Materials Express

Upregulation of signal transducer and activator of transcription 4 promotes osteoblast activity by activating AMP-activated protein kinase based on cationic liposome transfection

Tao Jiang1,4,†, Qingzhen Chen1,2,†,MinShao2,∗, Zhen Shen3, Gang Wang3, Qinsheng Wang2, and Zhenming Zeng2 1The Third Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, Guangdong, PR China 2Department of Orthopedics, The Third Affiliated Hospital, Guangzhou University of Chinese Medicine, Guangzhou 510240, Guangdong, PR China 3The First Clinical Medical College, Guangzhou University of Chinese Medicine, Guangzhou 510405, Guangdong, PR China 4 Department of Orthopedics, GuangdongIP: 192.168.39.151 Second Traditional On: Thu, Chinese 30 Sep Medicine 2021 19:20:15 Hospital, Guangzhou 510095, Guangdong, PR China Copyright: American Scientific Publishers Delivered by Ingenta Article ABSTRACT Activation of Protein Kinase AMP-Activated Catalytic Subunit Alpha (AMPK) is an important regulatory pathway for osteogenic differentiation. STAT4 acts as a transcriptional activity factor to regulate the transcription of many genes and is potentially a regulatory factor for AMPK transcription activity. To confirm the regulatory effect of STAT4 on AMPK and the effect of STAT4 on osteogenic differentiation, the promoter sequence of AMPK was analyzed via bioinformatics, the STAT4 overexpression vector was constructed and transfected into human osteoblast-like cells MG-63 by cationic liposome, fluorescence quantitative PCR (RT-qPCR) and western blotting technologies were used to detect the effect of STAT4 on the expression of AMPK.MTT and ALP activity assays were also used to verify the effect of STAT4 on the proliferation and maturation of osteoblasts by regulating AMPK expression. Our results showed that STAT4 was a co-transcriptional regu- lator of AMPK1 and AMPK2, which combined the enrichment region of CpG on the promoter sequence of AMPK1/2. Overexpression of STAT4 significantly increased the expression of AMPK1 and AMPK2, which promoted the proliferation and maturation of osteoblasts. We concluded that STAT4 was a transcriptional activator of AMPK and promoting STAT4 expression enhances the proliferation and differentiation activity of AMPK in osteoblasts. Keywords: STAT4, AMPK, Bioinformatics Analysis, Osteogenic Differentiation.

1. INTRODUCTION cause of osteoporosis. Bone formation concerns the growth The discrepancy in bone formation and bone resorption and differentiation of osteoblasts [1–3]. Many studies have processes, caused by metabolic disorders, is an important found that the activation of AMP-activated protein kinase

∗Author to whom correspondence should be addressed. (AMPK) plays a key role in osteogenic differentiation, †These two authors contributed equally to this work. which is due to the regulation of energy metabolism

