DOCSLIB.ORG

Knockdown of Microtubule Associated Serine/Threonine Kinase Like

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Knockdown of Microtubule Associated Serine/Threonine Kinase Like Current Medical Science 41(1):108-117,2021 108 DOI https://doi.org/10.1007/s11596-021-2325-2Current Medical Science 41(1):2021 Knockdown of Microtubule Associated Serine/threonine Kinase Like Expression Inhibits Gastric Cancer Cell Growth and Induces Apoptosis by Activation of ERK1/2 and Inactivation of NF-κB Signaling* Cai-xia AN1†, Shou-pin XIE2†, Hai-long LI3, Yong-hua HU3, Rong NIU4, Lin-jie ZHANG5, Yan JIANG5, Qiang LI6, Yong-ning Zhou1# 1Division of Gastroenterology and Hepatology, The First Hospital of Lanzhou University, Lanzhou 730000, China 2Department of Neurology, The First People’s Hospital of Lanzhou City, Lanzhou 730050, China 3Department of Internal Mddicine, The First School of Clinical Medicine, Gansu University of Chinese Medicine, Lanzhou 730000, China 4Department of External Chest, Gansu Provincial Cancer Hospital, Lanzhou 730030, China 5Division of Pediatric Emergency, Gansu Provincial Maternal and Child Health Hospital, Lanzhou 730050, China 6Division of Neurosurgery, The Second Hospital of Lanzhou University, Lanzhou 730000, China The Author(s) 2021 Summary: Microtubule-associated serine/threonine kinase (MASTL) functions to regulate chromosome condensation and mitotic progression. Therefore, aberrant MASTL expression is commonly implicated in various human cancers. This study analyzed MASTL expression in gastric cancer vs. adjacent normal tissue for elucidating the association with clinicopathological data from patients. This work was then extended to investigate the effects of MASTL knockdown on tumor cells in vitro. The level of MASTL expression in gastric cancer tissue was assessed from the UALCAN, GEPIA, and Oncomine online databases. Lentivirus carrying MASTL or negative control shRNA was infected into gastric cancer cells. RT-qPCR, Western blotting, cell viability, cell counting, flow cytometric apoptosis and cell cycle, and colony formation assays were performed. MASTL was upregulated in gastric cancer tissue compared to the adjacent normal tissue, and the MASTL expression was associated with advanced tumor stage, Helicobacter pylori infection and histological subtypes. On the other hand, knockdown of MASTL expression significantly reduced tumor cell viability and proliferation, and arrested cell cycle at G2/M stage but promoted tumor cells to undergo apoptosis. At protein level, knockdown of MASTL expression enhanced levels of cleaved PARP1, cleaved caspase-3, Bax and p-ERK1/2 expression, but downregulated expression levels of BCL-2 and p-NF-κB-p65 protein in AGS and MGC-803 cells. MASTL overexpression in gastric cancer tissue may be associated with gastric cancer development and progression, whereas knockdown of MASTL expression reduces tumor cell proliferation and induces apoptosis. Further study will evaluate MASTL as a potential target of gastric cancer therapeutic strategy. Key words: gastric cancer; microtubule-associated serine/threonine kinase; gene expression; shRNA Gastric cancer has been proved and regarded as a Cai-xia AN, E-mail: [email protected]; Shou-pin XIE, prevalent disease with a very poor prognosis globally, E-mail: [email protected] † and most patients suffered from gastric cancer died These authors contributed equally to this work. [1] Cai-xia AN’s present address: Gansu Provincial Maternity because of late diagnosis . Epidemiology data showed and Child-care Hospital that gastric cancer is the fifth most common cancer #Corresponding author, E-mail: [email protected] and the third most common cancer-related death *This study was supported in part by grants from Lanzhou worldwide[2]. In China, gastric cancer has also shown Science and Technology Planning Project (No. 2016-3-113), increases in incidence