DOCSLIB.ORG

Type II Cgmp‑Dependent Protein Kinase Inhibits EGF‑Induced JAK/STAT Signaling in Gastric Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Type II Cgmp‑Dependent Protein Kinase Inhibits EGF‑Induced JAK/STAT Signaling in Gastric Cancer Cells MOLECULAR MEDICINE REPORTS 14: 1849-1856, 2016 Type II cGMP‑dependent protein kinase inhibits EGF‑induced JAK/STAT signaling in gastric cancer cells MIN WU, YAN WU, TING LAN, LU JIANG, HAI QIAN and YONGCHANG CHEN Department of Physiology, School of Medicine, Jiangsu University, Zhenjiang, Jiangsu 212013, P.R. China Received June 20, 2015; Accepted June 7, 2016 DOI: 10.3892/mmr.2016.5452 Abstract. Previous research has demonstrated that type II Introduction cyclic guanosine monophosphate (cGMP)-dependent pro- tein kinase (PKG II) inhibited epidermal growth factor Janus kinase (JAK)-signal transducer and activator of tran- (EGF)-initiated signal transduction of MAPK-mediated, scription (STAT)-mediated signal transduction pathway is PI3K/Akt-mediated and PLCγ1-mediated pathways through important for regulating DNA transcription and the activi- blocking EGF-induced phosphorylation/activation of EGF re- ties of the cell cycle. This pathway has three main signaling ceptor (EGFR). As EGF/EGFR signaling also initiated signal components: Receptors, JAK, and STAT (1). Extracellular transduction of the Janus kinase (JAK)/signal transducer and signal molecules, including interferon, interleukin and growth activator of transcription (STAT)-mediated pathway, the pres- factors, can bind with their receptors and cause activation of ent study was performed to investigate whether PKG II exerts the kinase function of JAK through auto-phosphorylation. an inhibitory effect this pathway. AGS human gastric cancer Consequently, STAT binds to the phosphorylated receptor, cell line was infected with adenoviral constructs encoding the where it is phosphorylated by JAK. The phosphorylated STAT cDNA of PKG II (Ad-PKG II), to increase the expression of protein then binds to another phosphorylated STAT protein to PKG II, and treated with 8-pCPT-cGMP to activate the kinase. form STATs dimer complex. The complex can be translocated Western blotting was performed to detect the phosphoryla- into the nucleus and there it binds to DNA, promotes transcrip- tion/activation of EGFR, JAK1, JAK2, STAT1 and STAT3 tion of genes and causes the expression of proteins that affect and the expression of cell cycle-associated proteins, includ- basic cell activities, including cell growth, differentiation and ing cyclin D1 and cyclin E. EGF-induced cell cycle changes death (2). were detected by flow cytometry. Transcriptional activity was Type II cyclic guanosine monophosphate determined by a reporter gene assay. The results demonstrated (cGMP)- dependent protein kinase (PKG II) is a serine/threo- that EGF treatment increased the phosphorylation of EGFR, nine kinase. It was identified >30 years ago and has been JAK1, JAK2, STAT1 and STAT3, increased the expression typically implicated only in several physiological functions, levels of cyclin D1 and cyclin E, promoted the cells to enter including intestinal secretion, bone growth, and learning S phase, and stimulated transcriptional activity in the cells. and memory (3). However, increasing evidence has demon- Increased PKG II activity through infecting the cells with strated that this kinase is involved in regulating proliferation Ad-PKG II and activating the kinase with 8-pCPT-cGMP ef- and apoptosis of cells, and is potentially associated with ficiently reversed the changes caused by EGF. The results sug- tumorigenesis. For example, research data demonstrated that gest that PKG II inhibits EGF-induced signal transduction of PKG II inhibited proliferation and/or induced apoptosis of the JAK/STAT‑mediated pathway and further confirms that human prostate cells, neruoglioma cells and breast cancer PKG II may be a cancer inhibitor. cells (4-6). Additionally, the inhibitory