DOCSLIB.ORG

Molecular Dissection of Inbreeding Depression for Semen Quality Traits in Cattle

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Dissection of Inbreeding Depression for Semen Quality Traits in Cattle FACULTY OF AGRICULTURE Maja Ferenčaković Molecular dissection of inbreeding depression for semen quality traits in cattle DOCTORAL THESIS Zagreb, 2015 AGRONOMSKI FAKULTET Maja Ferenčaković Molekularna disekcija inbriding depresije za svojstva kvalitete sperme kod goveda DOKTORSKI RAD Zagreb, 2015. FACULTY OF AGRICULTURE Maja Ferenčaković Molecular dissection of inbreeding depression for semen quality traits in cattle DOCTORAL THESIS Supervisors: Professor Ino Čurik, PhD Professor Johann Sölkner, PhD Zagreb, 2015 AGRONOMSKI FAKULTET Maja Ferenčaković Molekularna disekcija inbriding depresije za svojstva kvalitete sperme kod goveda DOKTORSKI RAD Mentori: prof. dr. sc. Ino Čurik Univ. Prof. DI. Dr. Johann Sölkner Zagreb, 2015. Supervisors: prof. dr. sc. Ino Čurik Department of Animal Science Faculty of Agriculture, University of Zagreb Svetošimunska cesta 25, 10000 Zagreb, Croatia [email protected] Univ. Prof. DI. Dr. Johann Sölkner University of Natural Resources and Life Sciences, Vienna, Austria [email protected] This doctoral thesis was evaluated by the Dissertation Evaluation Committee members: 1. Miroslav Kapš, PhD Full professor, Faculty of Agriculture, University of Zagreb, Croatia 2. Johannes Arjen Lenstra, PhD Associate professor, Utrecht University, Institute for Risk Assessment Sciences, The Netherlands 3. Vlatka Čubrić Čurik, PhD Assistant professor, Faculty of Agriculture, University of Zagreb, Croatia Doctoral thesis was defended at Faculty of Agriculture, University of Zagreb on ____________ 2015 in front of the Dissertation Defense Committee members: 1. Miroslav Kapš, PhD, _______________ Full professor, Faculty of Agriculture, University of Zagreb, Croatia, 2. Johannes Arjen Lenstra, PhD, _______________ Associate professor, Utrecht University, Institute for Risk Assessment Sciences, The Netherlands, 3. Vlatka Čubrić Čurik, PhD, _______________ Assistant professor, Faculty of Agriculture, University of Zagreb, Croatia. Acknowledgements First of all, I would like to thank my mentor prof. dr. sc. Ino Čurik who guided me through the process of becoming a scientist in every sense of the word. I am grateful for your leadership, support, selflessly sharing knowledge, motivation and encouraging me to simply follow where the data lead. You helped with my personal and academic development. I cannot think of a better mentor to have. Truly, there are no words that could express my deep gratitude to you. Many thanks to Univ. Prof. DI. Dr. Johann Sölkner for patience, encouragement and all the time dedicated to guide me in research. Thank you for giving me opportunity to work with you and for all your advices and encouragements in tough times. I would like to express my deepest gratitude to doc. dr. sc. Vlatka Čubrić Čurik for support, caring for my future and for constantly reminding me that I have to finish my Ph.D. Thank you for being a good friend and excellent motivator. Big thanks to prof. dr. sc. Miroslav Kapš for honest and unselfish support, sharing knowledge about modeling and all the help with solving statistical issues encountered during writhing this Thesis. You have provided invaluable perspectives on my research when most needed I take this opportunity to express my gratitude to Dr. Johannes Lenstra for the useful comments and engagement through the process of writing of this thesis. Thank you for always finding time to propose consistently excellent improvements. For funding I would like to acknowledge the Croatian Ministry of Science, Education and Sports (project 178-1780460-0546, ‘Strategies for elimination of genetic defects in selected populations’), by a bilateral collaborative project involving the Croatian Ministry of Science, Education and Sports and the Austrian Agency for International Cooperation in Education and Research (OeADGmbH) (“Analysis of genetic diversity in cattle populations using dense sets of molecular markers”),“Ernst Mach grant – worldwide” financed by the Austrian Federal Ministry of Education and Science, Erasmus Mundus programme ‘European Master in animal Breeding and Genetics’, financed by the European Commission and European Science Foundation networking program “Advances in Farm Animal Genomic Resources” (“GENOMIC- RESOURCES”) grant (EX/3733) for which I am deeply thankful. I am very grateful to Zuchtdata EDV-Dienstleistungen GmbH and Geno SA, as well as Austrian Simmental association and Braunvieh Austria, Association of the Tyrolian Grey Cattle Breeders, Austrian association of the Pinzgauer cattle breeders and Federation of Austrian Cattle Breeders for provision of genotype and pedigree data. I would like to thank Dipl. Ing. Peter Stückler from