Inhibition of Haspin Kinase Promotes Cell-Intrinsic and Extrinsic Antitumor Activity Johannes C
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Characterization of Protein Kinase C Alpha Deficiency in a Mouse Model
Aus der Medizinischen Klinik mit Schwerpunkt Infektiologie und Pneumologie der Charité – Universitätsmedizin Berlin Eingereicht über das Institut für Veterinär-Physiologie des Fachbereichs Veterinärmedizin der Freien Universität Berlin Characterization of Protein Kinase C Alpha Deficiency in a Mouse Model Inaugural-Dissertation zur Erlangung des Doctor of Philosophy (Ph.D.) an der Freien Universität Berlin vorgelegt von Elena Ariane Noe Tierärztin aus Düsseldorf Berlin 2016 Journal-Nr.: 3878 Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Prof. Dr. Dr. Petra Reinhold Zweiter Gutachter: Univ.-Prof. Dr. Martin Witzenrath Dritter Gutachter: Univ.-Prof. Dr. Christa Thöne-Reineke Deskriptoren (nach CAB-Thesaurus): Mice; animal models; protein kinase C (MeSH); pulmonary artery; hypertension; blood pressure, vasoconstriction; esophageal sphincter, lower (MeSH); respiratory system; smooth muscle; esophageal achalasia (MeSH) Tag der Promotion: 14.07.2016 Contents Contents ................................................................................................................................... V List of Abbreviations ............................................................................................................... VII 1 Introduction ................................................................................................................. 1 1.1 Protein Kinase C (PKC) and its Role in Smooth Muscle Contraction ........................ -
Aurora Kinase a in Gastrointestinal Cancers: Time to Target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4*
Katsha et al. Molecular Cancer (2015) 14:106 DOI 10.1186/s12943-015-0375-4 REVIEW Open Access Aurora kinase A in gastrointestinal cancers: time to target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4* Abstract Gastrointestinal (GI) cancers are a major cause of cancer-related deaths. During the last two decades, several studies have shown amplification and overexpression of Aurora kinase A (AURKA) in several GI malignancies. These studies demonstrated that AURKA not only plays a role in regulating cell cycle and mitosis, but also regulates a number of key oncogenic signaling pathways. Although AURKA inhibitors have moved to phase III clinical trials in lymphomas, there has been slower progress in GI cancers and solid tumors. Ongoing clinical trials testing AURKA inhibitors as a single agent or in combination with conventional chemotherapies are expected to provide important clinical information for targeting AURKA in GI cancers. It is, therefore, imperative to consider investigations of molecular determinants of response and resistance to this class of inhibitors. This will improve evaluation of the efficacy of these drugs and establish biomarker based strategies for enrollment into clinical trials, which hold the future direction for personalized cancer therapy. In this review, we will discuss the available data on AURKA in GI cancers. We will also summarize the major AURKA inhibitors that have been developed and tested in pre-clinical and clinical settings. Keywords: Aurora kinases, Therapy, AURKA inhibitors, MNL8237, Alisertib, Gastrointestinal, Cancer, Signaling pathways Introduction stage [9-11]. Furthermore, AURKA is critical for Mitotic kinases are the main proteins that coordinate ac- bipolar-spindle assembly where it interacts with Ran- curate mitotic processing [1]. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
MARK4 with an Alzheimer's Disease-Related Mutation Promotes
bioRxiv preprint doi: https://doi.org/10.1101/2020.05.20.107284; this version posted May 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. MARK4 with an Alzheimer’s disease-related mutation promotes tau hyperphosphorylation directly and indirectly and exacerbates neurodegeneration Toshiya Obaa, Taro Saitoa,b, Akiko Asadaa,b, Sawako Shimizua, Koichi M. Iijimac,d and Kanae Andoa,b, * aGraduate School of Science, Tokyo Metropolitan University, Tokyo 192-0397, Japan, bDepartment of Biological Sciences, School of Science, Tokyo Metropolitan University, Tokyo 192-0397, Japan, cDepartment of Alzheimer’s Disease Research, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan, dDepartment of Experimental Gerontology, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi 467-8603, Japan *Corresponding author Kanae Ando, Ph.D. E-mail: [email protected] Running title: Mutant MARK4 enhances phospho-tau accumulation Abstract Accumulation of the microtubule-associated protein tau is associated with Alzheimer’s disease (AD). In AD brain, tau is abnormally phosphorylated at many sites, and phosphorylation at Ser262 and Ser356 play critical roles in tau accumulation and toxicity. Microtubule-affinity regulating kinase 4 (MARK4) phosphorylates tau at those sites, and a double de novo mutation in the linker region of MARK4, ΔG316E317InsD, is associated with an elevated risk of AD. However, it remains unclear how this mutation affects phosphorylation, aggregation, and accumulation of tau and tau-induced neurodegeneration. Here, we report that MARK4ΔG316E317D increases the abundance of highly phosphorylated, insoluble tau species and exacerbates neurodegeneration via Ser262/356-dependent and -independent mechanisms. -