and eventual mortality as a University Research Project of Gansu Province (No. 2018A- commonly diagnosed malignancy[3]. Gastric cancer risk 049), the Foundation of the Fundamental Scientific Research factors include infection with Helicobacter pylori (H. Funds for Colleges and Universities in Gansu Province [No. pylori), which accounts for more than 60% of all gastric (2014)63-15], the China’s National Science and Technology cancer cases[4, 5], tobacco smoking, dietary factors such Program for Public Wellbeing (No. 2012GS620101), and [6] National Key Research and Development Planning (No. as eating pickled vegetables, and obesity . Despite 2017YFC0908302). recent advancements in the treatment and prevention of Current Medical Science 41(1):2021 109 gastric cancer, the overall survival rate of gastric cancer 803 were originally obtained from the Type Culture patients remains low, which could be due to delayed Collection of Cancer Institute and Hospital, Chinese diagnosis. For example, most gastric cancer patients Academy of Medical Sciences (CAMS; China). Cells have local and distant metastases at diagnosis[7, 8], were grown in Dulbecco’s modified Eagle’s medium which, if diagnosed early, may allow more than 90% (DMEM) and supplemented with 10% heat-inactivated of patients to survive for at least five years post- fetal bovine serum (FBA; Zhejiang Tianhang detection or to be completely cured[6]. Thus, finding Biotechnology Co. Ltd., China), 100 IU/mL penicillin novel biomarkers for early detection and prediction and 100 μg/mL streptomycin in a humidified incubator of treatment responses, as well as prognosis and with 5% CO2 at 37°C. When the cells reached the identification of novel targets for effective control of exponential growth stage, they were used for our gastric cancer, could help medical oncologists reduce experiments. the gastric cancer burden clinically. 1.3 Lentivirus and Cell Infection To this end, microtubule-associated serine/ Lentivirus carrying MASTL shRNA (shMASTL) threonine kinase-like enzyme (MASTL, also known and negative control shRNA (shCtrl) were purchased as Greatwall, or Gwl) is a serine/threonine kinase from GeneChem Co., Ltd. (China). The shMASTL that is active during mitotic division, and it regulates sequences were 5′-CCGGTTCTCCGAACGTGTCA chromosome condensation and mitotic progression CGTTTCAAGAGAACGTGACACGTTCGGAGA through the phosphorylation of cyclinB-Cdk1[9]. ATTTTTG-3′, whereas the LvshMASTL sequences Previous studies have demonstrated that aberrant were 5′-CCGGGTCAGCCCTTAGATTCAGATACT MASTL expression occurs in various human cancers, CGAGTATCTGAATCTAAGGGCTGACTTTTT-3′. including breast[2, 10], gastric[11], and colorectal cancer[12], For cell infection, AGS cells were seeded into six- and that MSATL overexpression is associated with well plates at a density of 5×104 cells/well, grown poor survival[6], resistance to chemotherapy[2, 12] and overnight to reach 60%–70% confluence, infected with tumor recurrence[6]. In contrast, knockdown of MASTL one of the aforementioned lentiviruses at a multiplicity expression using RNAi induced tumor cell cycle of infection (MOI) of 10 and observed under a arrests and inhibited tumor cell invasion and metastasis fluorescence microscope (IX7, Olympus, Japan) 48 h in colon cancer[12]. However, to date, there is still no after infection for levels of green fluorescent protein in vitro study of MASTL shRNA in gastric cancer and (GFP). Cells with a transfection efficiency >80% were therefore, in this study, we further analyzed MASTL used for subsequent experiments. expression in gastric cancer vs. adjacent normal tissue, 1.4 qRT-PCR to elucidate the association between MASTL expression Total cellular RNA was isolated from gastric and clinicopathological data from patients using online cells using the RNAiso Plus reagent (Takara, China) database data. We then assessed the effects of MASTL