Annual Report 1983

Cold Spring Harbor Laboratory Box 100 Cold Spring Harbor, New York 11724

Editors, Elizabeth Ritcey, Dorothy Brown Photographers, Joan James, Rosemary Chan Photo editor, David Mick los

Cover photo: Urey Cottage, renovated in 1983 under the supervision of Jack Richards and the Laboratory's Buildings and Grounds staff, provides offices for the Publications Department. (Photo by Herb Parsons)

Photo page ii: Situated at the entrance to the Labora- tory, Davenport House is one of seven structures on the grounds dating from the 19th century. Annual Report 1983 LUMMINI 11111M1111 111111MIN, atalla COLD SPRING HARBOR LABORATORY Annual Report 1983 GOVERNANCE AND MAJOR AFFILIATIONS

The Laboratory is governed by a 25-member Board of Trustees which meets three or four times a year. Authority to act for the Board of Trustees between meetings is vested in the Executive Committee of the Board of Trustees. The Executive Committee is composed of the Officers of the Board plus any other members who may be elected to the Executive Committee by the Board of Trustees. Additional standing and ad hoc committees are appointed by the Board of Trustees to provide guidance and advice in specific areas of the Laboratory's operations. Representation on the Board of Trustees itself is divided between community representatives and sci- entists from major research institutions. Ten such institutions are presently represented on the Board of Trustees: Albert Einstein College of Medicine, Columbia University, Duke University, Massachusetts Institute of Technology, Memorial Sloan-Kettering Cancer Center, New York University, The Rockefel- ler University, The State University of New York at Stony Brook, University of Wisconsin, and Yale University. Institutional Trustees were brought onto the Board during the 1960s-a difficult period when the Laboratory was undergoing reorganization as an independent entity. In addition to supplying scien- tific leadership to the governing body, participating institutions also provided emergency funds to help keep the Laboratory afloat during this crucial phase of development. Although participating institu- tions now give only token financial support, their Trustees continue to help steer the course of the Laboratory's scientific and administrative policies. Also represented as participating institutions are the Wawepex Society and the Long Island Biologi- cal Association (LIBA). The Wawepex Society was formed in the mid-nineteenth century as a philan- thropic arm of the Jones family, who supported the formation of the Laboratory. LIBA's origins began in 1890 when members of the local community became involved as friends and with membership on the Board of Managers of the Biological Station in Cold Spring Harbor, under the aegis of the Brooklyn Academy of Arts and Sciences. When the Brooklyn Academy withdrew its support of the Biological Station, community leaders, in 1924, organized their own association that actually administered the Laboratory until the Laboratory's reorganization as an independent unit in 1962. Today, LIBA remains a nonprofit organization organized under the Department of Social Welfare of the State of New York and represents a growing constituency of 'friends of the Laboratory." Its 450 members support the Laboratory through annual contributions and participation in fund drives to raise money for major construction projects. The Laboratory is chartered as an educational and research institution by the Board of Regents of the Education Department of the State of New York. It is designated as a 'public charity" by the Inter- nal Revenue Service and claims special status as a school under the Internal Revenue Code. OFFICERS OF THE CORPORATION

Walter H. Page, Chairperson Dr. Bayard Clarkson, Vice-Chairperson Dr. Norton D. Zinder, Secretary Robert L. Cummings, Treasurer Roderick H. Cushman, Assistant Treasurer Dr. James D. Watson, Director William R. Udry, Administrative Director

BOARD OF TRUSTEES Institutional Trustees Individual Trustees Albert Einstein College of Medicine Robert L. Cummings Dr. Matthew Scharff Roderick H. Cushman Duke University Oliver R. Grace Dr. Robert Webster Mary Jeanne Harris Long Island Biological Association Ambassador John P. Humes Edward Pulling John Klingenstein Massachusetts Institute of Technology Dr. Ralph Landau Dr. Boris Magasanik Mary Lindsay Memorial Sloan-Kettering Cancer Center Walter H. Page Dr. Bayard Clarkson William S. Robertson Columbia University Alexander C. Tomlinson Dr. Eric R. Kandel Dr. James D. Watson New York University Medical Center Taggart Whipple Dr. Claudio Basilico State University of New York, Stony Brook Dr. Thomas E. Shenk The Rockefeller University Dr. Norton D. Zinder University of Wisconsin Dr. Masayasu Nomura Wawepex Society Honorary Trustees Townsend J. Knight Dr. Harry Eagle Yale University Dr. H. Bentley Glass Dr. Charles F Stevens Dr. Alexander Hollaender COMMITTEES*

Audit Finance Plant Molecular Biology Alexander C. Tomlinson, Chairman Robert L. Cummings, Chairman Dr. Norton D. Zinder, Chairman Ambassador John P. Humes Roderick H. Cushman Dr. Ralph Landau Townsend J. Knight Oliver R. Grace Dr. Thomas E. Shenk Ambassador John P. Humes Dr. James Hicks Banbury Program Townsend J. Knight Dr. Russell Malmberg William S. Robertson Dr. Norton D. Zinder, Chairman Alexander C. Tomlinson Dr. Bayard Clarkson Tenure & Appointment William R. Udry Robert L. Cummings Taggart Whipple Dr. Norton D. Zinder, Chairman Mary Lindsay Dr. Claudio Basilico Walter H. Page Dr. Boris Magasanik Dr. Matthew Scharff Building Infrastructure & Future Plans Edward Pulling, Chairman Robertson House Roderick H. Cushman Dr. Bayard Clarkson, Chairman William S. Robertson, Chairman Oliver R. Grace Mary Lindsay Mary Jeanne Harris Mary Jeanne Harris Robert L. Cummings John Maroney Mary Lindsay Roderick H. Cushman Anne Meier Elizabeth Watson Ambassador John P. Humes Dr. Ralph Landau Jack Richards Dr. Michael Shodell Commercial Relations John Maroney Jack Richards Townsend J. Knight, Chairman William R. Udry Robertson Investment Dr. Ralph Landau Dr. James D. Watson Dr. Richard Roberts Robert L. Cummings, Chairman Dr. Matthew Scharff Oliver R. Grace William S. Robertson Dr. Jeffrey Strathern Neurobiology Taggart Whipple William R. Udry Dr. Charles F. Stevens, Chairman Taggart Whipple Executive (Elected) Dr. Matthew Scharff Dr. James D. Watson Dr. Ronald McKay Walter H. Page, Chairman Dr. Joseph Sambrook Dr. Bayard Clarkson Robertson Research Fund Robert L. Cummings (Laboratory Representatives) Roderick H. Cushman Nominating Robert L. Cummings, Chairman Dr. Charles F. Stevens Walter H. Page William R. Udry Edward Pulling, Chairman Alexander C. Tomlinson Dr. James D. Watson Mary Lindsay William R. Udry Dr. Norton D. Zinder Dr. Matthew Scharff Dr. James D. Watson

*Committees and membership as of October 21, 1983. LABORATORY STAFF

First row: A. Klar, J. Strathern, J. Hicks; D. York, N. Cap lin Second row: D. Lukralle, C. Jackson; (top) F. Matsumura, J.J. Lin; (bottom) B. Stillman, T. Grodzicker, Y. Gluzman First row: J. Feramisco, W. Welch, D. Helfman, (foreground) G. Binns, J.L. Lin; 0. Fasano, S. Powers, E. Taparowski, T. Kataoka, C. Birchmeier, M. Wig ler, (foreground) L. Edlund, D. Birnbaum Second row: J.-Z. Li, W. Addison, E. Nozik, D. Danna, D. Matkovich; R. Gerard, M. DeLuca Third row: R. McKay, K. Frederiksen, A. Hishinuma, S. Hockfield, E. Waldvogel; (top) J. Garrels, S. Blose; (bottom) J. Wood James D. Watson, Director Joseph Sambrook, Assistant Director for Research William R. Udry, Administrative Director John Maroney, Assistant Administrative Director Michael Shodell, Banbury Center Director

Research Staff Postdoctoral Yamada, Masao Research Fellows Yamashiro-Matsumura, Shigeko Beach, David Zerler, Bradley Blose, Stephen Adams, Timothy Bonitz, Susan Addison, William Broker, Thomas Bautch, Victoria Bukhari, Ahmadt Bhagwat, Ashok Chow, Louise Birchmeier, Carmen Visiting Scientists Daldal, Fevzi Birnbaum, Daniel Feramisco, James Dellaporta, Stephen Cai, Guang-Yun Garrels, James Flanagan, Thomas Fasano, Ottavio Gething, Mary-Jane Franza, Robert Frederiksen, Kristen Gluzman, Yakov Freyer, Gregory Hanahan, Douglas Goldfarb, Mitchell Gerard, Robert Hinton, Stephen Grodzicker, Terri Guilfoyle, Richard Kataoka, Tohru Harlow, Edward Helfman, David Li, Jin-Zhao Hicks, James Herr, Winship Lin, Pei Mao Hockfield, Susan Hiatt, Andrew Hughes, Stephen Huse, William Mar, Amar Ivy, John Kurtz, David Kamata, Tohru Support Staff Lewis, John Kataoka, Yuriko Lin, James Kiss, Antal Balamuth, Michael Lundell, Daniel Koka, Prasad Balke, Deborah Mathews, Michael Krangel, Michael Bird, Patricia Malmberg, Russell Livi, George Borruso, Robert Matsumura, Fumio Maclnnes, Janet Brings, Arthur McKay, Ronald Maihle, Nita Dalessandro, Louisa Roberts, Richard Mains, Paul Dellaporta, Joanne Rossini, Mara Martin, Kathy Donohue, Jeanne Ruley, Earl Maruyama, Kazuo Dulis, August Silver, Lee Moran, Elizabeth Goodwin, Marilyn Stillman, Bruce Patterson, Thomas Greene, David Strathern, Jeffrey Powers, Scott Jackson, Catherine Tamanoi, Fuyuhiko Roth, Michael Keller, Christopher Thomas, Paul Sadaie, Reza Lukralle, Deborah Topp, William Sundin, Olof Mickus, Raymond Welch, William Taparowski, Elizabeth Ockler, Michael Wigler, Michael Watts, Susan Renna, Philip Youvan, Douglas Weisbrod, Stuart Rubino, Marlene Zipser, Birgit Weiss, Robert Schubert, Richard Zoller, Mark White, Eileen Schwarz, Regina t We note with sorrow the death of Dr. Bukhari in November 1983.

ix Suhan, Joseph Schley, Carol Dumser, Nadine Sutkevich, Clifford Silbiger, Scott Kirk, Annette Szadkowski, Madeline Smith, Patricia Owen, Douglas Timm, Carole Tohill, Kathleen Support Staff Vanderwal, Linda Ebert, Joan Waldvogel, Elizabeth Guerra, Adrienne Graduate Students Walsh, Martin Ritcey, Elizabeth Wenzel, Heidi Sundin, Karen Chou, Chin-Sheng Wiggins, Jeanne Tannenholz, Pauline Doyle, Carolyn Williamson, Nicola Taylor, Michaela Kelly, Margaret Wood, Jonathan Kostriken, Richard York, Deborah Manos, Michele Matlack, Kent Library/Marketing O'Malley, Robert Sarvetnick, Nora Laboratory Aides Director Sharma, Sreenath Asouline, Gigi Gensel, Susan Stephens, Carmel la Azzoni, Michael Administrative Staff Van Doren, Kevin Ca lasso, Angela DeWeerdt, Ellen Chisum, Rodney Falvey, Genemary Cooper, Robert Hyman, Laura Laboratory Technicians Falkowski, Margaret Support Staff Hallaran, Connie Gaveglia, Elaine Ahrens, Barbara McTernan, Michele Gibson, Amy Applebaum, Joy Penzi, Sandra Main, Margaret Binns, Georgia Wallace, Margaret Mick los, Laurie Blose, Gladys Cisek, Lois Part-time Staff Danna, Debra Ewing, Monica DeLuca, Mark Laboratory Aides, part-time Falvey, Kathryn Dermody, Marlene Gibson, David Nancy Klar, Kuljit Edlund, Louise Bernstein, Jordana Faha, Barbara Lanahan, Colleen Bronson, Andrew McBride, Michaela Fraser, Cecilia Cap lin, Nina Gould, Jane McBride, Christina Herrmann, Christine Ismail, Sajida Johnson, Karen Accounting Medium Makers Kosik, Elaine Comptroller Lin, Jenny Hallaran, Marie Keen, William Matkovich, Diana LoFranco, Geraldine Grants Manager McGill, Carolyn Maruyama, Midori Schultz, Susan McGuirk, Robert Administrative Staff-Accounting McKeever, Mathew Cozza, Guy Mclndoo, Jeanne Mendez, Carlos Merle, Mary Genetics Research Unit Miglio, Lisa Carnegie Institution Support Staff- Accounting Doherty, Joan Moomaw, Carolyn of Washington Moomaw, John Keiger, Terry Hershey, Alfred D. Nozik, Eva Kurfess, Patricia McClintock, Barbara O'Neill, Kathy Lambert, Dorrine Osheroff, Wendy Polistina, June Pascucci, Diane Administrative Staff-Fulfillment Apsel, Charlaine Pelletier, Anthony Publications Pereira, Lynn Support Staff-Fulfillment Perez, Jacqueline Director Felton, Ann Ramirez, Kim Ford, Nancy Penn, Neil Reichel, Patricia Administrative Staff Terry, Barbara Riggs, Michael Brown, Dorothy Support Staff-Grants Rodgers, Linda Cuddihy, Judith Barkley, Patricia Information Services Buildings and Grounds Banbury Center Director Supervisor Blum, Judith Mick los, David Richards, Jack Davey, Katya Support Staff Foremen McEvoy, Margaret Wilson, Robin Marshall, Charles To liver, Beatrice Pfeiffer, Alfred Scarduzio, Diamond Schneider, Charles Personnel and Meetings Smith, Lane Trede, Hans Staff Departures during 1983 Director Support Staff Putnam, William Bach, John Senior Staff Investigators Administrative Staff-Personnel Berejka, John Fiddes, John Terrence, Jacqueline Boehm, Kenneth Heffron, Fred Support Staff-Personnel Brodawchuk, Joseph So, Magdalene Duffy, Rita Caldarelli, Carol Staff Investigators Administrative Staff-Meetings Canner, Joseph Gingeras, Thomas Kist, Gladys Carey, Vincent Harshey, Rasika Parsons, Herb Chambers, Ronald Visiting Scientists Ward, Barbara Cuff, Barbara Johansen, Jorgen Support Staff-Meetings Eddy, Warren Katoh, Yoshiki Berejka, Maureen Ellis, Joseph Shimizu, Kenji Schmitz, Thomas Fahlbusch, Bruce Postdoctoral Fellows Simkins, Merilyn Gardner, Willie Abraham, Judith Stephenson, Andrea Gruebel, Louis Brandsma, Janet Haskett, Douglas Brooks, Joan Jusino, Daniel Deal, Carolyn Krumm, Philip Flaster, Murray Purchasing Larsen, John Harper, Mary Manager Lyden, Thomas Kost, Thomas Rice, Peter McEvoy, Christopher Lee, Chao-Hung Administrative Staff Meyer, John Lemaster, Saundra Continelli, Grace Ann Mueller, Elizabeth Sorge, Joseph D'Arcangelo, Sandra Nickel, Alfred Talmadge, Karen Diliberto, Salvatore Palmer, Gary Graduate Students Sabin, James Pimak, Joseph Rubin, Ellen Reichert, Gerry Support Staff Segal, Ellen Robinson, Barbara Baker, Deon Personnel Manager Rose, Donald Horly, Steven Hickey, Patrick Schweda, Paul Stahl, Peter Grants Manager Stewart, Owen Kron, Stephen Banbury Editor Administrative Support Staff Sullivan, Patrick Thum, Cherie Moran, Lynda Gerard, Fran Tierney, Peter Librarian Salant, Roberta Youngs, Dorothy Powers, Audrey

xi First row.P. Barkley, J. Doherty, S. Schultz, W. Keen, P. Kurfess; W Putnam Second row:C. Mendez, J. Polistini, D. Lambert; A. Stephenson, M. Berejka, M. Simkins, G. Kist, B. Ward Third row:J. Maroney; G. Continelli, S. D'Arcangelo Fourth row:H. Trede; J. Pirnak, L. Gruebel; D. Scarduzio CONTENTS

Officers and Trustees, v Laboratory Staff, ix

Director's Report 1 Departmental Reports 7 Research Mammalian Cells 15 Structural Studies 15 Transport and Secretion of Eukaryotic Glycoproteins 31 Heat Shock and Stress Responses 35 Oncogenes 39 Tumor Viruses 47 Papilloma Viruses 47 Adenoviruses/SV40 50 Viral Vectors 64 Mammalian Genetics 71 Yeasts 81 Plants 87 Prokaryotes 91 Neurobiology 101 Publications 107 Author Index 113 Cold Spring Harbor Meetings 115 Postgraduate Courses 123 Banbury Center 131 Financial Report Financial Support 139 Financial Statement 140 Grants 147 Contributors 153 Long Island Biological Association 155

Cold Spring Harbor Meetings Programs 161 Banbury Meetings Programs 221 Postgraduate Courses: Participants and Seminars 229 Undergraduate Research 239 Seminars 241 Nature Study 243 DIRECTOR'S REPORT

When I first came to Cold Spring Harbor, in June of 1969, it was to a laboratory that was very different in character than it is today. The physical plant was dilapidated and only one building - Demerec - was usable as a year-round laboratory. McClintock -in those days called the Animal House -had that special air of stagnation found only in empty Victorian structures: Its musty rooms and silent corridors echoed to a visitor's footsteps like an abandoned railroad station. The lower floor of James was a grubby warren of unusably small spaces divided from one another by a series of partitions that effectively insulated workers in the building from any contact with one another; the upper floor swayed precariously, empty for all but three brief weeks of summer. Delbriick - then named Davenport- buzzed with bacteriophages in June and July. But come the fall, its water pipes were drained, its windows were shuttered, and the building hunkered down into the hillside for the cold winter. On the site of the present Hershey office building was a set of greenhouses, their cracked and grimy windows serving more effectively to screen out the sunlight than to provide protection to a few long-forgotten plants whose only source of nourishment seemed to be the still- strong smell of garden loam. The grounds were disorderly and delightful with cover, vibrant with birds and animals. For four months of the year, Bungtown Road was little more than a leafless tunnel for the bitter north wind, but in early spring it softened into a narrow culvert whose flowered walls were a mass of head- high brambles and rhododendrons. In late evening, with the light slanting at a certain angle, it was easy to believe that this was the perfect setting for a Wagnerian opera, so overpowering was the combination of color and perfume to the senses. Of all the changes at the Laboratory, it is only the loss of those intense evenings that I regret. Today, the vines have been tamed, the trees nursed back to health, and much of the ground has been cleared into open spaces and planted with grass. So, whereas it was difficult previously to obtain a clear view of the harbor, now the water is always in plain sight, and the land is inviting to the casual walker. As our grounds have changed over the years from bucolic to pastoral, so the individual buildings have been transformed from their rustic decay into highly functional labora- tories and spacious offices. There is now the pleasure of doing science in a cultivated setting in well-equipped laboratories. It is this restoration of old buildings, together with the planning and siting of new, that has been a major interest of Jim Watson. Remarkably, he has been able to guide the Laboratory through a period of explosive growth and massive renovation without compromis- ing the basic beauty of the land or the style of the science. His absence from the Laboratory for a sabbatical year in London gives me the opportunity to thank him on behalf of the staff for creating an environment so stimulating to the intellect and beautiful to the eye. This year has seen the completion of a major at an extraordinary rate. That we survive at all new addition to Demerec Laboratory - chiefly is entirely due to the work of Jack and his de- to make room for the scientists associated with partment. Working often under great pressure, our joint program with Exxon Research and they are infinitely cheerful and never-failingly Engineering. The upper floor therefore houses helpful. units working on site-directed mutagenesis and Dominant among our building plans for the prokaryotic genetics. On the lower floor, we immediate future is the new auditorium, to be have been at last able to achieve our ambition sited on the west side of Bungtown Road op- of a protein chemistry laboratory equipped to posite our existing Bush Lecture Hall. The fi- the best modern standards. Much more signif- nal drawings by Moore, Grover, and Harper icant than our physical expansion, however, has show a post-modernist structure whose archi- been the infusion of new people into our sci- tectural strength should rival the sophistication entific community: Doug Youvan from Berke- of the work presented at our annual symposia ley and Mark Zoller from Vancouver, who have and summer meetings. Inevitably, since last come here to work on site-directed mutagene- year's annual report was written, the estimated sis; Pablo Scolnick, from the University of costs of the building have risen (now to $3.3 Chicago, who will continue his genetic analy- million),and consequently, we have been sis of the nif genes of Rhodopseudomonas; forced to delay construction for several Steve Hinton from Purdue and Dan Lundell months. However, the building contract is fi- from Berkeley, who are studying molybde- nally to be signed within the next four weeks num-iron centersin metalloenzymes; and, (before May 1, 1984), and we still have some most recently, Clive Slaughter, an English ex- hope that the building may be completed in patriate who brings not only much-needed ex- time for next year's 50th Symposium. That the pertise in protein chemistry, but also a long- new auditorium will be realized is in large part standing interest in mammalian cell genetics. due to the extraordinary generosity of benefac- Despite our intensive building program, we tors in our local community. Year after year, continue to work in very crowded conditions - the members of the Long Island Biological As- nowhere more so than in James Laboratory. It sociation, under the continually inspired lead- istherefore welcome news that the long- ership of their Chairman Ed Pulling, raise very awaited extension to this building will be com- substantial sums of money to help the Labora- pleted by midsummer of 1984. Funded in part tory achieve specific goals; 1983 was an espe- by grants from the National Cancer Institute, cially successful year in that LIBA exceeded its the Pew Memorial Trust, the Fannie Rippel own fund-raising target and has now pledged Foundation, and the Robertson Research Fund, to contribute at least $500,000 toward the new the building will provide year-round space for auditorium. The magnitude of this gift makes the growing efforts of Ed Harlow's group to us realize once again how fortunate we are to develop monoclonal antibodies against tumor- be surrounded by a community that is so sup- specific antigens and proteins coded by viral portive of our goals and so responsive to our oncogenes. needs. Late in 1983, the renovations were com- A major part of the remaining money re- pleted to Urey Cottage, which has now become quired to build the auditorium has been donated the home of our Publications Department. For by a single family -again one of our neigh- the first time in its 50-year existence this bors. Although they wish for the time being to building, perched on the hillside above James remain anonymous, we nevertheless want to Laboratory, has achieved a state of elegance. take this opportunity to thank them for their Originally a small summer house and then an magnificent gift of one million dollars. We uncomfortable and draughty year-round resi- hope that we shall soon be able to acknowledge dence, Urey now provides a splendid series of this generosity in a more open and fitting way. offices for Nancy Ford and her staff. The ren- ovations were carried out with the efficiency + + and skill that have become the hallmark of our Buildings and Grounds Department under the The subject of the 1983 Symposium was Mo- direction of Jack Richards. For some reason, lecular Neurobiology. The opening address was the laboratory buildings at Cold Spring Harbor given by Max Cowan, who set the high intel- seem to suffer disasters -from floods to fire - lectual plane that was to be the standard for the

2 subsequent seven days. Eric Kandel provided a plants for some time; several others, notably most perceptive and balanced summary of the Jim Hicks and Jeff Strathern, have started 91 papers that were presented. He, like many smaller-scale projects with plants whilecon- others, is optimistic about the benefits thata tinuing their long-standing involvement with fusion of molecular biology and neurobiology yeast. During the last year, this group applied may bring. To my mind such benefits still lie to the National Science Foundation for funds several years away - certainly the papers given to renovate and equip the Uplands Farm facil- at the Symposium were far more neurobiolog- ity. The grant of $691,000 which theywere ical in nature than molecular. I came away with awarded - the largest ever given by the Na- the impression that molecular biology can do tional Science Foundation for plant research- much to help define the structural properties will allow us without delay to begin theexpan- of particular proteins that until now have been sion that is essential to the future success of the recognized on the basis of their electrophysio- project. logical behavior. Genes coding for several of Ambitious though our plans are, their scale the neurochemical receptor and channel pro- is small compared with the magnitude of the in- teins have already been cloned and expressed; tellectual problems that plants pose. It isa ma- others will rapidly follow. These studies will jor concern, therefore, that the prospectsre- surely lead to a thorough understanding of the main bleak for secure, long-term funding of structure and function of such molecules and basic research into the biology of plants. Al- thence to an appreciation of one of the major though agencies such as the National Science properties that set nerve cells apart from other Foundation and the Departments of Energy and differentiatedcellsinthe body. However, Agriculture have established programson a whether molecular biology can be as illumi- small scale, the funds made availableso far nating about the formation and selection of the cannot fuel sufficient grants to have an impact complex neural networks that characterize the on such a large area of science. Most people higher workings of the brain is a question that would agree that the major source of public this Symposium left unresolved. funds for basic research on plants should be the Department of Agriculture. Although there 4. are some indications that the Department of Agriculture, in response to increasing pressure Our commitment to plant molecular biology from Congress, is willing to dispense a larger has been greatly strengthened during the year. fraction of its research budget through a com- First, the Laboratory has successfully con- petitive granting system, it still seems likely cluded negotiations with the Nature Conser- that insufficient funds will be available from vancy to purchase approximately 12 acres of governmental sources for several years to land at Uplands Farm, a former dairy farm lo- come. We cannot wait that long. During the cated about half a mile from the Laboratory. next year, therefore, we will need to attract During the summer of 1983, Barbara Mc- support from both private individuals and large Clintock and Steve Dellaporta used the exist- corporations who can more clearly see the eco- ing greenhouses and a large field at Uplands to nomic and social benefits that will flow from carry out a series of genetic experiments with research in this area. corn. With the purchase of the land, we will It seems slightly incongruous that we should now be able to carry out our longer-term plans be worried about funds for plant research in to convert the old brick garage at Uplands into the same year that Barbara McClintock was laboratories and offices for six to eight scien- awarded a Nobel prize for her work on mov- tists, and to expand and renovate the green- able genetic elements in maize. This was an houses. event that gave many forms of pleasure, be- Our immediate aim is to assemble a research cause the award itself was so clearly deserved group that will be as influential during the next and yet so long overdue; because the work was ten years of plant molecular biology as our tu- prophetic and individual rather than, as is more mor virologists have been during the last de- common these days, the efforts of an anony- cade. Central to this goal are the scientists pres- mous group; and most of all, because it was a ently working in Delbriick Laboratory. Two of victory of radical thought over scientific or- them - Steve Dellaporta and Russell Malm- thodoxy. Barbara McClintock changed the way berg - have been devoting all their efforts to we think about genetics and evolution, and it is

3 not often that intellectual revolutionaries are was extremely limited. The safest of a bad honored by the establishment. bunch seemed to be animal viruses, since they A more pleasant revolutionary than Barbara provided the only homogeneous pieces of eu- would be hard to find. On the sunny, fall day karyotic DNA then available to the molecular on which the award was announced, she han- biologist. So we started working on them hop- dled the celebrations and press conferences and ing that we might be able to confirm that the television interviews with great grace and wit. truths previously discovered in prokaryotes She made sure that the day became an occasion really were universal. from which all of us could draw delight and Of course, our preconceptions about eukary- could share in her success. otes fortunately were wrong. But our esprit as a Laboratory in those early years was not + + + merely the reflection of an excitement gener- ated by the unexpected results that eukaryotes The year brought sudden sadness as well as provided, but also had to do with the way we great pleasure. Ahmad Bukhari's death in No- organized ourselves to attack the problems at vember left emptiness in many forms -the loss hand. Virtually all of the Laboratory was then of a friend and counsellor and the unresolved working on one aspect or another of gene or- cadences of his interrupted science. Those of ganization and expression in adenoviruses and us who had known Ahmad since his arrival SV40. Although each individual group might here in those bright early days had seen him bring different ideas and techniques to bear on mature scientifically in synchrony with the the various aspects of this problem, there was Laboratory. The stages of his scientific life - a strong sense of shared purpose that came nat- from postdoctoral fellow to staff investigator urally from the fact that much of our scientific to tenured faculty- therefore seemed to mark attention was focused toward a common end. the growth rings of Cold Spring Harbor itself. If the science in retrospect seems highly de- His death made us feel both bereft and vulner- scriptive, it was nevertheless exhilarating at the able. time. Ahmad himself would have been impatient How long such a group effort could have re- hard to say. Before very curious things and derived too much joy from long, however, two scientific events occurred clever ideas to tolerate sadness for long. All of that led to its premature dissolution: the dis- us, however, continue sorely to miss his vital- covery of splicing and the advent of molecular ity and intelligence. cloning. The intellectual ferment caused by the first of these and the technical facility granted by the second combined to form forces for change that we were unable to resist. Sud- In recent years, there has been a great diversi- denly, any eukaryotic gene became as interest- fication of science at Cold Spring Harbor. For ing and amenable to structural analysis as viral a period of 25 years following the Second genomes had been just a short time previously. World War, the work of the Laboratory was Freed from the confines of technical limita- concerned almost exclusively with the genetic tions we, like many other laboratories, began behavior of a small number of prokaryotic or- to spread laterally into many other systems. ganisms, chiefly Escherichia coli and its tem- This urge to diversify led us to study the wealth perate bacteriophages. In those days, there of topics that are discussed in the body of this seemed to be no sensible direction from which annual report. molecular biologists might attack eukaryotic My guess is that the tendency to radiate out- organisms; in any case, work on prokaryotes ward into other systems soon will come to an was taken to be prophetic and certainly was too end. Should it continue, we would have less exciting to abandon in favor of the slower eu- and less to say to one another aside from the karyotes. So it was not until 1968 that serious latest technical tricks in molecular cloning. work began here on mammalian cells,al- And in any case, it now seems unlikely that we though Phil Marcus and Gordon Sato had for will be able easily to achieve a satisfactory un- several years previously taught an excellent derstanding of more than a small fraction of summer course on animal viruses and cells. the systems currently under study. We are in The choice of systems available in those days an era in which large numbers of genes are

4 identified each year, isolated from the organ- soon arrive at a similar situation with many ism of choice, and quickly reduced to their other mammalian genes. component DNA sequences. In time, wild-type Because there is not likely to be a general and mutant versions of many of these genes solution to this paradox for several years to will be inserted into the appropriate vectors come, there is at present little choice but to and expressed in the parental organism. This determine individually the structure of each of area of detailed structural and functional anal- the proteins in which we are interested. To ysis of individual genes -the Great Middle what level of resolution we pursue each protein Ground of molecular biology -will undoubt- is an open question, although to my mind, edly continue to yield huge quantities of valu- nothing short of the atomic level will be satis- able information for many years to come. Ma- factory in the last analysis. While the idea of jor among the foreseeable benefitsisa bringing large numbers of proteins to the point thorough analysis of the structure of eukary- where we can derive their structures by X-ray oticregulatory elements,particularly pro- crystallographyisclearlyfar beyond our moters and enhancers. This is likely to lead to current capacity, it now seems imperative that an understanding of the mechanisms that de- we do so, at least for those proteins in which termine tissue-specific expression of mamma- we already have considerable intellectual in- lian genes. We can also expect over a longer vestment. At Cold Spring Harbor, the natural term to learn a great deal about the evolution choice would include proteins such as those of gene families and to decipher the rules that encoded by the ras-gene family, early region 1 determine the relationship between the do- of adenoviruses, and SV40 large T antigen. mains of proteins and the location of introns Our desire to work effectively on the chemistry within the corresponding genes. of these proteins may well prompt a partial re- In the excitement of finding out all that we turn to the sort of group effort that was so pro- need to know about the organization of eukary- ductive previously. However, the Laboratory is otic genes, it is sobering to remember the lim- now much larger than it was ten years ago and itations of the techniques that are currently so it is inconceivable that we could, or would wish dominant. Even when the Great Middle to, return to an essentially monolithic system. Ground has been completely explored, we will Clearly, we need to find a balanced position know comparatively little about the proteins that will allow us quickly to develop critical that are coded by those genes we have mapped. mass in areas new to us, such as protein chem- Unfortunately, the sequence of nucleotides in a istry and protein structure, without unneces- gene presently makes no predictions about the sarily sacrificing the catholic nature of the top- tertiary structure or function of the corre- ics now under study here. sponding protein. Not even the power and ele- gance of site-directed mutagenesis can com- + + pletely solve this problem. For example, the gene coding for SV40 large T antigen has been During this year as Acting Director, I have under intensive study for some 20 years; its drawn help and encouragement from many complete nucleotide sequence is known and its sources. I owe particular thanks to three groups transcriptional pattern has been established. of people: to the scientific staff, who have been Hardly a single base pair of the gene has been uncommonly tolerant and supportive; to Bill left unmutated, and the biological properties of Udry and his administrative staff, who have most of the resulting mutants have been cata- been unfailingly cooperative and innovative; loged. Molecular biologists can fairly claim to and finally, to the Board of Trustees of the have carried out the best possible analysis of Laboratory, whose counsel, both individual the gene. Yet I am sure none of them would and collective, has been excellently wise. believe that they have anything but the most superficial understanding of the structure and March 18, 1984 Joe Sambrook function of the T-antigen protein itself. We will

5 Ahmad Iqbal Bukhari 1943-1983

On November 19, 1983, Dr. Ahmad Bukhari died suddenly of aheart attack. Dr. Bukhari came to Cold Spring Harbor Laboratory in 1970 as a postdoctoralfellow. In 1972 he was appointed to the staff and conducted research involving genetic rearrangementsof the bacteriophage Mu. A native of Pakistan, he entered the University of Karachi at age15 and earned his master's degree by age 20. He came to the U.S. in 1964 as a Fulbright Haysscholar at Brown University and received his Ph.D. in 1970 from the University of Colorado. Although a U.S. citizen, Dr. Bukhari maintained scientific liasonswith Pakistan and other third-world countries. He served as an advisor to the United NationsInternational Develop- ment Organization and helped to establish an InternationalCenter for Genetic Engineering and Biotechnology, whose aim is to increase the flow of biotechnologyto developing coun- tries. He was also a scientific advisor to UNESCO and played akey role in establishing a national biotechnology center for Pakistan. His friends and colleagues respected him as an outstanding scientistand humanitarian. They also enjoyed his enthusiasm for sports and games. Dr. Bukhari wasCaptain of the Laboratory's cricket team and was a challenging player at tennis and chess. Anavid reader of poetry, he found an outlet for his own creative talents in writing short stories. Through his work, personality, and philosophy, Dr. Bukhari enhancedthe lives of the sci- entists, students, and co-workers with whom he interacted. Heis survived by his wife Chris- tine, and two children, Yousaf Ali and Jaffer Ahmad.

6 DEPARTMENTAL REPORTS Recto: Carnegie Library. Designed as a laboratory in 1905, this building now houses the Library, Marketing Department, Book Store, and Office of Information Services. ADMINISTRATION

As discussed in this year's Director's Report, we clude financial support of our ongoing research have managed to protect the Laboratory's charming projects, equity and consultant arrangements be- environment in the face of rapid changes and tween individual scientists and commercial firms, growth. This has certainly pleased our neighbors, collaborative projects, and licensing. Again a spe- and the small community structure thus maintained cial committee of our Board of Trustees was ap- we believe has allowed ideas to move quickly and pointed to investigate these questions. As its study easily throughout the organization. In a similar progressed, a consensus developed that it is indeed vein, we have also eschewed a highly formalized in the Laboratory's interest, which is reinforced by bureaucracy. While both these policies result in a federal government policy, to encourage the trans- certain inefficiency, they also make it possible for fer of findings from our basic research to the gen- us to respond flexibly and rapidly. eral public and that many times a variety of rela- Continuing growth is, however, leading us in the tionships with commercial organizations is the best administrative sense to rely less on the spoken word or only way to accomplish that objective. Accord- and memory and move towards the embryonic stir- ingly, during 1983, the Laboratory licensed its dis- rings of memos, forms and "guidelines." And as coveries and know-how in the two-dimensional gel frustrations build over the lack of a place to put techniques developed by Dr. James Garrels to a new one's car, or a desk for a new secretary, or a needed corporation beginning operations on Long Island computer attachment, we are beginning to accept (Protein Databases, Inc.). The company hopes to that planning may be more than a "bugaboo" or an develop these basic techniques to the extent needed infringement on academic freedom. Thus, in 1983, to make them viable as a clinical diagnostic tool of we began, under the leadership of a special com- major importance. mittee of our Board of Trustees, a detailed analysis We also licensed the H-ras oncogene isolated in of the Laboratory's infrastructure of physical and Mike Wigler's lab to the Actagen Corporation of personnel resources and of the directions in which New Haven, Connecticut. We are now conducting our research potentially might lead us. While the negotiations with a number of firms for use of the "business" considerations will be of continuing im- various ras oncogenes as potential probes for the portance for our guidance in the future, the studies diagnosis of cancer. most interestingly provided the framework for a The year's end marked the completion of a col- dramatic expression of consensus by the Board for laborative research project among the Laboratory, a serious commitment to plant genetics. Baxter-Travenol, and Genetics Institute. The proj- The studies also provided us with the opportunity ect successfully obtained, by recombinant DNA to present our future plans to a combined meeting techniques, a plasminogen activator substance of of the officials of the Village of Laurel Hollow. human origin which may be useful as a therapeutic Once again, we received their expression of appre- medicine for treating thromboembolism in humans. ciation and support. The Wellcome Foundation in Great Britain has now As we faced the necessity of upgrading our sup- taken over the project and will endeavor to scale- port facilities, the major expressions of which are up the process of making the substance and will do the new auditorium and the new additions to James the testing and experiments necessary to bring it to and Demerec, we sought out more creative financ- the public at the earliest possible time. ing arrangements which would relieve some of the strain on our capital and operating funds. With the cooperation of the Nassau County Industrial Devel- opment Agency, we received approval for an $8 Retiring from our Board after completing the six- million dollar development bond issue which was year limit in our By-Laws were Charles Cantor, In- immediately subscribed. The funds derived at low, stitutional Trustee from Columbia University, tax exempt rates of interest will be of immense ben- where he was Professor of Biology, who provided efit to the Laboratory's building program and by us much appreciated advice on both scientific and costing far less than otherwise possible, will result administrative matters, and Walter Frank,Jr., in substantial savings to the Laboratory. whose keen insight on financial markets served us so well while he was a member of the Finance and + + Investment Committees. We accepted the resigna- tion of John Carr after his move to Washington, As the Laboratory, and indeed the academic re- D.C., to head the Grumman Corporation office, search community in general, continued to explore which removed him from the possibility of contin- its relationships with industry, the question moved uing his invaluable help in a variety of administra- from the basic challenges of "should we" to "how tive areas. do we best" handle such relationships. These in- Dr. Eric Kandel, University Professor at Colum-

9 bia University Medical Center, was elected as an Institutional Trustee, making even more official his long-time association with the Laboratory. Mr. Taggart Whipple, partner in the law firm of Davis, Polk, and Wardwell, and John Klingenstein, partner in Wertheim Company, were newly elected as Individual Trustees.

After an extensive search to fill the post of Person- nel Director, we found an ideal replacement in Bill Putnam who brought to us many years of successful experience in personnel management, most re- cently at the Celanese Corporation. Margaret M. Heckler, Secretary of Health and Human Services We were also greatly pleased to appoint Susan Schultz as Grants Manager. Susan had previously served for two years as Grants Assistant and her great helpfulness and most pleasing personality are well-known to the staff. In September, the Laboratory joined the Ameri- can Cancer Society in a tribute to Mary Lasker for + + her contribution to the advancement of scientific research on the causes and cure of cancer. In con- Two festive occasions, which were orchestrated by junction with a Laboratory conference on "The David Micklos, highlighted our otherwise too in- Cancer Cell," which was dedicated to Mrs. Lasker, tensive summer of 1983. In June, the lawn at Air- a dinner was held in her honor at the Piping Rock slie, under the direction of Elizabeth Watson, was Club. Speakers included Secretary of Health and bedecked in splendor for an Appreciation Dinner at Human Services, the Honorable Margaret Heckler; which over 200 friends and neighbors honored the Director of the National Institutes of Health, Vin- combined forty years of service to the Laboratory cent DeVita, Jr.; President of the American Cancer by Walter Hines Page and Edward Pulling. For Society, Lane Adams; and Chairman of the Na- twenty-five years Mr. Page has served on the Boards tional Advisory Cancer Council, Benno Schmidt. of the Long Island Biological Association and of J. Michael Bishop was Master of Ceremonies and the Laboratory, mostly as President or Chairman. Jim Watson welcomed the guests. Unfortunately, Mr. Pulling has for the past fifteen years been an untimely illness prevented Mrs. Lasker's attend- Chairman of the Long Island Biological Associa- ance, but the speeches, so laudatory to her activi- tion and a member of the Board of Trustees of the ties, were recorded and presented to her. Laboratory. William R. Udry

Edward Pulling Walter H. Page

10 INFORMATION SERVICES

The Information Services Department was created Rippel Foundation to help purchase equipment for in 1983 to perform three major functions: (1) public the Monoclonal Antibody Extension to James Lab- relations, (2) fundraising for special projects, and oratory. (3) media relations. A long-standing objective to formalize and In the broadest sense, the department seeks to ex- strengthen the Laboratory's relationships with plain the Laboratory to various interest groups. To- companies that have expertise in genetic engineer- ward this end, two publications were initiated in ing/biotechnology was also realized. In 1983, fif- 1983. A multipurpose brochure, "Cold Spring Har- teen companies were recruited as charter members bor Laboratory: At the Horizon of Molecular Biol- of the 1984 Corporate Sponsor Program- Agrige- ogy," explains the history and current research ef- netics Corporation; Biogen, Inc.; CPC Interna- forts of the Laboratory in language understandable tional, Inc.; E.I. du Pont de Nemours & Company; to educated laymen. "Harbor Transcript" is a quar- Genentech, Inc.; Genetics Institute; Hoffman-La terly internal newsletter designed to keep employ- Roche, Inc.; Johnson & Johnson; Eli Lilly & Com- ees up-to-date on current events at the Laboratory. pany; Molecular Genetics, Inc.; Monsanto Com- During the year, the department coordinated sev- pany; Pall Corporation; Pfizer, Inc.; Schering Cor- eral special events held in conjunction with the poration; and Upjohn Company. Long Island Biological Association (LIBA). Also, Throughout the year, an effort was made to keep an educational outreach program was begun to pro- media outlets apprised of the activities of the Lab- vide tours and presentations for school and civic oratory. The department acted as liaison to sched- groups. ule interviews and filming sessions with print and The department coordinated successful efforts to broadcast journalists. A press conference held the find funding for the Undergraduate Research day of the announcement of the Nobel prize to Bar- Training Program and the Neurobiology Training bara McClintock was attended by media represen- Program. A major grant was also secured from the tatives from around the world. David Micklos

TWELVE YEARS OF LIBRARY SERVICE

The 1972 Annual Report states that the Laborato- brary loan, circulation, archives, and photocopy- ry's library collection numbered almost 25,000 vol- ing, have increased an overall 246 % to meet the umes. Interestingly enough, at the end of 1983 our needs of the 183 % increase in the Laboratory's collection numbered only 25,895. In 1973, approx- staff. imately 360 journal titles comprising 10,800 bound In 1972, a staff of two provided access to a stand- volumes were placed on permanent loan with The ard card catalog of books, 261 subscriptions, and State University of New York at Stony Brook. ten tedious manual searches from two complicated Placements such as this, and a program of contin- scientific sources for 56 scientists. Today, 5.5 staff uous weeding, account for the relative stability in members provide services that range from highly total volume count. This is the only library statistic technical on-line literature searches using over 170 that has not significantly increased in the past 12 databases covering all disciplines, through citation years. verification for grant applications and our Publi- In the areas of patron services and collection de- cations Department, to the acquisition of obscure velopment, the story is quite different. In these 12 historical materials for 165 scientists. years there has been a 75 % increase in journal sub- These sizeable increases in the numbers of pa- scriptions; the addition of two branch libraries, one trons, materials, and personnel make space the ma- for Neurobiology, the other for the Banbury Cen- jor priority of the library's long-range planning. It ter; the processing of 2100 bound books and jour- is essential to look at both renovation of the present nals per year; and the addition of several computer- facility and off-grounds storage to provide ade- based systems for business application and for ac- quate reader facilities. We look with pleasure to the cess to highly sophisticated scientific information completion in 1985 of the new auditorium which networks. All of this has contributed to the 161 % will allow our present tenants, the computer center, increase in materials being received. Information Services, and audio-visual services, a Patron services, including manual and comput- place of their own. erized scientific searches, ready reference, interli- Susan Gensel

11 PUBLICATIONS

In 1983 I began my 11th year at the Laboratory and series. Results to date indicate that savings of it was an exciting year indeed. Most exciting was 30 -40% on initial composition costs can be at- the move of the Publications offices to Urey cot- tained by keying and coding manuscripts on our tage, which was completely renovated and enlarged own system. Now with the space available in Urey, to meet the needs of the editorial, production, and we intend to expand our capabilities in this direc- order fulfillment functions. In 1983 we also saw our tion. all-time best-seller, Molecular Cloning, reach cu- The Urey facility has also made it possible to mulative sales of more than 22,500 copies. This was provide individual offices for the editors, which has not an unmixed blessing, however, since the unex- resulted in a level of efficiency not previously pos- pected continuing strong demand for this title ne- sible when they shared a communal office. The new cessitated three rapid reprintings during the year. building has allowed computerization not only of Net sales of all publications for 1983 were almost our own typesetting, but also of word processing $1,600,000 (with more than 35,000 units sold), and financial and scheduling management, as giving us a year second only to 1982 when Molec- planned for implementation in 1984, and the estab- ular Cloning was first released. Among the titles lishment of a true production group. published in 1983 were: a two-book set on Struc- With the number of new titles steadily increas- tures of DNA as volume 47 of the Symposia; Te- ing, the importance of our Marketing Department, ratocarcinoma Stem Cells, volume 10 in the series headed by Susan Gensel, becomes increasingly ev- Cold Spring Harbor Conferences on Cell Prolif- ident. In 1983, the Marketing Department achieved eration; three monographs -Nucleases, Molecular high visibility for our publications by exhibiting our Biology of the Yeast Saccharomyces: Metabolism titles at five major scientific conferences. They also and Gene Expression, and Lambda II; a collection prepared eight direct mailings (consisting of some of reprint articles entitled Readings in Tumor Virol- 16 flyers) that reached a total of 306,500 scientists, ogy; Muscle Development; and Genetic Maps vol- libraries, and universities. ume 2. The Publications Department was also re- Additional exposure is achieved through our on- sponsible for the production of two Strain Kits to grounds bookstore, operated by the Marketing De- accompany the lab manuals Experiments in Molec- partment. In 1983, bookstore sales amounted to $84,836 with 2994 books sold. Through both the well as the Annual Report and ten different Ab- bookstore and attendance at conferences, we are stract booklets for the Meetings Program. able to gather important information from our cus- Although scheduled to appear in 1983, volume 48 tomers so that we can better serve their needs. of the Symposia, Molecular Neurobiology, did not An aggressive program to increase our foreign make its appearance until early 1984, due to delays sales resulted in 1983 in overseas sales constituting at the printers. When published, however, it marked 32 % of our net sales, a 42 % increase over our 19 % a radical departure in policy, since it appeared si- in foreign sales in 1979. multaneously both in paperback and in its tradi- To provide better service to our expanding for- tional cloth binding. It isstill too early to tell eign market and our individual customers, Char- whether our aim of increasing unit sales of the laine Apsel, our Fulfillment Manager, instituted in Symposia to their previously higher levels will be 1982 services which address their special needs. achieved by offering the volume in the lower-priced The first allows foreign customers to opt for a ship- paperback format. ping service which provides 2-4-week airmail de- We also began a new series in 1983, Current livery overseas at less than standard airmail costs. Communications in Molecular Biology. This se- The second provides our individual customers with ries, composed of paperback editions of extended the convenience of having their orders billed to any abstracts, makes possible the rapid dissemination of three major credit cards. of information exchanged at small meetings fo- Both of these services have greatly increased the cused on rapidly expanding areas of research. The number of shipments made from the Laboratory, first two titles in the series, Plant Infectious Agents the end result being a 42 % increase in direct ship- and Enhancers and Eukaryotic Gene Expression, ments in 1983 over 1982. This has sorely strained appeared less than five months after their respec- our on-grounds storage capacity, and the acquisi- tive meetings. tion of sufficient local warehousing is just one of Work begun almost two years ago to establish our goals for 1984. codes and procedures to enable direct photocom- Nancy Ford position from our on-grounds computer also yielded results in 1983 with the publication of Nucleases and both volumes of our Current Communications

12 RESEARCH Barbara McClintock Nobel Prize in Medicine, 1983 MAMMALIAN CELLS

STRUCTURAL STUDIES

This past year of research on the structural and ide concentration to their respective standard, the functional organization of cells focused on molec- following protocol is now used. ular details and on integration of cell biological and One of the darkest films is selected as a model biochemical approaches. As we delve deeper into for the experiment. The model is matched carefully the individual components responsible for cell ar- to the standard pattern. (The standard is the collec- chitecture, we find that we have to return at some tion of all spots detected so far on this type of gel. point to the whole cell in order to understand more The broad pH range, 10 % standard currently con- fully the functional significance of a given molec- tains over 2600 spots.) The match of the model to ular component. More and more, as proteins are the standard is done by automatic procedures sim- identified as interesting spots on two-dimensional ilar to those described below, and the accuracy of gels, purified by some appropriate method, used to this match iscarefully checked by interactive elicit antibodies in rabbits and mice, and obtained graphics. Next, each of the other dark films is in the form of molecular DNA clones, the conver- matched first to the model and then to the standard, sation and ideas turn to attempts to study the pro- by completely automatic procedures. tein as an active part of the living cell. Thus, we Three automatic steps are involved in the match have pressed to advance our capabilities in the mi- of a typical film to a standard. The first step is the croinjection techniques and the subsequent "micro" selection of landmark matches between the film and cell biological assays that need to be done follow- the model. (Until recently, this was done manually.) ing injections. These types of experiments, which The second step is the automatic match of the film bring together virtually all of the various individu- to the model. The automatic matching process be- als working here in the field of cell structure, will gins at the landmark spots and uses spot-neighbor most likely continue to be an important tool for the relationships to match the rest of the pattern. Be- foreseeable future. cause the spots of the model have standard spot numbers (through its match to the standard), the spots of each film can also be assigned standard The QUEST System for Two- spot numbers as they are matched to the model. In dimensional Gel Analysis the third step of automatic matching, each spot hav- J.I. Garrels ing a standard spot number becomes a landmark to initiate a complete match to the standard. In this The QUEST software package for two-dimensional match, any spots on the film that were not present gel analysis has been further developed for the in the model have a chance to be assigned a stand- PDP-11/60 computer by the addition of several new ard spot number by direct match to the standard. matching programs. Matching of patterns contain- Matching the spots of a film to those of a previous ing up to 1500 spots is now completely automatic, matched (model) film from the same experiment is and very little manual editing or checking of the much more accurate than matching directly to the matched patterns is required. standard. Patterns from the same experiment are A typical experiment will generate about 40 gels, usually quite similar, whereas the standard pattern representing ten samples run on four different types is a much more complicated distribution of spots of two-dimensional gels (differing in pH ranges and derived from many experiments. slab-gel concentrations). Each gel is exposed to When all the dark films have been matched by the film three times (on the average) to detect the full above procedure, a cross-matching program is run range of spot intensities. Each film patternis to improve the match quality further. Each film of scanned into the computer, and spot detection and the group is automatically matched to each other integration take place automatically. To match the film of the group (using spots with identical stand- group of ten gels of a given pH range and acrylam- ard spot numbers as landmarks), and the results are

15 checked for internal consistency.If, during the selected for tumor formation followed by return to above matching procedures, any spots have failed culture. All SV40 transformants were isolated by to match or have been matched incorrectly due to McClure et al. (Cold Spring Harbor Conf. Cell gel distortion, the error will usually be corrected Proliferation 9: 345 [19821). The other lines stud- by the cross-match. Discrepancies that cannot be ied include a Kirsten murine sarcoma virus (Ki- conclusively resolved by the automatic program are MSV) transformant of REF52 (from B. Ozanne, flagged for operator inspection. Usually fewer than University of Texas Health Science Center, Dallas) 10 out of 1000 spots are flagged, and not all of these and two adenovirus-5 (Ad5) transformants of are actually in error. REF52 (from J. Logan and T. Shenk, SUNY, Stony After the darkest films have been matched, the Brook). For a typical sample, approximately 1500 next lightest exposure of each film is matched au- proteins are quantitated, matched, and entered into tomatically. This group does not use one model the data base. film; instead, the darker exposure of each gel serves A few general conclusions can be made from the as the model for the lighter exposure. The same au- baseline data already in the system. In independent tomatic procedure, followed by a cross-match, is clones of REF52 cells, approximately 6% of the used to complete the match of the lighter films. The proteins differ in intensity by more than twofold, very lightest films (used to quantitate actins, tubu- compared to approximately 4% when duplicate lins, and a handful of other major proteins) usually samples of the same clone are analyzed. REF52 require manual intervention because there are too cells do not change their protein composition rap- few spots for the operation of the automatic pro- idly during logarithmic growth; samples labeled 1 grams. day apart are as similar as duplicate samples la- This procedure is sufficiently accurate that we no beled on the same day. However, when confluent longer need to routinely check and edit each of the cells are compared with rapidly proliferating cells, matches. However, all FILMSPOTS (spot descrip- approximately 15 % of the proteins are found to dif- tion) files and MATCHLIST (match status) files are fer by more than twofold in rate of synthesis. preserved so that a graphic display of the match of In comparisons of normal and virus-transformed any film to another film or to a standard can be REF52 cells, we found that the series of focus-se- obtained at any future time. Manual editing, or fur- lected SV40 transformants are highly reproducible. ther automatic cross-matching, can be used to im- The same proteins are altered in each line relative prove the matches further at a later date, taking into to the control, although there are differences in the account new spots that may have been added to the degree of alteration. Comparison of a typical SV40- standard in the meantime. transformed line with normal REF52 cells reveals that about 20% of the proteins have been altered by twofold or more, but comparison of SV40-trans- Rat Protein Data Base formed lines with one another reveals that 5-8% of J.I. Garrels, B.R. Franza, Jr. proteins differ by twofold or more. When the pro- teins altered due to transformation were compared The gel-analysis software runs around the clock, with the proteins that differ in proliferating versus processing data from our large backlog of experi- confluent cells, no overall correlation was found. ments. Quantitative data from each film are This statistical comparison does not exclude some matched to standard patterns, as described in the proteins that are induced both in proliferating cells preceding report, and the standardized data are en- and in transformed cells, but it does show that a tered into the rat protein data base. Part of our data transformed cell is not just a normal cell held in a base consists of background information necessary highly proliferative state. for the interpretation of other studies, and part of The adenovirus-transformed lines are altered to it is composed of data from experiments of great a much greater extent relative to REF52 than are immediate interest. The background part of the data the SV40-transformed lines. More than 30% of the base that has already been established includes data total proteins are altered by more than twofold in from five clones of REF52 cells, data from six each of our two adenovirus-transformed lines. In- SV40 transformants of REF52 cells selected by fo- terestingly, many of the same proteins are affected cus formation in monolayer culture, data from by SV40 and by adenovirus, but the magnitude of REF52 cells labeled for differing lengths of time, the alteration is greater for adenovirus transforma- and data from a large experiment in which normal tion. REF52 cells and nine virus-transformed REF52 de- One of our recent interests has been the proteins rivatives were each labeled at five time points dur- that respond to serum stimulation in normal and ing their growth to confluence. The latter ex- transformed cells. Normal, SV40-transformed, and periment includes data from two of the SV40 Ad5-transformed REF52 cells were held in low transformants selected by focus formation, two serum until proliferation had stopped (in REF52) SV40 transformants further selected for growth in or slowed significantly (in the transformants). Cells soft agar, and two SV40 transformants yet further were labeled at several times after the addition of

16 fresh serum. Data for about 1000 spots have been Experiment 663 (Fig. 1, fourth graph) shows the quantitated and entered into the data base. Both response of normal cells at 0, 1, and 21 hours after early and delayed responses to refeeding have been refeeding (samples A-C), of SV40-transformed identified. One of the most interesting delayed re- cells at the same time points (samples D-F), and of sponses is the protein PCNA (proliferating cell nu- Ad5-transformed cells at the same time points clear antigen), or cyclin. This protein is identified (samples G-I). Other experiments (not shown) con- on a section of the standard map in Figure 1. Each firm that PCNA synthesis in normal REF52 cells is of the graphic inserts plots the relative intensities stimulated between 8 and 16 hours after refeeding. of PCNA for each sample in one of the experiments Each of the transformants maintains an elevated from the data base. (Users of the graphics worksta- level of PCNA synthesis even during serum depri- tion can obtain such graphs for every experiment vation, and this level is not further induced by analyzed and for every spot on the standard map.) serum stimulation. The relative levels of PCNA in this experiment are consistent with the levels found in experiment 532, in which normal REF52 and the nine transformed lines were compared (for further details, see Fig. 1). 4 Proteins of L6 skeletal-muscle cells have been Upc BC/E,IJO P analyzed throughout the period of differentiation in VT 1 culture. L6 cells labeled for long and short periods . lifeMg 4114. of time have been analyzed to measure turnover lib P. rates, and phosphoprotein patterns have been ob- 40, tained. A group of proteins, identified as actin-fil- ament-binding proteins by the monoclonal anti- body studies of F.Matsumura, S. Yamashiro- Matsumura, and J. Lin (this section), was found to be induced during muscle differentiation. Each of these becomes fully phosphorylated over a period of 4 hours after synthesis. Future entries into the rat protein data base will consist of many more transformed lines, especially lines or REF52 cells transformed by introduction Figure 1 of cloned oncogenes (see report by B.R. Franza, Display of data-base information for the protein PCNA. A re- Oncogene Section). New oncogene protein prod- gion of the standard rat-protein map was displayed on the ucts are being identified as monoclonal antibodies graphics monitor, and the PCNA spot was selected (at white become available, and the expression and modifi- cross-hair). Four experiments from the data base were selected cation of each of these proteins will be examined (experiment numbers are at the top of each graph), and the re- sults for the PCNA spot from each experiment were plotted on for each of the transformed lines. Studies of other the screen. Each graph shows the relative intensity of the spot cell types, including muscle cells, NRK cells, pri- for each of the samples generated in the experiment, normal- mary rat kidney cells (in collaboration with H.E. ized so that the highest intensity is at full scale. (Quantitative Ruley, Tumor Virus Section), and PC12 pheo- data, expressed as spot dpm divided by total incorporated dpm, chromocytoma cells(in collaboration with W. are simultaneously displayed on another terminal.) In experi- Huse) are extending the data base to more types of ment 435, each sample (A-C) represents a different clone of normal REF52 cells. In experiment 433, the samples were la- rat cells. We hope in the future to expand the ca- beled with [35S]methionine for 30 min (A), 2 hr (B), 24 hr (C), pacity of our computer facility and to make more 24 hr followed by 2-hr chase (D), and 24 hr followed by 48-hr graphic workstations available so that more users chase (E). In experiment 532, normal and transformed REF52 can interact with the protein data bases. cells were labeled in log phase growth for 2 hr. The samples are normal REF52 cells (A), focus-selected SV40 transform- ants (B,E), agar-selected SV40 transformants (C,F), tumor-se- Microfilaments in Normal and lected SV40 transformants (D,G), Ki-MSV transformant (H), and Ad5 transformants (IA. The latter Ad5 transformant does Transformed Cells: Changes in the not produce the E1B 57K viral protein. In experiment 663, nor- Multiple Forms of Tropomyosin mal REF52 cells (A-C), focus-selected SV40-transformed cells (D-F), and Ad5-transformed cells (G-I) were deprived of serum F. Matsumura, J.J.-C. Lin, for 60 hr, followed by addition of fresh serum. Samples A, D, S. Yamashiro-Matsumura and G represent the serum-deprived cells; samples B, E, and H represent cells labeled 1 hr after refeeding; and samples C, F, As described in last year's annual report, we have and / represent cells labeled 21 hr after refeeding. All labelings found changes in tropomyosin patterns of microfil- were done for 3 hr. Note that the user of the graphics worksta- aments between normal and virus-transformed rat tion can obtain such graphs for any experiment in the data base and for any spot on the standard map. Equipment for recording cultured cells. To examine whether these changes the graphic data on instant Polaroid prints and slides is now in tropomyosin patterns are a common phenome- available. non with transformation, we have extended similar

17 studies to human and mouse cells with different and reorganization of the microtubules in response types of transformation. These cells included NIH- to transformation. 3T3 cells transformed by transfection with tumor We have modified a method adapted from Mat- DNA, BALB/c-3T3 cells transformed with chemi- sumura et al. (J. Biol. Chem. 285: 6636 [19831) in cal carcinogen or by UV-irradiation, human fibro- which a mouse monoclonal IgM antibody that binds blasts transformed with chemical carcinogen, and both a- and 13-tubulin subunits, SBMAP-D3 (here naturally occurring tumor cells from human. Like called D3), was used to harvest cellular microtu- the viral transformation of rat cultured cells, we bules. This was selected over the classic method of have found that the level of one or two of the major purification by reversible temperature-dependent tropomyosin forms with a higher molecular weight assembly of microtubules because the concentra- is decreased or missing, and the level of one of the tion of tubulin in cultured cells was low and micro- tropomyosin forms with a lower molecular weight tubules are very labile. After several experiments, is increased in all types of transformed cells so far we determined optimal conditions to stabilize cy- examined. Because the changes in tropomyosin toplasmic microtubules: We found that brief expo- patterns are well correlated with morphological sure of the cell lysate to the plant antitumor drug transformation, we suggest that differential expres- taxol was necessary. Taxol, a drug that stabilizes sion of tropomyosin forms in microfilaments may microtubules in cells, used in combination with D3 be responsible for the rearrangement of actin ca- antibody allowed us to remove intact microtubules bles in transformed cells. from the cytoplasm for subsequent analysis without prior disassembly. When a lysate is obtained by gentle disruption of the cells followed by low-speed spin (12,500g for Molecular Analysis of Microtubule 15 min) to remove nuclei, large membrane frag- Components in Normal and ments, and insoluble 10-nm filaments, the dis- Transformed Cells persed assembled microtubules will not sediment. S.H. Blose, G. Blose, F. Matsumura To this supernatant (total protein concentration of 6-8 mg/ml) was added 0.3 volume of D3 mono- Two important properties of cancer cells are their clonal antibody ( -- 7 mg /ml), and the mixture was ability to grow by cell division and to move in the incubated 30-45 minutes at 37°C to allow D3 to invasion of tissue. The microtubule system of the aggregate the microtubules. The mixture was spun cytoskeleton is intimately involved in both proper- at 12,500g for 7 minutes, and the pellet was then ties: (1) It sets up the mitotic spindle apparatus re- washed three times with Buffer B. The final pellet sponsible for the movement of chromosomes into was then analyzed by negative-stain electron mi- daughter cells as part of cell growth; (2) microtu- croscopy and one- and two-dimensional SDS gel bule depolymerization has been shown to regulate electrophoresis. Electron microscopy confirmed the initiation of cellular DNA synthesis; and (3) the that the isolated microtubules were in their native- polarity of the system indicates the direction of assembled state aggregated and decorated with the movement a cell is taking. Several studies in the antibody (Fig. 2) versus a denatured precipitated late 1970s investigated the tubulin content (the ma- aggregate. The major constituent proteins con- jor constituent protein of microtubules) of normal sisted of a- and 0-tubulin plus several other asso- and transformed cells and found virtually no differ- ciated proteins (Figs. 3 and 4). Autoradiographs ence in the total chemical amount between both were made from dried Coomassie-blue-stained two- 0-tubulin types of cells. However, several studies proposed dimensionalgels,and the a- and that the pool of disassembled tubulin was increased spots were cut out of gels obtained from the total in transformed cells. The regulation of microtubule lysate and the antibody precipitate. We found that assembly has been attributed in part to the micro- this method enables us to recover 60-70% of the tubule-associated proteins, MAP-1 (M, = 330,000) cell's tubulin within 2-3 hours from modest num- and MAP-2 (M, = 300,000), and a MAP called tau bers of cells(as compared with conventional (four proteins with M, between 50,000 and 68,000). cycling methods, which recover - 10% in a longer In addition to these, several new MAPs of cultured time from many liters of cells). One of the proteins cells with unknown function have been described. that coisolates with the microtubules was the M, Therefore, the expression, modification, and be- 73,000 heat-shock protein (hsp73) (Fig. 4, spot 1). havior of the MAPs may regulate the microtubule Approximately 10% of the cell's hsp73 was re- assembly dynamics that are ultimately linked to covered associated with the microtubules. This growth and movement. We initiated pilot studies to protein has been postulated to associate with 10-nm isolate the intact microtubule complex from normal filaments and/or microtubules, and we propose to and transformed cells to determine whether any determine whether it is a cross-linking protein. By molecular component of the microtubules such as counting the radioactive spots, we can quantitate the the MAPs was altered. We felt that this might lead amount of putative MAPs that are removed from to an understanding of what controls the assembly the total cell protein. We will use this information

18 A 4

Figure 2 Electron micrograph of D3-antibody-induced microtubule aggregate from NRK-1570 cells negatively stained with 2% aqueous uranyl acetate. Arrowheads indicate positions of the antibody (IgM) decorating the microtubules (MT) with a periodicity of -24 nm. The antibody cross-linked (X) adjacent microtubules.

S 1 23 4 567 89 10 11 23 45 67 89 10 1 1

2 0 0

94 68 57a 543.- 45

AUTORADIOGRPM Figure 3 One-dimensional SDS gel (11.5% acrylamide; 0.1% bis-acrylamide) stained with Coomassie blue (STAIN), dried, and exposed as an autoradiogram for 15.5 hr at 20°C. NRK-49F (NRK-1570) cells were grown to near confluence in three 24.5-cm2 dishes, and cells at the same density in one 100-mm-diameter dish were metabolically labeled with [35S]methionine (750 ACi [35S]methionine, 16 hr, in 2.5% calf serum and media lacking methionine). All cells were then combined and processed for rapid isolation of microtubules as described. (Lane 1) Total cell homogenate. (Lane 2) First pellet (Pt) obtained from the 12,500g spin for 15 min. P, contains the 10-nm filaments (vimentin), the nuclei, and other large sedimentable particles. (Lane 3) First supernatant (S,) from the low-speed spin. (Lane 4) Material that sediments (12,500g, for 15 min) after the S, is incubated for 30 min at 37°C. Microtubules do not pellet at this stage. (Lane 5) Supernatant (S1-S) obtained after incubation of SI at 37°C and centrifugation. To S1-S was added the monoclonal antibody D3 (anti-a/13 tubulin); the mixture was incubated for 40 min at 37°C to aggregate the microtubules and then centrifuged at 12,500g for 7 min to sediment the antibody-induced aggregated microtubules (P2) from the supernatant (S2). (Lane 6) P2 after being washed three times each in 5-10 volumes of buffer by suspension and sedimentation. In the stained gel, the heavy (H) and light (L) chains of D3 (IgM) antibody are seen, as well as a-tubulin (a) and 13-tubulin (b) of the harvested microtubules. In the corresponding autoradiograph, both tubulin subunits are heavily labeled with [35S]methionine. The displacement of radioactive peptides occurred due to the unlabeled heavy (H) and light (L) chains. This P2 is analyzed in lane 6. (Lane 7) Pooled supernatants obtained from the three washes of P2. They contain very little tubulin. (Lane 8) S2 does not have any remaining antibody. All of the antibody is found in the P2. (Lanes 9-11) Control in which buffer is substituted for antibody. (Lane 9) Control P2 showing only trace amounts of the tubulin subunits. (Lane 10) Pooled wash supernatants of the control P2. (Lane II) S2 from the control. (Lanes 1-5, 7, 8, 10, 11) Isovolumetric loads relative to the total homogenate (10 81 per lane); (lanes 6,9) P2s were suspended in 50 Al of sample buffer, and 10 Al was loaded per lane. Lane S contains the M, standards expressed as M, x 10-3; actin (M, = 45,000), a-tubulin (M, = 57,000), and (- tubulin (M, = 54,000) are included as standards.

19 that were expressed in very low amounts in the NRK-1569 a transformed cells. We are currently evaluating the relationship of these proteins to microtubule stabil- ity and proteins associated with the mitotic spindle.

