BMC Evolutionary Biology

This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon.

Conquering the Sahara and Arabian deserts: Systematics and biogeography of Stenodactylus geckos (Reptilia: Gekkonidae)

BMC Evolutionary Biology 2012, 12:258 doi:10.1186/1471-2148-12-258

Margarita Metallinou ([email protected]) Nick E Arnold ([email protected]) Pierre-André Crochet ([email protected]) Philippe Geniez ([email protected]) José Carlos Brito ([email protected]) Petros Lymberakis ([email protected]) Sherif Baha El Din ([email protected]) Roberto Sindaco ([email protected]) Michael Robinson ([email protected]) Salvador Carranza ([email protected])

ISSN 1471-2148

Article type Research article

Submission date 20 September 2012

Acceptance date 3 December 2012

Publication date 31 December 2012

Article URL http://www.biomedcentral.com/1471-2148/12/258

Like all articles in BMC journals, this peer-reviewed article can be downloaded, printed and distributed freely for any purposes (see copyright notice below).

Articles in BMC journals are listed in PubMed and archived at PubMed Central.

For information about publishing your research in BMC journals or any BioMed Central journal, go to

http://www.biomedcentral.com/info/authors/

© 2012 Metallinou et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Conquering the Sahara and Arabian deserts: Systematics and biogeography of Stenodactylus geckos (Reptilia: Gekkonidae)

Margarita Metallinou 1 Email: [email protected]

Nick E Arnold 2 Email: [email protected]

Pierre-André Crochet 3 Email: [email protected]

Philippe Geniez 4 Email: [email protected]

José Carlos Brito 5 Email: [email protected]

Petros Lymberakis 6 Email: [email protected]

Sherif Baha El Din 7 Email: [email protected]

Roberto Sindaco 8 Email: [email protected]

Michael Robinson 9 Email: [email protected]

Salvador Carranza 1* * Corresponding author Email: [email protected]

1 Institute of Evolutionary Biology (CSIC-UPF), Passeig Marítim de la Barceloneta 37-49, Barcelona 08003, Spain

2 The Natural History Museum, Cromwell Road, London SW7 5BD, UK

3 CNRS-UMR 5175 Centre d'Ecologie Fontionnelle et Evolutive, 1919 Route de Mende, 34293 Montpellier cedex 5, France

4 EPHE-UMR, Centre d'Ecologie Fontionnelle et Evolutive, 1919 Route de Mende, 34293 Montpellier cedex 5, France 5 CIBIO/InBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos da Universidade do Porto, Instituto de Ciências Agrárias de Vairão, R. Padre Armando Quintas 4485-661, Vairão, Portugal

6 Natural History Museum of Crete, University of Crete, Knosou Av, P.O. Box 2208, 71409 Heraklion, Greece

7 Nature Conservation Sector, Egyptian Environmental Affairs Agency, 3 Abdalla El Katib, Apt. 3, Cairo, Dokki, Egypt

8 Museo Civico de Storia Naturale, via San Francesco di Sales 188, Carmagnola I-10022, Italy

9 Sultan Qaboos University, Department of Biology, College of Science, P.O. Box 36, Al-Khod, Muscat, Sultanate of Oman

Abstract

Background

The evolutionary history of the biota of North Africa and Arabia is inextricably tied to the complex geological and climatic evolution that gave rise to the prevalent deserts of these areas. Reptiles constitute an exemplary group in the study of the arid environments with numerous well-adapted members, while recent studies using reptiles as models have unveiled interesting biogeographical and diversification patterns. In this study, we include 207 specimens belonging to all 12 recognized species of the genus Stenodactylus . Molecular phylogenies inferred using two mitochondrial (12S rRNA and 16S rRNA) and two nuclear (c-mos and RAG -2) markers are employed to obtain a robust time-calibrated phylogeny, as the base to investigate the inter- and intraspecific relationships and to elucidate the biogeographical history of Stenodactylus , a genus with a large distribution range including the arid and hyper-arid areas of North Africa and Arabia.

Results

The phylogenetic analyses of molecular data reveal the existence of three major clades within the genus Stenodactylus , which is supported by previous studies based on morphology. Estimated divergence times between clades and sub-clades are shown to correlate with major geological events of the region, the most important of which is the opening of the Red Sea, while climatic instability in the Miocene is hypothesized to have triggered diversification. High genetic variability is observed in some species, suggesting the existence of some undescribed species. The S. petrii - S. stenurus species complex is in need of a thorough taxonomic revision. New data is presented on the distribution of the sister species S. sthenodactylus and S. mauritanicus .

Conclusions

The phylogenetic hypothesis for the genus Stenodactylus presented in this work permits the reconstruction of the biogeographical history of these common desert dwellers and confirms the importance of the opening of the Red Sea and the climatic oscillations of the Miocene as major factors in the diversification of the biota of North Africa and Arabia. Moreover, this study traces the evolution of this widely distributed and highly specialized group, investigates the patterns of its high intraspecific diversity and elucidates its systematics.

Keywords

Stenodactylus, Gekkonidae, Arabia, North Africa, Phylogeny, Biogeography, Desert, Red Sea Background

North Africa and Arabia are home to a unique fauna and flora that has been shaped by the combination of several factors including the harsh climatic conditions of the Sahara and Arabian deserts, the episodic appearance of humid cycles, and by the complex geological evolution of the area [1-9]. One of the most important geological phenomena of the entire Cenozoic that occurred in this area was the break-up of the Arabian plate from Africa. Tectonic activity started approximately 30 Ma ago at the central Gulf of Aden with the formation of a rift basin in the Eritrean Red Sea and initial rifting at the Afar zone. A second phase of volcanism occurred 24 Ma ago, causing extension and rifting throughout the entire Red Sea, from Yemen to Egypt, as well as uplifting of the newly-formed continental shoulders [1]. Nevertheless, fluctuations of the sea level during the Miocene permitted the formation of transient land connections [1,10] that were subsequently lost [11].

The establishment of the Afro-Arabia - Eurasia land bridge ( Gomphotherium bridge) was another crucial event with major biogeographical implications [12-14]. Following the opening of the Gulf of Aden and the Red Sea and with the counterclockwise rotation of the Arabian plate, a first connection was presumably formed between the latter and the Anatolian plate, and subsequently with Eurasia. Although the connection between the Mediterranean Sea and the Indian Ocean is hypothesized to have been re-established in the Upper Middle Miocene, around 15 Ma ago, it is believed that posterior to this date the land bridge has been continuously present [15]. Important faunal and floral exchanges have been attributed to the establishment of this connection ([12-14] and references therein).

Although the origin of the Sahara and Arabian deserts is still hotly debated [16-19], it is generally accepted that climatic development in the late Miocene, as a result of major growth of the East Antarctic Ice Sheet and polar cooling, lead to an increase in aridification of mid- latitude continental regions [4] and that this had a profound effect on the diversification of faunas [20-22].

Reptiles are among the commonest inhabitants of arid areas and have long been used in biogeographic, ecological and evolutionary studies [23], constituting thus excellent models to investigate how diversity is originated and maintained. Several cases of faunal exchanges in both directions between North Africa and Arabia have been described (e.g. [2,13,24]) showing that there is not a single pattern, but rather different hypotheses including both vicariance and dispersal, heavily dependent on the estimated timeframe of the events. Moreover, several studies have shown that climatic changes towards aridity and contraction/expansion of the Sahara and Arabian deserts have played a decisive role in reptile species diversification [25-29]. Gekkonid lizards of the genus Stenodactylus Fitzinger, 1826 [30] are one of the most characteristic and abundant elements of the fauna of the arid and hyper-arid regions of Arabia and North Africa [31]. The genus comprises twelve species that are distributed in a more or less continuous range across northern Africa and Arabia, with an apparently isolated population in northern Kenya and extending around the Arabian Gulf to coastal southwestern Iran ([32,33]; see Figure 1). Up to three species may occur at a single locality and, where such sympatry exists, resource partitioning is largely achieved by microhabitat segregation, with species occupying different soil types [34]. Gravel plains, hard sand and aeolian soft sand all have their characteristic species that show specialized morphological adaptations. These include the presence of depressed and fringed toes, which increase the surface area and improve grip in the aeolian sand dune specialists Stenodactylus doriae (Blanford, 1874 [35]) , S. petrii Anderson, 1896 [36] and S. arabicus (Haas, 1957 [37]). Extensive webbing is also observed between the fingers for efficient sand burrowing in S. arabicus [31,32,38]. When two species are regularly found on the same substrate, they greatly differ in size and there are corresponding differences in the size of prey taken [32].

Figure 1 Sampling localities of the Stenodactylus specimens used in this study. Colors and locality numbers refer to specimens in Figures 2 and 3 (see also Table 1). The global distribution of the genus is seen on the upper right (data from Sindaco and Jeremcenko, 2008).

Morphologically, Stenodactylus is fairly homogeneous and all species exhibit phalangeal reduction that produces a formula of 2.3.3.4.3 on both fore and hind limbs and are also characterized by a very high scleral ossicle number (20–28) [31,39]. A morphology-based phylogenetic hypothesis has been proposed by Arnold (1980) [31]. Although these two characters are also present in Pseudoceramodactylus khobarensis Haas, 1957 [37], which was widely accepted as a Stenodactylus member [31,39], a recent phylogenetic study by Fujita and Papenfuss (2011) [40] including specimens of the former and six out of the twelve species of the genus Stenodactylus proposed the resurrection of the genus Pseudoceramodactylus . This was done in order to deal with the resulting paraphyly of Stenodactylus , caused by the branching of two representatives of the genus Tropiocolotes between P. khobarensis and the six Stenodactylus included in their analyses . Their molecular analyses also uncovered high levels of genetic divergence between the different Stenodactylus species. Genetic variability within some of the species, like S. arabicus and S. doriae , was also high and this could be linked to biogeographic discontinuities among some of the hyper-arid areas in Arabia.

Although Stenodactylus includes a relatively low number of species compared to other gecko groups in these areas, such as Pristurus , Tarentola or Hemidactylus [26,41-46], its relatively high level of resource partitioning and habitat specialization has allowed the different species to successfully colonize almost all available habitats in the arid and hyper-arid regions of North Africa and Arabia. It constitutes, therefore, a very interesting, but still poorly studied, genus that makes an excellent model for the study of desert biodiversity and biogeography. The main objectives of the present work are: (1) to provide for the first time a complete phylogeny of the genus Stenodactylus and evaluate its concordance with previous molecular and morphology-based studies; (2) to investigate the biogeographical and diversification patterns of Stenodactylus ; and (3) to explore the interspecific relationships, the patterns of intraspecific diversity and the possible presence of unrecognized divergent lineages in Stenodactylus . Methods