and reversely transcribed into cDNA using a Prime knockdown on regulation of gastric cancer cell ScriptTM RT Reagent Kit (Takara) according to viability, proliferation, apoptosis, and gene expression the manufacturer’s instructions. The qPCR was in vitro. We provide novel insights regarding MASTL performed in the Light Cycle 9600 Real-Time PCR in the development and progression of gastric cancer, Detection System (Roche, USA) using a SYBR and whether the targeting of MASTL expression using Master Mixture (Yeasen, China) in a final volume of MASTL shRNA is useful as a potential therapeutic or 20 μL containing 1 μL of cDNA and 0.5 mmol/L of detection strategy of MASTL expression as a novel each primer, 10 µL of 1 x SYBR Master Mixture, and potential biomarker for gastric cancer patients. 8 µL of ddH2O. The primer sequences for MASTL were 5′-AAGGACTCGTATGCCCTATGT-3′ and 1 MATERIALS AND METHODS 5′-CCAATGCTTCATCACTTTCC-3′, and for GAPDH were 5′-TGACTTCAACAGCGACACCCA-3′ and 1.1 Database Search and Data Extraction and Analysis 5′-CACCCTGTTGCTGTAGCCAAA-3′. The qPCR In this study, we first searched the UALCAN[13] conditions were set to initial denaturation at 95°C for and GEPIA[14] web servers for the TCGA database, the 15 s, and then 40 cycles of 95°C for 5 s and 60°C for GTEx projects, and Oncomine database (https://www. 30 s. At the end of these cycles, the melting curve was oncomine.org/resource/login.html). We then extracted generated to validate the specificity of the expected data on MASTL in gastric cancer and analyzed PCR product. The level of MASTL mRNA was these data for tumor vs. adjacent tissue, and the normalized to GAPDH mRNA using the 2-ΔΔCt method. clinicopathological features of MASTL overexpression The experiment was run in triplicates and repeated at in gastric cancer tissues, such as tumor grade, H. pylori least once. infection, histology, etc. 1.5 Cell Viability MTT Assay 1.2 Cell Lines and Culture The altered
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Role of MASTL in Mammals: Molecular Functions and Physiological Relevance
    Departamento de Biología Molecular Facultad de Ciencias Universidad Autónoma de Madrid Role of MASTL in mammals: Molecular functions and physiological relevance Belén Sanz Castillo Degree in Biotechnology Thesis Directors: Dr. Marcos Malumbres Dra. Mónica Álvarez Fernández Centro Nacional de Investigaciones Oncológicas (CNIO) Madrid, 2017 Marcos Malumbres Martínez, Jefe del Grupo de División Celular y Cáncer del Centro Nacional de Investigaciones Oncológicas (CNIO) y, Mónica Álvarez Fernández, Investigadora del Grupo de División Celular y Cáncer del CNIO. Certifican: que Belén Sanz Castillo ha realizado bajo su dirección el trabajo de Tesis Doctoral titulado: ”Role of MASTL in mammals: Molecular functions and physiological relevance” en el Centro Nacional de Investigaciones Oncológicas y tutelada en el departamento de Biología Molecular de la Universidad Autónoma de Madrid. Revisado el presente trabajo, considera que reúne todas las condiciones requeridas por la legislación vigente y la originalidad y calidad científica para su presentación y defensa con el fin de optar al grado de Doctor. Y para que conste donde proceda, firmamos el presente certificado. Dr. Marcos Malumbres Martínez Dra. Mónica Álvarez Fernández 3 A mi familia “Tu llegada allí es tu destino. Mas no apresures nunca el viaje. Mejor que dure muchos años y atracar, viejo ya, en la isla, enriquecido de cuanto ganaste en el camino” Constantino Cavafis 5 Acknowledgements Esta tesis hubiera sido completamente imposible sin la ayuda y apoyo de muchas personas. En primer lugar Marcos, muchas gracias por haberme acogido en tu laboratorio, aún recuerdo cuando llegué cargada de ilusión y ahora pienso que no podría haber escogido un sitio mejor. Gracias por tu entusiasmo, pasión y fuerza que nos transmites a cada uno de los que trabajamos contigo.