1836 Mater. Express, Vol. 10, No. 11, 2020 Upregulation of STAT4 promotes osteoblast activity by activating AMPK Materials Express Jiang et al. by AMPK, which affects bone metabolism processes 2. MATERIALS AND METHODS and thus influences osteogenic differentiation [4–9]. For 2.1. Bioinformatic Analysis of Promoter Sequences example, Ginsenoside Rd increases the phosphorylation Common databases such as NCBI and Ensembl were of AMPK to induce differentiation and calcification of used to find gene information of AMPKá1/2. The pro- osteoblasts, inhibition of AMPK expression, and activation moters of common genes were about 1,000 bp before and which significantly affects the differentiation of MC3T3- 1,000 bp after the transcriptional initiation sites. Using E1 cells [8]. AMPK is the core regulatory pathway in the websites BDGP and FPROM, the target gene pro- the process of osteogenic differentiation. It is impor- moters were predicted from the promoter region found tant to explore the mechanism of AMPK in osteogenic using Ensembl. The methylation sites in the promoter differentiation to contribute to the prevention and region were predicted by the websites Ensembl, CpG treatment of osteoporosis. Island, CpG Finder, EMBOSS, and GPMiner to pre- AMPK displays a significant difference in transcription dict the DNA methylation regulatory region. GPMiner level in patients with osteoporosis, which may be related and ROM were used to predict transcription binding to signal transducer and activator of transcription (STAT) factors in this promoter region as well as target gene family proteins. Generally speaking, STAT proteins com- transcription activating factors and their action sites bine with CpG islands, reduce levels of gene methyla- (Table I). tion, and regulate gene transcription levels; In addition, the STAT family translocates into the nucleus after dimer 2.2. Construction of STAT4 Overexpression Plasmid formation or other activation forms, directly targets the Vector pcDNA3.1(+)-STAT4 target gene transcription initiation region, and activates Full length CDS sequences of STAT4 and the transcription activity. However, there are few studies con- pcDNA3.1+ plasmid vector (Invitrogen, Carlsbad, CA, cerning the transcriptional activators regulating AMPK. In USA) labeled with enhanced green fluorescent protein this study, through bioinformatic analysis of the AMPK (EGFP) gene were digested by HindIII and BamHI promoter sequence, we screened the transcriptional activa- (TAKARA, Tokyo, Japan) at 37 C for 1 hour. T4 Article tors regulating the transcription level of AMPK and veri- DNA ligase (NEB, Hitchin, Herts, UK) was used to fied them at the cell level. In addition,IP: 192.168.39.151 the STAT signaling On: Thu,react 30 Sep at 252021C 19:20:15 for 10 minutes to connect the target pathway is a transcription activator, whichCopyright: correlates American with Scientificgene and Publishers pcDNA3.1(+) plasmid vector. The recombinant the occurrence and development of osteoporosis.Delivered When bypcDNA3.1( Ingenta +)-STAT4 plasmid vector was transfected into the STAT signaling pathway is inhibited, the expression of DH5á competent cells (TAKARA, Tokyo, Japan). Posi- BMP9 and ALP increased, which promotes bone forma- tive clones were selected for amplification. The plasmid- tion [10–14]. STAT4 is predicted to be a potential tran- carrier was extracted via plasmid extraction kit (Thermo scriptional activator of AMPK, but its effect on AMPK Fisher Scientific, Waltham, MA, USA). Subsequently, dou- and osteogenic differentiation needs further clarification. ble digestion and DNA sequencing were performed to Cationic liposomes [15] are effective and important identify the plasmid vectors. materials for the analysis of gene function and they have been widely used in to study osteogenic ability in 2.3. Cell Culture and Plasmid Vector Transfection vitro. Therefore, in this study, cationic liposomes were MG-63 cells were cultured with minimum essential used to transfer STAT4 recombinant gene into MG-63 medium (MEM) including 10% Fetal Bovine Serum and cells, interfere with the expression of STAT4, detect the 1% Penicillin-Streptomycin solution, at 37 C and 5% effect of STAT4 differential expression on AMPK expres- CO2. After the cell fusion rate was above 80%, adher- sion, and ultimately explore its effect on osteogenesis ent cells were made into a single cell suspension via in vitro. hatching with trypsin for 3 minutes, and then subcultured

Table I. Websites of various online websites.

Website Link address

Ensembl http://asia.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000132356;r=5:40759379-40798374 FPROM http://www.softberry.com/cgi-bin/programs/promoter/fprom.pl BDGP http://www.fruitﬂy.org/cgi-bin/seq_tools/promoter.pl CpG Island https://sites.ualberta.ca/∼stothard/javascript/cpg_islands.html CpG Finder http://www.softberry.com/cgi-bin/programs/promoter/cpgﬁnder.pl EMBOSS https://www.ebi.ac.uk/Tools/services/web/toolresult.ebi?jobId=emboss_cpgplot-I20190829-034717-0929-71406869-p2m GPMiner http://gpminer.mbc.nctu.edu.tw/show_prediction/show.php?OS=human&ID=20190829_112548&scale=3&GC_window=15& TFBS_core=1.00&TFBS_matrix=0.95&OR_zscore=5&OR_number=20&OR_occur=2&stability_window=15& miRNA_MFE=&miRNA_score=

Mater. Express, Vol. 10, 2020 1837 Materials Express Upregulation of STAT4 promotes osteoblast activity by activating AMPK Jiang et al.

