Expression of Androgen Receptor Coregulators in Prostate Cancer

1032 Vol. 10, 1032–1040, February 1, 2004 Clinical Cancer Research

Marika J. Linja,1 Kati P. Porkka,1 Conclusions: These findings suggest that the decreased Zhikang Kang,3 Kimmo J. Savinainen,1 expression of PIAS1 and SRC1 could be involved in the progression of prostate cancer. In addition, gene amplifica- Olli A. Ja¨nne,3 Teuvo L. J. Tammela,2 4 3 tion of SRC1 in one of the xenografts implies that, in some Robert L. Vessella, Jorma J. Palvimo, and tumors, genetic alteration of SRC1 may provide a growth 1 Tapio Visakorpi advantage. 1Laboratory of Cancer Genetics, Institute of Medical Technology and 2Department of Urology, University of Tampere and Tampere University Hospital, Tampere, Finland; 3Institute of Biomedicine, INTRODUCTION 4 University of Helsinki, Helsinki, Finland; and Department of The critical role of androgens in the development of pros- Urology, University of Washington, Seattle, Washington tate cancer is indicated, for example, by the fact that prostate cancer does not develop in men castrated early in their life (1). ABSTRACT In addition, more that 50 years ago, Huggins and Hodges (2) Purpose: The androgen receptor (AR)-mediated signal- showed that hormonal therapy is an effective treatment for ing pathway seems to be essentially involved in the develop- prostate cancer. Subsequently, androgen withdrawal has become ment and progression of prostate cancer. In vitro studies the standard and is practically the only effective treatment for have shown that altered expression of AR coregulators may advanced prostate cancer. Although most prostate carcinomas significantly modify transcriptional activity of AR, suggest- are originally androgen dependent, they eventually become hor- ing that these coregulators could also contribute to the mone refractory during treatment (3). The mechanisms under- progression of prostate cancer. Here, our goal was to assess lying the transition from androgen dependence to androgen alterations in the expression of the AR coregulators in pros- independence are incompletely understood. tate cancer in vivo. Androgen action in target tissues, such as the prostate Experimental Design: The expression of 16 AR coacti- gland, is mediated by nuclear androgen receptor (AR), which vators and corepressors (SRC1, ␤-catenin, TIF2, PIAS1, functions as a transcription factor. Several findings have already PIASx, ARIP4, BRCA1, AIB1, AIB3, CBP, STAT1, NCoR1, indicated that AR is involved in the development and progres- AES, cyclin D1, p300, and ARA24) was measured in prostate sion of prostate cancer. First, it has been suggested that certain cancer cell lines, xenografts, and clinical prostate tumor AR polymorphisms are associated with the risk of prostate specimens by using real-time quantitative reverse transcrip- cancer (4, 5). Second, somatic mutations of the AR gene have tion-PCR. In addition, gene copy number of SRC1 was been found, especially in tumors treated with antiandrogens analyzed by fluorescence in situ hybridization. such as flutamide and bicalutamide (6–8). Third, about one- Results: Both AR-positive and AR-negative cell lines third of the hormone-refractory prostate carcinomas contain and xenografts expressed the coregulators. Most of the co- amplification of the AR gene, leading to transcriptional up- regulators studied were expressed at equal levels in benign regulation of the gene (9, 10). In addition, hormone-refractory prostatic hyperplasia and untreated and hormone-refrac- tumors express more AR than the untreated tumors, even without tory carcinomas. However, the expression of PIAS1 and the gene amplification (10). Fourth, other growth factor signal- and 0.017, respectively) ing pathways may activate AR, especially in the presence of 0.048 ؍ SRC1 was significantly (P lower in hormone-refractory prostate tumors than in un- only low levels of androgens (11, 12). Finally, recent cDNA treated prostate tumors. No overexpression of the coregula- microarray studies (13, 14) have demonstrated that many of the tors was found in the clinical material. Paradoxically, the androgen-regulated genes become up-regulated at the progres- SRC1 gene was found to be amplified and highly expressed sion of the disease during androgen withdrawal. in a LuCaP 70 prostate cancer xenograft. Activation of AR by androgens is a complex process. The apo-AR stays associated with chaperone proteins in the cyto- plasm. Ligand binding leads to conformational changes in the receptor and its translocation into the nucleus, where it binds to an androgen response element located in the regulatory regions Received 6/29/03; revised 11/4/03; accepted 11/4/03. of target genes (15). In addition to the AR itself, transcriptional Grant support: The Academy of Finland, the Cancer Society of Fin- regulation involves a large number of activating and repressing land, the Reino Lahtikari Foundation, the Medical Research Fund of proteins (16). In vitro studies have indicated that altered expres- Tampere University Hospital, Biocentrum Helsinki, the Sigrid Juse´lius Foundation, and the Finnish Life and Pension Insurance Companies. sion of some of these coregulators may modify transcriptional The costs of publication of this article were defrayed in part by the activity of AR (17–23). For example, overexpression of a p160 payment of page charges. This article must therefore be hereby marked family member, TIF2, in a cotransfection assay enhanced AR advertisement in accordance with 18 U.S.C. Section 1734 solely to transcriptional activity in the presence of several steroids, in- indicate this fact. Requests for reprints: Tapio Visakorpi, Institute of Medical Technol- cluding adrenal androgens, within physiological concentrations ogy, FIN-33014 University of Tampere, Tampere, Finland. Phone: (23). In addition, coregulators may modulate the effects of 358-3-215-7725; Fax: 358-3-215-8597; E-mail: [email protected]. antiandrogens. For instance, it has been reported that hydroxy-