    [Show full text]
  • Kinase-Independent Functions of MASTL in Cancer: a New Perspective on MASTL Targeting
    cells Perspective Kinase-Independent Functions of MASTL in Cancer: A New Perspective on MASTL Targeting 1, 1, 1, James Ronald William Conway y , Elisa Närvä y, Maria Emilia Taskinen y and Johanna Ivaska 1,2,* 1 Turku Bioscience Centre, University of Turku and Åbo Akademi University, 20520 Turku, Finland; james.conway@utu.fi (J.R.W.C.); elisa.narva@utu.fi (E.N.); maria.taskinen@utu.fi (M.E.T.) 2 Department of Biochemistry, University of Turku, 20520 Turku, Finland * Correspondence: Johanna.ivaska@utu.fi These authors contributed equally to this work. y Received: 1 June 2020; Accepted: 1 July 2020; Published: 6 July 2020 Abstract: Microtubule-associated serine/threonine kinase-like (MASTL; Greatwall) is a well-characterized kinase, whose catalytic role has been extensively studied in relation to cell-cycle acceleration. Importantly, MASTL has been implicated to play a substantial role in cancer progression and subsequent studies have shown that MASTL is a significant regulator of the cellular actomyosin cytoskeleton. Several kinases have non-catalytic properties, which are essential or even sufficient for their functions. Likewise, MASTL functions have been attributed both to kinase-dependent phosphorylation of downstream substrates, but also to kinase-independent regulation of the actomyosin contractile machinery. In this review, we aimed to highlight the catalytic and non-catalytic roles of MASTL in proliferation, migration, and invasion. Further, we discussed the implications of this dual role for therapeutic design. Keywords: MASTL; actin; contractility; cell cycle; cancer; therapeutic targeting; kinase inhibitor 1. Introduction The serine/threonine kinase MASTL (microtubule-associated serine/threonine kinase-like; Greatwall) was first described in Drosophila melanogaster for the role it played in supporting cell-cycle progression [1].
    [Show full text]
  • MASTL Promotes Cell Contractility and Motility Through Kinase-Independent Signaling
    ARTICLE MASTL promotes cell contractility and motility through kinase-independent signaling Maria Emilia Taskinen1*, Elisa Narv¨ a¨1*, James R.W. Conway1, Laura Soto Hinojosa2,SergioLilla3,AnjaMai1, Nicola De Franceschi1, Laura L. Elo1, Robert Grosse2,SaraZanivan3,4, Jim C. Norman3,4, and Johanna Ivaska1,5 Microtubule-associated serine/threonine-protein kinase-like (MASTL) is a mitosis-accelerating kinase with emerging roles in cancer progression. However, possible cell cycle–independent mechanisms behind its oncogenicity remain ambiguous. Here, we identify MASTL as an activator of cell contractility and MRTF-A/SRF (myocardin-related transcription factor A/serum Downloaded from https://rupress.org/jcb/article-pdf/219/6/e201906204/1042522/jcb_201906204.pdf by guest on 05 May 2020 response factor) signaling. Depletion of MASTL increased cell spreading while reducing contractile actin stress fibers in normal and breast cancer cells and strongly impairing breast cancer cell motility and invasion. Transcriptome and proteome profiling revealed MASTL-regulated genes implicated in cell movement and actomyosin contraction, including Rho guanine nucleotide exchange factor 2 (GEF-H1, ARHGEF2) and MRTF-A target genes tropomyosin 4.2 (TPM4), vinculin (VCL), and nonmuscle myosin IIB (NM-2B, MYH10). Mechanistically, MASTL associated with MRTF-A and increased its nuclear retention and transcriptional activity. Importantly, MASTL kinase activity was not required for regulation of cell spreading or MRTF-A/SRF transcriptional activity. Taken together, we
    [Show full text]