every three days. The plasmid vectors were transfected Electrophoresis was performed at 100 V constant pres- into MG-63 cells by cationic liposomes (Life Technolo- sure to separate the protein and ran for 2 h. Following an gies Corporation, Carlsbad, CA, USA), according to the ice bath and 300 mA of constant current, the protein was instructions [16]. After 24 hours, the biological functions shifted from the SDS-PAGE gel to the nitrocellulose (NC) of the cells and the differences in target gene expression membrane. 5% skimmed milk powder (prepared with Tris- were detected. buffered saline, 0.1% Tween 20 (TBST)) was incubated at 25 C for 1.5 hours, and 1× TBST was washed three times 2.4. Transmission Electron Microscope (TEM) for 5 minutes each time. Specific first antibodies (1:1,000) 200 ng/mL of cationic liposome solution were prepared, were added to incubate overnight at 4 C. Goat anti-rabbit of which 1 L was inserted into a TEM. Under the work- secondary antibody (1:10,000) (Boster Biological Technol- ing condition of electron microscope, the system pressure ogy Co. Ltd., Wuhan, China) was added and allowed to (HV) was 22.0 kV and the current discharge (curr) was incubate at 25 C for 1 hour. An enhanced chemilumines- 0.2 mA. The morphology of the samples was visualized cence (ECL) detection kit (Solarbio, Beijing, China) was and observed at 10,000× magnification. added to the NC membrane according to the instructions in the gel imaging system to observe protein expression. 2.5. Real-Time Fluorescence Quantitative PCR Detection 2.7. MTT Assay Total-RNA was extracted via the TriZol method. Nan- MG-63 cells were subcultured to the bottom of the bot- odrop2000 (Thermo Fisher Scientific, Waltham, MA, tle and digested with 0.25% trypsin for 3 minutes. The USA) was used to detect the OD260/280 ratio and RNA MG-63 cells were diluted to 5 × 104 cells/mL with MEM purity was about 2.0. According to the instructional reverse medium. 100 L of cell suspension was added to a 96-well transcription kit (TAKARA, Tokyo, Japan), the total RNA plate and three groups were set up with each group con- was recovered in the first strand cDNA. The obtained sisting of six wells. The cells infected with pcDNA3.1(+) cDNA was amplified and detected by adding specific blank vector (pcDNA3.1(+) group) and untreated cells primers (Table II) and qPCR master mix (TAKARA, (NC group) were served as control groups. Plasmids and Tokyo, Japan). The resulting cDNAIP: 192.168.39.151 were initial denatured On: Thu, 30 Sep 2021 19:20:15 transfection reagents were added into the cells according at 95 C for 2 min, and then denaturedCopyright: at 95 C forAmerican 10 s, Scientificto the operation Publishers protocol, and were cultured for 24 hours Delivered by Ingenta annealed at 60 C for 30 s, reacted at 72 C for 30 s to under normal conditions. 10 L MTT solution (5 mg/mL) extend DNA strands for 40 cycles. The fluorescence values −Ct was added to 96-well plate and incubated in a cell incuba- obtained are expressed by 2 . Article tor for 6 hours, then 150 L DMSO was added to cells, and the absorbance value (OD value) at 570 nm wave- 2.6. Western Blotting length was measured by enzyme label (Huataihehe Busi- MG-63 cells were cleaned with pre-cooled PBS once, and ness and Trade Co., Ltd., Beijing, China). then lysed on ice for 10 minutes with 500 L1× RIPA lysate. Cells were then centrifuged at 4 C and 12,000 rpm 2.8. Annexin V/PI Double Staining for 10 minutes. The total protein concentration in super- MG-63 cells were transfected with STAT4 overexpression natant was detected with a BCA protein quantitative kit vector for 24 hours and cleaned twice with pre-cooled (Beytime Biotechnology Inc., Shanghai, China). A 10% SDS-PAGE electrophoresis gel was prepared and added to PBS. Cells were cultured at 25 C for 15 minutes with each sample hole with 50 g of protein to be measured. a mixture of 100 L AnnexinV and PI (5:1). Following that, 400 L of Annexin-binding buffer was used to detect apoptosis by flow cytometry. The excitation wavelength Table II. Specific primers for target genes. for flow cytometry was 488 nm. Genes Primers

2.9. Determination of Alkaline Phosphatase STAT4 F: 5 -ACGAAGCTTTCCACCTGCCACATTGAGTC-3 (PCR) (Hind III) (ALP) Activity R: 5-CGGGATCGCAAGGCTGAGAGCTGTAGT-3 ALP activity was detected via enzyme labeling instrument (BamH I) according to the speciﬁcations of the alkaline phosphatase STAT4 F: 5 -AGCTCATTGCCTGTGGTGAT-3 (ALP) activity detection kit (Beijing Solarbio Science and R: 5-TGACTCAATGTGGCAGGTGG-3 AMPKá1 F: 5-CGAGAAGCAGAAACACGACG-3 Technology Co., Ltd., Beijing, China). Then, the super- R: 5-AGGCTCCGAATCTTCTGTCG-3 natant of MG-63 cells was collected. The 55 L samples AMPKá2 F: 5-AGAAGCAGAAGCACGACGGG-3 were mixed with 50 L ALP Assay buffer and then incu- R: 5-ACTGCCACTTTATGGCCTGTTA-3 bated at 37 C for 5 min. The mixture was hatched in a ACTB F: 5 -GGGCATGGGTCAGAAGGATT-3 R: 5-TCGATGGGGTACTTCAGGGT-3 37 C water bath for 15 min with 50 L ALP color solution. Finally, 150 L chromogenic base solution was used

1838 Mater. Express, Vol. 10, 2020 Upregulation of STAT4 promotes osteoblast activity by activating AMPK Materials Express Jiang et al.

Table III. Prediction results of PRKAA1 and PRKAA2 promoter by online website BDGP.