flutamide paradoxically increases AR activity when CBP is standard curves, total RNA from LNCaP was used. After first- overexpressed (24). Therefore, changes in the expression of the strand cDNA synthesis, serial dilutions were made correspond- coregulators might be involved in the development and progres- ing to about 100, 20, 4, 0.8, 0.16, and 0.032 ng of total RNA. sion of prostate cancer (25). However, only a few studies on the Primer sequences used for PCR amplification of each gene are expression of the coregulators in prostate cancer have been given in Table 1. The primers were designed to correspond to published (22, 23, 26–28). different exons to avoid amplification of genomic DNA. We To evaluate the significance of alterations in the expression also checked carefully to ensure that the primers could not of AR coregulators in prostate cancer, we have measured the detect pseudogenes or retropseudogenes. The PCR reactions expression of 16 different putative AR coactivators and core- were performed in LightCycler apparatus (29) using an LC Fast pressors by using quantitative reverse transcription-PCR (RT- Start DNA SYBR Green I Kit (Roche Diagnostics, Mannheim, PCR). Clinical tumor samples, prostate cancer cell lines, and Germany). Thermocycling for each reaction was done in a final xenografts were analyzed. The expression data were also com- volume of 20 ␮l containing 2 ␮l of cDNA sample (or standard), ␮ ϫ bined with the data on the chromosomal alterations of the cell 4mM MgCl2, 0.5 M each primer, and 1 ready-to-use SYBR lines and xenografts, obtained previously by comparative Green I reaction mix including Taq DNA polymerase, reaction genomic hybridization, to identify putative amplifications of the buffer, and deoxynucleotide triphosphate mix. The cycling con- coregulator genes. Finally, the gene copy number of SRC1 was ditions were designed according to the manufacturer’s guide- studied by using fluorescence in situ hybridization (FISH). lines. The annealing temperatures are given in Table 1. The elongation time was calculated by dividing the size of the amplicon (Table 1) by 25. The fluorescence emitted by SYBR MATERIALS AND METHODS Green I was measured in every cycle at the end of the elongation Samples. The prostate cancer cell lines (LNCaP, PC-3, step or, to avoid any fluorescence from nonspecific products, at DU145, 22Rv1, and NCI-H660) were obtained from the Amer- higher temperatures (for PIASx, CBP, cyclin D1, p300, and ican Type Culture Collection (Manassas, VA) and cultured ARA24). After arithmetic background adjustment, the fit point under the recommended conditions. Freshly frozen samples of method was used to determine the crossing-point value as de- 10 prostate cancer xenografts (LuCaP 23.1, 23.8, 23.12, 35, 41, scribed previously (10). Fig. 1 illustrates an example of a 49, 58, 69, 70, and 73) were made available for the analyses by standard curve for PIAS1. For normalization of the expression one of the coauthors (R. L. V.). All xenografts, except LuCaP 49 levels, the expression of TATA box-binding protein (TBP) was and LuCaP 58, have been established from hormone-refractory measured as described previously (10). TBP was chosen as the human prostate carcinomas and propagated in intact male mice. reference gene because there are no known retropseudogenes for Freshly frozen prostate tumor specimens representing benign it, and the expression of TBP is lower than that of many prostatic hyperplasia (BPH; n ϭ 9) and androgen-dependent commonly used, abundantly expressed reference genes. We (n ϭ 30) and hormone-refractory (n ϭ 12) carcinomas were have also shown previously that the use of ␤-actin would give obtained from Tampere University Hospital (Tampere, Finland). results similar to those obtained with TBP (10). The relative The specimens were histologically examined for the presence of expression level was obtained by dividing the values for the tumor cells using H&E-stained slides. Only samples containing gene of interest with the TBP value and then multiplying by 100. Ͼ60% cancerous or hyperplastic epithelial cells were selected For xenograft and cell line samples, the TBP-normalized results for the analyses. The BPH samples were obtained from prosta- were also normalized against the median expression value de- tectomy specimens from cancer patients. However, care was tected in those samples. In addition to the melting curve infor- taken to ensure that these samples did not contain any cancerous mation obtained from the LightCycler, the PCR products were cells. Samples of hormone-refractory carcinomas were obtained run in 1.5% agarose gel electrophoresis to ensure that a right- from transurethral resections of prostate of patients experiencing sized product (but not other products) was amplified in the urethral obstruction despite ongoing hormonal therapy. The time reaction. Genomic DNA was also used as a control to ensure from the beginning of hormonal therapy to progression (tran- that no amplification could result from a residual DNA remain- surethral resection of prostate) varied from 15 to 60 months. In ing in the RNA preparation. The intra-assay coefficient of addition, a tissue microarray containing 47 locally recurrent variation for each gene was determined by repeating analyses of (transurethral resection of prostate samples), hormone-refrac- two samples 10 times. The coefficient of variation values were tory, formalin-fixed, paraffin-embedded prostate carcinomas 5.7% for SRC1, 6.8% for TIF2, 6.9% for BRCA1, 17.3% for from the Tampere University Hospital was constructed. NCoR1, 11% for AES, 13.2% for STAT1, 20% for cyclin D1, RT-PCR. Total RNA from the cell lines was isolated 10.6% for AIB1, 12.6% for PIAS1,4%for␤-catenin, 19% for using Trizol reagent (Life Technologies, Inc., Gaithersburg, PIASx, 26% for ARIP4, 11.5% for ARA24, 8.7% for AIB3, 13% MD) according to the manufacturer’s instructions. For RNA for CBP, and 28% for p300. extraction from tumor material, tissue was first scratched from FISH. For FISH analysis, human genomic bacterial arti- frozen tumor blocks using a precooled, sterile scalpel. Subse- ficial chromosome clones for SRC1 (GenBank accession num- quently, tissue powder was added directly into Qiagen RNeasy ber AC013459) and for pHyde (GenBank accession number MiniKit tissue lysis buffer (Qiagen, Valencia, CA), and total AC016673) were obtained from ResGen Invitrogen Corp. RNA was isolated according to the manufacturer’s instructions. (Huntsville, AL). Probes for SRC1 and pHyde were labeled by The first-strand cDNA was synthesized with Superscript II nick translation with digoxigenin-dUTP (Roche Molecular Bio- reverse transcriptase and oligo(dT)12–18 primer according to the chemicals, Mannheim, Germany) and FITC-dUTP (New Eng- manufacturer’s protocol (Life Technologies, Inc.). To prepare land Nuclear, Boston, MA), respectively. The dual-color hybrid-