effect of PKG II on gastric cancer cells for several years has been investigated. An important finding was that PKG II blocks the activation of epidermal growth factor receptor (EGFR), the initiating event of the epidermal growth factor (EGF)-induced signal transduction process (7,8). As the activation of EGFR can initiate the signal transduction of several pathways, including phospholipase Cγ-mediated, phosphatidylinositol 3-kinase Correspondence to: Professor Yongchang Chen, Department of Physiology, School of Medicine, Jiangsu University, 301 Xuefu Road, (PI3K)/Akt serine/threonine kinase 1 (Akt)-mediated and Zhenjiang, Jiangsu 212013, P.R. China JAK-STAT-mediated pathways (9-11), it is expected that the E-mail: [email protected] blockage of the EGFR activation by PKG II will inhibit the corresponding signal transductions and exert a wide-range Key words: cell cycle, EGFR, gastric cancer cells, JAK, PKG II, of effects on the biological activities of cancer cells. The STAT present study was performed to investigate the inhibitory effect of PKG II on EGF/EGFR-initiated signal transduction of the JAK-STAT-mediated pathway. 1850 WU et al: PKG II INHIBITS EGF/EGFR INDUCED JAK/STAT SIGNALING A A B B Figure 1. PKG II inhibits EGF-induced Y1068 phosphorylation of EGFR. AGS cells were infected with Ad-LacZ or Ad-PKG II for 24 h and serum-starved Figure 2. PKG II inhibits EGF-induced Tyr1022 phosphorylation of JAK1. overnight. In LacZ + EGF and PKG II + EGF groups, cells were incubated (A) AGS cells were treated and the cell lysate was subjected to western with 100 ng/ml EGF for 5 min. In Ad-PKG II+cGMP + EGF groups, cells blotting with antibody against p-JAK1 (Tyr1022) to detect the Tyr1022 phos- were treated with 8-pCPT-cGMP (100 or 250 µM) for 1 h and then with EGF phorylation of JAK1. β-actin was detected as a loading control and PKG II (100 ng/ml) for 5 min. (A) The cells were harvested and lysed as described was detected to demonstrate the efficiency of the infection with Ad‑PKG II. in material and methods and the cell lysate was subjected to western blotting (B) Densitometry analysis was performed to quantify the positive bands and with antibody against p-EGFR (Tyr1068) to detect the phosphorylation of the ratio of p-JAK1/β-actin was determined. The data are presented as the EGFR. β-actin was detected as a loading control and PKG II was detected to mean ± standard deviation from 3 independent experiments. *P<0.05 vs. con- demonstrate the efficiency of the infection with Ad‑PKG II. (B) Densitometry trol group and LacZ group; &P<0.05vs. LacZ + EGF group and PKG II + EGF analysis was performed to quantify the positive bands and the ratio of group. p-, phosphorylated; JAK1, Janus kinase 1; PKG II, type II cGMP-den- p-EGFR/β-actin was determined. The data are presented as the mean ± stan- pendent protein kinase; Ad, adenovirus; LacZ, β-galactosidase; EGF, * dard deviation from 3 independent experiments P<0.05 vs. control group epidermal growth factor; cGMP, cyclic guanosine monophosphate. and LacZ group; &P<0.05 vs. LacZ + EGF group and PKG II+EGF group. p, phosphorylated; EGFR, epidermal growth factor receptor; PKG II, type II cGMP-denpendent protein kinase; Ad, adenovirus; LacZ, β-galactosidase; EGF, epidermal growth factor; cGMP, cyclic guanosine monophosphate. Polyclonal rabbit antibody against PKG II was purchased from Abgent, Inc. (San Diego, CA, USA; cat no. AP8001a; dilution, 1:200). Monoclonal mouse anti-β-actin antibody Materials and methods was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA; cat no. sc-47778; dilution, 1:1,000). Polyclonal Cell line and reagents. AGS human gastric cancer rabbit anti-phosphorylated (p)-EGFR (Tyr1068) was obtained cell line was provided by the Institute of Cell Biology from Cell Signaling Technology, Inc. (Danvers, MA, USA; (Shanghai, China). Adenoviral vectors encoding the cDNA cat no. 2236; dilution, 1:1,000). Polyclonal rabbit anti-p-JAK1 of β-galactosidase (β-gal) and