RASSF1A Interacts with and Activates the Mitotic Kinase Aurora-A
Oncogene (2008) 27, 6175–6186 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE RASSF1A interacts with and activates the mitotic kinase Aurora-A L Liu1, C Guo1, R Dammann2, S Tommasi1 and GP Pfeifer1 1Division of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, CA, USA and 2Institute of Genetics, University of Giessen, Giessen, Germany The RAS association domain family 1A (RASSF1A) gene tumorigenesis and carcinogen-induced tumorigenesis is located at chromosome 3p21.3 within a specific area of (Tommasi et al., 2005; van der Weyden et al., 2005), common heterozygous and homozygous deletions. RASS- supporting the notion that RASSF1A is a bona fide F1A frequently undergoes promoter methylation-asso- tumor suppressor. However, it is not fully understood ciated inactivation in human cancers. Rassf1aÀ/À mice how RASSF1A is involved in tumor suppression. are prone to both spontaneous and carcinogen-induced The biochemical function of the RASSF1A protein is tumorigenesis, supporting the notion that RASSF1A is a largely unknown. The homology of RASSF1A with the tumor suppressor. However, it is not fully understood how mammalian Ras effector novel Ras effector (NORE)1 RASSF1A is involved in tumor suppression pathways. suggests that the RASSF1A gene product may function Here we show that overexpression of RASSF1A inhibits in signal transduction pathways involving Ras-like centrosome separation. RASSF1A interacts with Aurora-A, proteins. However, recent data indicate that RASSF1A a mitotic kinase. Surprisingly, knockdown of RASS- itself binds to RAS only weakly and that binding to F1A by siRNA led to reduced activation of Aurora-A, RAS may require heterodimerization of RASSF1A and whereas overexpression of RASSF1A resulted in in- NORE1 (Ortiz-Vega et al., 2002). -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
A Feed-Forward Cycle
GMJ.2020;9:e1681 www.gmj.ir Received 2019-08-08 Revised 2019-11-11 Accepted 2019-11-24 Tau Abnormalities and Autophagic Defects in Neurodegenerative Disorders; A Feed-forward Cycle Nastaran Samimi 1, 2, Akiko Asada 3, 4, Kanae Ando 3, 4 1 Noncommunicable Diseases Research Center, Fasa University of Medical Sciences, Fasa, Iran 2 Department of Brain and Cognitive Sciences, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 3 Department of Biological Sciences, School of Science, Tokyo Metropolitan University, Tokyo, Japan 4 Graduate School of Science, Tokyo Metropolitan University, Tokyo, Japan Abstract Abnormal deposition of misfolded proteins is a neuropathological characteristic shared by many neurodegenerative disorders including Alzheimer’s disease (AD). Generation of excessive amounts of aggregated proteins and impairment of degradation systems for misfolded proteins such as autophagy can lead to accumulation of proteins in diseased neurons. Molecules that contribute to both these effects are emerging as critical players in disease pathogenesis. Furthermore, impairment of autophagy under disease conditions can be both a cause and a consequence of abnormal protein accumulation. Specifically, disease-causing proteins can impair autophagy, which further enhances the accumulation of abnormal proteins. In this short review, we focus on the relationship between the microtubule-associated protein tau and autophagy to highlight a feed-forward mechanism in disease pathogenesis. [GMJ.2020;9:e1681] DOI:10.31661/gmj.v9i0.1681 Keywords: Neurodegenerative Diseases; Tauopathy; Autophagy; Microtubule Binding Pro- tein; Tau; Phosphorylation; Vesicle Trafficking Tau phosphorylation in physiology and dis- However, tau detaches from microtubules and ease misfolds to form insoluble filaments in neuro- isfolded tau protein is deposited in a fibrillary tangles in the brains of patients with Mgroup of neurodegenerative diseases tauopathies [4-9]. -
MAP2K3 (Human) Recombinant Protein (Q01)