Table 1 The primer sequences used in the real-time RT-PCR Annealing Temperature at the Size of the temperature fluorescence amplicon Gene Primer sequences (5Ј–3Ј) (°C) measurement (bp) SRC1 ATGGTGAGCAGAGGCATGACA 60 72 349 AAACGGTGATGCTCATGTTG TIF2 TAATGCACAGATGCTGGCC 67 72 314 TCTGTGTATGTGCCATTCGG PIAS1 CCACATGACACCCATGCCTT 67 72 333 CCAAAGATGGATGCCGGGTC PIASxa TCTTCTGACGAAGAGGAAGACC 59 81 275 TCAGAAGATGTTCCAAGCTTCA ARIP4 ATAGCAAGTTCCTACAGGGC 61 72 437 CAGATTCACACCCAAGCATC BRCA1 TTCAGGGGGCTAGAAATCTG 62 72 247 CTACACTGTCCAACACCCACTCTC ␤-Catenin AATACCATTCCATTGTTTGTGCAG 62 72 254 AGCTCAACTGAAAGCCGTTT AIB3 TCCAGAACTTCTACCCAGCA 61 72 344 ATCAAGTCGCAGTCCTGCTT AIB1 CGTCCTCCATATAACCGAGC 61 72 255 TCATAGGTTCCATTCTGCCG CBP CAGAGCGGATCATCCATGACTA 59 83 347 GCTTCTCCATGGTGGCATAC STAT1 TATAGAGCATGAAATCAAGAGCC 55 72 227 GGGCATTCTGGGTAAGTTCA NCoR1 GGCCCTCTTCAGTCTCCTCT 61 72 364 GGCAGGTTTTTGACCTGCTA AES CGCGATTGACATGATGTTTC 61 72 339 CTCTCAATGGCTCCCAAGAC Cyclin D1 CCCTCGGTGGGTCCTACTTCAA 55 81 390 TGGCATTTTGGAGAGGAAGT p300 CCTGAGTAGGGGCAACAAGA 58 85 353 GTGTCTCCACATGGTGCTTG ARA24 CCACCAGAAGTTGTCATGGAC 57 82 475 ACAAGGGATGAGTTCACTTGC a Primers amplify a region that is common to the PIASx␣ and PIASx␤ isoform.

ization was performed essentially as described previously (10, refractory prostate carcinomas. The expression levels of the 30). Freshly frozen tissue sections (5 ␮m) were fixed with a genes varied considerably between individual samples. How- series of 50%, 75%, and 100% methanol-acetic acid (3:1; Car- ever, on average, most of the genes were equally expressed in noy’s fixative). The sections from tissue microarray block were the three tumor groups. Two exceptions were PIAS1 and SRC1, pretreated as described previously (30). Subsequently, the slides whose expressions were, on average, 2-fold lower in hormone- were denatured and dehydrated in an increasing series of etha- refractory prostate carcinomas than in untreated prostate carci- nol. Hybridization was done overnight at 37°C. After stringent nomas (P ϭ 0.048 and 0.017, respectively). However, no dif- washes, the slides were counterstained with an antifade solution ferences in the levels of expression were found between primary (Vectashied; Vector Laboratories, Burlingame, CA) containing tumors and BPH. In the hormone-refractory tumors, the expres- 4Ј,6-diamidino-2-phenylindole. The FISH signals were scored sion of SRC1 varied considerably. Although the median expres- from nonoverlapped epithelial cells using an Olympus BX50 sion of SRC1 was lower in hormone-refractory tumors than in epifluorescence microscope (Tokyo, Japan). BPH or untreated tumors, the highest individual relative expres- Statistical Analyses. The associations of tumor type, sion value was found in a hormone-refractory tumor. clinical stage, and histological grade with expression levels were The association between coregulator expression and histo- calculated with nonparametric Kruskal-Wallis and Mann-Whit- logical grade and clinical stage of the primary untreated tumors ney U tests. Spearman rank test was used to study the correlation was next analyzed. The decreased expressions of p300 and AIB3 of expressions of the AR and coregulators. Grubb’s test was were associated with high histological grade (P ϭ 0.034 and used to detect the outlier values in box and whisker plot illus- 0.033, respectively). On the other hand, increased expression of trations. ARIP4 was associated (P ϭ 0.006) with advanced stage of ϩ ϩ disease (T3–4,orN or M against T1–2N0M0). For other RESULTS coregulators, there were no significant associations. Finally, we Expression of Coregulators in Clinical Prostate Tu- determined whether expression of any coregulators correlated mors. Fig. 2 shows the expression levels of each gene in BPH with the previously published expression data of AR (12). No and untreated primary as well as locally recurrent hormone- significant correlations were found.

and the expression levels. We found that xenograft LuCaP 70 contained a high-level gain at chromosome 2p21-pter (Fig. 4A), where the SRC1 gene is located, and expressed more SRC1 than the other cell lines or xenografts (Fig. 3). FISH analysis con- firmed that SRC1 is indeed amplified in LuCaP 70 (Fig. 4B). Subsequently, we analyzed the other xenografts as well as three hormone-refractory and six untreated prostate tumors, selected based on the high-level expression of SRC1, for gene amplification. None of the samples, except LuCaP 70, demonstrated amplification of the gene. Finally, a tissue microarray containing 47 hormone-refractory prostate carcinomas was analyzed by FISH. Six (13%) tumors showed increased copy number (3–4 copies) of SRC1, but none showed amplification of the gene.