PKG II (Ad-LacZ and (cat no. BS4108; dilution, 1:500), anti-p-JAK2 (cat no. BS4109; Ad-PKG II, respectively), as well as the SRE-luc plasmid, dilution, 1:500), anti-p-STAT1 (cat no. BS4178; dilution, RSV-β‑gal plasmid and CMV vector plasmid were gifts from 1:500) and anti-p-STAT3 (cat. no. BS4180; dilution, 1:500) Dr Gerry Boss and Dr Renate Pilz (University of California, antibodies were purchased from Bioworld Technology, San Diego, CA, USA). Dulbecco's modified Eagle's media Inc. (St. Louis Park, MN, USA). Monoclonal mouse (DMEM) and fetal bovine serum (FBS) were obtained from anti-cyclin D1 (cat. no. BMO771; dilution, 1:400) and poly- Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). clonal rabbit anti-cyclin E (cat no. BAO774; dilution, 1:400) MOLECULAR MEDICINE REPORTS 14: 1849-1856, 2016 1851 A A B B Figure 3. PKG II inhibits EGF-induced Tyr 1007/Tyr 1008 phosphoryla- Figure 4. PKG II inhibits EGF-induced Tyr701 phosphorylation of STAT1. tion of JAK2. (A) AGS cells were treated same as in Fig. 1 and the cell (A) AGS cells were treated and the cell lysate was subjected to western lysate was subjected to Western blotting with antibody against p-JAK2 (Tyr blotting with antibody against p-STAT1 (Tyr701) to detect the Tyr701 phos- 1007/Tyr 1008) to detect the Tyr 1007/Tyr 1008 phosphorylation of JAK2. phorylation of STAT1. β-actin was detected as loading control and PKG II β-actin was detected as loading control and PKG II was detected to show was detected to demonstrate the efficiency of the infection with Ad‑PKG II. the efficiency of the infection with Ad‑PKG II. (B) Densitometry analysis (B) Densitometry analysis was performed to quantify the positive bands was performed to quantify the positive bands and the ratio of p-JAK2/ and the ratio of p-STAT1/β-actin was determined. The data are presented β-actin was determined. The data are presented as the mean ± standard as the mean ± standard deviation from 3 independent experiments. *P<0.05 deviation from 3 independent experiments. *P<0.05 vs. control group and vs. control group and LacZ group; &P<0.05 vs.
Load more

Recommended publications
  • Phosphatidylinositol-3-Kinase Related Kinases (Pikks) in Radiation-Induced Dna Damage
    Mil. Med. Sci. Lett. (Voj. Zdrav. Listy) 2012, vol. 81(4), p. 177-187 ISSN 0372-7025 DOI: 10.31482/mmsl.2012.025 REVIEW ARTICLE PHOSPHATIDYLINOSITOL-3-KINASE RELATED KINASES (PIKKS) IN RADIATION-INDUCED DNA DAMAGE Ales Tichy 1, Kamila Durisova 1, Eva Novotna 1, Lenka Zarybnicka 1, Jirina Vavrova 1, Jaroslav Pejchal 2, Zuzana Sinkorova 1 1 Department of Radiobiology, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic 2 Centrum of Advanced Studies, Faculty of Health Sciences in Hradec Králové, University of Defence in Brno, Czech Republic. Received 5 th September 2012. Revised 27 th November 2012. Published 7 th December 2012. Summary This review describes a drug target for cancer therapy, family of phosphatidylinositol-3 kinase related kinases (PIKKs), and it gives a comprehensive review of recent information. Besides general information about phosphatidylinositol-3 kinase superfamily, it characterizes a DNA-damage response pathway since it is monitored by PIKKs. Key words: PIKKs; ATM; ATR; DNA-PK; Ionising radiation; DNA-repair ABBREVIATIONS therapy and radiation play a pivotal role. Since cancer is one of the leading causes of death worldwide, it is DSB - double stand breaks, reasonable to invest time and resources in the enligh - IR - ionising radiation, tening of mechanisms, which underlie radio-resis - p53 - TP53 tumour suppressors, tance. PI - phosphatidylinositol. The aim of this review is to describe the family INTRODUCTION of phosphatidyinositol 3-kinases (PI3K) and its func - tional subgroup - phosphatidylinositol-3-kinase rela - An efficient cancer treatment means to restore ted kinases (PIKKs) and their relation to repairing of controlled tissue growth via interfering with cell sig - radiation-induced DNA damage.