_1 23 Purification and Characterization of Multiple Forms of Tropomyosin in Normal and Transformed Rat Cultured Cells S. Yamashiro-Matsumura, F. Matsumura

1`31, 1I I4 Rat cultured cells have five forms of tropomyosin - NRK-1570 TM-1 (M, = 40,000), TM-2 (M, = 36,500), TM-3 (M, = 35,000), TM-4 (M, = 32,400), and TM-5 (M, = 32,000). Of these, three (TM-1, TM-2, and TM-4) are major tropomyosins (normal-cell tro- pomyosin) in normal cells, and two (TM-3 and TM- 2 3 -.1 5) are major tropomyosins (transformed-cell tro- pomyosin) in transformed cells. We have purified and partially separated normal- and transformed- 6o- cell tropomyosins to examine whether these multi- 410.- -08 ple forms of tropomyosin play different roles in the organization of microfilaments between normal and -49 transformed cells. fir- 11,21314 By hydroxyapatite column chromatography, a mixture of multiple forms of tropomyosin was sep- Figure 4 arated into four fractions, i.e., pure TM-4, pure Autoradiographs of two-dimensional gels of D3-antibody-har- TM-5, a mixture of TM-3 and TM-1, and a mixture vested microtubules obtained from KNRK cells (NRK-1569) and of TM-2 and TM-1. Using these fractions, we have NRK-49F cells (NRK-1570) metabolically labeled with examined some biochemical properties. Like mus- [35S]methionine. Alpha and beta indicate the positions of the tubulin subunits. Proteins numbered 1-14 (arrowheads) were cle tropomyosin, TM-1, TM-2, and TM-3 had found in association with the microtubule complexes. In the higher apparent molecular weights on SDS gels and KNRK complex, proteins 1 and 4 were found to be increased; showed a higher actin affinity (105) than that 2, 3, and 5-11 were decreased; and 12-14 were absent when ( 104) of TM-4 and TM-5 with lower molecular compared with NRK-49F. Protein 4 was not detected in NRK- weights. Moreover, polyclonal rabbit antiserum 49F. Act indicates the position of actin. Protein 1 is identified as the heat-shock protein hsp73, and proteins 2 and 3 appear to against smooth-muscle tropomyosin also showed be related to mitochondrial protein 24 of Bravo et al. (Cell Biol. much higher affinity to high-molecular-weight tro- Int. Rep. 5: 93 [1981]). The differences in spot intensities ap- pomyosins (TM-1, TM-2, and TM-3) than to low- pear to be related to the cell phenotype and growth character- molecular-weight tropomyosins (TM-4 and TM-5). istics: NRK-49F cells grow slowly and are flat; KNRK cells These results suggest that high-molecular-weight are very round and rapidly proliferate. tropomyosins may be similar to muscle tropomyo- sins. We have also examined whether these five as a guide to establish what is an associated protein forms of tropomyosin are homo- or heterodimers. versus a contaminant derived from coprecipitation. Although TM-3 did not make an S-S dimer with the For instance, in Figure 4, actin (Act) was found with oxidization of cysteine residues, all of the other the microtubule complexes. Although it is thought forms of tropomyosin were found to form homodi- that actin may bind to MAPs such as MAP-1, it is mers. Because the formation of homodimers ap- thought not to be a MAP. The spot was counted and pears to be more than 90% in each form of tropo- found to represent approximately 0.26% of the cell's myosin, it is likely that all five forms of troponi- total actin, indicating a possible contaminant. When yosin are present as homodimers. microtubule complexes were compared between Amino acid compositions of these five forms of normal NRK (1570) cells and NRK (1569) cells tropomyosin were examined. Normal-cell tropomy- transformed by Kirsten sarcoma virus, several dif- osins (TM-1, TM-2, and TM-4) showed composi- ferences in associated proteins were observed. Spot tions very similar to those of muscle tropomyosins. 1, the M, 73,000 heat-shock protein (hsp73), was Interestingly, however, the amino acid composi- elevated in the transformed cells (NRK-1569), and tions of transformed-cell tropomyosins (TM-3 and spot 4 was only observed in the transformant. The TM-5) are considerably different, although their normal cells exhibited several proteins (spots 5-14) amino acid compositions are very similar to each

20 other. The contents of glutamic acid, lysin, argi- However, little is known regarding how actin-bind- nine, and leucine residues in transformed-cell tro- ing proteins organize actin cables in cultured cells pomyosin were two times less than those in normal- and what role the proteins play in the disorganiza- cell tropomyosin, whereas the contents of serine, tion of actin cables upon cell transformation. As glycine, and phenylalanine in transformed-cell tro- the first step in addressing these questions, we have pomyosin were increased 2-3 times. In spite of purified some actin-binding proteins using a these differences in amino acid compositions, both method utilizing actin affinity. Briefly, muscle ac- normal- and transformed-cell tropomyosins are tin was mixed with the supernatant of HeLa cell recognized with either monoclonal or polyclonal homogenates, and the resultant actin gel was pre- antibody against tropomyosin, suggesting that these cipitated by a low-speed centrifugation. The actin two types of tropomyosins share a stretch of ho- gel was depolymerized, and proteins bound to actin mologous sequence. were separated on a DEAE-cellulose column. By this simple and rapid method, we could prepare fi- lamin and a-actinin and a yet unknown actin-bind- Tropomyosin Isoforms in Normal and ing protein with a relative molecular weight of RSV-transformed CEF Cells 55,000. The 55K protein is a monomer with a na- J.J.-C. Lin tive molecular weight of 55,000. It has a Stokes' radius of 32 A and a sedimentation coefficient We have identified seven polypeptides in chicken (S20, of 4.35. The protein bound to actin at a stoi- embryo fibroblasts (CEF) as tropomyosins (Lin chiometry of four actin molecules to one 55K pro- et al., J. Cell Biol. 98: 116 [1984]). Of these, spots tein. The protein caused F-actin to aggregate side 1 (M, = 38,000), 2 (M, = 36,500), 3a (M, = by side into bundles as do other F-actin-bundling 32,800), and 3b (M, = 32,800) were major forms, proteins such as fimbrin (M, = 68,000) and fascin whereas spots a (M, = 45,000), b (M, = 43,000), (M, = 55,000). Although a proteolytic fragment and c (M, = 38,000) were relatively minor. Spots of fimbrin had the same molecular weight 3a and 3b, as well as spots 1 and c, had a slight (M, = 55,000), the 55K protein did not comigrate difference in their pI values. All of these polypep- with this proteolytic fragment on two-dimensional tides were found to be associated with microfila- gels. Antiserum against either fimbrin or fascin did ments. These tropomyosin isoforms have also been not cross-react with this 55K protein. It is not likely purified from CEF by the combination of heat that the 55K protein is a proteolytic fragment be- treatment, ammonium sulfate fractionation, and cause the same 55K protein is found in freshly pre- DEAE chromatography. The purified tropomy- pared total cell lysates. Further characterization, osins (particularly, 1, 2, and 3) showed different including the localization in cultured cells and the binding to F-actin under conditions of 100 Mm KC1 differences between normal and transformed cells, and no Mg" . Other biochemical and biophysical is in progress. properties of these isoforms of tropomyosin are un- der investigation. Using the microfilament isolation method that we developed (Lin, et al., J. Biol. Chem. 258: 6636 Production of Monoclonal Antibodies to [1983]), we have compared the protein patterns of Tropomyosin Isoforms the microfilaments from normal and RSV-trans- C.-S. Chou, J.L.-C. Lin, J.J.-C. Lin formed CEF cells. In addition to the previous find- ing that tropomyosins 1 and 2 were greatly reduced Multiple forms of tropomyosin have recently been in transformed cells (Hendricks and Weintraub, observed to be present in a single cell type. During Proc. Natl. Acad. Sci. 78: 5633 [1981]), we have muscle differentiation, tropomyosin switched from found that the relative amount of tropomyosin 3 was one isoform to another. Moreover, in many trans- increased. Because of the different actin-binding formed cells, tropomyosin isoforms with higher ap- properties observed for tropomyosins, the change parent relative molecular weights tended to de- in tropomyosin isoform expression may be respon- crease or disappear, whereas another form of sible for the reduction of actin cables and the alter- tropomyosin with a lower apparent relative molec- ation of cell shape found in transformed cells. ular weight was increased. The intracellular local- ization and functional properties of these tropomy- osin isoforms are not understood. To address these Purification and Characterization of questions, we have used in vivo and in vitro im- 55K Actin-bundling Protein from munization methods to generate many monoclonal HeLa Cells antibodies (mAbs) against specific isoforms of tro- S. Yamashiro-Matsumura, F. Matsumura pomyosin from chick cells. For example, mAb CL2 reacted strongly with a striated muscle form of tro- It is believed that actin-binding proteins regulate pomyosin, whereas no reactivity or poor reactivity the organization of actin cables in cultured cells. was detected for the smooth-muscle form or fibro-

21 blastic form, respectively, of tropomyosin. The to all five forms of fibroblast tropomyosin. The reactivity for the 13 form of skeletal-muscle tro- cloned cDNAs will be used to study the structure pomyosin was threefold stronger than that for the and organization of these genes, as well as their a form. mAb CH1 recognized both a and 6 forms expression in normal and transformed cells. of skeletal-muscle tropomyosin equally well but did not react with either the smooth-muscle or the fi- broblastic form. mAb CG1, obtained from the fu- sion with smooth-muscle tropomyosin as immuno- Isolation of Cytoskeletal Genes gen, reacted preferentially to the a form of smooth- S. Hughes, J. Feramisco, D. Helfman, muscle tropomyosin. By Western blot analysis, N. Maihle, T. Kost, Y Kataoka, E. Kosik CG1 also reacted with CEF tropomyosin; however, by indirect immunofluorescence, only some popu- The long-range goal is to develop a system in which lations of CEF showed staining with this antibody. it is possible to study and to alter the patterns of The significance of these results is currently under expression of gene families that have tissue-spe- investigation. cific gene products (e.g., the cytoskeletal proteins). We wish to ask questions about the functional dif- ferences between the various gene family members expressed in specific cell types. We are developing Expression of Tropomyosin in Normal retroviral vectors appropriate for use in primary and Transformed Cells cell culture and ultimately for use in vivo. Such D. Helfman, Y. Kataoka vectors will be used to cause the expression of par- ticular genes in cells (or tissues) where they are not Transformation of cells by DNA and RNA tumor normally expressed. These experiments can be used viruses has profound effects on the organization of to look for subtle functional differences between the cytoskeleton, including disruption of the micro- proteins encoded by the various members of a gene filament organization. However, the molecular, family. In addition, the vectors can be used to ana- biochemical, and structural bases for these altera- lyze a variety of mutant genes, either naturally oc- tions of the actin cables are poorly understood. Re- curring or created in vitro, and to test the functions cent studies have suggested that alterations in the of recombinant genes made between different pattern of tropomyosin expression may be involved members of particular gene families. in the rearrangement of stress fibers and that this The chicken was chosen as the experimental ani- may be responsible for morphological alterations mal because chick embryos are a simple and inex- seen in transformed cells (see Matsumura and co- pensive source of material for the isolation of cell- workers, this section). We have begun to study the type-specific RNA and for the preparation of a nonmuscle (rat embryonic fibroblast) forms of tro- variety of different types of primary cultured cells. pomyosin and the genes that encode these proteins. In addition, Rous sarcoma virus appears to offer We have constructed a cDNA expression library of significant advantages as a prototype vector for approximately 100,000 members from rat embry- these experiments. Our efforts have been focused onic fibroblast RNA using the plasmid expression on two convergent pathways: (1) development of the vectors pUC8 and pUC9. Using both an immuno- retroviral vectors and (2) development of proce- logicalscreening procedure and "P-labeled dures for the rapid identification of genes that ex- cDNAs, we have identified and isolated at least press low to moderate levels of RNA. These tech- three different classes of clones. One set of clones niques have made it a relatively simple procedure has been identified by hybrid-selection translation to identify several cytoskeletal genes in the chicken. to contain sequences complementary to tropomy- Although the analysis of these genes is far from osin 1 (m.w. 40,000). Overlapping clones contain- complete (see below), a reasonable start has been ing the entire coding region and the entire 3'-un- made. translated region for tropomyosin 1 have been We believe that sufficient progress has been made identified and are being sequenced to determine the on both projects so that the initial attempts to rein- primary structure of the protein. Northern blot troduce specific cytoskeletal genes with the retro- analysis reveals a transcript of approximately 1.2 viral vectors will come in the next 6 months. kb. Furthermore, this transcript is absent in aden- We initially screened genomic libraries directly ovirus-transformed REF52 cell lines (Ad5D.1A and for cytoskeletal genes, and although we were able Ad5D.4A). These two cell lines were previously to isolate and identify clones that encode the shown not to contain tropomyosin 1(see Matsu- chicken fi-actin gene, the protocols are inefficient. mura and co-workers, this section). Thus, it would To facilitate the rapid identification of genes, we appear that transcription of tropomyosin 1 is shut have developed a method for the immunological off in these cells. We are continuing to isolate and screening of cDNA expression libraries (Helfman characterize other cDNAs and hope to obtain clones et al., Proc. Natl. Acad. Sci. 80: 31 [1983]). With

22 these techniques, cDNA clones from rare to mod- poly(A) tail. In contrast to the chick skeletal-mus- erately abundant mRNAs may be readily identi- cle actin gene, the 0-actin gene lacks the cysteine fied. To test the general utility of the procedures codon between the initiator ATG and the codon for we use, we have collaborated with several labora- the aminoterminal amino acid of the maturepro- tories to identify particular cDNA clones. The ini- tein. In the 5'-flanking DNA, 15 nucleotides down- tial experiments have been done with a cDNA li- stream from the CCAAT sequence, there is a tract brary containing approximately 100,000 members of 25 nucleotides that is highly homologous to the made from chick smooth-muscle mRNA. Two sets sequence found in the same region of the rat 0-actin of expression clones from the library have been gene. characterized by DNA sequence and hybrid selec- tion-translation. a- and 13- Tropomyosin cDNA clones from smooth The first set of cDNA clones that were isolated muscle. Two cDNA clones for a-tropomyosin specify smooth-muscle tropomyosin. A full-length were isolated from a small (-- 10,000 members) cDNA clone (1100 bp) has been completely se- cDNA library prepared from smooth-muscle RNA. quenced (Helfman et al., J. Biol. Chem. [in prep.]), Subsequently, a larger smooth-muscle library and overlapping genomic clones have been isolated ( - 100,000 members) was rescreened for tropomyo- and partially mapped. Northern analysis reveals sin clones with both cDNA and immunological re- tissue-specific transcripts. The second set of cDNA agents. In all cases the cDNA was inserted via clones specify smooth-muscle tropomyosin. A par- EcoRI and Sall linkers. The order in which the tial cDNA clone has been partially sequenced, and linkers were added determines the orientation of the genomic clones have been isolated but not fully insert; the cDNAs were matched to the expression characterized. Northern analysis reveals tissue- plasmids pUC8 and pUC9 such that the cDNA was specific transcripts. appropriately oriented for expression in Esche- Several other clones have been isolated, usually richia coli. The pUC9 portion of the library con- as collaborations. These are less well character- tained 13 clones that could be detected with the ized, most having only been identified as antibody- DNA probe, two of which reacted with anti-tropo- positive clones, and they include a-actinin, 36K myosin antisera. The pUC8 portion of the li- protein (the major src tyrosine phosphorylation tar- brary contained 39 clones that could be detected get), myosin light-chain kinase, ATPase, with cDNA and 13 clones that reacted with anti- 70K heat-shock protein, and spectrin. To complete tropomyosin antisera. Two of the clones from the the isolation and characterization of tissue-specific pUC8 library reacted with antisera were not de- genes, other cDNA expression libraries are being tected with a-tropomyosin cDNA. These two clones prepared and screened. Either complete or in prep- have been shown by hybrization/translation to con- aration are the following cDNA libraries: tain 0-tropomyosin cDNA. 1. Rat fibroblast cDNA library. This library is All three clones from the pUC8 library that must be checked by DNA sequencing have identical 3' complete and has been screened both with DNA termini. None of these clones contain the poly(A) probes and with antibodies to tropomyosin. tail or the sequence normally associated with poly- 2. Chick fibroblast cDNA library. The cDNA has adenylation. The simplest explanation is that there been prepared, ligated to plasmid, and tested by is a natural Sall at the 3' end of the message for transformation on a small scale. The cDNA is a- ready for large-scale transformation. tropomyosin. This would also explain why there are relatively fewer clones in the pUC9 library and why 3. Chick striated-muscle cDNA library. The cDNA only a small percentage of the pUC9 clones can ex- has been prepared, ligated to plasmid, and tested press a tropomyosin-related protein. by transformation on a small scale. The cDNA is ready for a large-scale transformation. The clones that express a-tropomyosin in E. coli contain cDNAs that encode anywhere from the car- boxyterminal third of the gene up to the entire cod- The chicken i3 -actin gene.The nucleotide se- ing region. When lysates of the clones were ana- quence of the chicken 0-actin gene has been deter- lyzed on SDS-acrylamide gels, the tropomyosin- mined. The gene contains five introns: four introns related proteins could be seen by staining. Despite interrupt the translated region at codons 41/42, 121/ the fact that all the proteins are made from the LacZ 122, 267, and 327/328 and a large intron occurs in promoter/AUG, there were considerable differ- the 5'-untranslated region. The gene has a 97-nu- ences in the steady-state level of tropomyosin-re- cleotide 5'-untranslated region and a 594-nucleo- lated protein present in the lysates. These differ- tide 3'-untranslated region. A slight heterogeneity ences did not correlate with the sizes of the in the position of the poly(A)-addition site exists; fragments. Furthermore, clones that contained dif- polyadenylation can occur at either of two positions ferent-size cDNAs contained common carboxyter- two nucleotides apart. The gene codes for an minal protein fragments, which are probably pro- mRNA of 1814 or 1816 nucleotides, excluding the duced by proteolysis.

23 These observations suggest two things. First, a preted to indicate that cultured cells synthesize tub- reasonable percentage of the clones that contain an ulin constitutively unless the subunit pool rises authentic insert can be expected to produce an im- above a specified level. At this point an autoregu- munologically detectable protein in E. coli; sec- latory control mechanism is triggered that sup- ond, at least for tropomyosin, certain "domains" presses new tubulin synthesis through specific loss exist that are reasonably stable in E. coli. Since the of tubulin mRNAs. That tubulin RNA levels are cloning protocol in effect scans through the gene, dramatically lowered by microtubule depolymeriz- the immunological screening procedure has a di- ing drugs is unquestionably correct; that fluctua- verse set of clones to search through for those that tions in the depolymerized tubulin pool size are re- produce proteins that are relatively stable in E. coli. sponsible for altered RNA levels rests, however, entirely on the presumptive effects of different mi- The smooth-muscle a-tropomyosin sequence. Two crotubule drugs. This caveat is not trivial, as these of the cDNA clones contained the entire a-tropo- drugs induce gross morphological alterations, and myosin-coding region; one of these clones was the specificities and detailed mechanisms of action sequenced. Despite the fact that the clone clearly of such drugs remain poorly understood. To inves- selects the RNA for a-tropomyosin in hybridiza- tigate the effect of altered levels of tubulin subunits tion/translation experiments, the sequence is much on the rate of new tubulin synthesis in mammalian closer to the rabbit skeletal-muscle 13-tropomyosin cells, we have microinjected purified tubulin sub- than to rabbit skeletal-muscle a-tropomyosin. units into cells in culture and analyzed the synthe- However, the a-13 designation is based on the posi- sized proteins. We have found that tubulin synthesis tion of migration of SDS-polyacrylamide gels, and is rapidly and specifically suppressed by injection since all three proteins contain 284 amino acids, of an amount of tubulin roughly equivalent to the a-a designation may be somewhat arbitrary. 25-50% of the amount initially present in the cell, What is more interesting is that the major differ- thus indicating the presence of a eukaryotic, auto- ences between the chicken smooth-muscle a-tro- regulatory control mechanism that specifies tubu- pomyosin and the rabbit skeletal-muscle a- and /3- lin content in a cultured mammalian cell line. tropomyosins are in the carboxyterminal portion of the proteins. Skeletal-muscle tropomyosins interact with troponin in vivo; nonmuscle tropomyosins ap- parently do not. The site of interaction with tro- Role of the Cytoskeleton in Gene ponin is in the carboxyl terminus of the skeletal- Expression Induced by Heat Shock muscle tropomyosins. W.J. Welch, S.H. Blose, J.R. Feramisco What reinforces the interpretation that these dif- ferences have functional significance is the obser- Although there has been considerable interest and vation that the carboxyterminal portion of the speculation concerning the function of the cytoskel- chicken smooth-muscle a-tropomyosin is closer in eton in gene expression and signal transduction sequence to equine platelet tropomyosin than it is into the nucleus, few direct tests of these possible to either of the skeletal-muscle tropomyosins. cytoskeletal functions have been made. We have used the gene-expression changes induced by heat shock as one model to examine the necessity (or lack thereof) of cytoskeletal integrity for appropri- ate gene switching to occur. As heat shock induces Elevation of Tubulin Levels by the synthesis of several discrete mRNAs, which are Microinjection Suppresses New translated into readily identifiable protein prod- Tubulin Synthesis ucts, and induces the translocation of one of the J.R. Feramisco [in collaboration with D. W. heat-shock proteins into the nucleus and nucleoli, Cleveland and M. F. Pittenger, Johns Hopkin,, several different types of effects of the heat-shock University School of Medicine] response were tested in these studies. The drugs cy- tochalasin D and Colcemid were used to disassem- Most eukaryotic cells rapidly and specifically de- ble the actin microfilaments or microtubules and to press synthesis of a- and /3-tubulin polypeptides in disrupt the normal, splayed intermediate-filament response to microtubule inhibitors that cause mi- structures in living fibroblasts. Combinations of the crotubule depolymerization and presumably in- drugs, coupled with variations in the time of treat- crease the intracellular concentration of free sub- ment of the cells with the drugs, allowed for the units. Other drugs that interfere with microtubule individual disruption of the three cytoskeleton net- function but lead to a decrease in the subunit pool works, as well as for the disruption of the three size have little effect on the rate of new tubulin syn- simultaneously. The cells were subsequently heat- thesis. These findings have previously been inter- shocked and analyzed for the induction of the heat-

24 shock proteins (in quantity, quality, and kinetics) same sites at which they are found phosphorylated and for the migration of hsp72 into the nucleus. The in vivo. These proteins include vinculin, myosin results of these analyses indicated that none of the light chain, and the EGF receptor. The myosin light cytoskeleton systems were required for the heat- chain is not known to be closely associated with shock response, nor for the migration of hsp72 into membranes. its appropriate locale in the cell. These results, al- To clarify the role of protein kinase C, and of though very much limited at the moment to the heat- protein kinases in general, in regulating cellular re- shock system, pose several interesting questions sponses, we would like to determine its distribution concerning the importance of the cytoskeleton in in vivo and to develop a means of specifically in- cellular events other than cell motility, shape, and hibiting its activity in living cells. We have there- adhesion; we are currently examining other gene- fore purified protein kinase C and are trying to pro- switching systems in this regard. duce monoclonal antibodies that inhibit the activity of the kinase; these will then be used for microin- jection. By doing this, we hope to be able to impli- cate the kinase directly in a number of cellular re- Toward the Intracellular Localization sponses and to begin to get an idea of the part it and Function of Protein Kinase C may play in cellular responses to external signals. K. Matlack, J.R. Feramisco

The response of cells to external stimuli may some- Detection of Hemopexin (a Heme- times involve the stimulation of intracellular pro- tein kinases. The last several years have seen the binding Plasma (3-Glycoprotein) in the discovery and characterization of a new type of Lysosomes of Cultured Cells Using a widely distributed protein kinase whose properties Monoclonal Antibody Against suggest that it may play a role in signal transduc- Hemopexin tion into the cell. This kinase, called protein kinase G.-Y. Cai, J. Suhan, G.A. Blose, S.H. Blose C and discovered and first purified by Y. Nishizuka and co-workers (Kobe University of Medicine, Ja- A mouse monoclonal antibody, SBV22 (IgG1), was pan), is dependent on divalent calcium ion and generated against bovine hemopexin, a heme-bind- phospholipid and is stimulated by diacylglycerol. ing plasma glycoprotein made by the liver. Western Diacylglycerol is not a common constituent of eu- immunoblot (Fig. 5) analysis demonstrated that karyotic membranes. It is present in them only SBV22 recognized the hemopexins found in a va- transiently and is the result of the breakdown of riety of mammalian sera, including human serum. inositol phospholipids. Inositol phospholipids are A variety of cultured cells grown in calf serum and broken down in response to external stimuli, which then stained with SBV22 revealed intensely flu- can produce either short-term responses or long- orescent perinuclear granules. These granules were term proliferative effects in the target cells. That coincident with structures that specifically concen- this protein kinase is stimulated by a compound in- trated the supravital dye acridine orange, indicat- timately involved in signal transduction suggests ing that hemopexin was concentrated in lysosomes that the kinase may be involved either in mediating (Fig. 6). Immunoelectron microscopy using SBV22 the early phases of the cellular response or in mod- confirmed that the hemopexin was contained in the ulating it. The evidence for its mediation of the re- lysosomes of the perinuclear region as well as the sponse of platelets to thrombin is good. The recent peripheral cytoplasm (Fig. 7). The lysosomal ac- discovery of protein kinase C as a receptor for tu- cumulation of hemopexin could be enhanced by in- mor-promoting phorbol esters also suggests that it cubating the cells with chloroquine, a lysosomal may play an important role in the coordination of trophic drug. This drug inhibited lysosomal degra- cellular activity. dation of hemopexin, causing the observed hemo- To date, the biochemistry of protein kinase C pexin accumulation in lysosomes. When the cells leaves unclear how it may function within the cell. were fed fetal calf serum (10% v/v), no hemopexin The same molecular species can apparently be iso- staining was observed, consistent with the fact that lated from both the particulate and soluble frac- fetal serum has only trace amounts of hemopexin. tions of rat brain, yet detergent is required for the These results indicate that the cells in culture can isolation from the particulate fraction. Treatment specifically ingest hemopexin from the ambient of intact cells with tumor-promoting phorbol esters media for lysosome-mediated degradation and is results in an increase of the fraction associated with the first demonstration that hemopexin is taken up the plasma membrane. In extracts, this kinase is ca- by nonliver cells. This might in part serve as a pable of phosphorylating perhaps 30 or more pro- source for intracellular iron. Current studies are teins. Highly purified protein kinase C can phos- directed at determining whether hemopexin uptake phorylate several purified proteins at some of the is facilitated by receptor-mediated endocytosis.

25 A

pf0 '1'8? 5'3; ffi .35 ILI If, E5 L'il10H 200 - Pi U 200. 116.5 94. 08. moo. I a 33, 30

2 21

STAIN BLOT BLOT STAIN BLOT (SBV22) (RAH-Hx) Figure 5 Western immunoblots analyzing the specificity of SBV22 monoclonal antibody (IgGI), an antihemopexin. (A) Comparison of the binding of SBV22 and a polyclonal rabbit anti-human hemopexin (RAH-Hx) (from Calbiochem-Behring Corp.) to partially purified calf serum hemopexin (C-Hx), calf serum (C-SER), and human serum (Hu-SER). SBV22 recognized calf hemopexin as a doublet (-M, = 60,000 and 62,000) in the partially purified protein (C-Hx) and calf serum (C-SER) and as a single band (-M, = 63,000) in human serum. The polyclonal anti-human hemopexin (RAH-Hx) on Western blots only detected hemo- pexin in human serum (Hu-SER). (B) SBV22 was used to probe sera from various mammalian species. SBV22 bound strongly to hemopexin in C-SER (M, = 60,000 and 62,000), Hu-SER (M, = 63,000), and mouse serum (Mo-SER, M, = 54,000).It bound weakly to hemopexin in horse serum (Ho-SER, M, = 62,800) and rabbit serum (Rb-SER, M, = 61,000). It did not detect the protein in fetal calf serum (Fc-SER) or guinea pig serum (Gp-SER). (STD) Molecular mass standards; (35S-CELLS) [35S]methionine- labeled cell protein for internal M, standard that is transferred to the blot (BLOT) and exposes the auto- radiogram.

Figure 7 Immunoelectron micrograph of a BHK-21 cell stained with SBV22 followed by peroxidase-labeled goat anti-mouse. The lysosomes (Lys) were stained intensely by the peroxidase reaction product, thus confirm- ing at the ultrastructural level that hemopexin was in the lysosomes. Asterisks mark lysosomes in which the centers were open, similar to the observations made at the light level by immunofluorescence. (Nu) Nucleus; (Mit) mitochondria; (MT) microtubules; (ER) endoplasmic reticulum.

26 LYSOSOME STAINING OF BHK-21 CELLS WITH SBV221A,a) AND RAH-HPXN(B,b)

Figure 6 Phase (A,B,E) and fluorescent (a,b,C,D) micrographs of BHK-21 cells used to detect the intracellular distribution of hemopexin. BHK-21 cells grown in nutrient media supplemented with calf serum (containing hemopexin) for 3 days show that approximately 30-40% of the cells at any one time contain hemopexin as detected by indirect immunofluorescence using the monoclonal antibody SBV22 (a) or the rabbit polyclonal anti-hemopexin (RAH-HPXN) (b). These antibodies intensely stained granules in the perinuclear region. The individual granules had an intensely stained outer region with a hole in the center. Cells supravitally stained with acridine orange (C) were then stained with SBV22 (D). The antibody staining was coincident with acridine-orange-positive granules, indicating that hemopexin is in lysosomes. (E) Phase mi- crograph of the same cell in C and D.

27 Figure 8 Phase (A ,B) and fluorescence (a ,b) micrographs of gerbil fibroma cells (A ,a) and HeLa cells (B,b) stained with SBC1. Some nuclei were stained intensely (arrowhead, a) and others were not stained (asterisk, a). Nucleoli were not stained (arrowhead, b) by SBC1. Fluorescent dots in the cytoplasm are the mitochondria stained by SBC1. (Nu) Nucleus.

O

giD[pril

Figure 9 Fluorescent micrographs of gerbil fibroma cells at various stages of mitosis stained with SBC1. (A) Early prophase; (B) prophase; (C) prometaphase; (D) metaphase (dotted line indicates the equatorial plate); (E) anaphase; (F) telophase. Arrowheads indicate the positions of the chromosomes.

28 Monoclonal Antibody to DNA munofluorescence (Fig. 12) and immunoelectron G.-Y. Cai, J. Suhan, G.A. Blose, S.H. Blose microscopy (Fig. 13), the antibody stained the mi- tochondria in a beaded pattern. By solid-phase ra- Immunological approaches developed recently in dioimmunoassay, the SBC1 antibody bound nick- several laboratories have been used to probe struc- translated X DNA (a gift from 0. Fasano, this sec- tural and conformational domains of DNA in vitro. tion) and nick-translated p-alpha 176 DNA (a gift We have cloned a mouse monoclonal antibody from J. Maclnnes, this section). When SBC1 was SBC1 (IgM) that binds DNA. When this antibody absorbed with total rat liver DNA (a gift from J. was used to stain cultured cells by immunoflu- MacInnes), fluorescence staining of the cell's nu- orescence, three patterns were observed: (1) Only cleus and mitochondria was abolished. When the some of the nuclei stained, (2) the mitochondria DNA was first digested with DNase and then used were stained in a beaded pattern, and (3) the chro- to absorb SBC1, antibody staining was not abol- mosomes were intensely stained. Nuclear fluores- ished. When cultured cells were treated with DNase cence varied from very intense to absence of stain- (0.2 mg/ml, 30 min) prior to staining with SBC1, ing; and in the case where the nuclei were stained, the fluorescent staining of both nuclei and mito- the nucleoli were unstained (Fig. 8). The intensely chondria was abolished. These results indicate that stained nuclei appeared to be related to the cell SBC1 was directed against DNA. Current studies cycle, since prophase nuclei (Fig. 9) were very in- in progress are aimed at determining the specificity tensely stained, as were the chromosomes (Fig. 9). of SBC1 binding to DNA structure/conformation Immunoelectron microscopy demonstrated that the and sequence. We are also investigating the possi- antibody stained over both euchromatin and the bility that the intense nuclear staining is an indica- heterochromatin next to the nuclear envelope (Fig. tion of DNA synthesis and/or conformational 10) but not the nucleolus. In mitotic cells, the chro- changes that occur in the S and M phases of the cell mosomes were also stained (Fig. 11). By light im- cycle.

Figure 10 Immunoelectron micrograph of a cell stained by SBCI, followed by peroxidase-labeled goat anti-mouse. The antibody stained the chromatin in the nucleoplasm (single arrowhead) and near the nuclear envelope (double arrowhead). The nucleoli (n) were not stained.

29 Figure 11 Immunoelectron micrograph of a gerbil fibroma cell in metaphase stained with SBC1, followed by per- oxidase-labeled goat anti-mouse. The chromosomes (Chr) were stained. Arrowhead indicates a stained mitochondrion.

SBC1 Rh123 PHASE 0 C

Figure 12 Fluorescent (A,B) and phase (C) micrographs of a gerbil fibroma cell stained supravitally with rhodamine 123 (Rh123) and SBC1. The living cell was seen in B and C with rhodamine 123 labeling the living mitochondria. This cell was then rapidly fixed and stained with SBC1. (A) SBC1 stained the mitochondria in a beaded pattern. Some translocation of the mitochondria was observed when comparing A with B due to fixation shrinkage and natural movement of the mitochondria during the time it took to fix. Arrowheads indicate mitochondria positions.

30 Figure 13 Immunoelectron micrograph of a cell stained with SBC I, followed by peroxidase-labeled goat anti-mouse. The antibody stained discrete regions of the mitochondria (arrowheads).

TRANSPORT AND SECRETION OF EUKARYOTIC GLYCOPROTEINS

During the past year, we have continued our studies of different cell types and to introduce site-directed on the molecular genetics of membrane and secre- mutations into the cDNAs and analyze the struc- tory proteins. Our two major interests are (1) to ture, function, and transport of the altered glyco- correlate structure with function by identifying and proteins. analyzing the protein domains or epitopes involved in receptor recognition, enzyme activity, and anti- genicity and (2) to understand the mechanisms that determine the route of transport and final destina- Development and Analysis of tion of nascent glycoproteins in eukaryotic cells. Continuous Cell Lines That Express Most of our work has involved the hemagglutinin Influenza Hemagglutinin of influenza virus, whose biosynthesis utilizes host- J. Sambrook, L. Rogers, M. -J. Gething cell enzymes and processes for translation, mem- brane transport, glycosylation, and maturation. The In recent years, we have used the hemagglutinin hemagglutinin provides an ideal system for our (HA) of influenza virus as a model to study the bio- studies because it is the best characterized of all synthesis, modification, and transport of cellular, integral membrane proteins: Its three-dimensional integral membrane proteins. The groundwork for structure is known, and the location of its major this approach was laid when it was shown that the antigenic sites, the points at which it is glycosyl- cloned gene for HA could be expressed with very ated, its organization into trimeric structures, and high efficiency in mammalian cells and that the its orientation with respect to the membrane have newly synthesized HA was translocated through the been defined. More recently, we have begun to endoplasmic reticulum to the Golgi apparatus and study tissue-type plasminogen activator, a serine then to the cell surface along a route similar to, if protease secreted from human cells. The genes en- not identical with, that believed to be taken by the coding both of these glycoproteins have been cloned majority of authentic cellular membrane proteins and expressed in eukaryotic cells using recombi- (Gething and Sambrook, Nature 293: 620 [1981]). nant vectors. This provides the opportunity to study Virtually all of this work has been carried out using the expression of the wild-type genes in a number vectors based on SV40 that express extremely large

31 quantities of HA during the course of a lytic cycle with the convenience of constitutive and continuous of viral growth in permissive simian cells. How- expression. ever, it would also be advantageous to study the biosynthesis and expression of HA in mammalian cells that are not destined to die as a consequence Signal Sequences Can Be Exchanged of viral infection. between Eukaryotic Glycoproteins The first continuous cell lines that were devel- S. Sharma, J. Brandsma, J. Sambrook, oped contained the HA gene integrated into the M. -J. Gething chromosome of murine LMtk- or human 143tk cells. The HA gene was introduced into these cells The precursors of secretory and integral membrane in a recombinant plasmid containing (1) the 13-lac- proteins of eukaryotic cells contain at or near their tamase gene, (2) the chicken thymidine kinase (tk) amino termini a tract of hydrophobic amino acids gene, and (3) the HA gene inserted between the (the signal peptide) that functions in the transloca- SV40 early promoter and SV40 early sequences tion of the nascent polypeptide across the lipid bi- containing RNA processing signals. tk+ clones were layer of the endoplasmic reticulum. Analyses of obtained that expressed up to 105 molecules/cell. these peptides from a large number of proteins have Evidence that HA is expressed at the surfaces of revealed a remarkable diversity of amino acid se- these cells was provided by H2-restricted lysis of quence, although hydrophobicity is always main- the cells by Japan HA-specific cytotoxic T lympho- tained. The question arises as to whether these sig- cytes (CTLs) (Braciale et al., J. Exp. Med. 159: nal peptides can be functionally exchanged between 341 [19841) (in collaboration with T. Braciale, different glycoproteins and, furthermore, whether Washington University, St. Louis). CTLs that occur the attachment of a signal peptide to a normally in- in both mice and humans in response to type-A in- tracellular protein can cause its export from the cy- fluenza virus show an unusually high degree of toplasm. cross-reactivity for target cells infected with sero- We have constructed chimeric genes that fuse the logically distinct influenza virus strains. We have nucleotide sequence coding for the signal peptides shown that the HA molecule, expressed in the ab- of calf preprochymosin and the env glycoprotein of sence of any other influenza virus gene products, Rous sarcoma virus(in collaboration with E. can serve as target antigen for both the subtype- Hunter, University of Alabama) in front of the se- specific and cross-reactive subpopulations of influ- quences coding for the hemagglutinin (HA) glyco- enza-specific CTLs. Thus, it is possible that HAs protein of influenza virus. Alternatively, we have of different subtypes of type-A influenza carry a placed the sequence coding for the HA signal in conserved epitope (or epitopes) that is immuno- front of those coding for the env glycoprotein or dominant for CTL recognition/activation but very for SV40 large T antigen. The chimeric genes were poorly recognized by the humoral response. These inserted into recombinant genomes based on SV40 findings now open the way for mapping specific or adenovirus, and the chimeric proteins were ex- CTL epitopes on the HA molecule by site-directed pressed in eukaryotic cells. We have demonstrated mutagenesis. that when the signal peptides are exchanged be- To obtain cell lines that constitutively express tween glycoproteins, the chimeric proteins are ef- higher levels of HA, murine cells (C127, NIH-3T3, ficiently translocated across the endoplasmic retic- or BALB MME) were transformed with bovine ulum (ER) membrane. Subsequent cleavage of the papilloma virus (BPV)-HA vectors in which the HA signal sequence and transport of the mature protein gene was under the control of either the SV40 early to the cell surface appear to depend on how close promoter or the murine metallothionein promoter. to the cleavage site the fusion has been placed and Transformed cell lines were obtained that con- whether the chimeric protein can fold correctly. tained 50-200 copies of the BPV-HA genome When the HA signal peptide is attached to large T maintained extrachromosomally as episomes. The antigen, the chimeric protein molecules are at HA protein is expressed continuously at levels of least partially translocated across the ER mem- up to approximately 107 molecules/cell per 24 brane. The signal sequence is cleaved from these hours. The production of HA was higher when the molecules, which also undergo glycosylation at a gene was under the control of the metallothionein normally cryptic canonical site (Asn153.Arg.Thr). promoter than when the SV40 early promoter was utilized. The addition of zinc to the medium re- sulted in an approximately two- to tenfold increase Recognition Signals for Sorting in expression of HA from the recombinants con- Surface Proteins taining the metallothionein promoter. Cell-surface M. Roth, C. Doyle, M. -J. Gething expression was demonstrated by indirect immuno- fluorescence and hemadsorption of guinea pig Eukaryotic cells maintain a complex, directed flow erythrocytes to the cell monolayer. These cell lines of proteins between their various organelles, in- combine the advantage of high-level production cluding their surface membranes. The mechanisms

32 by which cells control this intracellular traffic are posed on the cytoplasmic face of cellular mem- at present poorly understood. Polarized epithelial branes during transport of HA to the cell surface. cells that maintain two separate apical and basola- This location could allow for specific interactions teral surface domains provide a promising system between HA and molecules involved in intracellu- for the study of cellular sorting mechanisms. These lar transport. surface domains, each containing distinct comple- To investigate the possibility that the "cyto- ments of proteins, are separated by the zonula oc- plasmic tail" contains recognition signals impor- cludentes, belts of tight junctions between adjacent tant in its transport through the cell, we have mu- cells that serve as barriers to the diffusion of ma- tated portions of the cloned A/Japan/305/57 HA cromolecules. Previous work has shown that viral gene that code for this region of the molecule. Sev- glycoproteins are concentrated to either the apical eral types of altered HA genes were constructed: or basolateral surface, domain of such cells (Rodri- (1) a group of mutants in which sequences coding guez-Boulan and Pendergast, Cell 20: 45 [1980]; for the carboxyterminal amino acids were changed Roth et al., Cell 33: 435 [1983]). or deleted, (2) two mutants in which the termina- To determine which topological features of pro- tion codon was altered and the coding sequences teins are recognized by cellular sorting mecha- extended for either 16 or 21 codons, and (3) one mu- nisms, we are investigating the surface expression tant in which the sequences coding for the cyto- of cloned glycoprotein genes in polarized epithelial plasmic tail of HA is replaced by nucleotides en- cells. In the past year, in collaboration with E. Rod- coding the cytoplasmic tail of the envelope glyco- riguez-Boulan of Cornell Medical School, we have protein of Rous sarcoma virus. These genes were characterized a polarized cell line that supports the inserted into SV40 vectors and expressed in CV-1 growth of SV40 expression vectors containing a cells as mutant HA molecules in which the cyto- cloned gene for the hemagglutinin (HA) of influ- plasmic tail is either altered, truncated, extended, enza virus. In this cell line, MA104 rhesus kidney or changed to that of a different viral glycoprotein. cells, the HA glycoprotein is preferentially ex- The rate of biosynthesis and transport, the cellular pressed at the apical domain. To determine whether localization, and the biological activity of the al- features of HA important for sorting reside on the tered gene products have been analyzed. Several of large external domain of the protein or on the trans- the mutants displayed abnormalities in the pathway membrane or cytoplasmic domains, we are investi- of transport from the endoplasmic reticulum (ER) gating the expression of a secreted form of HA in to the cell surface. The HA mutant whose tail was MA104 cells infected with an SV40-HA recombi- extended by 16 amino acids is retarded in the ER nant virus. We have also constructed several genes and does not reach the cell surface. Another mutant coding for chimeric glycoproteins in which the whose tail was replaced by 16 nonhomologous transmembrane and/or cytoplasmic domain of HA amino acids is blocked in transport from the Golgi has been replaced by that of a different viral gly- apparatus to the surface. Other mutants are delayed coprotein. These chimeric molecules appear to re- in reaching the Golgi apparatus after core glycosy- tain all of the functional activities of wild-type HA lation is completed in the ER, although their sub- and are efficiently expressed on the cell surface in sequent transport to the surface appears normal. MA104 cells. We are in the process of quantitating However, the mutant in which the conserved amino the surface location of the wild-type and chimeric acids at the carboxyl terminus have been altered HA molecules using electron microscopy and are cannot be distinguished from the wild type in the developing an in situ radioimmunoassay for differ- kinetics or pathway of transport. We conclude that entiating between apical and basal HA expression. although some changes in the cytoplasmic tail drastically influence cell-surface expression and the rate of glycoprotein assembly and transport, the Expression and Intracellular Transport conservation of wild-type sequences coding for this of Mutant Hemagglutinins with Altered, region of the molecule is not absolutely required Deleted, or Extended Cytoplasmic for maturation and efficient expression of a biolog- Domains ically active HA on the surfaces of infected cells. C. Doyle, M. Roth, M. -J. Gething

Many cell-surface glycoproteins contain at their Site-directed Mutagenesis of the Fusion carboxyl termini a short stretch of hydrophilic Peptide of Influenza Hemagglutinin amino acids that follow a hydrophobic domain M.-J. Gething, D. York spanning the lipid bilayer of the plasma membrane. The carboxyterminal hydrophilic region of the in- Enveloped animal viruses enter and infect cells by fluenza virus hemagglutinin (HA) extends for only a process involving fusion of the viral membrane ten amino acids, with four of the final five residues with a cellular membrane. In some cases (e.g., Sen- being absolutely conserved among HA subtypes. dai virus), the fusion event occurs at the plasma The terminal ten amino acids are likely to be ex- membrane; for many other viruses including influ-

33 enza, entry occurs through the membranes of intra- cleave plasminogen to the active protease plasmin. cellular vesicles such as endosomes or lysosomes, These processes generally involve fibrinolysis, tis- where the fusion is triggered by the endogenous low sue remodeling, and cell migration. Two immuno- pH. Fusion is a function of the viral surface glyco- logically and biochemically distinct types of PAs proteins and occurs at a threshold pH that is char- have been identified as urokinase (uPA; found in acteristic of each viral species and strain. Experi- urine) and tissue PA (tPA; found in tissue extracts). mentally, this activity can be manifested as cell-cell tPA is probably the physiological thrombolytic fusion when monolayers of cells displaying these agent, since it not only binds to and requires fibrin glycoproteins on their plasma membranes are sub- for its activity, but also is released from the vascu- jected to transient low pH. We have previously lar wall into the blood by stimuli such as physical shown, using cells expressing influenza virus hem- exercise, venous occlusion, vasoactive drugs, and a agglutinin (HA) from a cloned copy of the HA gene variety of clinical states. Recently, much attention inserted into a recombinant SV40 vector, that the has been focused on the role of PAs in tumor for- HA molecule displays fusion activity in the absence mation and metastasis. Levels of PA activity in nu- of any other influenza-virus-coded components merous transformed cell lines are enhanced, com- (White et al., Nature 300: 658 [1982]). This fusion pared with levels in normal-cell counterparts. A activity requires a posttranslational proteolytic cleav- recent study suggests that it is the level of tPA rather age of the HA precursor, HA0, into the active form than uPA that correlates with the malignancy of hu- of the molecule, HA, which consists of two disul- man myeloid leukemic cells (Wilson et al., Blood fide-bonded subunits, HA, and HA2. A new amino 61: 568 [1983]). terminus, which has been implicated in the fusion In collaboration with G. Larsen, R. Kay, R. activity and which becomes exposed at low pH, is Hewick, E. Fritch, G. Brown, and R. Kaufmann generated on the HA2 subunit. The first ten amino (Genetics Institute) and D. Rifkin (New York Uni- acids of this aminoterminal "fusion peptide" are versity), we have cloned a cDNA copy of the tPA hydrophobic in nature and are highly conserved be- gene from a human melanoma cell line (Bowes). tween HAs from different influenza virus strains. Determination of its nucleotide sequence of 2350 To confirm the function of the fusion peptide and by showed that the polypeptide backbone of tPA is to identify the role of individual amino acids in the 562 amino acids in length, including a hydrophobic fusion activity, we have used oligonucleotide-di- signal sequence of 20-23 amino acids and a hydro- rected, site-specific mutagenesis to alter the nu- philic "pro" sequence of 12-15 amino acids. The cleotide sequence coding for selected residues at mature polypeptide (527 amino acids) has 35 cys- the amino terminus of HA2. Four mutants have been teine residues capable of forming disulfide link- constructed that contain single base alterations that ages and four potential glycosylation sites. Varia- result in nonconservative amino acid changes in the tions in the structure of the oligosaccharide side fusion peptide. These changes have included inter- chains may account for the two forms of PA that rupting the hydrophobic stretch with charged amino are secreted from cells and that run as a doublet on acids and extending the hydrophobic sequence to 18 SDS-PAGE (65K and 63K species). amino acids by replacing a hydrophilic residue. The If the full-length tPA clone were inserted into an altered sequences were used to replace wild-type SV40 vector between the HpaII and BamHI sites sequences in an SV40-HA recombinant vector, and (as used for HA expression), the resulting recom- the mutant HAs were expressed in CV-1 cells. Im- binant genome would be too large to fulfill the size munofluorescence, red-cell binding, and cell-fu- constraint for packaging into SV40 virions. Con- sion assays (in collaboration with J. White, Yale sequently, a truncated cDNA containing all of the University) have been used to establish the pheno- coding sequences but lacking the majority of the 3'- types of the mutants. So far we have defined two nontranslated sequences was inserted into the SV40 positions at which amino acid replacements can vector, and high-titer recombinant viral stocks were abolish the fusion activity and one position wh re generated as described for SV40-HA vectors (Ge- introduction of a charged residue causes a change thing and Sambrook, Nature 293: 620 [1981]). At in the pH at which fusion occurs. late times after infection with SV40-PA, simian CV- 1 cells secrete high levels of tPA into the medium (10 µg /ml of protein; 500 units /ml of fibrinolytic Expression of Tissue-type Plasminogen activity). This corresponds to about 50-fold higher Activator Using Recombinant levels per cell than are produced in the Bowes mel- Viral Vectors anoma cells from which the cDNA was cloned. M. -J. Gething, D. Hanahan, J. Sambrook Metabolic labeling of infected cells, followed by immunoprecipitation and SDS-PAGE, indicated Many normal and abnormal physiological processes that the tPA protein produced from the recombinant requiring extracellular proteolysis are thought to be vector is essentially identical in size to that secreted mediated by plasminogen activators (PAs) that from Bowes cells. The tPA cDNA has also been

34 inserted into a bovine papilloma virus vector under binant genome has yielded cloned lines that secrete the control of the murine metallothionein promoter. high levels of tPA (50 units/ml). Transformation of NIH-3T3 cells with the recom-

HEAT-SHOCK AND STRESS RESPONSES

A seemingly general and highly conserved re- affected by a number of other treatments to cells sponse to sudden adverse conditions is the so-called (in collaboration with B.R. Franza, this section). "heat-shock" or "stress" response.Itis found As indicated last year, the major induced mammal- throughout nature at all levels and is minimally ian heat-shock protein of 72K localizes to the nu- characterized by the induction of a specific and cleus and nucleolus. The remaining heat-shock limited suite of proteins, the "stress proteins" of as protein to be purified, the 110K protein, similarly yet undefined function. These proteins are related localizes to the nucleolus and appears to corre- to proteins that are expressed under normal condi- spond to the C-23 nucleolar protein described dur- tions and are by several criteria related among evo- ing the past few years by other laboratories. Puri- lutionarily distant organisms; the general features fication of both the 28K and 110K proteins is being of their induction also appear similar. Interest in accomplished using a combination of cell fraction- the stress response itself and the functions of these ation and ion-exchange and gel-filtration chroma- proteins has grown quite remarkably, as judged tography. from the number of concerned publications, and We are also continuing our efforts in the produc- work here at Cold Spring Harbor has largely ad- tion of both polyclonal and monoclonal antibodies dressed two broad aspects of the stress response against the various stress proteins. As reported last displayed by human and mammalian cells: (1) pu- year, polyclonal antibodies specific for the 72K, rification and detailed characterization of the stress 80K, 90K, and 100K proteins have been raised and proteins and (2) analysis of the genes that encode used to determine their intracellular localization in them and the means by which their induction is ef- the cell (Welch et al., J. Biol. Chem. 258: 7102 fected. [1983]; Welch and Feramisco, J. Biol. Chem. 259: 4501 [1984]). More recently, we have been concen- trating much effort on the production of mono- clonal antibodies against all of the stress proteins. Purification and Characterization of the In this context, we have just obtained one mono- Mammalian Stress Proteins clonal antibody that appears to be specific for the W.J. Welch, G. Binns, J.R. Feramisco 73K stress protein. Biochemical fractionation, as well as indirect immunofluorescence analysis, us- In our efforts to understand the biology of the ing this antibody has shown that a portion of the stressed cell, we have continued to focus our atten- 73K protein is associated with cytoskeletal ele- tion on the structure, function, and intracellular lo- ments, specifically microtubules and/or intermedi- cation of the individual stress proteins themselves. ate filaments (in collaboration with S. Blose, this ' As we reported last year, approximately half a doz- section). en polypeptides (M, = 28,000, 72,000, 73,000, Our battery of antibodies against the various 80,000, 90,000, 100,000, and 110,000) are synthe- stress proteins is also proving useful in studies sized at elevated levels in all mammalian cells in- aimed at dissecting the function of the individual cubated under certain adverse conditions. Purifi- stress proteins. We have begun a systematic study cation of the 72K, 73K, 80K, 90K, and 100K in which the various antibodies are introduced into proteins has been accomplished (Welch and Fer- living cells via microinjection, and the effects are amisco, J. Biol. Chem. 257: 14949 [1982] and un- assayed both morphologically and biochemically. publ.). Currently, we are in the process of purifying Using this approach, we have found that introduc- the remaining two proteins, the 28K and 110K spe- tion into the cell of anti-72K antibodies and subse- cies. Using cell-fractionation techniques and meta- quent heat treatment of the cells results in acceler- bolic labeling studies, we have found that both the ated cell death. Hence, although it had been estab- 28K and 110K proteins localize, in part, to the nu- lished previously that the stress proteins collec- cleus following stress and are heavily phosphoryl- tively afford the cell protection during heat-shock ated. The 28K stress protein, composed of at least treatment, this result is suggestive of at least the four related isoforms, may prove to be most inter- 72K protein being directly involved in thermal pro- esting since its phosphorylation state appears to be tection. We are currently examining whether the

35 anti-72K antibodies injected into the cytoplasm pre- agents that interfere with oxidative phosphoryla- vent the migration of newly synthesized 72K pro- tion can similarly induce the heat-shock response. tein into the nucleus/nucleolus of the heat-treated In the ensuing years, a large variety of treatments, cells. many of which affect general energy metabolism, have been shown to be effective inducers of the heat-shock proteins, prompting us and others to re- Comparison of the Stress Response in fer to the response in more general terms as the Normal and Transformed Cells "stress response." Consequently, I have begun ex- W.J. Welch, B.R. Franza, J.R. Feramisco amining the apparent relationship between cellular metabolism and the ability of cells to undergo and Although it has long been recognized that trans- survive heat-shock treatment. In this light, we have formed cells in vitro, as well as tumorigenic tissue shown that the synthesis of three of the stress pro- in vivo, show increased thermal sensitivity as com- teins (80K, 90K, and 100K) can also be affected by pared with normal cells, the biochemical basis for altering the extracellular levels of glucose in the this difference is not understood. Consequently, we culture medium of various mammalian cells (Welch have been examining and comparing a number of et al., J. Biol. Chem. 258: 7102 [1983]). In addi- properties of the stress response in both normal and tion, although many of the oxidative phosphoryla- transformed cells grown in vitro. Whereas the tion inhibitors apparently induce the stress proteins transformed cells do show a typical stress response in excised Drosophila salivary glands, these same at the protein synthetic level, there appear to be dif- agents have surprisingly little effect on protein syn- ferences in the location of some of the stress pro- thesis patterns in mammalian tissue-culture cells. teins in the transformed cell as compared with their However, a profound effect is observed when the normal cell counterparts. Specifically, we have mammalian cells are first treated with these inhib- found that although the major induced 72K stress itors and subsequently heat-treated. In this case, the protein localizes to the nucleus and nucleolus in cells' ability to synthesize the stress proteins as well normal cells, the protein localizes to only the nu- as survive the heat treatment is very much dimin- cleus and not the nucleolus in the heat-treated ished as compared with heat-treated cells not ex- transformed cells. Similarly, the 110K stress pro- posed to the drugs. Similarly, glucose deprivation tein, present in the nucleolus of both normal and of normal cells followed by heat-shock treatment transformed cells grown at 37 °C, shows a dimin- again results in accelerated cell death. It is also in- ished nucleolar locale in only the heat-treated teresting to note that highly glycolytic transformed transformed cells. In the case of the 72K protein, cells also deplete their extracellular glucose quite the failure to localize in the nucleolus of the trans- rapidly and, as mentioned above, show increased formed cell appears to reflect differences in the thermal sensitivity. Hence, it appears that by af- cells and not in the protein itself. For example, we fecting the manner by which cells generate their have purified the 72K protein from transformed energy pools, one can similarly affect their ability HeLa cells (which show no nucleolar distribution to respond and survive heat-shock treatment. Al- of 72K at high temperatures) and conjugated the though these studies are still at a preliminary stage, protein with the fluorescent tag, rhodamine iso- it is hoped that this approach may shed light on how thiocyanate. The rhodamine-coupled 72K protein the cells recognize the environmental insult at hand was then microinjected back into the cytoplasm of and how they subsequently react. normal rat fibroblasts, SV40-transformed fibro- blasts, or HeLa cells, and the cells were heat- treated. Only in the normal cells (and not in the Mechanisms of Translational Control in transformed cells) was the 72K protein observed to the Stress Response redistribute into the nucleolus. It would appear then G.P. Thomas, D.D. Pascucci, M.B. Mathews that the state of the cell, be it normal or trans- formed, somehow exerts an influence on the intra- In addition to induced synthesis of the stress pro- cellular distribution of the 72K protein following teins, the synthesis of the normal spectrum of cel- heat-shock treatment. lular polypeptides is markedly depressed, and the two processes, although separable, are part and parcel of the response. For our studies on the mech- anisms involved in stress-protein induction, we have Energy Metabolism and the Stress used as inducer an amino acid analog that is incor- Response porated into newly made proteins, resulting in W.J. Welch aberrant polypeptides. It is easily shown that incor- poration is necessary, and we assume that aberrant Over 20 years ago, Ferruccio Ritossa observed that polypeptides are at least the initial signal for induc- in addition to heat-shock treatment, a number of tion in this situation. RNA synthesis is also neces-

36 sary and there are two requirements: The first, as cells, and experiments to prove or disprove such a could be expected, is for the production of high hypothesis are under way. levels of the mRNAs for the stress proteins, and the second is more general in that protein synthesis as a whole requires continuous synthesis of RNA. When mRNA production was examined, it was Human Stress-response Protein Genes found that the stress-protein mRNAs are the only G.P. Thomas, D.D. Pascucci species produced shortly after stress is imposed. The patterns of protein synthesis also simplify with For many of the experiments aimed at monitoring time so that the stress proteins become the only transcription and translation of both normal and in- proteins made. Such parallelism could be mechan- duced genes, specific probes are essential. We have istically based and would result if only newly made isolated genomic clones for the two major proteins, mRNAs were translated. 90K and 72K, as well as what appears to be a 72K- Although the normal mRNAs are not used for related gene that is expressed under normal growth protein synthesis in stressed cells, they remain in- conditions yet is not induced by stress. When these tact and are associated with polysomes, the site of clones are used as probes in genomic DNA blots, protein synthesis. As RNA does not exist in a naked there are many more bands than would be expected state within cells, one means by which mRNAs for a single gene; therefore, we presume that there could be distinguished is through protein associa- are families of 90K and 73/72K genes and/or that tions. We have analyzed the distribution of normal these hybridizing species represent pseudogenes. and stress-protein mRNAs in normal and stressed On the basis of S, protection experiments, the cells as a function of their density, a measure of the clones in hand represent expressed copies, rather protein content of structures containing mRNAs. than pseudogenes, although nucleotide sequence We have found that polysomes of stressed cells determination of the complete genes will presum- contain two classes of mRNA-containing particles: ably be required before we can be sure. Neverthe- One is the same as the particles found in normal less, they are of utility as probes in the experiments cells, but the second is found only in the polysomes described above. of stressed cells. To date, we have characterized this The 72K genes are currently being sequenced to fraction as follows: (1) It contains a large propor- discover common and divergent regions and hope- tion of the newly synthesized stress-protein mRNA fully uncover sequences implicated in inducibility. made over a given period; (2) it contains both of The availability of the genes, the proteins, and the the subunits that comprise normal ribosomes, lead- antibodies directed against the proteins will greatly ing us to suspect its functional significance; (3) facilitate direct analyses of the expression of the mRNAs for three major normal cell proteins can- genes, particularly of autoregulation, for which not be detected easily in this polysome class, in there is circumstantial evidence. In addition, contrast to the fraction at normal density; and (4) through comparison with the corresponding stress- the novel peak has a greater ratio of protein to RNA protein genes of other organisms that have been se- than has normal polysomal mRNA. We are tempted quenced to date, it will provide a measure of the to speculate that this second polysome fraction is evolutionary conservation of these gene products the active vehicle of protein synthesis in stressed revealed by immunological cross-reactivity.

37

ONCOGENES

Structure and Activation of cells is activated by a single point mutation, result- Mammalian ras Genes ing in the substitution of cysteine for glycine at the K. Shimizu, M. Goldfarb, 0. Fasano, 12th amino acid position. E. Taparowsky, D. Birnbaum, M. Ruley, M. Wig ler Structure and activation of the human N-ras gene. We have now completed the cloning and se- DNA-transfer experiments have led to the obser- quencing of the N-ras gene. Like the Ha- and Ki- vation that many human tumor cells contain genes ras genes, a functional protein of 189 amino acids capable of the tumorigenic transformation of NIH- is encoded by four coding exons. This gene has the 3T3 cells. Most of these so-called "transforming same exonic structure as the Ha- and Ki-ras genes. genes" are members of the ras-gene family, a highly We have found no evidence for an alternate fourth conserved group of genes that were first identified coding exon. Comparison of the amino acid se- by their presence in the Harvey and Kirsten sar- quences of the three human ras genes reveals a re- coma viruses. We have cloned these genes from tu- markable sequence conservation: All three are mor cells and have been studying their nucleotide identical for the first 86 amino acids. Thereafter, sequences, their intron/exon structures, and the until position 165, they are very similar ( >80 % ho- predicted amino acid sequences of the proteins they mology). After this there is almost complete diver- encode. Additionally, we have determined the na- gence, in a region we call the variable region, until ture of the mutations that activate the transforming again there is homology in the carboxyterminal se- potential of the normal cellular genes. Further quence Cys-AAX, where A is an aliphatic amino studies, utilizing techniques of in vitro mutagene- acid and X is the terminal amino acid. sis, have provided information about the functional Comparison of the N-ras genes of SK-N-SH neu- domains of the ras proteins. Finally, we have been roblastoma cells and human placenta indicates that analyzing the ras proteins synthesized by cells to the former contains a mutation that activates the N- understand the complex posttranslational process- ras transforming potential. Chimeric gene con- ing events accompanying ras protein maturation. struction, transformation assays, and nucleic acid sequence analysis reveal that this is due to a single Structureandactivationof humanKi-ras point mutation that results in the substitution of ly- genes. We have completed the cloning of the hu- sine for glutamine at the 61st amino acid position. man Ki-ras gene and the sequencing of its coding Position 12 of the transforming and wild-type N- regions. This large gene encompasses 45 kbp and ras genes is glycine. has the potential to encode two ras-gene products, one of 189 amino acids homologous to the viral Ki- ras gene, and one of 188 amino acids. These two Processing of the ras proteins.Analysis of the proteins can be encoded by mRNA that utilizes predicted amino acid structure of the ras-gene "exon choice": There are two alternate fourth cod- products suggests that the carboxyterminal variable ing exons. Similarly, the vestige of an "alternate" domain is the candidate determinant for physio- fourth coding exon is found in the 3'-untranslated logic specificity of the ras proteins. However, it was sequences of the viral Ki-ras gene, suggesting that shown several years ago that the ras proteins the rat Ki-ras gene also has two fourth coding ex- undergo processing in the carboxyterminal two ons. Except for the alternate fourth coding exon, thirds of the molecule. This processing is visual- the Ha-ras and the Ki-ras genes have a similar in- ized by a marked increase in the electrophoretic tron/exon structure, indicating that they have mobility of mature ras protein, suggestive of pro- evolved from a common spliced ancestral gene. tein cleavage at the carboxyl terminus. This puta- Exon-shuffling experiments show that when either tive cleavage event would remove the variable re- alternate fourth coding exon of Ki-ras replaces the gion, making it unlikely that it could have more than fourth exon of Ha-ras, the resulting chimeric gene a transient function. We therefore prepared two-di- is still functional. Chimeric gene constructionsalso mensional tryptic cleavage maps of the processed show that the Ki-ras gene of Ca lu-1 lung carcinoma and unprocessed Ha-ras proteins to resolve this 39 question. These studies indicate that the processing purified in abundance. In collaboration with M. event is not the result of proteolytic cleavage and Rosenberg, R. Sweet, and M. Gross at Smith, Kline that the variable region is present on mature pro- and French Laboratories and J. Feramisco and T. cessed ras proteins. Work is continuing to deter- Kamata at Cold Spring Harbor, we have utilized an mine the nature and location of the processing efficient X promoter cloned into a pBR322 deriva- event. Preliminary data indicate that the same pro- tive to express clones of normal and mutant Ha-ras cessing event or a similar one occurs when the cDNAs. Escherichia coli harboring these vectors mammalian Ha-ras proteins are expressed in yeast express Ha-ras in great abundance. This protein cells (see below). comigrates with the unprocessed Ha-ras protein made in animal cells and also efficiently binds Activating mutations of the Ha-ras gene.All of the guanine nucleotides. Ha-ras synthesized and puri- activating mutations of the ras genes that occur in fied from E. coli can now be used to study the ef- vivo appear to be point mutations resulting in amino fects of mutation on ras protein structure, to raise acid substitutions at the 12th or 61st codons. There monoclonal antibodies, and to study ras function are at least nine examples of these reported by our by microinjection. Since ras made in E. coli is un- laboratory and others. However, they are not nec- processed, we have examined the processing of Ha- essarily the only mutations that can activate the ras expressed in yeast. In collaboration with J. transforming potential of the ras genes. To test this, Broach (SUNY, Stony Brook), we constructed a we randomly mutagenized a wild-type Ha-ras gene galactose-inducible expressor of the Ha-ras cDNA. by the bisulfite method, introducing C -T transi- Saccharomyces cerevisiae containing this vector tional mutations. By screening the resulting mu- can be induced to express an Ha-ras protein that tants in NIH-3T3 transformation assays and se- undergoes a time-dependent processing event sim- quencing the transforming mutants, we found that ilar to, but not identical with, the processing events point mutations leading to amino acid substitutions in animal cells. Thus, yeast expression systems may at positions 13, 59, and 63 can also activate the be used to purify large amounts of the processed transforming potential of the ras genes. Not all mu- Ha-ras protein for biochemical studies and also to tants are equally effective in transformation. Mu- study the signals for protein processing. tants encoding aspartic acid for glycine at position 13 are perhaps one-fifth as potent as those encoding valine for glycine at position 12. Mutants encoding Yeast ras Genes serine for glycine at position 13 are perhaps 1/100 S. Powers, T. Kataoka, 0. Fasano, as potent. Mutants encoding threonine for alanine M. Goldfarb, M. Wigler at position 59 are particularly potent. This is puz- zling, since both Ha-ras and Ki-ras viral genes have Since the ras genes are so well conserved in evolu- at least two transforming mutations: one encoding tion, being present even in Drosophila, we looked substitutions at position 12 and one encoding thre- for their existence in Saccharomyces cerevisiae, a onine at position 59. Furthermore, it is no longer simple eukaryotic organism that can be subjected clear why only position-12 and position-61 mutants to powerful genetic analysis. We have found two are found in vivo. homologous genes in yeast by Southern blot analy- The clustering of activating mutations has two sis, have cloned both from plasmid libraries, and other important implications. First, these results have completed DNA sequence analysis of the cod- suggest that activating mutations disrupt some crit- ing regions. The predicted amino acid sequence was ical ras protein function by disrupting protein compared with that of the human ras genes, with structure. We have argued that these mutations oc- striking results. Both yeast genes show almost 90 % cur about the guanine-nucleotide-binding site of the homology with the first 80-amino-acid positions of ras protein. From this, we have further argued that the mammalian ras and 50% homology with the activating mutations alter the conformational next 80. Although the yeast ras genes encode much changes induced by guanine nucleotide binding. larger proteins (315 amino acids for yeast RAS1 and Second, it may now be easier to screen tumor DNAs 322 amino acids for RAS2), they both terminate to determine whether they contain activating muta- with the sequence Cys-AAX, common to mamma- tions using methods of hybridization. lian ras. Thus, there are clear domains of conser- vation that we think reflect functional domains of the encoded proteins. Although the two yeast genes Expression of the Human Ha-ras Gene are far closer to each other than to the mammalian in Escherichia coli and Yeast ras, they diverge radically from each other at pre- S. Powers, M. Goldfarb, 0. Fasano, cisely the point where the mammalian variable re- M. Wigler gion begins. We have hypothesized that the first 80 amino acids comprise the effector domain of the Biochemical study of the ras proteins requires a ras proteins and that the variable region forms a source from which a functional ras protein can be domain that functions as a physiologic receptor.

