes – the Brain – Cognitive Functions: Genetics and Epigenetics

    Williams Syndrome As a Model for Elucidation of the Pathway Genes – the Brain – Cognitive Functions: Genetics and Epigenetics

    reVIeWS Williams Syndrome As a Model for Elucidation of the Pathway Genes – the Brain – Cognitive Functions: Genetics and Epigenetics Е. А. Nikitina1,2*, A. V. Medvedeva1,3, G. А. Zakharov1,3, Е. V. Savvateeva-Popova1,3 1Pavlov Institute of Physiology, Russian Academy of Sciences, nab. Makarova, 6, 199034, St. Petersburg, Russia 2Herzen State Pedagogical University, nab. r. Moyki, 48, 191186, St. Petersburg, Russia 3Saint Petersburg State University, Universitetskaya nab., 8-9, 199034, St. Petersburg, Russia *E-mail: [email protected] Received 16.07.2013 Copyright © 2014 Park-media, Ltd. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. abStract Genomic diseases or syndromes with multiple manifestations arise spontaneously and unpredict- ably as a result of contiguous deletions and duplications generated by unequal recombination in chromosomal regions with a specific architecture. The Williams syndrome is believed to be one of the most attractive models for linking genes, the brain, behavior and cognitive functions. It is a neurogenetic disorder resulting from a 1.5 Mb deletion at 7q11.23 which covers more than 20 genes; the hemizigosity of these genes leads to multiple mani- festations, with the behavioral ones comprising three distinct domains: 1) visuo-spatial orientation; 2) verbal and linguistic defect; and 3) hypersocialisation. The shortest observed deletion leads to hemizigosity in only two genes: eln and limk1. Therefore, the first gene is supposed to be responsible for cardiovascular pathology; and the second one, for cognitive pathology. Since cognitive pathology diminishes with a patient’s age, the original idea of the crucial role of genes straightforwardly determining the brain’s morphology and behavior was substituted by ideas of the brain’s plasticity and the necessity of finding epigenetic factors that affect brain development and the functions manifested as behavioral changes.
  • 1 Novel Expression Signatures Identified by Transcriptional Analysis

    1 Novel Expression Signatures Identified by Transcriptional Analysis

    ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009.