    [Show full text]
  • Signal Transducer and Activator of Transcription 5A/B in Prostate and Breast Cancers
    Endocrine-Related Cancer (2008) 15 367–390 REVIEW Signal transducer and activator of transcription 5A/B in prostate and breast cancers Shyh-Han Tan and Marja T Nevalainen Department of Cancer Biology, Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street, BLSB 309, Philadelphia, Pennsylvania 19107, USA (Correspondence should be addressed to M T Nevalainen; Email: [email protected]) Abstract Protein kinase signaling pathways, such as Janus kinase 2-Signal transducer and activator of transcription 5A/B (JAK2-STAT5A/B), are of significant interest in the search for new therapeutic strategies in both breast and prostate cancers. In prostate cancer, the components of the JAK2- STAT5A/B signaling pathway provide molecular targets for small-molecule inhibition of survival and growth signals of the cells. At the same time, new evidence suggests that the STAT5A/B signaling pathway is involved in the transition of organ-confined prostate cancer to hormone- refractory disease. This implies that the active JAK2-STAT5A/B signaling pathway potentially provides the means for pharmacological intervention of clinical prostate cancer progression. In addition, active STAT5A/B may serve as a prognostic marker for identification of those primary prostate cancers that are likely to progress to aggressive disease. In breast cancer, the role of STAT5A/B is more complex. STAT5A/B may have a dual role in the regulation of malignant mammary epithelium. Data accumulated from mouse models of breast cancer suggest that in early stages of breast cancer STAT5A/B may promote malignant transformation and enhance growth of the tumor. This is in contrast to established breast cancer, where STAT5A/B may mediate the critical cues for maintaining the differentiation of mammary epithelium.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Cyclin E1 and RTK/RAS Signaling Drive CDK Inhibitor Resistance Via Activation of E2F and ETS
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.2 Cyclin E1 and RTK/RAS signaling drive CDK inhibitor resistance via activation of E2F and ETS Barbie Taylor-Harding1, Paul-Joseph Aspuria1, Hasmik Agadjanian1, Dong-Joo Cheon1, Takako Mizuno1,2, Danielle Greenberg1, Jenieke R. Allen1,2, Lindsay Spurka3, Vincent Funari3, Elizabeth Spiteri4, Qiang Wang1,5, Sandra Orsulic1, Christine Walsh1,6, Beth Y. Karlan1,6, W. Ruprecht Wiedemeyer1 1 Women’s Cancer Program at the Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 2Graduate Program in Biomedical Sciences and Translational Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 4Department of Pathology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 5Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA 6 Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA 90048, USA Correspondence to: W. Ruprecht Wiedemeyer, e-mail: [email protected] Keywords: Cyclin-dependent kinase inhibitors, palbociclib, dinaciclib, cyclin E1, ovarian cancer Received: July 15, 2014 Accepted: November 02, 2014 Published: December 22, 2014 ABSTRACT High-grade serous ovarian cancers (HGSOC) are genomically complex, heterogeneous cancers with a high mortality rate, due to acquired chemoresistance and lack of targeted therapy options. Cyclin-dependent kinase inhibitors (CDKi) target the retinoblastoma (RB) signaling network, and have been successfully incorporated into treatment regimens for breast and other cancers. Here, we have compared mechanisms of response and resistance to three CDKi that target either CDK4/6 or CDK2 and abrogate E2F target gene expression.
    [Show full text]
  • Expression of Androgen Receptor Coregulators in Prostate Cancer
    1032 Vol. 10, 1032–1040, February 1, 2004 Clinical Cancer Research Expression of Androgen Receptor Coregulators in Prostate Cancer Marika J. Linja,1 Kati P. Porkka,1 Conclusions: These findings suggest that the decreased Zhikang Kang,3 Kimmo J. Savinainen,1 expression of PIAS1 and SRC1 could be involved in the progression of prostate cancer. In addition, gene amplifica- Olli A. Ja¨nne,3 Teuvo L. J. Tammela,2 4 3 tion of SRC1 in one of the xenografts implies that, in some Robert L. Vessella, Jorma J. Palvimo, and tumors, genetic alteration of SRC1 may provide a growth 1 Tapio Visakorpi advantage. 1Laboratory of Cancer Genetics, Institute of Medical Technology and 2Department of Urology, University of Tampere and Tampere University Hospital, Tampere, Finland; 3Institute of Biomedicine, INTRODUCTION 4 University of Helsinki, Helsinki, Finland; and Department of The critical role of androgens in the development of pros- Urology, University of Washington, Seattle, Washington tate cancer is indicated, for example, by the fact that prostate cancer does not develop in men castrated early in their life (1). ABSTRACT In addition, more that 50 years ago, Huggins and Hodges (2) Purpose: The androgen receptor (AR)-mediated signal- showed that hormonal therapy is an effective treatment for ing pathway seems to be essentially involved in the develop- prostate cancer. Subsequently, androgen withdrawal has become ment and progression of prostate cancer. In vitro studies the standard and is practically the only effective treatment for have shown that altered expression of AR coregulators may advanced prostate cancer. Although most prostate carcinomas significantly modify transcriptional activity of AR, suggest- are originally androgen dependent, they eventually become hor- ing that these coregulators could also contribute to the mone refractory during treatment (3).