  • Comprehensive Assessment of Indian Variations in the Druggable Kinome Landscape Highlights Distinct Insights at the Sequence, Structure and Pharmacogenomic Stratum
    SUPPLEMENTARY MATERIAL Comprehensive assessment of Indian variations in the druggable kinome landscape highlights distinct insights at the sequence, structure and pharmacogenomic stratum Gayatri Panda1‡, Neha Mishra1‡, Disha Sharma2,3, Rahul C. Bhoyar3, Abhinav Jain2,3, Mohamed Imran2,3, Vigneshwar Senthilvel2,3, Mohit Kumar Divakar2,3, Anushree Mishra3, Priyanka Banerjee4, Sridhar Sivasubbu2,3, Vinod Scaria2,3, Arjun Ray1* 1 Department of Computational Biology, Indraprastha Institute of Information Technology, Okhla, India. 2 Academy of Scientific and Innovative Research (AcSIR), Ghaziabad, India. 3 CSIR-Institute of Genomics and Integrative Biology, Mathura Road, Delhi-110020, India. 4 Institute for Physiology, Charite-University of Medicine, Berlin, 10115 Berlin, Germany. ‡These authors contributed equally to this work. * [email protected] TABLE OF CONTENTS Name Title Supplemental_Figure_S1 Fauchere and Pliska hydrophobicity scale for variations in structure data Supplemental_Figure_S2 Phenotypic drug-drug correlogram Supplemental_Table_S1 545 kinase coding genes used in the study Supplemental_Table_S2 Classes and count of kinase coding genes Supplemental_Table_S3 Allele frequency Indian v/s other populations from 1000 genome data(1000g2015). Supplemental_Table_S4 IndiGen Structure Data- consisting of 12 genes and their 22 variants Supplemental_Table_S5 Genes, PDB ids, mutations in IndiGen data and associated drugs (FDA approved) Supplemental_Table_S6 Data used for docking and binding pocket similarity analysis Supplemental_Table_S7
    [Show full text]
  • Thrombocytopenia-Associated Mutations in Ser/Thr Kinase MASTL
    Thrombocytopenia-associated mutations in Ser/Thr kinase MASTL deregulate actin cytoskeleton dynamics in platelets by Begoña Hurtado et al. SUPPLEMENTARY MATERIAL List of Supplementary Figures Figure S1. Hematopoietic precursors and megakaryocytes maturation in Mastl mutant mice. Figure S2. Sialylation and apoptosis profile of Mastl mutant platelets. Figure S3. Mastl E166D activity results in increased phosphorylation levels. Figure S4. Phospho-proteomic analysis in Mastl mutant platelets after thrombin activation. Figure S5. Signaling pathways differentially phosphorylated in Mastl mutant platelets. Figure S6. Changes in the phosphorylation status of signaling molecules in Mastl-mutant platelets. Figure S7. Full scan of blots showed in the manuscript. List of Supplementary Tables Table S1. Full data from phospho-proteomic studies. 1 Table S2. KEGG pathways enriched (FDR>0.05) in hyperphosphorylated proteins in resting Mastl(ED/ED) platelets (log2FC ED/WT>0.75), considering as statistical background the mouse platelet proteome. Table S3. KEGG pathways enriched (FDR>0.05) in hypophosphorylated proteins in resting Mastl(/) platelets (log2FC/WT<0.75), considering as statistical background the mouse platelet proteome. Table S4. KEGG pathways enriched (FDR>0.01) in hyperphosphorylated proteins in Mastl(ED/ED) platelets 3 minutes after stimulation with thrombin (log2FC ED/WT>0.75). Table S5. KEGG pathways enriched (FDR>0.01) in hyperphosphorylated proteins in both resting and 3-min-activated Mastl(ED/ED) platelets (log2FC ED/WT>0.5), considering as statistical background the mouse platelet proteome. Table S6. KEGG pathways enriched (FDR>0.05) in hyperphosphorylated proteins in Mastl(ED/ED) platelets 15 minutes after stimulation with thrombin (log2FC ED/WT>1.0), considering as statistical background the mouse platelet proteome.