Taxon sampling, DNA extraction and sequencing

A total of 207 individuals of Stenodactylus representing all twelve currently recognized species were included in the present study. Whenever possible, we tried to include multiple populations for each species in order to assess intraspecific variation; sampling was especially intense in the three African species with very large distribution ranges. In addition, three Pseudoceramodactylus khobarensis and eight individuals representing six species of the genus Tropiocolotes were included in an attempt to further test the relationship between Stenodactylus, Pseudoceramodactylus and Tropiocolotes . Four additional specimens from other closely related genera [47-49] were used as outgroups and sixteen specimens, from several genera, were added in order to estimate divergence times (see below). Table 1 lists all 238 samples used in the present work with their extraction codes, voucher references, localities and GenBank accession numbers (KC190516-KC191151). Table 1 Information on the specimens used in the phylogenetic analyses Locality Species DNA Voucher Country or Region Locality Genbank accession codes Code Extraction (or Tissue) Code (12S/16S/c -mos /RAG -2) Code 1 Stenodactylus affinis - 1 M131 Iran Heled National Park KC190679 / KC190873 / - / KC1901056 2 Stenodactylus affinis - 2 M198 Iran Bandar e Khamir, semidesert KC190677 / KC190871 / - / - 3 Stenodactylus affinis - 3** M7 BEV.10036 Kuwait 500 m W of Sulaibikhat Reserve, W. Kuwait City KC190675 / KC190869 / KC190946 / KC191054 4 Stenodactylus affinis - 4 M8 BEV.10095 Kuwait Mina Said KC190676 / KC190870 / KC190947 / KC191055 4 Stenodactylus affinis - 5 M32 BEV.10096 Kuwait Mina Said KC190674 / KC190868 / KC190945 / KC191053 73 Stenodactylus affinis - 6 M132 Iran - / KC190913 73 Stenodactylus affinis - 7 M133 Iran KC190678 / KC190872 5 Stenodactylus cf. arabicus - 1** M10 Oman S of Al Mintrib KC190696 / KC190890 / KC190998 / KC191116 5 Stenodactylus cf. arabicus - 2 M36 Oman S of Al Mintrib KC190697 / KC190891 / KC190999 / KC191117 6 Stenodactylus cf. arabicus - 3 M166 Oman Al Mintrib, Sharqiya Sands KC190699 / KC190893 / KC191000 / KC191118 7 Stenodactylus arabicus - 4 M129 Qatar 15 km NE of As Salwa KC190694 / KC190888 / KC190996 / KC191115 8 Stenodactylus arabicus - 5 M9 Oman Sand dunes N of Shisur KC190695 / KC190889 / KC190997 / KC191112 8 Stenodactylus arabicus - 6 M33 Oman Sand dunes N of Shisur KC190692 / KC190886 / KC191001 / KC191113 9 Stenodactylus arabicus - 7** M34 BEV.10042 Kuwait Wafrah Farms, 20 km E of Wafrah KC190690 / KC190884 / KC190994 / KC191110 9 Stenodactylus arabicus - 8 M35 BEV.10043 Kuwait Wafrah Farms, 20 km E of Wafrah KC190691 / KC190885 / KC190995 / KC191111 10 Stenodactylus arabicus - 9 E150536 UAE Dhafra Beach Hotel KC190693 / KC190887 / KC191011 / KC191114 6 Stenodactylus cf. arabicus - 10 M167 Oman Al Mintrib, Sharqiya Sands KC190698 / KC190892 11 Stenodactylus doriae - 1 M31 Oman Al-Areesh Desert Camp, Sharqiya Sands KC190643 / KC190837 / KC190936 / KC191044 6 Stenodactylus doriae - 2 M169 Oman Al Mintrib, Sharqiya Sands KC190644 / KC190838 / KC190937 / KC191121 12 Stenodactylus doriae - 3** E150538 UAE Sand dunes at Al Ain KC190653 / KC190847 / KC190939 / KC191050 13 Stenodactylus doriae - 4 M185 BEV.T3759 Jordan Between Aqaba and Wadi Rum KC190650 / KC190844 / KC190941 / KC191047 14 Stenodactylus doriae - 5 M28 BEV.10037 Kuwait 13 km N-NE of Jahra KC190646 / KC190840 / KC190938 / KC191045 15 Stenodactylus doriae - 6 M30 BEV.8483 Israel 14 km N of Eilot KC190649 / KC190843 / KC190940 / KC191046 6 Stenodactylus doriae - 7 M170 Oman Al Mintrib, Sharqiya Sands KC190645 / KC190839 74 Stenodactylus doriae - 8 M12 Oman Al-Areesh Desert Camp, Sharqiya Sands KC190642 / KC190836 75 Stenodactylus doriae - 9 E150537 UAE Al Aya, Abu Dhabi KC190652 / KC190846 18 Stenodactylus doriae - 10 M11 BEV.10038 Kuwait Wafrah Farms, 20 km E of Wafrah KC190647 / KC190841 13 Stenodactylus doriae - 11 M186 BEV.T3760 Jordan Between Aqaba and Wadi Rum KC190651 / KC190845 15 Stenodactylus doriae - 12 M29 BEV.8482 Israel 14 km N of Eilot KC190648 / KC190842 76 Stenodactylus doriae - 13 M120 Qatar KC190654 / KC190848 136 Stenodactylus doriae - 14 M210 Yemen Ma'rib KC190720 / KC190922 / KC191030 / KC191138 136 Stenodactylus doriae - 15 M211 Yemen Ma'rib KC190721 / KC190923 / KC191031 / KC191139 136 Stenodactylus doriae - 16 M212 Yemen Ma'rib KC190722 / KC190924 16 Stenodactylus grandiceps - 1** M13 Jordan Wadi Bayir KC190668 / KC190862 / KC190952 / KC191062 16 Stenodactylus grandiceps - 2 M14 Jordan Wadi Bayir KC190667 / KC190861 / KC190951 / KC191061 17 Stenodactylus grandiceps - 3 M191 BEV.10911 Jordan 6 km E of Shawbak KC190673 / KC190867 / KC190953 / KC191063 77 Stenodactylus grandiceps - 4 M158 NHMC80.3.107.6 Jordan 4km N of Al Manshiyya KC190669 / KC190863 77 Stenodactylus grandiceps - 5 M159 NHMC80.3.107.2 Jordan 4km N of Al Manshiyya KC190670 / KC190864 17 Stenodactylus grandiceps - 6 M189 BEV.10909 Jordan 6 km E of Shawbak KC190671 / KC190865 17 Stenodactylus grandiceps - 7 M190 BEV.10910 Jordan 6 km E of Shawbak KC190672 / KC190866 78 Stenodactylus grandiceps - 8 M160 NHMC80.3.107.1 Jordan 30 km W of Azraq - / KC190912 19 Stenodactylus grandiceps - 9 M203 Jordan Azraq KC190714 / KC190915 / KC191027 / KC191135 19 Stenodactylus grandiceps - 10 M204 Jordan Azraq KC190715 / KC190916 / KC191028 / KC191136 19 Stenodactylus grandiceps - 11 M205 Jordan Azraq KC190716 / KC190917 20 Stenodactylus leptocosymbotes - 1 M18 Oman Thumrait KC190662 / KC190856 / KC190943 / KC191052 21 Stenodactylus leptocosymbotes - 2 M23 Oman 4km SW Al Maaymir KC190655 / KC190849 / KC191012 / KC191051 22 Stenodactylus leptocosymbotes - 3 M25 Oman 2.5 km SE Ar Rumayliyah KC190657 / KC190851 / KC190942 / KC191048 23 Stenodactylus leptocosymbotes - 4** M26 Oman Wadi Maahdi, Masirah island KC190666 / KC190860 / KC190944 / KC191049 24 Stenodactylus leptocosymbotes - 5 E1505313 UAE Al Ain KC190664 / KC190858 / KC191013 / KC191105 20 Stenodactylus leptocosymbotes - 6 e903611 Oman Thumrait KC190660 / KC190854 20 Stenodactylus leptocosymbotes - 7 e903612 Oman Thumrait KC190661 / KC190855 79 Stenodactylus leptocosymbotes - 8 M24 Oman KC190658 / KC190852 21 Stenodactylus leptocosymbotes - 9 e90361 Oman KC190656 / KC190850 21 Stenodactylus leptocosymbotes - 10 e90363 Oman KC190659 / KC190853 24 Stenodactylus leptocosymbotes - 11 e90366 UAE Al Ain KC190663 / KC190857 24 Stenodactylus leptocosymbotes - 12 e90368 UAE Al Ain KC190665 / KC190859 25 Stenodactylus mauritanicus - 1 E1505339 Egypt El Omayed protected area KC190577 / - / KC191018 / KC191083 26 Stenodactylus mauritanicus - 2 E1505353 Tunisia Oued shili, 31 km NE of Tozeur KC190566 / KC190770 / KC191016 / KC191077 27 Stenodactylus mauritanicus - 3 M111 Tunisia Crossroad to Jbel Chambi KC190567 / KC190771 / KC190976 / KC191108 28 Stenodactylus mauritanicus - 4 M112 Tunisia Jbel Tamesmida KC190568 / KC190772 / KC190977 / KC191078 29 Stenodactylus mauritanicus - 5** M157 NHMC80.3.152.1 Libya 30 km S of Misirata KC190579 / KC190782 / KC190981 / KC191074 30 Stenodactylus mauritanicus - 6** M80 Morocco 44 km S-SW of Sidi Ifni KC190590 / KC190791 / KC190978 / KC191072 31 Stenodactylus mauritanicus - 7 M88 W. Sahara, Morocco 84 km N of Boudjour KC190595 / KC190796 / KC191017 / KC191085 31 Stenodactylus mauritanicus - 8 M110 W. Sahara, Morocco 5 km NE of Lemsid, KC190596 / KC190797 / KC191008 / KC191086 32 Stenodactylus mauritanicus - 9 M115 W. Sahara, Morocco 100 km S of Boujdour KC190597 / KC190798 / KC191009 / KC191079 33 Stenodactylus mauritanicus - 10 M176 BEV.10835 W. Sahara, Morocco Oued Lcraa, 170 km S-SW of Boujdour KC190599 / KC190800 / KC190980 / KC191080 34 Stenodactylus mauritanicus - 11 M177 BEV.10836 Morocco 12 km S-SW Tan Tan KC190587 / KC190789 / KC190979 / KC191073 80 Stenodactylus mauritanicus - 12 M55 BEV.9157 Mauritania Cap Blanc KC190600 / KC190801 32 Stenodactylus mauritanicus - 13 M116 W. Sahara, Morocco 100 km S of Boujdour KC190598 / KC190799 43 Stenodactylus mauritanicus - 14 M74 W. Sahara, Morocco 25 km W of Smara KC190583 / KC190786 43 Stenodactylus mauritanicus - 15 M75 W. Sahara, Morocco 25 km W of Smara KC190584 / KC190787 81 Stenodactylus mauritanicus - 16 M49 BEV.2387 Morocco Between Khnifiss and Tantan KC190588 / - 81 Stenodactylus mauritanicus - 17 M50 BEV.2388 Morocco Between Khnifiss and Tantan KC190586 / - 82 Stenodactylus mauritanicus - 18 M54 BEV.7889 Morocco 4 km Nwof Tantan KC190585 / KC190788 83 Stenodactylus mauritanicus - 19 M82 Morocco S of Sidi Ifni KC190592 / KC190793 84 Stenodactylus mauritanicus - 20 M83 Morocco S of Sidi Ifni KC190593 / KC190794 85 Stenodactylus mauritanicus - 21 M81 Morocco S of Sidi Ifni KC190591 / KC190792 86 Stenodactylus mauritanicus - 22 M84 Morocco S of Sidi Ifni KC190594 / KC190795 87 Stenodactylus mauritanicus - 23 M79 Morocco S of Sidi Ifni KC190589 / KC190790 88 Stenodactylus mauritanicus - 24 M142 NHMC80.3.88.40 Morocco 146 km E of Ouarzazate KC190602 / KC190803 89 Stenodactylus mauritanicus - 25 M137 NHMC80.3.88.45 Libya 55 km S of Misratah KC190578 / KC190781 90 Stenodactylus mauritanicus - 26 M153 NHMC80.3.88.1 Libya Libya - Egypt borders - / KC190911 91 Stenodactylus mauritanicus - 27 M135 NHMC80.3.88.47 Libya Qaminis, 120 km NE of Adjedabia KC190571 / KC190775 91 Stenodactylus mauritanicus - 28 M154 NHMC80.3.153.2 Libya Qaminis, 120 km NE of Adjedabia KC190572 / KC190776 91 Stenodactylus mauritanicus - 29 M155 NHMC80.3.153.1 Libya Qaminis, 120 km NE of Adjedabia KC190575 / KC190779 92 Stenodactylus mauritanicus - 30 M141 NHMC80.3.88.41 Morocco 30 km NE of Goulmina KC190601 / KC190802 / KC190988 / KC191075 93 Stenodactylus mauritanicus - 31 M140 NHMC80.3.88.42 Libya Kikla KC190580 / KC190783 94 Stenodactylus mauritanicus - 32 M156 NHMC80.3.152.2 Libya Ain Tagnit KC190581 / KC190784 95 Stenodactylus mauritanicus - 33 M151 NHMC80.3.88.29 Libya 75 km W of Tobruk - / KC190910 96 Stenodactylus mauritanicus - 34 M134 NHMC80.3.88.9 Libya Igdeida semidesert KC190574 / KC190778 96 Stenodactylus mauritanicus - 35 M152 NHMC80.3.88.28 Libya Igdeida semidesert KC190573 / KC190777 97 Stenodactylus mauritanicus - 36 M138 NHMC80.3.88.44 Libya Al Mabne KC190576 / KC190780 98 Stenodactylus mauritanicus - 37 E1505349 Morocco 17 Km Nortwest of Missour KC190558 / - 99 Stenodactylus mauritanicus - 38 M56 BEV.9985 Morocco Al Baten plain KC190564 / - 99 Stenodactylus mauritanicus - 39 M57 BEV.9986 Morocco Al Baten plain KC190561 / - 99 Stenodactylus mauritanicus - 40 M58 BEV.9990 Morocco Al Baten plain KC190560 / - 100 Stenodactylus mauritanicus - 41 M98 MCCR1160-1 Morocco Between Debdou and Ain Benimathar KC190562 / KC190769 101 Stenodactylus mauritanicus - 42 M103 Morocco N of Msoun, Taza KC190565 / - 101 Stenodactylus mauritanicus - 43 M76 Morocco N of Msoun, Taza KC190559 / KC190768 102 Stenodactylus mauritanicus - 44 E1505350 Morocco 19 Km W of El Aioum KC190563 / - 103 Stenodactylus mauritanicus - 45 M148 NHMC80.3.88.34 Tunisia 2 km N of Ouled Monaceur - / KC190909 28 Stenodactylus mauritanicus - 46 M113 Tunisia Jbel Tamesmida, base of KC190596 / KC190773 28 Stenodactylus mauritanicus - 47 M114 Tunisia Jbel Tamesmida, base of KC190570 / KC190774 104 Stenodactylus mauritanicus - 48 M124 Libya KC190582 / KC190785 35 Stenodactylus petrii - 1** M4 BEV.8987 Egypt Wadi El Natrun KC190603 / KC190804 / KC190954 / KC191093 36 Stenodactylus petrii - 2 E1505316 Egypt E of Al Arish, Sinai KC190610 / KC190811 / KC190955 / KC191094 37 Stenodactylus petrii - 3 M165 HUJR-23776 Israel NW Negev sands, Ovitz field Haluzza KC190611 / KC190812 / KC190956 / KC191107 38 Stenodactylus petrii - 4 M6 BEV.9131 Mauritania El Beyed KC190612 / KC190813 / KC190957 / KC191102 39 Stenodactylus petrii - 5 M78 Morocco Erg Chebbi KC190617 / KC190818 / KC190960 / KC191095 40 Stenodactylus petrii - 6 M105 BEV.10157 Algeria Tassili N'Ajer KC190613 / KC190814 / KC190958 / KC191106 41 Stenodactylus petrii - 7 M107 BEV.10181 Algeria Tisras KC190619 / KC190819 / KC190959 / - 42 Stenodactylus petrii - 8 M119 Mauritania Tarf Tazazmout KC190615 / KC190816 / KC191007 / KC191133 43 Stenodactylus petrii - 9** M2 W. Sahara, Morocco 25 km W of Smara KC190626 / KC190826 / KC190964 / KC191103 44 Stenodactylus petrii - 10 E1505326 Mauritania Oued Choum, Adrar KC190631 / KC190829 / KC191019 / KC191096 45 Stenodactylus petrii - 11 M178 BEV.T3692 W. Sahara, Morocco 90 km NW of Aousserd KC190621 / KC190821 / KC190965 / KC191097 46 Stenodactylus petrii - 12 M180 BEV.10842 W. Sahara, Morocco 22 km NW of Aousserd KC190623 / KC190823 / KC190966 / KC191098 46 Stenodactylus petrii - 13 M182 BEV.10844 W. Sahara, Morocco 22 km NW of Aousserd KC190625 / KC190825 / KC190967 / KC191099 105 Stenodactylus petrii - 14 E1505321 Mauritania 35 Km S of Bennichchab KC190632 / - 105 Stenodactylus petrii - 15 E1505322 Mauritania 35 Km S of Bennichchab KC190633 / - 105 Stenodactylus petrii - 16 E1505323 Mauritania 35 Km S of Bennichchab KC190629 / - 106 Stenodactylus petrii - 17 E1505324 Mauritania Ben Amira (Adrar) KC190620 / KC190820 107 Stenodactylus petrii - 18 E1505329 Mauritania 20 Km W of Tmeimichat KC190628 / KC190828 44 Stenodactylus petrii - 19 E1505325 Mauritania Oued Choum (Adrar) KC190630 / - 44 Stenodactylus petrii - 20 E1505327 Mauritania Oued Choum (Adrar) KC190627 / KC190827 46 Stenodactylus petrii - 21 M179 BEV.10841 W. Sahara, Morocco 22 km NW of Aousserd KC190622 / KC190822 46 Stenodactylus petrii - 22 M181 BEV.10843 W. Sahara, Morocco 22 km NW of Aousserd KC190624 / KC190824 108 Stenodactylus petrii - 23 E1505319 Mauritania 30 Km N of Zouerat KC190634 / - 109 Stenodactylus petrii - 24 M106 BEV.10180 Algeria KC190614 / KC190815 110 Stenodactylus petrii - 25 E1505328 W. Sahara, Morocco Tiffarity KC190916 / KC190817 111 Stenodactylus petrii - 26 M93 MCC1481 Egypt N Sinai, Zaranik National Park KC190608 / KC190809 35 Stenodactylus petrii - 27 M3 BEV.8986 Egypt Wadi El Natrun KC190607 / KC190808 35 Stenodactylus petrii - 28 M5 