Besamungsanstalt Gleisdorf, Dr. Josef Miesenberger from Besamungsanstalt Hohenzell and Dr. Friedrich Führer from NÖ-Genetik Wieselburg for provision of semen quality records. I would specially like to thank Golden Helix team for providing me free license for SNP & Variation Suite v7.6.8 Win64, which allowed me easy, efficient and headache- free work with genotype data. Thank you for making process of data preparation enjoyable experience. Many thanks to my friend Miroslav Horvacki who selflessly helped me to solve all those mysteries of installing and working with various strange software and platforms. This thesis would not have been possible to write without your help. A special mention for Dr. Félix Goyache; “Little by little…” was something I often heard from you and I continued practicing this philosophy permanently in my life. Thank you for lively discussions, encouraging emails, and sharing relevant publications. I would like to thank my colleagues from Department of Animal Science for support and friendship and being there when I needed help. To all my friends and dear people who patiently helped me to stay focused on my goal when I was exhausted and crazy and who kept reminding me there is a whole world outside of my PhD. Also, thank you for all your support, advice and belief that I was capable of taking on the PhD. To my brother and his family who always jumped in and helped every time there were things to do at home when I was abroad. Knowing that you are there brought me peace of mind and ability to easy concentrate to my work instead of worrying about all those domestic stuff, which are impossible to do if not present. Finally I would like to thank my mother who has supported me throughout the entire process and who was silently proud at all my achievements. I will be grateful forever. Thank you Preface This PhD thesis is based on four articles (Chapters 1, 3, 4 and 5), which are published in international journals, as well as study prepared for publication in which identification of genomic regions associated with inbreeding depression on semen quality traits is investigated (Chapter 5). A detailed literature review is presented in Chapter 1 in form of review article published in “Livestock Science” by Ino Čurik, Maja Ferenčaković and Johann Sölkner. Chapter 2 gives the hypotheses stated in this thesis and the resulting objectives. Chapter 3 was published in Journal of Animal Breeding & Genetics by Maja Ferenčaković, Edin Hamzić, Birgit Gredler, Trygve Solberg, Gunnar Klemetsdal, Ino Čurik and Johann Sölkner. This work is one of the first analyses of Runs of homozygosity (ROH) in cattle. It is important to notice that before this analysis similar studies were performed only in humans with exception of an EAAP conference paper in 2010 (Sölkner et al. 2010) and one paper published 2011, both by the same group of authors (article is in the supplementary material). This pioneer research was published in Agriculturae Conspectus Scientificus and this chapter is extension and confirmation of this research on larger sample and in more cattle populations. Chapter 4 was published in “Genetics Selection Evolution” by Maja Ferenčaković, Johann Sölkner and Ino Čurik. This article represents first comprehensive analysis of the issues that can arise in process of ROH determination and FROH. Chapter 5 present material and methods and results and discussion of unpublished part of this Thesis. This part shows how ROH approach can be used for estimating inbreeding depression. It clearly shows that simple attempt of finding regions that are responsible for changes in semen quality traits when they are autozygous, can yield in finding genes that are proven to affect fertility, as well as some whose function highly suggests important role for fertility traits. In Chapters 6 and 7 general discussion and conclusions are presented Copies of publications which I co-authored and which are directly associated with this Thesis are attached as Supplementary material A hundred times every day I remind myself that my inner and outer life depend on the labors of other men, living and dead, and that I must exert myself in order to give in the same measure as I have received and am still receiving. Albert Einstein, (1879 - 1955) ABSTRACT Runs Of Homozygosity (ROH) are a newly introduced approach for identifying inbreeding in diploid individuals. This approach is more reliable and available than pedigree data, but the lack of universal standards about ROH definition and identification introduces serious bias in ROH studies. In this thesis, ROH were analyzed in five cattle breeds (Brown Swiss, Fleckvieh, Norwegian Red, Pinzgauer and Tyrol Grey). The effects of SNP chip density and genotyping errors were tested on Brown Swiss, Pinzgauer and Tyrol Grey in order to establish the most optimal settings for precise estimation of levels of autozygosity.