MAP2K3 (Human) Recombinant phosphorylates and thus activates MAPK14/p38-MAPK. Protein (Q01) This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of Catalog Number: H00005606-Q01 RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the Regulation Status: For research use only (RUO) constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition Product Description: Human MAP2K3 partial ORF ( of this kinase is involved in the pathogenesis of Yersina AAH32478, 1 a.a. - 100 a.a.) recombinant protein with pseudotuberculosis. Multiple alternatively spliced GST-tag at N-terminal. transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq] Sequence: MESPASSQPASMPQSKGKSKRKKDLRISCMSKPPAP NPTPPRNLDSRTFITIGDRNFEVEADDLVTISELGRGAY GVVEKVRHAQSGTIMAVKRIRATVN Host: Wheat Germ (in vitro) Theoretical MW (kDa): 36.63 Applications: AP, Array, ELISA, WB-Re (See our web site product page for detailed applications information) Protocols: See our web site at http://www.abnova.com/support/protocols.asp or product page for detailed protocols Preparation Method: in vitro wheat germ expression system Purification: Glutathione Sepharose 4 Fast Flow Storage Buffer: 50 mM Tris-HCI, 10 mM reduced Glutathione, pH=8.0 in the elution buffer. Storage Instruction: Store at -80°C. Aliquot to avoid repeated freezing and thawing. Entrez GeneID: 5606 Gene Symbol: MAP2K3 Gene Alias: MAPKK3, MEK3, MKK3, PRKMK3 Gene Summary: The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. -
1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. -
TAK1 Mediates Convergence of Cellular Signals for Death and Survival
Apoptosis (2019) 24:3–20 https://doi.org/10.1007/s10495-018-1490-7 REVIEW TAK1 mediates convergence of cellular signals for death and survival Sabreena Aashaq1 · Asiya Batool1 · Khurshid I. Andrabi1 Published online: 4 October 2018 © Springer Science+Business Media, LLC, part of Springer Nature 2018 Abstract TGF-β activated kinase 1, a MAPK kinase kinase family serine threonine kinase has been implicated in regulating diverse range of cellular processes that include embryonic development, differentiation, autophagy, apoptosis and cell survival. TAK1 along with its binding partners TAB1, TAB2 and TAB3 displays a complex pattern of regulation that includes serious crosstalk with major signaling pathways including the C-Jun N-terminal kinase (JNK), p38 MAPK, and I-kappa B kinase complex (IKK) involved in establishing cellular commitments for death and survival. This review also highlights how TAK1 orchestrates regulation of energy homeostasis via AMPK and its emerging role in influencing mTORC1 pathway to regulate death or survival in tandem. Keywords Apoptosis · Autophagy · Cytokine · Inflammatory · Smad TAK1, a multifunctional kinase regulate a wide array of downstream cellular responses [2, 7, 8]. Various branches of MAP kinase pathways including Transforming growth factor-β is a versatile cytokine, regu- the extracellular signal regulated kinase (Erk) ½ [3, 9], p38 lating a wide variety of intracellular signaling pathways. MAPK [10, 11], c-Jun N-Terminal kinase (JNK) [12, 13], The Smad dependent signaling pathway is conventionally phosphatidylinositol-3-kinase/AKT pathway [14, 15] and acknowledged as the traditional pathway promoted by TGF- Rho-like GTPase [16, 17] signaling pathways are included β1 [1]. However, the Smad dependent signaling pathway among the Smad independent pathways. -
Map2k1 and Map2k2 Genes Contribute to the Normal Development of Syncytiotrophoblasts During Placentation
RESEARCH ARTICLE 1363 Development 136, 1363-1374 (2009) doi:10.1242/dev.031872 Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation Valérie Nadeau*, Stéphanie Guillemette*, Louis-François Bélanger, Olivier Jacob, Sophie Roy and Jean Charron† The mammalian genome contains two ERK/MAP kinase kinase genes, Map2k1 and Map2k2, which encode dual-specificity kinases responsible for ERK/MAP kinase activation. In the mouse, loss of Map2k1 function causes embryonic lethality, whereas Map2k2 mutants survive with a normal lifespan, suggesting that Map2k1 masks the phenotype due to the Map2k2 mutation. To uncover the specific function of MAP2K2 and the threshold requirement of MAP2K proteins during embryo formation, we have successively ablated the Map2k gene functions. We report here that Map2k2 haploinsufficiency affects the normal development of placenta in the absence of one Map2k1 allele. Most Map2k1+/–Map2k2+/– embryos die during gestation because of placenta defects restricted to extra-embryonic tissues. The impaired viability of Map2k1+/–Map2k2+/– embryos can be rescued when the Map2k1 deletion is restricted to the embryonic tissues. The severity of the placenta phenotype is dependent on the number of Map2k mutant alleles, the deletion of the Map2k1 allele being more deleterious. Moreover, the deletion of one or both Map2k2 alleles in the context of one null Map2k1 allele leads to the formation of multinucleated trophoblast giant (MTG) cells. Genetic experiments indicate that these structures are derived from Gcm1-expressing syncytiotrophoblasts (SynT), which are affected in their ability to form the uniform SynT layer II lining the maternal sinuses. Thus, even though Map2k1 plays a predominant role, these results enlighten the function of Map2k2 in placenta development. -
Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.