BEV.8988 Egypt Wadi El Natrun KC190604 / KC190805 25 Stenodactylus petrii - 29 E1505317 Egypt El Omayed protected area KC190606 / KC190807 112 Stenodactylus petrii - 30 M94 MCC1480-1 Egypt N Sinai, near Bir el Abd KC190609 / KC190810 113 Stenodactylus petrii - 31 E1505318 Egypt N Sinai, Zaranik National Park KC190605 / KC190806 114 Stenodactylus petrii - 32 M102 Morocco 15 Km S of Erfoud KC190618 / - 53 Stenodactylus petrii - 33 M92 MCC1329 Tunisia 6 km W of Nefta KC190636 / KC190830 / KC190961 / KC191104 54 Stenodactylus petrii - 34 E1505331 Tunisia 6 km W of Nefta KC190639 / KC190833 / KC190962 / KC191100 54 Stenodactylus petrii - 35 E1505332 Tunisia 6 km W of Nefta KC190637 / KC190831 / KC190963 / KC191101 117 Stenodactylus petrii - 36 M97 MCC1335 Tunisia 34 km S of Hazoua KC190638 / KC190832 54 Stenodactylus petrii - 37 M1 Tunisia 6 Km west of Nefta KC190635 / - 47 Stenodactylus pulcher - 1** M122 Yemen Mukkalla KC190700 / KC190894 / KC191002 / KC191119 48 Stenodactylus pulcher - 2 M130 Yemen Al Rayan KC190701 / KC190895 / KC191003 / KC191120 49 Stenodactylus slevini - 1** M19 Jordan Abar al Hazim KC190680 / KC190874 / KC190950 / KC191057 13 Stenodactylus slevini - 2 M184 BEV.10884 Jordan Between Aqaba and Wadi Rum KC190682 / KC190876 / KC190948 / KC191132 13 Stenodactylus slevini - 3 M187 Jordan Between Aqaba and Wadi Rum KC190683 / KC190877 / KC190949 / KC191058 50 Stenodactylus slevini - 4 M20 BEV.10065 Kuwait Sabah Al-Ahmed Natural Reserve KC190685 / KC190879 / KC191014 / KC191059 51 Stenodactylus slevini - 5 M127 Qatar 26 km SE of As Salwa KC190689 / KC190883 / - / - 52 Stenodactylus slevini - 6 E1505334 UAE Tabal Dani KC190687 / KC190881 / KC190993 / KC191060 115 Stenodactylus slevini - 7 E1505335 UAE Tabal Dannah (UAE) KC190688 / KC190882 13 Stenodactylus slevini - 8 M183 BEV.10883 Jordan Between Aqaba and Wadi Rum KC190681 / KC190875 13 Stenodactylus slevini - 9 M188 BEV.T3762 Jordan Between Aqaba and Wadi Rum KC190684 / KC190878 116 Stenodactylus slevini - 10 M38 BEV.T1501 Kuwait Ratqa, Kuwait-Irak borders KC190686 / KC190880 137 Stenodactylus stenurus** M199 CUP\REPT\LIB\143 Tunisia Chaffar KC190713 / KC190914 / KC191026 / KC191134 25 Stenodactylus sthenodactylus - 1** M22 Egypt El Omayed protected area KC190552 / KC190762 / KC190990 / KC191070 55 Stenodactylus sthenodactylus - 2 M64 BEV.7219 Egypt 10 km N of Hurghada, El Gouna KC190524 / KC190737 / KC191015 / - 56 Stenodactylus sthenodactylus - 3 M70 BEV.8990 Egypt Wadi Gharandal, Sinai KC190526 / KC190739 / KC190968 / KC191066 57 Stenodactylus sthenodactylus - 4 M73 BEV.9027 Egypt 26 km S-SW of Beer Abraq KC190543 / KC190754 / KC190971 / KC191067 58 Stenodactylus sthenodactylus - 5 M123 Egypt Farafra Oasis KC190550 / KC190760 / KC191010 / KC191068 59 Stenodactylus sthenodactylus - 6 M172 BEV.10370 Egypt Abu Simbel KC190548 / KC190758 / KC190972 / KC191069 37 Stenodactylus sthenodactylus - 7 M161 HUJR-23793 Israel NW Negev sands, Ovitz field Haluzza KC190522 / KC190735 / KC190989 / KC191076 60 Stenodactylus sthenodactylus - 8 M171 BEV.10199 Israel 5 km S-SW of Boker, Negev KC190529 / KC190742 / KC190982 / KC191084 61 Stenodactylus sthenodactylus - 9 M192 BEV.T3951 Jordan 8 km of Ad-Dura,Saudi Arabia borders KC190555 / KC190765 / KC190983 / KC191071 63 Stenodactylus sthenodactylus - 11 M136 NHMC80.3.88.46 Libya 20 km W of Derj oasis KC190541 / KC190752 / KC190973 / KC191081 64 Stenodactylus sthenodactylus - 12 M193 BEV.T4135 Algeria Oued Dider, Aguelmane Assar KC190537 / KC190749 / KC190969 / KC191082 65 Stenodactylus sthenodactylus - 13 M117 Mauritania 18 km NW of Baie d'Arguin KC190540 / KC190751 / KC190975 / KC191090 66 Stenodactylus sthenodactylus - 14 M118 Mauritania 5 km S of Tîgjafât KC190534 / KC190747 / KC190974 / KC191109 67 Stenodactylus sthenodactylus - 15 M173 BEV.10832 W. Sahara, Morocco 118 km NW of Aousserd KC190554 / KC190764 / KC190987 / KC191091 68 Stenodactylus sthenodactylus - 16 M174 BEV.10833 W. Sahara, Morocco 42 km NW of Aousserd KC190533 / KC190746 / KC190986 / KC191089 69 Stenodactylus sthenodactylus - 17** M175 BEV.10834 W. Sahara, Morocco 59 km NW of Aousserd KC190531 / KC190744 / KC190985 / KC191088 70 Stenodactylus sthenodactylus - 18 M87 Mauritania 170 km E of Bou Lenoir KC190532 / KC190745 / KC190984 / KC191087 118 Stenodactylus sthenodactylus - 19 M60 BEV.2410 Mauritania 26 km S of Chott Boul KC190538 / - 119 Stenodactylus sthenodactylus - 20 M53 BEV.2411 Mauritania 70 km E-NE Akjoujt KC190530 / KC190743 70 Stenodactylus sthenodactylus - 21 M109 Mauritania Inêl, 5km S of Dakhlet-Nouâdhibou - / KC190906 120 Stenodactylus sthenodactylus - 22 M86 Mauritania KC190539 / KC190750 120 Stenodactylus sthenodactylus - 23 M108 Mauritania Boû Lanouâr, 17km E of Dakhlet-Nouâdhibou - / KC190907 121 Stenodactylus sthenodactylus - 24 E1505336 Egypt N of Gebel Elba KC190542 / KC190753 122 Stenodactylus sthenodactylus - 25 M72 BEV.9004 Egypt 7 km NE of Abu Simbel KC190549 / KC190759 123 Stenodactylus sthenodactylus - 26 M66 BEV.7222 Egypt Abu Simbel KC190546 / KC190756 123 Stenodactylus sthenodactylus - 27 M68 BEV.7242 Egypt Abu Simbel KC190547 / KC190757 124 Stenodactylus sthenodactylus - 28 E1505345 Egypt Red Sea Coast, Egypt KC190544 / - 125 Stenodactylus sthenodactylus - 29 E1505347 Egypt Wadi ‘Adb al Malik KC190545 / KC190755 55 Stenodactylus sthenodactylus - 30 M65 BEV.7220 Egypt 10 km N of Hurghada, El Gouna KC190525 / KC190738 126 Stenodactylus sthenodactylus - 31 M62 BEV.7215 Egypt Feiran Oasis, Sinai KC190528 / KC190741 56 Stenodactylus sthenodactylus - 32 M71 BEV.8991 Egypt Wadi Gharandal, Sinai KC190527 / KC190740 127 Stenodactylus sthenodactylus - 33 E1505346 Egypt Siwa Oasis KC190536/ - 128 Stenodactylus sthenodactylus - 34 M146 NHMC80.3.88.37 Egypt Wadi Sudr, 10 km SE of Qa'lat el Jundi - / KC190908 129 Stenodactylus sthenodactylus - 35 M63 BEV.7216 Egypt 10 km N of Aïn Sukhna KC190519 / KC190732 130 Stenodactylus sthenodactylus - 36 M61 BEV.7214 Egypt 25 km W of Suez KC190517 / KC190730 130 Stenodactylus sthenodactylus - 37 M67 BEV.7241 Egypt 25 km W of Suez KC190518 / KC190731 111 Stenodactylus sthenodactylus - 38 M90 MCC1479 Egypt N Sinai, Zaranik National Park KC190521 / KC190734 131 Stenodactylus sthenodactylus - 39 M89 MCC1449 Libya Ghadames KC190535 / KC190748 132 Stenodactylus sthenodactylus - 40 E1505337 Egypt 30 km NE of Cairo KC190516 / KC190729 133 Stenodactylus sthenodactylus - 41 M69 BEV.8989 Egypt Wadi El Natrun KC190520 / KC190733 134 Stenodactylus sthenodactylus - 42 M125 Egypt KC190523 / KC190736 25 Stenodactylus sthenodactylus - 43 E1505340 Egypt El Omayed protected area KC190553 / KC190763 25 Stenodactylus sthenodactylus - 44 E1505342 Egypt El Omayed protected area KC190551 / KC190761 62 Stenodactylus sth. zavattarii - 1 M101 MCCR1372 Kenya Between Gatab and South Horr, Samburu distr. KC190557 / KC190767 / KC190970 / KC191092 135 Stenodactylus sth. zavattarii - 2 M95 MCC1297-1 Kenya North Horr KC190556 / KC190766 71 Stenodactylus yemenensis - 1** M126 Yemen Mokka KC190640 / KC190834 / KC190991 / KC191064 72 Stenodactylus yemenensis - 2 M128 Yemen N. Yukhtal KC190641 / KC190835 / KC190992 / KC191065 138 Stenodactylus yemenensis - 3 M206 Yemen N of Aden KC190717 / KC190918 / KC191029 / KC191137 138 Stenodactylus yemenensis - 4 M207 Yemen N of Aden KC190718 / KC190919 138 Stenodactylus yemenensis - 5 M208 Yemen N of Aden KC190719 / KC190920 138 Stenodactylus yemenensis - 6 M209 Yemen N of Aden - / KC190921 139 Stenodactylus yemenensis - 7 M213 Yemen N of Lahj, Wadi Tuban KC190723 / KC190925 / KC191032 / KC191140 139 Stenodactylus yemenensis - 8 M214 Yemen N of Lahj, Wadi Tuban KC190724 / KC190926 Outgroups Agamura persica** E18011017 Iran DQ852726 / - / KC191025 / - Aristelliger georgeensis* E280511 Belize KC190934 / KC190927 / KC191043 / KC191141 Bunopus tuberculatus** Buntub Kuwait EU589160 / - / AF148706 / - Crossobamon orientalis** Croori India HM921159 / HM040944 / DQ852730 / - Euleptes europaea* E260671 Italy KC190935 / - / KC191042 / KC191142 Gekko gecko* Gekgec China/Indonesia NC007627 / NC007627 / EF534939 / EF534981 Gekko vittatus* Gekvit NC008772 / NC008772 / - / - Hemidactylus frenatus** Hemfre Indonesia GQ245970 / GQ245970 / - / EF534982 Pseudoceramodactylus khobarensis - 1** M16 BEV.10039 Kuwait Wafrah Farms, 20 km E of Wafrah KC190703 / KC190897 / KC191005 / KC191123 Pseudoceramodactylus khobarensis - 2 M37 BEV.10040 Kuwait Wafrah Farms, 20 km E of Wafrah KC190702 / KC190896 / KC191004 / KC191122 Pseudoceramodactylus khobarensis - 3 M196 Oman Barr Al-Hickman KC190704 / KC190898 / KC191006 / KC191124 Saurodactylus brosseti* Saubro Morocco EU014300 / EF564006 / EF534928 / EF534970 Tarentola mauritanica* Tarmau Spain/Egypt NC012366 / NC012366 / EU293686 / EU293731 Tarentola delalandii* MtardeT Canary Islands Tenerife AF186131 / KC190928 / KC191033 / KC191143 Tarentola delalandii* MtardeP Canary Islands La Palma AF186130 / KC190929 / KC191034 / KC191144 Tarentola boettgeri boettgeri* E1011311 Canary Islands Gran Canaria AF186125 / KC190930 / KC191035 / KC191145 Tarentola boettgeri bischoffi* E101138 Madeira Selvagens AF186128 / - / - / - Tarentola boettgeri hierrensis* E1011310 Canary Islands El Hierro KC190725 / - / KC191036 / KC191146 Tarentola boettgeri boettgeri* E1011313 Canary Islands Gran Canaria AF186123 / - / KC191037 / KC191147 Tarentola boettgeri boettgeri* E1011314 Canary Islands Gran Canaria AF186124 / - / KC191038 / KC191148 Teratoscincus scincus* Mter1 JFBM14252 Turkmenistan KC190726 / KC190931 / KC191039 / KC191149 Teratoscincus roborowskii* Mter2 China KC190727 / KC190932 / KC191040 / KC191150 Teratoscincus microlepis* Mter3 Pakistan KC190728 / KC190933 / KC191041 / KC191151 Tropiocolotes algericus - 1** MT5 BEV.10862 W. Sahara, Morocco 175 km NW of Aousserd KC190709 / KC190902 / - / - Tropiocolotes algericus - 2** MT6 BEV.10860 W. Sahara, Morocco 110 km NW of Boudjour KC190710 / KC190903 / KC191023 / KC191129 Tropiocolotes tripolitanus - 1** MT7 BEV.10863 W. Sahara, Morocco Aousserd KC190711 / KC190904 / KC191024 / KC191130 Tropiocolotes tripolitanus - 2** MT8 BEV.9025 Egypt Wadi El Natrun KC190712 / KC190905 / - / KC190031 Tropiocolotes nubicus** MT9 BEV.9020 Egypt Abu Simbel KC190706 / KC190900 / KC191020 / KC191125 Tropiocolotes steudneri** MT10 BEV.10367 Egypt 175 km S of Safaga KC190705 / KC190899 / KC191021 / KC191126 Tropiocolotes nattereri** MT11 BEV.10886 Jordan Wadi Rum KC190708 / KC190901 / - / KC190028 Tropiocolotes scorteccii** MT12 Oman Coast, 250 km E of Salalah KC190707 / - / KC191022 / KC191127 Specimens are listed in alphabetical order, with the corresponding GenBank accession numbers. Specimens indicated with an asterisk (*) were included in the divergence time analysis, specimens indicated with a double asterisk (**) were included both in the phylogenetic and divergence time analyses, and specimens with no asterisk were included in the phylogenetic analysefs only. Locality codes refer to Figure 1. Voucher codes of specimens available in collections refer to the following collections: BEV.[X]: Laboratoire de Biogéographie et Écologie des Vertébrés de l'École Pratique des Hautes Etudes, Montpellier, France; NHMC.[X]: Natural History Museum of Crete, Greece; MCC[X]: Museo Civico di Storia Naturale di Carmagnola, Italy; HUJR-[X]: National Natural History Collections of the Hebrew University of Jerusalem, Israel; CUP[X]: Charles University, Prague; JFBM[X]: James Ford Bell Museum, Amphibian and Reptile Collection, University of Minnesota. Codes BEV.T[X] refer to the tissue collection of Laboratoire de Biogéographie et Écologie des Vertébrés de l'École Pratique des Hautes Etudes, Montpellier, France. Genomic DNA was extracted from ethanol-preserved tissue samples using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). All 222 specimens included in the phylogenetic analyses were sequenced for two mitochondrial gene fragments: 378–388 base pairs (bp) of 12S rRNA (12S) and 498–536 bp of the 16S rRNA (16S). A subset of 106 specimens, including representatives from all independent lineages recovered by the analysis of these two fragments, was also sequenced for two nuclear markers: 660 bp of the oocyte maturation factor MOS (c-mos ), and 410 bp of the recombination activating gene 2 ( RAG -2). Primers used for the amplification and sequencing of the 12S, 16S, c-mos and RAG -2 gene fragments as well as PCR conditions applied in the present work are listed in detail in Table 2. All amplified fragments were sequenced for both strands. Contigs were assembled in Geneious v.5.3 [50]. Table 2 Primers used in this study Gene fragment Primer name Or. 1 Sequence (5 ′- 3′) Reference PCR conditions 12S 12Sa F AAACTGGGATTAGATACCCCACTAT Kocher et al. (1989) 94º(5');94º(45"), 51º(45"), 72º(80") x 35;72(5') 12Sb R GAGGGTGACGGGCGGTGTGT Kocher et al. (1989) L1.STENO F GGATTAGATACCCCACTATGC This study 94º(5');94º(45"), 52º(45")’, 72º(90") x 35;72º(5') H1.STENO1 R TGACGGGCGGTGTGTACG This study 16S 16Sa F CGCCTGTTTATCAAAAACAT Palumbi (1996) 94º(5');94º(45"), 51(45"), 72(80") x 35;72º(5') 16Sb R CCGGTCTGAACTCAGATCACGT Palumbi (1996) 16SaST F ATCAAAAACATCGCCTTTAGC This study 94º(5');94º(45"), 57º(45"), 72º (70") x 35;72º(5') 16SbST R CTGAACTCAGATCACGTAGGAC This study C-mos FUF F TTTGGTTCKGTCTACAAGGCTAC Gamble et al. (2008) 94º (5');94º (30"), 55º (45"), 72º (70") x 35;72º (10') FUR R AGGGAACATCCAAAGTCTCCAAT Gamble et al. (2008) G73_STENO F GCTGTAAAGCAGGTGAAGAAATGC This study 94º(5');94º(45"), 56º(45"), 72º(80") x 35;72º(5') G74_STENO R GAACATCCAAAGTCTCCAATCTTGC This study G73.5_STENO F GCATTTGGACTTAAAACCTG This study G708 GCTACATCAGCTCTCCARCA Hugall et al. (2008) RAG -2 RAG2-PY1-F F CCCTGAGTTTGGATGCTGTACTT Gamble et al. (2008) 94º (5');94º (45"), 55º (45"), 72º (70") x 35;72º (5') RAG2-PY1-R R AACTGCCTRTTGTCCCCTGGTAT Gamble et al. (2008) List of primers used in the amplification and sequencing of gene fragments, with the corresponding source and PCR conditions. 1Orientation. Phylogenetic analyses and hypothesis testing