Load more

Recommended publications
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Supplemental Figure and Table Legends
    Supplemental figure and table legends Supplementary Figure 1: KIAA1841 is well conserved among vertebrates. NCBI HomoloGene pairwise alignment scores of human KIAA1841 sequence compared to other vertebrate orthologs. Supplementary Figure 2: µ-germline transcripts (GLT) and AID mRNA expression are not affected by overexpression of KIAA1841. Splenic B cells were isolated from wild-type mice, and transduced with retroviral vector control (pMIG) or a vector expressing KIAA1841. Levels of µ-GLT and AID mRNA were determined at 72h post-infection by RT-qPCR, and normalized to -actin mRNA and the pMIG control. The mean of three independent experiments +/- SD is shown. NS, p = not significant, p 0.05, two-tailed paired student’s t-test. Supplementary Figure 3: Overexpression of untagged and Xpress-tagged KIAA1841 does not affect cell proliferation. Splenic B cells were isolated from wild-type mice, stimulated with LPS+IL4, and transduced with retroviral vector control (pMIG) or a vector expressing KIAA1841 or Xpress (Xp)-tagged KIAA1841. Cells are labeled with seminaphthorhodafluor (SNARF) cell tracking dye and SNARF intensity was measured at 0h, 24h, and 48h after retroviral infection. Histograms of transduced cells (GFP+) for pMIG control, KIAA1841 and Xp-KIAA1841 were superimposed at each time point. Three independent retroviral infection experiments are shown. Supplementary Figure 4: Sequence alignment of the putative SANT domain of KIAA1841 with the SANT domain of SWI3. Alignment was performed using ClustalOmega; *, conserved residue, :, strongly similar residues, ., weakly similar residues. Numbers indicate amino acid residues in each sequence. Helix 3, which has been reported to be important for the chromatin remodeling function of SWI3 (Boyer et.
    [Show full text]
  • Network of Micrornas-Mrnas Interactions in Pancreatic Cancer
    Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 534821, 8 pages http://dx.doi.org/10.1155/2014/534821 Research Article Network of microRNAs-mRNAs Interactions in Pancreatic Cancer Elnaz Naderi,1 Mehdi Mostafaei,2 Akram Pourshams,1 and Ashraf Mohamadkhani1 1 Liver and Pancreatobiliary Diseases Research Center, Digestive Diseases Research Institute, Tehran University of Medical Sciences, Tehran, Iran 2 Biotechnology Engineering, Islamic Azad University,Tehran North Branch, Tehran, Iran Correspondence should be addressed to Ashraf Mohamadkhani; [email protected] Received 5 February 2014; Revised 13 April 2014; Accepted 13 April 2014; Published 7 May 2014 Academic Editor: FangXiang Wu Copyright © 2014 Elnaz Naderi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. MicroRNAs are small RNA molecules that regulate the expression of certain genes through interaction with mRNA targets and are mainly involved in human cancer. This study was conducted to make the network of miRNAs-mRNAs interactions in pancreatic cancer as the fourth leading cause of cancer death. Methods. 56 miRNAs that were exclusively expressed and 1176 genes that were downregulated or silenced in pancreas cancer were extracted from beforehand investigations. MiRNA–mRNA interactions data analysis and related networks were explored using MAGIA tool and Cytoscape 3 software. Functional annotations of candidate genes in pancreatic cancer were identified by DAVID annotation tool. Results. This network is made of 217 nodes for mRNA, 15 nodes for miRNA, and 241 edges that show 241 regulations between 15 miRNAs and 217 target genes.
