DOCSLIB.ORG

Transformation by Ras Modifies AP1 Composition and Activity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transformation by Ras Modifies AP1 Composition and Activity Oncogene (1997) 14, 837 ± 847 1997 Stockton Press All rights reserved 0950 ± 9232/97 $12.00 Transformation by ras modi®es AP1 composition and activity Fatima Mechta1, Dominique Lallemand, Curt M Pfarr2 and Moshe Yaniv Unite des Virus OncogeÁnes; URA 1644 du CNRS, DeÂpartement des Biotechnologies, Institut Pasteur, 25, rue du Dr Roux, 75724 Paris Cedex 15, France. The Ras proteins play a central role in regulating cell Ras proteins play a central role in signal transduc- growth and their mutation can lead to abnormal tion (Feig and Cooper, 1988; Mulcahy et al., 1985; proliferation. To analyse the potential link betwen AP1 Smith et al., 1989). These proto-oncogenes, frequently activity, encoded by members of the jun and fos gene mutated in human tumors, connect receptors as the cell families, and Ras-mediated cellular transformation, we membrane with a cytoplasmic cascade of protein have studied several NIH3T3 clones which overexpress kinases followed by downstream nuclear events the Ha-Ras or Ki-Ras oncogenes. These transformed including induction of transcription and DNA synth- ®broblasts accumulated higher levels of cJun, JunB, esis. The proteins (p21Ras) encoded by the ras genes Fra1 and Fra2 proteins relative to their normal counter- (Harvey-ras/Ha-ras, Kirsten-ras/Ki-ras and N-ras) bind parts. They also displayed increased AP1 DNA binding guanine nucleotides, possess an intrinsic GTPase activity which was predominantly composed of cJun and activity and cycle between an active (GTP bound) Fra1 containing dimers. Following serum stimulation of form and an inactive (GDP bound) state (Barbacid, Ras clones, the elevated levels of cJun and Fra1 1987). Activated p21Ras proteins stimulate a cascade remained steady, while the induction of JunB and Fra2 of cytoplasmic protein kinases including Raf, MEK, was partially attenuated. Moreover, deregulated Ras MAPK (Mitogen Activated Protein Kinase) which in signaling resulted in a complete loss of the serum turn culminates in the phosphorylation of nuclear inducibility of cFos and FosB. Ectopic co-expression of transcription factors resulting in transcriptional activa- cJun and Fra1 in NIH3T3 ®broblasts led to a tion of growth-mediating genes (Bollag and McCor- transformed phenotype, attenuation of cFos serum mick, 1991; Boulton et al., 1991; de Vries-Smit et al., inducibility, increased AP1 activity and Cyclin D1 1992; Dent et al., 1992; De rijard et al., 1994; Hibi et accumulation, all characteristics of oncogenic Ras al., 1993; Howe et al., 1992; Kyriakis et al., 1992; expressing cells. These results demonstrate that cJun Lowenstein et al., 1992; Wood et al., 1992). and Fra1 are crucial mediators of the Ras-transforma- The induction of c-jun and c-fos transcription is one tion process. of the earliest nuclear responses to a wide variety of extracellular stimuli and is thought to be crucial in Keywords: AP1; cJun; Fra1; Ras; serum inducibility; mediating cellular proliferating (Curran and Franza, transformation 1988; Herschman, 1991). The mitogen stimulation of c-fos transcription is a paradigm for a gene regulated via the Ras pathway. The SRE (Serum Response Element) in the c-fos promoter is continuously bound by two nuclear proteins SRF and Elk/TCF (Herrera Introduction et al., 1989; KoÈ nig, 1991; Norman et al., 1988; Prywes and Roeder, 1987; SchroÈ ter et al., 1990; Shaw et al., The precise mechanism by which speci®c oncopro- 1989; Treisman, 1987). Upon Ras activation Elk1 is teins cause malignant transformation of cells by rapidly phosphorylated by MAPK-1 and MAPK-2 transmitting signals for aberrant growth is not fully (also called ERK1 and ERK2) resulting in a strong understood. Proto-oncogenes commonly participate in increase in its transcriptional activity (Hipskind et al., the regulation of normal cellular growth through 1994; Prywes et al., 1988; Zinck et al., 1993). A signal transduction pathways which convert extra- dierent mechanism has been proposed for c-jun cellular stimuli into a program of gene expression. transcriptional activation which involves a cJun/ Many of these genes are also activated during the G0 ATF2 heterodimer stably bound to a TRE element to G1 transition when quiescent cells are stimulated in the c-jun promoter (van Dam et al., 1993). Ras by mitogens to re-enter the cycle. The rapid activation promotes phosphorylation of the cJun induction of such genes, called `immediate early protein