DNA sequences were aligned using the online version of MAFFT v.6 [51] with default parameters (gap opening = 1.53, offset value = 0.0) for the mitochondrial genes and with modified parameters (offset value = 0.1) for the nuclear genes, in which long gaps are not expected. Coding gene fragments (c-mos and RAG -2) were translated into amino acids and no stop codons were observed. Uncorrected p-distances were calculated in MEGA v.5 [52].

Phylogenetic analyses of the combined dataset were done employing maximum likelihood (ML) and Bayesian (BI) methods. Separate ML analyses were also performed on 12S, 16S, c- mos and RAG -2 to test for conflicting signal among genes. Best-fitting nucleotide substitution models were selected for each partition under the Akaike information criterion [53] using jModelTest v.0.1.1 [54]. The GTR + I + G model was independently estimated for each of the 12S, 16S, RAG-2 partitions and the GTR + G model for the c-mos partition. Alignment gaps were treated as missing data and the nuclear gene sequences were not phased. Hemidactylus frenatus was used for rooting the tree, based on published evidence [47,48].

A Bayesian analysis of the combined dataset was performed in MrBayes 3.1.2 [55,56] with best fitting models applied to each partition (gene) and all parameters unlinked across partitions. Analyses ran for 10 7 generations, with sampling intervals of 1000 generations, producing 10000 trees. Convergence and appropriate sampling were confirmed examining the standard deviation of the split frequencies between the two simultaneous runs and the Potential Scale Reduction Factor (PSRF) diagnostic. Burn-in was performed discarding the first 2500 trees of each run and a majority-rule consensus tree was generated from the remaining trees. ML analyses were performed in RAxML v.7.0.3 [57]. A GTR + I + G model was used and parameters were estimated independently for each partition. Node support was assessed by bootstrap analysis [58] including 1000 replications.

Haplotype networks were constructed for the two nuclear markers c-mos and RAG -2. The software PHASE v.2.1.1 [59,60] was used to resolve the haplotypes where more than one heterozygote position was present. Input files were prepared using Seqphase [61]. In order to include as much information as possible for the better resolution of the haplotypes, the alignment of all full-length sequences of each marker was used. Phase probabilities parameter was set at 0.7 and all other settings were set by default. The network of the resulting haplotypes was calculated with TCS v.1.21 [62] applying default settings (probability of parsimony cutoff: 95 %).

Topological constraints to test alternative topologies were constructed by hand and compared to the unconstrained (best) tree using the Approximately-Unbiased (AU) [63] and Shimodaira-Hasegawa (SH) [64] tests. Per-site log likelihoods were estimated in RAxML 7.0.3 [57] and P-values were calculated using CONSEL [65]. Tests were also run in a Bayesian framework, where the relative support of competing hypotheses given the data was quantified using the Bayes factor (BF) [66]. Topologies were constrained in analyses run in BEAST v.1.6.1 [67], the marginal likelihood for each topology was estimated using the harmonic mean estimator and the Bayes factors were calculated by taking the ratios, as estimated in Tracer v.1.5 [68]. Estimation of divergence times

A Bayesian approach was used to estimate divergence times as implemented in the software BEAST v.1.6.1. The dataset comprised sequences from all four partitions (the nuclear genes c-mos and RAG-2 unphased). An arbitrarily pruned phylogeny was used in order to include only one representative from each species or main lineage uncovered with the concatenated analysis (45 specimens in total; see Table 1). This method excludes closely related terminal taxa because the Yule tree prior (see below) does not include a model of coalescence, which can complicate rate estimation for closely related sequences [69]. Additionally, several taxa belonging to other gecko genera were added for the calibration process (see below).

Two individual runs were performed for 4x10 7 generations with a sampling frequency of 4000 and the results were combined to infer the ultrametric tree after discarding 10 % of the samples from each run. Models and prior specifications applied were as follows (otherwise by default): GTR + I + G (12S, 16S), GTR + I (c-mos ), HKY + I ( RAG-2); Relaxed Uncorrelated Lognormal Clock (estimate); Yule process of speciation; random starting tree; alpha Uniform (0, 10); yule.birthRate (0, 1000). Parameter values both for clock and substitution models were unlinked across partitions.

Unfortunately, no fossils belonging to Stenodactylus , Pseudoceramodactylus or Tropiocolotes are known, precluding the direct estimation of the time of the cladogenetic events within our study group. Consequently, the estimation was based on well-known calibration points published in recent literature [70,71] related to members of the families Phyllodactylidae and Sphaerodactylidae (see Table 1). Three fossil and biogeographical calibration points were applied as “soft” priors, in order to account for uncertainty in the date of the corresponding nodes: (1) the minimum age for the divergence between Euleptes and its sister clade was set to 22.5 Ma ago using the approximate age of a fossil Euleptes [72,73] (Lognormal distribution: median 22.5, 97.5 % 36.55); (2) the split between Teratoscincus scincus - Teratoscincus roborowskii caused by the Tien Shan-Pamir uplift 10 Ma ago [74-76] (Lognormal distribution: median 10.08, 97.5 % 12.96); (3) the age of El Hierro island [77] at 1.12 Ma ago, assuming that divergence between Tarentola boettgeri hierrensis and Tarentola boettgeri bischoffi began soon after its appearance [26,44] (Uniform distribution: lower 1, upper 1.12). In order to cross-check the results, the posterior mean rates of the mitochondrial gene fragments of our analysis were compared to the rates calculated for well-known and well-studied reptile groups from the Canary Islands (the geckos of the genus Tarentola , the lacertid lizards of the endemic genus Gallotia and the skinks of the genus Chalcides ), for which robust calibrated phylogenies have been produced in several independent analyses ([26,45,78-80], among others), and evolutionary rates for the 12S gene have been obtained using BEAST [44].

Ancestral area reconstruction

MacClade v. 4.08 [81] was used to reconstruct the ancestral areas for the Stenodactylus species in a parsimony framework, using both delayed transformation (DELTRAN) and accelerated transformation (ACCTRAN). Additionally, in order to incorporate branch-length information, ML was used as implemented in the Mesquite software package [82]. Both Markov k-state 1-parameter and Asymmetrical Markov k-state 2-parameter models were applied and a likelihood ratio test was used to choose the best reconstruction. Two states, Arabia and Africa, were identified in the extant species depending on the present distribution of the species [33] and were used with both methodologies. Results

Phylogenetic analyses and topological tests

Two datasets were used to infer the phylogenetic relationships of the genus Stenodactylus : a mitochondrial one for building the preliminary phylogeny and analyzing the divergence patters, and a multi-locus one for producing a more robust phylogeny (TreeBASE ID: 13567). The first dataset consisted of an alignment of 974 bp of mitochondrial DNA (415 bp of 12S and 559 bp of 16S, of which 270 in both cases were variable positions) for 222 terminals including 207 Stenodactylus . The results of the ML and BI of this dataset were very similar and are summarized in Supplementary Figure 1 (Additional file 1: Figure S1). In order to improve our phylogenetic hypothesis applying a multi-locus approach, a second dataset was assembled with a selection of 106 terminals, including 91 Stenodactylus (see Table 1) for which two extra nuclear genes were sequenced. The aligned dataset consisted of 2092 bp (419 bp of 12S, 560 bp of 16S, 703 bp of c-mos and 410 bp of RAG -2, of which 262, 269, 109 and 99 positions were variable, respectively). The result of the phylogenetic analyses of the concatenated alignment of four genes is shown in Figure 2. Well-supported relationships in the independent gene trees were congruent among partitions, but at this level not all markers offered sufficient resolution to differentiate particularly between S. sthenodactylus and S. mauritanicus (data not shown but see below). The networks constructed for the phased haplotypes of the nuclear markers are presented in Figure 3. Not all ambiguities were resolved.

Figure 2 BI tree of the genus Stenodactylus inferred using 12S, 16S mtDNA and c-mos , RAG -2 nuclear gene fragments. Black circles on the nodes indicate posterior probability values above 0.95 in the Bayesian Inference analysis. Numbers next to the nodes indicate bootstrap support of the Maximum Likelihood analysis (only values above 70 are shown). Ages of the nodes estimated with BEAST are indicated with an arrow, with the corresponding age range in brackets. The tree was rooted using Hemidactylus frenatus . Numbers in square brackets next to specimens code refer to localities in Figure 1. Information on the samples included is shown in Table 1. Species' pictures were not submitted to precise relative scaling.

Figure 3 Haplotype networks of the nuclear markers c-mos and RAG -2. Only full-length sequences were used and phase probabilities that were set as ≥ 0.7. Information on the samples included is shown in Table 1.

Both ML and Bayesian analyses of the concatenated alignment of four gene fragments (Figure 2) gave almost identical results to the mtDNA tree from the Additional file 1: Figure S1 There is low support over the relationships between the genera Stenodactylus, Pseudoceramodactylus and Tropiocolotes . According to the results, the North African T. algericus and T. tripolitanus branch first and P. khobarensis is sister to a poorly supported clade formed by two reciprocally monophyletic groups: one including T. scorteccii, T. steudneri , T. nubicus and the Middle Eastern T. nattereri and the other one including all 12 species of the genus Stenodactylus . In order to further investigate these relationships, three topological tests were carried out: (1) Stenodactylus + Pseudoceramodactylus were forced monophyletic; (2) Tropiocolotes was forced monophyletic; and (3) Stenodactylus + Pseudoceramodactylus were forced monophyletic and Tropiocolotes was forced monophyletic on the same constraint tree. The resulting constrained topologies were compared to our optimal topology from Figure 2 under both ML and Bayesian frameworks (see Table 3). The results of the topological tests indicate that our dataset cannot reject the alternative hypothesis of monophyly of Stenodactylus + Pseudoceramodactylus (AU:0.461, SH:0.839, BF:0.647), monophyly of Tropiocolotes (AU:0.161, SH:0.495, BF:-0.530) or both concurrently (AU:0.153, SH:0.492, BF:1.589).

Table 3 Statistical support for alternative hypotheses on Stenodactylus phylogeny ML framework 1 Bayesian framework 2

Tree -log likelihood AU P SH P HME log 10 BF Unconstrained tree 15180.095955 −15175.4907 Monophyly of Stenodactylus+Pseudoceramodactylus 15180.877129 0.461 0.839 −15175.0633 0.647 Monophyly of Tropiocolotes 15183.765511 0.161 0.495 −15175.6215 −0.530 Monophyly of Stenodactylus+Pseudoceramodactylus and Tropiocolotes 15183.696084 0.153 0.492 −15177.9132 1.589 Monophyly of African species 15192.711115 0.029 0.123 −15190.3457 7.221 Monophyly of S. petrii 15189.220967 0.036 0.210 −15181.4116 2.578 All topological tests are done versus the unconstrained (best) tree. Values in bold indicate statistically significant results. 1ML: Maximum likelihood; AU: Approximately Unbiased test (Shimodaira, 2002); SH: Shimodaira & Hasegawa (1999) test. P < 0.05 suggests that the two solutions are significantly different. 2 HME: The harmonic mean of sampled likelihoods as estimated by Tracer. BF: Bayes Factor. A log 10 Bayes factor > 2 indicates decisive evidence for statistically significant difference between solutions (Kass & Raftery, 1995).

Within Stenodactylus , three well supported clades are revealed (see Figure 2): (i) clade A, formed by the Arabian species S. pulcher Anderson, 1896 [36], S. arabicus and the divergent lineage S. cf. arabicus , (ii) clade B, that includes five Arabian species ( S. leptocosymbotes Leviton and Anderson, 1967 [83], S. doriae , S. slevini Haas, 1957 [37], S. grandiceps Haas, 1952 [84] and S. affinis (Murray, 1884) [85] grouped in 2 sub-clades, and (iii) clade C, formed by the four African species ( S. petrii, S. stenurus Werner, 1899 [86], S. mauritanicus Guichenot, 1850 [87] and S. sthenodactylus (Lichtenstein, 1823) and the southwest Arabian endemic S. yemenensis Arnold, 1980 [31].

Clade A is sister to the remaining species of the genus and includes the two morphologically similar but highly divergent species S. pulcher and S. arabicus (p-distance 12S: 12.5 % and 16S: 14.5 %) (Table 4a). Genetic variability within S. arabicus is very high and includes two reciprocally monophyletic deep lineages ( p-distance 12S: 7.7 % and 16S: 5.0 %), Table 4c one of them restricted to the Sharqiya Sands (formerly Wahiba Sands) in Oman, hereafter referred to as S. cf. arabicus , and the other one covering the rest of the distribution range of the species. Network analysis of the nuclear gene fragments c-mos and RAG -2 shows that for the former all alleles are unique for each lineage and all but one for the latter (Figure 3). Table 4 Uncorrected p-distances (pairwise deletion) a. Between species Talg Ttrip Tnatt Tscort Tsteud Tnub khob pulch arab lepto dori slev grandi affi petr stenu yeme mauri stheno Talg 0.082 0.155 n/c 0.164 0.158 0.148 0.169 0.153 0.157 0.162 0.163 0.166 0.166 0.166 0.170 0.187 0.164 0.158 Ttrip 0.120 0.173 n/c 0.186 0.184 0.161 0.168 0.165 0.167 0.161 0.179 0.160 0.172 0.175 0.180 0.187 0.172 0.169 Tnatt 0.172 0.194 n/c 0.143 0.133 0.169 0.173 0.161 0.139 0.147 0.170 0.144 0.162 0.151 0.152 0.177 0.160 0.154 Tscort 0.199 0.199 0.159 n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c n/c Tsteud 0.161 0.181 0.151 0.125 0.057 0.180 0.194 0.189 0.167 0.174 0.175 0.177 0.183 0.167 0.170 0.179 0.164 0.163 Tnub 0.154 0.173 0.159 0.151 0.057 0.167 0.185 0.185 0.156 0.163 0.168 0.170 0.176 0.166 0.165 0.180 0.160 0.158 khob 0.190 0.192 0.214 0.199 0.187 0.173 0.168 0.152 0.146 0.166 0.159 0.158 0.164 0.175 0.174 0.178 0.149 0.147 pulch 0.181 0.201 0.192 0.190 0.166 0.161 0.206 0.145 0.156 0.155 0.148 0.162 0.168 0.166 0.182 0.176 0.140 0.140 arab 0.206 0.219 0.220 0.216 0.189 0.206 0.222 0.125 0.157 0.165 0.159 0.157 0.163 0.177 0.173 0.179 0.152 0.141 lepto 0.190 0.217 0.189 0.201 0.182 0.185 0.230 0.182 0.206 0.068 0.079 0.065 0.074 0.111 0.115 0.128 0.119 0.110 dori 0.189 0.226 0.186 0.197 0.179 0.190 0.236 0.186 0.194 0.063 0.083 0.064 0.076 0.116 0.117 0.133 0.117 0.114 slev 0.195 0.204 0.205 0.208 0.192 0.200 0.218 0.196 0.214 0.094 0.099 0.092 0.092 0.122 0.134 0.139 0.126 0.112 grandi 0.199 0.213 0.195 0.203 0.186 0.192 0.225 0.194 0.208 0.070 0.094 0.076 0.072 0.113 0.114 0.120 0.104 0.102 affi 0.202 0.232 0.219 0.218 0.205 0.213 0.242 0.209 0.211 0.076 0.097 0.093 0.068 0.130 0.131 0.133 0.118 0.109 petr 0.218 0.226 0.227 0.220 0.200 0.195 0.235 0.178 0.217 0.148 0.167 0.183 0.163 0.169 0.045 0.122 0.111 0.119 stenu 0.206 0.217 0.224 0.210 0.199 0.197 0.216 0.183 0.209 0.142 0.161 0.174 0.156 0.162 0.056 0.130 0.116 0.118 yeme 0.193 0.217 0.212 0.205 0.192 0.195 0.209 0.208 0.231 0.190 0.191 0.193 0.187 0.201 0.175 0.167 0.114 0.099 mauri 0.196 0.226 0.209 0.218 0.196 0.197 0.237 0.183 0.189 0.148 0.158 0.177 0.159 0.160 0.166 0.162 0.156 0.072 stheno 0.195 0.215 0.213 0.234 0.196 0.195 0.247 0.194 0.207 0.165 0.179 0.189 0.169 0.182 0.187 0.182 0.158 0.109 b. Within species khob pulch arab lepto dori slev grandi affi petr stenu yeme mauri stheno 12S 0.005 0.000 0.045 0.009 0.029 0.030 0.002 0.029 0.044 n/c 0.060 0.047 0.047 16S 0.007 0.000 0.033 0.004 0.022 0.022 0.002 0.008 0.038 n/c 0.009 0.043 0.032 c. Between intraspecific groups arab_EOma arab_Arabia dori_EOma dori_Arabia petr_Egy petr stheno_NEg stheno_SEg stheno_Wes mauri_ELib mauri_WLi mauri_Tun mauri_NMor mauri_CMor mauri_WSah y y t b arab_cf 0.050 0.156 0.155 0.164 0.175 0.135 0.130 0.137 0.147 0.156 0.151 0.151 0.157 0.142 arab_Arabia 0.077 0.173 0.172 0.174 0.184 0.146 0.141 0.147 0.150 0.165 0.156 0.152 0.150 0.154 dori_EOma 0.184 0.197 0.027 0.114 0.125 0.113 0.113 0.112 0.100 0.115 0.118 0.116 0.114 0.123 dori_Arabia 0.189 0.200 0.040 0.111 0.116 0.116 0.114 0.114 0.103 0.115 0.122 0.119 0.116 0.123 petr_Egy 0.223 0.226 0.173 0.178 0.060 0.111 0.106 0.110 0.108 0.109 0.117 0.121 0.104 0.099 petr 0.208 0.219 0.161 0.165 0.072 0.125 0.120 0.124 0.115 0.115 0.119 0.130 0.114 0.107 stheno_NEgy 0.198 0.207 0.175 0.175 0.192 0.186 0.039 0.042 0.062 0.079 0.068 0.069 0.081 0.078 stheno_SEgy 0.195 0.206 0.177 0.180 0.188 0.185 0.058 0.032 0.060 0.071 0.064 0.066 0.075 0.068 stheno_West 0.210 0.218 0.186 0.185 0.187 0.189 0.059 0.051 0.067 0.081 0.071 0.073 0.084 0.077 mauri_ELib 0.174 0.188 0.145 0.154 0.164 0.161 0.099 0.100 0.111 0.043 0.049 0.041 0.043 0.052 mauri_WLib 0.180 0.202 0.136 0.148 0.163 0.159 0.106 0.110 0.116 0.045 0.056 0.046 0.060 0.064 mauri_Tun 0.178 0.195 0.134 0.143 0.158 0.158 0.096 0.103 0.112 0.040 0.049 0.042 0.060 0.063 mauri_NMor 0.198 0.199 0.154 0.162 0.169 0.162 0.112 0.104 0.120 0.046 0.049 0.047 0.060 0.066 mauri_CMor 0.160 0.187 0.138 0.146 0.170 0.161 0.096 0.094 0.109 0.046 0.052 0.049 0.058 0.048 mauri_WSah 0.178 0.194 0.166 0.172 0.171 0.174 0.111 0.112 0.118 0.061 0.066 0.070 0.074 0.052 12S: lower left, 16S: upper right. Abbreviations: Talg: Tropiocolotes algirus , Ttrip: T. tripolitanus , Tnatt: T. nattereri , Tscort: T. scortecci , Tnub: T. nubicus , khob: Pseudoceramodactylus khobarensis , pulch: Stenodactylus pulcher , arab: S. arabicus , lepto: S. leptocosymbotes , dori: S. doriae , slev: S. slevini , grandi: S. grandiceps , affi: S. affinis , petr: S. petrii , stenu: S. stenurus , mauri: S. mauritanicus , stheno: S. sthenodactylus.