40 The availability of powerful genetic tools in yeast Cooperation among Oncogenes has enabled us to begin a series of experiments D. Birnbaum, L. Edlund, M. Wigler probing the function of yeast ras genes. This work was carried out with the collaboration of J. Strath- Recent observations by E. Ruley at Cold Spring ern (Yeast Section) and J. Broach (SUNY, Stony Harbor and H. Land and others at the Massachu- Brook). We have found that yeast cells with a dele- setts Institute of Technology indicate that certain tion of either yeast RAS1 or RAS2 are viable; dele- oncogenes can cooperate in the morphologic and tion of both genes is lethal. By site-directed muta- tumorigenic transformation of primary embryo genesis, we have introduced the activating valine cells. In particular, a mutant ras gene appears to be for glycine substitution in RAS2 at the position ho- insufficient to induce full transformation but re- mologous to the mammalian ras position 12. Cells quires in addition the presence either of high-level containing this mutant have a drastically altered expression of myc or adenoviral E 1 A or of another phenotype: They grow poorly on certain media, are suitable viral gene. We have confirmed these obser- flocculant, and do not appear to arrest properly in vations concerning the cooperation of myc and ras G,. Diploids with this mutation do not sporulate. and,in particular, have shown that high-level This phenotype is dominant. expression from a normal human myc gene is suf- These experiments indicate that it will be possi- ficient to complement a mutant ras gene in the tu- ble to do detailed genetic studies of the yeast ras morigenic transformation of primary rat embryo fi- genes and that they may have cellular functions that broblasts. As in the work of Land, we observed that are homologous to their mammalian counterparts. mutant ras alone is sufficient to induce morphol- In particular, failure to arrest properly in G, is a ogical changes in primary embryo cells, but that hallmark of transformed animal cells. such cells have only a very limited life span. In- deed, we observed that primary embryo fibroblasts containing mutated ras genes have a greatly re- duced life span compared with normal embryo fi- Tumorigenicity Assay for Transforming broblasts, and we interpret this to mean that, in the Genes absence of high-level expression of myc function, 0. Fasano, D. Birnbaum, C. Birchmeier, mutant ras genes are actually toxic to these primary L. Edlund, M. Wig ler cells. We have also tested the cooperation between myc and various other viral oncogenes using the All of the transforming genes we have detected in primary rat embryo fibroblast transformation sys- tumor-cell DNA using the NIH-3T3 focus assay tem. So far, we have observed cooperative interac- have been members of the ras-gene family. All of tions between sarc and myc and, surprisingly, none these genes have had mutations that introduced between myc and a variety of other tyrosine kinases structural alterations into the ras proteins. We or between myc and mos. We also observed a co- therefore suspected that the NIH-3T3 focus assay operative interaction between myc and fos, an on- was biased in its sensitivity to structurally mutated cogene encoding a nuclear protein. ras genes. In collaboration with J. Fogh (Sloan- Kettering Institute, Rye, New York), we have de- veloped and applied an alternative assay for trans- Biochemistry of ras and ras-related forming genes present in NIH-3T3 cells after DNA Proteins transfer: tumorigenicity in nude mice. NIH-3T3 F. Tamanoi, M. Walsh, M. Rao cells are cotransfected with a selectable marker in the presence of tumor DNA and then assayed for Mutations in ras genes are known that are respon- tumorigenicity. We found that many more DNAs sible for the alteration of a normal protein to a form are positive in this assay than in the focus assay. active in transformation of NIH-3T3 cells. An in- We have identified and cloned three transforming triguing question is, what biochemical activities are genes in the DNA of the human breast carcinoma affected by these mutations? To obtain an answer, cell line, MCF-7, which did not induce transformed it is necessary to carry out a detailed enzymologi- foci of NIH-3T3 cells in our hands. One of these cal study, as well as a conformational and crystal- genes is N-ras, and we find N-ras to be amplified lographic study, of the protein. One of the most in MCF-7 cells. The other two genes have no ap- promising ways to obtain pure ras protein for such parent relationship to previously known viral or a study is to express the protein in Escherichia coli. cellular oncogenes. We have not yet established Therefore, during the past year we have concen- whether these human genes are genetically altered trated on expressing ras protein in E. coli using in MCF-7. These results raise anew the question of various expression vectors. the number of potential oncogenes in our genome First, we have attempted to express mammalian and indicate that some (perhaps most) tumor cells ras protein using the lac promoter. Using a unique may contain a multiplicity of weakly transforming MstI site five nucleotides upstream of ATG, we in- genes. serted the ras gene downstream from the lac pro-

41 moter in M 13mp10. The recombinant phage di- copy, and computer analyzable two-dimensional gel rected the production of a 23K fusion protein that electrophoresis. Initial studies have focused on the was immunoprecipitable with a monoclonal anti- cloned Ha-ras-1 (pT24) transforming gene from the body against the mammalian ras protein. The level human bladder carcinoma line T24 (Fasano et al., of expression could be increased to 5 -10% of the J. Mol. Appl. Genet. 2: 173 [1983]). We found that total protein by transferring into a pUC vector. The this gene will not transform REF52 cells (a rat-em- protein made in E. coli is active in binding GDP. bryo-derived line; McClure et al., Cold Spring Recently, a ras expression system that utilizes the Harbor Conf. Cell Proliferation 9: 345 [1982]) un- X P, promoter has been constructed by M. Wigler less other genes such as the Ad5 E 1 A region are (this section) in collaboration with M. Rosenberg cointroduced into the cell either by calcium phos- (Smith, Kline and French Laboratories) and J. Fera- phate transfection or by microinjection. Despite the amisco. This system has the advantage that an in- failure of the T24 gene product to transform, it is tact protein is expressed. Characterization of this abundantly expressed in microinjected REF52 cells. intact protein is discussed by J. Feramisco et al. At 72 hours postinjection, the protein product is (this section). easily detected on two-dimensional gels (Fig.1); Recently, two yeast genes (RAS1 and RAS2) that however, no major alteration of cell morphology is exhibit remarkable homology with the mammalian apparent. ras gene have been isolated (see M. Wigler, this Another cloned oncogene is capable of rapid and section). To investigate the biochemical activity of dramatic morphological transformation of REF52 these gene products, we have started to express the cells. Less than 24 hours after injection of the gene products in E. coli. The RAS2 gene contains a cloned c-sis gene-cloned from HUT-102 cells, a T- unique HpaI site just upstream of ATG that could cell lymphoblastoid cell line that produces a human be used to insert the gene into expression vector T-cell leukemia virus (Poiesz et al., Proc. Natl. pUC. The recombinant plasmid produced two pro- Acad. Sci. 77: 7415 [1980]), and kindly provided, teins, 46K and 35K, that could be immunoprecipi- as part of an ongoing collaboration, by S. Josephs, tated by the monoclonal antibody against the mam- F. Wong-Staal, and R. Gallo (National Cancer In- malian ras protein. The relationship between the stitute) - many cells have changed their morphology two proteins is currently being investigated. With and their growth rate, leading to formation of a fo- the RAS1 protein, no restriction sites suitable for cus within 72 hours of the time the gene was in- cloning were found around ATG. Therefore, we jected (Fig. 2). We are intrigued by the response of have created a SphI restriction site (GCATGC) at REF52 cells to the c-sis-gene product given the fact the ATG by a single base change. This was possible that considerable homology exists between the pro- by cloning the RAS1 gene into bacteriophage M13 tein product of v-sis (the simian sarcoma virus one and by using a synthetic oligonucleotide. Using this gene) and a platelet-derived growth factor (PDGF) Spit' site, we are inserting the RASI gene into vec- (Deuel et al., Science 221: 1348 [1983]; Doolittle tors that contain PR or P, promoters of bacterio- et al., Science 221: 275 [1983]); and yet PDGF will phage X. Our immediate goal is to see whether yeast not support growth of normal REF52 cells. ras proteins exhibit any GTP-binding activity and, We intend to continue such studies as these and if they do, to compare the activities between the utilize the resolution capacity of the two-dimen- two yeast proteins, as well as to the mammalian sional gel and QUEST computer analysis (Garrels protein. et al., in Two-dimensional Gel Electrophoresis of Yeast provides an attractive system to carry out Proteins, Academic Press, New York [1984]) of the biochemical analyses of ras proteins. Powerful protein patterns to begin defining the early events yeast genetics could lead to the identification of that occur in changes of protein synthesis and turn- proteins that interact with the ras proteins (see M. over as cells respond to the products of genes Wigler, this section). These interacting proteins known either to transform or to assist in the trans- could be expressed in E. coli to carry out studies formation process. on the protein-protein interaction. Mutation of ras protein to a form active in transformation might in- Production of Monoclonal Antibodies volve alteration of such a protein-protein interac- to the ras Proteins tion. T. Kamata, C. Fraser, G. Binns, K. Ramirez, J.R. Feramisco Microinjection of Cloned Genes to Study the Mechanisms of In a collaborative effort utilizing the human c-Ha- Transformation ras genes cloned in M. Wigler's laboratory, an ef- B.R. Franza, Jr., H. E. Ruley, J.I. Garrels ficient protein expression system of M. Rosenberg and colleagues (at Smith, Kline and Beckman Lab- We are studying the effects of cloned oncogenes in- oratories), and the combined use of ours and Smith, troduced into defined populations of cells utilizing Kline and Beckman's protein-purification tech- the techniques of microinjection, photomicros- niques and facilities, we have obtained homoge- 42 Figure 1 Expression of pT24 gene in REF52 cells. Subconfluent REF52 cells were labeled for 2 hr with [35S]methionine, 72 hr after introduction of the pT24 gene by microinjection. (A) Proteins resolved from control, noninjected cells; (B) proteins resolved from cells injected with pT24; (C) phase photomicrograph of pT24-injected cells just prior to prepa- ration for two-dimensional gel analysis. (Ac) Actin; (Tml) tropomyosin 1. Arrow indicates the synthesis of the T24 gene product by the injected cells.

. -.,.., A a \ ---- C-.`.,-,-,,,,,_.4.,

i -,.-- - - ' -.-.---.... - i `,1 / ------,--, ,.:...- -... 1/4 , .. -Z. -,t7--'`-----_-- - - \ \-,- - -,.. '.. .7, .;.:-.;,, ,...:,- i, A ; .:./ ,,-, - , -

., .74 / f' .s''' ,,,, ... I ,.... , 1 ,.,1 i .,.....,,i i ,,,\A..\,...... ,,,, ,. ..,,, ' / /I -7,.- ) ." - "ifl,,\ .;.,..4"..,' 11 \`, ,,,'i \ ,,:,-,; It*, y. :: . 'N t/i./. ... ---. t . ----/- i i / .,'"..- - , 1 ',,,,,i/ \--',....?\''' ----_1.---- \ i -2

, - :: , l' .:------',,''--,,'71,\., -.zit, .. --': ,/,/ '*".

's, 7 \. I 1 '- 10 ,,,, \--- 4,7, .. ..,-..ttist.:,,..-- '---''Z..< . ... _ ... I N f, airP:',...... 4 -, ...., / - , ,,,,, . ...- ---..,--, , . .,- t i i _ k , - i / . . ,/ /-'- \-- '' / ,-1 !" -,-- 97/ . , -.., 0.. /' ----""7",_, / 1 1 ...-.1--/,---L----, ;,,,,,,, ,' 1 ,'/... , -. -,"./ , - ',.- -. \ .;-....'----,-_, . / 4 ' P * Figure 2 Morphological transformation of REF52 by the c-sis oncogene. Confluent (stringent condition for inducing transformation) REF52 cells were injected with the plasmid containing the sis gene (pSMI) and photographed at 24 hr and 72 hr after microinjection. (A-C) Noninjected controls for each time point. Cells microinjected with the vector minus the c-sis-gene insert are indistinguishable from noninjected cells at each time point. (D-F) Phase photomicrographs of the pSM1-injected cells at 0, 24, and 72 hr, respectively. Note that C and Fare photographed at higher magnification.

43 neous, biochemically active preparations of several In addition, we produced two 18-residue syn- protein forms of the human ras proto-oncogenes thetic peptides corresponding to the two aminoter- and oncogenes, including the "activated" c-Ha-ras minal sequences that differ by one residue between product, the "wild-type" c-Ha-ras product, and a the activated and proto-oncogenic forms of the hu- carboxyterminal truncate of the activated c-Ha-ras man Ha-ras proteins. Smith, Kline and Beckman protein lacking 19 amino acids. have provided us with a 22-residue peptide that cor- Using in the first case a readily obtainable ami- responds to the carboxyl terminus of the human c- noterminal truncate ( -20 amino acids) as an anti- Ha-ras proteins. All of these peptides will be used gen, we have prepared several hundred mouse hy- as antigens and, with luck, might provide us with bridoma celllinessecreting antibodiesthat some very useful antibodies. recognize the antigen. Of these, approximately seven have been cloned through soft agar to homo- geneity. At least five of these cloned lines produce IgGs that are capable of immunoprecipitating the Microinjection of the Purified Human ras protein in the presence or absence of denatur- Forms of the Activated and Normal ants (SDS) and are being characterized as to their Cellular ras Proteins into Living Cells relative specificities toward the other protein mem- J.R. Feramisco, T. Kamata, G. Binns bers of the ras family and to their effects on the guanine-nucleotide-binding reaction characteristic As mentioned above, we have made homogeneous of the ras proteins. preparations of the full-length forms of the human

Figure 3 Approximately 30 NRK cells in the center of the field were each injected with approximately 106 molecules of the human activated Ha-ras protein (full length) purified after expression in E. coli. Photographs of the area were taken right after injection (0 hr) and as indicated in the frames.

44 Ha-ras proteins (both the wild-type or proto-onco- or c-N-ras, depending on the degree of homology genic form and the activated or oncogenic form), with v-Ha-ras, v-Ki-ras oncogenes, or the human as well as an activated protein lacking the carboxy- cell line of initial description (i.e., neuroblastoma), terminal 20 or 50 amino acids. All of these pro- respectively. All of the known c-ras oncogenes have teins seem to be "native" and are capable of binding normal or proto-oncogene forms that have only a guanine nucleotides (to at least the 30 % level) by single amino acid change from the corresponding several different types of assays. M. Gross, S. Yo- activated oncogene forms. In general, the proteins koyama, R. Sweet, M. Rosenberg, and colleagues encoded by the ras-gene family are approximately (Smith, Kline, and Beckman Laboratories) are in 21,000 daltons and are associated with the inner- the process of quantitating the binding properties surface plasma membrane. The only known bio- of these proteins more exactly. chemical property common to all forms of the ras We have begun studies utilizing these purified proteins is the ability to bind guanine nucleotides. proteins and microinjection into living, normal cells In the particular case of the v-Ha-ras protein, ap- in order to gain more insight into the function of parent autophosphorylation on threonine occurs the human ras oncogenes. The initial results of (both in vivo and in vitro). The guanine-nucleotide- these experiments show some very promising fea- binding property is most likely an important prop- tures. As shown in Figure 3, within several hours erty of the ras proteins, since in a temperature-sen- after injection of the oncogenic form of the human sitive viral mutant of the v-Ki-ras gene, the virus is Ha-ras protein into confluent NRK cells, dramatic temperature sensitive for transformation and the v- morphological changes in the cells can be detected. Ki-ras protein is temperature sensitive for the Microinjection of high levels of the normal, proto- guanine-nucleotide-binding activity. Of the many oncogenic form of the ras protein has a slight effect alterations in the cellular phenotype associated with on the cells, but nothing as obvious as the effect of transformation by the ras oncogenes, the one rele- the activated protein. The carboxyterminal truncate vant to the present work is the apparent loss of epi- of the activated protein appears to have no effect on dermal growth factor (EGF)-binding sites on the the cells. Video time-lapse recording of the cells surfaces of the transformed cells. This has been after microinjection of the activated ras protein in- postulated to occur as a result of either down-reg- dicated numerous cell divisions and incredibly ac- ulation of the receptors or occupancy of the recep- tive cell movements such as blebbing and ruffling. tors by the alpha-type transforming growth factor Other experiments indicate that the effect of the ras (TGFa), which is produced by the transformed protein requires entry into the cells, is temporary, cells. Because of the similar cellular location of does not require the presence of serum, and is in- ras oncogene proteins and the growth factor recep- hibited by cycloheximide or actinomycin D. We are tors, and because several other hormone systems in the process of trying to understand this effect in utilize guanine-nucleotide-binding proteins as reg- ulatory elements (such as the G protein of the ade- molecular detail. nylate cyclase system), we investigated the possible relationship of ras oncogene proteins to the EGF receptors. We have found that the normally low Is the ras Oncogene Protein a EGF-binding activity of ras-transformed cell mem- Component of the Epidermal Growth branes is apparently stimulated by the addition of Factor Receptor System? guanine nucleotides. By immunoadsorption of the ras proteins from the membranes, wefound that T. Kamata, G. Binns, J. R. Feramisco this effect appears dependent on the presence of the found that the A number of human cellular oncogenes have been ras protein. In addition, we have phosphorylation of the v-Ha-ras protein and the identified in part by transfection of DNA from tu- guanine-nucleotide-binding activity of the v- or mor-cell lines and tumor tissues into NIH-3T3 cells. Several of these oncogenes have been classified as c-Ha-ras proteins in membranes isolated from members of the ras-gene family because of their transformed cells are stimulated by the addition of relatedness to the viral oncogenes of Harvey (v-Ha- EGF and MgGTP- . Taken together, these results ras) or Kirsten (v-Ki-ras) murine sarcoma virus suggest a role for the ras oncogene protein in the (Ha-MSV or Ki-MSV). The human genes have been EGF receptor system, perhaps acting in a manner put into at least three classes, c-Ha-ras, c-Ki-ras, similar to the G protein.

45

TUMOR VIRUSES

PAPILLOMA VIRUSES

Human Papilloma Virus Expression new restriction sites in the noncoding region up- Vectors stream of the E region and downstream from the L L. T. Chow, A.J. Pelletier, S. Cheng, region. In addition, small deletions have been made R.L. Galli, T.R. Broker (using BAL-31 exonuclease) in the noncoding re- gion of HPV-1 so that the surrogate heat-shock pro- Human papilloma viruses (HPVs) cannot be prop- moter is at different distances from the E-region agated in cell cultures. Nor do they generally ex- open reading frames. Part of our anticipation is that press mRNA in warts, in organ cultures, or in possible regulatory sequences in this region that transformed, transfected, or infected cell cultures may result in the normally very low levels of HPV in amounts sufficient for recovery and molecular transcription might be eliminated. Forty hours after analysis. Accordingly, to determine the structures transfection into COS A2 cells and amplification of of the mRNAs, we have adapted expression vec- the plasmid DNAs, the cells were shocked at 43°C. tors that variously include transcriptional enhancer The recovered cytoplasmic mRNAs were analyzed sequences, surrogate promoters, the SV40 replica- by electron microscopic heteroduplex methods. One tion origin (to amplify the DNA and increase gene of the clones gave about 100-fold more HPV-1-spe- dosage), or selectable drug resistances for isolation cific mRNA than had been observed previously. of transformed cells. Determination of the mRNA Most of the many mRNA species were indeed de- sequences will be necessary to ascertain how the rived from the Drosophila heat-shock promoter. All open reading frames might be used alone or in contained one or more splices. The most abundant combination after RNA splicing to encode proteins species spans the overlapping open translation necessary for cellular transformation, DNA repli- frames E4 and the carboxyterminal half of E2 in the cation, and virion morphogenesis. transformation region (Fig. 1); less-abundant spe- Our studies during the past year have focused cies extend across the Ll region coding for the ma- largely on three types of HPVs. HPV-1 causes plan- jor capsid protein. Minor species have long leader tar warts and exhibits relatively prolific replication sequences that span the E6 and E7 regions or long and gene expression in highly keratinized tissues. main bodies that extend through the El and L2 re- HPV-6 and HPV-11 are (along with HPV-16 and gions. Other clones were constructed to take advan- HPV-18) the leading causes of viral venereal dis- tage of the SV40 early promoter and enhancer. eases (condylomas, dysplasias, and, possibly, some Transfection of COS cells with such clones pro- carcinomas), resulting now in more than 1 million duced less HPV-specific RNA than clones with the medical visits per year in the United States alone. Drosophila heat-shock promoter. HPV-11 also causes laryngeal papillomatosis. CELLULAR TRANSFORMATION PAPILLOMA VIRUS EXPRESSION VECTOR Transformation of mouse C127 cells with clones We have assembled a vector that consists of a mod- driven by the Drosophila heat-shock promoter. ified pML2 (pBR322 deleted for the tet resistance Mouse C127 cells can be morphologically trans- gene and for the "poison" sequences that inhibit formed with cloned bovine and HPV DNAs. The replication in eukaryotes), the SV40 origin of rep- transformants contain the input DNA in an episo- lication and enhancer sequences, and the promoter mal state. We have attempted to transform C127 for the Drosophila gene encoding the heat-shock cells with a variety of cloned HPV-1 and HPV-6 protein (received from H. Pelham, Medical Re- DNAs, including those containing the Drosophila search Council, Cambridge, England). Into this heat-shock promoter upstream of the E-coding re- expression vector, the complete HPV-1 and HPV-6b gion. Transfected cells were generally kept at 37 °C DNA sequences have been cloned after addition of but were heat-shocked at 42 -43 °C for 1-5 hours

47 HPV-Ia

g"-E. 8

0 7 815 I I rl II I I

I m m `,7 s= 2, Open Reading Frames 71 E4 E;5 L I

2 1E 6 1 E l 3 E2 L2

fl AATAAA AATAAA

Figure 1 Electron microscopic mapping of RNA transcripts derived from COS cells transfected with a shuttle-expression vector containing the D. melanogaster heat-shock promoter, the SV40 replication origin and enhancer region, and a bacterial replication origin and the ampicillin resistance gene. The HPV-la restriction site and open reading frames are based on the revised DNA sequence of Danos et al. (EMBO J. 1: 23 [19821; see also Schwarz et al., EMBO J. 2: 2341 [19821). The HPV -1 cloning site near nucleotide 7630 is indicated by the dashed vertical line adjacent to the RNA 5' ends. Gaps in the RNA structures shown are intervening sequences deleted from the messages, the two most common of which are indicated by stars. The 3' ends are just beyond AATAAA poly(A) signals evident in the sequence. El is required from episomal DNA replication, E2/E4 for transformation, and L2 and LI for virion morpho- genesis. every other day. Morphological transformants were with laryngeal papillomatosis. Cloned HPV-11 se- picked after 3 weeks, and these are being grown up quences, also received from Gissman, were re- for further characterization as to the state of the moved from the original vector, recloned in a "poi- input DNA. son"-minus pK0 vector, and then used to transform C127 cells. The DNAs from morphological trans- formants were characterized by Southern blotting, Transformation of Rat 4 cells.HPV-6b DNA se- and the input HPV-11 clone was found to be inte- quences received from L. Gissman (German Can- grated, similar to the result we obtained with HPV- cer Research Center, Heidelberg) were originally 6b. represented in two separate BamHI-EcoRI frag- ments. These were reassembled at the EcoRI site, and the entire HPV-6b was recloned in pKO-neo (constructed by D. Hanahan, Mammalian Cells PHYSICAL CHARACTERIZATION OF HPV DNAs Section) from which we deleted the "poison" se- Heteroduplexes were prepared between HPV-6b and quences in the pBR322 portion. This recombinant HPV-11 DNAs, and the samples were analyzed DNA was then transfected into Rat 4 cells, and col- under moderate stringency (30% formamide, 0.1 M onies resistant to the neomycin analog G418 were salt, 23°C). The DNAs were paired over 90% of obtained. DNA was recovered from clonal isolates their lengths, indicating that the homology is at of the transformed cells and characterized. All least 46% in the paired regions. Extensive pairing clones experienced rearrangements, and the DNA persists at higher stringencies (60% formamide), is integrated. This result is different from what was indicative of more than 73% homology in those re- observed with BPV-1 cloned into similar vectors gions. On the basis of these electron microscopic (Matthais et al., EMBO J. 2: 1487 [1983]). studies, the physical and genetic maps of HPV-6b HPV-11, a virus related to HPV-6b, is associated and HPV-11 have been aligned.

48 Genomic Organization of HPV-5 not yet been determined. Therefore, to infer the ap- S. Watts, L. T. Chow proximate locations of the functional regions of the HPV-5 genome, we annealed HPV-5 DNA to HPV - Patients with epidermodysplasia verruciformis la DNA, for which the complete DNA sequence (EV) exhibit a rare familial disease characterized and the organization of open translation frames are by multiple persistent flat warts. Many distinct known (Danos et al., EMBO J. 1: 231 [1982]), and types of HPVs have been isolated from these le- we examined the heteroduplexes by electron mi- sions, but thus far only HPV types 5 and 8 have croscopy. Under low-stringency hybridization con- been associated with the progression of sun-ex- ditions, partial hybrids were formed between HPV-5 posed lesions to primary and metastatic squamous and HPV-1 DNAs in two regions, the major one cell carcinomas. Multiple episomal copies of HPV representing portions of the El and E2 open read- DNA are present both in the benign warts and in ing frames and another, less homologous region, the primary and metastatic carcinomas, although representing a portion of the L2 open reading frame carcinomas do not produce detectable viral parti- of the HPV-1 genome. Partial homologies in these cles. We have demonstrated that molecularly cloned particular regions have been seen consistently be- HPV-5 DNA is able to induce morphological trans- tween many pairs of papilloma virus genomes an- formation of cultured mouse C127 cells and to per- nealed under conditions of reduced stringency. sist as an episome in these transformed cells (S. Therefore, alignment of the HPV-5 DNA homology Watts et al., in prep.). Accordingly, we chose to in- to HPV-1 DNA allowed us to approximate the po- vestigate the functional organization of the HPV-5 sitions of the corresponding genetic regions of genome. HPV-5 DNA (Fig. 2A,C). The nucleic acid sequence of HPV-5 DNA has In addition to wild-type genomes, several sub-

A.HPV-5

0PI .4 V±1 cg

h q t7 Ei II a NN m 6 r`l

B. Bom 59.0 90.3 S HPV-5/ 3 5 4300 by 2400 cud. 800 by

B m 51.3 75.083.887.5 HPV -5/3 7 I 3700 by 1800 nucl 700 by\ 1000 by 300nucl. Born 66.5 86 S HPV - 5/4 0 i 4900 by 1500 nucl. IIOObp

C. HPV-lo p ( A ) p(A) Frame 1, [1] L I 2M

3 E2 1.2 1

Figure 2 Diagrams of the genomic organizations of HPV-5 DNA and deletion mutants. (A) Restriction endonu- clease map of HPV-5 DNA. Map positions indicate the percentage of the genome from the unique Sad site. (B) Map positions of deletions in the 3.5-, 3.7-, and 4.0-MD subgenomic species of HPV-5 DNA. Map positions of the deletions as determined by electron microscopic heteroduplex formation are indi- cated by the open boxes. (C) Alignment of HPV-1 DNA relative to HPV-5 DNA by electron microscopic heteroduplex mapping. The positions of the HPV-1 open translation frames are based on the revised DNA sequence.

49 genomic species of episomal HPV-5 DNA have formed cells in an episomal state. We have also as- been detected in carcinomas of EV patients by sayed purified fragments of the HPV-5 genome for Southern blot hybridization (Ostrow et al., Proc. their ability to transform C127 cells. A 3.3-MD- Natl. Acad. Sci. 79: 1634 [1982]), and some have fragment BamHI (03)- Hindlll (71) and a 2.9-MD- been molecularly cloned in bacteriophage X. Re- fragment BglII (03)-Bgill (62) were able to induce striction endonuclease mapping indicated that the transformation. sequences deleted in these mutants overlapped a Thus, studies with HPV-5 subgenomic species single region of the wild-type genome. As depicted and genomic fragments have delineated the gen- in Figure 2B, we mapped three of these subgenomic omic region necessary for in vitro transformation DNAs relative to wild-type DNA by electron mi- and episomal replication and are consistent with the croscopy of heteroduplexes to show that these DNA organization of the genome that we propose as a species lacked portions of the genomic region as- result of heteroduplex mapping relative to HPV-1 sociated with virion morphogenesis. DNA. Through analyses of transcripts and proteins All of the mutants appeared to retain the ability in cells transfected with vectors containing HPV-5 to transform C127 cells in culture. Preliminary re- DNA, we intend to help elucidate the requirements sults of Southern blots of transformed cells indicate for HPV-5 expression and transformation. that virus-specific DNA was present in the trans-

ADENOVIRUSES/SV40

Adenovirus Early Gene Regulation inhibitory effects on E2A expression. This investi- M. Rossini, R. Guilfoyle, W. Osheroff, gation has taken advantage of two preexisting and L. T. Chow, T.R. Broker [Electron characterized adenovirus E1A mutants: hrl,in Microscopy Section] which a single-base mutation introduces a protein termination codon into the 13S mRNA while leav- ing the 12S mRNA functional (Ricciardiet During the study the al., Proc. Natl. Acad. Sci. 78: 6121 [1981]), and genome of human adenovirus type 2 (Ad2) as a pEKpm975 (obtained from A. Berk, University of model for gene regulation. We have concentrated California, Los Angeles), in which a single-base our effort on the regulatory interactions between transversion at the donor splice site for the 12S early regions IA (E1A) and 2A (E2A). E2A en- mRNA eliminates its production while the 13S codes the DNA-binding protein (DBP) necessary message and its protein product are still made for replication. An interesting and unusual prop- (Montell et al., Nature 295: 380 [1982]). erty of E2A is that its transcription occurs from Last year, we reported as preliminary results that different promoters: At early times after infection, the E1A plasmid (pEKpm975) generating only the RNA synthesis initiates from a promoter located at 13S mRNA maintained, in the microinjection sys- map coordinate 75 (Berk and Sharp, Cell 12: 45 tem, the ability to stimulate the production of DBP [1977]; Evans et al., Cell 12: 733 [1977]; Kitching- from the early promoter clone but lost the ability to man et al., Proc. Natl. Acad. Sci. 74: 4392 [1977]) inhibit its expression from the late promoter plas- and at late times from a promoter at map coordinate mid. Conversely, the E1A plasmid with an intact 72 (Chow et al., J. Mol. Biol. 134: 265 [1979]). 12S mRNA (hrl) lost the ability to stimulate the The expression of DBP is under the control of E1A DBP early promoter but maintained the inhibitory (Berk et al., Cell 17: 935 [1979]; Jones and Shenk, effect on the late promoter clone (M. Rossini et al., Proc. Natl. Acad. Sci. 76: 3665 [1979]; Nevins, in prep.). These results have been confirmed by Cell 26: 213 [1981]). many replicate experiments, and the same results E2A plasmids containing the DBP gene associ- have also been achieved using cDNA clones (con- ated with its early or late promoter were microin- structed by B. Zerler and E. Moran, this section) jected into hamster cell nuclei in the presence or of the 12S and 13S mRNAs. absence of plasmids expressing some or all of the To test the assumption that the effect of E1A on E1A functions, and DBP production was monitored E2A synthesis occurs at the transcriptional level, by indirect immunofluorescence. E1A stimulates we have constructed deletions at the E2A early and the production of DBP from the early promoter and late promoter regions by BAL-31 exonucleolytic represses the synthesis of DBP from its late pro- digestion to define the DNA sequences respon- moter (Rossini, Virology 131: 49 [1983]). sive to E1A regulation. Microinjection analyses of From these findings, we have analyzed which of these deletion mutants have indicated that the se- the El A products is involved in the stimulatory or quences between nucleotides 87 and 51 upstream of

50 the E2A late transcription RNA cap site contain the gion blocks entry of RNA polymerase II at this site E1A regulatory interaction site. Surprisingly, dele- and transcription initiates from the late promoter. tions in the early promoter region up to +5 (within (3) The action of anti-Z DNA antibodies could be the normal transcript) fail to abolish the ability of indirect, through binding to a cellulargene coding E1A to stimulate DBP production, suggesting a for the factor with a repressor function on early less-specific mechanism of activation of E2A early gene transcription, as proposed by Nevins (Cell promoter by E1A. 26: 213 [1981]). In any case, the finding that an an- Recognizing certain limitations of our experi- tibody directed to a specific structure of DNA has mental system based on the immunofluorescent an effect on gene expression and can simulate the staining of the final product (DBP) of a multistep action of a known protein is of great interest, and process, we have initiated experiments leading to a additional investigation of the subject should shed more precise characterization of the regulation. more light on the complex problem of gene regu- These consist of (1) immunoprecipitation of DBP lation. from microinjected cells for a better quantitation of the stimulation or the inhibition of its production, (2) analysis of RNA from cells transfected with wild types and deletion mutants in the presence or Identification of Adenovirus DNA absence of E1A DNA, and (3) analysis of chlor- Replication Proteins amphenicol acetyltransferase (CAT) activity in cells B. Stillman, T. Grodzicker, E. White transfected with plasmids containing the E2A early or late promoter upstream of the bacterial cat gene, The replication of adenovirus DNA in cell-free ex- in the presence or absence of wild-type or mutant tracts remains the only such system available in E1A plasmids. higher cells to study the detailed enzymology of Analysis of the sequences in the E2A early pro- DNA synthesis and its control. Studies from a moter has revealed the presence of a few stretches number of laboratories over the past 5 years have of alternating purines and pyrimidines 7 or 8 nu- identified and purified five proteins that, when cleotides long, apparently sufficient for the DNA combined, will initiate and complete one round of conformation to switch to the Z-helix structure. adenovirus DNA synthesis. Three of these pro- This observation has been the basis to attempt in teins, encoded by the viral genome, are the single- vivo studies using the microinjection technique to stranded DNA-binding protein (DBP), the precur- investigate the effect of antibodies against the Z- sor terminal protein (pTP), and the adenovirus DNA structure (obtained from A. Rich, Massa- DNA polymerase (Adpol). The latter two are re- chusetts Institute of Technology) on the expression quired for initiation of DNA synthesis at the repli- of DBP. Preliminary results have indicated that cation origin (see below), and probably all three coinjection of anti-Z-DNA antibodies with the DBP are required for elongation of DNA synthesis. Two plasmid containing both its early and late pro- proteins, encoded by the host cell, are also required moters significantly increases the percentage of to replicate adenovirus DNA in vitro and have been cells fluorescent in response to DBP. named factor I and factor II. Factor I is a site-spe- We have also examined human cells infected with cific DBP required for initiation of DNA synthesis Ad 5d1312, a mutant virus in which the E1A region and binds to sequences within the adenovirus origin has been completely deleted (Jones and Shenk, Cell of DNA replication (see below), whereas factor II 17: 683 [1979]) and, accordingly, from which E2A is required for elongation of DNA synthesis and is not expressed. As expected, the cells did not has been shown to be a type I topoisomerase. show any fluorescence for DBP. When an E1A Biochemical characterization in vitro of adeno- plasmid was injected into Ad5dl312- infected cells, virus mutants that fail to replicate their DNA in in- complementation occurred and the cells showed flu- fected cells has proved an invaluable method to de- orescence for DBP. Cells infected with Ad 5d1312 termine the role of virus-coded proteins in the and then microinjected with anti-Z-DNA anti- replication process. Using such an approach, we bodies also produced DBP. had previously identified and characterized a novel Although these results are preliminary, several DNA polymerase that is encoded by the virus and possibilities can be envisioned to explain the mech- is defective in the mutant Ad5ts149. Another tem- anism of action of anti-Z-DNA antibodies: (1) A perature-sensitive mutant Ad2ts111, isolated by tract of alternating purines and pyrimidines ob- Martin et al. (J. Gen. Virol. 41: 303 [1978]), has served in the early promoter for DBP is recognized an unusual and interesting phenotype in infected by the antibodies, which act as Z-DNA-binding He La cells; it is unable to replicate its DNA at the proteins. A change from B conformation to Z con- nonpermissive temperature, but it also induces deg- formation or, conversely, stabilization of a transi- radation of the host cell's chromosomal DNA tory Z-DNA structure might occur by this interac- (D'Halluin et al., J. Virol. 32: 61 [1979]). tion, with a subsequent activation of the gene. (2) Replication extracts prepared from the nuclei of The binding of antibodies to the early promoter re- cells infected with Ad2ts111 were unable to repli-

51 cate adenovirus DNA at 37°C, but they could rep- rus does not induce this DNA degradation. The licate DNA at 30°C. Thus, the virus contained a amount of degraded DNA increases with time post- mutation in a gene that encoded a thermolabile pro- infection and with the multiplicity of infection, and tein. The replication defect was shown to be at the it is not a temperature-sensitive phenotype, unlike stage of elongation of DNA synthesis, since these the DNA replication defect (see above). The amount extracts could form a functional initiation complex of degraded DNA is also increased by preventing at 37°C. viral and cellular DNA synthesis in infected cells, A protein was purified from Ad2 wild-type-in- which suggests that cellular DNA synthesis is not fected He La cells that could completely comple- required for the degradative process and that an ment the Ad2ts111 replication defect in vitro and early viral gene is responsible, at least in part, for was shown to be the adenovirus DBP. This was an the defect. This is consistent with our finding that unexpected finding, since a previous report sug- this mutation is localized in the E1B 19K tumor an- gested that the mutation in Ad2ts111 did not map in tigen. A recombinant virus that contains the E1B the gene encoding DBP (D'Halluin et al., J. Virol. mutation from Ad2ts111 and the wild-type DBP 41: 265 [1982]). However, this proved to be incor- gene from Ad5 was obtained. This recombinant, rect, and we have demonstrated that Ad2ts111 con- named Ad2cyt106, retains the ability to induce cel- tains two mutations, one in the gene encoding DBP lular DNA degradation and,likeitsparent and the other in an E1B gene. Ad2ts111, causes enhanced cytopathic effect in the The mutation in the DBP gene produces a defec- host cell. These phenotypes are similar to those tive protein that can be distinguished by several cri- previously observed with some Ad12 mutants (Tak- teria from the defective DBP produced in another emori et al., Virology 36: 575 [1968]; Ezoe et al., temperature-sensitive mutant Ad5ts125. Unlike the J. Virol. 40: 20 [1981]). Ad2ts111 DBP, which is stable and normally phos- A number of mutants in the adenovirus E1B 19K phorylated at the nonpermissive temperature, the tumor antigen have been reported, and we have Ad5ts125 DBP is rapidly dephosphorylated and de- studied three additional mutants, Ad2/p3, Ad21p5 graded by proteases at the restrictive temperature. (Chinnandurai, Cell 33: 759 [1983]), and Ad5d1337 Second, the Ad5ts125 DBP, produced at the per- (T. Shenk, pers. comm.). All of these mutants cause missive temperature, is very difficult to heat-inac- enhanced cytopathic effect in infected HeLa cells, tivate in vitro, whereas the Ad2ts111 DBP is readily but only 1p5 and d1337 induce degradation of cel- inactivated in vitro. It is most likely that the muta- lular DNA. Thus, 1p3 is an example of a cyto- tion in the gene encoding the Ad2ts111 DBP occurs pathic-effect mutant (cyt) that fails to induce deg- at an active site in the protein, and we are currently radation of cellular DNA and therefore eliminates sequencing this gene to determine the change in the possibility that the DNA degradation is a result primary protein structure. of general cell destruction by the virus. A second mutation found in Ad2ts111 is respon- The intracellular localization of the E1B 19K tu- sible for the degradation of cellular DNA that oc- mor antigen was investigated using antibodies that curs after infection with this virus. This defect oc- recognize synthetic peptides contained within either curs at all temperatures in vivo and has been the carboxyterminal or aminoterminal region of the localized by DNA sequence analysis and marker protein (Green et al., J.Virol. 48: 604 [1983]). rescue techniques to the E1B 19K tumor antigen, a Both antisera stain, by indirect immunofluores- protein that is required for adenovirus-induced cence, the E1B 19K antigen in wild-type-infected transformation of cells to tumor equivalents. Bio- HeLa cells. The protein is localized in both a cyto- chemical characterization of this protein and the plasmic membrane structure (endoplasmic reticu- mutant phenotype is described below. lum) and the nuclear envelope at early to interme- diate times postinfection, but late in infection it localizes solely within the nuclear envelope (see Fig. 1). The nuclear-envelope staining was similar Mutations in a Nuclear-envelope- to that observed in cells stained with a human au- associated Adenovirus Tumor Antigen toantibody (McKeon et al., Proc. Natl. Acad. Sci. Induce Degradation of Cellular DNA 80: 4374 [1983]) that recognizes lamins A and C, E. White, T. Grodzicker, B. Stillman two proteins that form part of the nuclear lamina at the internal surface of the nuclear envelope (see Fig. As indicated above, we have shown that an adeno- 1). Upon biochemical fractionation of infected virus mutant, Ad2ts111, contains two apparently in- cells, the E1B 19K protein copurifies with the lamin dependent mutations that affect viral DNA synthe- proteins, with 50% of the protein very tightly bound sis and cellular DNA integrity. Upon infection with to the lamina and 50% eluting with high-salt treat- this mutant, cellular DNA is degraded into low- ment. molecular-weight fragments (-- 40,000 to 300 bp) By indirect immunofluorescence, the E1B 19K that can be visualized by electrophoresis of extra- protein produced in /p3-infected cells was indistin- chromosomal DNA through agarose. Wild-type vi- guishable from wild-type protein; however, in the

52 tains and expresses E1A and E1B gene products) but fail to grow in HeLa cells (which do not contain adenovirus gene products). When HeLa cells were infected at low multiplicities of infection with either mutant, the amount of accumulated intracellular viral DNA at late times in infection was low com- pared with the amount for similar infections with wild-type virus. At higher multiplicities of infec- tion, the difference between the amount of mutant and wild-type DNAs was not as apparent. Upon closer examination of the time course of DNA synthesis using one of the host-range mu- tants, Ad5hr7, it was found that the onset of viral DNA synthesis was delayed in infected HeLa cells by approximately 10 hours, relative to the onset of Figure 1 DNA synthesis observed in wild-type-infected Indirect immunofluorescence (A and C) of He La cells infected HeLa cells. The rate of accumulation of viral DNA with wild-type adenovirus and fixed at 40 hr postinfection. Cells was also reduced in Ad5hr7-infected HeLa cells. were labeled with antisera against the E1B 19K protein (A) or But Ad5hr7 synthesizes normal amounts of early the host-cell lamin protein (C). The corresponding phase-con- viral proteins with no apparent delay in their rate trast photographs are shown in B and D. of accumulation (Ross et al., Virology 103: 475 [1980]), except for the E1B 57K tumor antigen, which cannot be detected in mutant-infected cells. mutants that induce degradation of cellular DNA, This might suggest that the E1B 57K protein en- the E1B 19K protein had an altered intracellular lo- hances the efficiency of viral DNA synthesis in an cation (tslll, cyt106, 1p5; the protein is not de- indirect manner. We have produced a number of hy- tected in d1337-infected cells). These studies show bridoma cells that make monoclonal antibodies that the degradation of cellular DNA induced by against the E1B 57K tumor antigen, and these will these mutants correlates with the failure of the El B aid in future biochemical characterization of the 19K tumor antigen to localize with the nuclear en- role that this protein plays in controlling DNA syn- velope. However, in mutants that fail to produce the thesis. E1B 19K protein (Ad5d1337 and Ad5d1313), the One intriguing feature of the E1B 57K host-range degradation is still observed. This suggests that it mutants is that they appear to grow normally in is not the E1B 19K protein that degrades cellular nontransformed, primary human embryo kidney DNA, but that degradation is caused by either a cells (Harrison et al., Virology 77: 319 [1977]), cellular protein or another early adenovirus protein which raises the possibility that some human em- that is activated in the absence of the E1B 19K pro- bryonic cells may contain a protein with a function tein. We are currently searching for this activity in similar to that of the E1B 57K tumor antigen. A mutant-infected cells. number of human cell lines that do not contain ad- enovirus sequences are currently being examined for their ability to complement the DNA replica- tion defect in Ad5hr7. Adenovirus Mutants That Delay the Onset of DNA Synthesis In Vivo B. Stillman Characterization of DNA Sequences In addition to the three virus-coded proteins that Required for Adenovirus Replication are directly required for replication of viral DNA, Origin Function a number of "early" viral proteins are indirectly re- B. Stillman, F. Tamanoi quired. These include the E1A proteins, which en- hance transcription of the early region genes that We had previously cloned into bacterial plasmid encode replication proteins, and an E1B gene prod- vectors adenovirus DNA sequences that are re- uct. The replication of adenovirus DNA in HeLa quired for the initiation and elongation of DNA cells infected with E1B host-range mutants was ex- synthesis, using partially purified enzymes pre- amined as part of a study to define the function of pared from adenovirus-infected HeLa cells. These E1B gene products. These studies employed two studies demonstrated that specific sequences were host-range mutants, Ad5hr6 and Ad5hr7, which required for the initiation of DNA synthesis in vi- were originally isolated by Harrison et al. (Virol- tro, and recent work has concentrated on defining ogy 77: 319 [1977]) and are capable of growth in the precise boundaries of these sequences and their 293 cells (a human embryo kidney cell that con- function, particularly their interaction with repli-

53 cation proteins. Recently, we have also collabo- and the 5'-terminal dC residue where initiation takes rated with R. Guggenheimer and J. Hurwitz (Al- place. bert Einstein College of Medicine) and have The two domains of the adenovirus origin are examined the ability of purified replication pro- both required for efficient initiation of DNA syn- teins to interact with origin sequences and their thesis. The function of the factor I protein and its mutant derivatives, and this has led to the func- specific binding site in adenovirus DNA may shed tional origin being divided into two independent light on the role that this protein plays in uninfected domains. cells. We introduced mutations into the origin se- quences by creating deletions that remove se- quences from either end of the cloned inverted ter- minal repeat of adenovirus DNA, a structure that is Transcriptional Activation by the SV40 located at both ends of the linear adenovirus chro- Enhancer: Possible Role for Z-DNA mosome and contains within its boundaries the rep- W. Herr, Y. Gluzman lication origin. In addition, site-specific mutations in this sequence were created using synthetic oli- Enhancer elements were originally discovered as gonucleotides. The individual mutant DNAs were novel elements contained in the SV40 early pro- tested for their ability to act as a template for initi- moter. They have received considerable attention ation and elongation of DNA synthesis using both because of their ability to increase the transcrip- partially purified and purified replication proteins. tional activity in cis of a variety of heterologous Furthermore, the mutant DNAs were also exam- promoters as well as the bona fide SV40 promoter. ined for their ability to bind to purified factor I, Enhancers are unique controlling elements because a He La cell protein that is a site-specific DNA- they are capable of stimulating transcription irre- binding protein required for efficient initiation of spective of their orientation or position in relation DNA synthesis in vitro. All plasmid DNAs that to the affected promoter. The mechanism of tran- contained a deletion of sequences that overlap with scriptional activation is not yet known. the factor-I-binding site were not capable of bind- In a recent study, A. Nordheim and A. Rich ing to that protein and also were unable to support (Massachusetts Institute of Technology) identified DNA synthesis. Thus, in the presence of He La fac- sequences within the SV40 genome that have the tor I, the factor-I-binding site is required for effi- potential to form the Z configuration of DNA (Z- cient DNA synthesis, and we have called this re- DNA). Z-DNA is a left-handed double helix that gion domain II(see Fig.2).However, under occurs in nucleotide sequences of alternating pur- conditions where factor I is present in suboptimal ine and pyrimidine residues and is stabilized in concentrations, as well as high DNA template con- negatively supercoiled, circular DNA molecules, centrations, the factor-I-binding site was no longer because the B Z form transition relieves stress necessary for DNA synthesis, but a sequence of created by such supercoils. Using antibodies that only 20 by (domain I, see Fig. 2) could support bind specifically to Z-DNA, Nordheim and Rich initiation in vitro. Domain I contains a 10-bp core identified two 8-nucleotide-long sequences of al- sequence (sequence A in Fig. 2) that we had previ- ternating purines and pyrimidines that can form ously shown to be perfectly conserved in all human Z-DNA in negatively supercoiled SV40 genomic adenoviruses. The B region in Figure 2 is thought DNA. Because these sequences lie within the en- to be a spacer sequence between the core sequence hancer region, Nordheim and Rich suggested that the potential to form Z-DNA may be important for enhancer activity. In support of their hypothesis, they found short stretches of alternating purines and DOMAIN II pyrimidines in many other enhancer elements. DOMAIN I This model can be tested by mutating these short sequences within the SV40 enhancer so that the ability to form Z-DNA is either destroyed or main- 10 20 30 40 50 11 tained and then to determine whether the enhancer CATCATCAATAATATACCT ATTTTGGATTGAAGCCAATATGATAATGAGGG activity correlates with the ability to form Z-DNA.

1 Transitions (i.e., pyrimidine to pyrimidine) should R8 S201 not markedly affect the ability to form Z-DNA, R17 1 pLAS107 whereas transversions (i.e., pyrimidine to purine), which eliminate the alternating pattern of purines Figure 2 and pyrimidines, should both destroy the potential DNA sequences required for the adenovirus origin of DNA to form Z-DNA and, if the model is correct, dimin- replication. The origin has been functionally divided into two domains and a cell protein binds to domain II. (Reprinted, with ish enhancer activity. We have tested the model in permission, from Guggenheimer et al., Proc. Natl. Acad. Sci. this fashion by point mutagenesis of the SV40 en- [1984, in press].) hancer region.

54 We constructed two sets of mutated enhancers by enovirus to grow in simian cells. Recent evidence oligonucleotide-directed mutagenesis in which two also suggests that the T antigen is involved in the of the eight nucleotides of the alternating purine assembly of viral particles. In nonpermissive cells, and pyrimidine stretches were each altered by either T antigen is implicated in both the initiation and transition or transversion mutations. The potential maintenance of the transformed phenotype. This of the mutated enhancers to activate transcription 96-kD protein specifically binds to the SV40 origin was measured by analyzing the relative levels of of replication, has an ATPase activity, and is tightly human 0-globin transcription in a He La cell tran- bound to a 53-kD cellular protein in vivo. sient expression assay. We have found that, con- Several of these functions can be mapped to spe- sistent with the model that Z-DNA is important for cific regions of the SV40 A gene encoding large T enhancer function, the mutants containing trans- antigen. This suggests that the T-antigen protein versions exhibit a sevenfold reduction in the ability may contain distinct domains that are able to func- to activate the13-globin promoter, whereas the tran- tion somewhat independently. Mutants deficient in sition mutants show a less than twofold effect. only a subset of the biochemical and physiological To examine the effects of these mutations on activities of T antigen have been invaluable in map- SV40 replication, we reinserted the altered enhan- ping activities to different regions of the protein. cer elements into the SV40 genome and assayed the To investigate the role of the numerous activities of efficiency of plaque formation after transfection of T antigen in cellular transformation and the SV40 the DNAs into CV-1 cells. As in the O-globin tran- lytic cycle, we have utilized early mutants that are scription assay, the wild-type SV40 and transition deficient in viral DNA replication, but retain trans- mutants replicated with similar efficiencies, forming activity. whereas the mutants containing transversions Mutant SV40 DNA insertions have been rescued formed plaques at least 100-fold less frequently. from a variety of permissive cells transformed by By passage of the SV40 stock containing the UV-irradiated SV40 (simian cell lines C2, C11, C8, transversion mutations, we have obtained 18 rever- T22, and BSC-SV1). Viral DNA was rescued by fu- tants that have an increased ability to grow in CV-1 sion of these lines with COS-1 cells, which provide cells, albeit less efficiently than wild-type SV40. a functional T antigen in trans that allows mutant The revertants are the result of tandem duplication insertions to excise and replicate in the heterokary- of the mutated enhancer region that varies in size ons. The rescued SV40 inserts were cloned into from 45 to 135 nucleotides. Although the exact the plasmid vector pK1, restoring a complete SV40 boundaries of the duplicated sequences differ genome containing the early region (BglI- BamHI) greatly, there is a 15-nucleotide-long sequence in from the mutants and a wild-type late region. These common to all of the duplications, suggesting that DNAs were analyzed by marker rescue and DNA this region may also be important for enhancer sequencing. The mutants contain lesions in differ- function. Curiously, this 15-nucleotide stretch con- ent parts of T antigen that render the protein defec- tains the sequence GTGGAAAG that G. Khoury and tive for viral DNA replication but efficient in trans- P. Gruss (National Cancer Institute) have suggested forming cells in vitro. is functionally important because the sequence is Three mutants were sequenced and found to have conserved in a variety of enhancers. We plan to mu- mutations predicting amino acid changes at posi- tate this latter sequence to verify its functional sig- tion 516, Lys - Arg (pC2); position 522, Pro- Ser, nificance. and position 549, Pro- Arg (pCll); and position 203, His - Gln (pT22). Two mutations of the dou- ble mutant (pC11) were separated by subcloning pC11 restriction fragments. Two new mutant DNAs SV40 Mutants That Differentiate the (pC11-A and pC11-B) that contain only one of the Lytic and Transforming Functions of two mutations present in pCll were constructed. Large T Antigen pC11-A (position 522) retains the replication-neg- M. Manos, Y. Gluzman ative phenotype, whereas pC11-B (position 549) replicates at levels lower than those of wild type The large T antigen of SV40 is a multifunctional and forms pinpoint plaques. T antigen isolated from phosphoprotein. It is essential both in the lytic cycle mouse cells transformed by pCll -A is deficient in of the virus and in the process of oncogenic trans- ATPase activity (no activity was detected in our as- formation of cells by SV40. T antigen is expressed says). C2 and C 11-B T antigens were positive in early in the lytic pathway and functions in numer- ATPase assays. ous processes throughout the infectious cycle. It is The tumorigenicity of pC2 and pC11 was inves- required for the initiation of viral DNA replication; tigated by subcutaneous injection of the plasmids it autoregulates early viral RNA synthesis, stimu- into newborn hamsters. Both pC2 and the double- lates late viral transcription, and induces host-cell mutant pC11 caused tumors. pC2 appears to have DNA synthesis and rDNA transcription. T antigen an enhanced tumorigenicity compared with plas- also possesses a "helper function" that enables ad- mid pKl containing the wild-type SV40 genome.

55 Characterization of the Biological detectable. Induction by heavy metals gives effi- Properties of cDNA Encoding SV40 cient expression of T antigen from all of the hybrid constructs. Large T Antigen These hybrid genes have been used to transform Y. Gluzman both mouse embryo fibroblasts and monkey kidney cells. Transformants were obtained in the absence Last year, we reported cloning a complete cDNA of any induction of T-antigen expression by heavy copy of the SV40 large-T-antigen mRNA andplac- metals. The basal level of expression in these cell ing it under the control of the bona fide SV40 reg- lines is variable, as judged from both immunoflu- ulatory region. This early region was reconstructed orescent staining and immunoprecipitation of T an- with the SV40 late region into the complete SV40 tigen. Most lines increase the level of expression genome with the exception that the early regionhas two- to threefold upon heavy-metal induction. Rep- the cDNA for large T antigen. This DNA could lication of SV40 on sequences in at least some of replicate on CV-1 cells with greatly reduced effi- the transformed monkey cell lines is much greater ciency and produce very small plaques 15-20 days in the presence of heavy metals. postinfection. Marker-rescue experiments located We have also used a bovine papilloma virus vec- the deficiency in the cDNA construct to a region tor containing the metallothionein promoter/T an- that spans only the splicing region. Complementa- tigen chimeric gene to transform C127 mouse cells tion analysis with temperature-sensitive mutants and have characterized the subsequent expression demonstrated that cDNA SV40 DNA could be of T antigen by these cells. In this system, the me- complemented by tsB, but not tsA, mutants. These tallothionein promoter directs the synthesis of lev- data suggest that the cDNA construct has a defi- els of T antigen equal to or greater than that in COS ciency in the early region, but not in the coding cells and two- to threefold higher upon heavy-metal region per se. Preliminary data comparing the induction. The T antigen produced by these cells is amounts of mRNA produced from the cDNA con- capable of rescuing SV40 on sequences upon fu- struct and the bona fide early region indicate that sion with C6 monkey cells; however, no replication there is 3-5 times less mRNA made from the cDNA of SV40 on sequences can be detected in the trans- template. formed mouse cells when transfected with on -con- The SV40 cDNA construct transforms primary taining plasmids or infected with adenovirus-SV40 baby rat kidney cells and mouse embryo fibroblast hybrids. cells, although with lower efficiency than wild-type SV40. This reduced efficiency may be linked to the deficiency of producing normal quantities of mRNA or to the lack of small T antigen. Transformation and Viral Tumor Induction W. C. Topp, M. Dermody-Weisbrod, Heterologous Promoter Expression of K. Lionetti, E. Rubin SV40 T Antigen R.D. Gerard, Y. Gluzman Over the past several years, our group has been studying the phenomenon of rat breast fibroaden- of COS cells produce a relatively limited amount of oma induction by certain members of group D SV40 T antigen. For experimental purposes, it the human adenoviruses. We reported last year that would be advantageous to derive a COS-like cell susceptibility to tumor induction appeared to seg- line that produces a higher level of T antigen. It regate as a single recessive locus linked to the MHC would also be useful to be able to regulate the level haplotype of the animal. The F, cross between a of T antigen in these cells. Expression of the mouse susceptible and a resistant strain gave 100% resist- metallothionein gene has been shown to be induci- ance. We have now completed the N, backcross to ble by heavy metals such as cadmium and zinc. We the susceptible parent and have recovered suscep- have used the metallothionein promoter to express tibility in 17 of 100 animals inoculated at birth with SV40 T antigen inducibly and to a high level. human Ad9. To date, we have determined the MHC A BAL-31 deletion series in the 5'-untranslated haplotype of six tumor-bearing and six nontumor- sequences of the SV40 early gene has been con- bearing animals. All six tumor-bearing animals ex- structed. These deletions in the leader sequences pressed the MHC haplotype of the susceptible par- have been fused to the metallothionein promoter to ent, whereas four of the six resistant animals were produce a series of chimeric genes lacking SV40 of the haplotype of the F, parent. Although this on sequences and T-antigen autoregulatory se- strongly suggests that susceptibility to viral tumor induction is linked to the MHC, we have good evi- quences. In transient assays on cells transfected with these dence that this is not the sole determining factor. A constructs, immunofluorescent staining shows that second inbred strain (Albany) of the same MHC the basal level of expression of T antigen is barely haplotype as a known susceptible rat (Buffalo) has

56 proved resistant to tumor induction. We now plan coded large T antigen, one produces antibodies genetic crosses between the Buffalo and Albany against the viral VP1 protein, and four others se- strains to determine the nature of this resistance. crete antibodies that recognize intermediate fila- Although they are all very similar to one another ments. An eighth hybridoma from this series pro- physically, only 2 of the more than 20 group-D vi- duces antibodies that precipitate NPCs that have ruses are tumorigenic. To date, we have tested ten. been pulse-labeled with [3H]thymidine. Initial ex- It is interesting that of these ten, only two are as- periments have indicated that this protein is not vi- sociated with a known disease state in man, kera- rus-coded, and we are currently attempting to iden- toconjunctivitis, and the same two viruses are on- tify this antigen. cogenic. We reported earlier (in collaboration with L. Chow and T. Broker, this section) that a specific gene bank, early gene region 3 (E3), is substan- Analysis of the Cellular Tumor tially overexpressed in human Ad9-infected cells as compared with other adenovirus infections. We have Antigen p53 now found that in cells infected by two nononco- E. Harlow, N. Williamson, T. Adams genic group-D viruses (13 and 26), E3 is not abun- dantly expressed. This is particularly interesting in Animals bearing tumors induced by a wide variety light of the fact that E3 encodes at least one cell- of agents often produce antibodies specific for a surface glycoprotein known to interact with the normal cellular protein known as p53. This protein MHC. Furthermore, keratoconjunctivitis is thought has been implicated in an obligatory role in one of to result from the formation of an antibody/antigen the steps between mitogen stimulation and the ini- precipitate over the cornea of the eye, and it is in- tiation of cellular DNA synthesis. Several studies triguing that E3 may encode this precipitating an- have demonstrated that the regulation of p53 syn- tigen. Preliminary results, however, show that thesis, phosphorylation, and/or turnover is altered Ad10, also oncogenic, does not noticeably over- in a number of transformed cells. In SV40- and ad- produce E3, but we are continuing to evaluate this enovirus-transformed mouse cells, p53 is found in hypothesis and are repeating a number of these ex- a stable complex with one of the virus-coded early periments. proteins. In collaboration with S. Benchimol and J. Jenkins (Imperial Cancer Research Fund Labora- tories, London), we have isolated a cDNA copy of a portion of the mouse mRNA for p53. Using this cDNA as a hybridization probe, we have deter- Monoclonal Antibodies to SV40 mined the levels of p53 mRNA in various tissues Nucleoprotein Complexes and during development. Analysis of mRNA iso- R. D. Gerard, E. Harlow lated from different stages of embryonic develop- ment of the mouse has revealed that the expression During the lytic cycle of SV40 infection, the viral of p53 mRNA is drastically reduced during the fi- DNA can be recovered from the nucleus as a nu- nal stages of embryogenesis. Preliminary evidence cleoprotein complex. These complexes are hetero- suggests that the expression of p53 is also differ- geneous in nature and include DNA that is being entially controlled in tissues of the adult mouse. We actively replicated and transcribed. Consequently, have used the mouse cDNA clone to identify a hu- these complexes should contain a variety of eukary- man cDNA clone that appears to be a full-length otic proteins that are involved in replication and copy of the human p53 mRNA. This cDNA is cur- transcription. We have begun an analysis of the im- rently being cloned into several of the well-char- munogenic proteins in these complexes. acterized eukaryotic expression vectors. Introduc- SV40 nucleoprotein complexes (NPCs) were iso- tion of these vectors into the appropriate mam- lated from virus-infected CV-1 monkey cells and malian cells should allow the production of suffi- were purified by sucrose gradient centrifuga- cient quantities of p53 to begin purification and tion. After the complexes were fixed by formalde- biochemical analyses. Because of the small quan- hyde treatment, they were used to immunize a tities of p53 found in normal cells and tissues, these BALB/c mouse. Hybridomas were constructed, and experiments have not been possible until now. tissue-culture supernatants were screened for anti- bodies specific for NPCs by indirect immunoflu- orescence on SV40-infected CV-1 monolayers. Of the 384 cultures examined, 36 hybridomas pro- Monoclonal Antibodies to the duced antibodies recognizing antigens present in Adenovirus E1A Proteins SV40-infected cells. Four distinct staining patterns E. Harlow, C. Schley were observed: cell surface, diffuse cytoplasmic, cytoplasmic network, and nuclear. Two of these hy- Following infection of mammalian cells with ad- bridomas produce antibodies specific for the SV40- enovirus, the first virus-coded proteins synthesized

57 are the products of the E1A region. RNA from this nation of translation and also may be useful in the region is differentially spliced to produce two early construction of an in vitro system for the produc- mRNAs of 12S and 13S. Translation of these RNAs tion of large polysome complexes. A number of yields two proteins with identical amino and car- laboratories have demonstrated that rare mRNAs boxyl termini, but the 13S product has 46 addi- may be simply and efficiently cloned using anti- tional amino acids in the central region of this poly- bodies to immunoselect mRNAs from a polysome- peptide. These proteins are phosphorylated and are mRNA-nascent polypeptide complex. We are cur- found primarily in the nucleus. Although their rently investigating the properties of rabbit reticu- functions are poorly understood at present, these locyte lysates depleted in RF with the hope that proteins have been implicated in the activation of these systems will allow the generation of large po- transcription from other adenovirus early pro- lysomes in vitro. These lysates could then be used moters as well as in the production of established as a convenient source of polysomes for mRNA cell lines. Very little is known about the biochemi- isolation. cal or immunochemical properties of these pro- teins. To help in the studies of the E1A proteins, we have begun the construction of a library of mono- clonal antibodies specific for these polypeptides. Monoclonal. Antibodies to SV40 Virions A bacterial expression plasmid (kindly supplied by E. Harlow, M. Wylen K. Spindler and A. Berk, University of California, Los Angeles) that will direct the synthesis of a fu- BALB/c mice were immunized with CsCl-purified sion protein between the bacterial tryptophan E virions of SV40, and hybridomas were prepared by gene product and a cDNA copy of the 13S mRNA standard procedures. Tissue-culture supernatants was used as a source to purify an E1A-related pro- were screened for the production of antibodies spe- tein. This polypeptide was purified by SDS-poly- cific for the external surface of viral particles. Fifty acrylamide electrophoresis, electroeluted, and used positive cultures were identified, and five of these to immunize BALB/c mice. Hybridomas were were selected for further characterization. These prepared, and tissue-culture supernatants were five hybridomas were single-cell-cloned, and both screened for the production of antibodies that would tissue-culture supernatant and ascitic fluid were bind to the fusion protein in a solid substrate ra- prepared. Analysis of these antibodies showed that dioimmunoassay. These antibodies were detected all five were capable of precipitating both the na- by their ability to bind to '"I-labeled protein A. tive virions and the precursors of viral 250S parti- Seventy-seven hybridomas secreting antibodies cles. Western blotting and immunoprecipitations specific for the fusion protein have been isolated using proteins prepared from denatured virions and single-cell-cloned. Several of these hybrid- have shown that two of the five monoclonal anti- omas secrete antibodies that will bind to the au- bodies are specific for the VP1 protein. The speci- thentic E I A proteins synthesized in 293 cells, an ficities of the remaining antibodies have not been adenovirus-transformed human cell line. We are determined, but these antibodies are also likely to currently using these antibodies to immunoaffinity- recognize VP1 but probably will bind to epitopes purify the E1A proteins from infected cells. that are destroyed by denaturation. We are cur- rently testing whether these antibodies can be used to purify SV40 virions on immunoaffinity col- umns. This would circumvent the tedious process Monoclonal Antibodies to the Rabbit of CsC1 centrifugation and may serve as a test sys- Translation Release Factor tem for developing similar technologies for other E. Harlow viruses. The final step of the synthesis of a polypeptide is the release of the nascent polypeptide from the ri- bosome. The mechanism of termination and release In Vitro Splicing of the nascent polypeptide is a poorly understood G.A. Freyer, K. Tohill phenomenon, especially in eukaryotic cells. This is primarily because of the lack of drugs that specifi- Our strategy for examining the mechanism of cally inhibit steps in the termination procedure. It mRNA splicing in vitro has been to construct a re- has been demonstrated that termination is con- combinant plasmid that could be used to produce trolled by a protein known as the release factor large amounts of a suitable precursor mRNA and (RF), and this process requires ATP. Using a par- then to use that RNA as a substrate in various cell tially purified preparation of RF obtained from T. extracts. The construction that was made posi- Caskey (Baylor College of Medicine), we have pro- tioned the X leftward promoter (XpL) next to the duced monoclonal antibodies specific for RE. These Ad2 major late transcript in such a way that tran- antibodies will be used for the study of the termi- scription initiated at the exact nucleotide used in

58 vivo. Characterization of the in-vitro-synthesized leader sequence, in cDNA libraries made by the transcript revealed that it does indeed initiate at the conventional procedure. correct position. A key feature of this method is From the sequence analysis of these cDNA that a completely unmodified transcript is pro- clones, the exact splice sites of all but one of the duced, and thus any requirements for posttran- previously characterized mRNAs was obtained. In scriptional modification can be studied. To this end, addition, five new mRNAs were found that had not a second clone, containing a poly(A) stretch adja- been detected by either electron microscopy or S1- cent to a unique restriction site, was made to allow nuclease analysis. A large number of cDNAs, con- a study of the effect of polyadenylation. In either taining the large common intron between coordi- case, the initial transcript can be modified in vitro nates 92.4% and 94.4 %, were obtained and se- by the addition of a 5' cap structure, allowing its quenced. All but one of these clones contained the significance to be examined. same donor and acceptor splice sites, with the ex- To date, we have been unsuccessful in demon- ception differing in the location of the acceptor strating splicing with the in vitro transcript, irre- splice site. From in vitro translation studies, it had spective of whether it is unmodified or modified, been predicted that a large open reading frame i.e., capped, polyadenylated, or both capped and present in this large intron was used to make a va- polyadenylated. The extracts used have included the riety of E4 proteins. Our data failed to reveal any one described by Hernandez and Keller (Cell 35: mRNAs from which this reading frame might be 89 [1983]), which has been shown to splice suc- accessed directly. We could, however, tentatively cessfully the Ad2 major late transcript prepared in assign predicted polypeptides to the various E4 vitro in He La cell extracts according to the proto- mRNAs, which should help in future studies on the col of Manley (Proc. Natl. Acad. Sci.77: 3855 function of this region. [1980]). These results suggest that our in vitro tran- script is lacking some crucial modification. We are attempting to identify this modification by exam- ining the fate of our transcript during incubation in Adenovirus-2 Genomic Sequence whole-cell extracts. In addition, we are construct- R.J. Roberts, K. O'Neill ing two new clones that will produce a much sim- pler transcript ( -200 bases) containing a large The Ad2 DNA sequence is finally complete as a deletion in the intron. result of work in this laboratory and in others, most Finally, experiments are under way to examine notably the groups of F. Galibert (Hopital Saint- the possibility that the introns are removed by a re- Louis, Paris), U. Pettersson (University of Upps- ciprocal mechanism in which the intron sequences ala, Sweden), and J.Sussenbach (University of themselves become joined to generate circular mol- Utrecht, Holland). A contiguous sequence of 35,937 ecules. nucleotides can be constructed, although because of sequence heterogeneity both within individual viral stocks and between stocks in different labo- ratories, the actual length varies ± 9 nucleotides. Early Region IV of Adenovirus 2 Within this sequence, the coding regions for 25 G.A. Freyer, Y. Katoh well-characterized Ad2 proteins and 2 small virus- associated (VA) RNAs can be identified. An addi- A project aimed at mapping the splice junctions of tional 30 open reading frames, which might encode the early region IV (E4) mRNAs of Ad2 is now polypeptides with molecular weights of 10,000 or complete. This has been accomplished by sequenc- greater, are present in the sequence, and it is likely ing cDNA clones corresponding to early mRNA that many of these encode polypeptides that are isolated from Ad2-infected HeLa cells. The cDNA synthesized during the viral life cycle. One of the libraries were constructed both by conventional most striking features of this sequence is its ex- cDNA cloning methods and by a novel method de- traordinarily high information content. There are veloped in this laboratory. The new procedure in- numerous examples of overlapping genes, both on volved synthesizing a 20-base-long oligomer, whose the same strand and on complementary strands. In sequence corresponded to a segment of the leader general, distances between adjacent coding regions sequence present on all E4 mRNAs. This oligomer are extremely short, and signals for mRNA initia- was ligated onto pBR322 to produce a single-strand tion, termination, and splicing are frequently found 3' extension, which was then used as a primer for to overlap the coding regions. Thus far, 47 splice second-strand synthesis of the cDNA. This strategy sites have been defined within the sequence, re- proved to be extremely useful in producing large flecting the extreme complexity of RNA processing numbers of E4-specific recombinants, essentially that takes place during the expression of the viral all of which contained the 5' leader sequence. This genome. Current work is focused on discovering new method was devised because of the low num- the fate of the intron sequences, which in many ber (<5 %) of cDNA clones found to contain the 5' cases contain open reading frames within them.