DISCUSSION The transcriptional activity of AR and the other nuclear receptor superfamily members is modulated by different coregulatory proteins. Coactivator proteins enhance AR transactivation in a ligand-dependent manner, whereas the corepressor proteins suppress AR activity either in the absence of androgens or in the presence of antiandrogens (35). AR-mediated transcriptional regulation requires several protein complexes (36) that may interact sequentially, in combination or in a parallel fashion. Whereas recruitment of chromatin remodeling proteins for dis- Fig. 1 Standard curve of the PIAS1 mRNA measurement by real-time reverse transcription-PCR. A, amplification of serially diluted standards. ruption of histone-DNA interaction by acetyl transferases, such Cycle numbers are plotted against fluorescent signal measured at the end as CBP/p300 (37), is essential to make the target sequences of the elongation step. Signals are also detected in negative sample due accessible for the ligand-bound receptor, other proteins are to primer-dimer formation. B, standard curve plotting the cycle number needed to bridge the receptor complex to basal transcription at the crossing-point value of each standard presented in A. machinery (16). Although the critical role of AR-mediated signaling in the development and progression of prostate cancer has become increasingly understood, the role of altered expres- Expression of Coregulators in Prostate Cancer Cell sion of AR coregulators has remained elusive. Thus, the expres- Lines and Xenografts. Fig. 3 depicts the relative expression sion of selected AR coactivators and corepressors in prostate levels of the coregulators in the prostate cancer cell lines and cancer was studied in this work. xenografts. Xenografts and cell lines were divided into two A real-time RT-PCR approach was chosen to measure the groups: androgen-independent ones (PC-3, DU145, NCI-H660, expression of the different coregulatory genes for three reasons. 22Rv1, and LuCaP 49); and androgen-sensitive ones (the rest of First, good antibodies for immunostaining are available only for the cases). Of the xenografts, LuCaP 49 and 58 are the only ones a few coregulators. Second, the RT-PCR strategy allows an established from tumor samples obtained from untreated pa- analysis from small tumor specimens. Third, real-time RT-PCR tients. LuCaP 49 is a small cell carcinoma with neuroendocrine is a reliable method for quantitation of mRNA abundance (10, features and is therefore considered as truly androgen independ- 29). The intra-assay coefficient of variation values varied for ent (31). The rest of the xenografts originated from patients different genes from 4% to 28%. Thus, at least severalfold treated with hormonal therapy. However, after serial passage in expression differences should have been reliably detected, even intact male athymic mice, the growth of the these xenografts in the case of the poorest assay (the highest coefficient of was shown to be inhibited by castration, indicating that they had variation) performance. The small sample number (n ϭ 41) of reacquired an androgen-sensitive phenotype. Of the cell lines clinical tumors limits the statistical power of the analyses. examined, only LNCaP is considered to be androgen sensitive. However, with the same material, we have previously demon- 22Rv1 is androgen independent, expressing mutated AR (32), strated statistically highly significant overexpression of AR in whereas PC-3, DU145, and NCI-H660 do not even express AR. the hormone-refractory carcinomas (10), indicating that at least The expression of all AR coregulators was also detected in common overexpression of any of the genes analyzed should AR-negative cell lines. have been detected in this material. Copy Number Analysis of SRC1. The cell lines and The most intensively investigated coactivator group is the xenografts used in the study have previously been analyzed for p160/SRC protein family. It comprises three distinct but struc- DNA sequence copy number changes by comparative genomic turally and functionally related members, SRC1 (NCoA1), TIF2 hybridization by us (33, 34). To study whether the high-level (SRC2/GRIP1/NCoA2), and AIB1 [SRC3/RAC3/ACTR (16)]. expression of some coregulators in individual cell lines or These proteins interact with steroid receptors and enhance their xenografts was due to amplification of the corresponding gene, transcriptional activation in a ligand-dependent manner. In ad- we compared the comparative genomic hybridization profiles dition, these proteins possess histone acetyltransferase activity,

Fig. 2 Box and whisker plots displaying the expression of 16 putative AR coregulators in benign prostatic hyperplasias (group A; n ϭ 9), primary untreated carcinomas (group B; n ϭ 30), and hormone-refractory carcinomas (group C; n ϭ 12) by real-time quantitative reverse transcription-PCR. The boxes indicate the area of 50% of samples, the horizontal line in the boxes indicates median value. The whiskers display the range. Stars depict the outlier values as evaluated by Grubb’s test. Most of the genes were equally expressed in the three tumor groups. The expression of PIAS1 and SRC1 was significantly lower in hormone-refractory prostate carcinomas than in untreated prostate carcinomas (group C compared with group B, P ϭ 0.048 and 0.017, respectively).

and they are able to recruit CBP/p300 (16). Here, the expression for reliable quantitation (data not shown). Our finding of de- of SRC1 was found to be lower in hormone-refractory prostate creased expression of SRC1 in hormone-refractory tumors is carcinomas than in the untreated prostate carcinomas (P ϭ concordant with the findings of an earlier study by Nessler- 0.017). The finding that SRC1 expression is decreased in hor- Menardi et al. (26), who showed that an androgen-independent mone-refractory prostate cancer is contradictory to the findings LNCaP subline has lower SRC1 expression than androgen- of Gregory et al. (23), who showed increased SRC1 protein sensitive LNCaP. Decreased expression of SRC1 has also been expression in hormone-refractory tumors. Although the average suggested to be associated with tamoxifen resistance in breast SRC1 expression was lower in our samples, the highest individ- cancers (38). Two recent studies have investigated the associa- ual expression value was nevertheless found in a hormone- tion of histological differentiation with SRC1 expression in refractory tumor. This may explain, in part, the discrepancy prostate cancer. Li et al. (28) found no association with SRC1 between our results and those of the study by Gregory et al. expression and Gleason score in 45 primary prostate cancers by (23). It should also be noted that Gregory et al. (23) studied using mRNA in situ hybridization. In contrast, Fujimoto et al. protein levels, whereas mRNA expression was analyzed here. (27) reported that SRC1 expression, as measured by RT-PCR, We also immunostained untreated and hormone-refractory, for- was higher in poorly differentiated tumors and in cancers that malin-fixed, paraffin-embedded prostate carcinomas with poly- responded poorly to therapy. Our data showed no correlation clonal anti-SRC1 antibody (Affinity BioReagents Inc., Golden, between SRC1 expression and tumor grade or clinical stage in CO). The tumors showed variable amounts of mainly nuclear the untreated tumors. staining. However, the quality of staining was not good enough In contrast to down-regulation of SRC1 expression in hor-

