
Current Medical Science 41(1):108-117,2021 108 DOI https://doi.org/10.1007/s11596-021-2325-2Current Medical Science 41(1):2021 Knockdown of Microtubule Associated Serine/threonine Kinase Like Expression Inhibits Gastric Cancer Cell Growth and Induces Apoptosis by Activation of ERK1/2 and Inactivation of NF-κB Signaling* Cai-xia AN1†, Shou-pin XIE2†, Hai-long LI3, Yong-hua HU3, Rong NIU4, Lin-jie ZHANG5, Yan JIANG5, Qiang LI6, Yong-ning Zhou1# 1Division of Gastroenterology and Hepatology, The First Hospital of Lanzhou University, Lanzhou 730000, China 2Department of Neurology, The First People’s Hospital of Lanzhou City, Lanzhou 730050, China 3Department of Internal Mddicine, The First School of Clinical Medicine, Gansu University of Chinese Medicine, Lanzhou 730000, China 4Department of External Chest, Gansu Provincial Cancer Hospital, Lanzhou 730030, China 5Division of Pediatric Emergency, Gansu Provincial Maternal and Child Health Hospital, Lanzhou 730050, China 6Division of Neurosurgery, The Second Hospital of Lanzhou University, Lanzhou 730000, China The Author(s) 2021 Summary: Microtubule-associated serine/threonine kinase (MASTL) functions to regulate chromosome condensation and mitotic progression. Therefore, aberrant MASTL expression is commonly implicated in various human cancers. This study analyzed MASTL expression in gastric cancer vs. adjacent normal tissue for elucidating the association with clinicopathological data from patients. This work was then extended to investigate the effects of MASTL knockdown on tumor cells in vitro. The level of MASTL expression in gastric cancer tissue was assessed from the UALCAN, GEPIA, and Oncomine online databases. Lentivirus carrying MASTL or negative control shRNA was infected into gastric cancer cells. RT-qPCR, Western blotting, cell viability, cell counting, flow cytometric apoptosis and cell cycle, and colony formation assays were performed. MASTL was upregulated in gastric cancer tissue compared to the adjacent normal tissue, and the MASTL expression was associated with advanced tumor stage, Helicobacter pylori infection and histological subtypes. On the other hand, knockdown of MASTL expression significantly reduced tumor cell viability and proliferation, and arrested cell cycle at G2/M stage but promoted tumor cells to undergo apoptosis. At protein level, knockdown of MASTL expression enhanced levels of cleaved PARP1, cleaved caspase-3, Bax and p-ERK1/2 expression, but downregulated expression levels of BCL-2 and p-NF-κB-p65 protein in AGS and MGC-803 cells. MASTL overexpression in gastric cancer tissue may be associated with gastric cancer development and progression, whereas knockdown of MASTL expression reduces tumor cell proliferation and induces apoptosis. Further study will evaluate MASTL as a potential target of gastric cancer therapeutic strategy. Key words: gastric cancer; microtubule-associated serine/threonine kinase; gene expression; shRNA Gastric cancer has been proved and regarded as a Cai-xia AN, E-mail: [email protected]; Shou-pin XIE, prevalent disease with a very poor prognosis globally, E-mail: [email protected] † and most patients suffered from gastric cancer died These authors contributed equally to this work. [1] Cai-xia AN’s present address: Gansu Provincial Maternity because of late diagnosis . Epidemiology data showed and Child-care Hospital that gastric cancer is the fifth most common cancer #Corresponding author, E-mail: [email protected] and the third most common cancer-related death *This study was supported in part by grants from Lanzhou worldwide[2]. In China, gastric cancer has also shown Science and Technology Planning Project (No. 2016-3-113), increases in incidence and eventual mortality as a University Research Project of Gansu Province (No. 2018A- commonly diagnosed malignancy[3]. Gastric cancer risk 049), the Foundation of the Fundamental Scientific Research factors include infection with Helicobacter pylori (H. Funds for Colleges and Universities in Gansu Province [No. pylori), which accounts for more than 60% of all gastric (2014)63-15], the China’s National Science and Technology cancer cases[4, 5], tobacco smoking, dietary factors such Program for Public Wellbeing (No. 2012GS620101), and [6] National Key Research and Development Planning (No. as eating pickled vegetables, and obesity . Despite 2017YFC0908302). recent advancements in the treatment and prevention of Current Medical Science 41(1):2021 109 gastric cancer, the overall survival rate of gastric cancer 803 were originally obtained from the Type Culture patients remains low, which could be due to delayed Collection of Cancer Institute and Hospital, Chinese diagnosis. For example, most gastric cancer patients Academy of Medical Sciences (CAMS; China). Cells have local and distant metastases at