59 Autoantibodies and Ribonucleoprotein adenovirus VA RNAs, an indirect argument links Particles the Jo-1 antigen with viral RNA. We believe that M.B. Mathews, M.R. Sadaie, C. Herrmann the viral connection is more than coincidental and may point to an origin for at least some autoim- In autoimmune diseases, the organism's tolerance mune diseases in viral infection. to "self" breaks down and antibodies arise to nor- A third antigen recognized by autoantibodies is mal body components. Among the targets of this the proliferating cell nuclear antigen (PCNA). This inappropriate immune response are molecules of antigen is characteristically seen in dividing cells, intense biological interest, such as DNA, ribonu- especially tumor cells, but not in resting cells. It is cleoproteins (RNPs), and proteins. In collaboration also known to alter its localization within the nu- with R. Bernstein of the Royal Postgraduate Medi- cleus during the cell cycle, shuttling between the cal School, London, we have screened a large num- nucleolus and nucleoplasm. Although this antigen ber of patients' sera and measured the disease fre- does not appear to be associated directly with RNA, quency of more than 20 antibody systems. At the it can be solubilized from the nucleus by DNase same time, we have examined the molecular nature digestion, suggesting a possible association with of the corresponding cellular antigens and have chromatin. We have shown that the antigen is an characterized a number of these in considerable de- acidic protein with a molecular weight of 35,000. tail. In collaboration with J. Garrels and R. Franza of The La antigen, described in previous annual re- this laboratory, we have characterized the protein ports, is a 46,000-dalton phosphoprotein that binds as a spot on a two-dimensional gel of human pro- many RNA species transcribed by RNA polymer- teins and demonstrated its identity with the protein ase III, including the adenovirus VA RNAs. Anti- known as "cyclin." The regulation of cyclin has bodies to this cellular protein are found in rheu- been described in the literature, and its properties matic diseases, such as systemic lupus erythe- mirror those of PCNA as expected. We are cur- matosus and Sjogrens syndrome, and have proved rently attempting to exploit the PCNA autoantibod- to be invaluable aids to studying the protein. We ies to isolate the gene for this interesting and poten- have now shown that the protein recognizes the 3' tially important nuclear protein. tail of VA RNA, comprising a run of up to four uridylate residues. When there are three or four residues at the 3' end, the RNA molecule is effi- ciently bound by the antigen; molecules with two Translational Role of VA RNA residues are partially bound, but those with only P.A. Reichel, R. O'Malley, M.B. Mathews one terminal uridylate residue fail to bind. We have demonstrated directly that the binding site is the 3' In addition to some 40 mRNA species, adenovirus terminus by cross-linking the RNA to the protein encodes two small RNAs known as the VA RNAs. by UV-irradiation and then digesting it with ribo- These RNAs, about 160 nucleotides in length, dif- nuclease T1. The only portion of the RNA mole- fer from other viral transcripts in being synthesized cule that is not released from the protein is its 3' by RNA polymerase III and in their inability to code end. Thus, the La antigen recognizes and binds to for proteins. Previous work from this and other the 3' uridylate-rich terminus of these molecules. laboratories led to a description of the structure of Current data suggest that the antigen is not involved the VA RNAs, their binding to other cellular com- in RNA synthesis or the release of new transcripts ponents, and the organization of their genes on the from the template, and there is also evidence chromosome, but their significance remained an against involvement in the translational role of VA enigma until Thimmappaya and his co-workers RNA. We are therefore led by elimination to pos- (Cell 31: 543 [19821) constructed a mutant virus tulate that La antigen functions in the poorly under- lacking the major species, VA RNA,. This mutant stood transport or processing of these RNA species. fails to translate mRNA late in infection, suggest- More definitive assignations have been obtained ing that VA RNA might interact with elements of with autoantibodies found in polymyositis and der- the protein synthetic apparatus of the cell. To ex- matomyositis. Over one quarter of the patients suf- plore this possibility, we have prepared cell-free fering from these muscle-wasting diseases have systems from infected and uninfected HeLa cells. antibodies of the Jo -1 type. Again, the antigen is an These cell-free systems duplicate the properties of RNA-binding protein, but in this case, the RNA is the infected cells in that extracts of mutant-infected a transfer RNA. By assaying for inhibition of cells are unable to translate the viral mRNAs that amino-acid-charging activity, we have demon- they contain. The deficiency extends to mRNAs strated that the antigen is the enzyme histidyl-tRNA from other sources which, when added exoge- synthetase, responsible for coupling histidine to its nously, are also not translated by the cell-free sys- cognate tRNA. tem from mutant-infected cells. This finding and As in the case of the La antigen that can bind the results obtained with specific inhibitors of transla-

60 tion support the idea that the block is at the level of protection analyses using SP6 probes have shown initiation of polypeptide chains. that only 13S ElA RNA is detectable from the 13S We have tried to restore translational activity to virus or plasmids, and only 12S RNA is detectable the extract by supplementing it with purified VA from the 12S constructs. In collaboration with E. RNA, but to no avail. Nor is the block overcome Ruley (this section), it has been shown that trans- by the addition of a competent cell-free extract from fection with either the 12S or 13S plasmids can es- uninfected cells or cells infected with wild-type vi- tablish primary baby rat kidney cells in culture in a rus. We conclude that the block is not due simply manner similar to that for wild-type E1A plasmids. to the lack of VA RNA, but must result from a more Both the 12S and 13S plasmids can also, like E1A, complicated set of interactions involving VA RNA cooperate with plasmids carrying the ras genes to in an indirect way. Reciprocal mixing experiments transform baby rat kidney cells. We have also stud- indicated that the mutant-infected cell extract seems ied these plasmids using a transient expression as- to contain an inhibitor capable of interfering with say developed by Weeks and Jones (Mol. Cell. Biol. translation in either of the other systems. Likewise, 3: 1222 [19831) in which expression of the bacte- some inhibition is seen when the mutant-infected rial chloramphenicol acetyl transferase (cat) gene cell extract is added to an unrelated translation sys- is under the control of the adenovirus E3 promoter tem, prepared from rabbit reticulocyte lysate; but and dependent on cotransfection with the ElA gene. strikingly, the reticulocyte system makes use of the The 13S plasmids stimulate E3-cat expression when adenovirus mRNAs, showing that they are not ir- substituted for the E1A gene, but the 12S plasmids retrievably blocked. Fractionation of the reticulo- do not. These assays will be extended by construct- cyte system shows that the component chiefly re- ing plasmids in which the cat gene is placed under sponsible for rescue of the protein synthetic ability the control of various other adenovirus promoters. of the mutant system is not associated with ribo- In collaboration with T. Grodzicker (this sec- somes. We are currently engaged in purifying this tion), we have studied the roles of the 12S and 13S factor and in comparing its properties with those of products in the lytic and transforming functions of known initiation factors from reticulocytes. reconstructed adenovirus. Viruses containing the Once the nature of this factor is understood, we 13S cDNA region in place of E1A are competent should be able to work back to the reactions in for lytic functions in HeLa, whereas the 12S vi- which VA RNA takes direct part. As a complemen- ruses are defective. Immunofluorescence studies of tary approach, we have also begun to study the in- virus-infected HeLa cells indicate that the adeno- teraction of VA RNA with adenoviral mRNAs in virus DNA-binding protein, a product previously vivo. Plasmids containing a VA RNA gene and a shown to be dependent on E1A, is made during in- gene encoding a viral mRNA are introduced into fection of HeLa cells with the 13S virus but is not tissue-culture cells by transfection, and synthesis detectable during infection with the 12S virus. Reg- of the corresponding protein is examined. By sys- ulation of gene expression from various other re- tematically altering regions of the two genes, we gions of adenovirus during infection by wild-type hope to discover the sequences in each that are in- and the 13S or 12S viruses is currently under inves- volved in this novel kind of translational control. tigation. Although defective for lytic functions in human cells, the 12S virus transforms baby rat kid- ney cells in culture at very high efficiency. Infec- Functional Analysis of the Adenovirus tion of these cells with the 13S virus, as with wild- E1A Gene type E1A, results mainly in cell death. E. Moran, M.B. Mathews, R.J. Roberts, We have recently constructed a 9S cDNA using B. Zerler synthetic oligomers that span the splice junction. The 9S cDNA has been placed under the control of Adenovirus E1A is required for adenovirus-in- the mouse metallothionein promoter, and recombi- duced cell transformation and is involved in the nants with the ElA promoter in plasmids and in regulation of expression of other adenovirus genes. whole virus are under construction. The role of the At least three different mRNAs are produced from 9S product is being studied using the transforma- the E1A region, and our aim is to distinguish the tion and transient expression assays. In addition to roles of the separate products of this gene. We have the "9S only" virus described above, a "9S minus" therefore isolated cDNA clones corresponding to virus is being constructed using oligonucleotide-di- the two largest known mRNA species, the 13S and rected in vitro mutagenesis to alter the 9S splice 12S mRNAs. These cDNAs have been subcloned donor site in E1A. Current experiments are di- into plasmids so that they are expressed either from rected toward the identification and purification of the adenovirus E1A promoter or from the inducible the protein synthesized from the 9S mRNA. mouse metallothionein gene promoter. They have To investigate the functions of the ElA products also been rebuilt into the entire viral genome in in more detail, we are currently engaged in a mu- place of the wild-type E1A region. Ribonuclease tational analysis of their active sites. Using oligo-

61 nucleotide-directed and random mutagenesis in bac- of baby rat kidney cells by coprecipitation with cal- teriophage M13, we have obtained various point cium phosphate. Plasmid DNAs were introduced mutations in the E1A gene or in the specific cDNA both individually and in combinations to examine clones. These mutations will be subcloned into potential interactions leading to oncogenic trans- plasmids and viruses and assayed for their effect on formation. The principal results from these studies lytic, transforming, and gene-regulating functions. are summarized below: 1. The polyoma middle T antigen and the T24 Ha- ras-1 genes are individually unable to transform Two-step Transformation of primary baby rat kidney cells. This result is par- Primary Cells ticularly interesting given that these genes are H.E. Ruley, J. Moomaw, K. Maruyama able to transform oncogenically a variety of es- tablished cell lines. During the past year, we have investigated the ge- 2. The adenovirus E1A is able to provide functions netic requirements for the oncogenic transforma- that enable these genes to transform primary tion of cultured primary cells. Work in other labo- cells, indicating (a) that viral establishment and ratories has suggested that transformation of transformation functions of polyoma virus and primary cells by polyoma virus and by human ade- adenovirus can be interchanged and (b) that cel- noviruses requires the expression of at least two lular ras oncogenes require additional functions viral functions. The first, an establishment func- in order to transform primary cells. tion, is able to extend the life span of primary cells 3. A nonactivated c-Ha-ras-1 gene is unable to in vitro, whereas the second, a transformation transform even following cotransfer of E1A, in- function, is required for full expression of an on- dicating that oncogene activation is necessary cogenic phenotype. Thus, establishment functions but not sufficient for oncogenic transformation expressed by adenovirus E1A or portions of the po- of cultured primary cells. lyoma virus large T antigen lead to the ability of primary cells to grow indefinitely in culture. Ad- ditional functions expressed by adenovirus E 1B or the polyoma virus middle T antigen result in phen- Transforming Functions of Adenovirus otypic changes characteristic of oncogenic trans- E1A Mutants formation, such as anchorage-independent growth H.E. Ruley, K. Maruyama, J. Moomaw, T. and the ability to form tumors when cells are trans- Grodzicker [in collaboration with E. Moran, planted into syngeneic animals. In contrast, trans- B. Zerler, M. Mathews, and R. Roberts] formation of established cell lines can require fewer viral functions. Thus, expression of the polyoma During lytic infection, E1A transcripts are differ- virus middle T antigen alone is sufficient to trans- entially spliced, generating coding sequences for form a variety of established cell lines. Apparently, three related proteins. Two of these are synthesized such cells constitutively express establishment in adenovirus-transformed cells: Proteins contain- functions that can substitute for those of the virus. ing 289 and 243 amino acids are synthesized from The interaction between establishment and trans- 13S and 12S mRNAs, respectively. The metabolic formation functions is poorly understood, as is the functions of the E1A proteins remain largely ob- mechanism by which they combine to elicit the scure. The larger of these proteins expresses E1A transformed phenotype. functions that are required for the transcriptional Research in this area has addressed two ques- activation of the other adenovirus early-region tions. The first concerns the possibility of trans- genes, whereas no specific function has been at- forming cultured primary cells by mixing and tributed to the smaller protein. Activities attributed matching viral establishment and transformation to the E1A region include (1) an establishment functions. For example, would it be possible to function that leads to the ability of primary cells transform primary cells with a combination of the to grow indefinitely in culture; (2) activities that adenovirus E1A and polyoma virus middle T anti- produce cell-cycle effects, such as the induction of gen genes? The second question concerns the abil- mitosis in quiescent cells and the induction of ity of cellular oncogenes, isolated by virtue of their chromosomal aberrations; and (3) effects on or ability to transform NIH-3T3 cells, to transform stimulation of the transcription of a variety of cel- cultured primary cells. Given the requirement for lular genes. Whether any of these activities of E1A at least two functions in the case of viral transfor- are related to one another is presently unknown. mation, it seemed quite likely that cellular onco- To probe the function of E1A in transformation, genes would also require two or more functions to plasmids containing mutations in E1A were trans- transform primary cells. fected into primary baby rat kidney (BRK) cells To address these questions, cloned viral and cel- alone and together with the polyoma middle T an- lular genes were introduced into primary cultures tigen and T24 Ha-ras-1 genes. Sequences con-

62 taining two E1A mutations, from Ad5hrl and gene is myc, which is activated in a variety of tu- Ad5hr440 viruses, were cloned by D. Solnick (In- mors, and yet myc is unable to transform NIH-3T3 stitute of Cell and Tumor Biology, Heidelberg). hrl cells. Consequently, the v-myc gene of MC29 virus contains a deletion within the intron of the 12S was tested for establishment functions either by mRNA, resulting in the synthesis of a truncated leading to the ability of primary baby rat kidney form of the 289-amino-acid protein while having cells to grow indefinitely in culture or by providing no effect on the 243-amino-acid peptide. hrl is de- the transforming functions required by the T24 Ha- fective in E1A functions required to activate the ras-1 gene. The v-myc gene was found to express transcription of the other adenovirus early-region both activities, providing further evidence that genes. hr440 contains two base changes that abol- where primary cells are concerned, the require- ish processing of 12S mRNA; consequently, the ment for separate establishment and transformation 243-amino-acid protein is not made. This lesion functions reflects a basic mechanism of oncogenic also introduces a termination codon in the reading transformation. The fact that proteins made early frame of the 13S mRNA, resulting in the synthesis during the lytic infection by oncogenic DNA vi- of a truncated form of the 289-amino-acid protein. ruses express activities similar to those expressed Both hrl and hr440 plasmids express E1A estab- by oncogenes activated in certain human tumor cells lishment functions. Transfection of either plasmid supports the conviction that the study of the onco- alone into primary BRK cells gives rise to cells with genic DNA viruses will provide basic knowledge extended growth potential in vitro, from which es- concerning the mechanisms of oncogenic transfor- tablished cell lines can be isolated. hrl is able to mation. provide functions required by both the polyoma middle T antigen and T24 Ha-ras-1 genes to trans- form primary BRK cells; however, the T24 Ha -ras/ hrl cotransformants are not tumorigenic in synge- neic rats. hr440 is able to provide the functions re- Regulation of Viral Gene Expression: quired by the T24 Ha-ras gene for transformation Anti-death but is unable to assist the polyoma middle T antigen T. Grodzicker, H. E. Ruley gene in transformation. Despite this limitation, T24 Ha- ras /hr440 cotransformants are tumorigenic in We have also investigated the ability of mutant ad- syngeneic rats. enoviruses to transform primary BRK cells. Ad5hrl Plasmids separately expressing the 12S and 13S is defective in E1A functions required for the tran- mRNAs have been constructed. Both plasmids ex- scriptional activation of the other viral early-region press E1A establishment functions and both enable genes and, consequently, is much less cytotoxic the polyoma middle T antigen and T24 Ha-ras genes than wild-type virus on primary BRK cells. Ad5hrl to transform primary BRK cells. These results sug- also expresses E1A establishment functions as evi- gest the following: (1) The activity of E1A required denced by the high frequency with which Ad5hrl for transformation of primary cells by viral and induces colonies of cells with extended growth po- cellular transforming genes is linked to establish- tential in vitro. Ad5hr440 also contains a mutant ment functions and is not linked to E1A functions E1A region; however, the viral early regions are required for transcriptional activation of the other expressed to a much greater extent than in Ad5hrl. adenovirus early-region genes. (2) The establish- As a result, Ad5hr440 is cytotoxic to an extent that ment functions of E1A are located in the aminoter- obscures detecting the establishment functions of minal portion of the E1A proteins common to both he virus. We investigated the ability of Ad5hr 1 and the 12S and 13S products. (3) Although it is possi- Ad5hrA to complement for transformation of pri- ble to mix and match establishment and transfor- mary BRK cells, reasoning that the establishment mation functions to a broad extent, certain combi- activity of Ad5hrl might complement the activation nations do not work. The reasons for this are not of E 1B by Ad5hr440. We were surprised to find understood. that the establishment activity of Ad5hrl was dom- inant over the cytotoxicity of Ad5hr440 (we have called this activity of Ad5hr 1 anti-death). d1312 (a mutant lacking E1A) failed to suppress Ad5hr440, indicating that the interference by Ad5hrl was not Establishment Functions of the due to viral interference. In coinfection experi- v-myc Oncogene of MC29 Virus ments in HeLa cells, Ad5hrl was able to suppress H. E. Ruley, J. Moomaw, K. Maruyama the induction of the 72K DNA-binding protein by both hr440 and wild-type viruses, as judged from Since E1A is a viral gene, the question arises as to immunofluorescence. These results suggest that an whether there are cellular genes that express activ- activity associated with Ad5hrl is able to repress ities similar to those of E1A that are important in the expression of adenovirus early-region genes. malignant transformation. A candidate for such a Mutant adenoviruses expressing only the 12S E1A

63 ye in a manner similar to that of Ad5hrl, truncated protein product of the 13S El A RNA suggesting that the anti-death activity results from synthesized by Ad5hrl. The nature of the interfer- expression of the 12S E1A RNA and not from the ence by the 12S E1A product is being investigated.

VIRAL VECTORS

Work on the development and use of eukaryotic adenoviruses that express T antigen. Furthermore, viral vectors has continued this year. The major if the SV40 A gene has been previously linkedto systems used are adenovirus and retrovirus vectors. another foreign gene, the hybrid virus containing A variety of genes have been inserted into these the foreign gene can be selected by thesame mech- vectors, and the resulting viruses have been used anism. (2) Use of in vivo as well as in vitrorecom- for several purposes, including overproduction of bination for construction of hybrid viruses. There proteins in mammalian cells; investigation of the are no convenient unique restriction sites that can biological role of inserted gene products and their be used to insert an exogenous gene in the third controlling elements; study of the controlling ele- segment of the tripartite leader downstream from ments, signals for RNA processing, and translation the adenovirus major late promoter. The starting of the viral vectors themselves; and integration of material is a plasmid containing adenovirus DNA vectors into mammalian cells to establish cell lines linked to the foreign gene that is lacking itsown producing gene products of interest. promoter. The joint between the adenovirus DNA and the foreign gene is at a position on the adeno- virus genome (the third leader) where we want the Expression of Foreign Eukaryotic Genes foreign gene to be located in the hybrid virus to be constructed. Downstream from the gene (if it isa from Adenovirus Promoters and gene other than the SV40 A gene) are sequences Controlling Elements that code for SV40 T antigen (including the SV40 M. Yamada, M. Merle, T. Grodzicker early promoter). The entire insert is ligated to Barn- digested adenovirus DNA. The resulting molecule, We reported last year studies of the SV40 A gene which has normal adenovirus ends, contains a du- inserted into adenovirus as a model system for plication of adenovirus DNA (in the left arm of the studying adenovirus late gene transcriptional and vector and the insertion). Such molecules, once in- translational regulation. We also wanted to con- troduced by transfection into 293 cells along with struct viruses that would produce large quantities wild-type helper DNA, may recombine, leading to of SV40 T antigen that could be easily purified and excision of the intervening DNA and placement of used in biochemical studies (Thummel et al., Cell the foreign gene at the desired and predetermined 23: 825 [1981]; Thummel et al., J. Mol. Appl. Ge- location. net. 1: 435 [1982]; Thummel et al., Cell 33: 455 [1983]). These studies showed that the SV40 A gene Integration and expression of the herpes simplex lacking its own promoter is transcribed very effi- virus type I thymidine kinase gene and the human ciently when the gene is positioned in adenovirus a-chorionic gonadotropin gene in adenovirus vec- so that it is controlled by the strong adenovirus ma- tors.The thymidine kinase (tk) gene of herpes jor late promoter. Furthermore, the T-antigenpro- simplex virus type I (HSV) and the human a-cho- tein is expressed at a high level when the A gene is rionic gonadotropin (a-HCG) gene were chosen as located in the third segment of the late tripartite representative exogenous genes. The tk gene con- leader; in this case, the T-antigen mRNA thatwas tains no introns, whereas the coding sequences for efficiently translated in vivo carried almost the en- a-HCG contain the two introns (Fiddes and Good- tire tripartite leader and the wild-type SV40 initia- man, J. Mol. Appl Genet. 1: 3 [1981]). The coding tion codon. sequences of these genes were separated from their The following features are essential for con- promoters, ligated at their 5' ends with a segment structing a hybrid virus in our vector system: (1) derived from adenovirus for proper insertion into Expression of the SV40 T-antigen helper function the virus, and also ligated at their 3' ends with the for growth of adenovirus in monkey cells. Adeno- SV40 A gene for production of helper function. virus grows well in human cells but very poorly in These manipulations were carried out in plasmids monkey cells. This block can be overcome if SV40 in Escherichia coli. The fragment carryinga piece T antigen is expressed in adenovirus-infected mon- of the adenovirus-exogenous gene-SV40 Agene key cells. Thus, we can select and amplify hybrid was ligated with adenovirus DNA, mixed with

64 helper DNA, and transfected into 293 cells. The size a-HCG endogenously; the molecular weights of hybrid viruses were grown in monkey cells to se- the polypeptides are 20,000 and 16,000 in the cy- lect viruses that express T antigen. After trying toplasm, and a 22,000-molecular-weight form is many arrangements of the gene order and junction secreted into culture medium. The amount of these point, we have so far obtained four hybrid viruses products increased severalfold in late stages of in- containing either the tk gene (one) or the a-HCG fection with the hybrid virus, but the ratio among gene (three) that produced Tk or a-HCG, respec- the three species was constant. This fact indicated tively. In all cases, the exogenous gene was posi- that the virus-coded a-HCG was expressed and gave tioned in the third leader sequence, and the SV40 the same products as the endogenous ones. The dif- T-antigen gene had its own promoter. There were ferent molecular-weight species probably represent no other ATG codons in the 5' end of the presumed differently glycosylated forms of a-HCG. These mRNA before the authentic starting codon. The experiments indicated that there was a cell-line length of the exogenous DNA was 2.4 kb for the tk specificity for secretion of a-HCG. gene, 4.5 kb for full-length genomic a-HCG, 3.3 kb These results indicate that our adenovirus vector for the a-HCG gene with a deletion of its poly(A) system works well to express the exogenous genes site, and 1.5 kb for the a-HCG gene with both a and produce their protein products. Furthermore, deletion of the poly(A) site and a deletion of part we found several interesting phenomena in the of an intron. Each of the DNAs, along with a 3.1- course of these experiments. For example, the level kb insert of SV40 T-antigen DNA, replaced 11.9 kb of expression of the endogenous tk and a-HCG was of adenovirus DNA from 26.5 to 59.5 map units, as affected by adenovirus infection. Also, as men- expected. There may be little preference in the tioned above, there is cell-line specificity for gly- length of exogenous DNA to be inserted. On the cosylation and secretion of a-HCG. We are contin- other hand, the presence of a poly(A)-addition sig- uing to analyze these phenomena in various ways. nal in the a-HCG gene affected the propagation of hybrid virus. The proportion of the hybrid virus Expression of polyoma T antigens in adenovirus. with a poly(A) site was estimated as 1 -5% of the In collaboration with R. Tjian and S. Mansour population, as judged from plaque formation on (University of California, Berkeley), we are study- CV-1 monkey cells and HeLa cells. In contrast, the ing the expression and production of polyoma T an- hybrid virus that did not contain a poly(A) site in tigens expressed from the adenovirus major late the a-HCG gene comprised 10 -30% of the viral promoter. These studies are being conducted in or- population. der to produce large quantities of protein in in- The following results concerning foreign gene fected cells so that the T antigens can be analyzed expression have been obtained. (1) Hybrid viruses and purified. containing the tk gene (Ad-SVR-TK): Ad-SVR-TK Using the methods described above, a segment of produced, in the late stage of infection, a 1.55-kb the polyoma early region that codes for large, mid- mRNA that hybridized with a tk probe. This size dle, and small T antigens has been removed from corresponds to an mRNA containing the first, sec- its promoter and joined to a segment of adenovirus ond, and part of the third tripartite leader se- DNA so that they are joined at a position in the quences and the coding sequence of tk. It suggests middle of the third segment of the tripartite leader. that the tk gene was controlled by the major late The SV40 A gene containing its promoter is located promoter of adenovirus, and its mRNA was pro- at the 3' end of the polyoma DNA, and the entire cessed in the same way as normal adenovirus late insert is cloned in a pBR-derived plasmid and mRNAs. The virus produced 2-5 times more tk ac- grown in E. coli. The insert is excised and inserted tivity in CV-1 monkey cells at late times after infec- into adenovirus as described above. Hybrid viruses tion than is found in cells infected by HSV. A poly- are grown in CV-1 cells. peptide with an apparent molecular weight of Hybrid viruses have been isolated that contain 47,000, which is indistinguishable from that pro- polyoma DNA in the desired position. CV-1 cells duced by HSV, could be precipitated with anti-tic infected with the virus synthesize polyoma large T antiserum from infected cells. (2) Hybrid viruses antigen, as determined by indirect immunoflu- containing the a-HCG gene (Ad-SVR-HCG): Three orescence using anti-polyoma T antisera. Immu- hybrid viruses isolated showed the same properties noprecipitation of infected cell extracts with these with respect to the expression of the protein. At antisera shows that the hybrid virus synthesizes late stages of infection of CV-1 cells, polypeptides middle and small T antigens as well as large T an- with apparent molecular weights of 21,000, 16,000, tigen. The proportion of these antigens relative to 15,000, and 12,000 could be detected in the cyto- one another is different from that found in po- plasm by immunoprecipitation experiments using lyoma-infected mouse cells. Regardless of whether anti-a-HCG antiserum. Only extremely low levels HeLa or CV-1 cells are infected with the hybrid vi- of polypeptide could be detected in the culture su- rus, there is a large amount of middle and small T pernatant by immunoprecipitation. Uninfected CV-1 antigens and small amounts of large T antigen pro- cells did not produce a-HCG. HeLa cells synthe- duced. We wish to investigate whether this is due

65 to prererentiar splicing of polyoma-containing cant increase in stability. There is no requirement RNAs in adenovirus-infected cells. We previously for the vector to carry a selectable marker. As long found that in our adenovirus vectors containing the as the helper-independent construction is itself sta- SV40 A gene, much more large-T-antigen mRNA ble, any sequence inserted into the vector will be was produced than small-T-antigen mRNA and that passively carried to all infected cells as a part of the proportion of these mRNAs relative to one an- the viral genome. There are also disadvantages. The other differed from that found in SV40-infected size of insert that can be introduced into the vector cells. is further reduced. Our vectors can accept cDNAs We have also constructed viruses made with po- about 2 kb in length. At least initially, helper-in- lyoma DNAs that code for only large T antigens dependent vectors are confined to the avian system. (from R. Kamen, Genetics Institute). These viruses The avian system, however, has two advantages: produce large, but not middle or small, T antigen, Culturing a variety of different types of primary as determined by immunoprecipitation of infected cells is trivial, and birds, both chickens and related cell extracts. They clearly produce more large T species, are available that completely lack endoge- antigen than is found in polyoma-infected mouse nous viruses homologous to the avian sarcoma-leu- cells. kosis viruses.

Vector construction.With the above considera- tions in mind, we began to construct a family of Retroviral Vectors helper-independent retroviruses a few years ago. S. Hughes, E. Kosik, J. Sorge All of the constructions are derived from the Schmidt-Ruppin A (SRA) strain of Rous sarcoma When compared with other vector systems that can virus (RSV), and all the helper-independent con- be used either in vivo or in cultured cells from the structions are based on the replacement of the cel- higher eukaryotes, retroviruses offer several ad- lular oncogene, src, carried by RSV, with other vantages. Since retroviruses are the only naturally genes or sequences. In experiments initiated by J. occurring vectors in higher eukaryotes, it is reason- Sorge (who was a postdoctoral fellow in our labo- able to expect that they can be readily adapted as ratory and is now at Scripps), a cloned copy of the vectors capable of accepting a wide variety of in- unintegrated circular DNA from the SRA strain of serts. Retroviral genomes are small, making it rel- RSV was manipulated in vitro to remove src. CIaI atively easy to manipulate a cloned DNA copy of linkers were inserted at the end points of the dele- the genome. The viruses are efficient; in culture, tions. Such vectors can both carry and express DNA essentially all of the cells can be infected. Retrovi- sequences inserted in place of src; however, there ruses are nonlytic; infection has little or no effect is a problem with these constructions. In all known on cultured cells. Certain strains of virus have little RSV strains, the src gene is flanked by direct re- or no effect on the intact animal. Since the viral peats about 110 by in length. Homologous recom- genome integrates into the host genome, the prog- bination (presumably during reverse transcription) eny of a single infected cell are all infected, and the results in the frequent loss of src in wild-type RSV. provirus is in the same place in the genome of each It is hardly surprising that the vector constructions of the progeny cells. Infection is self-limiting; each lose their inserts by the same route. We chose to try infected cell usually acquires 1-5 copies of the viral to eliminate one of two 110-bp direct repeats. This genome. Intervening sequences can be removed ultimately led to a series of experiments that tested from genomic inserts cloned into a retroviral vec- the function in RSV of the regions lying between tor upon passage of the recombinant virus in cul- env and src and between src and the long terminal tured cells. Retroviral vectors have considerable repeat (LTR) (Sorge and Hughes, J. Virol. 43: 482 potential for in vivo use, both for short-term infec- [1982]; Hughes and Kosik, Virology [1984, in tions and for insertion into the germ line. press]; J. Sorge and S. Hughes, unpubl.). The con- Unfortunately, there are also some disadvan- clusions of this work are summarized below. tages. Retroviruses, and the vectors derived from One copy of the direct repeat sequences must be them, are relatively unstable. When a helper virus retained for the virus to replicate; however, it is is present, there is extensive recombination, and possible to eliminate the region of homology flank- even in the absence of a helper, internal rearrange- ing src, either by eliminating the upstream copy of ments are frequently seen. The total size of the vec- the direct repeat or by removing a small portion of tor,including both the viral and nonviral se- the upstream copy and most of the downstream quences, is limited to about 10-11 kb. copy. To express src, or another gene inserted in For several reasons, we have chosen, at least in- place of src, there must be an appropriate splice itially, to work with helper-independent retroviral acceptor. A partially synthetic splice acceptor can vectors. Helper-independent vectors offer certain be substituted for the naturally occurring splice ac- advantages. There is no requirement for a helper ceptor. Most of the segment of unknown origin (cell or virus), and, in general, this gives a signifi- (which we call E.T.) that lies just upstream of src

66 in the SRA strain of RSV can be deleted without the virus via Clal sites. (These experiments are interfering with viral replication or with src being done in J. Brugge's laboratory.) In theory, the expression. vectors can be used to study mutants of any gene whose coding region is less than 2 kb. RNA splicing.The available constructions can be used for several purposes. Splicing has been stud- New vectors.In addition to the vector construc- ied with genomic inserts derived from both a ho- tions already tested, we are currently working on a mologous host (chick aD globin; Fischer et al., construction that will supply an initiation ATG to Proc. Natl. Acad. Sci. [1984, in press]) and a non- inserts that lack an ATG appropriate for translation homologous host (human a-HCG; Sorge and initiation.Several different experiments would Hughes, J. Mol. Appl. Genet. 1: 547 [1982]). In- benefit from such a construction. For example, with trons are removed from the genomic inserts rela- such a vector, most or all of the retroviral portion tively slowly. The two introns present in the chick of viral oncogene fusions could be removed; in ad- aD globin are processed at different rates; viruses dition, we have large Escherichia coli expression can be found that have one of the two introns re- libraries that contain cDNAs inserted into the lac moved (Fisher et al., Proc. Natl. Acad. Sci. [1984, expression plasmids pUC8 and pUC9 (see Stuc- in press]). It may be possible to use these construc- tural Studies in the Mammalian Cells Section). The tions to examine splicing intermediates. majority of the plasmids we have isolated and char- Since the virus replicates normally whether or not acterized as expressing a portion of a particular the src gene is expressed, the src splice acceptor protein in E. coli contain cDNA inserts that lack can be modified and the effects on src expression the 5' end of the coding region. In some cases, there analyzed. We have successfully substituted a new are reasons to express these incomplete genes in splice acceptor for the splice acceptor originally chick cells as well as in E. coli. For these experi- present in RSV. Three closely related construc- ments, the initiating ATG must be supplied by the tions, which vary in the region ten bases upstream retroviral vector. of the new splice acceptor, fail to express src. Such We could make constructions that would initiate constructions not only are potentially useful vector either at the gag ATG or at the src ATG. There are constructions, but also provide information about several reasons to think that the src ATG construc- splicing. tions will be better, and they will be tried first. The advantages and uses of such constructions are dis- AUG choice in initiation.The vectors can also be cussed below. used to study how ATG codons are selected during There is a simple route by which the reading initiation. The four RSV messages gag, gag-pol, frame of the retroviral vector constructions can be env, and src are all derived from a full-length tran- made to match the reading frame of pUC8 and script. All four messages contain the same 5'-leader pUC9. In such a system, a cDNA that is in frame segment. Three of the messages, gag, gag-pol, and in the E. coli vector will, perforce, be in frame upon env, use the same ATG to initiate translation. The insertion into the retroviral vector. Since the src src ATG initiation codon lies 3' to the gag ATG in ATG is a part of an NcoI site (CCATGG), the vector the spliced src mRNA. For the src ATG to be used can be designed to add only 2-3 amino acids onto efficiently in initiation there must be, in the com- the amino terminus of the protein. pleted message, a termination codon in frame with Although there are obvious limitations, such a the gag ATG. A virus (1057 CGA) has been derived system can be used to assay functional domains in by oligonucleotide-directed mutagenesis that has proteins made from the same DNA fragment both this particular termination codon (TGA) altered to in E. coli and in chick cells. Mutants can be made CGA. The 1057 CGA virus initiates src translation with the insert in the pUC plasmid and a prelimi- at the gag ATG. Cells infected by the mutant show nary screen done with the protein that is synthe- a spindle-shape morphology distinct from the sized in E. coli. Potentially interesting mutants can rounded morphology of cells infected with the wild- be transferred directly into the retroviral vector for type SRA strain RSV (S.H. Hughes et al., unpubl.). a more complete analysis in chick cells. The 1057 CGA mutant specifies a src protein of 63,000 daltons, which is currently being studied in In vivo retroviral vectors.Although the vectors J. Brugge's laboratory (SUNY, Stony Brook). that have already been described lack an oncogene, these vectors are still oncogenic and can activate Expression of foreign genes.The vectors nonse- the endogenous oncogenes c-myc and c-erbB. Al- lectively express genes whose coding region is less though such constructions are suitable for a variety than 2 kb (v-src and Tn5 neo have been tested; pre- of experiments in cultured cells and possibly even sumably, any other would also work). The vector for some experiments in vivo, they may not be well derivatives are much more convenient for site-di- suited for long-term in vivo experiments or for in- rected mutagenesis of src than is wild-type RSV, sertion into the germ line. The related endogenous since in the vectors, src can be moved in and out of virus RAV-0 is not oncogenic. We have replaced the

67 avian leukosis virus (ALV) LTR of the vectors with linked to a segment whose expression can be read- the RAV-0 LTR and, in collaboration with L. Crit- ily monitored at the protein or the nucleic acid tenden (USDA Poultry Laboratory, Michigan), have level. The retroviral vectors can be introduced into shown that these recombinant viruses have little or a variety of cell types in culture and the cells no tumorigenic potential in vivo. Because only the checked for tissue-specific expression of the test LTR is replaced, essentially all of the ALV vector segment that was attached to the cell-type-specific derivatives can be readily converted to nononco- promoter. It may be useful to insert the promoter genicity. and the test sequence in the orientation opposite to In addition to providing prototype in vivo vec- the direction of transcription of the retrovirus, to tors, these constructions locate the sequences re- avoid confusion from transcripts arising from the sponsible for the difference in the oncogenicity of retrovirus. the two viruses. Work from other laboratories (P.A. Luciw, H.E. Varmus, J.M. Bishop, and M.R. Ca- pecchi, unpubl.) suggests that the RAV-0 LTR lacks an enhancer. We have subcloned the murine leuke- Helper-free Adenovirus-5 Vectors mia virus (MLV) enhancer to test its effect on rep- K. Van Doren, D. Hanahan, Y. Gluzman lication, expression, and oncogenicity of the ALV/ RAV-0 recombinants. If the RAV-0/ALV recombi- Last year we reported the construction of helper- nants lack a functional enhancer, they may also be independent adenovirus-5 (Ad5) vectors and the useful for cell-type-specific promoter assays (see cloning of several different genes in recombinant below). helper-independent viruses. These genes included Since the ALV/RAV-0 recombinants appear to (1) an SV40 T-antigen-coding region under control have a weaker "promoter" (lack of an enhancer?) of the Ad2 major late promoter, (2) a wild-type or than the ALV vectors, the ALV/RAV-0 recombi- replication-defective SV40 early region with its nants should express inserts at lower levels. This is own promoter, or (3) a neomycin resistance gene being tested with v-src and Tn5 neo inserts. In many from Tn5 under control of the SV40 promoter. cases, viruses that express a particular gene prod- Since then we have constructed recombinant vi- uct at various levels would aid in the analysis of the ruses carrying (4) an SV40 T-antigen-coding re- gene product. For example, such a system could be gion under control of the Ad2 major late promoter, used to ask questions about threshold levels of on- including most of the tripartite leader that normally cogene products required for transformation. precedes all late adenovirus messages, (5) cDNA of Crittenden's laboratory is trying to define condi- SV40 large T antigen under control of the Ad2 ma- tions for efficient germ-line infection in chickens. jor late promoter, and (6) cDNA of SV40 large T We have agreed to supply nononcogenic recombi- antigen under contol of the SV40 early transcrip- nants for these experiments. If techniques can be tion unit. developed that permit the ready introduction of re- The biological properties of these genes were troviruses into the germ line of chickens, the non- evaluated in a variety of assays. During lytic infec- oncogenic vectors will be most useful; however, the tion of 293 cells with recombinant viruses carrying retroviral vectors can be used to introduce genes the cDNA encoding SV40 large T antigen under into the intact animal without germ-line integra- control of either the Ad2 major late or SV40 early tion. promoter, mRNAs were made and translated into protein. Both mRNA and protein levels were three- Foreign promoters.In addition to analyzing the to fivefold lower than those of their wild-type proteins, it is possible that retroviral vectors can be counterparts. Nevertheless, this result indicates that used as vehicles for testing whether particular DNA this vector can be used to express certain cDNA segments are capable of initiating tissue-specific constructs. RNA expression. There are numerous ways in Infection of 293 cells with the recombinant virus which such experiments can fail; however, some carrying SV40 T-antigen-coding sequences under modest test is warranted. We may be able to avoid control of the Ad2 major late promoter, including one potential problem simply by using construc- most of the tripartite leader, results in production tions that have the ALV LTR (which contains an of large quantities of SV40 T antigen. Comparison enhancer) replaced by the RAV-0 LTR (which ap- with a similar construct of T antigen under control pears to lack an enhancer). Initially, we plan to of the Ad2 major late promoter, but containing only compare two promoters, the chicken 0-actin pro- half of the first leader (of the late tripartite leader), moter, which we have isolated and characterized reveals that the first construct is more efficient than (Kost et al., Nucleic Acids Res. 11: 8287 [1983]), the latter one. These data are in agreement with the and the chicken a-actin promoter, isolated and pro- work of others (Thummel et al., Cell 33: 455 [1983]) vided on a collaborative basis by C. Ordahl (Uni- and indicate that the presence of the tripartite leader versity of California, San Francisco). Such pro- in front of mRNA in adenovirus-infected cells im- moters will be inserted into the retroviral vectors proves the translatability of the messages.

68 Helper-independent adenovirus vectors carrying full-length copies of viral DNA as described for either a selectable marker for neomycin resistance HS74BM transformants. The integration patterns in (under control of the SV40 early promoter) or the these cell lines differed from those of the human early region of SV40 (origin positive or negative) fibroblast lines in that some sequences had become integrate viral DNA into host-cell chromosomes in amplified in MEF cell lines and two of the eight the absence of adenovirus early region 1. This in- lines analyzed may contain the left and right ends dicates that viral functions encoded in early region of the viral genome linked together, as observed 1 are not essential for the integration of viral DNA. with the neomycin-resistant Rat 2 cell lines. Fur- We have analyzed DNAs from CV-1 and Rat 2 ther analysis of these cell lines is in progress. cells transformed to neomycin resistance and from We have recently begun to analyze cell lines es- MEF (mouse embryo fibroblasts), HS74BM (hu- tablished from transformations of REF52 cells by man fibroblasts), and REF52 (ratfibroblasts) the SV40 recombinant viruses. Preliminary results transformed by SV40 recombinant adenoviruses. indicate that the integration patterns are different Neomycin-resistant CV-1 cell lines contained usu- in cell lines transformed by origin-positive SV40 ally 1 but sometimes 2 copies of the viral genome recombinant viruses and those transformed by ori- integrated colinearly with the infecting viral DNA. gin-defective viruses. Transformed cell lines of or- These cells contained between 60 % and 100 % of igin-defective viruses, in general, contain fewer the infecting viral DNA integrated into host-cell copies of integrated DNA than cells transformed chromosomes. Rat 2 cell lines transformed to neo- with viruses carrying a functional SV40 origin of mycin resistance also incorporated full-length viral replication. These data are the first we have ob- genomes, colinear with the infecting viral DNA. tained to suggest that the SV40 origin of replication One to several copies of the recombinant viral may affect transformation in some nonpermissive DNA molecules were integrated. Three of the five cell types. In addition, we have isolated cell lines lines analyzed contained the left and right ends of of baby rat kidney (BRK) cells transformed with the viral DNA linked together and viral genomes SV40 recombinant viruses alone or in conjunction arranged in a tandem array. Tandem arrays were with neomycin recombinant viruses. It will be in- not observed in transformed CV-1 cell lines, sug- teresting to analyze the integration patterns in the gesting the involvement of a cellular factor in either cells to see what effect, if any, the origin of repli- promoting or preventing interaction between viral cation has had in these cells. It will also be of inter- DNA molecules. HS74BM cell lines established est to determine whether both the neomycin recom- from transformation using origin-defective SV40 binant viruses and the SV40 recombinant viruses recombinant viruses contained 1-2 copies of viral are treated the same in cells transformed by both DNA integrated in the host genome. The integrated viruses. We also wish to examine whether the pres- copies in these cell lines appear to be full length ence of early region 1 will change the integration and colinear with the infecting viral DNA, as was pattern during nonlytic infections with these re- observed with the neomycin-transformed cells. combinant viruses. SV40-transformed MEF cell lines contained 1-2

69

MAMMALIAN GENETICS

Mouse t Haplotypes: A Model System their hosts. The very existence of t haplotypes in for Understanding the Organization, the mouse, and highly analogous genetic systems in Expression, and Evolution of the other species (e.g., SD in Drosophila, spore killer in Neurospora, and pollen killer in tobacco), poses Mammalian Genome important questions concerning genomic evolution L.M. Silver, V. Bautch, L. Cisek, H. Fox, and the dynamics of chromosome polymorphism. C. Jackson, M. Krangel, D. Lukralle, Knowledge of the structure and origin of t haplo- P. Mains, N. Sarvetnick types would certainly contribute to our understand- ing of these broader biological questions. Further- Mouse t haplotypes are naturally occurring, highly more, an understanding of the "natural" mech- variant forms of a region of mouse chromosome 17 anisms by which t haplotypes have thwarted the that has multiple and interacting loci with profound machinery of sperm differentiation to their advan- effects on embryogenesis and sperm differentia- tage would yield insight into the differentiation ma- tion. The t haplotypes maintain themselves as dis- chinery itself. Finally, we hope that studies of em- crete genomic entities through recombination bryonic lethal genes will lead to a better under- suppression, and these chromosomal units are standing of normal embryogenesis. propagated through wild populations by a male- Many of the molecular tools necessary for a con- specific transmission ratio distortion in their favor. certed analysis of an isolated region of the mam- Our understanding of t haplotypes has undergone malian genome are only now becoming available. radical changes over the last 5 years, and it is now Although we have chosen to concentrate our efforts possible to focus research efforts in attempts to an- on the t complex for the reasons just given, as an swer specific questions through the combined use added benefit, we expect many of our molecular of molecular and genetic techniques. results to be indicative of general principles of t haplotypes represent a common polymorphism mammalian genome structure and function. (often present at a level of 20%) in house mouse populations from all over the world and have been found in three separate commensal species, Mus domesticus, Mus musculus, and Mus molossinus, Isolation and Mapping of Random DNA that evolved apart between 1 and 2 million years Clones of the t Complex ago. A complete t haplotype is operationally de- H. Fox, P. Mains fined as one that suppresses recombination in +It heterozygotes, along the entire 12-cM region of The pleiotropic effects of the t haplotypes indicate chromosome 17 encompassing T and the H-2 com- that they have diverged from the corresponding plex. In general, t haplotypes recovered from wild wild-type region of chromosome 17. As a result, it mouse populations are complete. However, sup- is possible that the entire region, and not just the pression of recombination is not absolute -rare re- relatively few genes in it so far identified, has di- combinants have been isolated in the laboratory and verged significantly from the wild type in arrange- are referred to as partial t haplotypes. These partial ment and DNA sequence. Indeed, M. Lyon (Medi- t haplotypes are portions of a complete t haplotype cal Research Council, England) suggested that a that continue to suppress recombination along their change in interstitial heterochromatin blocks re- length and express only a subset of the t-specific combination, and it has been proposed that t hap- properties. lotypes were introduced into the house mouse as an Wild t haplotypes now appear to be genetically introgression from another species. and evolutionarily isolated from normal mouse To investigate these possibilities, as well as to chromosomes, even as they coexist within the same gain a molecular entrance into the t region, we are genome. These isolated genetic units are propagat- collaborating with H. Lehrach's group (including ing themselves through mouse populations as self- D. Rohme, B. Herrmann, A.-M. Frischauf, and ish chromosomes without any obvious benefit to J.-E. Edstroem) at the European Molecular Biology

71 Laboratory in Heidelberg. They have obtained ran- plex, we compared genomic DNA restriction pat- dom DNA clones of the region by microdissecting terns from mice carrying a series of complete or the proximal half of chromosome 17 from meta- partial t haplotypes on the 129 background. We also phase chromosome spreads (chromosome 17 was analyzed 11 inbred strains of mice and other wild- marked by a Robertsonian translocation). This derived ( + ) forms of chromosome 17. Restriction- DNA was cloned into bacteriophage X in nanoliter fragment-length polymorphisms were observed volumes and then subcloned into plasmids. These when genomic DNA was digested with TaqI. All are referred to as "microclones." To show that these wild-type forms of chromosome 17 carry one of two microclones were indeed from chromosome 17, we alleles- either a single 3.4-kb fragment or a pair of have performed Southern blots using DNA from a fragments of 3.8 kb and 1.4 kb. In contrast, all com- hamster-mouse hybrid cell line containing only plete t haplotypes carry an identical third allele of chromosome 17 of the mouse. Of 18 clones tested, Hba-ps4 represented by a single 5.2-kb TaqI re- 17 mapped to chromosome 17. Nine of these clones striction fragment. Analysis of partial t haplotypes were further mapped to the t region using 129.t allowed the localization of Hba-ps4 to the distal congenic mice. If a clone shows a restriction-frag- portion of the t complex. ment-length polymorphism (RFLP) between 129 Among the t haplotypes examined was t"°. This and 129.t mice, the clone must map to the only re- t haplotype arose from t6 and was first identified by gion that differs between the two lines -the proxi- the appearance of a tufted phenotype in a tf/th2° mal portion of chromosome 17. Similar analysis re- mouse. For a number of reasons, Lyon suggested vealed no RFLPs between any of the different t that th2° carries a deletion within the t chromatin, haplotypes examined with 22 microclones, using an encompassing tufted as well as several other genes. average of three different restriction enzymes each. We have found that the th" chromosome carries no However, there were no sequences present in wild a-globin pseudogene sequences; however, this type that were absent in t, and the level of poly- chromosome is not missing any other distally lo- morphism between t and inbred strains is roughly cated t-specific markers. Hence, it would appear comparable to that between different inbred lines. that th20 has deleted a small region of t chromatin Thus, the t haplotypes appear to have a common located near the distal edge of the t complex and origin and have not radically diverged from other including the coat marker tf, the DNA marker Hba- mice at the nucleotide sequence level. ps4, and an embryonic lethal gene called Kinky. The microclones have been used to confirm that These three loci map close to one another in the the t complex is an extended region of the chro- central t complex region of wild-type chromosome mosome rather than a single point. Rare recombi- 17 (P. D'Eustachio [New York University], personal nants occur between t and wild-type chromosomes communication for Hba-ps4 mapping). at a 100-fold reduced frequency. Lyon used these recombinants in an elegant genetic analysis of the t complex. Different recombinant chromosomes, Molecular Cloning of a t Complex termed partial t haplotypes, display different sub- Structural Gene sets of the t phenotypes. By examining the cis and N. Sarvetnick, L. Cisek, L.M. Silver trans interactions between different partial haplo- types, she proposed that the T interaction factor and The t complex has been dissected biochemically the lethal factors mapped to single regions, sterility during the past several years in our laboratory. Two- resulted from the interaction of two separable re- dimensional gel analysis has identified eight testic- gions, and segregation distortion was controlled by ular proteins (TCP-1 to TCP-8) that are specified three regions. She derived a genetic map and de- by this region of the mouse genome. Since t haplo- fined the crossover points for the partial haplo- types have profound effects on spermatogenesis, it types. We have used RFLPs between t and wild type is likely that one or more of these proteins play a to order the physical end points of the partial t hap- crucial role. To investigate this possibility further lotypes. This physical map agrees with Lyon's ge- and obtain probes in the proximal region of the t netic map. complex, we set out to clone TCP-1. Using methods developed by J. Fiddes (Califor- nia Biotechnology, San Jose), we constructed a An a-Globin Pseudogene Maps cDNA library starting with testis mRNA. The li- within the t Complex brary was screened with several different radioac- H. Fox tively labeled probes. The probes were obtained by sequential size fractionations of liver and testis The mouse a-globin gene family consists of three mRNAs. In vitro translations identified enriched "real" genes and two pseudogenes. With the use of and nonenriched pools of TCP-1 message, and these somatic-cell hybrids, it was found that one pseu- pools were reverse-transcribed and used as differ- dogene Hba-ps4 was located on chromosome 17. To ential probes for the library. Utilizing what we determine whether Hba-ps4 is located in the t coin- knew about TCP-1 message abundance and tissue

72 distribution, we made qualitative assessments from change of genetic material between homologous the autoradiograms and selected 70 clones for fur- chromosomes. As a result, even though an individ- ther analysis. ual inherited a certain combination of alleles on the Northern blot analysis with a group of these con- chromosomes from each parent, the combination firmed the message length, and differential expres- would be randomized in subsequent generations. sion was inferred from the screen. DNA blotting One property of t haplotypes is an inhibition of experiments with a hybrid hamster cell line con- crossing-over with wild-type chromosomes, which taining mouse chromosome 17 showed that two causes the diverse set of phenotypes associated with clones of the first dozen checked indeed mapped on t to be locked together as a unit. chromosome 17. Hybrid-selection experiments with Recombination is dependent on homologous one of these clones (testis RNA was hybridized to chromosomes having the same order of genes; i.e., immobilized clone DNA, eluted, and translated in their genetic maps must be identical. The particular vitro) produced a band with a molecular weight be- order is for the most part unimportant; what mat- tween 61,000 and 64,000 on an SDS gel. The ac- ters is that they be the same. It has recently been cumulated data strongly suggest that this clone found that the coat marker tufted, tf, and the major codes for the TCP-1 protein. histocompatibility complex, H-2 (which itself is a Further DNA blotting experiments were carried large gene family), are in opposite orders in t and out to identify restriction-fragment-length poly- wild-type chromosomes. A chromosomal rearrange- morphisms (RFLPs), which would then allow this ment would explain why one t chromosome can clone to be mapped within the t complex. Although cross over with another, and one wild type can cross extensive, these experiments produced no RFLPs over with another wild type, but t cannot cross over between congenic lines. All strains examined pos- with wild type. We are attempting to define pre- sess several cross-hybridizing fragments, two map- cisely the chromosomal rearrangement between t ping on another chromosome. A second set of blots and wild type. These chromosomes may carry a revealed a polymorphism between C3H, DBA, and simple inversion or the rearrangement could be B6 inbred lines. We were therefore able to map cer- complex, such as multiple overlapping inversions tain alleles with recombinant inbred mouse DNAs or transpositions. A fine-structure genetic map of provided by the Jackson Laboratory. The B6/ both t and wild type will define the rearrangement. DBA,C3H polymorphism is not surprising as B6 is Mice carrying chromosomes that show recombi- considered somewhat "speciated" from the other nation between the markers T and tf (which map to inbred lines. However, we found the lack of RFLPs opposite ends of the t complex) are selected among between t/ + unexpected, as the suppression of re- the progeny of females heterozygous for comple- combination described by t geneticists over the menting t haplotypes. These are then scored for years led us to assume that there would be extensive H-2 alleles by Southern blot analysis and for the nonhomology between the chromosome-17 alleles. presence of lethal alleles by further breeding ex- We now realize that this view is narrow, as gross periments. We have currently isolated 29 recombi- rearrangements do not necessarily predict the de- nant chromosomes. One of these crossovers oc- tection of polymorphisms on a local level. Further- curred within the H-2 complex and shows that genes more, it would appear that the coding-sequence re- within the H-2 region are probably inverted with gions identified by this clone are highly conserved. respect to wild type. Cross-hybridizing genomic clones have recently We plan to extend the mapping analysis to in- been isolated from a library provided by H. Leh- clude the chromosome-17 microclones. Because we rach (European Molecular Biology Laboratory, have not yet found any restriction-fragment-length Heidelberg). Noncoding DNA could diverge more polymorphism between the parental t chromosomes readily, so hopefully a third series of blots might with the microclones, we plan to use a gel system allow RFLPs to be identified. developed by L. Lerman (SUNY, Albany) that sep- Studies are in progress to characterize this clone arates DNA fragments independently of size by the further. Sequence analysis and expression in a pro- use of a gradient of DNA denaturants. When a re- karyotic vector system are the main focus. The lat- striction fragment reaches a concentration of de- ter efforts should produce an antibody that will tell naturants such that a portion "melts," it stops mi- us more about TCP-1 intercellular localization and grating. Single-base-pair changes anywhere within its pattern of expression during spermatogenesis. the melted region (usually 50-100 bp) can have a profound effect on mobility. This should be a much more efficient method of detecting polymorphisms Recombinational Analysis of the than by restriction fragment size. Thus, we hope to t Complex increase the resolution of our map to detect com- P. Mains plex rearrangements by saturating the t region with microclones as genetic markers. Currently, Leh- The process of recombination, or crossing-over, rach is performing a similar recombinational anal- takes place during meiosis and results in the ex- ysis on wild-type chromosomes.

73 A long-term goal of this work will be the cloning strain. These suppressors can then be mapped of the t lethal mutations. If enough microclones can quickly by the use of the appropriate panel of re- be mapped ( -100), a mutation could be localized combinant inbred (RI) strains. These are inbred to a 200-kb region. It may then be feasible to clone mice that are derived from two different inbred this area and attempt to rescue mutant embryos by strains. The panel chosen will be such that one pa- microinjection of oocytes. This approach may al- rental strain shows suppression while the other does low the cloning of a lethal allele without prior not. knowledge of the gene product. Linked suppressors can be mapped by taking ad- vantage of the fact that the H-2 complex maps within the t complex. There exist a large number of mouse strains derived from intra-H-2 recombina- Genetic Analysis of Segregation tion events between different inbred strains. By us- Distortion of the Mouse t Haplotypes ing the appropriate recombinants derived from pa- P. Mains rental strains in which one strain shows suppression of segregation distortion while the other does not, The t complex is one of the few exceptions to Men- the suppressors can be mapped to subregions of del's law of segregation. Normally, an organism chromosome 17. heterozygous for two alleles passes each to its off- spring in equal frequencies. However, male mice can transmit their t-bearing chromosomes to more than 90% of their offspring. This phenomenon, Genetic Analysis of Dosage Effects of termed segregation distortion or transmission ratio the Proximal Region of Chromosome 17 distortion, probably maintains the otherwise dele- N. Sarvetnick, P. Mains terious t chromosomes at high levels in wild popu- lations. Two deficiencies within the proximal region of M. Lyon proposed that segregation distortion is chromosome 17 display peculiar breeding patterns. controlled by three loci, one acting in cis and two One such chromosome, ThP shows a deletion of 3 acting in cis or trans. Detailed analysis is ham- cM. Offspring that acquire two copies of ThP die in pered by the fact that all complete t chromosomes utero at the morula stage of embryogenesis. When appear to carry identical (or at least very similar) the deficient chromosome is acquired only through alleles at these loci; i.e., there are no polymorph- the father, the resulting heterozygotes are normal isms to allow further genetic dissection. However, except for the short-tailed phenotype seen in all T wild-type chromosomes do show polymorphisms in mutations. However, when the PP chromosome is their interaction with segregation distortion. Both acquired through the mother, the heterozygous em- linked and unlinked suppressors of segregation dis- bryos die 15 days after conception. Analysis of this tortion are found in different inbred strains of mice "maternal" effect is important because it may tell (this polymorphism has complicated the analyis of us that the same chromosome acts differently when segregation distortion, since most t chromosomes it is derived from the egg or sperm. This nonequi- are maintained as outbred stocks that are geneti- valence of genetic material has been observed in a cally heterogeneous). The fact that an allele can few other instances and is reconciled most easily suppress (or enhance) segregation distortion indi- by asserting that something is missing in the oocyte cates that it must interact with the t factors respon- that cannot be compensated for by the paternal gene sible for the phenomenon. Therefore, analysis of after fertilization. these loci in inbred mice may further elucidate the A second chromosome showing the same mater- mechanism of segregation distortion. nal effect as ThP has recently been identified by us As a first step, we wish to map these suppressors. and H. Winking (Medical Institute at Lubeck, West Congenic 129.t' males (which show >90% trans- Germany). Biochemical studies indicate that the t'u'2 mission of t) are being mated to females from a chromosome has lost the TCP-1 protein that maps variety of inbred mouse strains. The sons will then to this region, implying that it also has a deletion. be tested for the level of segregation distortion. The t'Ph2 arose as a recombinant between a complete t F, males of the strains that show suppression will haplotype and a "wild-type" chromosome 17. It ap- then be backcrossed to 129, and those sons will be pears that a deletion was introduced into this new tested. During a backcross, there is an equal prob- distal t haplotype chromosome as a result of une- ability that the suppressor or the permissive 129 al- qual crossing over. lele in the F, animal will be transmitted. Those sons We have been interested in reversing the maternal that happen to receive the suppressor(s) will show effect by manipulating the genetic backround of the no segregation distortion. The relative frequencies female harboring t'"" so that extra doses of a prox- of sons that show or do not show suppression in the imal portion of chromosome 17 are provided. Dur- backcross generation will indicate the number of ing the last several years, two-dimensional gel unlinked suppressor loci present in the inbred analysis has enabled us to identify several other

74 partial t haplotypes that result from unequal cross- erozygous for the same t haplotype and associated ing-over and have duplications. Chromosomes that lethal factor. Embryos at different developmental duplicate TCP-1 should provide at least part of the stages are dissected from the uterus, labeled in vi- region missing from thth2. By utilizing these chro- tro with ["S]methionine, and analyzed by high-res- mosomes, we hope to determine when the region is olution two-dimensional gel electrophoresis. The required and whether or not two doses in the egg genotype of each embryo is determined after elec- or sperm can rescue the embryo. A cross that at- trophoresis by the presence or absence of allelic tempts to reverse the phenotype by providing two forms of a t-complex-specific protein (TCP-1 or doses of the proximal region in the sperm is as fol- p63/6.9) in the two-dimensional gel pattern. The lows: embryos carrying t haplotypes are congenic on a t'""/Ttf x th"tflth'tf(th45 has duplication) standard inbred background. This means that the DNAs of normal and mutant embryos differ only in (F) (M) the portion of chromosome 17 that contains the t Rescued t'." offspring will have normal tails and be complex, and that a comparison of the two-dimen- nontufted. Similarly, another cross provides two sional gel patterns of these staged embryos should doses through the egg: yield only those protein polymorphisms that result Th45tf/ t'ub2 x + tf/ + tf from the lethal factors or other t-specific genes. (F) (M) Different t haplotypes are remarkably similar in By looking for nontufted progeny, we can score for terms of DNA structure and protein polymorph- the rescue of the maternally derived t' °b2 embryos. isms; therefore, the differences in two-dimensional During oogenesis, half the chromosomes are set gel patterns of embryos carrying different t haplo- aside in polar bodies that can no longer contribute types should reflect the action of the different le- genetic information to the egg. If this is the critical thal factors. The types of differences we are fol- period for the maternal effect, then the genes in the lowing in patterns of mice carrying t haplotypes polar body will not be available to rescue the egg. include (1) the presence of an aberrant protein spot, However, a proximal duplication can accompany a (2) the absence of a normal protein spot, and (3) t'ub2 chromosome if crossing-over occurs. We could the inappropriate temporal expression of a normal monitor this by marking a chromosome with a Rob- protein spot during development. We have obtained ertsonian translocation that could be visualized by two-dimensional gel protein patterns of normal em- cytogenetic techniques. Such a genetic configura- bryos at several different developmental stages, and tion will allow us to score recombination anywhere we are compiling data on mutant embryos of three between the centromere and the tufted marker. If different t haplotypes. Preliminary results indicate the 0'2 offspring are observed and are all recom- that embryos homozygous for a particular t haplo- binants, this would imply that the region is required type and its associated lethal genetic factor show after the first meiotic division. two-dimensional gel protein patterns very similar to those of normal embryos. Those proteins whose structure and/or temporal expression is altered in the mutant embryos will be mapped genetically and Two-dimensional Protein Patterns of analyzed for tissue distribution. It is hoped that Embryos with Lethal t Haplotypes these studies will result in the identification of V.L. Bautch, M. S. Krangel products of the lethal factors associated with t hap- lotypes and help elucidate their role in mammalian Mice that are homozygous for certain t haplotypes development. die during embryogenesis as a consequence of le- thal genetic factors within the t complex DNA. Each complete t haplotype is associated with a spe- cific lethal genetic factor, and each factor causes Gene Transfer into Mice morphological abnormalities and death at a differ- D. Hanahan ent stage in mouse development. The nature of these lethal genetic factors is not known. In an ef- During the past year, an embryology laboratory has fort to identify the products of these factors and to been established in the Harris Animal Facility. One understand their role in development, we are com- purpose of this laboratory is to manipulate mouse paring the two-dimensional protein patterns of nor- embryos experimentally, in particular to transfer mal embryos with those containing one (heterozy- cloned genes into the mouse germ line, as a means gous) or two (homozygous) doses of the lethal of studying gene regulation in the context of the factors. This work utilizes the QUEST system di- organism. This is accomplished by injecting a so- rected by J. Garrels (see Structural Studies in the lution of DNA into fertilized one-cell mouse em- Mammalian Cells Section). Embryos with each of bryos and then placing the inoculated embryos into these genotypes are all found in litters resulting a foster mother, where a significant fraction de- from mating a male and female that are both het- velop to term; about 10-30% of the mice contain

75 the injected DNA integrated into one of their chro- I have been interested in employing minor struc- mosomes. The past few years have seen demonstra- tural variants of these molecules to aid in drawing tions that this approach can be used to study the detailed structure-function relationships. In collab- expression of cloned genes. The most notable are oration with D. Pious (University of Washington, the studies by Palmiter and Brinster (Palmiter et Seattle), mutants in one particular HLA allele, al., Nature 300: 611 [1982]), which have shown HLA-A2, have been obtained. Mutagenesis of a hu- that the transfer of a rat growth-hormone gene into man B-cell line, followed by immunoselection with mice will produce unusually large mice as a con- a monoclonal antibody plus complement, has al- sequence. lowed the selection of mutants that have lost cell- The ongoing studies at Cold Spring Harbor Lab- surface antigenic determinants. Biochemical stud- oratory focus on examining the structure and ex- ies of the resulting HLA-A2 mutants have allowed pression of a series of hybrid genes following their the identification of that region of the molecule that transfer into mice. The hybrid genes contain regu- is recognized by the selecting antibody. Other mu- latory information derived from the rat insulin gene tants have been obtained in which the molecules do or the chicken alpha-2 (I) collagen gene, each fused not mature appropriately and fail to reach the cell to control expression of structural information surface. derived from three viral genes: SV40 T antigen, One mutant cell line displayed a particularly MC29 gag-myc protein, and RSV-gag protein. The complex phenotype and is the subject of ongoing purpose of using these genes is twofold: (1) to de- experiments. These cells synthesize two forms of fine cis-acting regulatory information associated HLA-A2, a low-abundance cell-surface form and a with insulin or collagen genes that elicits their cor- predominant form that is secreted. The latter form rect expression in the organism and (2) to examine is somewhat smaller than wild-type HLA-A2, and the phenotypic consequences of the expression of this difference was localized to that region of the oncogenes in the tissues specified by the cellular molecule that interacts with the plasma membrane. regulatory sequences. Further experiments suggested that the secreted Recent work from the laboratory of B. Mintz form was not derived from a membrane form by a (Wagner et al., Cell 35: 647 [1983]) has demon- posttranslational mechanism. It was proposed that strated that integration of injected DNA can pro- the two forms of HLA-A2 in the mutant resulted duce recessive lethal mutations at a remarkably high from alternative splicing of the same primary tran- frequency (33 %). This result motivates examina- script, the secreted molecule deriving from tran- tion of the integrated structure of genes transferred scripts spliced so as to delete the exon encoding into mice. At Cold Spring Harbor Laboratory, this that portion of the molecule that interacts with the question is being addressed by retrieving integrated membrane. plasmids out of their resident status in mouse chro- To test this hypothesis, cDNA libraries were con- mosomes and establishing them as episomes in structed from both the parent and mutant cell lines. Escherichia colt. It is possible to retrieve sequen- cDNA clones that encode HLA-A and HLA-B were ces flanking the integrated transgenes by this ap- isolated from the mutant library using a general proach (plasmid rescue) and then to examine the HLA-specific probe, and restriction mapping was mouse DNA before and after the integration event. used to identify a clone encoding the secreted HLA- This will facilitate assessment of the extent of dele- A2 molecule. A comparison of the DNA sequence tion, rearrangement, and/or translocation that oc- of this clone with that of an HLA-A2 encoding curred upon integration, which in turn pertains to cDNA derived from another cell line (D. Arnot, alternative mechanisms of mutagenesis (which pers. comm.) has demonstrated unequivocally that could occur either by relatively clean insertion or the exon encoding the membrane-anchoring region by consequent large deletion and rearrangement). of the polypeptide has been precisely deleted. Other minor differences between the sequences are most probably cell-line-specific; however, this issue Molecular Analysis of Human awaits the isolation of the appropriate clone from Histocompatibility Antigen Mutants the wild-type cDNA library. An analysis of HLA- M.S. Krangel A2 genomic clones from both parent and mutant will likely be necessary to define precisely the mu- Human histocompatibility antigens (HLA-A and tation leading to aberrant splicing in these cells. HLA-B) are highly polymorphic cell-surface mol- ecules that play important roles in self-nonself dis- crimination by the immune system. Polymorphism at these loci represents the major barrier to trans- Hormonal Control of Gene Expression plantation between different individuals of the spe- D. T. Kurtz, W.R. Addison, J. I. Maclnnes, cies. However, the primary physiological role of D. Danna, J. -Z. Li, E. Nozik these molecules is in mediating immune recogni- tion of virally infected cells by cytotoxic T lympho- We have been studying the hormonal and develop- cytes. mental regulation of gene expression in higher eu- 76 karyotes. The model system we have been using is quences involved in hormonal modulation is to a rat protein called a globulin. This protein is en- compare the sequences of several au genes. We coded by a multigene family (20-25 copies per have already found that at least two of eight genes haploid genome), and its production is under com- tested do not respond to hormones when trans- plex hormonal and developmental control in vivo. fected into L cells. Interestingly, the rate of tran- The synthesis of a2 in rats is regulated by gluco- scription from these variant genes is constitutively corticoids, insulin, sex steroids, and growth hor- high. This is consistent with a model in which the mone. DNA region responsible for hormonal control is a negative control element; i.e., these DNA sequen- DNA sequences involved in hormonal induction of ces keep the au gene off in the absence of hor- a2u. The generally accepted model for the molecu- mones. The hormonal induction of au globulin, lar mechanism of action of steroid hormones pos- then, is a derepression, rather than a positive in- tulates that the hormone binds to a cytoplasmic duction. protein, the receptor; this binding activates the re- ceptor and renders it competent to induce (or re- Tissue distribution of a2u synthesis in vivo.Until press) the synthesis of specific genes. The simplest recently,02uwas thought to be synthesized exclu- literal interpretation of this model predicts that sively in the liver of adult male rats. Indeed, the hormone-responsive genes have specific sequences liver is the major site of synthesis of this protein: in or around them that are responsible for hor- In adult male rats,02,represents 1 -2% of hepatic monal modulation and that a hormone-inducible mRNA. In the liver, the level of02umRNA is influ- gene should respond in any cell in which a compe- enced by several hormones: Androgens, glucocor- tent receptor exists. We have tested this model by ticoids, thyroid hormone, insulin, and growth horn- reintroducing cloned au, genes into mouse L cells, one all induce02umRNA, and estrogens repress which contain a functional glucocorticoid receptor. the level of au. However, we have found that au is The transfected02ugenes indeed do respond to glu- synthesized in several other rat tissues: the salivary cocorticoids, and the level of correctly initiated au gland, the lachrymal gland, and the mammary mRNA is induced 10-20-fold in individual clones. glands of pregnant females. The hormonal modu- We are identifying the sequences responsible for lation in each tissue is different, and different au the induction using the "linker-scanning" method genes or gene sets are transcribed in the various first devised by S. McKnight (Hutchinson Cancer tissues. Research Center, Seattle). In this method, BAL-31 deletions are made in plasmids containing the au 1. Salivary gland: au protein and mRNA are found in the submaxillary glands of both male and fe- promoter region. Independent deletions are made coming from both the 5' and 3' directions, and an male rats of any age. The synthesis seems to be Xho linker is added. Clones are selected in which constitutive, at a level - 1/20 of that in the liver. the deletion end points are in the 02 promoter re- No hormonal modulation is evident. 2. Lachrymal gland:a2,is also found in the ex- gion. BAL deletions from each direction with end points near each other are then joined through the traorbital lachrymal glands of rats and is present Xho linker. This leads to a clustered point muta- in both males and females. The level seems to rise somewhat at puberty, and in adults,it tion, in which the bases in the Xho linker substitute for the wild-type sequence (if the BAL deletions reaches a level - 1/5 that found in the liver. from opposite directions were exactly 8 bases 3. Mammary gland: a2u mRNA and protein are found in day-17-19 pregnant rats. The level apart), or leads to small deletions or duplications seems to peak sharply but never reaches a level (if the BAL deletions were greater or less than 8 greater than - 1/50 that found in the liver. The bases apart). We have saturated the region from the au cap site back to -200 with such mutations. mRNA declines precipitously following day 19, and by parturition (day 22) it is essentially These mutant genes have been reintroduced into L absent. The hormonal modulation of au in the cells, and the effects on hormonal modulation are mammary gland is currently under investiga- currently being assessed. Although this method is tion. The time course of its appearance and sub- more time consuming than simple 5' deletions, in sequent repression is consistent with a model in the long run, the information obtained from these which it is being induced by progesterone and clustered point mutations will be more meaningful. then shut off by prolactin. As many investigators are discovering, when BAL deletions are made, and heterologous sequences are The a2u mRNA found in each of the tissues ap- brought in next to the end point of the deletion, pears to be a single species of approximately 1 kb. these sequences (even from pBR322) can have un- 5'-end mapping indicates that the cap site is identi- predictable and artifactual effects on transcription. cal in all tissues. Analysis of the au, protein being Our method ensures that the mutation is localized made in the various tissues revealed that, on one- and that the neighboring sequences are identical to dimensional gels, the protein made in the liver, wild type. submaxillary gland, and the salivary gland is a ho- Another possible method to localize the DNA se- mogeneous species with a molecular weight of 77 20,000, whereas the protein made in the mammary ily assayed in cell cultures growing in mid-log gland is slightly smaller (- 19,000). Isofocusing phase but are virtually undetectable in cultures gels (one dimensional), however, reveal clear dif- resting in stationary phase. This growth-phase-de- ferences in the a, proteins being made in the dif- pendent gene expression is presently understood to ferent tissues. reflect the exclusive expression of these genes dur- Liver a2 is represented by four or five isoelec- ing the S phase of the mammalian cell-division tric species with pI values ranging from approxi- cycle. Our laboratory is working to define the ge- mately 5.0 to 6.0. The ce, produced by the submax- netic determinants that govern this mode of differ- illary and lachrymal glands appears as three to four ential gene expression, and as a first step toward species with pI values of approximately 4.0-4.8. the development of an experimental system, we The mammary-gland pattern is more complex and have cloned the thymidine kinase (tk) gene from appears to comprise most of the liver proteins and Chinese hamster ovary DNA in recombinant bac- several more basic species. This finding is consis- teriophage X (Lewis et al., Mol. Cell. Biol. 3: 1815 tent with different a, gene sets being transcribed in [1983]). Our experimental plan is to search for such different tissues. We are now in the process of iden- genetic determinants by variously modifying the tifying which 02 genes code for which tissue-spe- hamster tk gene in vitro, transfecting such modi- cific proteins. Eighteen independent 02,, genomic fied tk genes into mammalian Tk- cells, and then clones have now been isolated from a library of rat studying the growth dependence of the modified tk- DNA cloned in Charon 4A. These genes have been gene expression in Tk*-transformed cells. In this transfected into L cells in tissue culture to assess way, by defining the character and genetic location their response to various hormones. These same of the determinants of growth-dependent gene cells can then be used essentially as a linked tran- expression, we can begin to infer the physiological scription-translation system to determine which a, processes they govern. isoelectric species each gene encodes. This is cur- As we have previously reported, restriction en- rently being performed using isofocusing followed zyme sensitivity experiments and Southern and by Western blotting. Northern blot hybridizations indicate that the ham- Once specific cloned a2 genes have been "as- ster tk gene extends over 10-12 kb, from the HpaI signed" to various tissues, it may be possible to de- site in the 3.2-kb EcoRI fragment of XHaTK-5 termine the molecular basis for the tissue specific- through the HindIII site in the 5.5-kb EcoRI frag- ity of expression of the different genes by reintro- ment at the left-arm end of XHaTK-5 (Fig. 1). To ducing these genes into primary cultures of rat cells define the structure of this gene more precisely, we or into immortalized or transformed analogs of have isolated a nearly full sequence (1250 nucleo- these primary cultures. tides) of double-stranded cDNA to hamster tk mRNA from a cDNA library prepared from poly(A)* RNA from the Chinese hamster A-29 cell line. On the basis of preliminary S1 analysis, this Cell-cycle-modulated Gene Expression double-stranded cDNA lacks at its 5' end approxi- J. Lewis, D. Matkovich mately 30 nucleotides of the hamster tk mRNA. Various subclones of this cDNA have been pre- Since the early 1960s, evidence has accumulated pared in M13 and have been sequenced using the demonstrating that the expression of various genes Sanger-Coulson dideoxynucleotide method. The in mammalian cells cultured in vitro is strictly cDNA sequence information, in conjunction with growth-phase-dependent. The enzymes thymidine sequencing data derived from M13 subclones of the kinase, thymidylate synthetase, and dihydrofolate hamster tk gene, have permitted us to define the reductase, for example, important to the biosyn- structure of the hamster tk gene. In brief, the ma- thesis of DNA nucleotide precursors, can be read- ture hamster tk mRNA sequences are organized into

Pvo Smo I Pst I Eco RI PvuII EcoRI PvuII EcoRiPst Sst I EcoRI PstI Pst I EcoRI

11 1

1 1 MstII MsitIfIKpinI Bo. Kpn I HindTIIISol IClaI Son I Hind Ia SmaISmall'X hoI Bst E BstEII HindDIHind DI Sma I HpaI

52KB 18K8 26KB 92KB 34KB

X HoTK-5 Figure 1 Restriction enzyme map of XHaTK-5. The Chinese hamster tk gene extends over 11 kb in the 17-kb recombinant insert in XHaTK-5, from the HpaI site in the rightmost 3.4-kb EcoRI fragment through the leftmost HindIII site in the 5.2-kb EcoRI fragment.