    [Show full text]
  • Supplementary Table 1. Hypermethylated Loci in Estrogen-Pre-Exposed Stem/Progenitor-Derived Epithelial Cells
    Supplementary Table 1. Hypermethylated loci in estrogen-pre-exposed stem/progenitor-derived epithelial cells. Entrez Gene Probe genomic location* Control# Pre-exposed# Description Gene ID name chr5:134392762-134392807 5307 PITX1 -0.112183718 6.077605311 paired-like homeodomain transcription factor 1 chr12:006600331-006600378 171017 ZNF384 -0.450661784 6.034362758 zinc finger protein 384 57121 GPR92 G protein-coupled receptor 92 chr3:015115848-015115900 64145 ZFYVE20 -1.38491748 5.544950925 zinc finger, FYVE domain containing 20 chr7:156312210-156312270 -2.026450994 5.430611412 chr4:009794114-009794159 9948 WDR1 0.335617144 5.352264173 WD repeat domain 1 chr17:007280631-007280676 284114 TMEM102 -2.427266294 5.060047786 transmembrane protein 102 chr20:055274561-055274606 655 BMP7 0.764898513 5.023260524 bone morphogenetic protein 7 chr10:088461669-088461729 11155 LDB3 0 4.817869864 LIM domain binding 3 chr7:005314259-005314304 80028 FBXL18 0.921361233 4.779265347 F-box and leucine-rich repeat protein 18 chr9:130571259-130571313 59335 PRDM12 1.123111331 4.740306098 PR domain containing 12 chr2:054768043-054768088 6711 SPTBN1 -0.089623066 4.691756995 spectrin, beta, non-erythrocytic 1 chr10:070330822-070330882 79009 DDX50 -2.848748309 4.691491169 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 chr1:162469807-162469854 54499 TMCO1 1.495802762 4.655023656 transmembrane and coiled-coil domains 1 chr2:080442234-080442279 1496 CTNNA2 1.296310425 4.507269831 catenin (cadherin-associated protein), alpha 2 347730 LRRTM1 leucine rich repeat transmembrane
    [Show full text]
  • Rbsn (NM 030081) Mouse Untagged Clone – MC202719 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC202719 Rbsn (NM_030081) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Rbsn (NM_030081) Mouse Untagged Clone Tag: Tag Free Symbol: Rbsn Synonyms: 5330426D11Rik; Zfyve20 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC049106 sequence for NM_030081 CCGGCAGTCAGAACCCGAGGTGGAAAGGCAGGCTGCCGACTGCCTGTCGGAAGCCGCAGGGAGTGAGAAA GGGTGTCGCAGAGAGCGCGGCGGTGGCTGAGATTTCTTCTGCTGAAGAGAGGAAATCTCATCCAAGGCCA CAATGTCACTTCCCAATTATCCGAGTGCTGCCTGCTCAAGCTAACACTGCCAGAGTCCTGCTCCCTCGGG AGGAGTCAAGCTTACTTGGCATGAGGTTCCTGCTTTCCTGGGGTTGAGAGAAGCACAACTATGGCATCTC TTGATGACCCAGGGGAGGTGAGGGAAGGCTTCCTGTGCCCTTTGTGCCTGAAGGACCTTCAGTCTTTCTA TCAACTTCAGTCACATTATGAGGAAGAACACTTGGAAGATCGTGATGTCAAAGGGCAAATTAAAAATCTT