Clade B is well supported and groups S. doriae and S. leptocosymbotes in sub-clade B1, while S. slevini , S. grandiceps and S. affinis in B2. Phylogenetic relationships are not completely resolved in the latter. Genetic distances between these five species are among the lowest in the genus (Table 4a). Nuclear network analyses (Figure 3) reveal only unique alleles in the c-mos gene fragment for all five species, while there is some allele sharing in RAG -2 between S. doriae and S. leptocosymbotes .

Finally, clade C consists of three sub-clades, two African and one Arabian. The North African sub-clade C1 braches first, and the Arabian S. yemenensis is sister to sub-clade C3 formed by the two North African species S. mauritanicus and S. sthenodactylus, making the group of North African Stenodactylus species paraphyletic. Topological constraint analyses indicate that the alternative hypothesis of monophyly of the North African species is rejected by the AU and BF tests (AU:0.029, SH:0.123, BF:7.221) (Table 3).

In sub-clade C1, S. stenurus is nested within S. petrii , rendering the latter paraphyletic. The results of the topological constraint analysis in which S. petrii was forced monophyletic show that this hypothesis is rejected by both AU and BF tests (AU:0.036, SH:0.210, BF:2.578) (Table 3). Network analysis shows that S. stenurus lacks unique alleles in both nuclear markers (Figure 3). The level of intraspecific genetic variability within S. petrii (Table 4b) is very high: the uncorrected p-distances between specimens from Egypt and Israel, and the remaining S. petrii specimens sampled for this study is 7.2 % and 6.0 % for the 12S and 16S mitochondrial markers, respectively (Table 4c). Nuclear networks indicate that all six c-mos and four out of six RAG -2 alleles investigated are unique to this former lineage of S. petrii (Figure 3).

In sub-clade C3, the two North African species S. sthenodactylus and S. mauritanicus are reciprocally monophyletic and highly divergent ( p-distance 12S: 10.9 % and 16S: 7.2 %) (Table 4a). The former is highly variable ( p-distance: 12S 4.7 % and 16S 3.2 %) (Table 4b) and presents three deep lineages that follow a clear geographical pattern (Figures 1 and 2), grouping animals from: 1.- northern Egypt, Israel and Jordan; 2.- south, southeast Egypt and Kenya; 3.- all the animals from Libya, Algeria, Tunisia, Western Sahara and Mauritania, although a single specimen from NE Egypt (loc. 127 in Figure 1, Siwa Oasis) is also part of this latter clade. The results of the network analyses also show a differentiation between these three lineages. In c-mos (Figure 3), in the first lineage 7 out of 10 alleles are unique, in the second lineage 2 out of 6 and in the third lineage 9 out of 16, while in RAG -2, 3 out of 10, 2 out of 8 and 10 out of 12 are unique, respectively (Figure 3). Genetic variability within S. mauritanicus is slightly higher than in S. sthenodactylus (p-distance: 12S 4.7 % and 16S 4.3 %) (Table 4b) and six different mitochondrial lineages with geographic structure are found: 1.- easternmost part of Libya and Egypt; 2.- central Libya; 3.- Tunisia; 4.- Northern Morocco; 5.- two very divergent samples from southeastern Morocco; and 6.- all the southern Morocco plus Western Sahara samples (see Figure 1 and Additional file 1: Figure S1).

Estimation of divergence times

Convergence was confirmed examining the likelihood and posterior trace plots of the two runs with Tracer v.1.5. Effective sample sizes of the parameters were above 200, indicating a good representation of independent samples in the posterior. The estimated divergence times are illustrated in Figure 2 and the chronogram can be seen in Supplementary Figure 2 (Additional file 2: Figure S2). Diversification within Stenodactylus initiated 29.5 Ma ago (95 % HPD: 20.7-39.2). In clade A, the split between S. pulcher and S. arabicus is dated back to 17.3 Ma (95 % HPD: 11.3-23.6). The separation between the ancestors of clades B and C dates back to 21.8 Ma (95 % HPD: 15.4-29.1), while diversification within these two clades started 11.0 Ma (95 % HPD: 7.4-15.0) and 19.3 Ma (95 % HPD: 13.1-25.5) ago, respectively.

Posterior mean rates for the 12S and 16S mitochondrial gene fragments were estimated at 0.00701 and 0.00642 substitutions per lineage per million years, respectively (or divergence rate: 1.402 % and 1.284 %). The posterior rates for the nuclear fragments, c-mos and RAG -2, were 0.00052 and 0.00060 respectively, more than 10 times lower than the mitochondrial ones. The 12S mitochondrial rate concords extremely well with the average rate for the same mitochondrial gene for three Canary Island reptile groups ( Gallotia, Tarentola and Chalcides ; 0.00755 for the 12S gene) as estimated by Carranza and Arnold (2012) [44].

Ancestral area reconstruction

Reconstruction of the ancestral areas of Stenodactylus species was done in a parsimony framework based on the topology of the phylogeny presented in Figure 2. The analysis indicates that the reconstruction of the area for some of the ancestors is equivocal (see Figure 4). These are the common ancestor of clade C formed by all North African species and S. yemenensis and the ancestor of the latter and the sister species S. sthenodactylus /S. mauritanicus . Reconstructions using accelerated transformation (ACCTRAN) or delayed transformation (DELTRAN) optimizations support an identical number of events involving Arabia and Africa, but the direction of events is different. ML-based reconstruction, considering branch-length information, with the best-fit Markov k-state 1-parameter model also provided results with fairly similar probabilities for the two states in the aforementioned nodes (Figure 4).

Figure 4 Ancestral area reconstruction. The tree figure illustrates the parsimony reconstruction, while numbers above and below nodes correspond to ML probabilities for character states. Black and white colors correspond to Africa and Arabia respectively, and grey color indicates equivocal nodes. Discussion

This constitutes the first phylogenetic study using a complete sampling of Stenodactylus taxa and including 207 specimens from across the entire distribution range of North Africa and Arabia (Figure 1). This has enabled a robust phylogenetic reconstruction (see Figure 2 and Additional file 1: Figure S1), the uncovering of intraspecific diversity and, in some cases, the unveiling of interesting distribution patterns (see below). The phylogenetic results show a high level of support in most of the nodes and a striking agreement with the phylogenetic analyses of Stenodactylus by Arnold (1980) [31], based on morphological data, increasing our confidence that the recovered topology represents the true evolutionary history of the genus.

Monophyly of Stenodactylus

Despite the general concordance between morphological and phylogenetic conclusions, one important discrepancy is observed: while morphology supports the inclusion of P. khobarensis in the genus Stenodactylus , the results of our molecular analyses indicate that Pseudoceramodactylus and Stenodactylus are not even sister genera (Figure 2). Kluge (1967) [39] transferred P. khobarensis to the genus Stenodactylus based on a “large number of external (meristic and mensural) and internal morphological similarities”, including relevant characters like the phalangeal reduction to a formula of 2.3.3.4.3 on both fore and hind limbs and a very high scleral ossicle number (20–28). Arnold (1980) [31], despite pointing out some unique scale characters of P. khobarensis , retained it in Stenodactylus and considered the scalation characters as “convincing pointers to holophyly”. However, according to a recent molecular analysis of the group by Fujita and Papenfuss (2011) [40] based on independent samples and sequences of different mitochondrial and nuclear regions, two representatives of Tropiocolotes branched between P. khobarensis and the six species of Stenodactylus included in the analysis (see Figure 1 of [40]). In order to deal with the non- monophyly of Stenodactylus , the genus Pseudoceramodactylus was resurrected. This pattern is repeated and further investigated in our study, with a complete taxon sampling of Stenodactylus and the inclusion of a greater number of representatives of Tropiocolotes , resulting in the splitting of the latter genus into two groups, a surprising but not strongly supported, albeit consistent, result.

We performed a series of constraint analyses in which Stenodactylus and Pseudoceramodactylus were forced to form a monophyletic group. Results clearly show that our dataset cannot reject the alternative hypothesis of a monophyletic Stenodactylus + Pseudoceramodactylus group (Table 3). In order to further investigate this, the dataset of Fujita and Papenfuss (2011) [40] was subjected to the same ML topological tests, but also could not reject the alternative hypothesis of monophyly of Stenodactylus + Pseudoceramodactylus (AU P = 0.074; SH P = 0.092). In view of the confusing molecular evidence and taking into account the morphological data, we think that the resurrection of Pseudoceramodactylus was precipitated, but in the meanwhile, this change accommodates for both the paraphyly reported by Fujita and Papenfuss and confirmed here, and the hypothesis of monophyly of Stenodactylus + Pseudoceramodactylus . We recommend not performing any further changes at the generic level before an in-depth revision clarifies the evolutionary relationships between the genera Stenodactylus , Pseudoceramodactylus and Tropiocolotes .

Systematics and evolution

The well-supported clade A is formed by the morphologically similar S. pulcher , S. arabicus and the lineage S. cf. arabicus and, according to the inferred dates, the split between the former and the two latter species dates back to approximately 17 Ma ago (95 % HPD: 11.3- 23.6) (Figure 2). On the one hand, variability within S. pulcher is very low, probably as a result of the two specimens analyzed being from very close localities. On the other hand, the S. cf. arabicus lineage from the Sharqiya Sands (formerly Wahiba Sands), as already highlighted by Fujita and Papenfuss (2011) [40], is genetically very distinct from all other populations of S. arabicus included in our study in both mitochondrial and nuclear markers (Table 4c and Figure 2), where almost all alleles are lineage-specific (see Results and Figure 3). This supports the idea that the Sharqiya Sands are isolated and surrounded by some areas of unsuitable habitat for sand dune specialists like this species [88-90]. Further morphological and molecular studies including more specimens from putative contact zones and faster nuclear markers are expected to give S. cf. arabicus formal recognition.

Clade B is well-supported (ML 100 %, BI 1.0) and was also recovered by the morphological analysis of Arnold (1980) [34]. Stenodactylus doriae and S. leptocosymbotes are reciprocally monophyletic and form the relatively well-supported sub-clade B1 (Figure 2). Our molecular results agree with the results of the morphological analysis by Arnold (1980) [31], who also recovered the two species as sister taxa based on three synapomorphies. The two species diverged approximately 7.0 Ma ago (95 % HPD: 4.2-10.1) (Figure 2) and, like the two North African sister species S. sthenodactylus and S. mauritanicus , they are ecologically distinct. Stenodactylus leptocosymbotes is an arid-adapted species that lives on relatively hard, although usually sandy, substrates being replaced by its sister species, S. doriae , on soft, wind-blown sand [34,91]. Thanks to its morphological and physiological adaptations, the latter is able to live in hyper-arid sand dune environments like for example the Eastern Rub al Khali [92], one of the largest and driest sand deserts in the world [93]. Given the clear morphological and ecological differences between these two species and the apparent absence of morphologically intermediate individuals [31,34], it seems reasonable to deduce that allele sharing in RAG-2 (see Results), which is limited to the ancestral allele, is the result of incomplete lineage sorting rather than ongoing gene flow between the two species. Variability within S. leptocosymbotes is rather low (Table 4b) and the number of samples included permit to observe only moderate geographical structuring (Figures. 1–2 and Additional file 1: Figure S1). In contrast, S. doriae , shows a higher level of genetic differentiation, with the Sharqiya Sands lineage being quite divergent (Table 4c and Figure 2), as already mentioned by Fujita and Papenfuss (2011) [40].

Sister to sub-clade B1 is a group composed by S. slevini , S. grandiceps and S. affinis , for which support is relatively low (ML 62, BI = 0.95). The topology within this sub-clade differs from the morphological hypothesis of Arnold (1980) [34], which supported the following relationship: ( S. grandiceps (S. affinis (S. slevini (S. leptocosymbotes , S. doriae )))). Stenodactylus slevini is the only member of the group with two divergent lineages, one limited to Jordan and the other with representatives from East Arabia. Although the divergence based on mitochondrial data is clear (Additional file 1: Figure S1), there is no supporting nuclear data available (Figure 3), and no obvious morphological differences (pers. obs.). With the only exception of the soft wind-blown sand specialist S. doriae , all remaining representatives of clade B plus two other species, the African S. sthenodactylus and the Arabian S. yemenensis , appear to occupy rather similar spatial niches. These six species are adapted to living on relatively hard ground, coarse sandy planes, large wadis and sandy substrates and, based on their head dimensions, probably feed on similar-sized prey [31,32,34]. As a consequence of that, these species rarely coexist and have largely allopatric distribution ranges, while in places where they coincide they are not syntopic [31,33,34]. The analysis of the nuclear allele networks (Figure 3) indicate that the morphologically and ecologically similar and phylogenetically closely related S. leptocosymbotes , S. slevini , S. grandiceps and S. affinis do not share a single allele in the c-mos and RAG -2 genes analyzed, even though the results of the calibration analyses suggest that S. grandiceps and S. affinis diverged later (6.7 Ma ago; 95 % HPD: 4.1-9.3) than other lineages for which extensive allele sharing in the RAG -2 has been identified ( S. doriae and S. leptocosymbotes ; see above and Results). These differences of the level of lineage sorting in some of the morphologically well-recognized species may also be the result of differences in effective population sizes, which affect the lineage coalescence time [94].