78 at least seven exon blocks (distributed over 11 kb of genomic DNA) separated by intronic sequences that range in size from 100 to 5400 nucleotides. We are Eco RI not yet certain whether the tk mRNA sequences that are not represented in our cDNA are contained in the genome as a continuous part of exon block (I). Nonetheless, the information we now have avail- able makes it possible for us to undertake construc- tion of the first modified hamster tk gene. The genetic determinants of growth-dependent tk- gene expression might reside within 5' or 3' se- quences flanking the gene, within its five introns, or conceivably even within tk coding sequences. Our experimental strategy, therefore, is to reduce the size and complexity of the hamster tk gene by first constructing a minimal hamster tk gene that depends on the hamster tk-gene promoter to direct Figure 2 transcription of the hamster tk cDNA and then test- Structure of a minimal hamster tic gene. pHaTK1 was con- ing the extent to which the expression of this mini- structed by fusing the hamster tk-gene promoter lying between mal gene is growth-phase-dependent. We have con- the Smal and Xhol sites (open box) to a 1180-bp EcoRI-Smal fragment of the hamster tk cDNA (solid line). pHaTK1 trans- structed the prototype of a hamster minimal tk gene forms a variety of mammalian Tk- cells to the Tk* phenotype. designated pHaTK1 (Fig.2) and have demon- Cells transformed with this construction are currently being strated that it is active in transforming a variety of studied for the growth dependence of their tk expression. Tk- mammalian cell lines to the Tic+ phenotype. This gene, however, still embodies some 1000 nu- cleotides to the 5' side of the hamster tk-gene pro- moter, which we have tentatively mapped, on the the search for the gene sequences that control basis of restriction enzyme sensitivity data and growth-phase-dependent expression. Should the genomic nucleotide sequencing, to lie 200 nucleo- expression of this gene prove to be growth-phase- tides to the 3' side of the Hpal site. We are presently independent, as is true for the herpesvirus tk gene generating deletion derivatives of pHaTK1, using in Tk+-transformed mammalian cells, we intend to the technique of Exo III/S, mutagenesis, to prepare modify our minimal tk gene further by adding to it a hamster tk gene of approximately 1400 nucleo- either 5' or 3' flanking segments from the genomic tides, of which 1250 nucleotides are derived from tk clone or intron blocks that necessitate splicing of the double-stranded cDNA and 150 are derived the primary tk RNA transcript. From a full analysis from the promoter and its most proximal nucleo- of this sort, we expect to provide insights into the tides. Should the expression of this gene be growth- mode of growth-phase-dependent tk-gene expres- phase-dependent, we will have quickly narrowed sion.

79

YEASTS

The year 1983 marked a new stage in the develop- site-specific transposition/substitution process oc- ment of yeast genetics and molecular biology at curs. Cold Spring Harbor Laboratory. The addition of Several years ago, we cloned both alleles of the David Beach and Mark Zoller and their research expression locus, MATa and MAT«, and both of the groups to the laboratory staff has broadened the silent loci that serve as donors of the MAT cas- scope of research to include regulation of the cell- settes, HML and HMR. These genes have been se- division cycle and the application of site-directed quenced, and hence we have a complete end-prod- mutagenesis to the study of DNA-protein interac- uct description of the cassette switching event (Fig. tions in yeast. In addition, the startling observation 1). The MATa and MATa alleles differ by substitu- that proteins similar to mammalian cancer genes tions Ya and Ya, respectively. There are regions of occur naturally in yeast and may play functionally homology (W, X, Z1, Z2) between the donor and similar roles in the control of the cell cycle (DeFeo- recipient loci on each side of the Y sequences that Jones et al., Nature 306: 707 [1983]; Powers et al., one might expect have roles in the initiation and Cell 36: 607 [1984]; Lorincz and Reed, Nature resolution of the switching intermediate. Several 307: 183 [1984]) has led the group headed by M. loci whose products might have catalytic roles in Wig ler (Oncogene Section) to focus new efforts on the switching process have been identified (HO yeast as a model for cancer biology and has RAD52 SWI). We are now in a position to examine spawned the study of "yeast oncogenes." a specific gene conversion event that is efficient, These developments, along with the long-stand- reproducible, and genetically regulated. ing research program on cell-type switching in Over the past few years, we have shown that yeast and S. Bonitz' studies on mitochondrial RNA homothallic switching is initiated by a site-specific, processing, have established yeast genetics as a ma- double-strand cut in the recipient locus, MAT, jor research area of the laboratory, with three re- in the Z region near the cell-type-specific Y se- search groups in the Delbriick Laboratory building quences. This observation is in contrast to gene and two groups in the Demerec building. This par- conversion models positing a nick in the donor lo- allels the increased interest in yeast as an experi- cus. An enzyme that makes this cut (YZ endo) has mental organism world wide. been identified in homothallic cells. Variants of the MAT locus that have changes in this site are not able to switch. The Z1 region of homology between MAT and HMR is normally 230 bp. We made sev- eral deletions of the right side of Z1 but found that Mechanism of Cassette Transposition the rate of switching was not reduced when that ho- J.N. Strathern, A.J.S. Klar, J.B. Hicks, mology was reduced to less than 100 bases. The M. Kelly, C. McGill, L. Miglio, R. Kostriken results did suggest that aberrant events leading to fusion of MAT and the donor loci were elevated in Homothallic strains of the budding yeast Saccha- these strains. romyces cerevisiae change from one mating type to Several different approaches have been employed the other by a mechanism that involves specific to determine whether sites essential to the switch- rearrangements of the genome. Copies of unex- ing reaction exist in the W and X regions of MAT. pressed regulatory genes are transposed from stor- In one set of experiments, a variety of deletions age sites to an expression site. This is called the throughout this region were tested for ability to cassette mechanism of gene activation. The se- switch. This approach involved having the recipient quence present at the expression site, MAT, con- MAT locus on a plasmid. No essential sites were trols the mating type of the cell. Elsewhere in this identified using this assay. Any homology between report, experiments bearing on the mechanism by the donor loci and the recipient was sufficient to which the unexpressed copies are kept repressed are allow completion of the switching process. A sec- presented. Here, we describe recent experiments ond set of experiments involved making restriction- designed to determine the mechanism by which this enzyme-site polymorphisms between the X region

81 MAR-SIR MAR-SIR REPRESSION REPRESSION

83 matt mot 2 mat 3 =1\AAAAAAKANvill--- h90 L K

mot 12 mat3 EZiwivvvvww.i- h+ L.

mat 1,2 mat 3.1 mat 2 mat 3 --Ellavvvvvvwvvvigki EZEtwAwAnnAlM1--- h+N

mat1,2 mat 3,1 mot 2 mat 3 ---.111vwvW~wi FZEix.n.AAAAAAAAAM---- h U

Figure 3 Diagram of the structure of the mating-type locus in different strains. Each 1.3-kb cas- sette is marked as a box, separated by the L and K regions, each approximately 15 kb in length. The arrow marks the cut site of the double-stranded DNA.

The mating-type cassettes have recently been se- locus unlinked to cdc2. The gene, suci, has been quenced in the laboratory of M. Smith (University subjected to "gene destruction" by insertion of a of Vancouver). Future work in this system will con- yeast selectable marker, leu2, into a transcribed re- sist of identification of the role of each of the mat- gion. When this construction is integrated into the ing-type gene products and also further characteri- chromosome in a manner that displaces the original zation of the mechanisms of switching. copy of the gene, the cell is inviable. Spores car- rying this mutation germinate and undergo between one and three cell divisions before dying. The dead Cell-cycle Control in Fission Yeast cells do not have an obvious cdc phenotype. The D. Beach, S. Silbiger [in collaboration with relationship between cdc2 and suci will be the P. Nurse, University of Sussex] subject of further investigation.

The cell cycle of fission yeast is controlled at two points: one in G, referred to as "start" and the other in G2. Genes in which mutations cause no defect in Regulation of Yeast Mitochondrial general cell metabolism but arrest cell-cycle pro- Gene Expression gression are called cdc genes. cdc2 is one such S. Bonitz, C. Moomaw gene, and it has been found that its product is re- quired both in G, at start and in G2. The percentage Gene expression in yeast mitochondria is regulated of cells caught in the G, or G2 block depends en- by proteins made from yeast nuclear genes. To de- tirely on the age distribution of the cells at the time termine which nuclear genes regulate mitochon- of shift up to the restrictive temperature for cdc2. drial gene expression, a set of nuclear mutants that The cdc2 gene was previously isolated, and by affect mitochondrial functions have been isolated cross-complementation experiments it was shown by A. Tzagoloff at Columbia University. Over 200 that this gene of fission yeast and the cdc28 gene different nuclear genes regulate various mitochon- of budding yeast are functionally equivalent. Se- drial functions, such as RNA splicing and mito- quencing of both genes reveals that they are evolu- chondrial protein synthesis. Many of these nuclear tionary homologs, which are also related to the ty- genes regulate the gene expression of one of the rosine kinase family of mammalian oncogenes. The mitochondrial proteins, cytochrome oxidase. cdc2 gene contains at least four introns. Our pres- Cytochrome oxidase is a protein required for the ent work consists of isolating a cDNA clone of the synthesis of adenosine triphosphate.It contains cdc2 gene so that the gene product can be expressed seven subunits, four made from nuclear DNA and in Escherichia coli. The protein expressed in E. coli three made from mitochondrial DNA. The three will be used for raising antibodies against the pro- largest subunits, subunits 1, 2, and 3, are made from tein and to establish whether it is a protein kinase. mitochondrial DNA. The gene encoding the sub- During the isolation of cdc2, a second sequence unit-1 protein is a complex gene coding for a pro- was found that is capable, when present on an au- tein with a molecular weight of 56,000. DNA se- tonomously replicating plasmid, of rescuing cer- quence analysis has revealed that the subunit-1 gene tain alleles of cdc2. This sequence integrates at a is a split gene containing 10,000 nucleotides. The

84 subunit-1 coding sequence consists of six to eight The mechanism by which this occurs is not fully exons separated by five large introns. The entire understood. It is believed that the HO endonuclease gene is transcribed, and the introns are removed in initiates the event by creating a double-strand break several steps to generate the subunit-1 mRNA. The in the chromosome at MAT. R. Kostriken, who re- mRNA is then translated to give the subunit-1 pro- cently joined the laboratory as a postdoctoral fel- tein.Therefore, the possibility exists that the low, has demonstrated endonuclease activity in expression of the subunit-1 gene can be regulated yeast extracts from HO strains and has determined at either of three different levels: transcription, the specific nucleotides that are cleaved in MAT splicing, or translation. DNA. This work was done with F. Heffron in col- To determine how the expression of the subunit- laboration with the Yeast group at Cold Spring Har- 1 gene is regulated, we are studying the set of nu- bor. Kostriken is currently purifying the HO endo- clear mutants that control the synthesis of subunit nuclease from a strain of Escherichia coli that has 1 of cytochrome oxidase. Of the 200 different nu- been engineered to express the HO-gene product. clear genes affecting mitochondrial functions, This construction demonstrated that the HO gene 10-15 different nuclear genes specifically affect the encodes the endonuclease. subunit-1 gene. These mutants lack only the sub- The current effort in the laboratory stemmed unit-1 protein of cytochrome oxidase and contain from the characterization of nonswitching strains all other mitochondrial proteins. To characterize of yeast (inconvertible mutations). DNA sequence these mutants at a more detailed level, we have been analysis indicated that these strains contained point studying the mitochondrial RNA from these mu- changes within the HO recognition sequence at tants. Mitochondria were isolated and lysed to re- MAT. To understand the specific determinants by lease their RNA. This RNA was separated by size which the HO endonuclease recognizes the cut site, on an agarose gel and then transferred to DBM pa- we are analyzing the effects of point changes at per. Using a radioactively labeled exon fragment, other positions within this region. the RNA was probed to determine whether any sub- Seventeen single-point changes have been con- unit-1 mRNA was present. RNA prepared from structed in a clone of MATa using oligonucleotide- wild-type mitochondria contained the subunit-1 directed mutagenesis. Wild type and each mutant mRNA. However, several nuclear mutants con- substrate were analyzed by an in vitro cutting assay tained no mRNA but instead had some of the using extracts containing the HO endonuclease. The higher-molecular-weight, subunit-1 RNA precur- results indicate that the major determinant of the sors. These mutants may be defective in RNA HO recognition sequence is a 13-bp region that splicing. Other mutants have the subunit-1 mRNA spans the YZ junction (see Fig. 4). MAT DNAs with but no subunit-1 protein. Therefore, it appears that alterations at positions Z1, Z2, Z3, or Z6 are com- there may be several different nuclear genes that pletely resistant to cleavage by the HO endonu- control expression of the subunit-1 gene of cyto- clease. Substrates with base-pair changes at other chrome oxidase. Studies with the nuclear mutants positions within this region are cleaved at slower indicate that regulation by these nuclear genes may rates compared with wild type. By using HO en- occur at the level of mitochondrial splicing or donuclease purified by Kostriken, we hope to iden- translation. Further characterization at the mito- tify which mutations affect binding and which chondrial RNA level is continuing to determine ex- affect catalysis. In addition, we plan to conduct actly how the nuclear gene products are affecting footprinting experiments in order to identify ma- subunit-1 gene expression. jor- and minor-groove interactions. The second phase of these experiments will be to analyze the effects of these mutations on in vivo switching. Each mutant will be integrated into the Point Mutations in MATa That Affect yeast genome and assessed for the ability to serve the Function of the HO Endonuclease M. Zoller, R. Kostriken, K. Johnson

This is a new laboratory that began operation in November, 1983. We are studying the interaction Ya ZI between the HO endonuclease and MAT DNA in TCAGCTTTCCGCAACAGTAAAA the yeast Saccharomyces cerevisiae. Our aim is to AGTCGAAAGGCGTTGTCATTTT understand the role this enzyme plays in the trans- position of mating-type DNA. In addition, we are t interested in the general problem of the means by Figure 4 Sequence of the HO endonuclease cut site at the Y-Z junction which a protein recognizes a specific sequence of of the mating-type cassette (see Fig. 1). The enclosed base pairs DNA. The HO endonuclease is required for effi- represent the extent of the recognition sequence as determined cient transposition of mating-type DNA from an by site-directed mutagenesis. Arrows denote the actual cleav- unexpressed locus to MAT, the expressed locus. age sites, generating a 4-bp 3' overhang.

85 as either a donor or a recipient of a switch. In obtain revertants. Some may be in the cut site and strains that carry the mutations at MAT, we predict others may be in the HO endonuclease gene, thus that the frequency of switching will be correlated encoding an enzyme that recognizes and cuts the with the efficiency of cutting. Furthermore, we altered recognition sequence. The latter mutations predict that the mutations will have no effect on the will shed light on the amino acids that function in ability of the cassette to serve as a switch donor. specific protein/DNA interactions. These experi- Mutants that are unable to switch will be used to ments are currently in progress.

86 PLANTS

Maize Transposable Elements Recently, our efforts have been focused on the S.L. Dellaporta, P. S. Chomet, J.B. Hicks [in molecular characterization of the sh-5586 and sh- collaboration with J. P. Mottinger, University 5584 mutations for several reasons: The sh-5586 of Rhode Island] mutation mapped at a position near the 3' end of the shrunken gene, and in F3 and subsequent popula- Genetic studies in maize have shown that progeny tions, numerous phenotypic reversion events have from plants that are systemically infected with vi- been isolated. The sh-5584 mutant has the most in- rus exhibit genetic instabilities, such as chromo- teresting genetic behavior; it appears to exhibit a somal breakage and high rates of spontaneous mu- dosage effect due to reduced levels of the shrunken- tation, even in the absence of the inciting virus for gene product sucrose synthase Mottinger, pers. many generations postinfection. We have been in- comm.). vestigating the molecular basis for this aberrant ge- We have cloned the sh-5586 allele and its Sh8 netic behavior in spontaneous mutations at the progenitor using standard genomic library con- Shrunken (Shl) locus originally isolated by J. Mot- struction in bacteriophage vectors. Restriction tinger from maize lines exposed to systemic viral mapping data demonstrated that the alleles are infection. In work reported last year, we deter- identical, with the exception of a 3.6-kb insertion mined that several of these mutations resulted from in sh-5586. This insertion maps to the wild-type genomic rearrangements, probably insertions of 0.7-kb HindIII fragment located in the 3' region of transposable elements. Genomic blotting data es- the shrunken gene. This region was sequenced from tablishing the positions of the rearrangements are both ShR and sh-5586, indicating that the sh-5586 shown in Figure 1. element, which we refer to as Tz86, is integrated

sh-5584 sh-5582

B282 B2 82 LIII 34 1. 64 Sh-A 1 2 3 1 2 2 i Xb H3 H3 H3 Xb Xs= 9.5 Kb

sh-5592 sh-5586 11 B2 B2 B2 02 5.2 Sh -B 1. 2.3 T3 32.1 1.71 Xb H3 H3 H3 H3 Xb Xb. 9.4 Kb

82B2 B2 82

3.4 5.8 1 1 sh-t 1 r 1 2.3 1 2.2 1.71 Xb H3 H3 H3 H3 Xb XI, 9.4 Kb Figure 1 Restriction mapping data obtained from genomic blot analysis of the dominant Sh isoal- Ides (Sh" and She and the sh tester allele (sh') used to generate the sh mutants described in this study. Positions of four of the seven sh mutants are indicated by arrows in the appropriate progenitor allele. The Sh transcriptional unit begins close to the position of the sh-5584 insertion ( >3.5 kb) and ends within the 700-bp HindlII fragment of the She allele. The sh-5586 insertion (3.6 kb) is 5' to the end of Sh transcription (see Fig. 2). sh- 5582 represents a 2.1-kb insertion within the Sh" gene.

87 within a Sh exon (Fig. 2). Like mobile elements of mutations. It is thus possible that increased trans- other organisms including maize, the insertion in position activity of endogenous maize elements is a the sh-5586 mutation has caused a duplication of response to the stress of viral infection. Tests of host DNA at the site of insertion. In this case, a 10- this hypothesis will be the subject of work in the bp duplication of the sequence GAGGCTGATG is coming year. present as a direct repeat at the termini of Tz86 and only once in the wild-type gene. However, unlike most transposable elements, this transposon does Cell and Developmental Genetics of not contain simple inverted or direct repeats im- Tobacco mediately adjacent to the insertion site. Instead, a R.L. Malmberg, A.C. Hiatt, J. Mclndoo complex series of perfect and imperfect inverted and direct repeats comprise the terminal regions. We are interested in studying the regulation of the This structural feature has also been identified re- polyamine synthesis pathway in tobacco cells. The cently in the maize controlling elements Ac, Ds (J. polyamines - putrescine, spermidine, and sperm- Messing, pers. comm.), and the Antirrhinum trans- ine - are small molecules with a high positive poson Tam 1 (H. Saedler, unpubl.). Complex stem- charge that play a variety of roles in the cell and in and-loop secondary structures developed from these the whole organism. They have been implicated in regions may be important in controlling element processes as diverse as the cell cycle, hormone re- function. sponse, stress response, nucleic acid structure, and We have also observed that the transposition abil- protein synthesis. Our hope is that, by collecting ity of the sh-5586 element remains active for the mutations altered in their synthesis, we will learn three generations we have studied this mutant. In more about the role of polyamines in the cell and genetic studies of advanced progeny of the sh-5586 plant, in addition to studying the molecular genetic mutant, we have isolated phenotypic revertants regulation of the pathway. A simplified diagram of (ShR) to the wild-type Sh phenotype. Genomic blot the pathway is given in Figure 3. analysis of the ShR DNAs indicated that in one re- One feature of this pathway that makes it suitable vertant the element has excised and in another for biochemical and genetic analyses is the exist- phenotypic revertant a secondary rearrangement ence of specific inhibitors that block the action of has occurred without loss of the element at shrun- the enzymes in the pathway, as shown in Figure 3. ken. When applied to cell cultures of tobacco, these in- Gel-blot analysis of maize genomic DNA has hibitors cause the levels of the polyamines to fall; shown that the Tz86 element represents a repetitive the cells become starved for the polyamines, stop family of heterogeneously related sequences with dividing, and eventually die. This suggests a simple different regions of the insertion represented at dif- strategy for selection of mutants with altered po- ferent levels ranging from about 5 to 50 copies per lyamine synthesis: Start with wild-type tobacco genome. It is important to note that the element is cells, mutagenize, and then select for resistance to not homologous to the genome of barley stripe the inhibitor. These mutants would then be ana- mosaic virus, the virus used to induce the original lyzed to determine the nature of the genetic change.

02 H3 H3 Sh

VAI 4- 4- Sh- 5506 A V/7I r -14 3.0 .1

88 ORNITHINE ARGININE

Figure 3 OrnDC -DEMO ArgDC -DFMA Polyamine synthesis pathway. (OrnDC) Ornithine decarbox- ylase; (SamDC) S-adenosylmethionine decarboxylase; PU RESCINE-w AGMATINE (ArgDC) arginine decarboxylase; (DFMO) difluoromethyl- SamDC -MGBG ornithine; (DFMA) difluoromethylarginine; (MGBG) methylglyoxal bis(guanylhydrazone). OrnDC, ArgDC, and SP RMIDINE SamDC are enzymes in the pathway; DFMO, DFMA, and SamDC -MGBG MGBG are specific inhibitors that block the action of the enzymes indicated. SPERMINE

The power of working with tobacco cell cultures is a direct cause-and-effect relationship has not yet that the mutants can then be regenerated into whole been demonstrated. Genetic teststo determine plants. This allows us to perform conventional ge- causality are currently in progress. netic crosses and also to examine the effects of a Our mutant collection has provided a molecular lesion in polyamine synthesis on the whole plant entry into the pathway. One of our mutants makes and its development. abnormally large amounts of the second enzyme in We have isolated a variety of mutants that are the pathway, S-adenosylmethionine decarboxylase. either deficient in polyamine synthesis or resistant Also, we can induce wild-type cells to make an ex- to the specific inhibitors. When these mutants are cess of the enzyme by treating them with methyl- regenerated back into whole plants, we found the glyoxal bis(guanylhydrazone) (MGBG). Recently, surprising result that many of the mutants had ab- we have shown that in wild-type cells, MGBG normal flowers. All were male sterile, some were causes an increase in abundance of the enzyme by female sterile, and most had altered morphologies, protecting it from degradation, rather than by in- i.e., anthers apparently turned into petals, ovules creasing its rate of synthesis. Our goal for future turned into stamens, sepals turned into petals, and/ research is to use our mutant collection further to or anthers turned into pistils in individual mu- explore the regulation of polyamine synthesis and tants.This suggests that polyamines are important to clarify the effects of polyamines on flower de- in the normal development of the flower; however, velopment.

89

PROKARYOTES

Cloned Genes for the MspI Restriction- is normal. However, attempts to transfer the plas- Modification System mid into the E. coli strains MM294, JM107, or DHI P. -M. Lin, R.J. Roberts lead to extremely low transformation efficiencies. This suggests that the expression of this gene in an The Mspl restriction-modification system recog- inappropriate genetic background can severely dis- nizes the sequence 5'-CCGG-3' and is found in an rupt normal cell metabolism. A similar effect has organism originally characterized as a Moraxella been observed with the BsuRI methylase gene (see species, although there is now reason to believe that A. Kiss, this section) this identification was incorrect. DNA from this organism has been cloned in a random fashion into the plasmid vector pUC9, and a clone has been iso- lated that expresses both the methylase and restric- tion endonuclease activities of the Mspl restriction EcoRII Restriction-Modification system. This clone contains a 15-kb insert. Both Genes and dcm Gene plasmid DNA and host DNA from the clone have A. Bhagwat been shown to be resistant to MspI cleavage in vi- tro, and the endonuclease has been partially puri- N3, a 60-kb natural plasmid of Escherichia coli, fied from cell-free extracts of the clone. codes for the EcoRII restriction-modification en- A series of subclones of the original 15-kb insert zymes. The enzymes recognize the sequence 5'- have been prepared, and one of these, containing a CC(A/T)GG-3; the endonuclease breaks the DNA 1.55-kb insert, still retains methylase activity. This before the first C residue unless the methylase has insert has been sequenced and contains a single methylated the second C residue. The genes that open reading frame that could code for a polypep- code for these enzymes have been cloned from N3 tide of 418 amino acids (M, = 47,664). This is the into the plasmids pBR322 and pACYC184. A 5.8- only large open reading frame present in the se- kb fragment of N3 contains all the information re- quence and must therefore encode the Msp methyl- quired to express these proteins. ase. A series of specific deletions of this clone have Random insertions of the transposon Tn3 into the been prepared. Removal of the aminoterminal se- pACYC clone and a series of deletions constructed quences of the open reading frame destroys the in these plasmids have helped narrow the coding ability of the clone to produce active methylase. region to about 2.8 kb. Of this, no more than 350 One deletion, which removes 14 amino acids from by is likely to contain the noncoding space between the carboxyl terminus of the reading frame, still re- the two genes. A StuI site within this region may tains methylase activity. Immediately upstream of lie within the methylase promoter. Tn3 insertions, the first AUG in this reading frame is a sequence 350 by upstream of this site, do not significantly that closely resembles the Pribnow box found in affect the methylase, but the insertion of an 8-bp Escherichia coli promoters. This is probably the Part linker at the StuI site gives only partial meth- natural promoter, since clones containing the 1.55 - ylase expression. This and other data suggest that kb insert express the methylase gene irrespective of the two genes are transcribed from the central non- its orientation in pACYC184. Another subclone coding region in divergent directions. carries an insert of 3 kb and, like the parent clone, The product of the endonuclease gene does not carries both the methylase and the restriction en- appear to be required for the methylase expression, zyme genes. The latteris currently being se- and vice versa. Tn3 insertions in the putative en- quenced. donuclease gene have the phenotype R-M+. A set One interesting feature of plasmids carrying the of eight clones containing Tn3 insertions spanning Mspl methylase gene is that they show considerable a 1.3-kb region can survive only when a functional variation in their ability to transform different E. EcoRII methylase gene exists on another plasmid coli strains. The original clones were isolated using in the same cell. This suggests that these insertions the host E. coli RR1, in which plasmid propagation lie within the methylase gene and that the continued

91 In vivo restriction-modification by the clone was synthesis of the endonuclease in these cells threat- demonstrated using bacteriophage X. The degree of ens their survival unless a functional methylase is restriction was between 10-s and 10-4. The endo- provided by a complementing plasmid. A further nuclease and the methylase genes were further lo- conclusion from these data is that the functional calized to a 4.3-kb Hpal-SalI fragment, and a de- dcm gene within the chromosome of these cells is tailed restriction map of the DNA region coding for unable to complement the Tn3 insertions in the the BsuRI enzymes was established. The two genes EcoRII methylase gene. The product of dcm has are less than 0.5 kb apart. been reported to have the same specificity as the The attraction of the BsuRI enzymes as a model EcoRII methylase (Schlagman et al., J. Bacteriol. system for the study of sequence-specific DNA- 126: 990 [1976]). This may mean that either (1) the protein interaction is that genes of three other mod- amount or the efficiency of the dcm product in the ification methylases,recognizing the sequence cell is much less than that of the EcoRII methylase GGCC, have also been cloned. These are M.BspRI, or (2) the methylation specificities of the two en- M.SPR, and M.HaeIII. Comparison of the primary zymes are not identical. sequence of these enzymes is likely to give infor- mation about the structural determinants of this type of specific DNA recognition. During these studies we found that the related E. The Bacillus subtilis R Restriction- coli strains, RR1 and HB101, can be transformed Modification System easily with the plasmid carrying the BsuRI genes. A. Kiss In contrast, several other E.coli strains (DHI, GM272, GM161) cannot be transformed, even with The enzymes of the restriction-modification sys- plasmids carrying only the methylase gene. Plas- tem of Bacillus subtilis R recognize the sequence mids coding for other cloned GGCC-specific meth- 5'-GGCC-3'. The endonuclease cleaves between the ylases (M.BspRI, M.SPR, and M.HaeIII) showed a G and C residues to produce blunt-ended frag- similar pattern of transformation. We have shown ments, whereas the modification enzyme meth- that this phenomenon is related to the methylase ylates the internal C residue. I began studies of this function and its cause is being examined. system while at the Biological Research Center of the Hungarian Academy of Sciences, and these studies resulted in the cloning of the BsuRI meth- ylase gene. Escherichia coli clones carrying this Transposase Recognition Sites gene expressed the BsuRI methylase but did not ex- A.I. Bukhari press the BsuRI endonuclease (Kiss and Baldauf, Gene 21: 111 [1983]). The methylase gene was lo- The temperate bacteriophage Mu is a very efficient cated close to one end of the cloned segment, and transposon and yet the sequences at its ends are not one possibility was that the endonuclease gene was the typical inverted repeats of most prokaryotic wholly, or partially, on an adjacent fragment, since transposons. To gain more insight into the function genetic data from T. Trautner's laboratory (Max of these terminal sequences, we have determined Planck Institute) indicated that the two genes were the nucleotide sequences at the left end of bacte- linked. riophages D108 and Mu. The rationale for this ex- The cloned methylase gene was used as a hybrid- periment is that D108 and Mu are essentially iden- ization probe, in Southern experiments, to identify tical viruses, both in sequence and in mechanism of fragments of B. subtilis R DNA that would carry transposition. However, as shown by Toussaint et the methylase gene and would extend into the al. (Mol. Gen. Genet. 190: 70 [1983]), the A-gene neighboring sequences. One such fragment was a product (the transposase) of Mu specifically acts at 9.5-kb SalI-Sphl fragment. This fragment was its own left end and does not recognize the D108 cloned into pBR322, using E. coli RR1 as the host, left end. Similarly, the D108 transposase is specific by in vitro selection for the presence of the meth- to its own left end. This difference in specificity ylase gene. Both the recombinant plasmid and the must reflect a difference in the nucleotide se- chromosomal DNA from the clone were resistant quences at the left ends of Mu and D108 and must to HaeIII digestion (HaeIII is an isoschizomer of signify at least one site that is recognized by the BsuRI), indicating the presence and expression of respective transposases. The left-end 1-kb HindIII the BsuRI methylase gene. Cell-free extracts from fragment of Mu and the left-end 1.5-kb EcoRI frag- the clone were prepared and partially purified by ment of D108 were purified and cloned into M13 Bio-Gel A0.5m chromatography. Fractions were vectors for dideoxy sequencing. The fragments tested for the presence of the BsuRI endonuclease were positioned so that extension of the primer and were found to be positive. Preliminary esti- yielded the sequence of the host segment attached mates suggest that the amounts of endonuclease are to the left end, followed by the specific phage se- comparable with those found in the parent strain. quence. Sequencing of several independent clones

92 has shown the following: (1) The first 53 by in Mu temperature-sensitive Mu repressor, (II) those in and D108 are identical. At that point the 8-bp pair which lacZ expression is loosely regulated in cis by sequence GATCTGAT in Mu isreplaced by the Mu repressor, (III) those in which lacZ expres- TATTTGGC in D108. (2) The sequences between sion is unaffected by temperature but is affected by nucleotides 61 and 200 are substantially the same host-strain mutations, and (IV) those in which lacZ with only scattered base changes. (3) The host se- expression is not influenced by the Mu repressor or quences show some common features. For exam- any host mutations tested so far. ple, a sequence TTTGGCGG is found in several Since the fusions were isolated on an F' episome, host segments. This sequence is also present in we can easily transfer them into strains carrying D108 and overlaps the 8-bp change between Mu and different alleles of host genes that may affect reg- D108. A part of this sequence is present in Mu. (4) ulation, strains carrying different genetically The first five nucleotides of the host sequence pre- marked Mu prophage, or strains carrying various ceding the host-phage junction are generally, but plasmids. Thus far, we have transferred the Mu- not always, GC-rich. lacZ fusion episomes into strains with mutations in These results suggest that the transposase recog- the dam (deoxyadenine methylase) gene and the nizes a sequence at least 53 by from the end of Mu himA gene (encoding the a subunit of the integra- and that it probably makes a large complex that tion host factor protein), into a strain carrying a covers the Mu-host junction during transposition. wild-type Mu prophage, and into a strain carrying a low-copy-number mini-Mu plasmid. The result- ing strains were tested for lacZ activity at high and low temperatures, and the following observations Studies on the Regulation of the were made: (1) lacZ activity from category I fu- sions becomes noninducible by temperature in the Bacteriophage Mu Transposition presence of a wild-type Mu prophage, indicating Functions that the fusions are subject to regulation in trans. T. Patterson, K. Martin, R. Weiss, J. Gould, These fusions are apparently unaffected by himA or A. I. Bukhari dam mutations, but interestingly, some of them lose temperature regulation in the presence of the mini- The regulation of the transposition functions of a Mu plasmid. (2) lacZ activity from category II fu- transposable element is crucial to its persistence, sions becomes noninducible in the presence of a since unchecked transposition would certainly re- wild-type Mu prophage and becomes tightly regu- sult in the death of the host. Since transposition is lated in the presence of the mini-Mu plasmid. This an integral part of the Mu lytic cycle, the mode of suggests that the fusions retain the target sites nec- regulation employed by Mu should share features essary for regulation but do not synthesize suffi- in common with nontransposing bacteriophage as cient or necessary regulatory molecules. These fu- well as with nonviral transposable elements. In- sions appear to become more tightly regulated at deed, what has been learned thus far about Mu reg- low temperature in the presence of a himA mutation ulation is consistent with this notion. and are unaffected by dam mutations. (3) lacZ ac- The current picture of Mu regulation has been tivity from category III fusions is unaffected by the developed from a number of different experimental presence of a wild-type Mu prophage or by the systems, many of which have involved the use of mini-Mu plasmid. However, these fusions become high-copy-number plasmids carrying cloned frag- subject to temperature regulation in the presence of ments of the Mu genome. We feel that the use of a dam mutation and exhibit increased but unregu- these plasmids may have precluded the formulation lated lacZ expression in the presence of a himA mu- of a unified model of Mu regulation, consistent with tation. These studies are being extended by trans- most of the available evidence. For example, the ferring the episomes to strains carrying the host involvement of host functions in Mu regulation mutations, prophage, or mini-Mu plasmids in var- could be swamped out by the increased gene-dos- ious combinations. age effect when using high-copy-number plasmids. In conjunction with the work described above, we We are taking a different, systematic approach to have been approximating the extent of Mu DNA in the study of Mu regulation that involves the use of the fusions by hybridization of DNA from the epi- fusions between the Mu genome and a lacZ gene some-bearing strains to plasmid DNA carrying de- located on a F' prolac episome. Starting with an fined restriction fragments of Mu. We have also insertion of a temperature-inducible Muamp pro- been successful in moving some of the fusions onto phage in the lad region of an episome carrying a multicopy plasmid by in vivo recombination. This fused lacl and lacZ genes, we have isolated 100 in- will allow us to define more precisely the fusion dependent Lac' revertants that carry defective Mu junctions through restriction mapping and/or DNA prophage. We have been able to divide these re- sequence analysis and to test the effects of gene vertants into four categories: (I) those in which lacZ dosage. Correlation of the location of the fusion end expression is tightly regulated in cis by the points with their phenotypic properties will pro-

93 vide valuable insight into the regulatory elements other activity of the synthetic IS5 ends. Plasmid of Mu. pBR328 carries an inverted duplication of a 482-bp As a corollary to the studies employing the fu- segment that lies at the end of the tetracycline re- sions isolated in vivo, we are creating fusions be- sistance gene. We have observed the low-frequency tween Mu and lacZ in vitro on multicopy plasmids recA-independent appearance of a dimeric pBR328 and are developing a method for moving the fu- molecule that has a structure consistent with having sions into a chromosomal or episomal location. Us- been formed by intermolecular recombination ing information gained from our experiments with within the region of the inverted repeats. The plas- the F' Mu-lacZ fusions, we will be able to target mid carrying the synthetic IS5 ends (pSN162) also specific regulatory regions of Mu for detailed study generates this dimeric form. However, the propor- employing techniques of in vitro mutagenesis. tion of pSN162 in the dimeric form after 30 gener- ations of growth is almost tenfold higher than with pBR328. Our preliminary results indicate that this increase in the amount of dimeric pSN162 does not Synthetic Transposons occur in a recA- strain of the closely related spe- T. Patterson, A.I. Bukhari cies, Salmonella typhimurium. Since S. typhimu- rium does not carry IS5 in its chromosome, this The basic requirements for the movement of bac- suggests that the increase in dimer formation in E. terial transposable elements are the ends of the coli is due to an IS5-encoded function acting on the elements, element-encoded transposition proteins synthetic ends present in pSN162. Experiments to that recognize the ends and catalyze transposition, test this hypothesis are in progress. and various functions provided by the host. With The construction of a plasmid analogous to pSN- the goal of performing a detailed study of the role 162, which will consist of the chemically synthe- of the terminal sequences in the transposition pro- sized right- and left-end sequences of bacterio- cess, we are constructing synthetic transposons in phage Mu cloned into pUC9, is almost complete. A collaboration with S. Narang's group at the Na- kanamycin resistance determinant will be inserted tional Research Council, Canada. The synthetic between the ends, and the transposition of the re- transposons consist of chemically synthesized right- sulting mini-Mu will be tested. An advantage of the and left-end terminal sequences of a naturally oc- Mu system is that the production of Mu-specific curring transposable element cloned into a plas- transposition proteins can be triggered at will using mid. The ends are synthesized with a restriction en- a temperature-inducible prophage and that these zyme recognition site in between to allow the in functions will act efficiently in trans. Once trans- vitro insertion of a selectable marker, such as a drug position of the synthetic transposons is successful, resistance determinant. The presence of a selecta- we will perform site-specific mutagenesis on the ble marker will allow us to monitor transposition ends to determine which nucleotides are important of the synthetic transposon. Our initial efforts have in the transposition process. been with the ends of two elements, the insertion element IS5 and bacteriophage Mu. The 16-bp inverted terminal repeats of IS5 (with 1 by difference) have been synthesized with a BglII Visualization of the Mu Lytic Cycle restriction site in between. This oligonucleotide was A.I. Bukhari, K. Martin inserted into the EcoRI site of pBR328, and the re- sulting plasmid was designated pSN162. We in- The structureof thebacterial chromosome serted a 1-kb kanamycin resistance determinant into throughout the lytic cycle of bacteriophage Mu is the BglII restriction site in pSN162 but have been being studied using a technique that allows the rapid unable to detect transposition of kanamycin resis- isolation of genetically active nucleic acid-protein tance mediated by the synthetic IS5 ends. Since we complexes for analysis in the electron microscope. are relying on IS5-specific transposition proteins During the time required for one doubling of the synthesized from the 10-12 copies of IS5 present in Escherichia coli chromosome, the phage is able to the E. coli chromosome to act efficiently in trans, increase from 1 copy to 100 copies. The replication it may be necessary to insert IS5 (without its ends) of Mu is accompanied by its transposition within into the plasmid carrying the synthetic transposon the chromosome. Analyses of structures associated to provide the transposition proteins in cis. Alter- with the chromosome's replication forks are being natively, it may be necessary to increase the length carried out in an attempt to observe directly the of the synthetic sequences to include regions lo- process of Mu DNA transposition. Preliminary ex- cated outside the inverted repeats that may be re- periments show that when cells are opened and pre- quired for transposition. Both of these approaches pared for microscopy immediately prior to lysis, are being tried. viral particles are observed extruding from the cell. Although we have been unable to detect transpo- At this time point, the bulk of the chromosomal sition of the IS5 transposon, we have observed an- DNA appears to be degraded, but there are many

94 visible polysomes. The DNA that is observed ap- how abnormal translocation (2- or 4-base mRNA pears to be significantly more supercoiled than the movement) should occur. The prediction is very DNA from cells harvested less than 15 minutes after precise (Weiss, Proc. Natl. Acad. Sci. [1984, in induction of the Mu lytic cycle. The significance, press]). When all observations concerning abnor- if any, of this finding awaits further analysis. A mal translocation, from frameshifting by normal more surprising preliminary finding is the presence tRNA to frameshift suppressor tRNAs, are exam- of significant numbers of circular molecules in cells ined under this prediction, a unified explanation of harvested approximately 10 minutes prior to the the mechanics of normal and abnormal transloca- time at which mature viruses are observed. These tion emerges. This new view of the ratchet model molecules are heterogeneous in size (range, 4-50 provides specific testable predictions concerning kb), and one putative circle displays a polysome the mechanism, and these are now under investi- gradient, suggesting the presence of an active tran- gation. scription unit. One hypothesis is that these mole- cules arise as a result of the removal of Mu DNA from the bacterial genome during phage matura- Homology-dependent Repair of Double- tion. The circles would then be the result of a re- strand Breaks and Chromosomal circularization of the bacterial DNA present be- tween two copies of the Mu DNA within the Transformation in Exonuclease-deficient chromosome. This hypothesis is being tested by Escherichia coli Strains spreading cultures at earlier time points after the A.I. Bukhari, R. Weiss induction of Mu to determine whether larger cir- cles that still contain Mu are observable prior to the Recent evidence from Saccharomyces cerevisiae appearance of the small, circular DNA molecules. suggests that double-strand DNA breaks are re- Electron microscopic analysis of the structure of combinogenic. The free duplex end is thought to the chromosomal DNA-protein complex during the invade a homologous segment, thus establishing a proliferation of Mu DNA should contribute to a Holliday junction. The repair of double-strand better understanding of the mechanism of transpo- breaks and gaps within regions of homology can be sition and the action of the bacteriophage Mu pro- easily demonstrated by the rescue of linearized teins in the cell. plasmid DNA during transformation. Such experi- ments have not been attempted in Escherichia coli because of high levels of exonuclease activity in wild-type strains. Use of recB- recC- sbcB- strains Shifty Ratchets: Molecular Mechanics as recipients overcomes the exonuclease problem of Protein Synthesis Revisited by removing two major nucleases (ExoI and ExoV) R. Weiss but leaving the cell "recombination *." The recB recC sbcB strain is known to be competent for high- The physical mechanism of ribosome translocation level chromosomal transformation. has remained shrouded in mystery, inaccessible to Initial experiments with plasmids linearized or experimental tests. Fourteen years ago, a potential gapped by restriction endonucleases and trans- solution to the problem of a plausible physical basis formed into recB recC sbcB strains have revealed for the mechanics of translocation was proposed by frequencies of high-level, homology-dependent C.R. Woese (University of Illinois). His model re- rescue of linear plasmid DNA comparable to the placed the notion of phantom movements of the frequency of double-strand break repair in S. cere- peptidyl-tRNA across the ribosome's surface with visiae; i.e., the double-strand break reduces the a simple, precise, and defined conformational flip transformation frequency by only 3-5-fold in a recB of the codon:anticodon helix. This conformational recC sbcB strain versus 1000-fold in wild-type E. flip, termed ratcheting, serves to move the mRNA coli. The majority of transformants, however, suf- by precise triplet intervals and provides a mecha- fer deletions encompassing the site of the break or nism for the strict maintenance of reading frame. gap. This is in sharp contrast to the high fidelity of One of the more important aspects of the ratchet double-strand break and gap repair in yeast. The model is the implication for the evolution of ribo- implication is that E. coli is unable to prime the somes and genetic code, which has been pursued in repair DNA synthesis needed to establish the pos- detail by F.H.C. Crick (Salk Institute), S. Brenner tulated double-Holliday-junction intermediate nec- (MRC, England), A. Klug (MRC, England), and G. essary to repair a gapped plasmid. Since resolution Piecznik (Origins Life 7: 389 [1976]). However, of the postulated double Holliday junction should Woese's model has not gained general acceptance, yield an equal ratio of integrated repaired plasmid and most investigators still labor under an insuffi- versus extrachromosomal repaired plasmid, the cient paradigm: the A-site-P-site model. ability to detect integration events is important. The Recently, I discovered a hidden prediction in recB recC sbcB strains are unable to maintain Woese's original proposal; the prediction involves ColE 1-derived replicons in a stable form, and this

95 may prove usetul for detecting integration of cut mation on the DNA and protein sequences respon- circular molecules. The homology requirement for sible for Mu transposition. The amber mutant se- mutagenic repair of cut plasmid can be dissected by quence will allow us to identify unambiguously the introduction of various rec- alleles (such as recA coding sequence of the A gene. and recF) into the recB recC sbcB strain. Involve- ment of heteroduplex regions of DNA, indicative of Holliday junction formation, can be probed by scoring chromosomal markers flanking the area of Photosynthetic Reaction Center and the double-strand break. Light-harvesting Genes The recB recC sbcB strain also provides a unique D. Youvan, S. Ismail tool for disrupting E. coli chromosomal genes by direct chromosomal transformation with cloned Purple nonsulfur bacteria such as Rhodopseudo- segments altered in vitro. The coding sequences of monas capsulata have a very diverse metabolism the cloned release factor genes (Weiss et al., J. that includes the ability to grow photosynthetically Bacteriol. [1984, in press]) are being disrupted with under anoxygenic conditions. At least seven poly- antibiotic resistance genes, and these markers will peptides (three reaction-center and four light-har- be used to select for disruption of the chromosomal vesting polypeptides) are induced, along with the genes during transformation. A genetic analysis can biosynthetic enzymes for carotenoid and bacte- then be applied to the unique codon-recognition riochlorophyll biosynthesis during the differentia- properties of the release factors. This should illu- tion of the respiratory membrane into the invagin- minate the mysterious "tRNA-like" properties of ated photosynthetic membrane. These polypeptides these protein molecules. are necessary for the proper binding of the carot- enoid and bacteriochlorophyll pigments, quinones, and other cofactors that absorb light, mediate pri- mary charge separation, and generate reductant. An Nucleotide Sequences Encoding Mu adjacent oxidoreductase complex utilizes reduced Transposition Proteins quinones to generate a transmembrane proton gra- A.I. Bukhari, P. Koka dient. Many of the bacterial photosynthetic pro- cesses are analogous or identical to processes that The transposition of bacteriophage Mu into the host occur in the thylakoid membranes of higher plant genome occurs by replication. The product of the chloroplasts. Because it is easier to study and ma- A gene, transposase, is essential for transposition. nipulate photosynthetic bacteria, we have chosen R. The function encoded by the B gene, which also capsulata as a model organism for the study of the affects transposition by enhancing the transposition photosynthetic membrane. frequency, is implicated in the replication. Thus, Several genetic techniques have been employed both the A- and B-gene products play a role in Mu in the past 10 years in the characterization of pho- transposition. However, the relative amounts of the tosynthetic mutants and in the localization of the 70,000-dalton protein of the A gene and the 33,000- genes involved in the differentiation of the photo- dalton protein of the B gene present in the cells vary synthetic apparatus.Initially,the gene-transfer substantially, with the B-gene protein much in ex- agent (GTA) was isolated from R. capsulata and cess over the A-gene protein. This differential was used to show that mutations in carotenoid and expression of these genes could be due to the nature bacteriochlorophyll biosynthesis were linked. Co- and presence of the DNA sequences that control the transduction of these markers was used to generate expression of the A and B genes. One line of inves- a genetic map, and mutations were correlated with tigation to establish the reasons for this varying intermediates in bacteriochlorophyll and carot- content of A- and B- gene proteins is to determine enoid biosynthesis. Later, these genes were mobi- the DNA sequence of the A and B genes and the lized for conjugation using a broad host-range con- sequences preceding these genes. Knowledge of the jugative plasmid. R-prime plasmids were obtained DNA sequence will also provide information on the carrying the photosynthetic gene cluster. The 46-kb nature of the proteins. Both orientations of the left- photosynthetic gene insert on the R-prime plasmid end BalI -HpaI fragment of Mu DNA consisting of pRPS404 was shown to complement all known mu- 3.6 kb have been cloned into the SmaI site of tations in carotenoid and bacteriochlorophyll bio- M13mp8. This fragment consists of the A gene car- synthesis. rying an amber mutation and the majority of the B The complete nucleotide sequence (8867 bp) and gene. The remaining portion (74 bp) of the B-gene the predicted polypeptide sequence have now been sequence and the sequence preceding the A gene determined for 11 proteins from the photosynthetic and of its first 260 by are available. Using in-vitro- gene cluster of R. capsulata (46 kb), including the synthesized primers (M. Zoller, Yeast Section), the photosynthetic reaction center (RC) L, M, and H 3.6-kb fragment is being sequenced from both the subunits and the light-harvesting I (LHI)and a Ball and the HpaI sites. This will provide infor- polypeptides. Hydropathy plots indicate that the L

96 and M subunits are transmembrane proteins that duces a cold labile enzyme that is less sensitive to .bisphosphate־may cross the membrane five times with highly hy- its inhibitor, fructose-1,6 drophobic stretches of amino acids. The H subunit The wild-type gene and its mutant derivatives -control re ׳has only one hydrophobic section near the amino have been cloned and sequenced. The 5 terminus that may be transmembrane. The L and M gion has been defined by construction of operon subunits are homologous over their entire length fusions between the 5-proximal part of pfkB and and have a high degree of homology with the 32- the coding part of the galactokinase genes, and by kD quinone-binding (Q/3) protein from photosys- in vitro transcription. Comparison of the overpro- tern II of higher plants (Youvan et al., Cell [1984, ducing mutant with the wild-type gene revealed that in press]). overproduction is mediated by increased transcrip- We have recently identified the light-harvesting tion due to a C —T single-base-pair change in the II (LHII; infrared maxima: B800 -I- 850 com- —10 region of the pfkB promoter. The nature of the plex) genes from R. capsulata by probing a X li- second mutation affecting the structure of the en- brary of chromosomal EcoRl fragments with oli- zyme has yet to be defined at the nucleotide se- gonucleotide probes. Two oligonucleotide probes quence level. with a degeneracy of 32 were synthesized based on The 5-proximal region controlling the expres- the amino acid sequence of the j8 and a subunits of sion of the pfkB gene is complex. In addition to the LHII. Both probes hybridize specifically to a 6-kb in vitro functional promoter, proximal to the cod- EcoRl restriction fragment in genomic Southern ing part of the gene, there is another potential pro- hybridizations (hybridization to total bacterial DNA moter, about 100 bp upstream of the first one. An digested with EcoRl). Several X phages that carry operatorlike sequence and a p-dependent termina- kb EcoRl fragment were identified by filter torlike hairpin structure are both located within this־the 6 hybridization to a library of R. capsulata chromo- second promoter region. Furthermore, adjacent to somal EcoRl fragments (courtesy of R Scolnick, the —35 region of the first promoter, a CRP-bind- Cold Spring Harbor Laboratory). The 6-kb EcoRl ing consensus sequence is present. The functions, fragment has been recloned in pBR322, and both if any, of these features are not yet known. We have probes hybridize to an internal 1250-bp Smal frag- shown that a fragment carrying this CRP sequence ment. This indicates that the structural genes for /3 is able to bind in vitro, although weakly, the CRP and a are adjacent. Southern hybridization of the 0 protein in the presence of cAMP. However, since and ol probes to the 46-kb photosynthetic gene clus- the pjkB gene is thought to be expressed constitu- ter carried by pRPS404 indicates that the LHII genes tively, the meaning of this interaction is not clear. are outside of this cluster. The structural genes for To analyze the role of these features, we took ad- and the upstream regulatory elements (light- vantage of the galactose-sensitive phenotype of pfkB ,׳0 ,8! intensity-modulated) will be sequenced. up promoter-galK fusions. galK strains carrying When the sequencing of LHII is completed, R. such fusions on multicopy plasmids are inhibited capsulata will be the only organism in which all of by galactose, presumably due to the accumulation the structural genes involved in the primary light of galactose-l-phosphate. Several mutants resis- reactions of photosynthesis have been mapped and tant to galactose and still presenting a functional sequenced. DNA mutagenized in Escherichia coli galactokinase were selected. By retransformation by transposons, or in the future by oligonucleo- back into the galK strain, it was found that most tides, may be returned to R. capsulata using ge- of the mutations were localized on the plasmids. netic techniques specifically developed for this or- Analysis of the total cell proteins by SDS-PAGE ganism. Structure-function problems involving indicated the presence of two major classes of mu- specific residues in the RC and LH polypeptides tants. In the first class, the galactokinase protein is and their role in the light reactions of photosyn- present at a much lower amount than the parent, thesis may be first addressed in R. capsulata. and in the second class, it is barely detectable. Since, in the fusion strains, galactokinase produc- tion is under pfkB control, apparently these muta- tions affect the pfkB promoter. Their molecular na- Control Region of Escherichia coli ture is now being determined by DNA sequence ׳5 pfkB Gene analysis. It is hoped that some of these mutations F. Daldal, J. Applebaum will help us to understand the functions of the fea- .control region of the pfkB gene ׳tures found in the 5 The pfkB gene encodes the Escherichia coli minor phosphofructokinase Pfk-2. In the past, two inter- esting mutants affecting this gene have been iso- Clostridium pasteurianum Galactokinase lated. One of them has a mutation that increases the F. Daldal, J. Applebaum expression of the wild-type gene about 20- to 40- fold. The other one, apparently a double mutant, In the past, no gene from a bacterium like Clostri- not only has increased Pfk-2 activity, but also pro­ dium pasteurianum, which has a very high A + T

97 content (72%), has been isolated. To study the pasteurianum galK gene, even when expressed at a structure of such a gene, and also to use it as a low level, are not yet understood. marker in genetic studies, we cloned the galK gene of C. pasteurianum by complementation of an Escherichia coli galactokinase-defective mutant. Initial screening of a C. pasteurianum chromo- Isolation of Mutants from Clostridium somal library in an E. coli galK mutant revealed no pasteurianum plasmid conferring complementation. However, F. Daldal, J. Applebaum after longer incubation, several galactose-utilizing papillae were defected. A recombinant plasmid iso- The genetics of strict anaerobes belonging to the lated from one of them provided a galactokinase genus of Clostridiae is not well studied. We have activity detectable by enzyme assay. The amount of chosen Clostridium pasteurianum as a prototype for the activity is lower than would be expected from a such studies because it is a true prototroph, it has gene carried by a multicopy plasmid. Restriction no reported pathogenicity, and it has been the an- analysis, subcloning, and Tn5 mutagenesis indi- aerobic microorganism of choice for several bio- cated that the galK gene is located on a 2-kb EcoRl- chemical studies. BamHl fragment. Use of “maxicells” and in vitro To explore possible genetic exchange between transcription-translation-coupled E. coli extracts cells, we first isolated and characterized a collec- showed that this plasmid encodes a protein with a tion of spontaneous or mutagen-induced mutants of relative molecular weight of approximately 40,000. C. pasteurianum ATCC 6013 either by direct selec- Strong hybridization detected by Southern analysis tion or by screening after enrichment. To date, between this gene and C. pasteurianum, but not E. about 25 independent mutants, including several coli, chromosomal DNA indicated that the galK auxotrophs, several antibiotic and UV resistants, gene originated from C. pasteurianum. It seems and several others defective in sporulation, have that even though the subunit molecular weights of been obtained. A procedure for the formation of both gene products are similar, there is little ho- osmotically sensitive cells, “protoplasts,” by lyso- mology at the DNA level. zyme treatment and for the regeneration of such In the absence of selection, this Gal+ phenotype cells on protective media has also been developed. is unstable in E. coli. Even when the maintenance However, we have not yet been able to detect pro- of plasmid is forced by the use of antibiotic selec- totrophs by fusing the auxotrophic mutant proto- Analy- plasts with polyethylene glycol. It is hoped that . ־tion, about 0.1% of the cells are still Gal sis of these derivatives showed that about 25% of emerging techniques, such as Zimmerman dielec- them had insertions. In two distinct cases, we have trie field fusion, will be useful in the future to over- detected the presence of IS 7 and IS5 within the come such difficulties. gene. Therefore, it appears that in E. coli, the C. pasteurianum galK gene presents a hot spot for IS insertions. Using this gene as a probe, by colony hybridization, the original clone from the starting Molybdenum Metabolism in Clostridium library has also been isolated and was found to be pasteurianum unable to grow on galactose. However, analysis of S. Hinton the total cell proteins by SDS-PAGE revealed that galactokinase was overproduced in this clone. Thus, For several years I have been studying molybdenum as is also the case for the E. coli enzyme, overprod- (Mo) metabolism in Clostridium pasteurianum, a uction of the C. pasteurianum galactokinase is del- nitrogen-fixing anaerobe. To date, it is not known eterious to E. coli in the presence of galactose. how the nutrient, molybdate, is biologically pro- Papillae growing upon longer incubation are pre- cessed or chemically transformed into a biological sumably mutants expressing the kinase at a lower, catalyst (molybdenum cofactors). My efforts have but tolerable, amount. been directed toward identifying and characterizing Comparison of these plasmids, producing low or molybdoproteins that may play a role in the synthe- high levels of galactokinase, indicated that the low- sis of the Mo-containing cofactors. level producer carries a deletion of approximately An anaerobic native gel-electrophoresis proce- -region of the gene. This dure was developed to identify all (oxygen-sensi ׳bp located in the 5 300 region is now being characterized by DNA se- tive) molybdoproteins in clostridial crude extracts. quencing. Assuming that in E. coli, the C. pasteu- Six distinct molybdoproteins were identified by an- rianum galactokinase is expressed from its authen- aerobic electrophoresis, and four of the molybdo- tic control region, comparison of these sequences proteins have characteristics that suggest they might will define the molecular structures governing the play a role in the synthesis of the Mo-containing expression of a clostridial gene. However, the rea- cofactor(s). One of the molybdoproteins identified sons for the instability in E. coli of the active C. as a “suspected” intermediate in the synthesis of the

98 Mo cofactor was purified and biochemically char- tive under ambient conditions and therefore under- acterized. The purified molybdoprotein, Mop, has standing the mechanism of its reduction is of some an unusually low molecular weight (6000), and interest. The reaction is carried out by two pro- UV, visible, and fluorescence spectroscopy suggest teins, collectively called nitrogenase - an oe2(32 mo- that a pterin derivative is associated with it. J. John- lybdenum-iron-sulfur protein (MoFe protein; coded son (University of North Carolina) has proposed a for by the nifD and nifK genes in Klebsiella pneu- model that all molybdoenzymes (except the MoFe moniae; nif, nitrogen fixation) of 250,000 daltons protein of nitrogenase) have a common Mo cofac- that appears to contain the active site for dinitrogen tor (Mo-co) in which the Mo atom is bound to a reduction and an a2 iron-sulfur protein (Fe protein; pterin derivative via sulfur ligands. X-ray absorb- niffl-gene product) that acts as the unique reductant ance spectroscopy (XAS) has shown that all mo- of the MoFe protein. My aim is to use in vitro mu- lybdoproteins studied to date have at least one mo- tagenesis to understand the structure and mecha- lybdenum-sulfur ligand. In collaboration with S. nism of nitrogenase. To this end I have started clon- Cramer (Exxon Research Co.), the structure of the ing the Fe and MoFe protein genes from Clos- Mo environment in Mop was determined by XAS. tridium pasteurianum. This organism is being used The mononuclear Mo site in Mop is unusual in that because an X-ray crystal structure is being deter- it has three terminal oxo groups and three oxygen mined for its MoFe protein. or nitrogen ligands (no sulfur ligands). Recently, Prior to my arrival, various genomic libraries of formate dehydrogenase found in C. pasteurianum C. pasteurianum DNA were constructed in the has been shown to have a Mo site identical to Mop. expression vectors, pUC8 and pUC9, by F. Daldal Evidence suggests that Mop binds a precursor of and S. Hinton (this section). Two MoFe protein the Mo-co that eventually is inserted into formate clones were identified by immunoscreening. The dehydrogenase, the end product of the Mo process- smaller clone (MF4), containing an insert of550 ing pathway. From biochemical analysis, it is ap- bp, was shown by Southern hybridization to be parent that Mop might be useful in studying the completely represented within the larger clone structure of the Mo-co and how the Mo-co is bound (MF21), which contained a 2700-bp Pstl-BamHI to the molybdoproteins. fragment. Western blot analysis showed that MF21 There is a parallel effort using recombinant DNA directed synthesis of a - 60,000-dalton polypep- technology to complement the biochemical studies tide corresponding in molecular weight to the nifK- of Mop. In collaboration with G. Freyer and M. So gene product and a - 35,000-dalton polypeptide, (Tumor Virus Section), a genomic library of C. probably a fragment of the nifD-gene product. pasteurianum was constructed in a pBR322 vector, DNA sequence analysis of MF4 showed it to match and an expression clone of the mop gene was iden- a portion of the nifD polypeptide sequence recently tified using immunoscreening. The coding region published. Knowing the position of MF4 within the of the mop gene was identified by aligning the se- larger clone, MF21 can be shown to contain the quence of the first 26 amino acids of the amino ter- carboxyterminal portion (330 amino acids out minus with the DNA sequence. The DNA sequence of 529) of the nifD-gene product immediately fol- predicts that the protein is hydrophobic and is en- lowed by the entire nifK gene. This gene order, riched with lysine and glutamic acid residues that nifDK, is the same as is seen in K. pneumoniae. are potential ligands to the Mo atom. The DNA se- quence upstream of the mop gene shows comple- mentarity to Escherichia coli promoter sequences, which may explain why Mop is expressed in E. coli. The Pae Restriction-Modification Since Clostridium as yet has no gene-transfer sys- System tem, further characterization of the cloned gene will T.R. Gingeras, J.E. Brooks, D. O'Loane have to be performed in E. coli. If mop is func- tional (binds Mo-co) in E. coli, site-directed muta- Restriction and modification systems are present in genesis will be used to attempt to determine the Mo- many bacteria as a means of preventing foreign co binding site. DNA from entering the host cell. Such systems consist of a restriction endonuclease that recog- nizes and cleaves a specific short nucleotide se- quence and a DNA methylase that modifies the Isolation of Nitrogenase Genes from same recognition sequence, thus protecting the host Clostridium pasteurianum from self-destruction. D.J. Lundell Because the activity of the endonuclease pro- duces a double-strand break in the chromosomal Certain prokaryotic organisms can satisfy their ni- DNA, expression of this gene without the protec- trogen requirement by reduction ofatmospheric tion of the companion methylase gene has been dinitrogen to ammonia. Dinitrogen is quite unreac- considered to be lethal. Consequently, expression of both of these genes is thought to be highly con- putative Pribnow box region of the operon resulted trolled and coordinated. Such regulation would be in a reduction in the levels of phage restriction. needed most in those instances where restriction- The most striking feature first noted about this modification systems are located on mobilizable Pae system was the ability to construct subclones plasmids. that express only the endonuclease gene. Such The PaeR7 restriction-modification system from clones were viable but incapable of restricting in- an R-type plasmid (pMG7) found in Pseudomonas fecting phage. How such a phenotype was possible aeruginosa has been cloned and sequenced in col- was somewhat puzzling. However, measurement of laboration with G. Theirault (Lavelle University, the levels of expression by these unusual clones in- Quebec) over the course of the last year. The orga- dicated that they, like the deletion mutants involv- nization of the two genes in this system is in the ing the control region, made 100-fold less endonu- form of an operon with the methylase gene preced- clease than the clones carrying the intact system. ing the endonuclease gene on the same strand of This was due to the deletion of most of the 5' end DNA. This operon covers approximately 2300 nu- of this system and, presumably, the activation of a cleotides and is regulated by a control region whose secondary promoter. A lower level of endonuclease sequence has been determined. Deletions of vary- appears tolerable in vivo when no methylase is ing segments of this control region by BAL-31 nu- present. Since dimers are the active form of the en- clease give rise to a collection of clones that dis- donuclease, it may be that at such low levels of en- playsa spectrum of restriction-modification donuclease expression, formation of dimers is re- phenotypes. The DNA sequence of these clones in- tarded. dicated deletions concentrated within an 80-bp re- Deletion mutants involving both the regulatory gion at the 5' end of the operon. Such deletions af- and structural segments of this operon produced re- fect the expression of both genes. Analysis of the striction phenotypes. Thus, it appears that the lev- DNA sequence of this region showed a sequence els of endonuclease within bacteria are important used as a Pribnow box by the araC gene of Esche- in order for the restriction phenotype to be ob- richia coli. Deletions within and proximal to this served.