augmenting its transcriptional activity (Bine - genes' is followed by the transcription of down- truy et al., 1991; Smeal et al., 1991). stream target genes that are critical for the The jun and fos families of genes are composed of proliferative response of the cell. A number of these three jun members (c-jun, junB, and junD) (Bohmann et immediate early genes encode transcription factors, al., 1987; Hirai et al., 1989; Maki et al., 1987; Ryder et including Jun and Fos. al., 1988, 1989) and four dierent fos partners (c-fos, fosB, fra1 and fra2) (Cohen and Curran, 1988; Nishina et al., 1990; Zerial et al., 1989). These genes encode Correspondence: M Yaniv components of the AP1 transcription factor formed by 1Present addresses: 1Unite INSERM 368, Biologie mole culaire du homo- or hetero-dimerization of the Jun and Fos De veloppement, ENS, 46 rue d'Ulm. 75230 Paris Cedex 05 France proteins. Dimerization occurs through a leucine-repeat 2Department of Cell Biology and Biochemistry, Texas Tech University Health Science Center, 3601 4th Street, Lubbock, Texas located in the highly conserved C-terminal part of the 79430 USA Jun proteins or in an internal position in the Fos API composition and activity in Ras-transformed fibroblasts FMechtaet al 838 proteins (Landschulz et al., 1988; Sassone-Corsi et al., dimers exhibit similar DNA binding speci®cities but 1988a). As the Fos proteins do not form dimers among dier in their transactivation eciencies (Chiu et al., themselves, AP1 is a set of low anity Jun/Jun and 1989; Hirai et al., 1990; Suzuki et al., 1991). The high anity Jun/Fos dimers (Nakabeppu et al., 1988). binding anities for dierent dimer combinations is This complex set of dimers recognizes and binds to the dependent on the speci®c TRE sequence and on the TRE element (TPA Responsive Element or TGACT- promoter context (Halazonetis et al., 1988; Ryseck and CA) through the basic domain of both proteins, Bravo, 1991). Moreover, the jun and fos immediate adjacent to the Leucine-zipper. AP1 recognition early genes are dierentially expressed during develop- sequences are found in many promoters and enhancers ment and in adult tissues (Dony and Gruss, 1987; Hirai of cellular and viral genes, including Collagenase, et al., 1989; Wilkinson et al., 1989). They also respond Stromelysin, Metallothionein IIA, Interleukin 2, dierently to mitogenic stimuli, genotoxic or differ- Transforming Growth Factor b, Simian Virus 40, entiating agents (Almendral et al., 1988; de Groot et Polyomavirus and Papillomavirus. The dierent AP1 al., 1990; Devary et al., 1991; Lau and Nathans, 1987; 3 Clone Ras Protein — NIH3T —R5 —R4 —R3 —R2 —R1 NIH3T3 L Ras L R5 R4 R3 R2 R1 Figure 1 Characterization of Ras expressing ®broblasts. Dierent neomycin-resistant clones were isolated after stable transfection of an activated Ha-ras gene in NIH3T3 ®broblasts. The level of Ras expression was analysed by immuno¯uorescence and immunoblot staining with a speci®c anti-Ras monoclonal antibody (see Material and methods). The plating eciency of soft agar clones was de®ned as the ratio of the number of macroscopic colonies after 15 days of growth to the number cells initially seeded. The plotted numbers represent data of one typical experiment. There was a good correlation between the amount of activated Ras and transformation as measured by a soft agar assay (ie: normal NIH3T3 ®broblasts or clone R5 that did not show accumulation of Ras protein do not grow in agar, whereas clones expressing the higher levels of Ras produced the higher number of colonies) API composition and activity in Ras-transformed fibroblasts FMechtaet al 839 3 3 — NIH3T —R5 —R4 —R3 —R2 —R1 —R5 —R4 —R3 —R2 —R1 — NIH3T L L cJun L cFos L L FosB L L L L L L L D L JunB L FosB Fra1 L JunD L Fra2 Figure 2 Expression pattern of the Jun and Fos proteins after transformation by Ras. The Jun and Fos protein levels were determined in the various Ras overexpressing clones by immunoblots probed with speci®c anti-Jun and anti-Fos antibodies as described in Material and methods. Identical amounts of whole-cell extracts were loaded in each lane, transferred to nitrocellulose, incubated with the indicated primary antibody and developed using enhanced chemiluminescence. The same extracts were used to performed each blot. The arrows or brackets indicate the position of the speci®c immuno-reactive band(s). Multiplicity of bands observed for JunB, Fra1 and Fra2 is caused by phosphorylation (DL, unpublished results). Note that cFos, FosB and DFosB are undetectable in these extracts. The weak bands reacting with the anti-cFos or anti-Fra1 antibodies in