    [Show full text]
  • Phosphatidylinositol 3-Kinase Mediates Proliferative Signals in Intestinal Epithelial Cells H Sheng, J Shao, C M Townsend Jr, B M Evers
    1472 COLON Gut: first published as 10.1136/gut.52.10.1472 on 11 September 2003. Downloaded from Phosphatidylinositol 3-kinase mediates proliferative signals in intestinal epithelial cells H Sheng, J Shao, C M Townsend jr, B M Evers ............................................................................................................................... Gut 2003;52:1472–1478 Background and aims: Determination of intracellular signalling pathways that mediate intestinal epithelial proliferation is fundamental to the understanding of the integrity and function of the intestinal tract under normal and diseased conditions. The phosphoinositide 3-kinase (PI3K)/Akt pathway transduces signals See end of article for initiated by growth factors and is involved in cell proliferation and differentiation. In this study, we assessed authors’ affiliations the role of PI3K/Akt in transduction of proliferative signals in intestinal epithelial cells. ....................... Methods: A rat intestinal epithelial (RIE) cell line and human colorectal cancer HCA-7 and LS-174 cell lines Correspondence to: served as in vitro models. The Balb/cJ mouse was the in vivo model. Dr H Sheng, Department of Results: PI3K activation was critical for G1 cell cycle progression of intestinal epithelial cells. Ectopic Surgery, University of expression of either active p110a or Akt-1 increased RIE cell proliferation. In vivo experiments Texas Medical Branch, 301 University Boulevard, demonstrated that PI3K activation was closely associated with the proliferative activity of intestinal mucosa. Galveston, Texas 77555, Treatment of mice with PI3K inhibitors blocked induction of PI3K activity and attenuated intestinal mucosal USA; [email protected] proliferation associated with oral intake. Epidermal growth factor and transforming growth factor a Accepted for publication stimulated PI3K activation which was required for growth factor induced expression of cyclin D1.
    [Show full text]
  • Materials Express
    Materials Express 2158-5849/2020/10/1836/010 Copyright © 2020 by American Scientific Publishers All rights reserved. doi:10.1166/mex.2020.1822 Printed in the United States of America www.aspbs.com/mex Upregulation of signal transducer and activator of transcription 4 promotes osteoblast activity by activating AMP-activated protein kinase based on cationic liposome transfection Tao Jiang1,4,†, Qingzhen Chen1,2,†,MinShao2,∗, Zhen Shen3, Gang Wang3, Qinsheng Wang2, and Zhenming Zeng2 1The Third Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, Guangdong, PR China 2Department of Orthopedics, The Third Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou 510240, Guangdong, PR China 3The First Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, Guangdong, PR China 4 Department of Orthopedics, GuangdongIP: 192.168.39.151 Second Traditional On: Thu, Chinese 30 Sep Medicine 2021 19:20:15 Hospital, Guangzhou 510095, Guangdong, PR China Copyright: American Scientific Publishers Delivered by Ingenta Article ABSTRACT Activation of Protein Kinase AMP-Activated Catalytic Subunit Alpha (AMPK) is an important regulatory path- way for osteogenic differentiation. STAT4 acts as a transcriptional activity factor to regulate the transcription of many genes and is potentially a regulatory factor for AMPK transcription activity. To confirm the regulatory effect of STAT4 on AMPK and the effect of STAT4 on osteogenic differentiation, the promoter sequence of AMPK was analyzed via bioinformatics, the STAT4 overexpression vector was constructed and transfected into human osteoblast-like cells MG-63 by cationic liposome, fluorescence quantitative PCR (RT-qPCR) and western blotting technologies were used to detect the effect of STAT4 on the expression of AMPK.MTT and ALP activity assays were also used to verify the effect of STAT4 on the proliferation and maturation of osteoblasts by regulating AMPK expression.