    [Show full text]
  • MASTL Overexpression Promotes Chromosome Instability and Metastasis in Breast Cancer
    Oncogene (2018) 37:4518–4533 https://doi.org/10.1038/s41388-018-0295-z ARTICLE MASTL overexpression promotes chromosome instability and metastasis in breast cancer 1,2 1 3 1,4 1 Samuel Rogers ● Rachael A. McCloy ● Benjamin L. Parker ● David Gallego-Ortega ● Andrew M. K. Law ● 1 1 4 5,6,7 8,9 1,10 Venessa T. Chin ● James R. W. Conway ● Dirk Fey ● Ewan K. A. Millar ● Sandra O’Toole ● Niantao Deng ● 1,10 11 2 1,10 1,10 Alexander Swarbrick ● Paul D. Chastain ● Anthony J. Cesare ● Paul Timpson ● C. Elizabeth Caldon ● 1,10,12 3,13 1,10,14 15 David R. Croucher ● David E. James ● D. Neil Watkins ● Andrew Burgess Received: 20 October 2017 / Revised: 27 February 2018 / Accepted: 8 April 2018 / Published online: 10 May 2018 © The Author(s) 2018. This article is published with open access Abstract MASTL kinase is essential for correct progression through mitosis, with loss of MASTL causing chromosome segregation errors, mitotic collapse and failure of cytokinesis. However, in cancer MASTL is most commonly amplified and overexpressed. This correlates with increased chromosome instability in breast cancer and poor patient survival in breast, ovarian and lung cancer. Global phosphoproteomic analysis of immortalised breast MCF10A cells engineered to 1234567890();,: 1234567890();,: overexpressed MASTL revealed disruption to desmosomes, actin cytoskeleton, PI3K/AKT/mTOR and p38 stress kinase signalling pathways. Notably, these pathways were also disrupted in patient samples that overexpress MASTL. In MCF10A cells, these alterations corresponded with a loss of contact inhibition and partial epithelial–mesenchymal transition, which disrupted migration and allowed cells to proliferate uncontrollably in 3D culture.
    [Show full text]
  • Human Kinases Info Page
    Human Kinase Open Reading Frame Collecon Description: The Center for Cancer Systems Biology (Dana Farber Cancer Institute)- Broad Institute of Harvard and MIT Human Kinase ORF collection from Addgene consists of 559 distinct human kinases and kinase-related protein ORFs in pDONR-223 Gateway® Entry vectors. All clones are clonal isolates and have been end-read sequenced to confirm identity. Kinase ORFs were assembled from a number of sources; 56% were isolated as single cloned isolates from the ORFeome 5.1 collection (horfdb.dfci.harvard.edu); 31% were cloned from normal human tissue RNA (Ambion) by reverse transcription and subsequent PCR amplification adding Gateway® sequences; 11% were cloned into Entry vectors from templates provided by the Harvard Institute of Proteomics (HIP); 2% additional kinases were cloned into Entry vectors from templates obtained from collaborating laboratories. All ORFs are open (stop codons removed) except for 5 (MST1R, PTK7, JAK3, AXL, TIE1) which are closed (have stop codons). Detailed information can be found at: www.addgene.org/human_kinases Handling and Storage: Store glycerol stocks at -80oC and minimize freeze-thaw cycles. To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip, puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate. To patch the hole, use sterile tape or a portion of a fresh aluminum seal. Note: These plasmid constructs are being distributed to non-profit institutions for the purpose of basic
    [Show full text]
  • MASTL Datasheet
    Catalog # Aliquot Size M72-10G-05 5 µg M72-10G-10 10 µg MASTL, Active Full-length recombinant human protein expressed in Sf9 cells Catalog # M72-10G Lot # Q2393-5 Product Description Specific Activity Full-length recombinant human MASTL was expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. 120,000 The gene accession number for MASTL is NM_001172303. 90,000 Gene Aliases 60,000 GREATWALL; GW; GWL; hGWL; RP11-85G18.2; THC2 30,000 (cpm) Activity Formulation 0 0 50 100 150 200 Recombinant protein stored in 50mM Tris-HCl, pH 7.5, Protein (ng) 150mM NaCl, 10mM glutathione, 0.1mM EDTA, 0.25mM DTT, 0.1mM PMSF, 25% glycerol. The specific activity of MASTL was determined to be 18 nmol /min/mg as per activity assay protocol. Storage and Stability Store product at –70oC. For optimal storage, aliquot target Purity into smaller quantities after centrifugation and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles. The purity of MASTL protein was determined to be ~70% by Scientific Background densitometry, MASTL approx. MW 150kDa. Microtubule associated serine/threonine kinase-like (MASTL) belongs to the MAST family, AGC Ser/Thr protein kinase group. MASTL promotes mitotic progression and cell cycle reentry after DNA damage. Loss of MASTL leads to defects in chromosome condensation, separation, and other aspects of mitotic progression, which is primarily mediated by inhibiting PP2A/B55δ. Overexpression of MASTL, Active MASTL is correlated with cancer progression, poor patient Full-length recombinant human protein expressed in Sf9 cells survival, and tumor recurrence in various cancers.