In sub-clade C1, S. petrii is grouped together with the North African endemic S. stenurus that branches inside it (Figure 2). As a result, S. petrii is paraphyletic and constitutes the only exception among the otherwise monophyletic Stenodactylus species. The results of the topological tests (Table 3) indicate that our dataset most probably rejects the monophyly of this species (AU:0.036, SH:0.210, BF:2.578). Stenodactylus stenurus was described by Werner (1899) [86] and synonymized ten years later by the same author [95]. It remained in synonymy until Kratochvil et al. (2001) [96] recognized it as a valid species, based on a multivariate analysis of several metric and scalation characters. It is noteworthy that the representative of S. stenurus included in our analysis is one of the specimens used by Kratochvil et al. (2001) [96] in their study.

The highly divergent lineage that includes specimens from Egypt and Israel (see Results) is estimated to have split from specimens further west in Algeria, Morocco, Western Sahara and Mauritania approximately 6.1 Ma ago (95 % HPD: 3.9-8.6) (Figure 2). In fact, the northern Sinai populations of S. petrii have been reported to be morphologically distinct and, as a result of that, were considered a different species ( S. elimensis ) by Barbour (1914) [97], now under the synonymy of S. petrii [31,98]. Yet, specimens from this area included in our analyses do not present considerable genetic differences with the rest of the Egyptian and Israeli specimens (Figures. 1–2 and Additional file 1: Figure S1). It should be pointed out that the type locality of S. petrii is Egypt and, thus, this lineage represents the 'true' S. petrii . The pattern in the nuclear genes, with numerous unique alleles for this lineage (Figure 3), contrasts with the situation in S. stenurus that lacks unique alleles. This suggests that further analyses and a thorough taxonomic revision including more samples of S. petrii , especially from not sampled areas of Algeria and Libya, and mainly S. stenurus will be necessary in order to evaluate the status of the populations assigned to the two species. With this evidence it will be possible to differentiate between a single species with high genetic variability (petrii ), two species ( petrii in the East and stenurus in the West) or three species, if stenurus proves to be distinct from the more western forms.

The two North African species of sub-clade C3, S. sthenodactylus and S. mauritanicus , are shown to be reciprocally monophyletic and highly divergent (Table 4a), while their separation dates back to approximately 10.0 Ma (95 % HPD: 6.6-13.7) (Figure 2). These results help to clarify the status of these two taxonomically controversial taxa that were treated as two different subspecies by Loveridge (1947) [99] and Sindaco and Jeremcenko (2008) [33], as the same monotypic species by Arnold (1980) [31] and that were finally considered as full species by Baha el Din (2006) [98], who found them in sympatry at particular localities in northern Egypt. As observed by Baha el Din (2006) [98], although these two sister species can be morphologically similar and share similar habits, they are ecologically different. Stenodactylus mauritanicus is restricted to fairly mesic coastal semi- desert under the influence of the Mediterranean (see Figure 1), where it inhabits flat rock- strewn sand and gravel plains with fairly good vegetation cover. On the contrary, S. sthenodactylus inhabits areas of the Sahara that are far more arid and inhospitable than the ones of its sister species (see Figure 1), being the only vertebrate to be readily found in some parts of the Western Desert of Egypt [98]. It prefers gravelly and coarse sandy plains and large wadis and, although the species is typical of hard coarse substrates, it sometimes penetrates some dune areas [98].

The distributions of these two species, as introduced by the present study, give insights into the controversial taxonomic status and frequent misidentification of the two forms [99]. Our analysis concludes that S. sthenodactylus extends west from the Middle East and Egypt, previously thought to be its eastern limit, across the Sahara and into Mauritania (Figure 1). Stenodactylus mauritanicus is confirmed to be present in Egypt [98] and has a wide, almost continuous distribution roughly along the northern margin of the Sahara desert. The two species are found in sympatry or in close proximity in Egypt and coastal Mauritania, yet retain distinct mtDNA lineages and exhibit only limited allele sharing in the nuclear markers, most of which is due to sharing of ancestral alleles and hence is likely to represent incomplete lineage sorting (see Figure 3).

Stenodactylus sthenodactylus presents high variability, both at genetic (see Results) and morphological levels [31]. Its three deep lineages are estimated to have diverged approximately 4.8 Ma ago (95 % HPD: 2.8-6.9) (Figure 2). According to Baha el Din (2006) [98], some morphological characters appear to correlate with environmental factors, with populations from hyper-arid places showing a very slender body, less contrasting pattern and tubular nostrils, while populations from more mesic areas being usually more robust, with thick limbs, big heads and marked pattern [31,36,98]. The populations from coastal regions in southeast Egypt are especially distinct and, according to Baha el Din (2006) [98], they resemble specimens of S. s. zavattarii from Kenya, which Loveridge (1957) [100] synonymized with S. sthenodactylus . Two specimens of this form were included in our phylogenetic analyses (see Figure 2 and Additional file 1: Figure S1), and indeed they belong to a clade with samples from south and southeast Egypt. These results suggest that some of the morphological variability between populations of S. sthenodactylus may also be supported by molecular data. A nomenclatural revision of North African Stenodactylus (work in progress) is essential for stability before any changes are performed, while further work focused on the contact zones between the three lineages and combining detailed morphological analyses with additional nuclear data is needed in order to determine if they deserve formal recognition.

On the other hand, the high genetic variability within S. mauritanicus (Figure 2 and Table 4b) does not seem to correlate with differences in morphology. This species is fairly uniform morphologically, with populations from the West being a bit larger than Egyptian ones but generally maintaining the same proportions, pattern and scalation across most of its distribution range [98]. Nevertheless, the intra-specific divergence is estimated to date back to 6.6 Ma ago (95 % HPD: 4.0-9.5) and the six mitochondrial lineages present a clear geographical pattern (Figure 1 and Additional file 1: Figure S1). The relationship between these lineages, however, is not clear and neither is any structure observed in the nuclear alleles (Figure 3), both facts being mirrored in the low-supported nodes of the concatenated phylogeny (Figure 2).

Origin, biogeography and diversification of Stenodactylus

Reconstruction of ancestral areas with both parsimony and ML methods (Figure 4) suggests that the genus Stenodactylus originated in Arabia approximately 30 Ma ago (95 % HPD: 20.7-39.2) (Figure 2), a time of high geological instability as a result of the onset of major seismic and volcanic events in the general area of Ethiopia, northeast Sudan and southwest Yemen [101]. These major volcanic and tectonic events, centered over the Afar region, marked the onset of the formation of some of the most relevant and complex physiographical features in the contact zone between Africa and Arabia, like the Gulf of Aden, the Red Sea and the elevation of the Afro-Arabian rift-flanks to heights above 3600 m [1,101,102].

The tempo and mode of the deep splits in Stenodactylus bear a striking resemblance to the basal splits that occurred in the African-Eurasian snake genus Echis [13,103], which suggests a common biogeographical pattern for both groups. The distribution of the members of Arabian clade B ( S. doriae , S. leptocosymbotes , S. slevini , S. grandiceps , S. affinis ) and the mainly African clade C ( S. petrii , S. stenurus , S. yemenensis , S. mauritanicus , S. sthenodactylus ) (Figures 1 and 2) extend primarily on the opposite sides of the Red Sea, mimicking the situation of the sister taxa E. coloratus (mainly Arabian) and E. pyramidum (mainly African). The split between these two Stenodactylus groups dates back to 21.8 Ma ago (95 % HPD: 15.4-29.1) (Figure 2), which roughly coincides with the split between E. coloratus and E. pyramidum calculated at approximately 19.4 Ma ago. The dates of these phylogenetic events follow a well-studied phase of volcanism and strong rifting initiated at approximately 24 Ma ago, that appeared in an almost synchronous way throughout the entire Red Sea [1]. Therefore, it is possible that the formation of the Red Sea acted as a vicariant event separating the aforementioned clades of Stenodactylus , as also suggested by Pook et al. (2009) [13] for the genus Echis . The agamid lizards of the genus Uromastyx [25] is yet another group that could have been affected by such an event, although in this case the split between the Arabian and African clades seems to have happened later, at 11–15 Ma ago. Amer and Kumazawa (2005) [25] attributed this split to a dispersal event from Arabia into North Africa, coinciding with climatic changes towards aridity in this latter area, rather than to vicariance. However, since earlier dates had also been calculated for the split between African and Arabian Uromastyx that coincide with the inferred dates for Stenodactylus and Echis (18 Ma ago; [104]), a reassessment of the calibration dates of Uromastyx using relaxed clock methods like the ones applied by Pook et al. (2009) [13] and in the present study seems necessary (work in progress).

The split between the Arabian S. yemenensis and the ancestor of the African S. mauritanicus and S. sthenodactylus on either sides of the Red Sea also parallels the splits between Arabian and African sister clades of the E. pyramidum complex [13] and Uromastyx ocellata and U. ornata [25]. Although the divergence time estimate for the Stenodactylus members (15.4 Ma ago (95 % HPD: 10.5-20.8), Figure 2) predates the ones of the other two groups by almost 7 Ma, the split between African and Arabian lineages might be explained by the complex geology of the Red Sea. Several recurrent episodes during the Miocene caused the desiccation and refilling of this tectonically active rifting area [1,105] and provoked the severing of the land bridges that had existed after the initial formation of the Red Sea in the early Miocene. So, the separation between S. yemenensis and the ancestor of S. mauritanicus and S. sthenodactylus was probably also the result of vicariance, similarly to Echis and Uromastyx . After this event, S. yemenensis would have remained isolated at the coastal side of the southern Arabian highlands (Figures 1 and 2).

In Arabia, an example of a similar biogeographical pattern caused by a different biogeographical process is the case of the ecologically similar sister species of clade A, S. pulcher and S. arabicus (including S. cf. arabicus ), which, according to the results (Figure 2) and the geological data available, are hypothesized to result from vicariance caused by the uplift of the Yemen Mountains approximately 18 Ma ago [1,101,102]. The splits within clade B, however, seem more difficult to interpret, as little information is available on the geological and climatic history of the interior of Arabia. A general pattern could be proposed with a first North–South split between the ancestors of S. doriae , S. leptocosymbotes and S. slevini , S. grandiceps , S. affinis , respectively, followed by the posterior range expansion of some of these species. Interestingly, in Arabia, even though evidence exists for an increase in a ridification [106], it has been hypothesized that at the same time an important river system, as evidenced by the fluvial sediments, could characterize the interior of the peninsula [93,107]. Such dynamic scenery could be responsible for the rapid diversification within clade B, having caused fragmentation of the distribution range of the ancestor(s) and the different lineages to split allopatrically. The onset of diversification in clade B coincides in time with the split between the African S. mauritanicus and S. sthenodactylus in sub-clade C3 (Figure 2). These speciation events match very closely the estimates of the formation, in the late Miocene, of a major east- Antarctic ice sheet with its associated polar cooling, which triggered the aridification of mid- latitude continental regions and a shift in North Africa from forest to dry open woodlands and savannahs [4,20,108]. The two North African forms, S. mauritanicus and S. sthenodactylus , seem to have diverged in ecological niche, with one form adapted to mesic environments and the other occupying much dryer areas, respectively. It has been proposed that the gradual increase in aridity that took place in northern Africa during the late Miocene accelerated the diversification process in reptile faunas [21]. The estimated divergence times of the North African Stenodactylus seem to corroborate a common emerging pattern among European biota, according to which the speciation events in many reptile and amphibian groups do not coincide with the accentuated environmental instability during the Pleistocene, but rather date back into the Miocene and proceeding through the Quaternary, when many species and populations originated [109,110].

It has been suggested that 18 Ma ago, Africa connected with Eurasia through the closure of the Eastern Mediterranean seaway (the Gomphotherium land bridge) [15]. This land bridge later became disconnected temporarily but it has been continuously present since approximately 15 Ma ago. It is interesting to notice that, despite the existence of a continuous passage between Arabia and Eurasia, our phylogeny suggests that colonization of Eurasia by members of the genus Stenodactylus occurred much later and was very restricted geographically. In fact, only two Stenodactylus species extend their ranges into Eurasia ( S. affinis and S. doriae ). From these two, only samples of S. affinis from Eurasia (Iran) were available, while for the other species a specimen from neighboring Kuwait was included. In both species, however, the low intraspecific genetic variability suggests that the colonization of Eurasia was a very recent event (Figure 2 and Table 4b). One possible explanation of this biogeographical pattern may be the existence of ecologically and morphologically very similar forms in Iran like Crossobamon (formerly a member of Stenodactylus ; [39]) and Agamura , which may compete with Stenodactylus and therefore may have not allowed it to expand further outside the narrow coastal strip in southwestern Iran (Arnold, 1980). This situation is completely different than the one in North Africa, where no ecological analogs to Stenodactylus seem to exist and therefore several of its species are found across an area of more than 10 million Km 2 [31,33,98,111,112]. Conclusions

The analyses presented in this study, based on a multi-locus dataset that derives from a complete sampling of the 12 species of the genus Stenodactylus , reveal the existence of three clades with deep divergences within Stenodactylus and high intraspecific variability in some species, while the estimation of divergence times allows for biogeographical interpretations. The geckos Stenodactylus originated in Arabia 30 Ma ago. In clade A, the split between the two species is hypothesized to have resulted from vicariance caused by the uplift of the Yemen Mountains approximately 18 Ma ago. Stenodactylus cf. arabicus from the Sharqiya Sands constitutes a genetically and morphologically distinct lineage. In clade B, rapid diversification seems to relate to climatic and geological instability in the late Miocene, but this hinders the reconstruction of robust phylogenetic relationships between some species. The Sharqiya Sands host yet another divergent lineage, that of the species S. doriae . In clade C, the split between S. yemenensis and sub-clade C3 is hypothesized to relate to the recurrent episodes of the desiccation and refilling of the Red Sea, during the Miocene. An interesting distribution pattern is revealed for the sister species S. sthenodactylus and S. mauritanicus , differing greatly from what was previously thought. Several speciation events in Stenodactylus are estimated to date back to the late Miocene, indicating that this was an important period for reptile diversification in this area. The split between clades B and C is attributed to the opening of the Red Sea in the Upper Miocene, acting as a vicariant agent. On the other hand, the formation of the connection between Africa and Eurasia seems to have had little effect on Stenodactylus , probably because of the existence of ecological analogs. On a taxonomic level, further studies are expected to resolve the systematics of the S. petrii - S. stenurus complex. Validity of the specific status of S. mauritanicus is confirmed with mitochondrial and nuclear data. Overall, this work unveils the evolutionary history of Stenodactylus geckos and highlights their use as a model in the study of the faunal interchanges between North Africa and Arabia and the evolutionary processes in these arid areas. Abbreviations rRNA, ribosomal ribonucleic acid; c-mos , oocyte maturation factor Mos; RAG -2, Recombination activating gene 2; PCR, Polymerase chain reaction; ML, Maximum likelihood; BI, Bayesian Inference; AU, Approximately unbiased; SH, Shimodaira- Hasegawa; BF, Bayes factor; Ma, Megaannum; HPD, Highest posterior density Competing interests

The authors declare that they have no competing interests. Authors' contributions

SC and NA conceived the study. SC coordinated the study. All authors collected samples in the field and/or provided tissue samples. SC and MM assembled the data. MM obtained the sequences, carried out the analyses and drafted the manuscript. PAC contributed to improving the manuscript. MM and SC wrote the final manuscript. All authors read and approved the final manuscript. Acknowledgements

The authors are grateful to people who donated samples for this study or helped in the field: F. Ahmadzadeh, F. Amat, A. Bouskila, A. Cluchier, O. Chaline, M. Charpentier, D. Donaire, D. Escoriza, T. Gamble, J. Harris, Y. Hingrat, H. in den Bosch. D. Modry, J. Padial, O. Peyre, J.M. Pleguezuelos, C. Rato, J. Renoult, B. Shacham, J. Smid, J. Viglione. We are especially grateful to Jiri Moravec and Lukas Kratochvil for providing the S. stenurus tissue sample and the photograph of the species. We would also like to thank Elena Gómez-Diaz for providing helpful comments and Enric Planas for fruitful discussion and help with the figures. We are indebted to Ali Alkiyumii and the other members of the Ministry of Environment and Climate Affairs of the Sultanate of Oman for their help and support and for issuing collecting permits (Refs: 08/2005; 16/2008; 38/2010; 12/2011). This work was supported by grants CGL2009-11663 ⁄BOS from the Ministerio de Economía y Competitividad, Spain, Fondos FEDER - EU, and 2012RU0055 from the Consejo de Investigaciones Cientificas (CSIC) and the Russian Foundation for Basic Research (RFBR). SC and MM are members of the Grup de Recerca Emergent of the Generalitat de Catalunya: 2009SGR1462; MM is supported by a FPU predoctoral grant from the Ministerio de Educación, Cultura y Deporte, Spain (AP2008-01844). Some phylogenetic analyses were run in the cluster facility of the IBE funded by the Spanish National Bioinformatics Institute (http://www.inab.org) and in the CIPRES Science Gateway web portal [113]. We acknowledge support of the publication fee by the CSIC Open Access Publication Support Initiative through its Unit of Information Resources for Research (URICI). We thank two anonymous reviewers for helpful comments on an earlier version of the manuscript. References

1. Bosworth W, Huchon P, McClay K: The red sea and gulf of aden basins. J Afr Earth Sci 2005, 43 :334–378.

2. Carranza S, Arnold EN, Geniez P, Roca J, Mateo J: Radiation, multiple dispersal and parallelism in the skinks, Chalcides and Sphenops (Squamata: Scincidae ), with comments on Scincus and Scincopus and the age of the Sahara desert. Mol Phylogenet Evol 2008, 46 :1071–1094.