Target Start End Score Promoter sequence

PRKAA1 1084 1134 0.87 CCATTTATGTTTATATAATAGACTAAGTATTACTCATTACAAGTACAATA 1407 1457 0.99 GCTCCAAGCGAAAAAAGAGCTCGGGTTGGTGCGGGGGGGCGGGGAGCGGG 1938 1988 0.87 CCCGCGTCCCCACCCCCTCCCCGCCCGCCCCCGGCGCGGCCCTGCCCGCC 1954 2004 0.85 CTCCCCGCCCGCCCCCGGCGCGGCCCTGCCCGCCCCCTCCGCCCCCTCCC 1966 2016 0.81 CCCCGGCGCGGCCCTGCCCGCCCCCTCCGCCCCCTCCCGCAGCGCCATGC 3622 3672 0.94 AGGACAGGTCCATATAAGGCCAGTAAGATGTTTCTGTGCCATGGAAGTTT PRKAA2 293 343 0.98 ACTATATGTTTATATAAGCGCGTGGTAAAACTACATATTTATATAAGCAT 324 374 0.92 TACATATTTATATAAGCATGTGCTAAAAAACACTCGAGCAAATACCGTGA 337 387 0.91 AAGCATGTGCTAAAAAACACTCGAGCAAATACCGTGACTGAGATTTTTTG 955 1005 0.90 AGCGGGCGCCTCGCGCTCCCTCCCTCGGCCCCGCCCCGCCCGCCGCTCGC 1053 1103 0.83 CCCCGCGCCCGCCCCGCGCCCCTCGCGGCTCGGGGTCCGCCCCCTCGCCC 1429 1479 0.83 GGGTGGCGCGCACCGCCTCGCCTGGCACCGGCGCCCGGGCCCCACAGGGT 2631 2681 0.99 TTCATGTGTTCAAAAAACGCTGAGCACCTGCAACGTGGTAGGCACTGTTC 2915 2965 0.99 CTGTGAGGGTTATAAAGTCCTGGGTTATTTTTGAAAGACCTTATAAGTAG

to blend the reaction solution for measuring the optical transcription binding factors in the AMPKá1 promoter density values at 510 nm wavelength. region and 28 in the AMPKá2. YY1, STAT4, and GR were common transcription binding factors of AMPKá1 3. RESULTS AND DISCUSSION andAMPKá2(Fig.1). 3.1. STAT4 Combined with AMPKá1/2 Promoter and 3.2. Promoter Sequence of AMPKá1/2 was Rich in

CpG Island Article CpG Island NCBI, Ensembl, BDPG, and FPORM were used to predict The websites Ensembl, CpG Island, CpG Finder, the AMPá1/2 promoter. The results showed that AMPKá1 IP: 192.168.39.151 On: Thu,EMBOSS, 30 Sep 2021 and 19:20:15 GPMiner (Table I) were used to was located on Chr5 and AMPKá2 wasCopyright: located onAmerican Chr1. Scientific Publishers The Ensembl results showed that the promoter regionDelivered of bypredict Ingenta AMPKá1/2 CpG islands. The results from AMPKá1 was 4,001 bp long while the promoter region of EMBOSS showed that the CpG islands of AMPKá1 AMPKá2 was 3,201 bp long. After inputting the FASTA were mainly enriched in 1,344–1,629 (286 bp) and format sequence of the target promoter region into the 1,637–2,664 (1,028 bp), while the CpG islands of search box, BDGP predicted that there were 6 promot- AMPKá2 were mainly enriched in 755–1,502 (748 length) ers in the AMPKá1 promoter region and 8 promoters (Fig. 2). STAT4 had multiple binding sites in the in the AMPKá2 promoter region, and their length was AMPKá1/2 promoter region which were enriched 50 bp (Table III). PROMO predicted that there were 30 in CpG island (Table IV).

3.3. Morphology of Cationic Liposome The monolayer of free cationic liposomes is circu- lar or irregular in shape, and its size is less than 1 nm (Fig. 3(A)). Although liposomes are small in size, they tend to aggregate and fuse into larger molecules (Fig. 3(B)).

3.4. Overexpression of STAT4 Stimulates the Expression and Activation of AMPK1/2 After 24 hours of intervention with pcDNA3.1(+)- STAT4 (EGFP) overexpression plasmid vector in human osteoblast-like cell MG-63 (Fig. 4(A)), the expression of STAT4 and its inﬂuence on the expression of AMPK1 and AMK2 were detected by RT-q PCR and western blotting. The expression of p-AMPK1/2 was detected by western blotting. As shown in Figures 4(B)–(F) and 5, Fig. 1. Prediction results of transcription binding factors of PRKAA1 compared with the untreated group (NC group) and blank and PRKAA2 promoters by different online websites. vector control group (pcDNA3.1(+)-group), the levels of

Mater. Express, Vol. 10, 2020 1839 Materials Express Upregulation of STAT4 promotes osteoblast activity by activating AMPK Jiang et al.

IP: 192.168.39.151 On: Thu, 30 Sep 2021 19:20:15 Copyright: American Scientific Publishers Delivered by Ingenta Article

Fig. 2. Prediction of methylation sites. (A) Was the predicted CpG island in AMPK1 promoter region; (B) was the predicted CpG island in AMPK2 promoter region.