    [Show full text]
  • Modulation of STAT Signaling by STAT-Interacting Proteins
    Oncogene (2000) 19, 2638 ± 2644 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Modulation of STAT signaling by STAT-interacting proteins K Shuai*,1 1Departments of Medicine and Biological Chemistry, University of California, Los Angeles, California, CA 90095, USA STATs (signal transducer and activator of transcription) play important roles in numerous cellular processes Interaction with non-STAT transcription factors including immune responses, cell growth and dierentia- tion, cell survival and apoptosis, and oncogenesis. In Studies on the promoters of a number of IFN-a- contrast to many other cellular signaling cascades, the induced genes identi®ed a conserved DNA sequence STAT pathway is direct: STATs bind to receptors at the named ISRE (interferon-a stimulated response element) cell surface and translocate into the nucleus where they that mediates IFN-a response (Darnell, 1997; Darnell function as transcription factors to trigger gene activa- et al., 1994). Stat1 and Stat2, the ®rst known members tion. However, STATs do not act alone. A number of of the STAT family, were identi®ed in the transcription proteins are found to be associated with STATs. These complex ISGF-3 (interferon-stimulated gene factor 3) STAT-interacting proteins function to modulate STAT that binds to ISRE (Fu et al., 1990, 1992; Schindler et signaling at various steps and mediate the crosstalk of al., 1992). ISGF-3 consists of a Stat1:Stat2 heterodimer STATs with other cellular signaling pathways. This and a non-STAT protein named p48, a member of the article reviews the roles of STAT-interacting proteins in IRF (interferon regulated factor) family (Levy, 1997).
    [Show full text]
  • Targeting the Phosphatidylinositol 3-Kinase Signaling Pathway in Acute
    Integrative Cancer Science and Therapeutics Review Article ISSN: 2056-4546 Targeting the phosphatidylinositol 3-kinase signaling pathway in acute myeloid leukemia Ota Fuchs* Institute of Hematology and Blood Transfusion, Prague, Czech Republic Abstract The phosphatidylinositol-3-kinase-Akt (protein kinase B) - mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is often dysregulated in cancer, including hematological malignancies. Primary acute myeloid leukemia (AML) cell populations may include various subclones at the time of diagnosis. A relapse can occur due to regrowth of the originally dominating clone, a subclone detectable at the time of first diagnosis, or a new clone derived either from the original clone or from remaining preleukemic stem cells. Inhibition of mTOR signaling has in general modest growth-inhibitory effects in preclinical AML models and clinical trials. Therefore, combination of allosteric mTOR inhibitors with standard chemotherapy or targeted agents has a greater anti-leukemia efficacy. Dual mTORC1/2 inhibitors, and dual PI3K/mTOR inhibitors show greater activity in pre-clinical AML models. Understanding the role of mTOR signaling in leukemia stem cells is important because AML stem cells may become chemoresistant by displaying aberrant signaling molecules, modifying epigenetic mechanisms, and altering the components of the bone marrow microenvironment. The PI3K/Akt/mTOR signaling pathway is promising target in the treatment of hematological malignancies, including AML, especially by using of combinations of mTOR inhibitors with conventional cytotoxic agents. Introduction syndromes, chronic myelogenous leukemia (CML), multiple myeloma and lymphoid leukemias and lymphomas [42-54]. Below, I discuss the The mammalian target of rapamycin (mTOR) is a serine/threonine PI3K/Akt/mTOR pathway and its role in AML.