Fig. 3 Relative expression levels of AR coregulators in prostate cancer xenografts and cell lines: 1, LuCaP 58; 2, LNCaP; 3, LuCap 73; 4, LuCaP 41; 5, LuCaP 70; 6, LuCaP 23.1; 7, LuCaP 23.12; 8, LuCaP 23.8; 9, LuCaP 35; 10, LuCaP 69; 11, 22Rv1; 12, PC-3; 13, DU145; 14, NCI-H660; and 15, LuCaP 49. Prostate cancer models 11–15 are considered androgen independent. The expression value of each individual case was normalized against the median expression value of the particular gene.

mone-refractory prostate tumors, amplification of the SRC1 p160 coactivator proteins could compensate for the functions of gene was detected in the LuCaP 70 xenograft. LuCaP 70 was each other, at least to some extent (40). The third member of originally established from a hormone-refractory liver metasta- p160/SRC family, TIF2, showed constant expression in differ- sis but has been serially passaged in intact male mice. To our ent prostate tumor types. This latter finding disagrees with the knowledge, this is the first description of SRC1 gene amplifi- findings of a study by Gregory et al. (23), who showed over- cation. The amplification seems to lead to up-regulation of the expression of TIF2 protein in hormone-refractory tumors. gene because LuCaP 70 expressed more SRC1 than the other The activities of the p160 family members are dependent cell lines and xenografts. The other cell lines, xenografts, and on CBP and p300 (41). For example, CBP has been shown to clinical tumors analyzed did not exhibit SRC1 gene amplifica- interact with AR and augment AR activity in a ligand-dependent tion. A total of 66 tumors were analyzed for SRC1 copy number, manner (17). Recently, Comuzzi et al. (24) showed that the and only 1 (LuCaP 70) showed the amplification. Nevertheless, antiandrogen hydroxyflutamide enhanced AR activity in DU145 the amplification may, in rare cases, give a growth advantage to cells forced to express CBP. In the present study, the expression cancer. of CBP and p300 was about equal in different groups of clinical Expression of the other p160/SRC family members was prostate samples. However, the expression of p300 was de- also analyzed. AIB1, which is amplified and overexpressed in creased in poorly differentiated, untreated prostate carcinomas. ϳ10% of breast and ovarian cancers (39), showed no overex- The data indicate that CBP/p300 overexpression is unlikely pression in prostate cancer. Interestingly, expression of AIB1 during the progression of prostate cancer. was very low in xenograft LuCaP 70, which showed high The PIAS (protein inhibitor of activated STAT) protein expression of SRC1. This may indicate that SRC1 has substi- family members PIAS1 and splicing variants PIASx␣ (ARIP3) tuted the functions of AIB1 in the xenograft. Based on experi- and PIASx␤ (Miz1) have been reported to enhance transcrip- ments with SRC1 knockout mice, it has been suggested that tional activity of AR (42–44). PIAS proteins exhibit E3 small

not common in prostate cancer. BRCA1 has also been reported to enhance the transcriptional activity of AR in a ligand-dependent manner (21). Yeh et al. (50) demonstrated a contribution of BRCA1 to androgen-induced cell death via cyclin-dependent kinase inhibitor p21waf/cip1, which is an androgen target gene as well. In the present study, we did not find any changes in the expression of BRCA1 in the different prostate tissue and cancer samples studied. ␤-Catenin is a known downstream effector of the Wnt signaling pathway, and mutations in ␤-catenin have been described in numerous cancers, including prostate cancer (51). ␤-Catenin has also been shown to function as a transcriptional coactivator of AR (19). No ␤-catenin overexpression in prostate cancer was detected in this study. Ran/ARA24 has been shown to interact with the polyglutamine region of AR and to enhance AR-dependent transcription. Recently, Li et al. (28) reported that ARA24 is overexpressed in 81% of primary prostate tumor specimens by using in situ hybridization for ARA24 mRNA. This did not correlate with the Gleason score of the tumors. In this work, we failed to find ARA24 overexpression with quantitative real-time RT-PCR. This discrepancy could be due to the fact that although mRNA in situ hybridization is able to localize expression, it is poorly quantitative. ARIP4 modulates AR function in a promoter-dependent manner in transient transfection assays: it enhances receptor activity on minimal promoters, but it does not activate more complex promoters. ARIP4 mutants devoid of ATPase activity fail to alter DNA topology and behave as trans-dominant negative regulators of AR function (52). Here, the expression levels Fig. 4 A, comparative genomic hybridization profile (according to Ref. of ARIP4 were found to be higher in either locally (T3–4)or 34) of chromosome 2, indicating amplification of 2p16–2pter, in the distantly (Nϩ or Mϩ) advanced disease than in localized can- prostate cancer xenograft LuCaP 70. The localization of the SRC1 (2p23) gene is shown along the chromosome ideogram. B, dual-color cer. However, ARIP4 expression was about equal in hormone- fluorescence in situ hybridization analysis. The clustering of red signals refractory tumors and untreated primary tumors. Thus, overex- indicates amplification of the SRC1 gene. Green signal demonstrates pression of ARIP4 is unlikely to be involved in the emergence of one copy of human pHyde, located at chromosome 2q14. hormone-refractory disease. Nuclear receptor corepressors were originally identified as proteins associated with nonliganded type II nuclear receptors that, unlike type I nuclear receptors such as AR, estrogen ubiquitin like modifier (SUMO) ligase activity and modulate receptor (ER), glucocorticoid receptor (GR), and progesterone nuclear receptor and their coregulator activities through protein receptor (PR), can bind to DNA in the absence of ligand and sumoylation (45–47). Recently, Li et al. (28) showed that ex- mediate transcriptional repression (53). Two of the best-charac- pression of PIAS1 was increased in 33% of primary prostate terized corepressors, NCoR1 and SMRT (silencing mediator of cancers compared with normal prostates as determined by in situ retinoid and thyroid hormone receptor), do not interact with ER, hybridization for PIAS1 mRNA. Overexpression did not corre- GR, or PR in the absence of ligand (54). By analogy to other late with the Gleason score. Interestingly, we detected decreased steroid receptors, one might expect that the interaction with PIAS1 expression in hormone-refractory cancers compared with these corepressors could only happen with antagonist-bound AR untreated primary cancers. There was no difference in PIAS1 (55). Several other corepressors of AR, including cyclin D1 and