100 NEUROBIOLOGY

Our strategy for probing the molecular basis of tifying synaptic connectivities in leech CNS. Inter- neuronal connectivity is to isolate monoclonal anti- estingly, antibodies in this category were generated bodies (mAbs) that stain single types of neurons or not only against leech CNS, but also against the sets of different neurons. Now, after 4 years, we Drosophila CNS by S. Benzer's laboratory (Cali- have reached a vantage point from which we can fornia Institute of Technology, Pasadena). Both begin to formulate categories for the various pat- leech and Drosophila monoclonal antibodies stain terns stained by our monoclonal antibodies. We different intersecting sets of neurons and thereby recognize three broad categories of staining pat- reveal an assortment of combinatorial markers. For terns that are informative with respect to the molec- example, a class of primary mechanosensory neu- ular heterogeneity of the leech nervous system, one rons, the pressure-sensitive P cells, are stained by of them already pointing promisingly to combina- four different monoclonal antibodies as part of dif- torial markers that may specify neuronal connec- ferent-sized neuronal sets. Thus, the four mono- tivity. clonal antibodies point to four different combina- The first category of antibodies that we are gen- torial markers in these identified neurons. Another erating binds to 130K glycoproteins on Western example is the a cell for which one leech and three blots. In CNS tissue, some of these antibodies are Drosophila monoclonal antibodies have also dis- specific probes for select cell bodies and axons that covered four combinatorial markers (Fig. 1). run in tight bundles; other antibodies bind to 130K antigens that are shared by select axons and glial cells. Possibly, these 130K surface antigens are nCam-like molecules subserving specific adhesion between axons or between axons and glial cells, with implications for such phenomena as axonal guidance. The second type of monoclonal antibody that we are generating gives staining patterns similar to those created by polyclonal antisera against pep- tides. These antibodies stain neuronal processes with varicosities that resemble typical leech nerve terminals. Usually, these antibodies only stain a few neurons per ganglion, or sometimes even only a few neurons found in specialized ganglia. None of these monoclonal antibodies react with proteins on West- ern blots, but they might very well be directed against low-molecular-weight peptides. The third category consists of those antibodies that are currently the most promising in terms of pointing to molecular markers important for iden-

Figure 1 Drosophila monoclonal antibody 2G4B specificallystains the a cell (arrowheads) and is one of our four a-cell-specific markers. 1 00,u,

101 The Macroglial Cells of the Leech Are Acad. Sci. 79: 7929 [19821), identify an assortment Molecularly Heterogeneous of combinatorial markers. For sensory neurons (the M. S. Flaster, B. Zipser pressure cells), three different markers have been identified using three leech monoclonal antibodies. Using monoclonal antibodies obtained from either For a ventral medial pair of neurons, one leech and whole nerve cords or CNS extract run on polyacry- two Drosophila monoclonal antibodies have also lamide gels of the leech Haemopis marmorata, we identified three markers. Neurons are hypothesized have cataloged the distribution of several mono- to use an assortment of combinatorial factors to clonal antibodies directed against the macroglia of form precise synaptic connections. These hy- the nerve cord and have partially characterized potheses predict the type of overlapping chemically some of these glial antigens biochemically. The labeled sets our monoclonal antibodies have dis- identifiable macroglia of the leech, those in the lat- covered. eral connectives, the ganglionic neuropil, the gan- glionic packets, and the ganglionic roots, are dis- tinguishable anatomically by position. Here, we report several monoclonal antibodies that promi- Analysis of a Neuron-specific nently stain some, but not all, macroglia, differen- Leech Antigen tiating these cells at the molecular level. One mono- B. Zipser, T. Flanagan, M. Flaster, C. Schley clonal antibody stains the processes of the macro- [in collaboration with E. Macagno and glial cells of the lateral connectives, the ganglionic neuropil, and the ganglionic roots but does not stain R. Stewart, Columbia University] the packet glia appreciably. Immunoblots of SDS Is there a common denominator to leech neurons gels indicate that this monoclonal antibody binds a carrying the Laz2-1 antigen? In the CNS, the mono- single protein antigen with an apparent molecular clonal antibody labels about 40-odd neurons, or 20 weight of 130,000. The antigen is a glycoprotein. A second monoclonal antibody strongly stains bilateral pairs of different neurons. Five of these neurons have been identified through intracellular throughout the interior of the connective and root macroglia but does not appear to stain the other dye injections and all were observed to project their primary axons into roots, enabling them to inner- macroglial cells, whereas a third monoclonal anti- vate the periphery as sensory or motor neurons. body stains throughout the interior of only the con- Among these neurons are both pairs of the exten- nective macroglial cells. This monoclonal antibody sively studied primary mechanosensory neurons re- binds a single protein antigen with an apparent mo- sponding to pressure. The function of the other lecular weight of 77,000, and this antigen is not a three cells has not yet been determined. Of partic- glycoprotein, as judged from multiple lectin col- ular interest is the one pair next to the Retzius cells umn chromatography. The underlying significance that is the most likely candidate to be the first neu- of the differences in these identified glia to the de- ron expressing the Laz2-1 antigen during CNS de- velopment or adult function of the leech nervous velopment. The expression of the Laz2-1 antigen system remains to be thoroughly explored, al- has been extensively characterized both embryoni- though in developmental studies, the time of ap- cally and postembryonically and is seen to appear pearance of one of these monoclonal antibodies has in a precise spatial and temporal pattern both within already been established. the CNS and in the periphery. In the periphery, Laz2-1 stains putative sensory neurons in each annulus of the body wall. It also stains neurons within the esophagus and cells that Combinatorial Leech Antigens appear to be part of the testicular primordia. A pos- B. Zipser, C. Schley, T. Flanagan, J. Perez sible mechano- or chemosensory function of the peripheral neurons remains to be explored. In our A panel of monoclonal antibodies generated against attempt to find a common functional denominator either leech or Drosophila CNS divide the leech for Laz2 -l- labeled neurons, we are very interested ganglion into different sets of antigenetically ho- in identifying the functions of the other Laz2-1- mologous neurons. Some of the smaller sets are en- stained CNS neurons to determine whether they, tirely contained within larger sets; other sets over- like the pressure cells, are associated with first- or lap only partially. An electrophysiological analysis higher-order sensory function. of the set of Laz2-1-stained neurons has identified Our other interest in the Laz2-1 pattern relates to sensory and motor neurons and interneurons, which the temporal pattern of antigen expression in the are already shown to be in synaptic contact. Laz2- CNS. Measured immunocytochemically, some of 1, together with leech mAbs Lan3-5, and Droso- the Laz2 -l- labeled neurons only express their anti- phila mAbs, 3A4 and 8G1 (Fujita et al., Proc. Natl. gen postembryonically. This offers the opportunity

102 to analyze a given neuron before and after antigen tigen will be ascertained. Finally, the antibody will expression has begun. Since some of the neurons be applied to live ganglia while recording from the within the staining patterns are known to be syn- P cells and their postsynaptic targets. aptically connected, the possibility arises that neu- rons accumulate the Laz2-1 antigen as they become sequentially inserted in a functional network.

Varicosity Patterns and Rare Neuron Types in the Leech Central A Monoclonal Antibody Specific to the Leech Pressure-sensitive Nervous System T. Flanagan, B. Zipser Mechanosensory Neurons C. Schley, B. Zipser [in collaboration with C. Our studies indicate that the neuropile of leech gan- Loer and W. Kristan, University of glia is compartmentalized with reference to the California, San Diego] distributions of several types of immunoreactive varicosities. The leech neuropile is also compart- Two pairs of pressure-sensitive mechanosensory mentalized with reference to the characteristic dis- neurons (P cells) are found in the standard midbody tribution of neurites from identified cell types. We ganglion of the glossophoniid leech, Haementeria. suspect that such compartments may correspond to We have produced a monoclonal antibody specific regions restricted to specific types of cellular com- to the somata and neurites of these cells and to a munication. We report here the results of our im- small number of unidentified fibers. The anti- munocytological studies of 11 varicosity patterns bodies were prepared by immunizing BALB/c mice and an in depth morphological and electrophysio- with lightly fixed, homogenized Haementeria nerve logical description of one set of these immunoreac- cords. Their spleen cells were fused with myeloma tive cell types. cells to produce hybridomas. After a standard HAT Monoclonal antibodies raised against leech nerve selection, the clones were screened on paraformal- cords react with specific neuronal antigens. Of the dehyde-fixed ganglia of adult Haementeria using an 1200 hybridoma lines screened, 57% were immu- HRP-conjugated secondary antibody and staining noreactive, 3 % stain restricted neuronal sets, and with DAB and H202. Four large cell bodies stain in 1 % stain varicosities. These immunoreactive vari- the standard adult ganglion, along with their neu- cosities resemble leech varicosities stained with rites in the neuropil, peripheral nerves, and con- commercial anti-Leu-enkephalin antisera in terms nectives. A few as yet unidentified fibers are found of varicosity size, approximate number, and gan- more medially in the neuropil and connectives; glionic distribution pattern. Varicosities extend these also sometimes appear to be sending branches throughout the leech nervous system and are partic- out the nerves to the periphery. Some specialized ularly conspicuous within the cephalic neurohemal ganglia stain differently. The two sex ganglia have sites. Antisera that stain varicosities also stain a re- only one pair of cell bodies staining, and the last stricted number of immunoreactive soma that either two unfused ganglia have one pair of large cell bod- lie clustered within specialized ganglia or are reg- ies and one pair of small cell bodies that stain. The ularly distributed in sparse cell sets in segmental tail brain, composed of seven fused ganglia, has ganglia. The mAb Lan3-11, for example, stains so- cells staining that appear to be the segmental hom- ma within the subesophageal and the second seg- ologs of the P cells; the head brain, composed of mental ganglia. These cells are well suited for elec- four fused ganglia and a supraesophogeal ganglion, trophysiological and morphological analyses and segmental homologs are again apparent, as well as allow us to demonstrate that immunoreactive vari- a few additional cell bodies. cosities arise from immunoreactive soma. Using We have found as well that the antibody cross- double-labeling methods, we have established that reacts with another glossophoniid leech, He lob- these cells are interganglionic interneurons pro- della triserialis, in which experimental manipula- jecting to ganglionic sites that contain immuno- tions of P-cell progenitors are possible. We are now reactive varicosities and that their neurites display using the antibody to examine the consequences of swellings comparable to these varicosities. We rec- ablations and other experimental manipulations of ognize three Lan3-11 subtypes, and thus we are P-cell progenitors. We are investigating the possi- presently studying the extent to which Lan3 -11 pro- ble function of the antigen by a variety of means. jection fields overlap and varicosity distribution First, by light microscopy, the antigen appears to patterns correspond. Perhaps distinct neuropile tar- be located both on the surface and inside the cell; get sites will suggest separate follower cell types these observations will be confirmed by other and shed light on their individual physiological methods. Second, the molecular weight of the an- functions.

103 Identifying Cell Types in Adult and nizes a surface antigen, is not expressed on the sur- Developing Mammalian CNS face of most spinal cord neurons until after the S. Hockfield, E. Walvogel, C. Bautista second postnatal week. At this time, synapse elim- ination, one of the late events in neuronal matura- The mammalian CNS is composed of many differ- tion, is at its peak. This suggests a role for Cat-301 ent neuronal types. Much of neurobiology over the in the establishment or maintenance of adult syn- last 100 years has been concerned with the descrip- aptic patterns. tion of neuronal diversity on the basis of anatomi- We have now raised monoclonal antibodies to rat cal, physiological, and pharmacological criteria. embryonic day-15 spinal cord. At this age the ner- These studies have shown that the morphology and vous system contains both the rapidly proliferating physiology of identified neuronal types are consist- neuroepithelial cells and the recently differentiated ent among animals of the same species and often postmitotic neurons, some of which have begun to among animals of different mammalian species. extend their axons. We have obtained reagents that Many hypotheses for the generation and expression identify (1) postmitotic neurons; (2) early develop- of neuronal diversity have postulated that molecu- lar differences among neurons could direct cellular A Rat - 202 differentiation and the establishment and mainte- nance of specific connections. In our laboratory we are using hybridoma and recombinant DNA tech- nologies to explore the molecular basis of neuronal diversity. During the past year, we have used these techniques to examine further the cellular organi- zation of the adult mammalian brain and to study the development of the CNS by identifying early cell types and the sequence of events that give rise to the adult structure.

Monoclonal antibodies identify subsets of neurons in the adult CNS.Monoclonal antibody Cat-301 recognizes subsets of neurons in many areas of the In the dorsal lateral genicu- late nucleus (LGN) of both cat and monkey, the subset of Cat-301-positive neurons appears to cor- relate with a physiological class of neurons. In the visual cortex of monkeys, Cat-301 recognizes patches of neurons in both normal and monocularly enucleated animals. These groups of neurons lie in register with ocular dominance columns and may define a functionally distinct subset of cells. These studies show that the neurons in the LGN and vis- ual cortex are molecularly heterogeneous and that C Band the heterogeneity correlates with features of the or- ganization of each of these areas. We have further identified antibody-positive neurons by showing that they project to specific sites within the CNS using retrograde transport techniques. In addition, in collaboration with M. Sur (Yale University), we are electrophysiologically identifying individual LGN neurons and marking them using intracellular electrodes. These neurons are then stained with Cat-301 to determine precisely which physiological classes of neurons carry the Cat-301 antigen. Figure 2 Markers that differentiate among prevalent cell types in devel- Defining cell types in the developing mammalian oping CNS. Transverse sections of embryonic day-15 rats. (A) CNS.In our initial efforts to study developmental Monoclonal antibody Rat-202 stains axons in the developing spinal cord and periphery. (B) Monoclonal antibody Rat-401 events, we used the markers we have developed that stains radial glia in the CNS, nonneuronal cells in nerve routes, recognize antigens in the adult CNS. All of these and developing muscle cells. (C) Lectins fromBandeiria sim- markers are not expressed until relatively late in plicofolia stain developing blood vessels in embryos but not in development. For example, Cat-301, which recog- adults. Bar, 1 mm.

104 ing axons and their growth cones; (3) a class of Rat-401 recognizes radial cells in all areas of the proliferating cells, the radial glia; and (4) the em- developing rat brain but not in the adult. In each bryonic vascular system (Fig. 2). We have used area we have examined, antibody staining begins to these monoclonal antibodies to define major cell decrease at the end of the period of neuronal migra- types and to study the developmental events that tion (Fig. 3). This has important implications as the give rise to the diverse cell types in the adult ner- radial glial cells are thought to guide neuronal mi- vous system. One example of this approach is given gration. We have shown that a radial cell carrying by our studies using antibody Rat-401. the Rat-401 antigen is transiently present during the The antigen recognized by antibody Rat-401 (a period of neuronal migration-a cell that is spa- 200-kD species on immunoblots of SDS-polyacry- tially and temporally suited to serve as a structural lamide gels) first appears in the developing rat CNS guide for migrating neurons. after neural tube closure, on embryonic day 11 (Ell). We have used other monoclonal antibodies to fol- As neural development proceeds, antibody-positive low the development of axons. One antibody, Rat- cells come to resemble the radial glial cells de- 202, recognizes axons at very early stages and rec- scribed by Ramon y Cajal. Electron microscopic ognizes the entire axon, including the growth cone immunocytochemistry has shown that the antibody and its filopodia. As these early axons travel into recognizes mitotic cells. the periphery, they appear to be in close contact

Cerebellum: P2 P12 P28 A

Spinol Cord. E19 P2 P6

Figure3 Antigens recognized by Rat-401 are lost during development in cerebellum (A-C) and spinal cord (D-F). (A) Postnatal day-2 (P2) cerebellum contains numerous Rat-401-positive profiles. (B) By P12 the intensity of Rat-401 staining begins to decrease. (C) At P28 the cerebellum contains no Rat-401-positive profiles. The loss of Rat-401 staining is achieved by P21. In the developing cerebellum, the majority of neuronal proliferation and migration is complete by P21. (D) In the spinal cord, Rat-401 staining begins to decrease at embryonic day 19 (compare with E15 in Fig. 2). (E) At P2 very few antibody- positive profiles remain in the spinal cord (arrows). (F) By P6 the spinal cord contains no positive profiles. This section of P12 spinal cord illustrates the lack of Rat-401 staining at later stages. In the spinal cord, neuronal proliferation and migra- tion are complete by E19. Bar, 1 mm.

105 with a peripheral Rat-401-positive cell. This cell is concentrated our efforts on the specific problems present at the location of axon routes before axons raised by a set of antibodies that recognized a par- have grown out. This suggests that these nonneu- ticular subset of central neurons, the nociceptive or ronal cells may pioneer axon pathways and that the N cells. These cells give the leech information first axons may use these cells as a guide from CNS about noxious stimulation of the skin. We mapped to PNS. these N cells in different ganglia physiologically Other axonal antigens are expressed later in ax- and showed that all the segmental N cells carry spe- onal maturation than Rat-202. We have used anti- cific antigens (Johansen et al., J. Comp. Neural. bodies against these antigens to follow different [1984, in press]). These specific antigens are found time courses in axon development. Together, these on axons as well as cell bodies, and we showed that studies on antigen expression in the developing and these axons occupy specific locations in the CNS. adult mammalian CNS show that the amount of di- The specific location of leech central axons was versity among the cells in the CNS is large. They confirmed by electron microscopy of labeled axons also indicate that an elaborate, but tractable, pat- after electrophysiological identification of cells tern of antigenic expression occurs during neuronal (Johansen et al., J. Comp. Neurol. [1984, in press]). development. The regulation of axonal morphology has been rec- ognized as a central question of neural develop- ment. Although there are many properties of neu- rons that may contribute to axonal morphology, it Molecular Studies of Neural has often been postulated that different surface Organization molecules might play a role in axon pathfinding as R. McKay, S. Hockfield, K. Frederiksen, the growth cone establishes axonal morphology. We 0. Sundin then showed that the specific antigens which were present on stereotypically organized axons were Recently, the tools of molecular biology have be- present on the axon surface (McKay et al., Science come sufficiently simple to allow the experimental 222: 788 [1983]) and that these protease-sensitive, investigation of patterns of gene expression in com- glycosylated antigens are found on axons and filo- plex tissues. We have used hybridoma technology podia during the earliest stages of axon outgrowth to study both the molecular complexity and the cel- (McKay et al., Cold Spring Harbor Symp. Quant. lular organization of the nervous system. More re- Biol. 48: 599 [1983]). This work established that cently, we have applied recombinant DNA tech- growing axons can carry distinct surface mole- niques, particularly cDNA cloning, plus-minus cules. Using a cell culture of identified invertebrate screening, and in situ hybridization to these same neurons that send out neurites, we plan to explore problems. further the biochemistry of axon pathfinding. Using hybridoma technology, we showed that the nervous systems of the leech and of the cat were composed of antigenically diverse cell types. With both invertebrate and vertebrate systems, it became Genetic Complexity of the Rat Brain clear that specific monoclonal antibodies allowed a 0. Sundin, R. McKay, S. Hockfield high-resolution analysis of in vivo cellular organi- zation (Hockfield and McKay, J. Neurosci. 3: 369 We are now using recombinant DNA techniques to [1983]; Hockfield and McKay, Proc. Natl. Acad. obtain systematic data on the molecular complexity Sci. 80: 5758 [1983]; Hockfield et al., Cold Spring of the vertebrate brain. cDNA libraries in various Harbor Symp. Quant. Biol. 48: 877 [1983]; Hendry plasmid vectors have been made with oligo(dt)-se- et al., Nature 307: 267 [1984]). lected sequences from the embryonic neural tube and different regions of the adult brain of the rat. We are now using plus-minus screening and in situ hybridization to obtain probes that mark cell types Axon Organization during particular stages of differentiation. Our first R. McKay, K. Frederiksen, S. Hockfield results with these cDNA libraries show that there is a high degree of genetic complexity in the ver- The large numbers of antibodies that stained differ- tebrate brain. We now plan to use these techniques ent subsets of neurons in the leech suggested that to obtain a more complete description of the num- we were very far from saturating the pool of subset- ber and organization of different cell types in the specific antigens. To combat this complexity, we vertebrate brain.

106 PUBLICATIONS

Abraham, J., J. Feldman, K.A. Nasmyth, J.N. Strathern, 51 421-423. A.J.S. Klar, J.R. Broach, and J.B. Hicks. 1983. Sites Dellaporta, S.L., J. Wood, and J.B. Hicks. 1983. Maize required for position-effect regulation of mating-type DNA miniprep procedure. Maize Genet. Coop. News- information in yeast.Cold Spring Harbor Symp. lett. 53: 11. Quant. Biol. 47: 989-998. Engler, J.A., M.S. Hoppe, and M.P. VanBree. 1983. Nu- Asselbergs, F.A.M., M.B. Mathews, and J.E. Smart. cleotide sequence of the genes encoded in the early 1983. Structural characterization of the proteins en- region 2b of human adenovirus type7. Gene coded by adenovirus early region 2A. J. Mol. Biol. 21: 145-149. 163: 177-207. Fasano, 0., E. Taparowsky, J. Fiddes, M. Wigler, and Asselbergs, F.A.M., J.E. Smart, and M.B. Mathews. M. Goldfarb. 1983. Sequence and structure of the cod- 1983. Analysis of expression of adenovirus DNA ing region of the human H-ras-1 gene from T24 (fragments) by microinjection in Xenopus oocytes: In- bladder carcinoma cells. J. Mol. Appl. Genet. 2: 173- dependent synthesis of minor early region 2 proteins. 180. J. Mol. Biol. 163: 209-238. Flaster, M., C. Schley, and B. Zipser. 1983. Generating Bautch, V.L. and R.V. Storti. 1983. Identification of a monoclonal antibodies against excised gel bands to cytoplasmic tropomyosin gene linked to two muscle correlate immunocytochemical and biochemical data. tropomyosin genes in Drosophila. Proc. Natl. Acad. Brain Res. 277: 196-199. Sci. 80: 7123-7127. Garrels,J.I.1983. Quantitative two-dimensional gel Beach, D.H. 1983. Cell type switching by DNA transpo- electrophoresis of proteins. Methods Enzymol. sition in fission yeast. Nature 305: 682-688. 100: 411-423. Broach, J.R., Y.-Y. Li, J. Feldman, M. Jayaram, J. Abra- Gething, M.J. and J. Sambrook. 1983. Expression of ham, K.A. Nasmyth, and J.B. Hicks. 1983. Localiza- cloned influenza virus genes. In Genetics of influenza tion and sequence analysis of yeast origins of DNA viruses (ed.P.Palese and D.W. Kingsbury), pp. replication. Cold Spring Harbor Symp. Quant. Biol. 169-191. Springer-Verlag, Vienna. 47: 1165-1173. Gingeras, T.R. 1983. Computers and DNA sequences: A Broker, T.R. and L.T. Chow. 1983. Patterns and conse- natural combination. In Statistical analysis of DNA se- quences of adenoviral RNA splicing: Ex pluribus unum- quence data (ed. B.S. Weir), vol. 47, pp. 15-43. Marcel Ex uno plura (revised). In DNA makes RNA makes pro- Dekker, New York. tein (ed. T. Hunt et al), pp. 171-180. Elsevier, Cam- Gingeras, T.R. and J.E. Brooks. 1983. Cloned restric- bridge, England. tion/modification system from Pseudomonas aerugi- Brooks, J.G., R.M. Blumenthal, and T.R. Gingeras. nosa. Proc. Natl. Acad. Sci. 80: 402-406. 1983. The isolation and characterization of the Esche- Gluzman, Y. and K. Van Doren. 1983. Palindromic ad- richia coli DNA adenine methylase (dam) gene. Nu- enovirus type 5-simian virus 40 hybrid. J.Virol. cleic Acids Res. 11: 837-851. 45: 91-103. Chow, L.T., J.A. Engler, M. Rossini, R.A. Guilfoyle, Hanahan, D. 1983. Studies on transformation of Esche- M. VanBree, and T.R. Broker. 1983. The structure and richia coli with plasmids. J. Mol. Biol. 166: 557-580. regulation of early region 2 encoding the DNA repli- Hanahan, D. and M. Meselson. 1983. Plasmid screening cation functions of human adenoviruses. In Nucleic at high colony density. Methods Enzymol. 100: acid research, future development. First Asian Molec- 333-342. ular Biology Symposium (ed. K. Mizobuchi et al), pp. Helfman, D.M., J.R.Feramisco, J.C.Fiddes,G.P. 319-347. Academic Press, Tokyo, Japan. Thomas, and S.H. Hughes. 1983. Identification of Cleveland, D.W., M.F. Pittenger, and J.R. Feramisco. clones that encode chicken tropomyosin by direct im- 1983. Elevation of tubulin levels by microinjection munological screening of a cDNA expression library. suppresses new tubulin synthesis. Nature 305: Proc. Natl. Acad. Sci. 80: 31-35. 738-740. Hockfield, S. and R. McKay. 1983. A surface antigen Crawford, L., K. Leppard, D. Lane, and E. Harlow. expressed by a subset of neurons in the vertebrate cen- 1983. Cross reactions between cellular proteins and tral nervous system. Proc.Natl. Acad.Sci.80: SV40 T-antigen. UCLA Symp. Mol.Cell.Biol. 5758-5761.

107 Hockfield, S. and R. McKay. 1983. Monoclonal anti- ster thymidine kinase gene. Mol.Cell.Biol.3: bodies demonstrate the organization of axons in the 1815-1823. leech. J. Neurosci. 3: 369-375. Lopata, M.A., J.C. Havercroft, L.T. Chow, and D.W. Hockfield, S., R.D. McKay, S.H.C. Hendry, and E.G. Cleveland. 1983. Four unique genes required for )3- Jones. 1983. A surface antigen that identifies ocular tubulin expression in vertebrates. Cell 32: 713-724. dominance columns in the visual cortex and laminar Luther, P.W., H.B. Peng, and J.J.-C. Lin. 1983. Changes features of the lateral geniculate nucleus. Cold Spring in cell shape and actin distribution induced by constant Harbor Symp. Quant. Biol. 48: 877-889. electric fields. Nature 303: 61-64. Hogg, N., M. Flaster, and B. Zipser. 1983. Cross-reac- Macagno, E.R., R.R. Stewart, and B. Zipser. 1983. The tivities of monoclonal antibodies between select leech expression of antigens by embryonic neurons and glia neuronal and epithelial tissues. J. Neurosci. Res. 9: in segmental ganglia of the leech Haemopis marmor- 445-457. ata. J. Neurosci. 3: 1746-1759. Kassir, Y., J.B. Hicks, and I. Herskowitz. 1983. SAD mu- MacGillirray, A.J., M.R. Sadaie, and T.Y. Jing. 1983. The tation of Saccharomyces cerevisiae is an extra a cas- subnuclear location of Sm and RNP nuclear autoanti- sette. Mol. Cell. Biol. 3: 871-880. gens of human connective tissue disease. Brit. Soc. Cell Klar, A.J.S., J.N. Strathern, J.B. Hicks, and D. Prudente. Biol. Symp. (suppl. 1), p. 27 (Abstr.). 1983. Efficient production of a ring derivative of chro- Magnuson, T., G.R. Martin, L.M. Silver, and C.J. Ep- mosome III by the mating-type switching mechanism stein. 1983. Studies of the viability of tw5/tw5 embryonic in Saccharomyces cerevisiae. Mol.Cell.Biol.3: cells in vitro and in vivo. Cold Spring Harbor Conf. 803-810. Cell Proliferation 10: 671-681. Kost, T.A., N. Theodorakis, and S.H. Hughes. 1983. The Mains, P.E. and C.H. Sibley. 1983. LPS-nonresponsive nucleotide sequence of the chick cytoplasmic (3-actin variants of mouse B cell lymphoma, 70Z/3: Isolation gene. Nucleic Acids Res. 11: 8287-8301. and characterization. Somatic Cell Genet. 9: 699-720. Kostriken, R., J.N. Strathern, A.J.S. Klar, J.B. Hicks, Mains, P.E. and C.H. Sibley. 1983. The requirement of and F. Heffron. 1983. A site-specific endonuclease es- light chain for the surface deposition of the heavy chain sential for mating-type switching in Saccharomyces of immunoglobulin M.J.Biol.Chem.258: cerevisiae. Cell 35: 167-174. 5027-5033. Krangel, M.S., W.E. Biddison, and J.L. Strominger. Malmberg, R.L. 1983. Mutants of Nicotiana tabacum that 1983. Comparative structural analysis of HLA-A2 an- alter polyamine synthesis. In Current topics in plant tigens distinguishable by cytotoxic T lymphocytes. II. biochemistry and physiology (ed. D. Randall et al), Variant DK1: Evidence for a discrete CTL recognition pp. 211-221. University of Missouri Press, Columbia, region. J. Immunol. 130: 1856-1862. Missouri. Krangel, M.S., S. Taketani, D. Pious, and J.L. Strom- Malmberg, R.L. and R.J. Griesbach. 1983. Chromo- inger. 1983. HLA-A2 mutants immunoselected in vi- somes from protoplasts -Isolation, fractionation, and tro: Definition of residues contributing to an HLA-A2 uptake. In Genetic engineering of plants, an agricul- specific serological determinant. J. Exp. Med. 157: tural perspective (ed. T. Kosuge et al), pp. 195-201. 324-336. Plenum Press, New York. Kurkinen, M., D.P. Barlow, D.M. Helfman, J.G. Wil- Malmberg, R.L. and J. Mclndoo. 1983. Abnormal floral liams, and B.L.M. Hogan. 1983. Isolation of cDNA development of a tobacco mutant with elevated poly- clones for basil lamina components: Type IV procol- amine levels. Nature 305: 623-625. lagen. Nucleic Acids Res. 11: 6199-6209. Mathews, M.B. and R.M. Bernstein. 1983. Myositis au- Kurtz, D.T., D.K. Bishop, and M.M. Manos. 1983. Hor- toantibody inhibits histidyl-tRNA synthetase: A model monal control of rat 02, globulin gene expression. for autoimmunity. Nature 304: 177-179. UCLA Symp. Mol. Cell. Biol. 66: 441-444. Matsumura, E, J.J.-C. Lin, S. Yamashiro-Matsumura, Kurtz, D.T., L. McCullough, D.K. Bishop, and M.M. G.P. Thomas, and W.C. Topp.1983.Differential Manos. 1983. DNA sequences required for hormonal expression of tropomyosin forms in the microfila- induction of rat ce, globulin genes. Cold Spring Har- ments isolated from normal and transformed rat cul- bor Symp. Quant. Biol. 47: 985-988. tured cells. J. Biol. Chem. 258: 13954-13964. Lane, E.B., B.L.M. Hogan, M. Kurkinen, and J.I. Gar- Matsumura, E, S. Yamashiro-Matsumura, and J.J.-C. rets. 1983. Coexpression of vimentin and cytokeratins Lin. 1983. Isolation and characterization of tropomy- in parietal endoderm cells of early mouse embryo. Na- osin-containing microfilaments from cultured cells. ture 303: 701-704. J. Biol. Chem. 258: 6636-6644. Lee, C.-H., A. Bhagwat, M. McCormick, E. Ohtsubo, McKay, R. 1983. Immunoassay for sequence-specific and F Heffron. 1983. Dissection of transposition im- DNA-protein interaction. Methods Enzymol. 92: munity: The terminal 38 base pairs of Tn3 are required 138-146. for transposition immunity. UCLA Symp. Mol. Cell. McKay, R., S. Hockfield, I. Thomson, J. Johansen, and Biol. 10: 797-817. K. Frederiksen.1983.Surface molecules identify Leppard, K., N. Totty, M. Waterfield, E. Harlow, J. Jen- groups of growing axons. Science 222: 788-794. kins, and L. Crawford. 1983. Purification and partial McKay, R.D., S. Hockfield, J. Johansen, and K. Freder- amino acid sequence analysis of the cellular tumor an- iksen. 1983. The molecular organization of the leech tigen, p53, from mouse SV40-transformed cells. nervous system. Cold Spring Harbor Symp. Quant. EMBO J. 2: 1993-1999. Biol. 48: 599-610. Lewis, J.A., K. Shimizu, and D. Zipser. 1983. Isolation Prives, C., L. Covey, A. Scheller, and Y. Gluzman. 1983. and preliminary characterization of the Chinese ham- DNA binding properties of simian virus 40 T-antigen

108 mutants defective in viral DNA replication. Mol. Cell. Sugino, H. and E Matsumura. 1983. Fragmin induces Biol. 3: 1958-1966. tension reduction of actomyosin threads in the pres- Robertson, H.D., S.H. Howell, M. Zaitlin, and R.L. ence of micromolar levels of Ca". J.Cell Biol. Malmberg. 1983. Plant infectious agents: Viruses, vi- 96: 199-203. roids, virusoids, and satellites. Current Communica- Taketani, S., M.S. Krangel, D. Pious, and J.L. Strom- tions in Molecular Biology. Cold Spring Harbor Lab- inger. 1983. Structural analysis of HLA-A2 antigen oratory, Cold Spring Harbor, New York. from immunoselected mutant 8.6.1: Further definition Rossini, M. 1983. The role of adenovirus early region lA of an HLA-A2 specific serological determinant. J. Im- in the regulation of early regions 2A and 1B expres- munol. 131: 2935-2938. sion. Virology 131: 49-58. Tamanoi, E and B.W. Stillman. 1983. The origin of ad- Roth, M.G., R.W. Compans, L. Giusti, A.R. Davis, D.P. enovirus DNA replication. Curr. Top. Microbiol. Im- Nayak, M.J. Gething, and J. Sambrook. 1983. Influ- munol. 109: 75-87. enza virus hemagglutinin expression is polarized in Tamanoi, E and B.W. Stillman. 1983. Initiation of aden- cells infected with recombinant SV40 viruses carrying ovirus DNA replication in vitro requires a specific cloned hemagglutinin DNA. Cell 33: 435-443. DNA sequence. Proc. Natl. Acad. Sci. 80: 6446-6450. Ruley, H.E. 1983. Adenovirus early region lA enables Taparowsky, E., K. Shimizu, M. Goldfarb, and M. Wig- viral and cellular transforming genes to transform pri- ler. 1983. Structure and activation of the human N-ras mary cells in culture. Nature 304: 602-606. gene. Cell 34: 581-586. Sambrook, J. and M.J. Gething. 1983. Expression of Thalenfeld, B.E., S.G. Bonitz, F.G. Nobrega, G. Ma- proteins on the cell surface using mammalian vectors. cino, and A. Tzagoloff. 1983. olil transcripts in wild In Experimental manipulation of gene expression (ed. type and in a cytoplasmic "petite" mutant of yeast. J. M. Inouye), pp. 225-246. Academic Press, New York. Biol. Chem. 258: 14065-14068. Shimizu, K., M. Goldfarb, M. Perucho, and M. Wigler. Thummel, C., R. Tjian, S.-L. Hu, and T. Grodzicker. 1983. Isolation and preliminary characterization of 1983. Translational control of SV40 T antigen ex- the transforming gene of a human neuroblastoma cell pressed from the adenoviruslate promoter.Cell line. Proc. Natl. Acad. Sci. 80: 383-387. 33: 455-464. Shimizu, K., D. Birnbaum, M.A. Ruley, 0. Fasano, Y. Varshaysky, A., 0. Sundin, E. Ozkaynak, R. Pan, M. Suard, L. Edlund, E. Taparowsky, M. Goldfarb, and Solomon, and R. Snapka. 1983. Final stages of DNA M. Wigler. 1983. Structure of the Ki-ras gene of the replication: Multiply intertwined catenated dimers as human lung carcinoma cell line Calu-1. Nature SV40 intermediates. UCLA Symp. Mol. Cell. Biol. 304: 497-500. 10: 463-494. Shimizu, K., M. Goldfarb, Y. Suard, M. Perucho, Y. Li, Ware, C.F., M.S. Krangel, D. Pious, Si. Burakoff, and T. Kamata, J.R. Feramisco, E. Stavnezer, J. Fogh, and J.L. Strominger. 1983. Recognition of HLA-A2 mutant M. Wigler. 1983. Three human transforming and variant target cells by an HLA-A2 allospecific related to the viral ras oncogenes. Proc. Natl. Acad. human cytotoxic T lymphocyte line.J.Immunol. Sci. 80: 2112-2116. 131: 1312-1317. Silver, L.M. 1983. Reevaluation of the evidence for the Watson, J.W, J. Tooze, and D.T. Kurtz. 1983. Recombi- generation of new lethal t haplotypes by mutation. Im- nant DNA: A short course. Scientific American Books, munogenetics 18: 91-96. W.H. Freeman and Co., New York. Silver, L.M., J.I. Garrels, and H. Lehrach. 1983. Molec- Weiffenbach, B., D. Rogers, J. Haber, M. Zoller, D. Rus- ular studies of mouse chromosome 17 and the t com- sell, and M. Smith. 1983. Deletions and single base plex. In Genetic engineering-Principles and methods pair changes in the yeast mating type locus that prevent (ed. J.K. Setlow and A. Hollaender), vol.6,pp. homothallic mating type conversions. Proc.Natl. 141-156. Plenum Press, New York. Acad. Sci. 80: 3401-3405. Silver, L.M., D. Lukralle, and J.I. Garrels. 1983. T °" is Welch, W.J., J.I. Garrels, 3.3.-C. Lin, G.P. Thomas, and a novel, variant form of mouse chromosome 17 with a J.R. Feramisco. 1983. Biochemical characterisation of deletion in a partial t haplotype. Nature 301: 422-424. the mammalian stress proteins and identification of two Silver, L.M., G.R. Martin, and S. Strickland, eds. 1983. stress proteins as glucose- and Ca++-ionophore regu- Teratocarcinoma stem cells. Cold Spring Harbor Conf. lated proteins. J. Biol. Chem. 258: 7102-7111. Cell Proliferation 10. Whitehouse, S., J.R. Feramisco, J.E. Casnellie, E.G. Silver, L.M., J. Uman, J. Danska, and J.I. Garrels. 1983. Krebs, and D.A. Walsh. 1983. Studies on the kinetic A diversified set of testicular cell proteins specified by mechanism of the catalytic subunit of the cAMP- genes within the mouse t complex. Cell 35: 35-45. dependent protein kinase. J.Biol.Chem. 258: Sorge, J., B. Ricci, and S. Hughes. 1983. Cis-acting RNA 3693-3701. packaging locus in the 115-nucleotide direct repeat of Zipser, B., R. Stewart, T. Flanagan, M. Flaster, and E.R. Rous sarcoma virus. J. Virol. 48: 667-675. Macagno. 1983. Do monoclonal antibodies stain sets Stillman, B.W. 1983. The replication of adenovirus DNA. of functionally related leech neurons? Cold Spring UCLA Symp. Mol. Cell. Biol. 10: 381-393. Harbor Symp. Quant. Biol. 48: 551-556. Stillman, B.W. 1983. The replication of adenovirus DNA Zoller, M.J. and M. Smith. 1983. Oligonucleotide-di- with purified proteins. Cell 35: 7-9. rected mutagenesis of DNA fragments cloned into M13 Stillman, B.W. and F. Tamanoi. 1983. Adenovirus DNA vectors. Methods Enzymol. 100: 468-500. replication: DNA sequences and enzymes required for initiation in vitro. Cold Spring Harbor Symp. Quant. Biol. 47: 741-750.

109 In Press sponses to chemical exposure. Banbury Reports, Cold Spring Harbor Laboratory, New York. Garrels, J.I., J.T. Farrar, and C.B. Burwell IV. The Abraham, J., K.A. Nasmyth, J.N. Strathern, A.J.S. Klar, QUEST system for computer-analyzed two-dimen- and J.B. Hicks. Regulation of mating-type information sional electrophoresis of proteins. In Two-dimensional in yeast: Negative control requiring sequences both 5' gel electrophoresis of proteins: Methods and applica- and 3' to the regulated region. J. Mol. Biol. tions (ed. J.E. Celis and R. Bravo). Academic Press, Avner, P., E. Elphassi, J.I. Garrels, and L.M. Silver. Es- New York. tablishment and characterization of mouse lymphoma Gething, M.-J., T.J. Braciale, C.M. Brand, and J. Sam- cell lines carrying mutations in the Tit complex. Exp. brook. Comparison of different eukaryotic vectors for Cell Res. the expression of hemagglutinin glycoprotein of influ- Beach, D.H. and A.J.S. Klar. Rearrangements of the enza virus. In Modern approaches to vaccines (ed. transposable mating-type cassettes of fission yeast. R.M. Chanock and R.A. Lerner). Cold Spring Harbor EMBO J. Laboratory, Cold Spring Harbor, New York. Benchimol, S., J. Jenkins, L. Crawford, K. Leppard, P. Gething, M.-J., C. Doyle, M. Roth, and J. Sambrook. Lamb, N. Williamson, D. Pim, and E. Harlow. Molec- Mutational analysis of the structure and function of the ular analysis of the gene for the cellular tumor antigen influenza virus haemagglutinin. In Current topics in p53. Cancer Cells. membranes and transport (ed. C.W. Slayman and E.A. Bernstein, R.M., S.H. Morgan, J. Chapman, C.C. Bunn, Adelberg). Academic Press, New York. M.B. Mathews, M. Turner-Warwick, and G.R.V. Gooding, L., R. Geib, K. O'Connell, and E. Harlow. Hughes. Anti-Jo-1 antibody: A marker for myositis Antibody and cellular detection of SV40 T-antigenic with interstitial lung disease. Brit. Med. J. determinants on the surfaces of transformed cells. Blose, S.H. The endothelial cytoskeleton. Dev. Cardio- Cancer Cells. vasc. Med. Guggenheimer, R.A., B.W. Stillman, K. Nagata, F. Blose, S.H., D.I. Meltzer, and J.R. Feramisco. 10-nm Tamanoi, and J. Hurwitz. DNA sequences required filaments are induced to collapse in living cells mi- for the in vitro replication of adenovirus DNA. Proc. croinjected with monoclonal and polyclonal antibodies Natl. Acad. Sci. against tubulin. J. Cell Biol. Hanahan, D. and Y. Gluzman. Rescue of functional rep- Braciale, T.J., V.L. Braciale, T.J. Henkel, J. Sambrook, lication origins from embedded configurations in a and M.-J. Gething. Cytotoxic T lymphocyte recogni- plasmid carrying the adenovirus genome. Mol. Cell. tion of the influenza hemagglutinin gene product ex- Biol. Broker, T.R. Animal virus RNA processing. In Process- Hendry, S.H.C., S. Hockfield, E.G. Jones, and R.D.G. ing of RNA (ed. D. Apirion). CRC Press, Boca Raton, McKay. A monoclonal antibody that identifies subsets Florida. of neurons in the central visual system of the monkey Broker, T.R., C. Keller, and R.J. Roberts. Adenoviruses. and cat. Nature. In Genetic maps, 3rd edition (ed. S.J. O'Brien). Cold Hicks, J., J. Strathern, A. Klar, and S. Ismail. Structure Spring Harbor Laboratory, Cold Spring Harbor, New of the SAD mutation and the location of control sites York. at silent mating type genes in yeast. Mol. Cell. Biol. Chow, L.T. and T.R. Broker. Human papilloma virus type Hughes, S.H. and E. Kosik. Mutagenesis of the region 1 RNA transcription and processing in COS-1 cells. between env and src for the purpose of constructing Prog. Cancer Res. Ther. helper independent vectors. Virology. Egel, R., D.H. Beach, and A.J.S. Klar. Genes required Johansen, J., S. Hockfield, and R.D.G. McKay. Axonal for initiation and resolution steps of mating-type projections of mechanosensory neurons in the connec- switching in fission yeast. Proc. Natl. Acad. Sci. tive and peripheral nerves of the leech, Haemopis mar- Fasano, 0., T. Aldrich, E Tamanoi, E. Taparowsky, M. morata. J. Comp. Neurol. Furth, and M. Wigler. Analysis of the transforming Johansen, J., S. Hockfield, and R.D.G. McKay. Distri- potential of the human H-ras genes by random muta- bution and morphology of nociceptive cells in the CNS genesis. Proc. Natl. Acad. Sci. of three species of leech. J. Comp. Neurol. Feldman, J.B., J.B. Hicks, and J.R. Broach. Identifica- Kamata, T. and J.R. Feramisco. Is the ras oncogene pro- tion of sites required for repression of a silent mating tein a component of the epidermal growth factor re- type locus in yeast. J. Mol. Biol. ceptor system? Cancer Cells. Fischer, H.D., J.B. Dodgson, S.H. Hughes, and J.D. Klar, A.J.S. and J.N. Strathern. Resolution of recombi- Engel. An unusual 5' splice sequence is efficiently nation intermediates generated during yeast mating utilized in vivo. Proc. Natl. Acad. Sci. type switching. Nature. Fox, H.S., L.M. Silver, and G.R. Martin. An alpha glo- Klessig, D.F., T. Grodzicker, and V. Cleghon. Construc- bin pseudogene is located within the mouse t complex. tion of human cell lines which contain and express the Immunogenetics. adenovirus DNA binding protein gene by cotransfor- Franza, B.R., Jr. and J.I. Garrels. Transformation-sen- mation with the HSV-1 tk gene. Virus Res. sitive proteins of REF52 cells detected by computer- Krangel, M.S., D. Pious, and J.L. Strominger. Charac- analyzed two-dimensional gel electrophoresis. Cancer terization of a B lymphoblastoid cell line mutant which Cells. secretes HLA-A2. J. Immunol. Garrels, J.I. and B.R. Franza, Jr. Use of two-dimen- Lin, J.J.-C., J.R. Feramisco, S.H. Blose, and F. Matsu- sional gel electrophoresis for detection of proteins in- mura. Monoclonal antibodiesto cytoskeleton.In dicating genetic risk. In Genetic predisposition in re- Monoclonal antibodies and hybridomas: Progress and

110 applications (ed. R.H. Kennett et al.). Plenum Press, myelocytomatosis virus myc and adenovirus early re- New York. gion lA promote the in vitro establishment of cultured Lin, J.J.-C., F Matsumura, and S. Yamashiro-Matsu- primary cells. Cancer Cells. mura. Tropomyosin-enriched and alpha-actinin-en- Schulze, E.S. and S.H. Blose. Passage of molecules riched microfilaments isolated from chick embryo fi- across the intercellular bridge between post-mitotic broblasts by monoclonal antibodies. J. Cell Biol. cells. Exp. Cell Res. Lin, J.J.-C., S. Yamashiro-Matsumura, and F Matsu- Silver, L.M., D. Lukralle, J.I. Garrels, and K. Willison. mura. Microfilaments in normal and transformed cells: Persistence of a lethal t haplotype in a laboratory stock Changes in the multiple forms of tropomyosin. Cancer of outbred mice. Genet. Res. Cells. Stillman, B., E. White, and T. Grodzicker. Independent Malmberg, R.L. and J. Mclndoo. Ultraviolet mutagene- mutations in Ad2ts111 cause degradation of cellular sis and genetic analysis of resistance to methyl- DNA and defective viral DNA synthesis. J. Virol. glyoxal-bis(guanylhydrazone) in tobacco. Mol. Gen. Thomas, G.P. and M.B. Mathews. Alterations in tran- Genet. scription and translation in HeLa cells exposed to Mathews, M.B. and A.M. Francoeur. The La antigen amino acid analogues. Mol. Cell. Biol. recognizes and binds to the 3' oligouridylate tail of a Van Doren, K., D. Hanahan, and Y. Gluzman. Infection small RNA. Mol. Cell. Biol. of eukaryotic cells by helper independent recombinant Mathews, M.B., R.M. Bernstein, B.R. Franza, Jr., and adenoviruses: Early region 1 is not obligatory for in- J.I. Garrels. The identity of the "proliferating cell nu- tegration of viral DNA. J. Virol. clear antigen" and "cyclin." Nature. Weiss, R.B. Molecular mechanics of ribosome frame- McKay, R.D.G., J. Johansen, and S. Hockfield. Mono- shifting. Proc. Natl. Acad. Sci. clonal antibody identifies a 63,000 dalton antigen Weiss, R.B., J.P. Murphy, and J.A. Gallant. A genetic found in all central neuronal cell bodies but only a sub- screen for cloned release factor genes. J. Bacteriol. set of axons in the leech. J. Comp. Neurol. Welch, W.J. and J.R. Feramisco. Nucleolar localization Mottinger, J.P., S.L. Dellaporta, and P. Keller. Stable and of the 72,000 dalton heat-shock protein in mammalian unstable mutations in aberrant ratio stocks of maize. cells. J. Biol. Chem. Genetics. Zipser, B. Preparation of monoclonal antibodies and their Perez-Polo, R. and B. Zipser. Immunological and im- advantages in identifying specific neurons. Adv. Cell. munocytochemical assays. In Handbook of nervous Neurobiol. system factors. CRC Press, Boca Raton, Florida. Zipser, B. Molecular charting of leech CNS. In Model Powers, S., T. Kataoka, 0. Fasano, M. Goldfarb, J. systems and behavior (ed. L. Silverston). Plenum Strathern, J. Broach, and M. Wigler. Genes in S. cere- Press, New York. visiae encoding proteins with domains homologous to Zipser, B. and C. Schley. Two differently distributed the mammalian ras proteins. Cell. central nervous system antigens to which a single mono- Roehme, D., H. Fox, B. Herrmann, A.-M. Frischauf, clonal antibody binds can be differentiated through J.-E. Edstrom, P. Mains, L.M. Silver, and H. Lehrach. different fixations. Ann. N.Y. Acad. Sci. Molecular clone of the mouse t complex derived from Zipser, B. and C. Schley. Development and immuniza- microdissected metaphase chromosomes. Cell. tion for monoclonal antibodies. In Handbook of ner- Ruley, H.E., J.F. Moomaw, and K. Maruyama. Avian vous system factors. CRC Press, Boca Raton, Florida.

111

AUTHOR INDEX

Abraham, J., 82 Gerard, R.D., 56, 57 MacInnes, J.I., 76 Adams, T., 57 Gething, M.-J., 31, 32, 33, 34 Maihle, N., 22 Addison, W.R., 76 Gingeras, T.R., 99 Mains, P., 71, 73, 74 Applebaum, J., 97, 98 Gluzman, Y., 54, 55, 56, 68 Malmberg, R.L., 88 Goldfarb, M., 39, 40 Manos, M., 55 Gould, J., 93 Martin, K., 93, 94 Bautch, V.L., 71, 75 Grodzicker, T., 51, 52, 62, 63, 64 Maruyama, K., 62, 63 Bautista, C., 103 Guilfoyle, R., 50 Mathews, M.B., 36, 60, 61 Beach, D., 83, 84 Matkovich, D., 78 Bhagwat, A., 91 Matlack, K., 25 Binns, G., 35, 42, 43, 44 Hanahan, D., 34, 68, 75 Matsumura, E, 17, 18, 20, 21 Birchmeier, C., 41 Harlow, E., 57, 58 McGill, C., 81 Birnbaum, D., 39, 41 Helfman, D., 22 Mclndoo, J., 88 Blose, G.A., 18, 25 Herr, W, 54 McKay, R., 106 Blose, S.H., 18, 24, 25 Herrmann, C., 60 Merle, M., 64 Bonitz, S., 84 Hiatt, A.C., 88 Miglio, L., 81 Brandsma, J., 32 Hicks, J.B., 81, 82, 87 Moomaw, C., 84 Broker, T.R., 47, 50 Hinton, S., 98 Moomaw, J., 62, 63 Brooks, J.E., 99 Hockfield, S., 103, 106 Moran, E., 61 Bukhari, A.I., 92, 93, 94, 95, 96 Hughes, S., 22, 66

Nozik, E., 76 Cai, G.-Y., 25 Ismail, S., 96 Cheng, S., 47 Ivy, J., 82 Chomet, RS., 87 O'Loane, D., 99 Chou, C.-S., 21 O'Malley, R., 60 Chow, L.T., 47, 49, 50 Jackson, C., 71 O'Neill, K., 59 Cisek, L., 71, 72 Johnson, K., 85 Osheroff, W, 50

Kamata, T, 42, 43, 44 Pascucci, D.D., 36, 37 Daldal, F1, 97, 98 Kataoka, T., 40 Danna, D., 76 Patterson, T., 93, 94 Kataoka, Y., 22 Pelletier, A.J., 47 Dellaporta, S.L., 87 Katoh, Y., 59 Dermody-Weisbrod, M., 56 Perez, J., 102 Kelly, M., 81 Powers, S., 40 Doyle, C., 33 Kiss, A., 92 Klar, A.J.S., 81, 82, 83 Ramirez, K., 42 Edlund, L., 41 Koka, P., 96 Kosik, E., 22, 66 Rao, M., 41 Kost, T., 22 Reichel, RA., 60 Fasano, 0., 39, 40 Kostriken, R., 81, 85 Roberts, R.J., 59, 61, 91 Feramisco, J.R., 22, 24, 25, 35, 36, Krangel, M.S., 71, 75, 76 Rogers, L., 31 42, 43, 44 Kurtz, D.T., 76 Rossini, M., 50 Flanagan, T., 102, 103 Roth, M., 33 Flaster, M.S., 101, 103 Rubin, E., 56 Lewis, J., 78 Fox, H., 71, 72 Ruley, M., 39, 42, 62, 63 Li, J.-Z., 76 Franza, B.R., Jr., 16, 36, 42 Lin, J.J.-C., 17, 21 Fraser, C., 42 Lin, J.L.-C., 21 Sadaie, M.R., 60 Frederiksen, K., 106 Lin, P. -M., 91 Sambrook, J., 31, 32, 34 Freyer, G.A., 58, 59 Lionetti, K., 56 Sarvetnick, N., 71, 72, 74 Livi, G., 82 Schley, C., 57, 103 Galli, R.L., 47 Lukralle, D., 71 Sharma, S., 32 Garrels, J.I., 15, 16, 42 Lundell, D.J., 99 Shimizu, K., 39

113 Silbiger, S., 84 Tohill, K., 58 Wig ler, M., 39, 40, 41 Silver, L.M., 71, 72 Topp, WC., 56 Williamson, N., 57 Sorge, J., 66 Wood, J., 82 Stephens, C., 82 Van Doren, K., 68 Wylen, M., 58 Stillman, B., 51, 52, 53 Strathern, J.N., 81, 82 Waldvogel, E., 103 Yamada, M., 64 Suhan, J., 25 Walsh, M., 41 Yamashiro-Matsumura, S., 17, 20, 21 Sundin, 0., 106 Watts, S., 49 York, D., 33 Welch, W.J., 24, 35, 36 Youvan, D., 96 Tamanoi, E, 41, 53 Weisbrod, S., 82 Zerler, B., 61 Taparowsky, E., 39 Weiss, R., 93, 95 Zipser, B., 101, 102, 103 Thomas, G.P., 36, 37 White, E., 51, 52 Zoller, M., 85

114 COLD SPRING HARBOR MEETINGS

48TH COLD SPRING HARBOR SYMPOSIUM ON QUANTITATIVE BIOLOGY

MOLECULAR NEUROBIOLOGY June 1 -June 8

223 participants

Ever since the genetic code was solved in 1966, the brain and the phenomena it oversees -perception, mem- ory, and thinking -have stood out like Himalayan peaks to the world of molecular biologists. Until very recently, however, most of us have believed that we have little unique to offer those long professionally involved in neurobiological phenomena and that the brain in particular was far beyond our capabilities. Those few molecular biologists who did move into neurobiology we have in the past regarded as frightfully brave or recklessly silly. Apparently particularly hopeless was the approach that should be the most natural to us, that of focusing first on the structure and functioning of the molecules out of which the nerve cells are made. Although such research of itself could become fun to do, for many years the chances seemed nil that it would be through molecular biology that the intimate secrets of the brain would fall out. So an audacious few of us had moved into the fields of psychophysics, hoping that bouts of hard thinking could do the job. But here again the odds that fundamental revelations would quickly emerge seemed painfully low. Today, however, we sense a new mood among those molecular biologists who gaze upwards toward the brain. By using recombinant DNA, monoclonal antibodies, and the facts of receptor biochemistry to the fullest, we should have a fighting chance to understand the uniqueness of nerve cells and the ways they come together to form functional networks. To mark this new mood, we decided to hold the 48th Symposium on Molecular Neurobiology. In putting together this meeting, we received excellent advice from many colleagues, especially Eric Kandel and Charles Stevens, both long associated with the Cold Spring Harbor summer courses in neuro- biology. The final result was a Symposium that will be long remembered as a decisive turning point in the development of neurobiology. Funding for this meeting was provided by the National Institutes of Health, National Science Foundation, and the Department of Energy.

117 C. ELEGANS Relatively simple microorganisms are exception- ally attractive systems in which to study develop- May 4-May 8 ment because of the facility with which they can be manipulated by genetic and molecular techniques. Arranged by The meeting on Microbial Development was un- Robert H. Waterston, Washington University, usual in bringing together workers in a wide variety St. Louis of prokaryotic and eukaryotic microbial systems in David Hirsh, University of Colorado which general problems of cellular differentiation, Jonathan Hodgkin, MRC Laboratory of cell-cell interaction, and morphogenesis are being Molecular Biology addressed. A special feature of the meeting was the Sam Ward, Carnegie Institution of Washington, comparison of similar biological problems posed by Baltimore very different experimental systems, such as cell division and differential gene expression in E. coli, 178 participants Caulobacter, and yeast; spore formation in Bacil- lus, Streptomyces, yeast, and Aspergillus; mating The fourth international C. elegans meeting at Cold interactions in Streptococcus, Streptomyces, E. Spring Harbor attracted more than 170 scientists coli, Chlamydomonas, and yeast; and parallel pat- from 40 laboratories studying diverse aspects of this terns of social behavior in Myxobacteria and Dic- small nematode. The results presented at the meet- tyostelium. Despite the diversity of systems, a co- ing included a description of the complete neuro- herent set of recurring issues shaped the discussions: anatomy; genetic and molecular studies of the speci- the role of nutritional signals in triggering devel- fication of neural development and neuron-specific opment, the way in which sets of genes are acti- polypeptides; a genetic pathway of sex determina- vated in ordered sequences during differentiation, tion and the identification of genes specifying sex- polarity, and the role of positional information, cell specific proteins; a description of mutants affecting communication, and the transduction of sensory in- developmental lineages, including some with ho- formation. An important success of the meeting was meotic effects; the localization of gene products that workers in diverse systems found themselves within cells, from the asymmetric distribution of on common ground with respect to the questions proteins during cell division both in the embryonic being addressed and the experimental approaches cleavages and in spermatogenesis to the specific being employed. The meeting conveyed a strong positions occupied by myosin isoforms in the thick sense of excitement, since it was clear that many filament; the molecular and genetic analysis of pro- microbial developmental systems were yielding teins of the cuticle and muscle, especially of the rapidly to genetic and molecular approaches, with myosin heavy-chain gene; the search for transpos- able elements by genetic and molecular ap- many molecular details and, in some instances, im- portant general principles already emerging. proaches; the conclusive identification of a tRNA This meeting was supported in part by Abbott amber nonsense suppressor; a detailed deletion map Laboratories; American Cyanamid Co.; Biogen of a region of the second chromosome; and the first S.A.; Eli Lilly Co.; Miles Laboratories, Inc.; Mon- successful DNA transformation of C. elegans. The santo; Monsanto Agricultural Products Co.; Up- gathering of workers from all fields to share results john Co.; the National Science Foundation; and produced a wealth of ideas and collaborations, Searle Research and Development. demonstrating the value of the meeting. This meeting was supported in part by funds from the National Institute on Aging, National Institutes of Health. RNA PROCESSING May 18 -May 22 MICROBIAL Arranged by John Abelson, University of California, San DEVELOPMENT Diego May 11-May 15 James Dahlberg, University of Wisconsin Michael Mathews, Cold Spring Harbor Arranged by Laboratory Richard Losick, The Biological Laboratories, 224 participants Harvard University Lucy Shapiro, Albert Einstein College of Modification of primary transcripts plays an essen- Medicine tial role in the mobilization and expression of ge- Amar Klar, Cold Spring Harbor Laboratory netic information. The alterations can be of several 143 participants kinds, from changes in single nucleotides to the ad-

118 dition or deletion of lengthy sequences, and they dealing with human retroviruses, both endogenous can modulate the stability and function of RNAs of sequences and the exogenous human T-cell leuke- all types. It is not surprising, then, that the topics mia viruses. The mechanism of HTLV-induced leu- discussed at this year's meeting on RNA Processing kemogenesis remains obscure and clearly of great ranged widely, including nuclear structure and interest. There is no reason to think that the RNA function, ribonucleoprotein particles, and RNA Tumor Viruses meeting will be any smaller next structure, as well as mRNA, tRNA, and rRNA year. processing. In some areas, definitive answers have This meeting was supported in part by funds from begun to emerge -the detailed chemistry and bio- the Cancer Center Grant to Cold Spring Harbor chemistry of tRNA cleavage and ligation reactions Laboratory from the National Cancer Institute, Na- are a notable example. In others, such as mRNA tional Institutes of Health. splicing and polyadenylation, it was clear that suf- ficiently active cell-free systems are now in hand and rapid advances are anticipated. Yet other areas are moving through a more descriptive phase: The THE MOLECULAR structural analysis of ribonucleoprotein particles is BIOLOGY OF YEAST well advanced, for instance, while their functions offer food for thought and subjects for debate. August 16-August 21 This meeting followed a successful predecessor in 1982, and plans for a further meeting in 1984 are Arranged by now in hand. We are fortunate that the granting James B. Hicks, Amar Klar, and Jeffrey N. agencies, recognizing the significance of RNA Strathern, Cold Spring Harbor Laboratory processing, approved funding for two consecutive years -a rare act. Support comes from grants from 473 participants the National Science Foundation, the National In- stitutes of Health, the National Institute of General Well over 600 scientists applied to attend the 1983 Medical Sciences, and the Fogarty International Yeast meeting. This reflects both the proliferation Center. of the laboratories and the rapid progress in appli- cation of molecular approaches to a variety of bio- logical problems in yeast. As a result of this over- RNA TUMOR VIRUSES subscription, it was both more difficult to organize May 25-May 29 the sessions and more rewarding to absorb their content. One take-home lesson obvious from the Arranged by meeting is that the recombinant DNA and transfor- Edward Scolnick, Merk Sharp & Dohme mation technologies have progressed to the point Research Laboratories where the cloning of most genes is routine. Nearly Nancy Hopkins, Massachusetts Institute of a quarter of the mapped genes have been cloned. Technology Several molecular approaches to simplify mapping techniques have been developed that are expanding 441 participants our understanding of the organization of the ge- nome. Finally, enriched messages, genes from het- The annual RNA Tumor Virus meeting once again erologous systems, immunological screening, and achieved a record number of applicants and ab- synthetic probes are allowing the cloning of genes stracts, the abstract booklet being almost one inch for which there are no mutations. All of these tech- thick. The continuing intense interest in this field niques provided the raw material for several ele- is, of course, in large part due to viral oncogenes, gant molecular studies on the regulation and ex- those cellular sequences captured by retroviruses pression of genes that were reported at this meet- and thereby turned into cancer-inducing genes. At ing. Talks and posters addressed such topics as the least 50% of the abstracts dealt directly or indi- control and expression of cell-cycle-specific genes; rectly with viral oncogenes and their cellular ho- the coordinated expression of banks of genes such mologs, and it was clear that the existence of mutant as cell-type-specific, ribosomal, and sporulation; v-onc genes will continue to provide an important and the induction of metabolic genes. This past year probe into c-onc function. Central issues con- has seen the development of techniques for return- cerned the various mechanisms of oncogene acti- ing in-vitro-generated mutant sequences to their vation and the structure of c-onc genes in species proper place in the chromosome. Thus, the analysis as diverse as Drosophila, the frog X. laevis, man, of the function and regulation of genes is progress- and most novel and striking, yeast, where one group ing to the point of making single base-pair changes. reported finding ras-gene homologs. Cloned sequences have allowed the physical char- Retroviruses as vectors was a subject of increas- acterization of genetic rearrangements such as re- ing interest. Also, there were numerous abstracts combination between reiterated sequences, hops by

119 the transposon Ty 1, amplification of genes, and MODERN APPROACHES mating-type switching. These same technologies provide the raw material for the characterization of TO VACCINES yeast extracts exhibiting replication or recombina- August 31-September 4 tion of yeast plasmids. Furthermore, this meeting provided a forum for exchanging observations on Arranged by the use of yeast to express and properly localize or Robert Chanock, National Institutes of Health secrete proteins for use in biochemical or commer- Richard Lerner, Research Institute of Scripps cial enterprises. In summary, this meeting provided Clinic an invaluable opportunity to bring major yeast lab- oratories together to compare notes on their prog- 241 participants ress toward utilizing the various molecular ap- proaches to understand the biology of yeast. This meeting concentrated on the latest contribu- This meeting was supported by financial contri- tions of a worldwide selection of leading laborato- butions from Biogen Research Corp.; Hoffman- ries in the field of vaccines. Topics included viral LaRoche, Inc.; Pfizer, Inc.; Smith Kline & French structure and function as they relate to the devel- Laboratories; Biogen N.V.; Genentech, Inc. ; opment of vaccines; chemistry of virus neutraliza- Zymos Corp.; and LaBatt Brewing Company. tion; new experimental approaches to the construc- tion of viral proteins, including cloning and the expression of viral genes in prokaryotic and eukary- otic cell systems; attenuation of virulence; and en- hancement of antigenicity and immunogenicity. The broad scope of this meeting was of interest PHAGE AND BACTERIAL to individuals doing research on infectious disease, public health officials concerned with new strate- REGULATORY gies in the study and control of infection, members MECHANISMS of the pharmaceutical industry involved in the de- velopment of vaccines, regulatory authorities who August 23-August 28 set safety and efficacy standards for vaccines, and immunologists. Arranged by Funding was provided in part by Merieux Insti- Ahmad Bukhari, Cold Spring Harbor tute, Inc.; Merck and Co., Inc.; and Wellcome Bio- Laboratory technology, Ltd. Sankar Adhya, National Cancer Institute Harrison Echols, University of California, Berkeley 228 participants THE CANCER CELL September 8-September 13 This meeting formally joined the phage and its host for the first time at the level of their scientific ad- Arranged by mirers. Presentation of recent work on the ge- Arnold Levine, State University of New York, netics, physiology, and biochemistry of prokaryotic Stony Brook organisms attested to the value of this union be- William Topp, Cold Spring Harbor Laboratory cause of the similarity of molecular mechanisms George Vande Woude, NCI, National Institutes and of techniques for elucidating them. One high- of Health light of the meeting was the opportunity to note the James D. Watson, Cold Spring Harbor enormous diversity of regulatory mechanisms, an Laboratory aspect of prokaryotic control once overshadowed by the early understanding of the lac system of neg- 262 participants ative regulation. Transcription is regulated posi- tively and negatively at the initiation and termi- The Cancer Cell meeting begins a new series of nation stage; posttranscriptional regulatory mech- meetings on this topic that will replace the Cell anisms abound, including initiation and completion Proliferation and Cancer Conferences. The meet- of protein synthesis and protein stability. Another ing format sought to bring together scientists from highlight was the chance to view the integration of diverse disciplines and approaches to focus on the diverse individual mechanisms into a unified regu- molecular and cellular aspects of the cancer cell. latory response, as in the lysis-lysogeny decision Both RNA and DNA tumor virologists discussed by bacteriophage X and the SOS and heat-shock re- the gene structure, gene products, and functions of sponses of bacteria. oncogenes and virogenes involved in transforma-

170 tion and tumorigenesis. Cell biologists contributed 113 participants sessions on growth factors, the keratins and cyto- skeletal elements, chromosomal rearrangements, This was the first international meeting on human tumor promoters, and cancer cell surface antigens. T-cell leukemia viruses (HTLV). HTLV is the first The meeting succeeded in providing some unifying retrovirus that has been characterized that is clearly principles for the mechanisms of action of cell-de- associated with human leukemia/lymphoma. The rived oncogenes and DNA-virus-derived virogenes initial isolation in 1979 by Gallo and co-workers in the transformation process. The bridge from vi- was followed by additional isolations in Japan and rology to cell biology has begun with new relation- elsewhere. To date, there are approximately 35 iso- ships between oncogene products and growth fac- lates of HTLV worldwide. All of the HTLV isolates tors, chromosome rearrangements and oncogenes, except two belong to the HTLV-I subgroup. The and altered cytoskeletal genes and gene products. other two isolates belong to a related but distinctly The first clues to these unifying principles of on- different group designated HTLV-II, originally iso- cogenic mechanisms and their apparent relation- lated from a patient with hairy-cell leukemia. The ships to the problem of human cancer provided an clustering of adult T-cell leukemia/lymphoma appropriate level of excitement for this meeting (ATLL) in the southern islands of Japan led to the dedicated to Mrs. Albert D. Lasker. Her contribu- suspicion that ATLL might be caused by an infec- tions to the funding of this research over four de- tious agent. Further epidemiologic analysis world- cades were celebrated by the high caliber of science wide has exposed other areas of HTLV-associated and the rapid rate of progress now evident in this disease. HTLV is endemic in the southern islands field. of Japan, regions of Africa, southeastern United This meeting was supported by grants from the States, the Caribbean, and regions of Central and American Cancer Society, Becton-Dickinson and South America. Another disease of current world- Company, the Fogarty International Center, and the wide interest is the acquired immune deficiency National Cancer Institute. syndrome (AIDS). HTLV has been isolated from several AIDS patients. Although there is no clear etiology, HTLV has been linked to AIDS by virus isolation, molecular biology, and seroepidemiol- HUMAN T-CELL ogy. LEUKEMIA VIRUSES This meeting was supported in part by grants from the National Cancer Institute and Fogarty In- September 14-September 15 ternational Center, Cancer Research Institute, and N.Y.S. Department of Health. Arranged by Myron Essex, Harvard School of Public Health Robert Gallo, National Cancer Institute

121

POSTGRADUATE COURSES

The summer program of Postgraduate Courses at Cold Spring Harbor Laboratory is aimed at meeting the special need for training in interdisciplinary subjects which are either so new or so specialized that they are not ade- quately treated by universities. Our aim is to provide intensive study in the most recent developments and tech- niques in these subjects and to prepare students to enter directly into research in a particular area. To ensure up- to-date coverage of current research work, we bring together a workshop staff from many laboratories around the world and supplement this staff with a series of seminar speakers.