GTTCAGAAGGCTAGGAAAGCAAAGAACAAGTTGTTGAAACGAGAAGGAGATGATCGAGTGGAACCAGGGA CCCAAGGATATGAATCATTCAGTTATGGTGGGGTTGATCCTTACATGTGGGAACCCCAAGAGCTTGGTGC TATGAGAAGCCATCTTTCTGACTTCAAAAAACATCGTGCTGCAAGAATTGACCACTATGTTGTTGAAGTC AATAAATTAATCATCAGGTTGGAAAAGCTTACTGCATTTGACAGAACAAATACTGAGACTTCAAAGATTA GAGCAATAGAAAAGTCCGTGGTGCCTTGGGTCAATGACCAGGATGTCCCCTTCTGTCCAGACTGTGGGAA TAAATTCAGCATCCGGAACCGCCGTCACCACTGCCGCCTCTGTGGGTCTATCATGTGCAAGAAGTGTATG GAGCTCATCGGCCTGCCCTTAGCACATAAGCTCACCAGTGCCAGCAAGGACTCTCTGAGCACCCACACCA GCCCCAGCCAGTCTCCTAACAGTGTCCATGGCTCCCGCCGGGGCAGCATCAGCAGCATGAGCAGTGTCAG CTCAGTCCTAGACGAGAAGGATGATGACCGCATCCGCTGCTGCACACACTGCAAGGACAAGCTGCTCAAG
    [Show full text]
  • Rab Proteins and the Compartmentalization of the Endosomal System
    Downloaded from http://cshperspectives.cshlp.org/ on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Rab Proteins and the Compartmentalization of the Endosomal System Angela Wandinger-Ness1 and Marino Zerial2 1Department of Pathology MSC08 4640, University of New Mexico HSC, Albuquerque, New Mexico 87131 2Max Planck Institute of Molecular and Cell Biology and Genetics, 01307 Dresden, Germany Correspondence: [email protected]; [email protected] Of the approximately 70 human Rab GTPases, nearly three-quarters are involved in endo- cytic trafficking. Significant plasticity in endosomal membrane transport pathways is closely coupled to receptor signaling and Rab GTPase-regulated scaffolds. Here we review current literature pertaining to endocytic Rab GTPaselocalizations, functions, and coordination with regulatory proteins and effectors. The roles of Rab GTPasesin (1) compartmentalization of the endocytic pathway into early, recycling, late, and lysosomal routes; (2) coordination of individual transport steps from vesicle budding to fusion; (3) effector interactomes; and (4) integration of GTPase and signaling cascades are discussed. he general working principle of Rab coded by interacting proteins (Wittinghofer TGTPases is that they contribute to the struc- et al. 1993). Guanine-nucleotide exchange fac- tural and functional identity of intracellular or- tors (GEFs) and GTPase-activating proteins ganelles. These functions rely on the versatile (GAPs) catalyze the exchange and hydrolysis GTP/GDP cycle for the assembly of multipro- reactions and, therefore, act as regulators of tein machineries on the cytoplasmic surface of the GTP–GDP cycle (Yoshimura et al. 2010; intracellular membranes. Rab GTPase protein Wu et al. 2011; Barr 2013; Guo et al. 2013; Kot- assemblies are spatially and temporally regulat- ting and Gerwert 2013).