the NIH3T3 cell extracts are non speci®c. The dierences observed for the migration of JunB and Fra2 between the DT (R1) and the R2-R5 clones concerns probably their degree of phosphorylation and may depend on the nature of the Ras protein (Kirsten versus Harvey ras) Mechta et al., 1989; Ryseck et al., 1988; Lallemand et Results al., 1997). These observations suggest that, under various conditions, the members of the Jun and Fos Increased expression of cJun, JunB, Fra1 and Fra2 in families present dierent properties and have distinct Ras transformed cells functions. Several lines of evidence suggest that AP1 couples To study the consequences of oncogenic Ras expression signals from activated Ras proteins to the transcription on AP1 composition, we isolated a set of Ras- of target genes in transformed cells.
Load more

Recommended publications
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
    [Show full text]
  • Redundancy and Specificity F Mechta-Grigoriou Et Al 2379
    Oncogene (2001) 20, 2378 ± 2389 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc The mammalian Jun proteins: redundancy and speci®city Fatima Mechta-Grigoriou1, Damien Gerald1 and Moshe Yaniv*,1 1Unite des virus oncogenes, CNRS URA 1644, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France The AP-1 transcription factor is composed of a mixture transcription factors. These proteins are characterized of homo- and hetero-dimers formed between Jun and Fos by a highly charged, basic DNA binding domain, proteins. The dierent Jun and Fos family members vary immediately adjacent to an amphipathic dimerization signi®cantly in their relative abundance and their domain, referred as the `Leucine zipper' (Kouzarides interactions with additional proteins generating a and Zi, 1988; Landschulz et al., 1988). Dimerization complex network of transcriptional regulators. Thus, is required for speci®c and high anity binding to the the functional activity of AP-1 in any given cell depends palindromic DNA sequence, TGAC/GTCA (Rauscher on the relative amount of speci®c Jun/Fos proteins which et al., 1988; Gentz et al., 1989; Hirai and Yaniv, 1989; are expressed, as well as other potential interacting Ransone et al., 1989; Schuermann et al., 1989; Turner proteins. This diversity of AP-1 components has and Tjian, 1989). The dierent AP-1 dimers exhibit complicated our understanding of AP-1 function and similar DNA binding speci®cities but dier in their resulted in a paucity of information about the precise transactivation eciencies (Chiu et al., 1989; Hirai et role of individual AP-1 members in distinct cellular al., 1990; Kerppola and Curran, 1991b; Suzuki et al., processes.
    [Show full text]
  • Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute
    Integrative Cancer Science and Therapeutics Review Article ISSN: 2056-4546 Targeting the phosphatidylinositol 3-kinase signaling pathway in acute myeloid leukemia Ota Fuchs* Institute of Hematology and Blood Transfusion, Prague, Czech Republic Abstract The phosphatidylinositol-3-kinase-Akt (protein kinase B) - mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is often dysregulated in cancer, including hematological malignancies. Primary acute myeloid leukemia (AML) cell populations may include various subclones at the time of diagnosis. A relapse can occur due to regrowth of the originally dominating clone, a subclone detectable at the time of first diagnosis, or a new clone derived either from the original clone or from remaining preleukemic stem cells. Inhibition of mTOR signaling has in general modest growth-inhibitory effects in preclinical AML models and clinical trials. Therefore, combination of allosteric mTOR inhibitors with standard chemotherapy or targeted agents has a greater anti-leukemia efficacy. Dual mTORC1/2 inhibitors, and dual PI3K/mTOR inhibitors show greater activity in pre-clinical AML models. Understanding the role of mTOR signaling in leukemia stem cells is important because AML stem cells may become chemoresistant by displaying aberrant signaling molecules, modifying epigenetic mechanisms, and altering the components of the bone marrow microenvironment. The PI3K/Akt/mTOR signaling pathway is promising target in the treatment of hematological malignancies, including AML, especially by using of combinations of mTOR inhibitors with conventional cytotoxic agents. Introduction syndromes, chronic myelogenous leukemia (CML), multiple myeloma and lymphoid leukemias and lymphomas [42-54]. Below, I discuss the The mammalian target of rapamycin (mTOR) is a serine/threonine PI3K/Akt/mTOR pathway and its role in AML.