expression levels in BPH and untreated tumors. Biological sig- AES (NH2-terminal enhancer of split), have been identified (56, nificance of this finding requires additional studies, particularly 57). We found that cyclin D1 was not overexpressed in prostate because the E3 SUMO ligase activity of PIAS proteins is not cancer, confirming the findings of a recent study by Gumbiner restricted to steroid receptors and their coregulators (45, 48). et al. (58). No alterations in the expression of the other core- Several putative AR coregulators are mutated in cancers. In pressors were found here either. addition to AIB1 (discussed above), AIB3 (RAP250/ASC-2)is It should be pointed out that the relative expression levels known to be amplified and overexpressed in some breast carci- of coregulators did not correlate with those of AR in the clinical nomas (49). However, there was no difference in the expression tumors. In addition, the AR-negative small cell carcinoma sam- levels of AIB3 in BPH, untreated, and hormone-refractory pros- ples (cell lines NCI-H660 and LuCaP 49) and cell lines PC-3 tate cancer specimens. In addition, AIB3 expression was lower and DU145 expressed the coregulators. This may be due to the in poorly differentiated untreated tumors than in well-differen- fact that most of the coregulators have been shown to possess tiated untreated tumors, suggesting that AIB3 overexpression is functions that are not related to the AR signaling pathway.