STAT4, AMPK1, and AMPK2 in the pcDNA3.1(+)- 3.5. Overexpression of STAT4 Inhibits STAT4 group increased significantly. The phosphorylation Osteoblast Apoptosis level of AMPK1/2 also increased significantly, with sta- Flow cytometry (Annexin V-FITC/PI double staining) ∗∗P< tistical significance ( 0.01). technology was used to detect the effect of STAT4 overexpression on apoptosis in MG-63 cells. The results showed Table IV. Prediction of STAT4 binding sites on PRKAA1 and that the rate of apoptosis in MG-63 cells was signif- PRKAA2 promoters by online website PROMO (dissimilarity margin + ≤0%). icantly inhibited after transfecting with pcDNA3.1( )- STAT4 vector for 24 hours (Figs. 6(A and B)) compared Start End Target Factor position position String RE equally RE query with the NC group.

PRKAA1 STAT4 1327 1332 GGAAAT 0.97681 1.08063 2580 2585 ATTTCC 0.97681 1.08063 3.6. STAT4 Overexpression Promotes 2903 2908 ATTTCC 0.97681 1.08063 Osteoblast Differentiation 3139 3144 GGAAA 0.97681 1.08063 PRKAA2 STAT4 106 111 ATTTCC 0.78149 0.75059 ALP activity level is a biomarker of osteoblast calciﬁ- 258 263 ATTTCC 0.78149 0.75059 cation. The ALP expression level of MG-63 cells trans- 2486 2491 GGAAAT 0.78149 0.75059 fected with STAT4 overexpression vector was detected 2509 2514 ATTTCC 0.78149 0.75059 via ALP activity assay kit. The results showed that

1840 Mater. Express, Vol. 10, 2020 Upregulation of STAT4 promotes osteoblast activity by activating AMPK Materials Express Jiang et al.

Fig. 3. Cationic liposomes visualized under transmission electron microscope. (A) Displays the liposome in a free state; (B) displays the liposome in an aggregation state.

STAT4 overexpression signiﬁcantly promoted ALP expres- 3.7. Overexpression of STAT4 Promotes sion compared with the NC group and blank vector Osteoblast Growth group, and the difference was signiﬁcant (∗∗∗P<0.001) Compared with the NC group and pcDNA3.1(+) group, (Fig. 6(C)). the viability of MG-63 cells in pcDNA3.1(+)-STAT4 Article

IP: 192.168.39.151 On: Thu, 30 Sep 2021 19:20:15 Copyright: American Scientific Publishers Delivered by Ingenta

Fig. 4. The expression of target genes in human osteoblast-like cells MG-63 after interfering with the STAT4 overexpression vector for 24 hours. (A) Was the transfection efﬁciency of STAT4 overexpression vector; (B) displayed western blot results; (C–F) expressed the STAT4, AMPKá1, AMPKá2, p-AMPKá1/2 protein expression results, separately. ∗∗Indicated P<0.01 via NC and pcDNA3.1(+) group; ∗∗∗indicated P<0.001.

Mater. Express, Vol. 10, 2020 1841 Materials Express Upregulation of STAT4 promotes osteoblast activity by activating AMPK Jiang et al.

IP: 192.168.39.151 On: Thu, 30 Sep 2021 19:20:15 Copyright: American Scientific Publishers Delivered by Ingenta

Fig. 5. The results of RT-qPCR detection. (A) Expressed the AMPKá1 mRNA expression results; (B) expressed the AMPKá2 mRNA expression Article results; (C) expressed the STAT4 mRNA expression results. ∗Indicated P<0.05 via NC and pcDNA3.1(+) group; ∗∗∗indicated P<0.001.

group significantly enhanced (∗P<0.05) (Fig. 6(D)). with AMPK beta and AMPK gamma, constitutes a het- Overexpression of STAT4 stimulates the expression and erotrimeric trimer, which plays an energy regulatory activation of AMPK1/2, which significantly promotes the role in cells and influences cell growth, differentiation, growth of osteoblasts. and apoptosis functions [18–21]. AMPK is an important target for prevention and treatment of osteoporo- 3.8. Discussion sis. Activating AMPK in vivo and in vitro regulates In order to confirm the effect of STAT4 on AMPK and cell bone formation [22, 23]. Generally speaking, activa- proliferation, apoptosis, and differentiation in osteoblasts, tion of AMPK inhibits bone loss induced by ovariec- this study transfected the overexpression vector based on tomy in mice and also resists osteoporosis [24, 25]. cationic liposome to upregulate STAT4 expression in MG- This is because AMPK protects osteoblasts and pro- 63 cells. Cationic liposomes are a new kind of high- motes osteogenic differentiation [26]. Several studies have performance plasmid carrier transfection reagent that has shown that AMPK inhibits adipose differentiation of mes- a positive charge on its surface. It can wrap the plasmid enchymal stem cells, promotes osteogenic differentiation, through electrostatic action and form a plasmid liposome and induces bone regeneration [27, 28], which is mainly complex. The plasmids are transferred into the cells by achieved via phosphorylation of Thr172 or Thr183 sites. membrane adsorption through fusion and penetration, and In addition, RUNX2 is the direct downstream target of the recombinant genes are expressed in the cells, while the AMPK. AMPK activation regulates the phosphorylation of liposomes are degraded and recycled by the biofilm [17]. RUNX2-s118 site and induces bone formation. The loss In this study, STAT4 recombinant gene was transfected of phosphorylation at the RUNX2-s118 locus is likely to with cationic liposome. It was found that the expression lead to fat formation [29]. AMPK activation also affects of STAT4 was upregulated 24 hours later. osteogenic differentiation by regulating the SIRT1 signal- AMPKá is a subtype of AMPK, which is encoded ing pathway [30]. AMPK utilizes osteogenic differenti- by AMPKá1 and AMPKá2 genes. AMPKá, together ation and osteoprotective effects, which are also related