    [Show full text]
  • Cytometry of Cyclin Proteins
    Reprinted with permission of Cytometry Part A, John Wiley and Sons, Inc. Cytometry of Cyclin Proteins Zbigniew Darzynkiewicz, Jianping Gong, Gloria Juan, Barbara Ardelt, and Frank Traganos The Cancer Research Institute, New York Medical College, Valhalla, New York Received for publication January 22, 1996; accepted March 11, 1996 Cyclins are key components of the cell cycle pro- gests that the partner kinase CDK4 (which upon ac- gression machinery. They activate their partner cy- tivation by D-type cyclins phosphorylates pRB com- clin-dependent kinases (CDKs) and possibly target mitting the cell to enter S) is perpetually active them to respective substrate proteins within the throughout the cell cycle in these tumor lines. Ex- cell. CDK-mediated phosphorylation of specsc sets pression of cyclin D also may serve to discriminate of proteins drives the cell through particular phases Go vs. GI cells and, as an activation marker, to iden- or checkpoints of the cell cycle. During unper- tify the mitogenically stimulated cells entering the turbed growth of normal cells, the timing of expres- cell cycle. Differences in cyclin expression make it sion of several cyclins is discontinuous, occurring possible to discrirmna* te between cells having the at discrete and well-defined periods of the cell cy- same DNA content but residing at different phases cle. Immunocytochemical detection of cyclins in such as in G2vs. M or G,/M of a lower DNA ploidy vs. relation to cell cycle position (DNA content) by GI cells of a higher ploidy. The expression of cyclins multiparameter flow cytometry has provided a new D, E, A and B1 provides new cell cycle landmarks approach to cell cycle studies.
    [Show full text]
  • CSHL AR 1981.Pdf
    ANNUAL REPORT 1981 COLD SPRING HARBOR LABORATORY Cold Spring Harbor Laboratory Box 100, Cold Spring Harbor, New York 11724 1981 Annual Report Editors: Annette Kirk, Elizabeth Ritcey Photo credits: 9, 12, Elizabeth Watson; 209, Korab, Ltd.; 238, Robert Belas; 248, Ed Tronolone. All otherphotos by Herb Parsons. Front and back covers: Sammis Hall, new residence facility at the Banbury Conference Center.Photos by K orab, Ltd. COLD SPRING HARBOR LABORATORY COLD SPRING HARBOR, LONG ISLAND, NEW YORK OFFICERS OF THE CORPORATION Walter H. Page, Chairman Dr. Bayard Clarkson, Vice-Chairman Dr. Norton D. Zinder, Secretary Robert L. Cummings, Treasurer Roderick H. Cushman, Assistant Treasurer Dr. James D. Watson, Director William R. Udry, Administrative Director BOARD OF TRUSTEES Institutional Trustees Individual Trustees Albert Einstein College of Medicine John F. Carr Dr. Matthew Scharff Emilio G. Collado Robert L. Cummings Columbia University Roderick H. Cushman Dr. Charles Cantor Walter N. Frank, Jr. John P. Humes Duke Mary Lindsay Dr. Robert Webster Walter H. Page William S. Robertson Long Island Biological Association Mrs. Franz Schneider Edward Pulling Alexander C. Tomlinson Dr. James D. Watson Massachusetts Institute of Technology Dr. Boris Magasanik Honorary Trustees Memorial Sloan-Kettering Cancer Center Dr. Bayard Clarkson Dr. Harry Eagle Dr. H. Bentley Glass New York University Medical Center Dr. Alexander Hollaender Dr. Claudio Basilico The Rockefeller University Dr. Norton D. Zinder State University of New York, Stony Brook Dr. Thomas E. Shenk University of Wisconsin Dr. Masayasu Nomura Wawepex Society Bache Bleeker Yale University Dr. Charles F. Stevens Officers and trustees are as of December 31, 1981 DIRECTOR'S REPORT 1981 The daily lives of scientists are much less filled now be solvable or whether we must await the re- with clever new ideas than the public must im- ception of some new facts that as yet do not exist.