    [Show full text]
  • Genetic Circuitry of Survival Motor Neuron, the Gene Underlying Spinal
    Genetic circuitry of Survival motor neuron, the gene PNAS PLUS underlying spinal muscular atrophy Anindya Sena,1, Douglas N. Dimlicha,1, K. G. Guruharshaa,1, Mark W. Kankela,1, Kazuya Horia, Takakazu Yokokuraa,3, Sophie Brachatb,c, Delwood Richardsonb, Joseph Loureirob, Rajeev Sivasankaranb, Daniel Curtisb, Lance S. Davidowd, Lee L. Rubind, Anne C. Harte, David Van Vactora, and Spyros Artavanis-Tsakonasa,2 aDepartment of Cell Biology, Harvard Medical School, Boston, MA 02115; bDevelopmental and Molecular Pathways, Novartis Institutes for Biomedical Research, Cambridge, MA 02139; cMusculoskeletal Diseases, Novartis Institutes for Biomedical Research, CH-4002 Basel, Switzerland; dDepartment of Stem Cell and Regenerative Biology, Harvard Medical School, Boston, MA 02115; and eDepartment of Neuroscience, Brown University, Providence, RI 02912 Edited by Jeffrey C. Hall, University of Maine, Orono, ME, and approved May 7, 2013 (received for review February 13, 2013) The clinical severity of the neurodegenerative disorder spinal muscu- snRNP biogenesis, the molecular functionality that is most clearly lar atrophy (SMA) is dependent on the levels of functional Survival associated with SMN. Motor Neuron (SMN) protein. Consequently, current strategies for As the human disease state results from partial loss of SMN developing treatments for SMA generally focus on augmenting SMN function, we reasoned that a screening paradigm using a hypo- levels. To identify additional potential therapeutic avenues and morphic Smn background (as opposed to a background that achieve a greater understanding of SMN, we applied in vivo, in vitro, completely eliminates SMN function) would more closely resemble and in silico approaches to identify genetic and biochemical interac- the genetic condition in SMA.
    [Show full text]
  • Host Genomics Plasticity in Response to Ambient Temperature Change: Transcriptional Regulation Induced by Cold Temperature Perception in the Human BEAS-2B Cell Line
    Current Pharmacogenomics and Personalized Medicine, 2012, 10, 33-42 33 Original Research Article Host Genomics Plasticity in Response to Ambient Temperature Change: Transcriptional Regulation Induced by Cold Temperature Perception in the Human BEAS-2B Cell Line Seyeon Park1,*, Sohyun Chun1,2 and Danuh Kim1,2 1Department of Applied Chemistry, Dongduk Women’s University, Seoul, Korea; 2Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA Abstract: Pharmacogenomics has long attempted to identify genome-drug interactions and environmental exposures as guideposts for personalized medicine. However, non-drug related environmental factors, too, can interact with the host genome and potentially cause confounding in explaining drug-genome interactions. One such environmental factor that has been bracketed out in the past is the ambient temperature change, and ways in which it can influence genomic plasticity. Indeed, recognition of temperature is an important element of microsensory perception that allows cells to evaluate both their external environment and internal physiological milieu. In this paper, we report the changes in global gene expression three hours after a 30-min cold temperature (10°C) treatment in the human bronchial epithelial cell line BEAS-2B using DNA microarrays. We found 11,276 candidate genes (6,297 with increased, 4,979 with decreased expression) that were differentially expressed after low-temperature treatment of BEAS-2B compared to the untreated control cells (p<0.001). Additionally, up- and down-regulated transcription factor genes were further verified using real- time polymerase chain reaction. We found expression changes in response to cold temperature in transcription factor genes such as ZXDA, ZNF44, ZDHHC13, ZNF423, ZFYVE20, ZNF45, ZC3HAV, ZCCHC5, RUNX1T1, DMRT1, STAT4, EFCAB1 and HSFX1 that can alter the temperature-adaptive responsiveness of the bronchial epithelial cells.