    [Show full text]
  • 39UTR Shortening Identifies High-Risk Cancers with Targeted Dysregulation
    OPEN 39UTR shortening identifies high-risk SUBJECT AREAS: cancers with targeted dysregulation of GENE REGULATORY NETWORKS the ceRNA network REGULATORY NETWORKS Li Li1*, Duolin Wang2*, Mengzhu Xue1*, Xianqiang Mi1, Yanchun Liang2 & Peng Wang1,3 Received 1 2 15 April 2014 Key Laboratory of Systems Biology, Shanghai Advanced Research Institute, Chinese Academy of Sciences, College of Computer Science and Technology, Jilin University, 3School of Life Science and Technology, ShanghaiTech University. Accepted 3 June 2014 Competing endogenous RNA (ceRNA) interactions form a multilayered network that regulates gene Published expression in various biological pathways. Recent studies have demonstrated novel roles of ceRNA 23 June 2014 interactions in tumorigenesis, but the dynamics of the ceRNA network in cancer remain unexplored. Here, we examine ceRNA network dynamics in prostate cancer from the perspective of alternative cleavage and polyadenylation (APA) and reveal the principles of such changes. Analysis of exon array data revealed that both shortened and lengthened 39UTRs are abundant. Consensus clustering with APA data stratified Correspondence and cancers into groups with differing risks of biochemical relapse and revealed that a ceRNA subnetwork requests for materials enriched with cancer genes was specifically dysregulated in high-risk cancers. The novel connection between should be addressed to 39UTR shortening and ceRNA network dysregulation was supported by the unusually high number of P.W. (wangpeng@ microRNA response elements (MREs) shared by the dysregulated ceRNA interactions and the significantly sari.ac.cn) altered 39UTRs. The dysregulation followed a fundamental principle in that ceRNA interactions connecting genes that show opposite trends in expression change are preferentially dysregulated. This targeted dysregulation is responsible for the majority of the observed expression changes in genes with significant * These authors ceRNA dysregulation and represents a novel mechanism underlying aberrant oncogenic expression.
    [Show full text]
  • WEE1 Kinase Targeting Combined with DNA-Damaging Cancer Therapy Catalyzes Mitotic Catastrophe
    Published OnlineFirst May 11, 2011; DOI: 10.1158/1078-0432.CCR-10-2537 Clinical Cancer Molecular Pathways Research WEE1 Kinase Targeting Combined with DNA-Damaging Cancer Therapy Catalyzes Mitotic Catastrophe Philip C. De Witt Hamer1,3, Shahryar E. Mir2,3, David Noske1,3, Cornelis J.F. Van Noorden4, and Tom Wurdinger€ 1,3,5 Abstract WEE1 kinase is a key molecule in maintaining G2–cell-cycle checkpoint arrest for premitotic DNA repair. Whereas normal cells repair damaged DNA during G1-arrest, cancer cells often have a deficient G1-arrest and largely depend on G2-arrest. The molecular switch for the G2–M transition is held by WEE1 and is pushed forward by CDC25. WEE1 is overexpressed in various cancer types, including glioblastoma and breast cancer. Preclinical studies with cancer cell lines and animal models showed decreased cancer cell viability, reduced tumor burden, and improved survival after WEE1 inhibition by siRNA or small molecule inhibitors, which is enhanced by combination with conventional DNA- damaging therapy, such as radiotherapy and/or cytostatics. Mitotic catastrophe results from premature entry into mitosis with unrepaired lethal DNA damage. As such, cancer cells become sensitized to conventional therapy by WEE1 inhibition, in particular those with insufficient G1-arrest due to deficient p53 signaling, like glioblastoma cells. One WEE1 inhibitor has now reached clinical phase I studies. Dose-limiting toxicity consisted of hematologic events, nausea and/or vomiting, and fatigue. The combination of DNA-damaging cancer therapy with WEE1 inhibition seems to be a rational approach to push cancer cells in mitotic catastrophe. Its safety and efficacy are being evaluated in clinical studies.
    [Show full text]