    [Show full text]
  • A-Camkii Controls the Growth of Human Osteosarcoma by Regulating Cell Cycle Progression Kaiyu Yuan1, Leland WK Chung2, Gene P Siegal3 and Majd Zayzafoon1
    Laboratory Investigation (2007) 87, 938–950 & 2007 USCAP, Inc All rights reserved 0023-6837/07 $30.00 a-CaMKII controls the growth of human osteosarcoma by regulating cell cycle progression Kaiyu Yuan1, Leland WK Chung2, Gene P Siegal3 and Majd Zayzafoon1 Osteosarcoma is the most frequent type of primary bone cancer in children and adolescents. These malignant osteoid forming tumors are characterized by their uncontrolled hyperproliferation. Here, we investigate the role of Ca2 þ / calmodulin-dependent protein kinase II (CaMKII) in the growth of human osteosarcoma. We show that a-CaMKII is expressed in human osteosarcoma cell lines and in primary osteosarcoma tissue derived from patients. The pharmaco- logic inhibition of CaMKII in MG-63 and 143B human osteosarcoma cells by KN-93 resulted in an 80 and 70% decrease in proliferation, respectively, and induced cell cycle arrest in the G0/G1 phase. The in vivo administration of KN-93 to mice xenografted with human osteosarcoma cells significantly decreased intratibial and subcutaneous tumor growth. Mechanistically, KN-93 and a-CaMKII siRNA increased p21(CIP/KIP) gene expression, protein levels, and decreased the phosphorylation of retinoblastoma protein and E2F transactivation. Furthermore, the inhibition of CaMKII decreased membrane-bound Tiam1 and GTP-bound Rac1, which are known to be involved in p21 expression and tumor growth in a variety of solid malignant neoplasms. Our results suggest that CaMKII plays a critical role in the growth of osteosarcoma, and its inhibition could be an attractive therapeutic target to combat conventional high-grade osteosarcoma in children. Laboratory Investigation (2007) 87, 938–950; doi:10.1038/labinvest.3700658; published online 16 July 2007 KEYWORDS: osteosarcoma; CaMKII; cell cycle; osteoblasts; p21; Rac1 Osteosarcomas are among the most frequent primary bone cycle progression.
    [Show full text]
  • Journal of Molecular Biology
    JOURNAL OF MOLECULAR BIOLOGY AUTHOR INFORMATION PACK TABLE OF CONTENTS XXX . • Description p.1 • Audience p.2 • Impact Factor p.2 • Abstracting and Indexing p.2 • Editorial Board p.2 • Guide for Authors p.6 ISSN: 0022-2836 DESCRIPTION . Journal of Molecular Biology (JMB) provides high quality, comprehensive and broad coverage in all areas of molecular biology. The journal publishes original scientific research papers that provide mechanistic and functional insights and report a significant advance to the field. The journal encourages the submission of multidisciplinary studies that use complementary experimental and computational approaches to address challenging biological questions. Research areas include but are not limited to: Biomolecular interactions, signaling networks, systems biology Cell cycle, cell growth, cell differentiation Cell death, autophagy Cell signaling and regulation Chemical biology Computational biology, in combination with experimental studies DNA replication, repair, and recombination Development, regenerative biology, mechanistic and functional studies of stem cells Epigenetics, chromatin structure and function Gene expression Receptors, channels, and transporters Membrane processes Cell surface proteins and cell adhesion Methodological advances, both experimental and theoretical, including databases Microbiology, virology, and interactions with the host or environment Microbiota mechanistic and functional studies Nuclear organization Post-translational modifications, proteomics Processing and function of biologically
    [Show full text]
  • Dual-Specificity, Tyrosine Phosphorylation-Regulated Kinases