    [Show full text]
  • Interpretation of Cytokine Signaling Through the Transcription Factors STAT5A and STAT5B
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Interpretation of cytokine signaling through the transcription factors STAT5A and STAT5B Lothar Hennighausen1 and Gertraud W. Robinson Laboratory of Genetics and Physiology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892, USA Transcription factors from the family of Signal Trans- the “wrong” STATs and thus acquire inappropriate cues. ducers and Activators of Transcription (STAT) are acti- We propose that mice with mutations in various com- vated by numerous cytokines. Two members of this fam- ponents of the JAK–STAT signaling pathway are living ily, STAT5A and STAT5B (collectively called STAT5), laboratories, which will provide insight into the versa- have gained prominence in that they are activated by a tility of signaling hardware and the adaptability of the wide variety of cytokines such as interleukins, erythro- software. poietin, growth hormone, and prolactin. Furthermore, constitutive STAT5 activation is observed in the major- ity of leukemias and many solid tumors. Inactivation Historical perspective studies in mice as well as human mutations have pro- In 1994, Bernd Groner and colleagues (Wakao et al. vided insight into many of STAT5’s functions. Disrup- 1994), then at the Friedrich Miescher Institute in Basel, tion of cytokine signaling through STAT5 results in a cloned a cDNA from lactating ovine mammary tissue variety of cell-specific effects, ranging from a defective that encoded a transcription factor promoting prolactin- immune system and impaired erythropoiesis, the com- induced transcription of milk protein genes in mammary plete absence of mammary development during preg- epithelium.
    [Show full text]
  • Cytometry of Cyclin Proteins
    Reprinted with permission of Cytometry Part A, John Wiley and Sons, Inc. Cytometry of Cyclin Proteins Zbigniew Darzynkiewicz, Jianping Gong, Gloria Juan, Barbara Ardelt, and Frank Traganos The Cancer Research Institute, New York Medical College, Valhalla, New York Received for publication January 22, 1996; accepted March 11, 1996 Cyclins are key components of the cell cycle pro- gests that the partner kinase CDK4 (which upon ac- gression machinery. They activate their partner cy- tivation by D-type cyclins phosphorylates pRB com- clin-dependent kinases (CDKs) and possibly target mitting the cell to enter S) is perpetually active them to respective substrate proteins within the throughout the cell cycle in these tumor lines. Ex- cell. CDK-mediated phosphorylation of specsc sets pression of cyclin D also may serve to discriminate of proteins drives the cell through particular phases Go vs. GI cells and, as an activation marker, to iden- or checkpoints of the cell cycle. During unper- tify the mitogenically stimulated cells entering the turbed growth of normal cells, the timing of expres- cell cycle. Differences in cyclin expression make it sion of several cyclins is discontinuous, occurring possible to discrirmna* te between cells having the at discrete and well-defined periods of the cell cy- same DNA content but residing at different phases cle. Immunocytochemical detection of cyclins in such as in G2vs. M or G,/M of a lower DNA ploidy vs. relation to cell cycle position (DNA content) by GI cells of a higher ploidy. The expression of cyclins multiparameter flow cytometry has provided a new D, E, A and B1 provides new cell cycle landmarks approach to cell cycle studies.
    [Show full text]
  • Stats: Transcriptional Control and Biological Impact
    REVIEWS STATS: TRANSCRIPTIONAL CONTROL AND BIOLOGICAL IMPACT David E. Levy* and J. E. Darnell Jr‡ Extracellular proteins bound to cell-surface receptors can change nuclear gene expression patterns in minutes, with far-reaching consequences for development, cell growth and homeostasis. The signal transducer and activator of transcription (STAT) proteins are among the most well studied of the latent cytoplasmic signal-dependent transcription-factor pathways. In addition to several roles in normal cell decisions, dysregulation of STAT function contributes to human disease, making the study of these proteins an important topic of current research. SIGNALLING SH2 DOMAIN This year marks the tenth anniversary of the recogni- and transphosphorylation on tyrosine residues, releasing (Src-homology-2 domain). A tion of the STAT proteins, named after their dual role as their intrinsic catalytic activity. Tyrosine phosphoryla- protein motif that recognizes signal transducers and activators of transcription1–4. tion by activated JAKs of cytokine-receptor cytoplasmic and binds tyrosine- These transcription factors are latent in the cytoplasm domains then provides binding sites for the Src-homol- phosphorylated sequences, and thereby has a key role in relaying until they are activated by extracellular signalling pro- ogy-2 (SH2) DOMAIN of the STAT proteins. The STAT pro- cascades of signal transduction. teins (mainly cytokines and growth factors, but also teins are then recruited to the JAKs, whereupon they are some peptides) that bind to specific cell-surface recep- phosphorylated on a single tyrosine residue (around tors. These extracellular-signalling proteins can activate residue 700 of their 750–850-amino-acid sequence). various tyrosine kinases in the cell that phosphorylate Although the interactions and consequences of STAT STAT proteins.
    [Show full text]