1842 Mater. Express, Vol. 10, 2020 Upregulation of STAT4 promotes osteoblast activity by activating AMPK Materials Express Jiang et al.

Fig. 6. Effect of STAT4 overexpression vector on cell ALP levels, viability, and apoptosis of MG-63 cells after 24 hours detected. (A) Indicated MG- Article 63 cells apoptosis detected by Flow cytometry; (B) indicated statistical results of the total apoptosis level; (C) indicated the effect of pcDNA3.1(+)- STAT4 overexpression vector on differentiationIP: 192.168.39.151 of MG-63 cells; (D) On: indicated Thu, MG-6330 Sep cells 2021 viability 19:20:15 detected by MTT assay. ∗Indicated P<0.05 via NC and pcDNA3.1(+) group, ∗∗∗indicated Pcytokines and growth fac- 4. CONCLUSION tors, and translocates into the nucleus to play a transcrip- The results of this study show that STAT4 is a tran- tional regulatory role as a transcription activator [11, 36]. scription activator of AMPK, which promotes the expres- At present, many studies have conﬁrmed that STAT4 sion of AMPK through combining on the promoters mainly plays an immune-regulatory role in the body, of AMPK1andAMPK2, thereby enhancing the via- because STAT4 participates in the signal transduction of bility of osteoblasts and inducing the differentiation of inﬂammatory factor IL-12 and regulates the differentiation osteoblasts. and function of T immune cells [37, 38]. This study sug- gests that STAT4 promotes bone differentiation through its Acknowledgment: Funding was provided by the Sci- transcriptional activation activity. Through bioinformatic ence and Technology Planning Project of Guangzhou City

Mater. Express, Vol. 10, 2020 1843 Materials Express Upregulation of STAT4 promotes osteoblast activity by activating AMPK Jiang et al.