THE CELLULAR AND Sussex, Ian, Ph.D., Yale University, New Haven, MOLECULAR BIOLOGY Connecticut ASSISTANTS OF BEHAVIOR Waldren, John, CSIRO, Canberra, Australia June 10-June 23 Brown, Susan, Massachusetts General Hospital, Boston INSTRUCTORS Dunn, Barbara, Harvard University, Cambridge, Kandel, Eric, M.D., Columbia University, New Massachusetts York, New York Mclndoo, Jean, Cold Spring Harbor Laboratory, Koester, John, Ph.D., Columbia University, New New York York, New York LABORATORY INSTRUCTORS Nottebohm, Fernando, Ph.D., Rockefeller Dunsmuir, Pamela, Ph.D., CSIRO, Canberra, University, New York, New York Australia Pearson, Keir, Ph.D., University of Alberta, Jones, Jonathan, Ph.D., Advanced Genetic Canada Sciences, Berkeley, California Dellaporta, Stephen, Ph.D., Cold Spring Harbor This lecture course was designed to introduce stu- Laboratory, New York dents to cellular and molecular biological approaches Miles, Don, Ph.D., University of Missouri, to the study of behavior and learning. Rather than Columbia being exhaustive, the lectures provided an intensive Steinbeck, Kit, Ph.D., Advanced Genetic Sciences, coverage of four main areas: (1) general principles of Berkeley, California behavior and of cellular neurobiology, including reg- Ho, David, Ph.D., University of Illinois, Chicago ulation of gene expression; (2) simple forms of be- havior, learning, and motivation, and the role of bio- This course provided an introduction to current tech- genic amines, hormones, and peptidesintheir niques for the manipulation of plant material as ap- modulation; (3) initiation and maintenance of com- plied to experiments in molecular biology and ge- plex locomotor sequences, including voluntary move- netics. It was designed primarily for scientists working ment and motor learning; and (4) communication. To in other areas who wish to pursue research in plants. illustrate general principles, suitable systems for study It was assumed that applicants had a general working were selected from both invertebrate and vertebrate knowledge of molecular biology, but no previous ex- behavior. Emphasis was placed on the application of perience with plants was required. Experiments were recombinant DNA technology in the analysis of be- designed to emphasize aspects unique to plant sys- havior. To put the cellular work into perspective, se- tems, including mutagenesis and analysis of mutants, lected examples were also taken from human behav- tissue culture techniques, protoplast isolation and cul- ior and its abnormalities. Guest lecturers included: R. ture, regeneration of plants from culture, DNA and Axel, A. Fuchs, P. Getting, C. Ghez, I. Kupfermann, RNA isolation and cloning procedures, crown gall tu- G. Ojemann, R. Scheller, N. Suga, T. Thach, J. Tru- morigenesis, chloroplast genetics, and nitrogen fixa- man, J. Wine, R. Wurtz, and R. Zigmond. This tion. Guest lecturers provided a background in plant course was designed for advanced graduate students morphogenesis, physiology, pathology, genetics, and and research workers. A prior course in neurobiology cytology. Different plant species were used to illus- was required. trate particular experimental techniques, but the course emphasized tobacco and maize as model MOLECULAR BIOLOGY OF systems. PLANTS NERVOUS SYSTEM OF June 10-June 30 THE LEECH INSTRUCTORS June 10-June 30 Bedbrook, John, Ph.D., Advanced Genetic Sciences, Berkeley, California INSTRUCTORS Malmberg, Russell, Ph.D., Cold Spring Harbor Nicholls, John, Ph.D., M.D., Stanford University Laboratory, New York Medical School, California 125 Muller, Ken, Ph.D., Carnegie Institution of combination, purification and characterization of Washington, Baltimore, Maryland recombinant clones using restriction endonuclease and Thompson, Wesley, Ph.D., University of Texas, blot hybridization analyses, and reintroduction and Austin expression of cloned genes in heterologod systems. Strategies for isolating genes that encode rare mRNA In this laboratory course students used intracellular sequences were discussed. Guest lecturers discussed and extracellular recording techniques to recognize the application of molecular cloning procedures to the individual motor and sensory nerve cells, to map the study of specific eukaryotic gene systems. fields they innervate in the periphery, to measure their membrane properties, and to trace their synaptic conpections. Other techniques used included: staining cells with GENETICS AND horseradish peroxidase and Lucifer yellow, making chronic lesions in the CNS, and recording from cells MOLECULAR BIOLOGY OF in swimming preparations. In addition, the technique CHLAMYDOMONAS involved in staining leech cells with monoclonal anti- bodies was demonstrated. Last year, seminars and June 26-June 30 demonstrations were given by B. Zipser, W. Kristan, G. Stent, D. Weisblat, 0. Friesen, R. McKay, and S. CHAIRMAN Hockfield. Gillham, Nicholas W, Ph.D., Duke University, Our aim was to accept students who want to go on Durham, North Carolina and work with the leech or a similar preparation. On ORGANIZING COMMITTEE the other hand, students that wished to use this course Boynton, John E., Ph.D., Duke University, as an advanced techniques course were accepted if Durham, North Carolina their interest was great enough. Some prior knowl- Harris, E.H., Ph.D., Duke University, Durham, edge of neurobiology and experience in electrical re- North Carolina cording were required for this course. Luck, David J.L., M.D., Ph.D., Rockefeller University, New York, New York Goodenough, Ursala, Ph.D., Washington MOLECULAR CLONING OF University, St. Louis, Missouri EUKARYOTIC GENES The green alga Chlamydomonas is recognized as a June 10-June 30 particularly favorable model system for the study of a variety of basic biological problems. Students in this INSTRUCTORS 4-day combined course and conference participated Fritsch, Edward, Ph.D., Genetics Institute, in workshops with invited scientists working on the Boston, Massachusetts molecular biology, physiology, and genetics of this Davis, Mark, Ph.D., Stanford University, organism. Through review lectures, panel discus- California sions, and demonstrations, specialists working on Mullins, James, Ph.D., Harvard School of Public Chlamydomonas explored the use of this organism in Health, Boston, Massachusetts investigations of photosynthesis, flagellar structure and function, the cell cycle, porphyrin biosynthesis, ASSISTANTS chloroplast genetics, phototaxis, mating, and other Kim, Stu, B.S., California Institute of Technology, topics. In addition, techniques such as genetic analy- Pasadena sis, transformation, and gene cloning in Chlamydo- Boyer, Paul, B.S., Michigan State University, East monas were covered. This conference/course was de- Lansing signed to bring together established workers in the Federspiel, Mark, B.S., Michigan State University, field with people interested in using Chlamydomonas East Lansing as a research tool and was conducted in an informal setting where maximum interaction is possible be- This laboratory and lecture course covered the prin- tween the participants. ciples of recombinant DNA technology and the appli- cation of these procedures to the study of eukaryotic genes. The isolation and characterization of cellular structural genes were emphasized. Among the topics covered were the construction of cDNA libraries in MOLECULAR plasmid or bacteriophage X vectors, construction of EMBRYOLOGY OF THE bacteriophage X and cosmid libraries of high-molec- ular-weight eukaryotic DNA, screening DNA librar- MOUSE ies with gene-specific hybridization probes and by re- July 3-July 16

126 INSTRUCTORS Single-channel recording and other applications of the Hogan, Brigid, Ph.D., Imperial Cancer Research patch-clamp technique were taught in this intensive Fund, London, England lab/lecture course. Costantini, Frank, Ph.D., Columbia University, The laboratory work, in which two participants New York, New York work with each instructor, began with all groups Lacey, Liz, Ph.D., Memorial Sloan-Kettering working on a common preparation. Participants Cancer Institute, New York, New York learned to make electrodes; establish giga-seals; form ASSISTANTS inside-out, outside-out, and cell-attached patches; Barlow, Denise, Ph.D., Imperial Cancer Research voltage clamp whole cells; and to recognize and spe- Fund, London, England cifically activate different channel species. The third Raphael, Katherine, Columbia University, New week was spent on individual projects with prepara- York, New York tions of particular interest to the participants. Lee- tures covered electrode fabrication; properties of This course was designed for biochemists, molecular glasses and formation of a seal; design of the patch- biologists, and cell biologists interested in applying clamp circuit and sources of electronic noise; primary their expertise to the study of mouse development. In cell culture and cell lines; ion permeation and single- particular, the genetic manipulation of the mouse channel conductance; procedures for whole-cell through the introduction of foreign genes and cells clamp, separation of currents; rate theory and mac- into early embryos was stressed. Through laboratory roscopic kinetics; stochastic processes and single- exercises and lectures, the participants were intro- channel statistics; single-channel behavior and noise duced to the following procedures and their possible spectra; stimulation and data acquisition with com- applications: the isolation and in vitro culture of germ puters; and algorithms for single-channel analysis. cells and preimplantation and early postimplantation embryos, the microinjection of DNA into fertilized eggs, nuclear transplantation, the formation of chi- meras, dissection of germ layers, the localization of ADVANCED antigens and mRNAs in embryonic tissue sections, NEUROANATOMICAL and basic mouse handling and breeding techniques. Guest speakers discussed current research in related METHODS fields. July 3 —July 23

SINGLE-CHANNEL INSTRUCTORS RECORDING Jones, Edward G., Ph.D., Washington University, St. Louis, Missouri July 3 —July 23 Hand, Peter J., Ph.D., University of Pennsylvania, Philadelphia INSTRUCTORS Pickel, Virginia M., Ph.D., Cornell Medical Aldrich, Richard W., Ph.D., Yale University, New School, New York, New York Haven, Connecticut Wise, Steven P., Ph.D., National Institute of Cahalan, Michael D., Ph.D., University of Mental Health, Bethesda, Maryland California, Irvine Hendry, Stewart, Ph.D., Washington University, Corey, David P., Ph.D., Yale University; New St. Louis, Missouri Haven, Connecticut ASSISTANTS Dionne, Vincent E., Ph.D., University of California, San Diego Donoghue, John, National Institute of Mental Hume, Richard I., Washington University, St. Health, Bethesda, Maryland McClure, Bertha, Washington University, St. Louis, Missouri Lewis, Richard, Ph.D., California Institute of Louis, Missouri Hand, Carol, University of Pennsylvania, Technology, Pasadena Stevens, Charles F., M.D., Ph.D., Yale University, Philadelphia New Haven, Connecticut This is an intensive laboratory course in basic and LECTURERS advanced neuroanatomical methodology given by six Breakfield, Xandra O., Ph.D., Yale University, or more faculty, three assistants, and six visiting New Haven, Connecticut speakers. Students, individually or in pairs, carried Yellen, Gary, Ph.D., Yale University, New Haven, out an anatomical analysis of one of several parts of Connecticut the mammalian CNS. Methods used were anterograde ASSISTANT and retrograde axonal tracing by autoradiography, en- Stevens, Meg, Harvard University, Boston, zyme histochemistry, and fluorescent dyes; neuro- Massachusetts transmitter uptake and receptor binding techniques;

127 immunocytochemistry using conventional and mono- MOLECULAR AND clonal antibodies; and metabolic mapping by 2-deoxy- CELLULAR D-glucose uptake and certain oxidative enzymes. Students received training in conventional light and NEUROBIOLOGY electron microscopy methods, fluorescence micros- July 3 -July 23 copy, animal surgery, microinjectionmethods under electrophysiological control, photomicrography, au- INSTRUCTORS toradiography, and immunocytochemistry, as well as Rahamimoff, Rami, M.D., Hebrew University, practice in the use of most of the more common lab- Jerusalem, Israel oratory instruments. McMahan, U. Jack, Ph.D., Stanford University, Lectures by the faculty and by a series of visiting California speakers covered the methodologies used, dealt with PART-TIME INSTRUCTORS selected research on the parts of the CNS being inves- Herbert, Edward, Ph.D., University of Oregon, tigated, and provided insights into newly developed Eugene techniques. Stevens, Charles, M.D., Ph.D., Yale Medical School, New Haven, Connecticut Yoshikami, Doju, Ph.D., University of Utah, Salt Lake City ADVANCED BACTERIAL The aim of this intensive course was twofold: (1) to examine in detail the principles of nervous system GENETICS function, structure, and development at the cellular July 3 -July 23 and molecular level, and (2) to define specificprob- lems in neurosciences that can be studied byrecently INSTRUCTORS developed techniques in molecular and cellularbiol- Berman, Michael L., Ph.D., NCI, Frederick ogy. One week was devoted tothe application of mo- Cancer Research Facility, Frederick, Maryland lecular biological methods to nervous systemprob- Enquist, Lynn W., Ph.D., Molecular Genetics, lems. Specific topics included generalprinciples of Inc., Minnetonka, Minnesota molecular biology; the use of recombinantDNA Silhavy, Thomas J., Ph.D., NCI, Frederick Cancer methodology to study the regulation of neuropeptides Research Facility, Frederick, Maryland and acetylcholine use of hybridoma tech- nology for identification and characterizationof spe- ASSISTANTS and examina- Bear, Susan, Ph.D., NCI, National Institutes of cific molecules in the nervous system; tion of the genetic basis of specific patternsof Health, Bethesda, Maryland the syn- Garrett, Stephen, B.A., NCI, Frederick Cancer behavior. The cellular approach focused on synaptic excitation and Research Facility, Frederick, Maryland apse. Topics covered included inhibition; structure of presynaptic andpostsynaptic Bremer, Erhard, Ph.D., NCI, Frederick Cancer of neuro- Research Facility, Frederick, Maryland elements; release, storage, and inactivation transmitters; noise analysis and single-channelrecord- of recep- This course demonstrated the use of gene fusions, ing; structure, distribution, and metabolism immunology; electrical transposable elements, and recombinant DNA for ge- tor molecules; synaptic slow synaptic potentials; netic analysis in Escherichia coli. Students learned to synapses and gap junctions; construct gene fusions both in vivo and in vitro.Sub- synaptic development; degeneration and regenera- and neuro- sequent experiments stressed the use of thesefusions tion; role of peptides in neural function; for monitoring gene expression and, in conjunction biology of certain diseases. with transposable elements, for obtaining defined mu- tations (nonsense, deletion, and insertion) either in the target gene or in regulatory genes. Recombinant DNA was applied to clone and define physically the target gene, the regulatory genes, and thesites of ac- NEUROBIOLOGY OF tion of the regulatory proteins at the target gene. In HUMAN DISEASE addition, the cloned DNA and the defined mutations were used to analyze the genes andthe regulatory sys- July 24-July 30 tem genetically. For the sake of clarity,the course fo- cused on a particular regulon; however, the experi- INSTRUCTORS mental techniques presented were sufficientlygeneral Black, Ira B., M.D., Cornell University Medical to be applicable to any gene inE. coli for which College, New York, New York there exists a mutation conferring arecognizable Breakefield, X.O., Ph.D., Yale University School of Medicine, New Haven, Connecticut phenotype.

128 This intensive seminar course explored the cellular ELECTROPHYSIOLOGICAL and molecular basis of abnormal neural function, de- lineating the pathogenesis of neuropsychiatric disor- METHODS USED IN ders. Experimental models and human disease coun- ANALYZING THE MODE terparts were examined in detail. Topics included: (1) molecular basis of neurotransmitter derangement; (2) OF ACTION OF mechanisms of consciousness and the genesis of TRANSMITTERS coma; (3) neurophysiology of lateralization of brain July 26-August 15 function; (4) cellular basis of regeneration of brain systems; (5) mechanisms of dementia, including Alz- INSTRUCTORS heimer's disease; (6) experimental models of degen- Schuetze, Stephen, Ph.D., Columbia University, erative disorders, including Huntington's disease; (7) New York, New York genesis of movement disorders, including dystonia; Siegelbaum, Steven, Ph.D., Columbia University, (8) mechanisms underlying epilepsy; (9) biochemis- New York, New York try of the lipidoses; (10) slow virus infections of the Ascher, Philippe, D.Sc., Ecole Normale nervous system; (11) molecular basis of pain syn- Superieure, Paris, France dromes; (12) cellular biology of peripheral neuropa- thy; (13) pathogenesis of myasthenia gravis; and (14) In this experimental course, students were introduced diseases of DNA repair. to the various electrophysiological techniques that are currently applied to the study of transmitter action on ADVANCED TECHNIQUES ion channels in skeletal muscle and invertebrate neu- rons. They used both basic voltage-clamp techniques IN MOLECULAR CLONING (including a single microelectrode voltage clamp) as OF EUKARYOTIC GENES well as the patch-clamp technique for single-channel July 26-August 15 recording. Aspects of the theory of the techniques as well as some basic biochemical and biophysical prin- ciples of transmitter actions were also covered. INSTRUCTORS Smith, Michael, Ph.D., University of British Columbia, Vancouver, Canada Zoller, Mark, Ph.D., University of British Columbia, Vancouver, Canada Atkinson, Tom, B.S., University of British YEAST GENETICS Columbia, Vancouver, Canada Fiddes, John, Ph.D., California Biotechnology, July 26-August 15 Inc., Mountain View Shortle, David, Ph.D., State University of New INSTRUCTORS York, Stony Brook Sherman, Fred, Ph.D., University of Rochester, New York This was a laboratory and lecture course on advanced Fink, Gerald, Ph.D., Massachusetts Institute of aspects of molecular cloning designed for scientists Technology, Cambridge who are familiar with basic recombinant DNA tech- Hicks, James, Ph.D., Cold Spring Harbor niques. It included the chemical synthesis of oligo- Laboratory, New York deoxyribonucleotides of defined sequence and their ASSISTANT characterization by the Maxam-Gilbert sequencing Kim, Jinimi, Massachusetts Institute of method. These oligonucleotides were used in various Technology, Cambridge ways, including their use as probes for the isolation of specific genes from libraries and as reagents for The major laboratory techniques used in the genetic directing site-specific in vitro mutagenesis. Specific analysis of yeast were studied, including the isolation mutants were isolated, and the sequence of the altered and characterization of chromosomal and mitochon- genes was determined. Other methods of in vitro mu- dria) mutants, tetrad analysis, chromosomal mapping, tagenesis such as nucleotide misincorporation into mitotic recombination, and test of allelism and com- DNA, sodium bisulfate treatment of DNA, and linker plementation. Micromanipulation used in tetrad anal- insertion were covered in both laboratory exercises ysis was carried out by all students. Recombinant and lectures. DNA techniques, including yeast transformation, fil- Guest lectures and demonstrations covered the ap- ter hybridization, and gel electrophoresis, were ap- plication of these techniques to analysis of various plied to cloning and genetic analysis of yeast DNA. cloned genes, as well as the use of alternate methods Lectures on fundamental aspects of yeast genetics of mutagenesis, expression, and analysis of cloned were presented along with seminars given by outside genes by immunological screening. speakers on topics of current interest.

129 IMMUNOGLOBULINS: ers covered the following topics: structure and func- tion of immunoglobulins; thermodynamics of antigen- MOLECULAR PROBES OF antibody interaction; molecular genetics of antibody THE NERVOUS SYSTEM diversity; cellular regulation of the immune response; ;DNA expression vectors־July 26—August 15 hybridoma technology; c synthetic peptides; cell recognition and differentiation INSTRUCTORS antigens; immunological characterization of the ace- Brockes, Jeremy, Ph.D., Kings College, London, tylcholine receptor, the neuromuscular junction, and England synaptic components of the central nervous system; McKay, Ronald, Ph.D., Cold Spring Harbor and immunological characterization of cellular diver- Laboratory, New York sity in the invertebrate and vertebrate nervous system. The laboratory work focused around a practical in- ASSISTANT troduction to generating monoclonal antibodies to Kitner, Chris, Ph.D., Kings College, London, simple and complex antigens. In addition, some of the England growing number of associated immunological tech- niques were taught, e.g., antigen preparation, com- Through laboratory work and lectures, this course was plement-mediated lysis, solid-phase immunoassays, designed to provide an advanced understanding of the immunoprecipitation, Western blotting, purification power and limitations of immunoglobulins as a means and conjugation of immunoglobulins, double diffu- of identifying and characterizing molecules of interest sion, affinity purification, and immunocytochemical to neuroscientists. It was intended for research scien- techniques. tists at all levels. A series of lectures by invited speak­

130 BANBURY CENTER Recto: Interior view of Sammis Hall, Banbury Center's guest house, designed by Moore Grover Harper,PC., 1981. REPORT OF THE DIRECTOR

Scientific meetings have been recognized as being important to the progress of science at least since the 1660s, when the newly established Royal Society assumed the regular holding of such meetings at Gresham College in London as one of its main functions. The establishment, in 1977, of an intimate and informal biological sciences conference center within the magnificent estate atop Banbury Lane was entered upon very much within this tradition. The small, highly interactive conferences of the Banbury Center have proven of particular value not just in the promotion of rapid and efficient communication of new data and concepts, but also in their further refinement and development during the spontaneous discussions and anal- yses that are an intrinsic part of the meeting dynamic itself. This is especially important in areas where previously divergent approaches may be coming together for the first time as well as in facilitating progress in existing fields either through identification of critical areas to be addressed or by placing possible imped- iments to progress within broader disciplinary perspectives. This, the sixth year of such activities at the Banbury Center of Cold Spring Harbor Laboratory, saw a continuation and development of the Center's three broad areas of identified interest: human health risk assessment; pivotal areas accruing from newer approaches such as recombinant DNA methodologies and related molecular genetic manipulations; and the bringing of such perspectives to the attention of major public health concerns, especially in the area of biological aspects of, and possible interventions in, aging. The first 1983 meeting occurred early in February and addressed the increasingly pressing public health problem presented by acquired immunodeficiency syndrome (AIDS). This meeting, by bringing together immunologists, epidemiologists, pathologists, virologists, and public health officials in a small, informal yet intensive environment, proved particularly useful for setting priorities and developing a greater coher- ence of effort in approaches to this growing health concern. It was fairly clear, by the meeting's conclusion, that a consensus was developing for a concerted search for a blood-borne viral agent, the properties of which could at least begin to be loosely defined. Subsequent events are tending to bear out the soundness of what was then still a tentative and perhaps somewhat controversial proposal. If the AIDS conference was meant to help facilitate the coalescing of divergent approaches addressing the same central problem, the next two Banbury meetings were perhaps more useful in delineating and better defining critical areas to be addressed in already recognized important research areas. The first of these meetings, Plant Viruses and Viroids, considered an area of great potential importance not only in molecular biology, but also with regard to practical application. These often strange infectious agents, apparently unique to plants, present possible new mechanisms by which genetic material may be replicated, perpetu- ated, and transmitted from cell to cell or from plant to plant. The second meeting, held in the early spring, considered an equally important topic from both research and practical application perspectives -the ways in which the activities of genes may be regulated. This conference, Enhancers and Controlling Elements, focused on eukaryotic DNA sequences that, when placed anywhere in the vicinity of a given gene, have great effects upon the expression of that gene within the cell. Identification of such sequences will have great significance for fundamental questions of biology, such as molecular mechanisms of development, as well as for the manipulation of gene products in practical application. Plant Infectious Agents and Enhancers and Eukaryotic Gene Expression have both been published in extended abstract form as part of the Cold Spring Harbor Laboratory series Current Communications in Molecular Biology. The Banbury Center publishing program also remained quite active in 1983 with the appearance of three new titles, two in the ongoing Banbury Report series and one as the first Banbury publication directed to a wider, nonscientific audience. Banbury Report 14, Recombinant DNA Applications to Human Disease, grew out of a fall 1982 conference considering new approaches that combine DNA cloning and hybridization techniques with more traditional genetic methodologies for identification and diagnosis of genetic defects at the level of the defective gene itself. The second 1983 book emanating from the 1982 conference program was Banbury Report 15, Biological Aspects of Alzheimer's Disease. Reflecting the impetus of the original conference in bringing together clinicians and basic researchers for an exploration of the origins and path- ological bases of this devastating major health concern, this volume has proved a useful compendium both

133 of the current state of knowledge and of possible derstanding of what these technologies are likely to leads on how this might further be developed in the achieve and of the relative advantages and disad- future. The final publication of 1983 also grew out vantages of competing approaches. They must also of a 1982 Banbury conference, but it was the first have an overall feel for the benefits, risks, and costs Banbury publication outside of the Banbury Report that these technologies will potentially bring to the series. Gene Therapy: Fact and Fiction, published U.S. health care capability at large. The December as a “Banbury Public Information Report,” com- workshop, which considered everything from the bined the edited transcribed proceedings of the theoretical foundations of this technology to the original conference with additional interpretive and practical installation of the apparatuses themselves, descriptive material in an attempt to make known together with multiple examples of just what such to the public at large the import of this high-level approaches are currently achieving and are likely scientific meeting on a topic that continues to be of to achieve in the near future, helped to clarify con- significant public interest and concern. siderably the complexities of this new area of med- Although Gene Therapy: Fact and Fiction was a ical technology. departure in publishing for the Banbury Center, the Finally, two full Banbury Conferences, each with function of the Center in broadly disseminating in- an ensuing Banbury Report, were held in the fall of formation about developments in key areas of the 1983. The first of these, held in early October, con- biological sciences has been ongoing almost since sidered the genetic predisposition of the individual Banbury’s inception. Under continuing support in response to chemical exposure. Many of the bod- from the Sloan Foundation, Banbury Center has ily systems concerned with maintenance and integ- carried out a series of informational workshops rity of function, or with metabolic activation or de- specifically designed either for media representa- toxification of chemicals, have such a large degree tives or for congressional aides and staff members. of underlying genetic variability that each individ- Two such Sloan Informational Workshops were held ual almost certainly presents a unique profile of in 1983. The first of these, New Concepts in Mu- strengths and susceptibilities. Individualized ge- tation, was a summer workshop for journalists. For netic susceptibility profiles could clearly have a many years, mutational mechanisms could be stud- place in preventive medicine or even as personal- ied productively mainly in microorganisms. The ized guides toward maximizing health and safety. advent of current DNA methodologies, however, There have already been controversial nascent at- has presented opportunities for the highly effective tempts to apply such concepts to workers employed study of such processes in higher organisms as well. in hazardous workplace environments. The Octo- The cumulative body of microorganismal data, to- ber conference, considering in depth the scientific gether with the rapidly emerging new concepts de- data base underlying such possible approaches, is rived from approaches in higher organisms, is lead- to be published as Banbury Report 16, Genetic Var- ing to new perspectives on the origins and roles of lability in Responses to Chemical Exposure. mutation and on the mutational dynamic underlying The second full Banbury Conference, held at the biological evolution. These topics were considered end of October and into early November, examined in depth at the Sloan Journalists’ Workshop, as well the health consequences of coffee consumption. as at the subsequent full Banbury scientific confer- Due to the great popularity and prevalence of this ence, Mechanisms of Mutagenesis. beverage, even possible minor deleterious effects The second Sloan workshop, Biological Imaging have potentially far-reaching impact. The Coffee and Nuclear Magnetic Resonance, was held early in and Health conference assembled researchers from December for congressional staff members. This both private and public sectors representing both rapidly developing area of medical technology is epidemiological and experimental approaches to achieving spectacular results in imaging both struc- this question. These proceedings, reviewing major ture and function in the living body while employ- ongoing studies together with assessment of where ing minimally invasive procedures. However, the such research thrusts may be leading, is to be pub- costs can also be spectacular, and during this rela- lished as Banbury Report 17 in the spring of 1984. tively early stage of development, it is imperative for congressional decision makers to have an un­ Michael Shodell

134 1983 SUPPORT

Together with the donation to Cold Spring Harbor tional Coffee Organization; contributions toward Laboratory of his estate on Banbury Lane, Charles publication of these proceedings were received S. Robertson also generously supplied an endow- from the Folger Coffee Company, the Nestle Com- ment for upkeep of the grounds and of Robertson pany, Inc., and Tetley, Inc. The conference on Plant House proper. However, maintenance of Sammis Viruses and Viroids received corporate contribu- Hall and the conference center, as well as support tions from Monsanto Company, ARCO Plant Cell for Banbury Center conferences and publicatioris, Research Institute, Pfizer Central Research, Agri- remains strictly dependent upon government and genetics Corporation, and Calgene Corporation. foundation grants and corporate contributions. In The Enhancers and Controlling Elements confer- 1983, Banbury Center activities were greatly facil- ence was made possible by donations provided by itated by unrestricted core support accruing from Abbott Laboratories, Applied Molecular Genetics, the generous donations of nine corporations: The Inc., Biogen N.V., the Cetus Corporation, Collab- Bristol-Myers Fund, Inc., Conoco, Inc., The Dow orative Research, Inc., E.I. du Pont de Nemours & Chemical Company, E.I. du Pont de Nemours & Company, Genentech, Inc., Lilly Research Labo- Company, Exxon Corporation, Getty Oil Company, ratories, and the Monsanto Company. The confer- International Business Machines Corporation, Eli ence on Acquired Immunodeficiency Syndrome was Lilly & Company, and Texaco Philanthropic Foun- supported by a grant from the Cancer Research In- dation, Inc. In addition, the Center was able to pro- stitute and the National Cancer Institute (National ceed with specific conference programs as a result Institutes of Health). The meeting on Mechanisms of the following grants and contributions: The Role of Mutagenesis was supported in part by a grant of Genetic Predisposition in Responses to Chemi- from the March of Dimes Birth Defects Founda- cal Exposure was supported by the National Cancer tion. These generous grants and donations in sup- Institute, the National Institute of Environmental port of the Banbury Center program are gratefully Health Sciences, and the Fogarty International acknowledged. Collectively, these grants and con- Center, together with essential additional support tributions, the ongoing Sloan Foundation sponsor- from the American Occupational Medical Associa- ship of informational workshops for journalists and tion, the Aluminum Company of America, E.I. du congressionalstaff,and contributions received Pont de Nemours & Company, Johnson & Johnson, from the Kaiser Family Foundation financing the the Occupational Health Institute, Inc., and United publication of Gene Therapy: Fact and Fiction and States Steel. Support for Coffee and Health was ob- the original conference on this topic have formed tained from Cold Spring Harbor Laboratory, with the financial base that has permitted continuation major additional funding from the National Coffee of the Banbury Center program through its sixth Association of the U.S.A., Inc., and the Interna- year of operation.

Alfred Pfeiffer 1919 - 1984 When the Banbury estate was donated to Cold Spring Harbor Laboratory, the Laboratory was es- pecially fortunate in being able to retain the serv- ices of the estate's head groundskeeper, Fred Pfeif- fer. Fred not only continued to give his special type of care to the estate's grounds, but also brought to the Banbury community a special sense of culture and thoughtfulness. Fred's sudden death in March, 1984, just months before he was due to retire, was a great loss. He will continue to be missed by the staff and visitors to the Banbury Center.

135

FINANCIAL REPORT

COLD SPRING HARBOR LABORATORY SOURCES OF REVENUE YEAR END DECEMBER 31,19 83

Endowments Auxiliary Activities 3.2% 19.0%

Non-Federal Grants Private Contributions 23.6% .7% Interest and Miscellaneous 3.0%

FINANCIAL SUPPORT OF THE LABORATORY

Cold Spring Harbor Laboratory is a non-profit research and educational institution chartered by the University of the State of New York. Contributions are tax exempt under the provisions of Section 501(c)(3) of the Internal Revenue Code. In addition, the Laboratory has been designated a "public charity" and, therefore, may receive funds resulting from the termination of "private" foundations. Because its endowment is limited and the uses of research grants are formally restricted, the Labo- ratory depends on generous contributions from private foundations, sponsors, and friends for central institutional needs and capital improvements. Over the years, the Laboratory has won a reputation for innovative research and high-level science education. By training young scientists in the latest experimental techniques, it has helped spur the development of many research fields, including tumor virology, cancer genes, gene regulation, move- able genetic elements, yeast genetics, and molecular neurobiology. However, the continued develop- ment of new research programs and training courses requires substantial support from private sources.

Methods of Contributing to Cold Spring Harbor Laboratory Gifts of money can be made directly to Cold Spring Harbor Laboratory. Securities You can generally deduct the full amount of the gift on your income tax return, and, of course, you need pay no capital gains tax on the stock's appreciation. We recommend any of the following methods: (1) Have your broker sell the stock and remit the proceeds to Cold Spring Harbor Laboratory. (2) Deliver the stock certificates to your broker with instructions to him to open an account for Cold Spring Harbor Laboratory and hold the securities in that account pending instructions from Cold Spring Harbor Laboratory. (3) Send the unendorsed stock certificates directly to the Laboratory: Comptroller, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724. In a separate envelope send an executed stock power. Bequests Probably most wills need to be updated. Designating Cold Spring Harbor Laboratory as benefi- ciary ensures that a bequest will be utilized as specified for continuing good. Appreciated real estate or personal property Sizable tax benefits can result from such donations; the Laboratory can use some in its program and can sell others. Life insurance and charitable remainder trusts can be structured to suit the donor's specific desires as to extent, timing, and tax needs. Conversion of private foundation to "public" status on termination This may be done by creating a separate fund within Cold Spring Harbor Laboratory whereby the assets of the private foundation are accounted for as a separate fund and used for the purposes specified by the donor. Alternatively, the private foundation can be established as a "supporting organization of Cold Spring Harbor Laboratory." For additional information, please contact the Director of Information Services, Cold Spring Harbor Laboratory, Box 100, Cold Spring Harbor, N.Y. 11724, or call 516-367-8397.

139 FINANCIAL STATEMENT BALANCE SHEET year ended December 31, 1983 with comparative figures for year ended December 31, 1982

ASSETS

1983 1982 CURRENT FUNDS Unrestricted Cash and Short-term investments $ 4,119,413 $ 2,658,863 Accounts Receivable 375,687 464,261 Prepaid expenses and other assets 289,940 258,587 Inventory of books 194,111 203,899 Due from restricted fund 286,290 Due from Banbury Center 115,810 284,630 Total unrestricted 5,094,961 4,156,530

Restricted Grants and contracts receivable 3,779,375 4,615,780 Due from unrestricted fund 660,906 Total restricted 4,440,281 4,615,780 Total current funds $ 9,535,242 $ 8,772,310

ENDOWMENT FUNDS Robertson Research Fund Cash 3,536,782 508,041 Marketable securities (quoted market 1983-$13,466,772; 1982-13,987,572) 11,446,963 11,585,922 Total Robertson Research Fund 14,983,745 12,093,963

Olney Memorial Fund Cash 4,623 1,420 Marketable Securities (quoted market 1983-$23,252; 1982-$23,284) 27,538 27,538 Total Olney Memorial Fund 32,161 28,958 Total endowment funds $15,015,906 $12,122,921

PLANT FUNDS Investments 454,212 461,239 Due from unrestricted fund 983,773 961,628 Land and improvements 1,129,875 1,111,213 Buildings 9,621,165 7,307,583 Furniture, fixtures and equipment 2,485,774 1,647,248 Books and periodicals 365,630 365,630 Construction in progress 960,709 727,245 16,001,138 12,581,786 Less allowance for depreciation and amortization 4,013,770 3,371,273 Total plant funds $11,987,368 $ 9,210,513

140 LIABILITIES AND FUND BALANCES

1983 1982 CURRENT FUNDS Unrestricted Accounts payable $ 835,166 $ 171,326 Deferred income 140,000 - Mortgage payable - 33,300 Due to plant fund 983,773 961,628 Due to restricted fund 660,906 - Fund balance 2,475,116 2,990,276 Total unrestricted 5,094,961 4,156,530

Restricted Due to unrestricted fund - 286,290 Fund balance 4,440,281 4,329,490 Total restricted 4,440,281 4,615,780 Total current funds $ 9,535,242 $ 8,772,310

ENDOWMENT FUNDS

Fund balance $15,015,906 $12,122,921

PLANT FUNDS

Fund balance $11,987,368 $ 9,210,513

141 ASSETS (continued) 1983 1982 BANBURY CENTER Current funds Unrestricted Cash 700 700 Prepaid and deferred expenses 15,025 70,001 Inventory of books 36,857 25,777 Due from Banbury restricted fund 95,505 35,999 Total unrestricted 148,087 132,477

Restricted Grants and contracts receivable 142,988 91,046

Total restricted 142,988 91,046 Total current funds 291,075 223,523

Endowment Funds Robertson Maintenance Fund Cash 494,054 89,768 Marketable securities (quoted market 1983 - $2,314,259; 1982-$2,385,039) 1,978,853 1,971,628 Total endowment funds 2,472,907 2,061,396

Plant funds Land 772,500 772,500 Buildings 845,967 846,028 Furniture, fixtures and equipment 176,318 176,284 Construction in progress 1,386 1,386 1,796,171 1,796,198 Less allowance for depreciation 320,450 275,311 Total plant funds 1,475,721 1,520,887 Total Banbury Center $ 4,239,703 $ 3,805,806 Total-All funds $40,778,219 $33,911,550

142 LIABILITIES AND FUND BALANCES (continued)

1983 1982 BANBURY CENTER Current funds Unrestricted Accounts payable 32,277 11,376 Due to CSHL unrestricted fund 115,810 284,630 Fund balance (163,529)

Total unrestricted 148,087 132,477

Restricted Due to Banbury unrestricted 95,505 35,999 Fund balance 47,483 55,047 Total restricted 142,988 91,046 Total current funds 291,075 223,523

Endowment funds

Fund balance 2,472,907 2,061,396

Plant funds

Fund balance 1,475,721 1,520,887 Total Banbury Center $ 4,239,703 $ 3,805,806 Total-All funds $40,778,219 $33,911,550

143 CURRENT REVENUES, EXPENSES ANDTRANSFERS year ended December 31, 1983 with comparative figures foryear ended December 31, 1982

COLD SPRING HARBOR LABORATORY

1983 1982 REVENUES Grants and contracts $11,650,901 12,175,270 Indirect cost allowances on grants and contracts 3,626,022 Contributions 3,155,513 Unrestricted 27,800 Restricted and capital 30,682 868,528 225,000 Long Island Biological Association 33,300 46,500 Robertson Research Fund Distribution 453,000 453,000 Summer programs 491,049 Laboratory rental 433,188 20,732 20,732 Marina rental 56,170 Investment income 53,192 481,992 376,587 Publications sales 1,655,691 Dining Hall 1,650,263 490,678 469,196 Rooms and apartments 216,179 Other sources 269,061 26,371 12,347 Total revenues 20,098,413 19,370,531

EXPENSES Research* 10,098,170 8,855,612 Summer programs* 993,338 775,528 Publications sales* 1,306,539 Dining hall* 1,132,856 671,602 535,399 Research support 256,676 Library 203,631 223,117 191,344 Operation and maintenance of plant 1,921,985 1,719,729 General and Administrative 1,632,045 Depreciation 1,192,215 643,097 505,252 Total expenses 17,746,569 15,111,566

TRANSFERS Capital building projects 1,738,298 2,003,518 Banbury Center to (from) (80,420) 212,235 Total transfers-net 1,657,878 2,215,753 Total expenses and transfers 19,404,447 17,327,319 Excess of revenues over expenses and transfers $ 693,966 $ 2,043,212

*Reported exclusive of an allocation for research support, operation andmaintenance of plant, general and administrative, library, and depreciationexpenses.

144 BANBURY CENTER

1983 1982 REVENUES Endowment income $100,000 $ 99,000 Grants & contributions 261,436 288,226 Indirect cost allowances on grants and contracts 13,576 19,880 Rooms and apartments 76,522 46,353 Publications 191,993 136,391 Conference fees 54,096 20,375 Dining Hall 4,708 6,484 Transfer from (to) Cold Spring Harbor Laboratory (80,420) 212,235 Total revenues 621,911 828,944

EXPENSES Conferences 206,659 151,631 Publications 126,618 168,011 Operation and maintenance of plant 93,548 109,474 Program administration 202,651 163,312 Depreciation 45,107 53,954 Capital plant 53,271 Total expenses 674,583 699,653 Excess (deficit) of revenues over expenses $ (52,672) $129,291

Note: Copies of our complete, audited financial statements, certified by our independent auditors, Peat, Marwick, Mitchell & Co., are available upon request from the Comptroller, Cold Spring Harbor Laboratory.

145

GRANTS January 1, 1983-December 31, 1983

COLD SPRING HARBOR LABORATORY

Principal Investigator Grantor and Program Total Award Duration of Grant

National Institutes of Health Program Project Grants Dr. Bukhari-Genetics $ 2,375,371 06/01/80-11/30/83 Dr. Roberts-Cancer Research Center 18,604,426 01/01/77-12/31/86 Dr. Sambrook-Gene Organization 5,626,997 04/01/81-03/31/86

Research Grants Dr. Blose 449,929 12/01/78-11/30/84 Dr. Feramisco 686,968 07/01/80-07/31/86 Dr. Gething 976,587 *02/01/83-01/31/87 Drs. Gingeras & Roberts 408,085 03/01/80-02/28/83 Dr. Hicks 1,710,283 07/01/81-06/30/86 Dr. Hockfield 282,400 02/01/82-01/31/85 Dr. Klar 1,572,978 07/01/81-06/30/86 Dr. Klar 286,070 *12/01/83-11/30/85 Dr. Kurtz 606,389 04/01/80-03/31/86 Dr. Lin 290,636 09/24/82-08/31/85 Dr. Mathews 729,283 04/01/80-03/31/86 Dr. Matsumura 385,649 *07/01/83-06/30/86 Dr. McKay 288,546 07/01/81-06/30/84 Dr. Silver 625,803 02/01/82-01/31/85 Dr. Stillman 677,384*07/01/83-06/30/86 Dr. Topp 279,134 03/01/82-02/28/84 Dr. Topp 303,452 07/01/80-06/30/83 Dr. B. Zipser 299,219 12/01/81-11/30/84 Dr. B. Zipser 358,081 *12/01/83-11/30/86

Biomedical Research Dr. Watson 104,822 04/01/82-03/31/83 Support Grants Dr. Watson 111,124 *04/01/83-03/31/84

Fellowship Training Dr. Grodzicker (Institutional) 852,578 07/01/78-11/30/83 Dr. Bautch 57,244*09/01/83-08/31/86 Dr. Flanagan 36,204*09/16/83-09/15/85 Dr. Flaster 34,776 09/15/82-09/14/84 Dr. Ivy 38,776 01/27/82-01/26/84 Dr. Krangel 54,584 10/01/82-09/30/85 Dr. LeMaster 34,681 06/01/81-02/15/83 Dr. Livi 57,244 *10/16/83-10/15/86 Dr. Roth 36,776 *09/01/83-08/31/85 Dr. Taparowsky 54,584 10/16/82-10/15/85 Dr. Welch 56,584 *09/01/83-08/31/85

Course Support Dr. Hockfield-Neurobiology 131,277 05/01/82-04/30/85 Dr. Hockfield-Neurobiology 646,143 06/01/79-03/31/86 Dr. Grodzicker- Cancer Center 657,174 06/01/82-12/31/86 Dr. Hicks-Advanced Bacterial Genetics 302,523 05/01/80-04/30/88 *New grants awarded in 1983.

147 Principal Investigator Grantor and Program Total Award Duration of Grant

National Institutes of Health (continued)

Meeting Support Dr. Mathews-RNA Processing 18,000 04/15/82-04/30/84 Dr. Watson-Human T-Cell Leukemia 27,436 *09/13/83-08/31/84 Viruses Dr. Watson-Symposium: Molecular 41,977 *04/01/8343/31/84 Neurobiology Dr. Watson-Genetics of 5,000*06/26/8346/25/84 Chlamydomonas Dr. Watson-C. elegans 29,290 *04/01/8343/31/84 Dr. Watson-Cell Proliferation 61,350 08/15/81-07/31/84 Conference: The Cancer Cell

Construction Mr. Udry -Cancer Research Facility 1,411,011 09/15/77-12/31/83

National Science Foundation Research Grants Dr. Bukhari 60,000 07/82-12/83 Dr. Garrels 140,000 09/80-02/83 Dr. Harshey 78,001 01/82-05/83 Dr. Heffron 167,000 02/81-07/83 Drs. Hicks, Klar, Strathern 330,134 07/82-12/84 & Malmberg Dr. Lewis 140,000 *11/83-12/85 Dr. Roberts 210,000 12/79-05/83 Dr. Roberts 270,000 08/80-07/83 Dr. Roberts 28,442 *01/8348/86 Dr. Roberts 200,000 *01/83-12/86 Dr. Roberts 252,000 *07/83-12/86 Dr. So 32,194 07/82-12/83 Dr. Tamanoi 88,000 07/82-12/84 Dr. D. Zipser 100,000 01/81-06/83

Course Support Dr. Hicks-Plant Molecular Biology 99,600 05/81-10/84 Workshop

Meeting Support Dr. Bukhari-4th Bacteriophage Mu 32,000 *11/83-10/84 Workshop (Pakistan) Dr. Klar - Microbial Development 8,940 *04/8343/84 Dr. Mathews-RNA Processing 5,000 *05/8344/84 Dr. Watson-Symposium: 6,000 *07/83-06/84 Molecular Neurobiology Dr. Watson-Genetics of 8,000 *06/83-11/84 Chlamydomonas

Construction Dr. Watson-Plant Genetics Laboratory 406,350 *12/83-05/85 148 Principal Investigator Grantor and Program Total Award Duration of Grant

Research Grants

A.B.C. Foundation Dr. Wigler 600,000 05/01/82-04/30/87 Rita Allen Foundation Dr. Stillman 150,000 *01/01/83-12/31/87 American Cancer Society Dr. Chow 150,000 01/01/82-12/31/84 Dr. Rossini 110,000 01/01/82-12/31/84 Dr. Stillman (Institutional) 50,000 07/01/82-06/30/84 Cancer Research Institute Dr. Garrels 36,000 *07/01/83-06/30/84 Cell Biology Corporation Dr. Sambrook 627,746 01/01/82-12/31/83 Central General Hospital Research 2,000*01/01/83-12/31/83 Exxon Research 7,500,000 01/01/82-12/31/86 McKnight Foundation Dr. Malmberg 105,000 *03/01/83-02/28/86 Muscular Dystrophy Assn. Dr. Garrels 80,000 01/01/80-12/31/83 Dr. Lin 95,350 01/01/81-12/31/83 Dr. Mathews 25,000*07/01/83-06/30/84 Dr. Matsumura 15,228 *01/01/83-12/31/83 New England Bio-Labs Dr. Roberts 14,000 Marie Robertson Dr. Sambrook-Neurobiology Support 75,000 *01/01/83-12/31/83 Memorial Fund Stauffer Chemical Dr. Hicks 15,000 Strasser Company Dr. Hicks 20,000 State University of New York, Dr. Topp (Subcontract) 7,267 08/01/82-07/31/83 Stony Brook Yamasa Shoyo Co., Ltd. Dr. Katoh 94,480 10/01/81-09/30/83

Fellowships

Jane Coffin Childs Dr. Sundin 32,000 07/01/82-06/30/84 Helen Hay Whitney Dr. Herr 39,250 *01/01/83-06/14/85 Leukemia Society of America, Dr. Kost 22,375 07/01/82-09/15/83 Inc. Dr. Powers 34,000 *12/31/83-12/30/85 Muscular Dystrophy Assn. Dr. Helfman 17,000 *07/01/83-06/30/84 Robert P. Olney Memorial Dr. Dudley, Jr. 2,800 *1983 Cancer Fund Damon Runyon- Dr. Abraham 35,000 08/01/81-07/31/83 Walter Winchell Dr. Bhagwat 35,000 07/01/82-06/30/84 Cancer Fund Dr. Gerard 35,000*05/01/83-03/31/85 Dr. Mains 35,000*04/01/83-03/31/85 Dr. Roth 17,000 09/01/82-08/31/83 Dr. White 35,000*11/01/83-10/31/84 Training

Bayer Aspirin (Glen Brook Undergraduate Research Program 3,500 *1983 Labs) Burroughs Wellcome Fund Undergraduate Research Program 7,000 *1983 J.M. Foundation Undergraduate Research Program 25,300 *1983 Grass Foundation Neurobiology Scholarships 45,190 1980-1983 Volkswagen Foundation Neurobiology Scholarships 64,049 1980-1983 149 Principal Investigator Grantor and Program Total Award Duration of Grant

Construction Pew Memorial Trust Matching Grant Support 400,000 1981-1983 Equipment Fannie E. Rippel Foundation Matching Grant Support 100,000 *1983-1984

Course Support National Foundation for Jewish Neurobiology of Human Diseases Course 2,000 *1983 Genetic Diseases, Inc. Hereditary Diseases Foundation Neurobiology of Human Diseases Course 2,000 *1983 The Esther A. & Joseph Neurobiology Support 150,000 1982-1983 Klingenstein Fund Meeting Support Abbott Laboratories Microbial Development 500 *1983 American Cancer Society The Cancer Cell 34,000 *1983 American Cyanamid Company Microbial Development 500 *1983 Becton-Dickinson The Cancer Cell 5,000 *1983 Biogen Microbial Development 1,000 *1983 The Molecular Biology of Yeast 1,500 *1983 Cancer Research Institute Human T-Cell Leukemia Viruses 4,060 *1983 Department of Energy Genetics of Chlamydomonas 5,000 *05/15/83-05/14/84 Symposium: Molecular Neurobiology 9,000 *07/15/83-07/14/84 Genentech, Inc. The Molecular Biology of Yeast 1,000 *1983 Hoffmann-La Roche, Inc. The Molecular Biology of Yeast 2,000 *1983 Eli Lilly Research Labs Microbial Development 750 *1983 LaBatt Brewing Company The Molecular Biology of Yeast 250 *1983 Long Island Biological Community Conference on the Gypsy Moth 4,000 *1983 Association-Dorcas Cummings Memorial Fund Martin Marietta Laboratories Genetics of Chlamydomonas 3,192 *1983 Merck & Co., Inc. Modern Approaches to Vaccines 5,000 *1983 Merieux Institute Modern Approaches to Vaccines 15,000 *1983 Miles Laboratories Microbial Development 750 *1983 Monsanto Genetics of Chlamydomonas 3,000 *1983 Microbial Development 6,000 *1983 N.Y.S. Department of Health Human T-Cell Leukemia Viruses 4,060 *1983 Pfizer, Inc. The Molecular Biology of Yeast 1,000 *1983 Searle Research & DevelopmentMicrobial Development 500 *1983 Standard Oil Co. of Ohio Genetics of Chlamydomonas 2,000 *1983 Smith Kline & French The Molecular Biology of Yeast 1,000 *1983 Upjohn Company Microbial Development 2,000 *1983 Wellcome Biotechnology, Ltd. Modern Approaches to Vaccines 6,000 *1983 Zoecon Corporation Genetics of Chlamydomonas 1,500 *1983 Zymos Corporation The Molecular Biology of Yeast 1,000 *1983 150 BANBURY CENTER

Principal Investigator Grantor and Program Total Award Duration of Grant

Meeting Support National Institutes of Health Dr. Topp-AIDS and Kaposi's Sarcoma 20,367 *01/07/83-12/31/83 Dr. Watson-The Role of Genetic 31,575 *08/01/83-07/31/84 Predisposition in Responses to Chemical Exposure Abbott Laboratories Enhancers and Controlling Elements 1,000 *1983 Agrigenetics Research Plant Viruses and Viroids 500 *1983 Associates, Ltd. Alcoa Foundation The Role of Genetic Predisposition in 5,000 *1983 Responses to Chemical Exposure American Occupational The Role of Genetic Predisposition in 5,000 *1983 Medical Association Responses to Chemical Exposure Applied Molecular Genetics Enhancers and Controlling Elements 2,000 *1983 Arco Solar, Inc. Plant Viruses and Viroids 2,000 *1983 Biogen Enhancers and Controlling Elements 3,000 *1983 Calgene, Inc. Plant Viruses and Viroids 250 *1983 Cancer Research Institute AIDS and Kaposi's Sarcoma 4,050 *1983 Cetus Corporation Enhancers and Controlling Elements 3,000 *1983 Collaborative Research Enhancers and Controlling Elements 3,000 *1983 E.I. du Pont de Nemours & Enhancers and Controlling Elements 3,000 *1983 Co., Inc. The Role of Genetic Predisposition in 5,000 *1983 Responses to Chemical Exposure Genentech, Inc. Enhancers and Controlling Elements 1,000 *1983 International Coffee Coffee and Health 15,000*1983 Organization Johnson & Johnson The Role of Genetic Predisposition in 3,000 *1983 Responses to Chemical Exposure Eli Lilly Research Laboratories Enhancers and Controlling Elements 1,000*1983 March of Dimes Mechanisms of Mutagenesis 4,000 *1983 Massachusetts Institute of Marr Memorial Conference: Mechanisms 23,369 *1983 Technology of Perception Monsanto Enhancers and Controlling Elements 3,000 *1983 Plant Viruses and Viroids 2,000 *1983 Pfizer, Inc. Plant Viruses and Viroids 1,000 *1983 National Coffee Association Coffee and Health 10,000 *1983 of USA, Inc. Occupational Health Institute, The Role of Genetic Predisposition in 5,000 *1983 Inc. Responses to Chemical Exposure Sloan Foundation Journalists' Workshop: New Concepts 10,000 *1983 in Mutation Congressional Workshop: Biological 10,000 *1983 Imaging and NMR United States Steel The Role of Genetic Predisposition in 5,000 *1983 Responses to Chemical Exposure

151

CONTRIBUTORS

Action Dr. & Mrs. Monroe L. Levin Dr. Bruce Alberts Dr. & Mrs. R.V. Lewis Albert Einstein College of Medicine Mr. & Mrs. Robert V. Lindsay Anonymous Mrs. V.S. Littauer Dr. & Mrs. Alfred Azzoni Mr. Daniel Maguire Myra Blum Dr. & Mrs. Julius Marmur Boehringer Mannheim Biochemicals Mrs. John B. Marsh Cailor Resnick Studio Massachusetts Institute of Technology Mr. & Mrs. S.R. Callaway Leila L. McKnight Ms. Patricia Casentini Dr. & Mrs. Norman E. Melechen Chubb & Son, Inc. Memorial Sloan-Kettering Mr. John P. Cleary Mr. Arthur C. Merrill Collaborative Research Morgan Guaranty Trust Mr. & Mrs. R. Cunningham Ms. Edith Muma Dr. & Mrs. James A. de Tomasi Mr. Rem V. Myers Mr. & Mrs. C. Deregibus New York University Dr. & Mrs. Lester Dubnick Ms. Linda Peyton Duke University Mrs. William R. Potts Mr. & Mrs. D.C. Engle Mrs. Marjorie Robertson Rose Mr. Walter N. Frank, Jr. Mrs. Franz Schneider Dr. & Mrs. H. Bentley Glass Mr. Thomas J.M. Schopf Mrs. Arlene A. Golden Dr. A. Schuz Mr. Oliver R. Grace Dr. Philip A. Sharp Mrs. Charles A. Guarneri Dr. & Mrs. W. Shropshire, Jr. Dr. & Mrs. Alfred Hershey Mr. & Mrs. Robert Smirnow Dr. Ira Herskowitz Dr. & Mrs. A.R. Srinivasan Dr. Bernhard Hirt Dr. Gunther S. Stent Dr. Joy Hockstadt James E. Swiggett Dr. Alexander Hollaender Dr. Charles A. Thomas, Jr. Dr. Nancy H. Hopkins Mr. & Mrs. George Toumanoff Mrs. David Ingraham University of Wisconsin Dr. George Khoury Dr. Robert A. Weisberg Dr. & Mrs. Arthur Landy Mr. & Mrs. Johnny Wilson Mr. & Mrs. George Leckerling WOR Radio Mr. & Mrs. Richard Leckerling Yale University

153

THE LONG ISLAND BIOLOGICAL ASSOCIATION

OFFICERS EXECUTIVE COMMITTEE Mr. Edward Pulling, Chairperson The Officers, also Mr. George J. Hossfeld, Jr., Vice-Chairperson Mr. Samuel R. Callaway Mr. James A. Eisenman, Treasurer Mrs. Henry U. Harris, Jr. Mrs. James J. Pirtle, Jr., Secretary Mrs. Richardson Pratt Mr. William R. Udry, Assistant Secretary-Treasurer

DIRECTORS Mrs. Donald Arthur Mr. Joseph C. Dey, Jr. Mrs. James J. Pirtle, Jr. Dr. Alfred A. Azzoni Mr. Charles Dolan Mrs. Richardson Pratt Mrs. Gilbert A. Ball Mr. James A. Eisenman Mr. Edward Pulling Mr. Edmund Bartlett Mr. Charles S. Gay Mr. John R. Reese Mr. Samuel R. Callaway Mrs. Henry U. Harris, Jr. Mr. Harvey E. Sampson Mrs. John P. Campbell Mr. George J. Hossfeld, Jr. Mr. Stanley S. Trotman, Jr. Mrs. Miner D. Crary, Jr. Mr. Edward M. Lamont Dr. James D. Watson Mr. Arthur M. Crocker Mr. Arthur C. Merrill Mrs. Alex M. White Mr. George W. Cutting Mr. Grinnell Morris Mr. Lawrence L. Davis Mr. William Parsons, Jr.

Ambassador John P Humes with Mr and Mrs. Norris Darrell, Jr., at a dinner party held at Airslie House to honor a combined 40 years of service to the Laboratory by Walter Page and Edward Pulling. THE LONG ISLAND BIOLOGICAL ASSOCIATION (LIBA) and Its Relation to the Cold Spring Harbor Laboratory

Biological research at Cold Spring Harbor began in 1890 when the Brooklyn Institute of Arts and Sci- ences was looking for a place to set up a summer laboratory as the headquarters of its Department of Zoology. Representatives of the Institute were invited by Eugene S. Blackford, at that time one of the first Fish Commissioners of the State of New York, to inspect a site on Bungtown Road across Northern Boule- vard (25A) from the Fish Hatchery. The site was found to be ideal, and so the original Laboratory was organized with Mr. Blackford as president of the Board of Trustees. The land was leased from Mr. John D. Jones, whose family since 1819 had operated various industries including shipbuilding, coopering, and textile manufacture (later whaling, also) at the head of Cold Spring Harbor. Bungtown Road, which runs through the Lab property, got its name from the factory that specialized in making bungs-or stoppers - for barrels. In 1892 the Laboratory's land was leased for a dollar a year from the Wawepex Society, which Mr. Jones had organized as a corporation for holding real estate and for investing funds for the propagation of fishes and for scientific research. In 1904 the Wawepex Society leased additional land to the Carnegie Institution of Washington, which wanted to locate a Department of Experimental Evolution in the Cold Spring Harbor area. Charles B. Davenport, who had been directing the Laboratory since 1896, assumed the additional duties of director of the Carnegie Institution's experimental station. It is interesting to note that Mr. Davenport lived in what came to be known later as the Carnegie Dormitory, the Victorian house on 25A built by John D. Jones before the turn of the century, and recently repainted in its original colors. The Long Island Biological Association was established in 1924 when the Brooklyn Institute decided to discontinue its research at Cold Spring Harbor and offered its laboratory to two universities. Fortunately, a local group of interested neighbors decided to assume responsibility for the Lab, and thus LIBA came into being. For 38 years LIBA actually operated the Laboratory in conjunction with the Carnegie Institu- tion, but in 1962 it seemed advisable for the Laboratory to be reorganized as an independent unit. There- fore, the property on which it now stands was conveyed to it by LIBA, which, however, still retains rever- sionary rights. Today LIBA is one of twelve institutions participating in the support of the Laboratory, each institution being represented on the Laboratory's Board of Trustees. What has happened, in effect, is that LIBA has become an expanding group of local "Friends of the Laboratory" who help support it through annual contributions. Also, from time to time, the Association undertakes campaigns to finance special important projects for which the Lab cannot obtain funds from the Federal Government or from other sources. For instance, in 1974, LIBA made possible the building of the James Laboratory Annex and the renovation of Blackford Hall; and in 1976 the rebuilding of Williams House. The affairs of LIBA are handled by a board of 28 directors who are elected to office by the membership at an annual meeting. At least twice a year LIBA members are invited to bring their friends to a lecture or an open house at the Lab.

Membership in LIBA requires a minimum annual contribution (tax deductible) of $25 for a husband and wife, $15 for a single adult, $5 for a junior member (under 21). Further information can be obtained from the Long Island Biological Association, Box 100, Cold Spring Harbor, N.Y. 11724, or by telephoning the Laboratory's administrative director, Mr. William R Udry, at (516) 367-8300.

156 REPORT OF THE CHAIRMAN FOR 1983

The major effort of LIBA in 1983 was a continuation of our campaign launched in 1982 to raise at least $500,000 over a two-year period to help the Lab finance the construction of the urgently needed new auditorium. The Cold Spring Harbor Laboratory has become the world center for the exchange and distribution of infor- mation about the latest discoveries in molecular biology. As the number of molecular biologists from all over the world who apply for participation in the June Symposium and other seminar meetings continues to increase, the need for an auditorium large enough to accommodate them has become increasingly urgent. Of special interest to LIBA members and to all North Shore residents is the fact that the new auditorium has been planned to make it suitable for concerts, lectures, and other appropriate community functions during the off- season for Laboratory meetings. I am pleased to report that as of February 1984 we have reached our original goal of $500,000 and are now striving substantially to increase our support of the auditorium project, which has turned out to be more expensive than was anticipated at the time we began our campaign. As usual, LIBA members and their guests were invited to two lectures during the year. At the first, the annual Dorcas Cummings Memorial Lecture, our speakers were Amory and Hunter Lovins of the Rocky Mountain Institute at Snowmass, Colorado. They have become world famous for their study of the sources and proper use and conservation of energy, and gave us a fascinating account of their findings, followed by provocative sugges- tions for the solution of energy problems. At the Annual Meeting in December, the lecturer was Dr. Arnold Levine, Chairman of the Department of Microbiology at Stony Brook. He gave his audience a remarkably clear and exciting over-view of recent signifi- cant research in molecular biology, with a detailed explanation of the way mutation can change a healthy gene into an oncogene. The custom of giving dinner parties for visiting scientists during the June Symposium was successfully contin- ued in 1983. It is a custom enjoyed equally by the scientists and by their hosts and hostesses. This year's parties were given by

Mrs. Gilbert A. Ball Mr. & Mrs. James J. Pirtle, Jr. Mr. & Mrs. F. Sedgwick Browne Mrs. H. Irving Pratt Mr. & Mrs. John P. Campbell Mr. & Mrs. Franz Schneider Mr. & Mrs. David C. Clark Mr. & Mrs. Martin B. Travis Mr. & Mrs. Miner D. Crary Mr. & Mrs. Bronson Trevor, Jr. Mr. & Mrs. Henry U. Harris, Jr. Mr. & Mrs. Robert P. Walton Mr. & Mrs. George J. Hossfeld, Jr. Mr. & Mrs. R. Ray Weeks Mr. & Mrs. Grinnell Morris Mr. & Mrs. William A. Woodcock

At the Annual Meeting regret was expressed that the terms of office as directors for Messrs. David Clark, Roderick Cushman, Norris Darrell, Walter Frank, and Clarence Galston had terminated after eight years of faithful service, and that Mrs. Shirley Ames and Mrs. Stephen Ulman had found it necessary to resign from the Board. To fill the vacant places, the following directors were elected to office: Mrs. Donald Arthur, Mr. Arthur M. Crocker, Mr. George W Cutting, Mr. Lawrence L. Davis, Mr. Arthur C. Merrill, and Mr. Harvey E. Sampson. At the subsequent meeting of the Board of Directors the previous officers and members of the Executive Committee were re-elected to office with the exception of Mrs. Ames, who had resigned. Mr. Callaway was elected to take her place in the Executive Committee.