    [Show full text]
  • Interactome Analysis Reveals That Lncrna HULC Promotes Aerobic Glycolysis Through LDHA and PKM2
    ARTICLE https://doi.org/10.1038/s41467-020-16966-3 OPEN Interactome analysis reveals that lncRNA HULC promotes aerobic glycolysis through LDHA and PKM2 Chunqing Wang1,9, Yongmei Li2,9, Shuai Yan3,9, Hao Wang3,4, Xianfeng Shao3,7, Mingming Xiao1, Baicai Yang3,8, ✉ ✉ Guoxuan Qin5, Ruirui Kong6, Ruibing Chen 4 & Ning Zhang 1,6 1234567890():,; Interacting with proteins is a crucial way for long noncoding RNAs (lncRNAs) to exert their biological responses. Here we report a high throughput strategy to characterize lncRNA interacting proteins in vivo by combining tobramycin affinity purification and mass spec- trometric analysis (TOBAP-MS). Using this method, we identify 140 candidate binding proteins for lncRNA highly upregulated in liver cancer (HULC). Intriguingly, HULC directly binds to two glycolytic enzymes, lactate dehydrogenase A (LDHA) and pyruvate kinase M2 (PKM2). Mechanistic study suggests that HULC functions as an adaptor molecule that enhances the binding of LDHA and PKM2 to fibroblast growth factor receptor type 1 (FGFR1), leading to elevated phosphorylation of these two enzymes and consequently promoting glycolysis. This study provides a convenient method to study lncRNA interactome in vivo and reveals a unique mechanism by which HULC promotes Warburg effect by orchestrating the enzymatic activities of glycolytic enzymes. 1 Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin’s Clinical Research Center for Cancer, Tianjin Medical University, 300070 Tianjin, China. 2 Department of Pathogen Biology, School of Basic Medical Sciences, Tianjin Medical University, 300070 Tianjin, China. 3 Department of Genetics, School of Basic Medical Sciences, Tianjin Medical University, 300070 Tianjin, China.
    [Show full text]
  • Systems Survey of Endocytosis by Multiparametric Image Analysis
    Vol 464 | 11 March 2010 | doi:10.1038/nature08779 ARTICLES Systems survey of endocytosis by multiparametric image analysis Claudio Collinet1, Martin Sto¨ter2, Charles R. Bradshaw1, Nikolay Samusik1, Jochen C. Rink{, Denise Kenski{, Bianca Habermann1, Frank Buchholz1, Robert Henschel3, Matthias S. Mueller3, Wolfgang E. Nagel3, Eugenio Fava2, Yannis Kalaidzidis1,4 & Marino Zerial1 Endocytosis is a complex process fulfilling many cellular and developmental functions. Understanding how it is regulated and integrated with other cellular processes requires a comprehensive analysis of its molecular constituents and general design principles. Here, we developed a new strategy to phenotypically profile the human genome with respect to transferrin (TF) and epidermal growth factor (EGF) endocytosis by combining RNA interference, automated high-resolution confocal microscopy, quantitative multiparametric image analysis and high-performance computing. We identified several novel components of endocytic trafficking, including genes implicated in human diseases. We found that signalling pathways such as Wnt, integrin/cell adhesion, transforming growth factor (TGF)-b and Notch regulate the endocytic system, and identified new genes involved in cargo sorting to a subset of signalling endosomes. A systems analysis by Bayesian networks further showed that the number, size, concentration of cargo and intracellular position of endosomes are not determined randomly but are subject to specific regulation, thus uncovering novel properties of the endocytic system. Endocytosis is a fundamental process supporting many functions platform, on the basis of the custom-designed image analysis software such as nutrient uptake, intracellular signalling1, morphogenesis MotionTracking12. First, images were segmented to determine mor- during development2 and defence against pathogens3. Dysfunctions phological and positional descriptors for each endosome (Fig.