of China (Grant Number: 201707010463) and the National 17. Simões, S., Filipe, A., Faneca, H., Mano, M., Penacho, N., Natural Science Foundation of China (Grant Number: Düzgünes, N. and de Lima, M.P., 2005. Cationic liposomes for gene 81373654). delivery. Expert Opinion on Drug Delivery, 2(2), pp.237–254. 18. Speirs, C., Williams, J., Riches, K., Salt, I.P. and Palmer, T.M., 2018. Linking energy sensing to suppression of JAK-STAT signalling: References and Notes A potential route for repurposing AMPK activators? Pharmacologi- cal Research, 128, pp.88–100. 1. Compston, J.E., McClung, M.R. and Leslie, W.D., 2019. Osteoporo- 19. Steinberg, G.R. and Kemp, B.E., 2009. AMPK in health and disease. sis. The Lancet, 393(10169), pp.364–376. Physiological Reviews, 89(3), pp.1025–1078. 2. Lehouck, A., Boonen, S., Decramer, M. and Janssens, W., 2011. 20. Oakhill, J.S., Scott, J.W. and Kemp, B.E., 2010. Structure and func- COPD, bone metabolism, and osteoporosis. Chest, 139(3), pp.648– tion of AMP-activated protein kinase. Acta Physiologica, 196(1), 657. pp.3–14. 3. Khosla, S. and Hofbauer, L.C., 2017. Osteoporosis treatment: 21. Xiao, B., Heath, R., Saiu, P., Leiper, F.C., Leone, P., Jing, C., Walker, Recent developments and ongoing challenges. The Lancet Diabetes P.A., Haire, L., Eccleston, J.F., Davis, C.T., Martin, S.R., Carling, D. Endocrinol, 5(11), pp.898–907. 2007 4. Hardie, D.G., 2011. Sensing of energy and nutrients by AMP- and Gamblin, S.J., . Structural basis for AMP binding to mam- Nature, 449 activated protein kinase. American Journal of Clinical Nutri- malian AMP-activated protein kinase. (7161), pp.496– tion, 93(4), pp.891–896. 500. 5. Jeyabalan, J., Shah, M., Viollet, B. and Chenu, C., 2012.AMP- 22. Shah, M., Kola, B., Bataveljic, A., Arnett, T.R., Violet, B., Saxon, L., activated protein kinase pathway and bone metabolism. Journal of Korbonits, M. and Chenu, C., 2010. AMP-activated protein kinase Endocrinology, 212(3), pp.277–290. (AMPK) activation regulates in vitro bone formation and bone mass. 6. Zhong, X., Xiu, L.L., Wei, G.H., Liu, Y.Y., Su, L., Cao, X.P., Li, Bone, 47(2), pp.309–319. Y. B . an d X iao , H . P. , 2011. Bezafibrate enhances proliferation and 23. Wang, Y.G., Qu, X.H., Yang, Y., Han, X.G., Wang, L., Qiao, H., Fan, differentiation of osteoblastic MC3T3-E1 cells via AMPK and eNOS Q.M., Tang, T.T. and Dai, K.R., 2016. AMPK promotes osteogenesis activation. Acta Pharmacologica Sinica, 32(5), pp.591–600. and inhibits adipogenesis through AMPK-Gfi1-OPN axis. Cellular 7. Kim, D.Y., Kim, E.J. and Jang, W.G., 2017. Piperine induces Signalling, 28(9), pp.1270–1282. osteoblast differentiation through AMPK-dependent Runx2 24. Wei,M.,Gan,L.,Sha,X.,Lu,H.,Jiang,Y.,Lei,X.,Xu,C., expression. Biochemical and Biophysical Research Communica- Ruan, B., Wang, L. and Lu, Z., 2016. Mitochondria related pep- tions, 495(1), pp.1497–1502. tide MOTS-c suppresses ovariectomy-induced bone loss via AMPK 8. Kim, D.Y., Park, Y.G., Quan, H.Y., Kim, S.J., Jung, M.S. and activation. Biochemical and Biophysical Research Communica- Chung, S.H., 2012. Ginsenoside Rd stimulates the differentiation and tions, 476(4), pp.412–419. mineralization of osteoblastic MC3T3-E1IP: 192.168.39.151 cells by activating AMP-On: Thu,25. 30Zhou, Sep R.,2021 Wang, 19:20:15 Z. and Ma, C., 2014. Hispidulin exerts anti- activated protein kinase via the BMP-2 signalingCopyright: pathway. AmericanFitoter- Scientificosteoporotic Publishers activity in ovariectomized mice via activating AMPK apia, 83(1), pp.215–222. Delivered by Ingentasignaling pathway. Cell Biochemistry and Biophysics, 69(2), pp.311– 9. Chen, T., Wu, Y.W., Lu, H., Guo, Y. and Tang, Z.H., 2015. 317. Adiponectin enhances osteogenic differentiation in human adipose- 26. Yang, M., Huang, Y., Chen, J., Chen, Y.L., Ma, J.J. and Shi, derived stem cells by activating the APPL1-AMPK signaling P.H., 2014. Activation of AMPK participates hydrogen sulfide- Article pathway. Biochemical and Biophysical Research Communica- induced cyto-protective effect against dexamethasone in osteoblastic tions, 461(2), pp.237–242. MC3T3-E1 cells. Biochemical and Biophysical Research Communi- 10. Wurster, A.L., Tanaka, T. and Grusby, M.J., 2000. The biology of cations, 454(1), pp.42–47. Stat4 and Stat6. Oncogene, 19(21), pp.2577–2584. 27. Chen, S.C., Brooks, R., Houskeeper, J., Bremner, S.K., Dunlop, J., 11. Korman, B.D., Kastner, D.L., Gregersen, P.K. and Remmers, E.F., Viollet, B., Logan, P.J., Salt, I.P., Ahmed, S.F. and Yarwood, 2008. STAT4: Genetics, mechanisms, and implications for autoim- S.J., 2016. Metformin suppresses adipogenesis through both AMP- munity. Current Allergy and Asthma Reports, 8(5), pp.398–403. activated protein kinase (AMPK)-dependent and AMPK-independent 12. Huang, E., Zhu, G., Jiang, W., Yang, K., Gao, Y., Luo, Q., Gao, mechanisms. Molecular and Cellular Endocrinology, 440, pp.57–68. J.L., Kim, S.H., Liu, X., Li, M., Shi, Q., Hu, N., Wang, L., Liu, H., 28. Smieszek, A., Tomaszewski, K.A., Kornicka, K. and Marycz, K., Cui, J., Zhang, W., Li, R., Chen, X., Kong, Y.H., Zhang, J., Wang, J., 2018. Metformin promotes osteogenic differentiation of adipose- Shen, J., Bi, Y., Statz, J., He, B.C., Luo, J., Wang, H., Xiong, F., Luu, derived stromal cells and exerts pro-osteogenic effect stimulating H.H., Haydon, R.C., Yang, L. and He, T.C., 2012. Growth hormone bone regeneration. Journal of Clinical Medicine, 7(12), pp.482–506. synergizes with BMP9 in osteogenic differentiation by activating the 29. Chava, S., Chennakesavulu, S., Gayatri, B.M. and Reddy, A.B.M., JAK/STAT/IGF1 pathway in murine multilineage cells. Journal of 2018. A novel phosphorylation by AMP-activated kinase regulates Bone and Mineral Research, 27(7), pp.1566–1575. RUNX2 from ubiquitination in osteogenesis over adipogenesis. Cell 13. Xu, L., Zhang, L., Zhang, H., Yang, Z., Qi, L., Wang, Y. and Ren, S., Death and Disease, 9, pp.754–763. 2018. The participation of fibroblast growth factor 23 (FGF23) in 30. Chen, X., Yan, J.K., He, F., Zhong, D.Y., Yang, H.L., Pei, M. and the progression of osteoporosis via JAK/STAT pathway. Journal of Luo, Z.P., 2018. Mechanical stretch induces antioxidant responses Cellular Biochemistry, 119(5), pp.3819–3828. and osteogenic differentiation in human mesenchymal stem cells 14. Rzl, L., Li, L., Chew, N. and Yong, E.L., 2017. The prenylflavonoid through activation of the AMPK-SIRT1 signaling pathway. Free Icaritin enhances osteoblast proliferation and function by signal Radical Biology and Medicine, 126, pp.187–201. transducer and activator of transcription factor 3 (STAT-3) regu- 31. Li, Y., Su, J.J., Sun, W.C., Cai, L. and Deng, Z.M., 2018.AMP- lation of C-X-C chemokine receptor type 4 (CXCR4) expression. activated protein kinase stimulates osteoblast differentiation and min- Bone, 105, pp.122–133. eralization through autophagy induction. International Journal of 15. Pedroso de Lima, M.C., Neves, S., Filipe, A., Düzgüne¸s, N. and Molecular Medicine, 41(5), pp.2535–2544. Simões, S., 2003. Cationic liposomes for gene delivery: From 32. Chen, H.Q., Liu, X.B., Chen, H., Gao, J., Zhang, L., Hu, X.Y. and biophysics to biological applications. Current Medicinal Chem- Wang, J.A., 2014. Role of SIRT1 and AMPK in mesenchymal stem istry, 10(14), pp.1221–1231. cells differentiation. Ageing Research Reviews, 13, pp.55–64. 16. Yagi, K., 1995. Cationic liposomes. Tanpakushitsu Kakusan Koso 33. Dong, W., Qi, M.C., Wang, Y.R., Feng, X.J. and Liu, H.C., Protein Nucleic Acid Enzyme, 40(17), pp.2577–2582. 2018. Zoledronate and high glucose levels influence osteoclast