3. Dean WRJ: Nomadic Desert Birds . Berlin, Heidelberg, New York: Springer Verlag; 2004.

4. Flower BP, Kennett JP: The middle Miocene climatic transition: East Antarctic ice sheet development, deep ocean circulation and global carbon cycling. Palaeogeogr Palaeoclimatol Palaeoecol 1994, 108 :537–555.

5. Griffin DL: Aridity and humidity: two aspects of the late Miocene climate of North Africa and the Mediterranean. Palaeogeogr Palaeoclimatol Palaeoecol 2002, 182 :65–91.

6. Guiraud R, Bosworth W, Thierry J, Delplanque A: Phanerozoic geological evolution of Northern and Central Africa: an overview. J Afr Earth Sci 2005, 43 :83–143.

7. Lourenço W, Duhem B: Saharo-Sindian buthid scorpions; description of two new genera and species from Occidental Sahara and Afghanistan. ZooKeys 2009, 14 :37–54.

8. Quezel P: Analysis of the flora of Mediterranean and Saharan Africa. Ann Mo Bot Gard 1978, 65 :479–534.

9. Yom-Tov Y: Character displacement in the Psammophile Gerbillidae of Israel. Oikos 1991, 60 :173–179.

10. Haq BU, Hardenbol J, Vail PR: Chronology of fluctuating sea levels since the Triassic. Science 1987, 235 :1156–1167.

11. Fernandes CA, Rohling EJ, Siddall M: Absence of post-Miocene Red Sea land bridges: biogeographic implications. J Biogeogr 2006, 33 :961–966.

12. Harzhauser M, Kroh A, Mandic O, Piller WE, Göhlich U, Reuter M, Berning B: Biogeographic responses to geodynamics: a key study all around the Oligo-Miocene Tethyan Seaway. Zoologischer Anzeiger-A Journal of Comparative Zoology 2007, 246 :241– 256.

13. Pook CE, Joger U, Stümpel N, Wüster W: When continents collide: Phylogeny, historical biogeography and systematics of the medically important viper genus Echis (Squamata: Serpentes: Viperidae). Mol Phylogenet Evol 2009, 53 :792–807.

14. Zhou L, Su YCF, Thomas DC, Saunders RMK: 'Out-of-Africa' dispersal of tropical floras during the Miocene climatic optimum: evidence from Uvaria (Annonaceae). J Biogeogr 2012, 39 :322–335.

15. Rögl F: Paleogeographic Considerations For Mediterranean And Paratethys Seaways (Oligocene And Miocene) . Wien: Annalen des Naturhistorischen Museums in; 1998. 99A: 279-331.

16. Kroepelin S: Revisiting the age of the Sahara desert. Science 2006, 312 :1138–1139.

17. Schuster M: Revisiting the age of the Sahara Desert. Science 2006, 312 :1138–1139.

18. Schuster M, Duringer P, Ghienne J-F, Vignaud P, Mackaye HT, Likius A, Brunet M: The age of the Sahara desert. Science 2006, 311 :821.

19. Swezey CS: Revisiting the age of the Sahara desert. Science 2006, 312 :1138–1139.

20. Douady CJ, Catzeflis F, Raman J, Springer MS, Stanhope MJ: The Sahara as a vicariant agent, and the role of Miocene climatic events, in the diversification of the mammalian order Macroscelidea (elephant shrews). Proc Natl Acad Sci 2003, 100 :8325– 8330.

21. Fu J: Toward the phylogeny of the family Lacertidae–Why 4708 base pairs of mtDNA sequences cannot draw the picture. Biol J Linn Soc 2000, 71 :203–217.

22. Guillaumet A, Crochet PA, Pons JM: Climate-driven diversification in two widespread Galerida larks. BMC Evol Biol 2008, 8:32.

23. Camargo A, Sinervo B, Sites JW Jr: Lizards as model organisms for linking phylogeographic and speciation studies. Mol Ecol 2010, 19 :3250–3270.

24. Kapli P, Lymberakis P, Poulakakis N, Mantziou G, Parmakelis A, Mylonas M: Molecular phylogeny of three Mesalina (Reptilia: Lacertidae) species ( M. guttulata, M. brevirostris and M. bahaeldini ) from North Africa and the Middle East: another case of paraphyly? Mol Phylogenet Evol 2008, 49 :102–110.

25. Amer SAM, Kumazawa Y: Mitochondrial DNA sequences of the Afro-Arabian spiny- tailed lizards (genus Uromastyx ; family Agamidae): phylogenetic analyses and evolution of gene arrangements. Biol J Linn Soc 2005, 85 :247–260.

26. Carranza S, Arnold EN, Mateo JA, Geniez P: Relationships and evolution of the North African geckos, Geckonia and Tarentola (Reptilia: Gekkonidae), based on mitochondrial and nuclear DNA sequences. Mol Phylogenet Evol 2002, 23 :244–256. 27. Carranza S, Arnold EN, Pleguezuelos JM: Phylogeny, biogeography, and evolution of two Mediterranean snakes, Malpolon monspessulanus and Hemorrhois hippocrepis (Squamata, Colubridae), using mtDNA sequences. Mol Phylogenet Evol 2006, 40 :532– 546.

28. Fonseca MM, Brito JC, Rebelo H, Kalboussi M, Larbes S, Carretero MA, Harris DJ: Genetic variation among spiny-footed lizards in the Acanthodactylus pardalis group from North Africa. African Zoology 2008, 43 :8–15.

29. Gonçalves DV, Brito JC, Crochet PA, Geniez P, Padial JM, Harris DJ: Phylogeny of North African Agama lizards (Reptilia: Agamidae) and the role of the Sahara desert in vertebrate speciation. Mol Phylogenet Evol 2012, 64 :582–591.

30. Fitzinger LJ: Neue Classification Der Reptilien Nach Ihren Natürlichen Verwandtschaften: Nebst Einer Verwandtschafts-Tafel Und Einem Verzeichnisse Der Reptilien-Sammlung Des KK Zoologischen Museum's Zu Wien . Wien: JG Heubner; 1826.

31. Arnold EN: Reptiles of Saudi Arabia: a review of the lizard genus Stenodactylus (Reptilia: Gekkonidae). Fauna of Saudia Arabia 1980, 2:368–404.

32. Arnold EN: Little-known geckoes (Reptilia: Gekkonidae) from Arabia with descriptions of two new species from the Sultanate of Oman. The Scientific Results of the Oman Flora and Fauna Survey 1975, 1977 :81–110.

33. Sindaco R, Jeremcenko VK: The Reptiles Of The Western Palearctic . Latina (Italy): Edizioni Belvedere; 2008.

34. Arnold EN: Ecology of lowland lizards in the eastern United Arab Emirates. J Zool 1984, 204 :329–354.

35. Blanford WT: Descriptions of new reptilia and amphibia from Persia and Baluchistan. The Annals and Magazine of Natural History, London 1874, 4:31–35.

36. Anderson J: A Contribution To The Herpetology Of Arabia: With A Preliminary List Of The Reptiles And Batrachians Of Egypt . London: RH Porter; 1896.

37. Haas G: Some amphibians and reptiles from Arabia. Proc Calif Acad Sci 1957, 29 :47– 86.

38. Bauer AM, Russell AP: Pedal specialisations in dune-dwelling geckos. J Arid Environ 1991, 20 :43–62.

39. Kluge AG: Higher taxonomic categories of gekkonid lizards and their evolution. Bull Am Mus Nat Hist 1967, 135 :1–60.

40. Fujita MK, Papenfuss TJ: Molecular systematics of Stenodactylus (Gekkonidae), an Afro-Arabian gecko species complex. Mol Phylogenet Evol 2011, 58 :71–75. 41. Arnold EN: Relationships, evolution and biogeography of Semaphore geckos, Pristurus (Squamata, Sphaerodactylidae) based on morphology. Zootaxa 2009, 2060 :1– 21.

42. Arnold EN, Vasconcelos R, Harris DJ, Mateo JA, Carranza S: Systematics, biogeography and evolution of the endemic Hemidactylus geckos (Reptilia, Squamata, Gekkonidae) of the Cape Verde Islands: based on morphology and mitochondrial and nuclear DNA sequences. Zoologica Scripta 2008, 37 :619–636.

43. Carranza S, Arnold EN: Systematics, biogeography, and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 2006, 38 :531–545.

44. Carranza S, Arnold EN: A review of the geckos of the genus Hemidactylus (Squamata: Gekkonidae) from Oman based on morphology, mitochondrial and nuclear data, with descriptions of eight new species. Zootaxa 2012, 3378 :1–95.

45. Carranza S, Arnold EN, Mateo JA, López-Jurado LF: Long-distance colonization and radiation in gekkonid lizards, Tarentola (Reptilia: Gekkonidae), revealed by mitochondrial DNA sequences. Proc R Soc London, Ser B 2000, 267 :637.

46. Gamble T, Bauer AM, Colli GR, Greenbaum E, Jackman TR, Vitt LJ, Simons AM: Coming to America: multiple origins of New World geckos. J Evol Biol 2011, 24 :231– 244.

47. Feng J, Han D, Bauer AM, Zhou K: Interrelationships among Gekkonid Geckos inferred from mitochondrial and nuclear gene sequences. Zoolog Sci 2007, 24 :656–665.

48. Gamble T, Bauer AM, Greenbaum E, Jackman TR: Out of the blue: a novel, trans- Atlantic clade of geckos (Gekkota, Squamata). Zoologica Scripta 2008, 37 :355–366.

49. Han D, Zhou K, Bauer AM: Phylogenetic relationships among gekkotan lizards inferred from C-mos nuclear DNA sequences and a new classification of the Gekkota. Biol J Linn Soc 2004, 83 :353–368.

50. Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S: Geneious v5. 1 . 2010. Available from www.geneious.com.

51. Katoh K, Toh H: Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 2008, 9:286–298.

52. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011, 28 :2731–2739.

53. Akaike H: Information theory and an extension of the maximum likelihood principle . In Second International Symposium on Information Theory . Edited by Petrov BN, Csaki F. Budapest (Hungary): Akademiai Kiado; 1973:267–281.

54. Posada D: jModelTest: phylogenetic model averaging. Mol Biol Evol 2008, 25 :1253. 55. Huelsenbeck JP, Ronquist F: MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17 :754–755.

56. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19 :1572–1574.

57. Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006, 22 :2688.

58. Felsenstein J: Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985, 39 :783–791.

59. Stephens M, Scheet P: Accounting for Decay of Linkage Disequilibrium in Haplotype Inference and Missing-Data Imputation. Am J Hum Genet 2005, 76 :449–462.

60. Stephens M, Smith NJ, Donnelly P: A New Statistical Method for Haplotype Reconstruction from Population Data. Am J Hum Genet 2001, 68 :978–989.

61. Flot JF: Seqphase: a web tool for interconverting phase input/output files and fasta sequence alignments. Mol Ecol Resour 2010, 10 :162–166.

62. Clement M, Posada D, Crandall KA: TCS: a computer program to estimate gene genealogies. Mol Ecol 2000, 9:1657–1659.

63. Shimodaira H: An approximately unbiased test of phylogenetic tree selection. Syst Biol 2002, 51 :492.

64. Shimodaira H, Hasegawa M: Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol Biol Evol 1999, 16 :1114–1116.

65. Shimodaira H, Hasegawa M: CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics 2001, 17 :1246.

66. Suchard MA, Weiss RE, Sinsheimer JS: Models for Estimating Bayes Factors with Applications to Phylogeny and Tests of Monophyly. Biometrics 2005, 61 :665–673.

67. Drummond AJ, Rambaut A: BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 2007, 7:214.

68. Rambaut A, Drummond AJ: Tracer v1. 4 , :; 2007 [http://beast.bio.ed.ac.uk/Tracer].

69. Ho SYW, Phillips MJ, Cooper A, Drummond AJ: Time dependency of molecular rate estimates and systematic overestimation of recent divergence times. Mol Biol Evol 2005, 22 :1561–1568.

70. Gamble T, Bauer AM, Greenbaum E, Jackman TR: Evidence for Gondwanan vicariance in an ancient clade of gecko lizards. J Biogeogr 2008, 35 :88–104.

71. Vasconcelos R, Carranza S, Harris DJ: Insight into an island radiation: the Tarentola geckos of the Cape Verde archipelago. J Biogeogr 2010, 37 :1047–1060. 72. Agustí J, Cabrera L, Garcés M, Krijgsman W, Oms O, Parés JM: A calibrated mammal scale for the Neogene of Western Europe. State of the art. Earth-Science Reviews 2001, 52 :247–260.

73. Müller J: A new fossil species of Euleptes from the early Miocene of Montaigu, France (Reptilia, Gekkonidae). Amphibia-Reptilia 2001, 22 :341–348.

74. Abdrakhmatov KY, Aldazhanov SA, Hager BH, Hamburger MW, Herring TA, Kalabaev KB, Makarov VI, Molnar P, Panasyuk SV, Prilepin MT, et al : Relatively recent construction of the Tien Shan inferred from GPS measurements of present-day crustal deformation rates. Nature 1996, 384 :450–453.

75. Macey JR, Wang Y, Ananjeva NB, Larson A, Papenfuss TJ: Vicariant Patterns of Fragmentation among Gekkonid Lizards of the Genus Teratoscincus Produced by the Indian Collision: A Molecular Phylogenetic Perspective and an Area Cladogram for Central Asia. Mol Phylogenet Evol 1999, 12 :320–332.

76. Tapponnier P, Mattauer M, Proust F, Cassaigneau C: Mesozoic ophiolites, sutures, and large-scale tectonic movements in Afghanistan. Earth Planet Sci Lett 1981, 52 :355–371.

77. Guillou H, Carracedo JC, Torrado FP, Badiola ER: K-Ar ages and magnetic stratigraphy of a hotspot-induced, fast grown oceanic island: El Hierro, Canary Islands. J Volcanol Geotherm Res 1996, 73 :141–155.

78. Arnold EN, Arribas O, Carranza S: Systematics of the Palaearctic and Oriental lizard tribe Lacertini (Squamata: Lacertidae: Lacertinae), with descriptions of eight new genera. Zootaxa 2007, 1430 :1–86.

79. Brown RP, Yang Z: Bayesian dating of shallow phylogenies with a relaxed clock. Syst Biol 2010, 59 :119.

80. Cox SC, Carranza S, Brown RP: Divergence times and colonization of the Canary Islands by Gallotia lizards. Mol Phylogenet Evol 2010, 56 :747–757.

81. Maddison DR, Maddison WP: MacClade 4.0 . Sunderland, Massachusetts: Sinauer; 2000.

82. Maddison WP, Maddison DR: Mesquite: A Modular System For Evolutionary Analysis. Version 2.73 .: ; http://mesquiteproject.org.