In conclusion, we demonstrated that several AR coregula- systematic restoration of androgen responsive genes and activation of tors are ubiquitously expressed in AR-positive and -negative rapamycin sensitive signaling. Oncogene, 20: 6718–6723, 2001. prostate tissues and cancerous samples. It appears that overex- 14. Amler, L. C., Agus, D. B., LeDuc, C., Sapinoso, M. L., Fox, W. D., pression of these AR coregulators is not commonly associated Kern, S., Lee, D., Wang, V., Leysens, M., Higgins, B., Martin, J., Gerald, W., Dracopoli, N., Cordon-Cardo, C., Scher, H. I., and Hamp- with the progression of prostate cancer. However, other alter- ton, G. M. Dysregulated expression of androgen-responsive and nonre- ations, such as mutations, in these coregulator genes should now sponsive genes in the androgen-independent prostate cancer xenograft be investigated. In addition, the decreased expression of PIAS1 model CWR22–R1. Cancer Res., 60: 6134–6141, 2000. and SRC1 in hormone-refractory prostate cancer warrants addi- 15. Gelmann, E. P. Molecular biology of the androgen receptor J. Clin. tional studies. Oncol., 20: 3001–3015, 2002. 16. McKenna, N. J., Lanz, R. B., and O’Malley, B. W. Nuclear receptor coregulators: cellular and molecular biology. Endocr. Rev., 20: 321– ACKNOWLEDGMENTS 344, 1999. We thank Mariitta Vakkuri and Maarit Ohranen for technical 17. Aarnisalo, P., Palvimo, J. J., and Ja¨nne, O. A. CREB-binding assistance. protein in androgen receptor-mediated signaling. Proc. Natl. Acad. Sci. USA, 95: 2122–2127, 1998. 18. Hsiao, P-W., Lin, D-L., Nakao, R., and Chang, C. The linkage of REFERENCES Kennedy’s neuron disease to ARA24, the first identified androgen receptor polyglutamine region-associated coactivator. J. Biol. Chem., 1. Isaacs, J. T. Role of androgens in prostatic cancer. Vitam. Horm., 49: 274: 20229–20234, 1999. 433–502, 1994. 19. Truica, C. I., Byers, S., and Gelmann, E. P. ␤-Catenin affects 2. Huggins, C., and Hodges, C. V. The effect of castration, of estrogen androgen receptor transcriptional activity and ligand specificity. Cancer and of androgen injection on serum phosphatases in metastatic carci- Res., 60: 4709–4713, 2000. noma of the prostate. Cancer Res., 1: 293–297, 1941. 20. Caira, F., Antonson, P., Pelto-Huikko, M., Treuter, E., and Gustafs- 3. Palmberg, C., Koivisto, P., Visakorpi, T., and Tammela, T. PSA is an son, J-Å. Cloning and characterization of RAP250, a novel nuclear independent prognostic marker in hormonally treated prostate cancer. Eur. Urol., 36: 191–196, 1999. receptor coactivator. J. Biol. Chem., 275: 5308–5317, 2000. 4. Giovannucci, E., Stampfer, M. J., Krithivas, K., Brown, M., Dahl, D., 21. Park, J. J., Irvine, R. A., Buchanan, G., Koh, S. S., Park, J. M., Brufsky, A., Talcott, J., Hennekens, C. H., and Kantoff, P. W. The CAG Tilley, W. D., Stallcup, M. R., Press, M. F., and Coetzee, G. A. Breast repeat within the androgen receptor gene and its relationship to prostate cancer susceptibility gene 1 (BRCA1) is a coactivator of the androgen cancer. Proc. Natl. Acad. Sci. USA, 94: 3320–3323, 1997. receptor. Cancer Res., 60: 5946–5949, 2000. 5. Mononen, N., Ikonen, T., Autio, V., Ro¨kman, A., Matikainen, M. P., 22. Gnanapragasam, V. J., Leung, H. Y., Pulimood, A. S., Neal, D. E., Tammela, T. L., Kallioniemi, O. P., Koivisto, P. A., and Schleutker, J. and Robson, C. N. Expression of RAC3, a steroid hormone receptor Androgen receptor CAG polymorphism and prostate cancer risk. Hum. co-activator in prostate cancer. Br. J. Cancer, 14: 1928–1936, 2001. Genet., 111: 166–171, 2002. 23. Gregory, C. W., He, B., Johnson, R. T., Harris Ford, O., Mohler, 6. Taplin, M. E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, J. M., French, F. S., and Wilson, E. M. A mechanism for androgen A. E., Ogata, G. K., Keer, H. N., and Balk, S. P. Mutation of the receptor-mediated prostate cancer recurrence after androgen deprivation androgen-receptor gene in metastatic androgen-independent prostate therapy. Cancer Res., 61: 4315–4319, 2001. cancer. N. Engl. J. Med., 332: 1393–1398, 1995. 24. Comuzzi, B., Lambrinidis, L., Rogatsch, H., Godoy-Tundidor, S., 7. Hyytinen, E. R., Haapala, K., Thompson, J., Lappalainen, I., Roiha, Knezevic, N., Krhen, I., Marekovic, Z., Bartsch, G., Klocker, H., Ho- M., Rantala, I., Helin, H. J., Ja¨nne, O. A., Vihinen, M., Palvimo, J. J., bisch, A., and Culig, Z. The transcriptional co-activator cAMP response and Koivisto, P. A. Pattern of somatic androgen receptor gene mutations element-binding protein-binding protein is expressed in prostate cancer in patients with hormone-refractory prostate cancer. Lab. Investig., 82: and enhances androgen- and anti-androgen-induced androgen receptor 1591–1598, 2002. function. Am. J. Pathol., 162: 233–241, 2003. 8. Hara, T., Miyazaki, J., Araki, H., Yamaoka, M., Kanzaki, N., 25. Balk, S. P. Androgen receptor as a target in androgen-independent Kusaka, M., and Miyamoto, M. Novel mutations of androgen receptor: prostate cancer. Urology, 60: 132–139, 2002. a possible mechanism of bicalutamide withdrawal syndrome. Cancer 26. Nessler-Menardi, C., Jotova, I., Culig, Z., Eder, I. E., Putz, T., Res., 63: 149–153, 2003. Bartsch, G., and Klocker, H. Expression of androgen receptor coregu- 9. Visakorpi, T., Hyytinen, E., Koivosto, P., Tanner, M., Keina¨nen, R., latory proteins in prostate cancer and stromal-cell culture models. Pros- Palmberg, C., Palotie, A., Tammela, T., Isola, J., and Kallioniemi, O. P. tate, 45: 124–131, 2000. In vivo amplification of the androgen receptor gene and progression of 27. Fujimoto, N., Mizokami, A., Harada, S., and Matsumoto, T. Dif- human prostate cancer. Nat. Genet., 9: 401–406, 1995. ferent expression of androgen receptor coactivators in human prostate. 10. Linja, M. J., Savinainen, K. J., Sarama¨ki, O. R., Tammela, T., Urology, 58: 289–294, 2001. Vessella, R. L., and Visakorpi, T. Amplification and overexpression of 28. Li, P., Yu, X., Ge, K., Melamed, J., Roeder, R. G., and Wang, Z. androgen receptor gene in hormone-refractory prostate cancer. Cancer Heterogenous expression and functions of androgen receptor co-factors Res., 61: 3550–3555, 2001. in primary prostate cancer. Am. J. Pathol., 161: 1467–1474, 2002. 11. Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., 29. Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, Hittmair, A., Bartsch, G., and Klocker, H. Androgen receptor activation R. A., and Balis, U. J. The LightCycler: a microvolume multisample in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte fluorimeter with rapid temperature control. Biotechniques, 22: 176– growth factor, and epidermal growth factor. Cancer Res., 54: 5474– 181, 1997. 5478, 1994. 30. Sarama¨ki, O., Willi, N., Bratt, O., Gasser, T. C., Koivisto, P., 12. Craft, N., Shostak, Y., Carey, M., and Sawyers, C. L. A mechanism Nupponen, N. N., Bubendorf, L., and Visakorpi, T. Amplification of for hormone-independent prostate cancer through modulation of andro- EIF3S3 gene is associated with advanced stage in prostate cancer. gen receptor signaling by the HER-2/neu tyrosine kinase. Nat. Med., 5: Am. J. Pathol., 159: 2089–2094, 2001. 280–285, 1999. 31. True, L. D., Buhler, K., Quinn, J., Williams, E., Nelson, P. S., 13. Mousses, S., Wagner, U., Chen, Y., Kim, J. W., Bubendorf, L., Clegg, N., Macoska, J. A., Norwood, T., Liu, A., Ellis, W., Lange, P., Bittner, M., Pretlow, T., Elkahloun, A. G., Trepel, J. B., and Kallion- and Vessella, R. A neuroendocrine/small cell prostate carcinoma xe- iemi, O. P. Failure of hormone therapy in prostate cancer involves nograft-LuCaP 49. Am. J. Pathol., 161: 705–715, 2002.