1844 Mater. Express, Vol. 10, 2020 Upregulation of STAT4 promotes osteoblast activity by activating AMPK Materials Express Jiang et al.

differentiation and bone absorption via the AMPK pathway. MKK6/p38 pathway for interleukin-12-induced STAT4 serine phos- Biochemical and Biophysical Research Communications, 505(4), phorylation and transcriptional activity. Blood, 96(5), pp.1844– pp.1195–1202. 1852. 34. Wang, Y.G., Han, X.G., Yang, Y., Qiao, H., Dai, K.R., Fan, Q.M. and 37. Thierfelder, W.E., van Deursen, J.M., Yamamoto, K., Tripp, R.A., Tang, T.T., 2016. Functional differences between AMPK 1and2 Sarawar, S.R., Carson, R.T., Sangster, M.Y., Vignali, D.A., Doherty, subunits in osteogenesis, osteoblast-associated induction of osteo- P.C., Grosveld, G.C. and Ihle, J.N., 1996. Requirement for Stat4 clastogenesis, and adipogenesis. Scientiﬁc Reports, 6, pp.32771– in interleukin-12-mediated responses of natural killer and T cells. 32784. Nature, 382(6587), pp.171–174. 35. Kang, H., Viollet, B. and Wu, D., 2013. Genetic deletion of cat- 38. Wei,L.,Vahedi,G.,Sun,H.W.,Watford,W.T.,Takatori,H., alytic subunits of AMP-activated protein kinase increases osteoclasts Ramos, H.L., Takahashi, H., Liang, J., Gutierrez-Cruz, G., Zang, C., and reduces bone mass in young adult mice. Journal of Biological Peng, W., O’Shea, J.J. and Kanno, Y., 2010. Discrete roles Chemistry, 288(17), pp.12187–12196. of STAT4 and STAT6 transcription factors in tuning epigenetic 36. Visconti, R., Gadina, M., Chiariello, M., Chen, E.H., Stancato, modiﬁcations and transcription during T helper cell differentiation. L.F., Gutkind, J.S. and O’Shea, J.J., 2000. Importance of the Immunity, 32(6), pp.840–851.

Received: 28 February 2020. Accepted: 12 May 2020. Article

IP: 192.168.39.151 On: Thu, 30 Sep 2021 19:20:15 Copyright: American Scientific Publishers Delivered by Ingenta

Mater. Express, Vol. 10, 2020 1845