83. Leviton AE, Anderson SC: Survey of the reptiles of the Sheikhdom of Abu Dhabi, Arabian Peninsula. Part II. Systematic account of the collection of reptiles made in the Sheikhdom of Abu Dhabi by John Gasperetti. Proc Calif Acad Sci 1967, 35 :157–192.

84. Haas G: Two collections of Reptiles from Iraq, with descriptions of two new forms. Copeia 1952, 1952 :20–22.

85. Murray JA: Additions to the present knowledge of the vertebrate Zoology of Persia. The Annals and Magazine of Natural History 1884, 14 :97–106. 86. Werner F: Allerlei aus dem Kriechtierleben im Käfig. II. Zoologischer Garten, Frankfurt am Main 1899, 40 :12–24.

87. Guichenot AA: Histoire Naturelle Des Reptiles Et Des Poissons . Paris: Imprimerie nationale; 1850.

88. Gardner RAM: Aeolianites and marine deposits of the Wahiba Sands: character and palaeoenvironments. The Journal of Oman Studies 1988, 3:1985–1987.

89. Preusser F, Radies D, Driehorst F, Matter A: Late Quaternary history of the coastal Wahiba Sands, Sultanate of Oman. J Quat Sci 2005, 20 :395–405.

90. Preusser F, Radies D, Matter A: A 160,000-Year Record of Dune Development and Atmospheric Circulation in Southern Arabia. Science 2002, 296 :2018–2020.

91. Gallagher MD, Arnold EN: Reptiles and amphibians from the Wahiba Sands, Oman. J Oman Stud, Spec Rep 1988, 3:405–413.

92. Blanford WT: Descriptions of new lizards from Persia and Baluchistan. Ann Mag Nat Hist 1874, 13 :453–455.

93. Garzanti E, Andò S, Vezzoli G, Dell'era D: From rifted margins to foreland basins: investigating provenance and sediment dispersal across desert Arabia (Oman, U.A.E.). J Sediment Res 2003, 73 :572–588.

94. Knowles LL, Carstens BC: Delimiting species without monophyletic gene trees. Syst Biol 2007, 56 :887–895.

95. : Reptilien, Batrachier und Fische von Tripolis und Barka. Zoologische Jahrbucher Abteilung fur Systematik, Geographie und Biologie der Tiere 1909, 27 :595–646.

96. Kratochvil L, Frynta D, Moravec J: Third Stenodactylus in Africa: return of the forgotten form Stenodactylus stenurus . Israel Journal of Zoology 2001, 47 :99–110.

97. Barbour T: Notes on some reptiles from Sinai and Syria. Proceedings of the New England Zoological Club 1914, 5:73–92.

98. Baha El Din S: A Guide to the Reptiles and Amphibians of Egypt . Cairo and New York: The American University in Cairo Press, xvi; 2006.

99. Loveridge A: Revision of the African lizards of the family Gekkonidae. Bulletin of the Mus Comp Zool, Harvard 1947, 98 :1–469.

100. Loveridge A: Checklist of the reptiles and amphibians of East Africa. Bulletin of The Museum of Comparative Zoology 1957, 117 :151–362.

101. Menzies MA, Baker J, Bosence D, Dart C, Davison I, Hurford A, Al'Kadasi M, McClay K, Nichols G, Al'Subbary A, Yelland A: The timing of magmatism, uplift and crustal extension: preliminary observations from Yemen. Geological Society, London, Special Publications 1992, 68 :293–304. 102. Autin J, Leroy S, Beslier MO, DíAcremont E, Razin P, Ribodetti A, Bellahsen N, Robin C, Al Toubi K: Continental break up history of a deep magma poor margin based on seismic reflection data (northeastern Gulf of Aden margin, offshore Oman). Geophys J Int 2010, 180 :501–519.

103. Arnold EN, Robinson MD, Carranza S: A preliminary analysis of phylogenetic relationships and biogeography of the dangerously venomous Carpet Vipers, Echis (Squamata, Serpentes, Viperidae) based on mitochondrial DNA sequences. Amphibia- Reptilia 2009, 30 :273–282.

104. Joger U: Phylogenetic analysis of Uromastyx lizards, based on albumin immunological distances . In Studies in Herpetology . Edited by Rocek Z. Bonn, Germany: Societas Europaea Herpetologica; 1986:187–192.

105. Girdler RW: The Afro-Arabian rift system - an overview. Tectonophysics 1991, 197 :139–153.

106. Huang Y, Clemens SC, Liu W, Wang Y, Prell WL: Large-scale hydrological change drove the late Miocene C4 plant expansion in the Himalayan foreland and Arabian Peninsula. Geology 2007, 35 :531–534.

107. Friend PF: Rivers of the Lower Baynunah Formation, Emirate of Abu Dhabi, United Arab Emirates . In Fossil Vertebrates Of Arabia, With Emphasis On The Late Miocene Faunas, Geology, And Palaeoenvironments Of The Emirate Of Abu Dhabi, United Arab Emirates . New Haven, Connecticut: Yale University Press; 1999:38–49.

108. Zachos J, Pagani M, Sloan L, Thomas E, Billups K: Trends, Rhythms, and Aberrations in Global Climate 65 Ma to Present. Science 2001, 292 :686–693.

109. Paulo OS, Dias C, Bruford MW, Jordan WC, Nichols RA: The persistence of Pliocene populations through the Pleistocene climatic cycles: evidence from the phylogeography of an Iberian lizard. Proc R Soc London, Ser B 2001, 268 :1625–1630.

110. Tzedakis PC, Lawson IT, Frogley MR, Hewitt GM, Preece RC: Buffered tree population changes in a quaternary refugium: evolutionary implications. Science 2002, 297 :2044–2047.

111. Bons J, Geniez P: Amphibians And Reptiles Of Morocco . Barcelona: Asociación herpetológica Española; 1996.

112. Schleich HH, Kästle W, Kabisch K: Amphibians And Reptiles Of North Africa: Biology, Systematics, Field Guide . Königstein, Germany: Koeltz Scientific Books; 1996.

113. Miller MA, Pfeiffer W, Schwartz T: Creating The CIPRES Science Gateway For Inference Of Large Phylogenetic Trees , IEEE; 2010:1–8. Additional files

Additional_file_1 as PDF Additional file 1 Figure S1. BI tree of the genus Stenodactylus inferred using 12S and 16S mtDNA gene fragments. Description of data: Posterior probability values above 0.95 in the Bayesian Inference analysis are indicated next to the nodes with an asterisk, while numbers correspond to bootstrap support of the Maximum Likelihood analysis (only values above 70 are shown). The tree was rooted using Hemidactylus frenatus . Numbers in square brackets next to specimen code refer to Figure 1. Information on the samples included is shown in Table 1.

Additional_file_2 as PDF Additional file 2 Figure S2. Chronogram obtained with BEAST inferred using all markers and 3 calibration points. Description of data: Chronogram obtained with relaxed uncorrelated lognormal clock and Yule model of speciation. Filled numbered circles correspond to calibration points described in Materials and Methods. The x axis is in million years and the bars indicate 95 % HPD intervals. Information on the samples included is shown in Table 1. 50°N

40°N

30°N

20°N

10°N

S. pulcher S. affinis S. arabicus (& cf. arabicus) S. petrii S. leptocosymbotes S. stenurus S. doriae S. yemenensis S. slevini S. grandiceps 0°

Figure20°W 1 10°W 0° 10°E 20°E 30°E 40°E 50°E 60°E 84 Agamura persica 99 Bunopus tuberculatus Crossobamon orientalis 100 Tropiocolotes algericus - 1 - W. Sahara 100 Tropiocolotes algericus - 2 - W. Sahara 100 Tropiocolotes tripolitanus - 1 - W. Sahara Tropiocolotes tripolitanus - 2 - Egypt 100 Pseudoceramodactylus khobarensis - 3 - Oman Pseudoceramodactylus khobarensis - 2 - Kuwait 99 Pseudoceramodactylus khobarensis - 1 - Kuwait 97 Tropiocolotes nattereri - Jordan 90 Tropiocolotes scorteccii - Oman 100 Tropiocolotes steudneri - Egypt Tropiocolotes nubicus - Egypt S. pulcher - 1 - Yemen [47] 100 S. pulcher - 2 - Yemen [48] 100 99 S. cf. arabicus - 3 - Oman [6] 36.7 Ma S. cf. arabicus - 1 (25.8-48.5) Oman [5] 17.3 Ma 100 92 S. cf. arabicus - 2 (11.3-23.6) 100 S. arabicus - 7 A Kuwait [9] 6.4 Ma 100 S. arabicus - 8 (3.9-9.3) S. arabicus - 9 - U.A.E. [10] S. arabicus - 4 - Qatar [7] S. arabicus - 6 Oman [8] 71 S. arabicus - 5 100 S. leptocosymbotes - 2 - Oman [21] S. leptocosymbotes - 3 - Oman [22] 7.0 Ma S. leptocosymbotes - 4 - Oman [23] (4.2-10.1) S. leptocosymbotes - 1 - Oman [20] S. leptocosymbotes - 5 - U.A.E. [24] B1 78 73 S. doriae - 5 - Kuwait [14] 100 S. doriae - 15 - Yemen [136] 99 S. doriae - 6 - Israel [15] S. doriae - 4 - Jordan [13] 82 S. doriae - 14 - Yemen [136] S. doriae - 3 - U.A.E. [12] 29.5 Ma 100 100 S. doriae - 1 - Oman [11] (20.7-39.2) S. doriae - 2 - Oman [6] 11.0 Ma S. slevini - 1 - Jordan [49] (7.4-15.0) 98 B S. slevini - 2 Jordan [13] 100 S. slevini - 3 100 S. slevini - 4 - Kuwait [50] S. slevini - 6 - U.A.E. [52] 100 S. slevini - 5 - Qatar [51] S. grandiceps - 3 - Jordan [17] 100 S. grandiceps - 2 Jordan [16] B2 S. grandiceps - 1 S. grandiceps - 9 Jordan [19] S. grandiceps - 10 6.7 Ma 100 S. affinis - 2 - Iran [2] (4.1-9.3) S. affinis - 1 - Iran [1] S. affinis - 5 99 96 S. affinis - 4 Kuwait [4] 93 21.8 Ma S. affinis - 3 - Iran [3] (15.4-29.1) 100 S. petrii - 1 - Egypt [35] S. petrii - 2 - Egypt [36] S. petrii - 3 - Israel [37] 100 S. stenurus - Tunisia [137] 6.1 Ma 100 S. petrii - 33 - Tunisia [53] 83 (3.9-8.6) S. petrii - 34 Tunisia [54] 74 S. petrii - 35 64 S. petrii - 5 - Morocco [39] 91 S. petrii - 4 - Mauritania [38] C1 S. petrii - 6 - Algeria [40] 79 98 S. petrii - 8 - Mauritania [42] S. petrii - 7 - Algeria [41] 100 S. petrii - 9 - W. Sahara [43] 91 S. petrii - 10 - Mauritania [44] S. petrii - 12 W. Sahara [46] 19.3 Ma 96 S. petrii - 13 (13.1-25.5) S. petrii - 11 - W. Sahara [45] 100 S. yemenensis - 7 - Yemen [139] 96 S. yemenensis - 3 - Yemen [138] C2 S. yemenensis - 1 - Yemen [71] 100 S. yemenensis - 2 - Yemen [72] 72 S. mauritanicus - 5 - Libya [29] 6.6 Ma S. mauritanicus - 1 - Egypt [25] (4.0-9.5) 100 S. mauritanicus - 2 - Tunisia [26] 95 S. mauritanicus - 3 - Tunisia [27] 99 87 S. mauritanicus - 4 - Tunisia [28] C 15.4 Ma S. mauritanicus - 30 - Morocco [92] (10.5-20.8) 75 100 S. mauritanicus - 6 - Morocco [30] S. mauritanicus - 11 - Morocco [34] S. mauritanicus - 9 - W. Sahara [32] 76 S. mauritanicus - 10 - W. Sahara [33] 96 S. mauritanicus - 7 W. Sahara [31] 93 S. mauritanicus - 8 10.0 Ma S. sthenodactylus - 1 - Egypt [25] (6.6-13.7) 89 S. sthenodactylus - 8 - Israel [60] S. sthenodactylus - 9 - Jordan [61] C3 100 S. sthenodactylus - 2 - Egypt [55] 72 S. sthenodactylus - 3 - Egypt [56] 99 S. sthenodactylus - 7 - Israel [37] S. sth. zavattari - 1 - Kenya [62] 4.8 Ma S. sthenodactylus - 4 - Egypt [57] (2.8-6.9) S. sthenodactylus - 5 - Egypt [58] 81 S. sthenodactylus - 6 - Egypt [59] S. sthenodactylus - 12 - Algeria [64] 99 S. sthenodactylus - 11 - Libya [63] S. sthenodactylus - 13 - Mauritania [65] 96 S. sthenodactylus - 14 - Mauritania [66] S. sthenodactylus - 18 - Mauritania [70] S. sthenodactylus - 17 - W. Sahara [69] 91 S. sthenodactylus - 16 - W. Sahara [68] Figure 2 S. sthenodactylus - 15 - W. Sahara [67] 0.3 M129a M10b c-mos M9a M122a

M4a E1505316a M122b M165a,b M10a

M184a,b M126b M128b M187b M9b

M130a,b M4b M213a,b E1505316b M36a,b M206a,b M166a,b M126a M128a M19b M129b E1505 332a M2b M141a,b M180a,b M111b M182a,b M112b M178a,b

E1505331a M191a,b E1505332b M70b M73b M19a M14a,b M101b M172b M13a,b M199a,b M7a,b M92a,b M157a M203a,b M8a E1505331b M80a,b M204a,b M32a M78a M177a,b M6a M176a,b M136b M2a

M171a M70a M6b M157b M101a M8b M73a M187a M107b M78b M32b M105a,b M172a M193a,b M136a M111a M171b M112a M192a,b

M117a,b M25a,b M118a,b M161a,b M28a M22a M26a,b M107a M18a,b M211a M30a M30b M87a,b M185a,b M175a M210a,b M174a,b M173a M22b

S. pulcher S. affinis M28b S. arabicus (& cf. arabicus) S. petrii M211b E150 M175b E150538b S. leptocosymbotes S. stenurus 538a M173b M31a,b S. doriae S. yemenensis M169a,b S. slevini S. mauritanicus S. grandiceps S. sthenodactylus

M130a,b M122b M122a

M36a,b RAG-2 M10a,b M35b M34a M2a,b

M6a,b M35a M165b M34b M9a,b E150536a M129a,b M33a,b

M165a E1505316a E1505316b E1505332a,b M199a,b M4a,b E1505331a,b M88b M78a,b E1505326a,b M110b E150 M166a,b M180a,b 536b M178a,b M182a,b

E1505353b M111b M112b M115b M88a M110a M213a,b M206a,b M28b M126a,b M211b M176b M128a,b M187a,b E1505339 M19a,b a,b M20a,b E1505334a,b E150 M157a,b M28a M80a,b 538b E1505353a M211a M177a,b M112a M30a,b M115a M111a M185a,b M176a M141a,b M191a,b M210a,b M70a M203b M14a,b E150538a M136a M204b M13a,b M193a,b M203a M23a M204a M22a,b M73a,b M25a,b M70b M123a,b M26a,b M161a M172a,b M18a M192a,b M18b

M23b M131a M161b M7a,b M171a M8a,b M117a,b M32a,b M87a,b M173a M175a,b M174a M171b M136b

M131b M101a,b

M173b M174b

Figure 3 S. pulcher 0.95 0.05 S. cf. arabicus

S. arabicus

S. leptocosymbotes

0.75 S. doriae 0.25 1.00 0.00 S. slevini

S. grandiceps

S. affinis 0.64 0.36 S. petrii (E) 0.00 1.00 S. stenurus

S. petrii (W) 0.48 0.52 S. yemenensis

0.43 S. mauritanicus (E) 0.57 Arabia S. mauritanicus (W) Africa 0.03 0.97 S. sthenodactylus (E)

Figure 4 S. sthenodactylus (W) Additional files provided with this submission:

Additional file 1: 1988310945809427_add1.pdf, 2419K http://www.biomedcentral.com/imedia/8272212288273331/supp1.pdf Additional file 2: 1988310945809427_add2.pdf, 514K http://www.biomedcentral.com/imedia/4466056428827333/supp2.pdf