    International Journal of Molecular Sciences Review Dual-Specificity, Tyrosine Phosphorylation-Regulated Kinases (DYRKs) and cdc2-Like Kinases (CLKs) in Human Disease, an Overview Mattias F. Lindberg and Laurent Meijer * Perha Pharmaceuticals, Perharidy Peninsula, 29680 Roscoff, France; [email protected] * Correspondence: [email protected] Abstract: Dual-specificity tyrosine phosphorylation-regulated kinases (DYRK1A, 1B, 2-4) and cdc2- like kinases (CLK1-4) belong to the CMGC group of serine/threonine kinases. These protein ki- nases are involved in multiple cellular functions, including intracellular signaling, mRNA splicing, chromatin transcription, DNA damage repair, cell survival, cell cycle control, differentiation, ho- mocysteine/methionine/folate regulation, body temperature regulation, endocytosis, neuronal development, synaptic plasticity, etc. Abnormal expression and/or activity of some of these kinases, DYRK1A in particular, is seen in many human nervous system diseases, such as cognitive deficits associated with Down syndrome, Alzheimer’s disease and related diseases, tauopathies, demen- tia, Pick’s disease, Parkinson’s disease and other neurodegenerative diseases, Phelan-McDermid syndrome, autism, and CDKL5 deficiency disorder. DYRKs and CLKs are also involved in dia- betes, abnormal folate/methionine metabolism, osteoarthritis, several solid cancers (glioblastoma, breast, and pancreatic cancers) and leukemias (acute lymphoblastic leukemia, acute megakaryoblas- Citation: Lindberg, M.F.; Meijer, L. tic leukemia), viral infections (influenza, HIV-1, HCMV, HCV, CMV, HPV), as well as infections Dual-Specificity, Tyrosine caused by unicellular parasites (Leishmania, Trypanosoma, Plasmodium). This variety of pathological Phosphorylation-Regulated Kinases implications calls for (1) a better understanding of the regulations and substrates of DYRKs and (DYRKs) and cdc2-Like Kinases CLKs and (2) the development of potent and selective inhibitors of these kinases and their evaluation (CLKs) in Human Disease, an as therapeutic drugs.
    [Show full text]
  • Saturday, April 14, 2007
    Saturday, April 14, 2007 8:00-10:00 AM Educational Sessions Systems Biology as an Integrative Approach to Cancer, Arul M. Chinnaiyan, Chairperson, Room 403 A-B, Los Angeles Convention How to Design and Interpret Large-Scale Sequence Analyses of Center, p. 65 Human Cancer, Victor E. Velculescu, Chairperson, Room 408 A-B, Los Angeles Convention Center, p. 57 Targeted Cancer Therapy: Mono-specific versus Multi-targeted Strategies, Axel Ullrich, Chairperson, Concourse E, Los Angeles Manipulating the Immune System in Cancer Immunotherapy, Convention Center, p. 65 James P. Allison, Chairperson, Petree C, Los Angeles Convention Saturday Event Schedule Center, p. 58 Targeted Delivery of siRNA and Small Molecule Inhibitors, Jackson B. Gibbs, Chairperson, Concourse F, Los Angeles Convention Modeling Chemoprevention in Mice: The Next Generation, Cory Center, p. 66 Abate-Shen, Chairperson, Room 515 B, Los Angeles Convention Center, p. 58 The Ras Pathway: From Cancer Biology to Translational Opportunities, Dafna Bar-Sagi, Chairperson, Room 304 A-C, Los Novel Approaches to Drug Delivery in Cancer, Mark E. Davis, Angeles Convention Center, p. 66 Chairperson, Room 304 A-C, Los Angeles Convention Center, p. 59 Oxidative Stress and Senescence, Amato J. Giaccia, Chairperson, Room 515 A, Los Angeles Convention Center, p. 59 10:15 AM-12:15 PM Methods Workshops The Polygenic Basis of Phenotypic Variation and Disease: Lessons from Humans and Model Organisms, Bruce A. J. Ponder, Advances in Imaging: From Molecules and Live-Cell Research to Chairperson, Petree D, Los Angeles Convention Center, p. 60 Animal Models and Clinical Applications, Jiri Bartek, Chairperson, Room 515 B, Los Angeles Convention Center, p.
    [Show full text]