    [Show full text]
  • Table S1 (Revised)
    TABLE 1. LIST OF ALL PROTEINS IDENTIFIED SORTED BY GENE NAME Membrane Probability Accession GI Number Protein Name Entrez Gene Name # of Expts Peptides Fraction score number SV 0.82 10947122 NP_064693.1 ATP-binding cassette, sub-family C, member 9 isoform SUR2B ABCC9 1 EVQM[147]GAVKK SSILIMDEATASIDMATENILQK PM 0.99 21431817 P49597 Protein phosphatase 2C ABI1 (PP2C) (Abscisic acid-insensitive 1) ABI1 1 KEGKDPAAM[147]SAAEYLSK KEGKDPAAMSAAEYLSK PM 0.82 231504 P30172 ACTIN 100,ACTIN 101 AC100 1 AVFPSIVGRPR AGFAGDDAPR VSPDEHPVLLTEAPLNPK SV 1 4501853 NP_001598.1 acetyl-Coenzyme A acyltransferase 1 ACAA1 1 SITVTQDEGIRPSTTMEGLAK PM 0.86 4501855 NP_001084.1 acetyl-Coenzyme A carboxylase beta ACACB 1 VIQVENSHIILTGASALNK M[147]TVPISITNPDLLR MTVPISITNPDLLR EAISNMVVALK SV 0.75 38505218 NP_115545.3 putative acyl-CoA dehydrogenase ACAD11 1 QHSMILVPMNTPGVK QHSM[147]ILVPM[147]NTPGVK PM 1 113018 P08503 Acyl-CoA dehydrogenase, medium-chain specific, mitochondrial precursor (MCAD) ACADM 1 VPKENVLIGEGAGFK PM 0.99 4557237 NP_000010.1 acetyl-Coenzyme A acetyltransferase 1 precursor ACAT1 1 DGLTDVYNK SV 0.89 9998948 NP_064718.1 amiloride-sensitive cation channel 3 isoform c ACCN3 1 DNEETPFEVGIR PM 1 7662238 NP_055792.1 apoptotic chromatin condensation inducer 1 ACIN1 1 VDRPSETKTEEQGIPR CEAEEAEPPAATQPQTSETQTSHL SV 0.76 30089972 NP_004026.2 acyl-coenzyme A oxidase 1 ACOX1 1 EIGTHKPLPGITVGDIGPK TSNHAIVLAQLITK PM 1 16445033 NP_443189.1 ACRC protein; putative nuclear protein ACRC 1 FAKIQIGLKVCDSADR SV 0.93 27477105 NP_055977.3 lipidosin ACSBG1 1 EVEPTSHMGVPR MELPIISNAM[147]LIGDQR
    [Show full text]
  • Computational Studies of the Genome Dynamics of Mammalian Transposable Elements and Their Relationships to Genes
    COMPUTATIONAL STUDIES OF THE GENOME DYNAMICS OF MAMMALIAN TRANSPOSABLE ELEMENTS AND THEIR RELATIONSHIPS TO GENES by Ying Zhang M.Sc., Katholieke Universiteit Leuven (BELGIUM), 2004 B.E., Harbin Institute of Technology (CHINA), 1993 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) May, 2012 © Ying Zhang, 2012 Abstract Sequences derived from transposable elements (TEs) comprise nearly 40 - 50% of the genomic DNA of most mammalian species, including mouse and human. However, what impact they may exert on their hosts is an intriguing question. Originally considered as merely genomic parasites or “selfish DNA”, these mobile elements show their detrimental effects through a variety of mechanisms, from physical DNA disruption to epigenetic regulation. On the other hand, evidence has been mounting to suggest that TEs sometimes may also play important roles by participating in essential biological processes in the host cell. The dual-roles of TE-host interactions make it critical for us to understand the relationship between TEs and the host, which may ultimately help us to better understand both normal cellular functions and disease. This thesis encompasses my three genome-wide computational studies of TE-gene dynamics in mammals. In the first, I identified high levels of TE insertional polymorphisms among inbred mouse strains, and systematically analyzed their distributional features and biological effects, through mining tens of millions of mouse genomic DNA sequences. In the second, I examined the properties of TEs located in introns, and identified key factors, such as the distance to the intron-exon boundary, insertional orientation, and proximity to splice sites, that influence the probability that TEs will be retained in genes.
    [Show full text]