diagnosis[7, 8], were grown in Dulbecco’s modified Eagle’s medium which, if diagnosed early, may allow more than 90% (DMEM) and supplemented with 10% heat-inactivated of patients to survive for at least five years post- fetal bovine serum (FBA; Zhejiang Tianhang detection or to be completely cured[6]. Thus, finding Biotechnology Co. Ltd., China), 100 IU/mL penicillin novel biomarkers for early detection and prediction and 100 μg/mL streptomycin in a humidified incubator of treatment responses, as well as prognosis and with 5% CO2 at 37°C. When the cells reached the identification of novel targets for effective control of exponential growth stage, they were used for our gastric cancer, could help medical oncologists reduce experiments. the gastric cancer burden clinically. 1.3 Lentivirus and Cell Infection To this end, microtubule-associated serine/ Lentivirus carrying MASTL shRNA (shMASTL) threonine kinase-like enzyme (MASTL, also known and negative control shRNA (shCtrl) were purchased as Greatwall, or Gwl) is a serine/threonine kinase from GeneChem Co., Ltd. (China). The shMASTL that is active during mitotic division, and it regulates sequences were 5′-CCGGTTCTCCGAACGTGTCA chromosome condensation and mitotic progression CGTTTCAAGAGAACGTGACACGTTCGGAGA through the phosphorylation of cyclinB-Cdk1[9]. ATTTTTG-3′, whereas the LvshMASTL sequences Previous studies have demonstrated that aberrant were 5′-CCGGGTCAGCCCTTAGATTCAGATACT MASTL expression occurs in various human cancers, CGAGTATCTGAATCTAAGGGCTGACTTTTT-3′. including breast[2, 10], gastric[11], and colorectal cancer[12], For cell infection, AGS cells were seeded into six- and that MSATL overexpression is associated with well plates at a density of 5×104 cells/well, grown poor survival[6], resistance to chemotherapy[2, 12] and overnight to reach 60%–70% confluence, infected with tumor recurrence[6]. In contrast, knockdown of MASTL one of the aforementioned lentiviruses at a multiplicity expression using RNAi induced tumor cell cycle of infection (MOI) of 10 and observed under a arrests and inhibited tumor cell invasion and metastasis fluorescence microscope (IX7, Olympus, Japan) 48 h in colon cancer[12]. However, to date, there is still no after infection for levels of green fluorescent protein in vitro study of MASTL shRNA in gastric cancer and (GFP). Cells with a transfection efficiency >80% were therefore, in this study, we further analyzed MASTL used for subsequent experiments. expression in gastric cancer vs. adjacent normal tissue, 1.4 qRT-PCR to elucidate the association between MASTL expression Total cellular RNA was isolated from gastric and clinicopathological data from patients using online cells using the RNAiso Plus reagent (Takara, China) database data. We then assessed the effects of MASTL and reversely transcribed into cDNA using a Prime knockdown on regulation of gastric cancer cell ScriptTM RT Reagent Kit (Takara) according to viability, proliferation, apoptosis, and gene expression the manufacturer’s instructions. The qPCR was in vitro. We provide novel insights regarding MASTL performed in the Light Cycle 9600 Real-Time PCR in the development and progression of gastric cancer, Detection System (Roche, USA) using a SYBR and whether the targeting of MASTL expression using Master Mixture (Yeasen, China) in a final volume of MASTL shRNA is useful as a potential therapeutic or 20 μL containing 1 μL of cDNA and 0.5 mmol/L of detection strategy of MASTL expression as a novel each primer, 10 µL of 1 x SYBR Master Mixture, and potential biomarker for gastric cancer patients. 8 µL of ddH2O. The primer sequences for MASTL were 5′-AAGGACTCGTATGCCCTATGT-3′ and 1 MATERIALS AND METHODS 5′-CCAATGCTTCATCACTTTCC-3′, and for GAPDH were 5′-TGACTTCAACAGCGACACCCA-3′ and 1.1 Database Search and Data Extraction and Analysis 5′-CACCCTGTTGCTGTAGCCAAA-3′. The qPCR In this study, we first searched the UALCAN[13] conditions were set to initial denaturation at 95°C for and GEPIA[14] web servers for the TCGA database, the 15 s, and then 40 cycles of 95°C for 5 s and 60°C for GTEx projects, and Oncomine database (https://www. 30 s. At the end of these cycles, the melting curve was oncomine.org/resource/login.html). We then extracted generated to validate the specificity of the expected data on MASTL in gastric cancer and analyzed PCR product. The level of MASTL mRNA was these data for tumor vs. adjacent tissue, and the normalized to GAPDH mRNA using the 2-ΔΔCt method. clinicopathological features of MASTL overexpression The experiment was run in triplicates and repeated at in gastric cancer tissues, such as tumor grade, H. pylori least once. infection, histology, etc. 1.5 Cell Viability MTT Assay 1.2 Cell Lines and Culture The altered
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages10 Page
-
File Size-