32. Tepper, C. G., Boucher, D., Ryan, P., Ma, A-H., Xia, L., Lee, L-F., 46. Kotaja, N., Karvonen, U., Ja¨nne, O. A., and Palvimo, J. J. The Pretlow, T., and Kung, H-J. Characterization of a novel androgen nuclear receptor interaction domain of GRIP1 is modulated by covalent receptor mutation in a relapsed CWR22 prostate cancer xenograft and attachment of SUMO-1. J. Biol. Chem., 277: 30283–30288, 2002. cell line. Cancer Res., 62: 6606–6614, 2002. 47. Nishida, T., and Yasuda, H. PIAS1 and PIASx␣ function as 33. Nupponen, N. N., Hyytinen, E. R., Kallioniemi, A. H., and Visa- SUMO-E3 ligases toward androgen receptor and repress androgen re- korpi, T. Genetic alterations in prostate cancer cell lines detected by ceptor-dependent transcription. J. Biol. Chem., 277: 41311–41317, comparative genomic hybridization. Cancer Genet. Cytogenet., 101: 2002. 53–57, 1998. 48. Verger, A., Perdomo, J., and Grossley, M. Modification with 34. Laitinen, S., Karhu, R., Sawyers, C. L., Vessella, R. L., and Visa- SUMO. EMBO Rep., 4: 137–142, 2003. korpi, T. Chromosomal aberrations in prostate cancer xenografts detected by comparative genomic hybridization. Genes Chromosomes 49. Lee, S-K., Anzick, S. L., Choi, J., Bubendorf, L., Guan, X. Y., Jung, Cancer, 35: 66–73, 2002. Y-K., Kallioniemi, O. P., Kononen, J., Trent, J., Azorsa, D., Jhun, B., 35. Gao, X., Loggie, B. W., and Nawaz, Z. The roles of sex steroid Cheong, J., Lee, Y., Meltzer, P., and Lee, J. W. A nuclear factor, ASC-2, receptor coregulators in cancer. Mol. Cancer, 1: 1–7, 2002. as a cancer-amplified transcriptional coactivator essential for ligand- dependent transactivation by nuclear receptors in vivo. J. Biol. Chem., 36. Hermanson, O., Glass, C. K., and Rosenfeld, M. G. Nuclear receptor coregulators: multiple modes of action. Trends Endocrinol. Metab., 274: 34283–34293, 1999. 13: 55–60, 2002. 50. Yeh, S., Hu, Y., Rahman, M., Lin, H., Hsu, C., Ting, H-J., Kang, 37. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and H-Y., and Chang, C. Increase of androgen induced cell death and Nakatani, Y. The transcriptional coactivators p300 and CBP are histone androgen receptor transactivation by BRCA1 in prostate cancer cells. acetyltransferases. Cell, 87: 953–959, 1996. Proc. Natl. Acad. Sci. USA, 97: 11256–11261, 2000. 38. Berns, E., van Staveren, I., Klijn, J., and Foekens, J. Predictive 51. Voeller, J., Truica, C. I., and Gelmann, E. P. ␤-Catenin mutations in value of SRC-1 for tamoxifen response of recurrent breast cancer. Breast human prostate cancer. Cancer Res., 58: 2520–2523, 1998. Cancer Res. Treat., 48: 87–92, 1998. 52. Rouleau, N., Domanskyi, A., Reeben, M., Moilanen, A. M., Havas, 39. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, K., Kang, Z., Owen-Hughes, T., Palvimo, J. J., and Ja¨nne, O. A. Novel M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and ATPase of SNF2-like protein family interacts with androgen receptor Meltzer, P. S. AIB1, a steroid receptor coactivator amplified in breast and modulates androgen-dependent transcription. Mol. Biol. Cell, 13: and ovarian cancer. Science (Wash. DC), 277: 965–968, 1997. 2106–2119, 2002. 40. Xu, J., Qiu, Y., DeMayo, F. J., Tsai, S. Y., Tsai, M. J., and 53. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., O’Malley, B. W. Partial hormone resistance in mice with disruption of Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C. K., and the steroid receptor coactivator-1 (SRC-1) gene. Science (Wash. DC), Rosenfeld, M. G. Ligand-independent repression by the thyroid hor- 279: 1922–1925, 1998. mone receptor mediated by a nuclear receptor co-repressor. Nature 41. Demarest, S. J., Martinez-Yamout, M., Chung, J., Chen, H., Xu, W., (Lond.), 377: 397–403, 1995. Dyson, J., Evans, R. M., and Wright, P. E. Mutual synergistic folding in 54. Wagner, B. L., Norris, J. D., Knotts, T. A., Weigel, N. L., and recruitment of CBP/p300 by p160 nuclear receptor coactivators. Nature (Lond.), 415: 549–553, 2002. McDonnell, D. P. The nuclear corepressors NCoR and SMRT are key regulators of both ligand- and 8-bromo-cyclic AMP-dependent tran- 42. Moilanen, A. M., Karvonen, U., Poukka, H., Yan, W., Toppari, J., scriptional activity of the human progesterone receptor. Mol. Cell. Biol., Ja¨nne, O. A., and Palvimo, J. J. A testis-specific androgen receptor 18: 1369–1378, 1998. coregulator that belongs to a novel family of nuclear proteins. J. Biol. Chem., 274: 3700–3704, 1999. 55. Heinlein, C. A., and Chang, C. Androgen receptor (AR) coregulators: an overview. Endocr. Rev., 23: 175–200, 2002. 43. Kotaja, N., Aittoma¨ki, S., Silvennoinen, O., Palvimo, J. J., and Ja¨nne, O. A. ARIP3 (androgen receptor-interacting protein 3) and other 56. Knudsen, K. E., Cavenee, W. K., and Arden, K. C. D-type cyclins PIAS (protein inhibitor of activated STAT) proteins differ in their ability complex with the androgen receptor and inhibit its transcriptional ac- to modulate steroid receptor-dependent transcriptional activation. Mol. tivity. Cancer Res., 59: 2297–2301, 1999. Encrinol., 14: 1986–2000, 2000. 57. Yu, X., Li, P., Roeder, G., and Wang, Z. Inhibition of androgen 44. Gross, M., Liu, B., Tan, J., French, F. S., Carey, M., and Shuai, K. receptor-mediated transcription by amino-terminal enhancer of split. Distinct effects of PIAS proteins on androgen-mediated gene activation Mol. Cell. Biol., 21: 4614–4625, 2001. in prostate cancer cells. Oncogene, 20: 3880–3887, 2001. 58. Gumbiner, L. M., Gumerlock, P. H., Mack, P. C., Chi, S. G., 45. Kotaja, N., Karvonen, U., Ja¨nne, O. A., and Palvimo, J. J. PIAS DeVere White, R. W., Mohler, J. L., Pretlow, T. G., and Tricoli, J. V. proteins modulate transcription factors by functioning as SUMO-1 li- Overexpression of cyclin D1 is rare in human prostate carcinoma. gases. Mol. Cell. Biol., 22: 5222–5234, 2002. Prostate, 38: 40–45, 1999.

Marika J. Linja, Kati P. Porkka, Zhikang Kang, et al.

Clin Cancer Res 2004;10:1032-1040.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/10/3/1032

Cited articles This article cites 55 articles, 27 of which you can access for free at: http://clincancerres.aacrjournals.org/content/10/3/1032.full#ref-list-1

Citing articles This article has been cited by 17 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/10/3/1032.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/10/3/1032. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.