Edward Pulling, Chairman Long Island Biological Association February 21, 1984

157 MEMBERS Of the Long Island Biological Association

Mr. & Mrs. Thomas Ackerman Mr. & Mrs. John P. Campbell Mr. & Mrs. Clark M. Drasher, Jr. Mr. & Mrs. Amyas Ames Mr. & Mrs. Ward C. Campbell Dr. & Mrs. Arthur Drazan Mrs. Charles E. Ames Miss Martha Worth Carder Dr. & Mrs. Lester Dubnick Mrs. Shirley F. Ames Mr. & Mrs. John Carr Mrs. Eugene DuBois Mr. & Mrs. Hoyt Ammidon Mr. & Mrs. T.C. Cattrall, Jr. Mr. & Mrs. James C. Dudley Drs. Harold & Shirley Andersen Mr. & Mrs. Lionel Chaikin Dr. & Mrs. John L. Duffy Mr. Robert W. Anthony Dr. Carton Chen Mr. & Mrs. Edgar P. Dunlaevy Mr. & Mrs. J.S. Armentrout Mrs. Helen Chenery Mr. & Mrs. William T. Dunn, Jr. Mrs. Donald Arthur Mr. & Mrs. Beverly C. Chew Dr. & Mrs. Gerard L. Eastman Dr. & Mrs. Joseph T. August Mr. & Mrs. Charles M. Clark Dr. & Mrs. James D. Ebert Mrs. Robert W. Ayer Mr. & Mrs. David C. Clark Mr. & Mrs. Paul S. Eckhoff Dr. & Mrs. Alfred Azzoni Dr. & Mrs. Bayard Clarkson Mr. & Mrs. James A. Eisenman Mr. & Mrs. Henry D. Babcock, Jr. Mr. & Mrs. John P. Cleary Mrs. Fred J. Eissler Mr. & Mrs. Benjamin H. Balkind Mr. & Mrs. Thomas N. Cochran Mr. & Mrs. Duncan Elder Mrs. Gilbert Ball Dr. & Mrs. Peter Cohn Mr. & Mrs. Ashton G. Eldredge Mr. & Mrs. William M. Bannard Mrs. C. Payson Coleman Mr. & Mrs. Martin Elias Mrs. George C. Barclay Mr. & Mrs. Francis X. Coleman, Jr. Mr. & Mrs. John Evans Dr. & Mrs. Henry H. Bard Mr. & Mrs. John H. Coleman Mr. Henri Eyl Mrs. Lila Barnes Mrs. John K. Colgate Mr. & Mrs. Raymond Z. Fahs Mr. & Mrs. Dudley R. Barr Mr. & Mrs. Emilio G. Collado Mrs. B. Tappen Fairchild Mr. & Mrs. Edmund Bartlett Mr. & Mrs. Bradley Collins Mr. & Mrs. Joel M. Fairman Mrs. Robert E. Belknap, Jr. Mr. & Mrs. Patrick Collins Mr. & Mrs. Harold L. Fates Dr. & Mrs. Stefan Belman Mr. & Mrs. Kingsley Colton Mrs. Allston Flagg Miss Linda Bennetta Mrs. Ralph C. Colyer Mr. & Mrs. Mario Fog Mr. & Mrs. Loren C. Berry Dr. & Mrs. Crispin Cooke Mr. & Mrs. Henry L. Fox Mr. & Mrs. Robert P. Beuerlein Mr. & Mrs. Howard Corning, Jr. Mr. Walter N. Frank, Jr. Mr. & Mrs. Nicholas Biddle, Jr. Mr. Duncan B. Cox Mr. & Mrs. George S. Franklin Mrs. William Binnian Mr. & Mrs. Charles L. Craig Mr. & Mrs. Jack B. Friedman Mr. F. Roberts Blair Mr. & Mrs. Miner D. Crary, Jr. Mr. Louis M. Fuccio Mrs. Mary Lenore Blair Mr. & Mrs. Arthur M. Crocker Mr. D. Kent Gale Mr. & Mrs. Bache Bleecker Mr. & Mrs. Robert Cuddeback Mr. & Mrs. Clarence E. Galston Mrs. Margery Blumenthal Mr. Robert L. Cummings Mr. & Mrs. John W Galston Mr. & Mrs. Elito Bongarzone Mr. Robert L. Cummings III Mrs. James E. Gardner, Jr. Mr. & Mrs. A.L. Boorstein Mr. & Mrs. Richard T. Cunniff Mr. & Mrs. Charles S. Gay Mr. & Mrs. Murray Borson Dr. & Mrs. Paul Cushman, Jr. Mr. & Mrs. Robert A. Gay Dr. & Mrs. George Bowen Mr. & Mrs. Roderick H. Cushman Mrs. Louis F Geissler, Jr. Mr. & Mrs. William Braden Mr. & Mrs. George W. Cutting, Jr. Mrs. Ruth Reed Gillespie Dr. & Mrs. Arik Brissenden Mrs. Howard Dana Dr. & Mrs. H. Bentley Glass Mrs. Horace Brock Mr. Theodore H. Danforth Mrs. J. Wooderson Glenn Mr. & Mrs. F. Sedgwick Browne Mr. & Mrs. Norris Darrell, Jr. Mr. & Mrs. Bernard Gloisten Mr. & Mrs. G. Morgan Browne Jr. Mr. & Mrs. A. George Dam Mr. & Mrs. E. Rawson Godfrey Mr. & Mrs. Frank Bruder Mrs. Katya Davey Mr. C.F. Gordon Mr. & Mrs. James Bryan, Jr. Mr. & Mrs. Lawrence Davis Mr. & Mrs. Kilbourn Gordon, Jr. Mr. & Mrs. Julian Buckley Mrs. F. Trubee Davison Mr. & Mrs. Oliver R. Grace Mrs. R.P. Burr Mr. & Mrs. Jay De Bow Mr. & Mrs. William R. Grant Mr. & Mrs. John Busby Mr. & Mrs. Raymond DeClairville Mr. & Mrs. Alfred T. Gregory Mr. & Mrs. Albert Bush-Brown Mr. & Mrs. Donald L. Deming Mr. & Mrs. Sidney Hack Mr. & Mrs. Sidney G. Butler Mr. & Mrs. Douglas Despard, Jr. Mrs. Joanna Hadden Miss Grace T. Caidin Mr. & Mrs. Joseph C. Dey, Jr. Mr. & Mrs. John W.B. Hadley Mr. & Mrs. T.J. Calabrese, Jr. Mr. & Mrs. Charles Dolan Mr. & Mrs. Lawrence Hahn Mr. & Mrs. Samuel Callaway Russell & Janet Doubleday Fund Mrs. Beverly Hanson

158 Mr. & Mrs. Gordon Hargraves Mr. & Mrs. John H. Livingston Mr. & Mrs. Collier Platt Mr. & Mrs. Henry U. Harris Mr. & Mrs. Alan J. Long Mr. & Mrs. Graham L. Platt Mr. & Mrs. Henry U. Harris, Jr. Mr. & Mrs. John F. MacKay Mrs. Francis T.P. Plimpton Miss Maxine Harrison Mrs. Malcolm MacKay Mr. & Mrs. Martin Pollak Dr. & Mrs. C. Hartenstein Mr. & Mrs. Sayre MacLeod Mr. & Mrs. Edward Everett Post Mr. & Mrs. Rolf D. Hartmann Mrs. Henry R. Macy Mrs. William S. Post Mr. & Mrs. Horace Havemeyer, Jr. Mrs. John R. Mahoney Mrs. H. Irving Pratt Mr. Huy ler C. Held Mr. & Mrs. John Mariani Mr. & Mrs. Richardson Pratt Mr. & Mrs. James E. Hellier Mrs. John B. Marsh Dr. William Preston Dr. & Mrs. William W. Heroy Mr. & Mrs. John M. Martin Mr. Edward Pulling Mr. & Mrs. Charles L. Hewitt Mr. & Mrs. William H. Mathers Mr. Thomas L. Pulling Mrs. Herman A. Heydt Mrs. John D. Maxwell Mr. & Mrs. Preston V. Pumphrey Mr. & Mrs. Charles R. Holcomb Dr. Ernst Mayr Mr. & Mrs. Tarrant Putnam Mr. & Mrs. Karl Holtzschue Mr. & Mrs. James A. McCurdy, II Mr. & Mrs. James T. Pyle Mr. & Mrs. George J. Hossfeld Mr. & Mrs. Richard McDaniel Mr. & Mrs. William Rand Mr. & Mrs. George J. Hossfeld, Jr. Mr. & Mrs. Victor McElheny Mrs. Sara Redmond Mrs. Margaret H. Howe Miss Diana Mcllvaine Mr. & Mrs. John R. Reese Mrs. J. Taylor Howell Mr. & Mrs. Angus P. McIntyre Mr. & Mrs. Willis L.M. Reese Mr. & Mrs. Charles J. Hubbard Mr. & Mrs. Randall P. McIntyre Mrs. Cornelius J. Reid Mr. & Mrs. Philip G. Hull Mr. & Mrs. Lawrence M. Mead Dr. Robert M. Reiss Mr. & Mrs. John P. Humes Dr. & Mrs. Walter Meier Mr. Bernard J. Reveredin Mr. & Mrs. J.A.V. Hyatt Mr. Arthur C. Merrill Mr. & Mrs. John T. Ricks Mrs. Elmira S. Ingersoll Mrs. Frances Meurer Mr. & Mrs. J. Gregory Riley Mrs. David Ingraham Dr. & Mrs. Leo M. Meyer Mr. & Mrs. George Roberts Mr. & Mrs. Frederic B. Ingraham Mr. & Mrs. Kennedy B. Middendorf Mr. & Mrs. William S. Robertson Mr. & Mrs. Fred Irwin Mr. & Mrs. William H. Miller Mr. & Mrs. Samuel B. Rogers Mrs. Elizabeth W Ivins Mr. Dudley H. Mills Miss Elizabeth E. Roosevelt Mr. & Mrs. Richard M. Jackson Mrs. A.M. Milton Mrs. Phillip J. Roosevelt Mr. & Mrs. Valdemar F. Jacobsen Mr. & Mrs. George G. Montgomery, Jr. Mrs. Quentin Roosevelt Mr. & Mrs. Irving D. Jakobson Mrs. F. Franklin Moon Mrs. Donald W. Rose Walter B. James Fund Mr. & Mrs. Richard K. Moore Mr. & Mrs. Arthur W. Rossiter, Jr. Mr. & Mrs. Robert D. Jay Mr. & Mrs. George Morgese Mr. & Mrs. Walter N. Rothschild, Jr. Mrs. B. Brewster Jennings Mr. & Mrs. Grinnell Morris Mr. & Mrs. Francis J. Rue, Jr. L.S. Johnson C. Muhlhausen Mrs. Mr. & Mrs. John J. Juda Mr. & Mrs. Allan F. Munro Mr. & Mrs. Harold P. Salembier Mrs. Ruth Karp Mr. & Mrs. Francis W. Murray III Mr. & Mrs. Bernard Salzberg Mr. & Mrs. Morris I. Karpen Dr. & Mrs. Larry Nathanson Mr. & Mrs. Harvey E. Sampson Dr. & Mrs. Francis C. Keil Mr. & Mrs. John S. Nichols Mr. & Mrs. John K. Sands Mr. & Mrs. Francis E. Kelly, Jr. Mr. & Mrs. Adams Nickerson Mr. John M. Schiff Mrs. Walter A. Kernan Mrs. John W. Nields Dr. & Mrs. Carl J. Schmidlapp II Mr. & Mrs. Francis S. Kinney Mr. & Mrs. William S. Niven Mr. & Mrs. Frederick P. Schmitt Miss Louise M. King Mr. Lawrence W. Northam Mr. & Mrs. Franz Schneider Mr. & Mrs. Richard L. Kline Mr. & Mrs. Charles P. Noyes Dr. Irving M. Schneider Dr. & Mrs. Rudolf W. Knoepfel Mr. & Mrs. David C. Noyes, Jr. Mr. & Mrs. Hermann C. Schwab Mr. & Mrs. Robert P. Koenig Mr. & Mrs. George D. O'Neill Mr. & Mrs. David R. Schwarz Mr. & Mrs. Edward W. Kozlik Mr. & Mrs. Richard B. Opsahl Mr. & Mrs. Frederick E. Seymour Mr. & Mrs. Paul Kramer Mr. & Mrs. Robert Osterhus Mr. & Mrs. Marvin Sharfin Mr. & Mrs. Morton Kunst ler Mr. & Mrs. Arthur W. Page, Jr. Dr. & Mrs. Edward M. Shepard Mrs. Carol Lamb Dr. & Mrs. David A. Page Mr. & Mrs. Douglas A. Shepardson, Jr. Mr. & Mrs. Gordon Lamb Mr. & Mrs. John H. Page Mr. & Mrs. Robert E. Sheridan Mr. & Mrs. Edward M. Lamont Mr. & Mrs. Walter H. Page Mr. & Mrs. Oscar Shoenfeld Ms. Laurie J. Landeau Mr. & Mrs. Fred W. Pain Dr. & Mrs. Paul Siminoff Mr. Charles Lassen Mr. & Mrs. Samuel D. Parkinson Mr. & Mrs. William C. Simpson Mrs. Orin T. Leach Mr. & Mrs. Joseph M. Parriott Mrs. James C. Skiff Mr. & Mrs. Leslie S. Learned Mr. & Mrs. William Parsons Mr. & Mrs. Rowland G. Skinner Mrs. Randall J. LeBoeuf, Jr. Mr. & Mrs. William Parsons, Jr. Mr. & Mrs. H. Turner Slocum Mr. & Mrs. Henry C. Lee Mr. & Mrs. Fremont C. Peck Mr. & Mrs. Robert Smirnow Rev. & Mrs. T. Carleton Lee Mr. & Mrs. William H. Peck Mr. & Mrs. William S. Smoot Mr. & Mrs. Thomas Leon Mr. & Mrs. Paul Pennoyer, Jr. Mr. & Mrs. James Sommermeyer Dr. & Mrs. R.V. Lewis Mr. & Mrs. John M. Perkins Mrs. Julian C. Stanley Mrs. Elizabeth A. Lindsay Mr. & Mrs. Bernard Peyton 3rd Mr. W.O. Stanton Mr. & Mrs. George N. Lindsay, Jr. The Rev. Linda Peyton Mr. & Mrs. James F. Stebbins Mr. & Mrs Robert V. Lindsay Mr. & Mrs. Howard Phipps, Jr. Mrs. Theodore E. Stebbins Mr. & Mrs. Bernard Lippman Mr. John Pickett Mr. & Mrs. John C. Stevenson Mr. & Mrs. V.S. Littauer Mrs. Richard N. Pierson Mr. & Mrs. Norman W. Stewart Mr. & Mrs. Angus Littlejohn Mr. & Mrs. James J. Pirtle Mr. Dudley W. Stoddard

159 Mr. & Mrs. Richard S. Storrs Mr. & Mrs. A.M. Trotter Mr. John C. Weghorn Mr. & Mrs. Joseph S. Stout Mr. & Mrs. E.T. Milner Mr. & Mrs. Richard J. Weghorn Mr. & Mrs. Joseph S. Stout, Jr. Mr & Mrs. William R. Udry Mr & Mrs. Taggart Whipple Mr. Theodore C. Streibert Mr. & Mrs. Stephen Van R. Ulman Mrs. Alexander M. White Mr. Scott Sutcliffe Dr. & Mrs. Thornton Vandersall Mr & Mrs. Warren D. White Mr. & Mrs. Robert Swiggert Mr. & Mrs. Martin Victor Mr Theodore S. Wickersham Dr. Basil Tangredi Mr. Eric Von Raits Mr. Malcolm D. Widenor Mr. & Mrs. Benjamin Taylor Mr. & Mrs. Colton P. Wagner Mr & Mrs. Douglas Williams Mr. & Mrs. Frederick Taylor Ms. Christine M. Walker Mr. & Mrs. Duane N. Williams Mrs. Henry C. Taylor Mrs. George Walker Mr. Henry S. Williams Mr. & Mrs. John W. Taylor Mr & Mrs. R.W. Walker Mr & Mrs. Ichabod Williams Miss Jeanie Tengelson Mrs. Robert P Walton Mr. & Mrs. Thorndike Williams Mr. & Mrs. Daniel G. Tenney, Jr. Dr & Mrs. David E. Warden Mrs. John C. Wilmerding Mr. & Mrs. D.B. Tenney Mrs. Ethelbert Warfield Mrs. Henry S. Wingate Mr. & Mrs. Fred Thielking Mr & Mrs. Bradford A. Warner Mrs. Scudder Winslow Mrs. Denyse D. Thors Mr. & Mrs. Harold L. Warner, Jr. Mc & Mrs. William A. Woodcock Dr. & Mrs. Robert Tilney Dr. & Mrs. James D. Watson Mr. & Mrs. James A. Woods Mr. & Mrs. Warren I. Titus, Jr. Edwin S. Webster Foundation Mrs. Ford Wright Mr. & Mrs. Alexander C. Tomlinson Mrs. Arthur D. Weekes, Jr. Miss Flavia Helen Wyeth Dr. & Mrs. M.B. Travis Mc & Mrs. Bradford G. Weekes Mr & Mrs. Woodhull Young Mr. & Mrs. Bronson Trevor, Jr. Mr & Mrs. R. Ray Weeks Mr Robert Zakary Mr. & Mrs. Stanley Trotman Mrs. E Carrington Weems

160 COLD SPRING HARBOR MEETINGS PROGRAMS

48TH COLD SPRING HARBOR SYMPOSIUM ON QUANTITATIVE BIOLOGY Molecular Neurobiology June 1-June 8

Opening Remarks: W.M. Cowan, Salk Institute, San Diego, California

SESSION 1Electrically Excitable Channels Chairperson:A. Karlin, Columbia University College of Physicians and Surgeons, New York, New York

Aldrich, R.A., Stevens, C.F., Dept. of and functional reconstitution of the dium channel. Physiology, Yale University School sodium channel from rat brain. Agnew, WS.,' Miller, J.A.,'Ellis- of Medicine, New Haven, Connect- Fritz, L.C.,' Moore, H.-P.H.,2 Raf- man, M.H.,' 'Dept. of Physiology, icut: Rates of sodium channel Mac- tery, M.A.,' Brockes, 'Divi- tivation depend on the channel's Yale University School of Medi- sion of Chemistry, California In- cine, New Haven, Connecticut; state. stitute of Technology, Pasadena; 'Dept. of Neurosciences, Univer- Catterall, WA., Talvenheimo, J.A., 'Dept. of Biochemistry, University sity of California, San Diego: The Hartshorne, P., Tamkun, M.M., ofCalifornia,SanFrancisco; voltage-regulated sodium channel Messner,D.J.,Sharkey, R.M., 'MRC, Biophysics Unit, London, from electroplax of Electrophorus Dept. of Pharmacology, University England: Monoclonal antibodies as electricus. of Washington, Seattle: Structure probes for the eel electroplax so-

SESSION 2The Biochemistry and Molecular Genetics of the Acetylcholine Receptor Chairperson:C.F. Stevens, Yale University, New Haven, Connecticut Karlin, A.,' Cox, R.,' Dwork, A.,' organ of Torpedo californica. Barnard, E . A.,' Richards, B.M.,' Kaldany, R.-R.,' Kao, P.,' Lobel, P.,' Stengelin, S., Ueno, S., Ballivet, M., 'Dept. of Biochemistry, Imperial Yodh, N.,' Holtzman, E.,' 'Dept. of Heinemann, S., Patrick, J., Molec- College of Science and Technology, Biochemistryand Neurology, ular Neurobiology Laboratory, Salk London, England; 'Searle Research 'Dept. of Biological Sciences, Co- Institute, La Jolla, California: Mo- and Development Laboratories, lumbia University, New York, New lecular cloning of acetylcholine G.D. Searle Co., High Wycombe, York: The arrangement and func- receptor. England: Structural requirements in tions of the chains of the acetylcho- Noonan, D., Hershey, N.D., Mixter, nicotinic acetylcholine receptors, as line receptor of Torpedo electric revealed by translation of mRNA tissue. K.S., Claudio, T., Davidson, N., Dept. of Chemistry, California In- and cloning of cDNA. Raftery, M.A., Conti-Tronconi, B., stitute of Technology, Pasadena: Numa, S., Noda, M., Takahashi, H., Dunn, S.M.J., Division of Chemis- Structure and function of Torpedo Tanabe, T., Toyosato, M., Furutani, try and Chemical Engineering, Cal- acetylcholine receptor genes. Y., Kikyotani, S., Dept. of Medical ifornia Institute of Technology, J.P.,' Sebbane, R.,' Gardner, Chemistry, Kyoto University Fac- Pasadena: Signaling to and through 5.,2 Olson, E.N.,' 'Dept. of Phar- ulty of Medicine, Japan: Molecular nicotinic acetylcholine receptors. macology, Washington University, structure of Torpedo californica Forrest, J.W., Ingraham, H.A., Bal- St. Louis, Missouri; 'Dept. of Bio- acetylcholine receptor. livet, M., Patrick, J., Heinemann, logical Sciences, University ofBallivet, M., Nef, P., Spierer, P., Uni- S., Molecular Neurobiology Labo- Pittsburgh, Pennsylvania; 'Dept. of versity of Geneva, Switzerland: ratory, Salk Institute, La Jolla, Cal- Biochemistry, Washington Univer- Genomic sequences encoding the ifornia: Isolation and analysis of a sity, St. Louis, Missouri: Studies of alpha subunit of the nicotinic ace- cDNA clone synthesized from the regulation of acetylcholine re- tylcholine receptor are highly con- mRNA isolated from the electric ceptor synthesis. served in evolution.

161 SESSION 3Genetic Analysis of the Nervous System Chairperson:N. Davidson, California Institute of Technology, Pasadena, California Hahn, W., Chaudhari, N., Beck, L., Anderson, D., Jackson,J.,Ma- Switzerland: Chromatin changes Morrison, K., Dept. of Anatomy, daule, P., Schwartz, J., Institute of accompanying neuronal differen- University of Colorado Health Sci- Cancer Research and Center for tiation. ences, Denver: Genetic expression Neurobiology and Behavior, Co- Sulston, J.E., Laboratory of Molecu- in postnatally developing brain. lumbia University, New York, New lar Biology, MRC, Cambridge, Sutcliffe, LG.,' Milner, R.J.,' Bloom, York: Isolating genes expressed in England: Neuronal cell lineages in F.E.,2 'Scripps Clinic and Research single neurons. the nematode C. elegans. Foundation; 'Salk Institute, LaKuenzle, C.C., Heizmann, C.W., Horvitz, R., Ellis, H.M., Fixsen, W, Jolla, California: Cellular localiza- Hiibscher, U., Hobi, R., Winkler, Greenwald, I., Sternberg, P., Dept. tion of the proteins encoded by G.C., Jaeger, A.W., Morgenegg, G., of Biology, Massachusetts Institute brain-specific mRNAs. Dept. of Pharmacology and Bio- of Technology, Cambridge: Muta- Axel, R., Buck, L., Stein, R., Palaz- chemistry, School of Veterinary tions that affect neuronal develop- zolo, M., Claudio, T., Gallay, B., Medicine, University of Zurich, ment in the nematode C. elegans.

SESSION 4Studies on Neuronal Proteins with Recombinant DNA Techniques Chairperson:E. Barnard, Imperial College, London, England Mallet, J., Biguet, N.F., Grima, B., School of Medicine, California: Pharmacology,YaleUniversity Julian, J.F., Lamouroux, A., Insti- Structure, regulation, and brain lo- School of Medicine, New Haven, tut de Microbiologie,University calization of mRNA for rat dopa- Connecticut: Neuron-specific phos- Paris, France: A molecular genetics mine-/3- hydroxylase. phoproteins as models for neuronal approach to the study of catechol- Joh, T.H., Baetge, E.E., Ross, M.E., gene expression. amine biosynthesis. Moon, H.M., Albert, V.R., Reis, Lewis, R.M., Wallace, W.C., Kana - Chikaraishi, D.M., Brilliant, M.H., D.J., Laboratory of Neurobiology, zir,S., Greengard, P.,Dept. of Lewis, E.J., Tomasiewicz, H.G., Cornell University Medical Col- Pharmacology,YaleUniversity Molecular and Cellular Biology, lege, New York, New York: Evi- School of Medicine, New Haven, National Jewish Hospital/National dence for the existence of a gene Connecticut: Expression of cell- Asthma Center, Denver, Colorado: family coding for catecholamine type-specificneuronalphospho- Cloning and characterization of biosynthetic enzymes. proteins. brain-specific transcripts - Rare,DeGennaro, L.J.,' Wallace, W.C.,2 Fambrough, D.M., Dept. of Em- and tyro- Kanazir, 5.,2 Lewis, R.M.,2 Green- bryology, Carnegie Institution of sine hydroxylase. gard, P.,2 'Max-Planck Institute for Washington, Baltimore, Maryland: O'Malley, K., Mauron, A., Kedes, L., Psychiatry, Martinsried, Federal Regulation of the sodium pump. Barchas, J., Stanford University Republic of Germany; 'Dept. of

SESSION 5 Neuronal Surface Molecules Chairperson:Z. Hall, University of California, San Francisco, California Rutishauser, U., Dept. of Anatomy, Edelman, G.M., Hoffman, S., Cun- Federal Republic of Germany: Case Western Reserve University ningham, B.A., Rockefeller Uni- Characterization of cell-surface School of Medicine, Cleveland, versity, New York, New York: components involvedincell Ohio: Chemistry and biology of a Structure and modulation of neural adhesion. neural cell adhesion molecule. cell adhesion molecules. Raff, M.C.,' Miller, R.H.,' Noble, Goridis, C., Centre d'Immunologie Zipser, B., Flanagan, T., Flaster, M., M.,2 'MRC Neuroimmunology INSERM-CNRS de Marseille-Lu- Macagno, E., Stewart, E., Cold Project, Dept. of Zoology, Univer- miny, France: Neural surface anti- Spring Harbor Laboratory, New sity College London, England; gensduringnervoussystem York: Analysis of neuron-specific 'Institute of Neurology, London, development. leech antigen. England: Glial cell lineages in the Schubert, D., LaCordbiere, M., SalkSchachner, M., Faissner, A., Meier, rat optic nerve. Institute, La Jolla, California: A role D., Kruse, J., Lindner, J., Rathjen, for adherons in the adhesion of F., Wernecke, H., Dept. of Neuro- nerve and muscle cells. biology, University of Heidelberg,

SESSION 6 Biochemical Analysis of Electrically Active Proteins Chairperson:G. Edelman, Rockefeller University, New York, New York Lindstrom, J.,' Tzartos, S.,' Gullick, California, San Diego: Use of mono- autoimmune response to receptor in W.,' Hockschwender, S.,' Swanson, clonal antibodies to study acetyl- myasthenia gravis. L.,' Montal, M.,2 'Salk Institute for choline receptors from electric or- Anderson, DI,' Blobel, G.,2 'Insti- Biological Studies; 'University of gans, muscle, and brain and the tute for Cancer Research, Colum-

162 bia University College of Physi- Papazian, D.,' Chan, S.,' Hess, E.J.,' Radioligand binding in neuronal cians and Surgeons, New York, Rahamimoff,H.,3 Goldin,S.,2 and nonneuronal tissue. New York; 'Laboratory of Cell Bi- 'Dept. of Biochemistry; 'Dept. ofBirdsall, N.J.M.,' Hulme, E.C.H.,' ology, Rockefeller University, New Pharmacology,HarvardMedical Stockton,J.,'Wong,E.H.F.,2 York, New York: Biosynthesis of School, Boston, Massachusetts; 'Division of Molecular Pharmacol- the acetylcholine receptor in vitro. 'Dept. of Biochemistry, Hadassah ogy, National Institute for Medical Medical School, Jerusalem, Israel: Changeux, J.P., Institut Pasteur, Paris, Research, London, England; 'Dept. Purification and characterization of of Biochemistry, University of Cal- France: Allosteric properties of the synaptosomal Ca pumps. acetylcholine receptor. ifornia, Riverside: Muscarinic re- Triggle, D.J.,' Bolger, G.T.,' Gengo, ceptorsubclasses - Allostericin- Kristofferson, D., Fairclough, R., P.J.,'Luchowski, E.M.,' Rampe, teractions. Love, R., Moore, J., Young, E., D.,' Janis, R.A.,2 'Dept. of Bio- Stroud, R., Dept. of Biochemistry chemical Pharmacology, State Uni- and Biophysics, University of Cali- versity of New York, Buffalo; fornia, San Francisco: The struc- 'MilesInstitute for Preclinical ture of an acetylcholine receptor Pharmacology, New Haven, Con- and what it tells us about function. necticut: Ca-channel antagonists-

SESSION 7 Behavior Chairperson:M.C. Ralf, University College London, London, England Adler, J., Dept. of Biochemistry and Berkeley: Information processing in and Surgeons, New York, New Genetics, University of Wisconsin, a sensory system. York: Classical conditioning in Madison: How E. coli does neuro-Schwartz, J.H., Bernier, L., Castel- Aplysia- Conditioning and sensiti- biology . lucci, V.F., Eppler, C.M., Saitoh, zation seem to share aspects of the Boyd, A.,' Kirkos, A.,2 Mutoh, N.,2 T., Kandel, E.R., Center for Neu- same molecular cascade. Simon, N.,2 'Leicester Biocentre, robiology and Behavior, Columbia Aceves-Pina, E.O., Brooker, R., University of Rhode, England; University College of Physicians Duerr,J.S.,Livingston,M.S., 'Division of Biology, California In- and Surgeons and New York State Quinn, W.G., Smith, R.T., Sziber, stitute of Technology, Pasadena: PsychiatricInstitute, New York, RP., Tempel, B.L., Tully, T., Dept. The structure of proteins that act as New York: What enzymatic steps of Biology, Princeton University, receptors and sensory transducers determine the time course of short- New Jersey: Genetic studies of in bacteria. term memory in Aplysia? learningand memoryinDro- Koshland, D.E.,Jr.,Russo, A.F.,Kandel, E.R., Abrams, T.W., Carew, sophila. Gutterson, N.I., Dept. of Biochem- T.J., Hawkins, R.D., Columbia istry,University of California, University College of Physicians

SESSION 8The Regulation of Axon Organization Chairperson:U.J. McMahan, Stanford University, Stanford, California Bentley, D., Caudy, M., Dept. of Zo-McKay, R.D.G., Hockfield, S., Jo- White, J.G., Southgate, E., Thomson, ology and Biophysics Group, Uni- hansen,J.,Cold Spring Harbor J.N., Brenner, S., Laboratory of versity of California, Berkeley: Laboratory, New York: The orga- Molecular Biology, MRC, Cam- Pathways and pathfinding by pe- nization of molecularly distinct ax- bridge, England: Patterns of con- ripheralpioneerneurons in ons in the leech connective. nectivity in the nervous system of grasshoppers. Reichardt, L.F., Calof, A.L., Green- C. elegans. Goodman, C.S., Bastiani, M.J., Ko- span, R.J., Greig, K.F., Lander, Wyman, R.J., Thomas, J.B., Dept. of tria, K.J., Dept. of Biological Sci- A.D., Matthew, W D., Tomaselli, Biology, Yale University, New Ha- ences, Stanford University, Califor- K.J., Winter, J., Depts. of Physiol- ven,Connecticut:Genetic ap- nia: Guidance of neuronal growth ogy and Biochemistry, University of proach to the molecular basis of cones-Cell recognition and filo- California, San Francisco: Studies neural connectivity. podial interactions during embry- on factors that promote neurite out- onic development. growth in vitro.

SESSION 9 Molecular Aspects of Neuropeptides I Chairperson:H. Reuter, University of Berne, Berne, Switzerland Jan, Y.N., Bowers, C., Evans, L., Jan,Gould, R.J., Murphy, K.M.M., Sny-Evans, R.M.,' Swanson, L.,' Saw- L.Y., Dept. of Physiology, Univer- der, S.H., Dept. of Neuroscience, chenho, P.,' Vale, W,' River, J.,' sity of California, San Francisco: Johns Hopkins University School of Amara, S.,2 Rosenfeld, M.G.,' 'Salk Roles of peptides in neuronal func- Medicine, Baltimore, Maryland: Institute for Biological Studies; tion-Studies using frog autonomic Studies of voltage-operated Ca 'University of California School of ganglia. channels using radioligands. Medicine, San Diego: Generation of

163 diversity in the nervous system - fornia: The molecular basis of a University,Canberra:Proteolytic Exon invasion, splicing control, and simple behavior. processing and regulation of neu- complex genes. Shine,J.,Mason, A., Evans,B., ropeptide biosynthesis. Scheller, R.H., Dept. of Biological Richards, R., Centre for Recombi- Sciences, Stanford University, Cali- nant DNA Research, Australian

SESSION 10 The Cellular Organization of Neurons Chairperson:H. Thoenen, Max-Planck Institut, Martinsried, Federal Republic of Germany

Weber, K., Shaw, G., Osborn, M., the base of dendritic spines of CNS robiology, Weizmann Institute of Debus, E., Geis ler, N., Max-Planck neurons -Their possible role in Science, Rehovot, Israel: Expres- Institute for Biophysical Chemistry, synapse construction and modifi- sion of mRNA for microtubule pro- Gottingen, Federal Republic of cation. teins in the developing nervous Germany: Neurofilaments -Struc- system. Stallcup, W, Beasley, L., Levine, J., tural aspects and expression during Molecular Neurobiology Labora-Baitinger, C.,' Cheney, R.,' Clem- development. tory, Salk Institute, La Jolla, Cali- ents, D.,' Glicksman, M.,' Hiro- Lasek, R.J., Drake, P.F., Oblinger, fornia: Cell-surface molecules that kawa, N.,' Levine, J.,2 Meiri, K.,' M.M., Neurobiology Center, Dept. characterize different stages in the Simon, C.,' Skene, J.H.P.,, Wil- of Developmental Genetics and development of cerebellarinter- lard, M.,' 'Dept. of Anatomy and Anatomy, Case Western Reserve neurons. Neurobiology, Washington Univer- University, Cleveland, Ohio: Re- sity, St. Louis, Missouri; 'Dept. of gional differences in the periphery Matus, A., Friedrich Miescher Insti- Neurobiology, Salk Institute, La of neuronal cytoskeletons may be tute, Basel, Switzerland: Neuronal Jolla, California; 'Dept. of Neuro- specified in the cell body. microdifferentiation. biology, Stanford University, Cali- Steward, 0., Dept. of NeurologicalGinzburg, I., Scherson, T., Rybak, S., fornia: Intriguing axonally trans- Surgery, University of Virginia, Kimhi, Y., Neuman, D., Schwartz, ported proteins. Charlottesville: Polyribosomes at M., Littauer, U.Z., Dept. of Neu-

SESSION 11Synaptic Organization and Function Chairperson:D. Bentley, University of California, Berkeley, California McMahan, U.J., Dept. of Neurobiol- Psychiatry, Martinsried, Federal Gumbiner, B., Miljanich, G., Uni- ogy, Stanford University School of Republic of Germany: Quantitation versity of California, San Fran- Medicine, California: Molecular and purification of neurotropic fac- cisco: Sorting in neurons and pep- components of synaptic basal lam- tors from physiologically relevant tide-secreting cells. Ma that cause aggregation of ace- sources. Patterson, P.H., Dept. of Neurobiol- tylcholine receptors on regenerat- Dodd, J., Hamilton, P., Heath, M., ogy, Harvard Medical School, Bos- ing myofibers. Jahr, C., Jessell, T., Dept. of Neu- ton, Massachusetts: Surface mem- Sanes,J.R.,Dept.of Physiology, robiology, Harvard Medical School, brane and secreted glycoproteins of Washington University School of Boston,Massachusetts:Neuro- developing neurons. Medicine,St.Louis, Missouri: transmission and neuronal markers Basal lamina in neuromuscular re- at sensory synapses in the spinal generation and development. cord. Thoenen, H., Korsching, S., Barde, Kelly, R.B., Carlson, S., Burgess, T., Y.-A., Edgar, D., Dept. of Neuro- Moore, H. -P., Buckley, K., Sch- chemistry, Max-Planck Institute for weitzer, E., Hooper, J., Pfeffer, S.,

SESSION 12 Aspects of Vision Chairperson:T. Wiesel, Rockefeller University, New York, New York Stryer, L., Dept. of Structural Biol-Benzer, S., Zipursky, S.L., Venka- ida, H., NHLBI, National Institutes ogy, Stanford University School of tesh, T.R., Fujita, S.C., Biology of Health, Bethesda, Maryland: Medicine, California:Signal-am- Division, California Institute of Synapse formation by neuroblas- plifying proteins in the cyclic nu- Technology, Pasadena: A mono- toma hybrid cells. cleotide cascade of vision. clonal antibody study of the devel- opment of the Drosophila retina. Hockfield ,S. , 'McKay, R. D. G. , ' Dunn, R.J., Hackett, N.R., Huang, Hendry, S.H.,2 Jones, E.G.,' 'Cold K.-S., Jones, S.S., Khorana, H.G., Barnstable, C.J., Akagawa, K., Hof- Spring Harbor Laboratory, New Liao, M.-J., Lo, K.-M., Satterthwait, stein, R., Dept. of Neurobiology, York; 2Dept. of Neurology and A., Seehra, J.S., Yatsunami, K., Harvard Medical School, Boston, Neurosurgery, Washington Univer- Depts. of Biology and Chemistry, Massachusetts: Monoclonal anti- sity School of Medicine, St. Louis, Massachusetts Institute of Technol- bodies that label discrete cell types Missouri: Structural and organiza- ogy, Cambridge: Studies on the in the mammalian nervous system. tional features of mammalian CNS light-transducing pigments, bacter-Nirenberg, M., Krueger, K., Fukui, demonstratedwithmonoclonal iorhodopsin and rhodospin. H., Rotter, A., Wilson, S., Higash- antibodies.

164 SESSION 13Electrophysical Analysis of Membrane Properties Chairperson:J. Schwartz, Columbia University College of Physicians and Surgeons, New York, New York Reuter, H.,' Cachelin, A.B.,' de and voltage-clamp analysis of a K. Barker, J.L., Owen, D.G., Segal, M., Peyer, J. E.,' Kokubun, S.,' Levitan, channel in Drosophila. NINCDS, NationalInstitutesof I.,2 'Dept. of Pharmacology, Uni- Health, Bethesda, Maryland: Reg- versityof Berne,Switzerland; Jan, L.Y., Barbel, S., Timpe, L., Laf- ulation of excitable membrane 'Dept. of Biochemistry, Brandeis fer, C., Salkoff, L., O'Farrell, P., properties in cultured CNS neurons. University, Waltham, Massachu- Jan, Y.N., Depts. of Physiology andSakmann, B., Hamill, O.R, Max- setts: Modulation by phosphoryla- Biochemistry, University of Cali- Planck Institut fiir Biophysikalische tion of Cat* channels and Ca2+-ac- fornia, San Francisco: Mutating a Chemie, Gottingen, Federal Repub- tivated channels. gene for a potassium channel by hy- lic of Germany: The mode of action brid dysgenesis- An approach to Nowycky, M.C.,' Bean, B.P.,2 Hess, ofexcitatoryandinhibitory the cloning of the shaker locus in transmitters. P.,' Tsien, R.W.,2 'Dept. of Neu- Drosophila. roanatomy; 'Dept. of Physiology, Schramm, M., Dept. of Biological Yale University School of Medi- Cull-Candy, S.G., Dept. of Pharma- Chemistry, Hebrew University, Je- cine, New Haven, Connecticut: cology, University College Lon- rusalem, Israel: Mechanism of re- Properties of Ca channels in neu- don,England:Glutamateand ceptor action in the adenylate cy- rons and heart cells. GABA-receptor channels at the lo- clase system. Salkoff, L., Dept. of Physiology, cust nerve muscle junction-Noise University of California School of analysisandsingle-channelre- Medicine, San Francisco: Genetic cording.

SESSION 14 Molecular Aspects of Neuropeptides II Chairperson:S. Numa, Kyoto University, Kyoto, Japan Herbert, E., Dept. of Chemistry, Uni- M.,2 Rutter, W.J.,2 'Dept. of Neu- Rossier,J.,Liston, D., Patey, G., versity of Oregon, Eugene: Regu- robiology,StanfordUniversity Chaminade, M., Foutz, A., Vander- lation of expression of opioid pep- School of Medicine, California; haeghen, J.J., Laboratoire de Phy- tide genes in man, rat, and mouse. 'Dept. of Biochemistry and Bio- siologic Nerveuse, CNRS, Gif-sur- physics, University of California, Yvette, France: The enkephali- Roberts, J.L., Dept. of Biochemistry San Francisco: The biosynthesis nergic neuron-Implications of a and Center for Reproductive Sci- and processing of proteins in the polyenkephalin precursor. ences, Columbia University Col- mouse 7S nerve growth factor lege of Physicians and Surgeons, complex. Summary: E.Kandel, Columbia New York, New York: Pro-opiome- University College of Physicians lanocortin -A model for differen-Ullrich, A., Gray, A., Berman, C., and Surgeons, New York, New tial regulation of neuropeptide hor- Dull, T.J., Dept. of Molecular Bi- York. mone gene expression. ology, Genentech, Inc., South San Francisco, California: Characteri- Darling, T.,' Petrides, P.,' Beguin, P.,' zation of the gene encoding the Frey,P.,'Shooter, E.M.,' Selby, subunit of nerve growth factor.

C. ELEGANS May 4-May 8

SESSION 1Neurobiology Chairperson:P. Anderson, University of Wisconsin, Madison, Wisconsin Rand, J., Dept.of Biological Sci- York, New York:Still more onKenyon, C.J., Hedgecock, E.M., ences, University of Pittsburgh, touch sensitivity in C. elegans. MRC Laboratory of Molecular Bi- Pennsylvania: cha-1, unc-1Z and ology, Cambridge, England: A cell choline acetyltransferaseinC. Johnson, C.D., Stretton, A.O.W., lineage mutation that blocks neu- elegans. Dept. of Zoology, University of roblast formation in the lateral hypodermis. Perkins, L.,' Hedgecock, E.,2 Cu- Wisconsin, Madison: Monoclonal lotti,J.,' Thomson, N.,2 'North- antibodies to Ascaris neurons. Trent,C.,Desai, C., Tsung, N., western University, Evanston, Illi- Horvitz, R., Dept. of Biology, nois; 2MRC Laboratory of Molecu- Angstadt, J.D.,' Stretton, A.O.W.,2 Massachusetts Institute of Technol- lar Biology, Cambridge, England: 'Neurosciences Training Program; ogy, Cambridge: Egg-laying defec- Behaviors of mutants defective in 'Dept. of Zoology, University of tive mutants of C. elegans. fluorescein-concentrating sensory Wisccnsin, Madison: Intracellular neurons. recordings and Lucifer yellow-fills Chalfie, M., Dept. of Biological Sci- of interneurons in the nematode ences, Columbia University, New Ascaris.

165 SESSION 2 Sex Determination and Gametogenesis Chairperson:D.L. Riddle, University of Missouri, St. Louis, Missouri Meneely, P.M., Wood, W.B., Dept. of Technology, Cambridge: A lin-22 Isolation and characterization of a Molecular, Cellular, and Develop- mutation causes apparent spatial developmentally regulated sperm- mental Biology, University of Col- and sexual transformations in cell specific gene family in the nema- orado, Boulder: Autosomal genes fates. tode C. elegans. affecting dosage compensation andGoldstein, P., Dept. of Biology, Uni- Blumenthal, T., Donegan, M., Kirt- sex determination. versity of North Carolina, Char- land, S., Sharrock, W, Spieth, J., Doniach, T., Hodgkin, J., MRC Lab- lotte: Associated autosomal struc- Dept. of Biology, Indiana Univer- oratoryof Molecular Biology, tures(nondisjunctionregulator sity, Bloomington: The yolk protein Cambridge, England: New alleles regions) may specifically influence gene family of C. elegans. of intersex-1 (isx-1). X-chromosome nondisjunction. Stock Center Report Edgar, L.,' Kimble, J.,' Hirsh, D.,'Burke, D.J., Ward, S., Dept. of Em- Edgley, M.L., Swanson, M.M., Rid- 'NIADDK, National Institutes of bryology, Carnegie Institution of dle, D.L., Division of Biological Health, Bethesda, Maryland; Washington, Baltimore, Maryland: Sciences, University of Missouri, 'Laboratory of Molecular Biology, Identification of a large multigene Columbia: Caenorhabditis genetics University of Wisconsin, Madison; family encoding the major sperm center. 'Dept. of Molecular, Cellular, and protein of C. elegans. Developmental Biology, UniversityKlass, M.,' Kinsley,S.,' Lopez, of Colorado, Boulder: The role of L.C.," 'Biology Dept., University of isx-2 in male sexual differentiation. Houston,Texas;'Biochemistry Fixsen, W, Horovitz, R., Dept. of Bi- Dept., M.D. Anderson Hospital and ology, Massachusetts Institute of Tumor Institute, Houston, Texas:

SESSION 3Poster Session: Neurobiology, Sex, and Gametes

White, J.G., Southgate, E., Thomson, gent-solubilized levamisole recep- Madison: Motorneuron membrane J.N., Brenner, S., MRC Laboratory tor. constants and signaling properties of Molecular Biology, Cambridge, Kolson, D.L., Dept. of Biological in the nematode Ascaris. England: The nervous system of C. Donmoyer, J.E., Desnoyers, elegans. Sciences, University of Pittsburgh, Pennsylvania: New alleles of ace-2. Stretton, A.O.W., Dept. of Zool- Rand, J., Bashor, 0., Cavalier, L., ogy, University of Wisconsin, Mad- Russell, R., Dept. of Biological Zuckerman, B.,' Damon, R.,' Ka- ison: Synaptic interactions of ven- Sciences, University of Pittsburgh, hane, 'Dept. of Plant Pathol- tral cord interneurons in Ascaris. Pennsylvania: Anatomy and func- ogy; 'Dept. of Veterinary and Animal Science, University of Mas-Hedgecock, E., MRC Laboratory of tion of the juvenile motor nervous Molecular Biology, Cambridge, system in C. elegans. sachusetts, Amherst; 'Dept.of Biomembranes, Hebrew Univer- England: Q neuroblast migration Albert, RS., Riddle, D.L., Division of sity-Hadassah Medical School, Je- mutants. Biological Sciences, University of rusalem,Israel:Regulation ofFinney, M., Horovitz, R., Dept. of Missouri, Columbia: Reversible chemotaxis of C. elegans by Con- Biology, Massachusetts Institute of developmental alterations in dauer A-binding sites. Technology, Cambridge: The ge- larva sensory neuroanatomy. Siddiqui, S., Culotti, J., Dept. of Bio- netic analysis of unc-86. Perkins, L.,' Hedgecock, E.,2 Thom- Trent, C., Ellis, H.M., Horovitz,R., son, N.,' Culotti, J.,' 'Northwestern chemistry, Molecular Biology, and Cell Biology, Northwestern, Uni- Dept. of Biology, Massachusetts University,Evanston,Illinois; versity, Evanston, Illinois: Charac- Instituteof Technology, Cam- 'MRC Laboratory of Molecular Bi- bridge:Weaklysexuallytrans- ology, Cambridge, England: Ultra- terization of a 34 kD antigen pres- ent on the surface of neurons and formed XX animals are herma- structural analysis of mutants of the phrodites that lack HSN neurons. fluorescein concentrating sensory their support cells in C. elegans us- neurons. ing antibodies against horseradish Hodgkin, J., MRC Laboratory of Mo- peroxidase (HRP). lecular Biology, Cambridge, Eng- Chen, V.,' Hieb, W,' 'Dept. of Bio- land: Chauvinist dumpy genes. physics, 'Dept. of Biological Sci-Culotti, J.,' Siddiqui, S.,' Gremke, ences, State University of New L.,'Stretton, A.O.W.,2 Johnson, Pavalko, F.M., Roberts, T.M., Dept. York, Buffalo: Coordinated mass C.D.,' 'Northwestern University, of Biological Science, Florida State movement in C. elegans and Tuba- Evanston, Illinois; 'University of University,Tallahassee:Mono- trix aceti. Wisconsin, Madison: Monoclonal clonal antibodies as probes for antibodies to nerve-enriched tissue membrane movement on C. elegans Hieb, W.F.,' Chen, V.K. -H.,' 'Dept. from Ascaris bind to C. elegans. sperm. of Biological Sciences, 'Dept. of Biophysical Sciences, State Univer- Okamoto, H., MRC Laboratory of sity of New York, Buffalo: Culture Molecular Biology, Cambridge, morphology of C. elegans behav- England: Monoclonal antibodies to ioral mutants. C. elegans nervous tissue. Lewis, J.A., McLafferty, S., Dept. ofDavis, R.E.,'Stretton, A.O.W.,2 Biological Sciences, University of 'Neurosciences Program, 'Dept. of Missouri, Columbia: The deter- Zoology, University of Wisconsin,

166 SESSION 4Cell Biology Chairperson: H.R. Horvitz, Massachusetts Institute of Technology, Cambridge, Massachusetts

Miller, D.M., III, Ortiz, I., Berliner, Missouri, Columbia: Mutations in- Ward, S., Dept. of Embryology, Car- G., Epstein, H.F., Dept. of Neurol- terfering with indirect suppression negie Institution of Washington, ogy, Baylor College of Medicine, of muscle defects in C. elegans. Baltimore, Maryland: Asymmetric Houston, Texas: The location of two Edgar, L.G., McGhee, J.D., distribution of specific proteins myosins within nematode thick NIADDK, NationalInstitutes of during spermatogenesis. filaments. Health, Bethesda, Maryland: De-Roberts, T.M., Dept. of Biological Francis, R., Waterston, R.H., Dept. velopment of digestive enzymes in Science, Florida State University, of Genetics, Washington University the intestine of C. elegans. Tallahassee: Crawing C.elegans School of Medicine, St. Louis, Clokey, G., Jacobson, L.A., Dept. of spermatozoacontain 2-nmfila- Missouri: Minor muscle proteins in Biological Sciences, University of ments. C. elegans. Pittsburgh, Pennsylvania: Endocy- Brown, S.J., Riddle,D.L., Division of tosis by intestinalcells of C. Biological Sciences, University of elegans.

SESSION 5 Postembryonic Development and Aging Chairperson:D. Hirsh, University of Colorado, Boulder, Colorado Sternberg, P., Ferguson, E., Tsung, setts Institute of Technology, Cam- pool, England: Identification,ti- N., Greenwald,I.,Horvitz,R., bridge: The lin-12 locus determines ters, and functions of molting hor- Dept. of Biology, Massachusetts cell fates in C. elegans. mones in C. elegans. Instituteof Technology, Cam- Ambros, V., Horvitz, R., Dept. of Bi-Johnson, T.E.,' Roberts, L.,2 Cuc- bridge: Genetic control of C. ele- ology, Massachusetts Institute of caro, P.M.,' 'Dept. of Molecular gans vulval cell lineages. Technology, Cambridge: Genes af- Biology and Biochemistry, Univer- Ferguson, E., Horvitz, R., Dept. of fectingtemporalpatternsof sity of California, Irvine; 'Institute Biology, Massachusetts Institute of development. for Behavioral Genetics, Boulder, Colorado: Genetics of long-lived Technology, Cambridge: Synthetic O'Riordan, V., Burnell, A.M., Dept. multivulva mutations. of Biology, St. Patrick's College, variants of C. elegans. Hedgecock, E., MRC Laboratory of Maynooth, Ireland: Intermediary Molecular Biology, Cambridge, metabolism in dauer larvae of C. England: Two genes affecting cell elegans. proliferation in many lineages. Mendis, A.H.W., Keene, N.M., Rees, Greenwald, I., Sternberg, P., Horvitz, H.H., Goodwin, T.W., Dept. of R., Dept. of Biology, Massachu- Biochemistry, University of Liver-

SESSION 6 Poster Session: Genetics and Development Rosenbluth, R., Cuddeford, C., Scott, bert Einstein College of Medicine, University of British Columbia, G., Baillie, D.L., Dept. of Biolog- Bronx, New York: Mutations in Vancouver, Canada; 'Dept. of Bio- ical Science, Simon Fraser Uni- Bergerac induced by heat shock. logical Sciences, Simon Fraser versity, Burnaby, Canada: EMS and Park, J., Horvitz, R., Dept. of Biol- University, Burnaby, Canada: gamma-ray mutagenesis in C. ele- ogy, Massachusetts Institute of Overlapping duplications cover en- gans. Technology, Cambridge: Dominant tire chromosome I. Pulak, R., Samoiloff, M.R. Madrid, mutations of C. elegans. Sigurdson, D.C., Spanier, G., Her- A. Ager, D. Bogaert, T., Dept. of Hosono, R., Kuno, S., Dept. of Bio- man, R.K., Dept. of Genetics and Zoology, University of Manitoba, chemistry, Kanazawa University Cell Biology, University of Minne- Winnipeg, Canada: The 1983 ge- School of Medicine, Ishikawa, Ja- sota, St. Paul: A deficiency map for netic map of Panagrellus redivivus. pan: Isolation and partial charac- a region of chromosome II. Denich, K., Samoiloff, M., Dept. of terization of temperature-sensitiveRogalski, T.M., Baillie, D.L., Dept. Zoology, University of Manitoba, paralytic mutants of C. elegans. of BiologicalSciences, Simon Canada: Mutation rates induced by Ferguson, E., Sternberg, P., Green- Fraser University, Burnaby, Can- large doses of gamma, proton, and wald, I., Horvitz, R., Dept. of Bi- ada: Genetic analysis of the unc-22 neutron irradiation of the X-chro- ology, Massachusetts Institute of IV region of C. elegans. mosome of the nematode Panagrel- Technology, Cambridge: Mutations Golden, J.W., Riddle, D.L., Division lus redivivus. in the locus sup-17 reduce the level of Biological Sciences, University Hartman, P., Dept. of Biology, Texas of lin-12 gene activity. of Missouri, Columbia: Influence Christian University, Fort Worth: Greenwald, I., Horvitz, R., Dept. of of environmental cues on develop- Wild-type and rad mutant radiation Biology, Massachusetts Institute of ment of the C. elegans dauer larva. sensitivities-Effects of parental Technology,Cambridge:sup- Klass, M., Biology Dept., University genotype and developmental stage. 10(n983) confers a phenotype that of Houston, Texas: Age-correlated changes in DNA in C. elegans. Emmons, S.W., Roberts, S., Katzen- is similar to the of unc-93(e1500). berg, D. Sanicola, M. Rubinfeld, Rose, A.M.,' Baillie, D.L.,' Curran, Ishii, N., Suzuki, K., Dept. of Molec- B., Dept. of Molecular Biology, Al- J.,''Dept. of Medical Genetics. ular Biology,Tokai University

167 School of Medicine, Japan: Effect Developmental Biology, University Germany; 'Dept. of Molecular, of radiation on the life span of the of Colorado, Boulder: Studies at the Cellular, and Developmental Biol- nematode Rhabditidae tolcai. zyg-11 locus. ogy, University of Colorado, Boul- Yarbrough, P.O., Hecht, R.M., Dept. Cowan, A., McIntosh, J.R., Dept. of der: Cell lineage and develop- of Biochemical and Biophysical Molecular, Cellular, and Develop- mental defects of temperature- Sciences, University of Houston mental Biology, University of Col- sensitive embryogenesis mutants in Central Campus, Texas: Develop- orado, Boulder: Effect of reposi- C. elegans. mental regulation of two glyceral- tioning the first cleavage plane onCassada, R., Denich, K., Isnenghi, dehyde-3-phosphate dehydrogen- the development of C.elegans E., Schierenberg, E., Smith, K., ases in C. elegans. embryos. Dept. of Molecular Biology, Max- Planck Institute for Experimental Abdulkader, N., Otsuka, A., Dept. ofDenich, K.,' Cassada, R.,2 Isnenghi, Genetics, University of California, Medicine, Gottingen, Federal Re- E.,2 Schierenberg, E.,3 'Dept. of public of Germany: Temperature- Berkeley: Mutations affecting the Zoology, University of Manitoba, sensitive embryonic mutants-The morphology of thetailof C. Winnipeg, Canada; 'Dept. of Mo- elegans. lecular Biology, Max-Planck Insti- Gottingen set revisited. Kemphues, K., Wolf, N., Hirsh, D., tute for Experimental Medicine, Dept. of Molecular, Cellular, and Gottingen,FederalRepublicof

SESSION 7Transposons, Suppressors, and Transformation Chairperson:J. Hodgkin, MRC Laboratory of Molecular Biology, Cambridge, England

Eide, D., Anderson, P., Dept. of Ge- Einstein College of Medicine, lecular and genetic analysis of the netics,University of Wisconsin, Bronx, New York: Evidence for a dpy-14 unc-13 region of chromo- Madison:Spontaneousunc-54 transposon in C. elegans. some I. mutations. Liao, L.W, Rosenzweig, B., Hirsh, Waterston, R.H., Bolten, S., Dept. of Moerman, D.G., Waterson, R.H., D., Dept. of Molecular, Cellular, Genetics, Washington University, Dept. of Genetics, Washington Uni- and Developmental Biology, Uni- St. Louis, Missouri: Evidence that versity School of Medicine,St. versity of Colorado, Boulder: Tcl, sup-7 of C. elegans is a tRNAT'P Louis, Missouri: Spontaneous un- atransposable elementinC. gene. stable unc-22 IV mutations in C. elegans. elegans var. Bergerac. Stinchcomb, D., Shaw, J., Wood, W, Rose, A.M., Mawji, N., Harris, L., Hirsh, D., Dept. of Molecular, Cel- Emmons, S.W., Yesner, L., Ruan, K., Donati, L., Dept. of Medical Ge- lular, and Developmental Biology, Katzenberg, D., Rubinfeld, B., netics, University of British Co- University of Colorado, Boulder: Dept. of Molecular Biology, Albert lumbia, Vancouver, Canada: Mo- DNA transformation of C. elegans.

SESSION 8Genes and Molecular Biology Chairperson:R.K. Herman, University of Minnesota, Minneapolis, Minnesota

Sanford, T.R., Golomb, M., Riddle,Russnak, R.H., Jones, D., Candido, collagen genes during C. elegans D.L., Division of Biological Sci- E.P.M., Dept. of Biochemistry, development. ences, University of Missouri, Co- University of British Columbia, Politz, lumbia: RNA polymerase II from Kusch, M., Politz, S.M., Vancouver, Canada: The 16kD heat- Edgar, R.S., University of Califor- wild-type and amanitin-resistant shock protein gene family of C. strains of C. elegans. nia, Santa Cruz: The search for cu- elegans. ticlecollagenprimarygene products. Hedgecock, E., Salvato, M., Thom-Kramer, J., Cox, J., Hirsh, D., Dept. son, J.N., MRC Laboratory of Mo- of Molecular, Cellular, and Devel- Wild, M., Landel, C., Krause, M., lecular Biology, Cambridge, Eng- opmental Biology, University of Begley, M., Hirsh, D., Dept. of land: Nucleolar mutants. Colorado, Boulder:Organization Molecular, Cellular, and Develop- and sequence analysis of the colla- mental Biology, University of Col- Snutch, T.P., Bail lie, D.L., Dept. of gen multigene family of C. elegans. orado, Boulder: C. elegans actin Biological Sciences, Simon Fraser genes. University,Burnaby, Canada:Cox, J., Kramer, J., Hirsh, D., Dept. Karn, J., MRC Laboratory of Molec- Structure and molecular organiza- of Molecular, Cellular, and Devel- ular Biology, Cambridge, England: tion of genes coding for the major opmental Biology, University of More myosins (not more of my heat-shock peptide in C. elegans. Colorado, Boulder: Expression of sins.)

SESSION 9Poster Session: Proteins, DNA, and Polymorphisms

Burke, D.J., Ward, S., Kirschner, B., netics, University of California, C -A new class of acetylcholines- Dept. of Embryology, Carnegie In- Berkeley: A general method for the terase in C. elegans. stitution of Washington, Baltimore, identification of proteins affectedCarton, M.,Culotti, J., Northwestern Maryland: Identification of sperm- by null mutations. University,Evanston,Illinois: specific proteins and isolation ofKolston, D.L., Russell, R.L., Dept. their genes. Electrophoretic separation of ace- of Biological Sciences, University tylcholinesterase forms from C. Otsuka, A., Wang, D., Dept. of Ge- of Pittsburgh, Pennsylvania: Class elegans.

168 Jen-Jacobson,L., Jacobson, L.A., Eide, D., Anderson, P., Dept. of Ge- ner, L., Dept. of Molecular Biol- Shah, M.V., Dept. of Biological netics, University of Wisconsin, ogy, Albert Einstein College of Sciences, University of Pittsburgh, Madison: A novel insertion muta- Medicine, Bronx, New York: Iden- Pennsylvania: Biochemical charac- tion in unc-54. tification of distinctC.elegans terization of Cathepsin D. Prasad, S., Bail lie, D.L., Dept. of Bi- strains on the basis of restriction Jacobson, L.A., Jen-Jacobson, L. Bo- ological Sciences, Simon Fraser fragment polymorphisms. lanowski, M., Shah, M.V., Dept. of University, Burnaby, Canada: Clon- Carr, S., Cox, J., Hirsh, D., Dept. of Biological Sciences, University of ing and characterization of the gene Molecular, Cellular, and Develop- Pittsburgh, Pennsylvania: Mutants coding for the muscle protein tro- mental Biology, University of Col- deficient in lysosomal Cathepsin D pomyosin in C. elegans. orado,Boulder:Polymorphism activity. Nelson, D.W., Honda, B.M., Dept.of mapping. Jameel,S., McFadden, B.A. Bio- Biological Sciences, Simon Fraser Jefferson, R., Hirsh, D., Dept. of chemistry/Biophysics Program, University, Burnaby, Canada: 5S Molecular, Cellular, and Develop- Washington State University, Pull- RNA genesin C. elegans. mental Biology, University of Col- man:Isocitratelyase fromC. Stinchcomb, D., Mello, C., Roberts, orado, Boulder: Plasmid expres- elegans. J., Hirsh, D., Dept. of Molecular, sion vectors for the in vivo analysis Starck, J., Dept. de Biologie Gener- Cellular, and Developmental Biol- of regulatory sequences. ale et Appliquee, Universite Claude ogy, University of Colorado, Boul- Himmelhoch, S.,' Zuckerman, B.,' Bernard Lyon, France: Synthesis of der: C. elegans DNA that directs 'Dept. of Biomembranes, Weiz- the four specific proteins in C. ele- segregation in S. cerevisiae. mann Institute, Rehovot, Israel; gans mutant strains,affected inBail lie, D.L., Beckenbach, K.A., 'Dept. of Plant Pathology, Univer- their gametogenesis or in their Dept. of Biological Sciences, Si- sity of Massachusetts, Amherst: embryogenesis. mon Fraser University, Burnaby, Characterization from ultrathin Albertson, D.G., MRC Laboratory of Canada: Molecular analysis of the cryosections of negatively charged Molecular Biology, Cambridge, unc-22 region of chromosome IV. groups on the cuticle and intestine of C. elegans. England: Localization of genes onFelsenstein, K.M., Emmons, S.W., C. elegans chromosomes. Dept. of Molecular Biology, Albert Emmons, S.W., Yesner, L., Dept. of Benian, G.M., Waterston,R.H., Einstein College of Medicine, Molecular Biology, Albert Einstein Dept. of Genetics, Washington Uni- Bronx, New York: Short,inter- College of Medicine, Bronx, New York: Optimal bacterial strains for versity School of Medicine,St. spersed repetitive sequences in C. cultivation of C. elegans. Louis, Missouri: Cloning of myosin elegans. heavy chain genes and adjacentEmmons, S.W.,Felsenstein,K., regions. Katzenberg, D., Rubinfeld, B., Yes-

SESSION 10 Embryogenesis Chairperson:S. Ward, Carnegie Institution of Washington, Baltimore, Maryland

Priess, J., Hirsch, D., Dept. of Mo- sota, St. Paul: Genetic mosaics of mental Biology, University of Col- lecular,Cellular, and Develop- C. elegans. orado, Boulder: Segregation of mental Biology, University of Col- Schierenberg, E., Wood, W.B., Dept. germline-specific antigens during orado, Boulder: Embryonic cuticle of Molecular, Cellular, and Devel- embryogenesis in C. elegans. development. opmental Biology, University ofGossett, L.A., Hecht, R.M., Dept. of Ellis, H.M., Tsung, N., Horvitz, R., Colorado, Boulder: Experimental Biochemical and Biophysical Sci- Dept. of Biology, Massachusetts embryology. ences, University of Houston Cen- Instituteof Technology, Cam- Sulston, LE., Thomson, IN., MRC tral Campus, Texas: zyg-4 and its bridge: Activity of the gene ced-3 is Laboratory of Molecular Biology, allele emb-7 exhibit muscleless necessary for the initiation of pro- Cambridge, England: Ontogeny of phenotypes during embryogenesis grammed cell death. the anterior sensilla. in C. elegans. Herman, R.K., Dept. of Genetics and Strome, S., Wood, WD., Dept. of Cell Biology, University of Minne- Molecular, Cellular, and Develop-

MICROBIAL DEVELOPMENT May 11-May 15

SESSION 1 Chairperson:J. Adler, University of Wisconsin, Madison, Wisconsin

Chemotaxis Krikos, A., Mutah, N., Boyd, A., Si- adena: Sensory transducers of E. Callahan, A.M., Sherris, D., Slocum, mon, M., Dept. of Biology, Cali- coli are composed of discrete struc- M.K., Parkinson, J.S., Dept. of Bi- fornia Institute of Technology, Pas- tural and functional domains. ology, University of Utah, Salt Lake

169 City: Genetics of a chemotactic tants lacking the methyltransferase ton, Texas: Genetic dissection of transducer protein in E. coli. (cheR) or methylesterase (cheB) eukaryotic flagella. Stock J., Dept. of Biochemical Sci- enzymes. Dutcher, S.K., Ramanis, Z., Luck, ences, Princeton University, New Flagellar Structure D.J.L., Rockefeller University, New Jersey: The role of receptor methy- York, New York: Genetic behavior lation in chemotaxis as revealed by Huang, B., Dept. of Cell Biology, ofanewlinkagegroupin the behavior of S. typhimurium mu- Baylor College of Medicine, Hous- Chlamydomonas.

SESSION 2 Chairperson:N. Agabian, University of Washington Medical School, Seattle, Washington

Cell Division in E. coli sity of South Carolina, Columbia; flagellum biosynthesis and assem- Donachie, W, Dept. of Molecular Bi- 'Dept.of MolecularBiology, bly in the Caulobacter crescentus ology, University of Edinburgh, Northwestern University Medical cell cycle. Scotland: Regulation of expression School, Chicago, Illinois: Gene or- in a cluster of cell-division genes in ganization of Caulobacter cres- Cell Division in Physarum E. coli. centus. Burland, T.G.,' Dove, W ,' Gull, Hirota,Y., Maruyama, I.N., Naka- Shapiro, L., Dept. of Molecular Bi- Schedl, T.,' 'McArdle Laboratory, mura, M., Yamamoto, A., Nishi- ology, Albert Einstein College of University of Wisconsin, Madison; mura, Y., National Institutes of Ge- Medicine, Bronx, New York: Mem- 'Biological Laboratories, Univer- netics, Mishima, Japan:Entire brane biogenesis and the regulation sity of Kent, Canterbury, England: nucleotide sequence of E.coli of differentiation in Caulobacter. Expression of the tubulin gene fam- structure gene coding for penicil- Agabian, N., Gill, P.R., Milhausen, iliesin the cycles of Physarum lin-binding protein 3 (pbp-3). M., Dept. of Biochemistry, Univer- polycephalum. sity of Washington, Seattle: The Regulation of Polarity and Morpho- flagellin gene family of Caulobac- genesis during Cell Division in ter crescentus. Caulobacter Ohta, N., Chen, L.-S., Newton, A., Ely, B.,' Schoenlein, P.V.,' Winkler, Dept. of Biology, Princeton Uni- M.E.,' 'Dept. of Biology, Univer- versity, New Jersey: Regulation of

SESSION 3 Poster Session

Bellofatto, V., Amemiya, K. Shapiro, in the promoter region of a Bacillus tein S, a spore coat protein, during L., Dept. of Molecular Biology, Al- subtilis gene. fruiting body formation in Myxo- bert Einstein College of Medicine, Liu, C.-J.,'Pogell, B.M.,' Meade, coccus xanthus Bronx, New York: An RNA proc- H.,' 'Dept. of Medicinal Chemis-Piret, J.M., Cheer, K.F., John Innes essing enzyme from Caulobacter try/Pharmacognosy, crescentus. Schoolof Institute, Norwich, England: Clon- Pharmacy, University of Maryland, ing of genes involved in differentia- Curiel-Quesada, E., Fliss, E.R., Set- Baltimore; 'Biogen, Inc., Cam- tion of Streptomyces coelicolor low, P., Dept. of Biochemistry, Uni- bridge,Massachusetts: Complete A3(2). versity of Connecticut Health Cen- deletion of the argG gene occurs in ter,Farmington:Cloningand Ruby, E.G., Dept. of Biological Sci- aerial mycelium-negative isolates of ences, University of Southern Cali- analysis of the gene for the C pro- streptomycetes. tein- A spore-specific protein de- fornia, Los Angeles: Differentia- Manis, J.J., Olsen, M.K., Fermenta- tion of intraperiplasmically growing graded during Bacillus megaterium tion Research and Development, spore germination. Bdellovibriobacteriovorous- The UpjohnCompany,Kalamazoo, controlofinitiationof DNA DeWitt,J.P.,Abbott Laboratories, Michigan: Construction of an E. replication. North Chicago, Illinois:Genetic coli-Streptomcyespromoter-probe instability involving regulation of shuttle vector. Yee,T.,Correia,F.,Inouye, M., Dept. of Biochemistry, State Uni- secondary metabolism in Strepto- Nelson, D.R.,' Zusman, D.R.,' 'Dept. myces erythreus. versity of New York, Stony Brook: of Microbiology, University of Two-dimensional Si nuclease het- Donnelly, C.E., Sonenshein, A.L., Rhode Island, Kingston; 'Dept. of eroduplex mapping-Detection of Dept. of Molecular Biology and Microbiology and Immunology, rearrangements in bacterial Microbiology, TuftsUniversity, University of California, Berkeley: genomes. Boston, Massachusetts: Mutations Transport and localization of pro-

SESSION 4 Spore Formation in Bacillus Chairperson:R. Losick, Harvard University, Cambridge, Massachusetts

Ferrari, E, Hoch, J., Research Insti- Public Health Research Institute of sity, Cambridge, Massachusetts: tute of Scripps Clinic, La Jolla, the City of New York, Inc., New Developmental regulationof a California: Control of sporulation York: The Bacillus spoOH gene. sporulation promoter in Bacillus by spoO genes. Zuber, P., Johnson, W.C., Losick, R., subtilis. Smith, I., Dubnau, E., Ramakrishna, Dept. of Cellular and Develop- Sonenshein,A.L.,Rosenkrantz, N., Weir, J., Dept. of Microbiology, mental Biology, Harvard Univer- M.S., Donnelly, C.E., Fisher, S.,

170 Emond, R., Dept. of Molecular Bi- Set low,P.,Dept. of Biochemistry, of Cellular and Developmental Bi- ology and Microbiology, Tufts Uni- University of Connecticut Health ology, Harvard University, Cam- versity,Boston,Massachusetts: Center, Farmington: Protein degra- bridge, Massachusetts: Develop- Regulation in vivo of Bacillus sub- dationduringbacterialspore mental genetics in Bacillus using the tilis genes active during growth or germination. Streptococcus transposon Tn9/7. sporulation. Youngman, P.J., Perkins, J.B., Dept.

SESSION 5 Chairperson:D. Hopwood, JohnInnes Institute, Norwich, England RNA Polymerase Heterogeneity in nio: Isolation of Bacillus subtilis Laboratories, Indianapolis, Indi- Bacillus mutants with altered expression of ana: Genetic control of tylosin bio- a gene transcribed in vitro by a "- Pero, J., Costanzo, M., Hannett, N., synthesis in Streptomyces fradiae - containing RNA polymerase. A model to study regulation of an- Dept. of Cellular and Develop- tibiotic gene expression and DNA mental Biology, Harvard Univer- Price, C.W., Gitt, M.A., Wong, S.-L., sity, Cambridge, Massachusetts: Doi, R.H., Dept. of Biochemistry amplification. Sigma factors, promoters, and the and Biophysics, University of Cali-Westpheling, J., Dept. of Cellular and temporal control of gene fornia, Davis: Cloning and genetic Developmental Biology,Harvard expression. mapping of the RNA polymerase a" University, Cambridge, Massachu- Gilman, M.Z., Glenn J., Chamberlin, gene of Bacillus subtilis. setts: RNA polymerase heteroge- M.J., Dept. of Biochemistry, Uni- neity in Streptomyces coelicolor. versity of California, Berkeley: InDifferentiation in Streptomyces Solenberg, P.J., Mooney, P.Q., vivo expression of Bacillus subtilisChater, K.F., Bruton, C.J., Ikeda, H., Schaus, N.A., Lilly Research Lab- transcripts controlled by a2' RNA King, A.A., Piret, J.M., Rodicio, oratories, Indianapolis, Indiana: polymerase. M.R., John Innes Institute, Nor- Development of a model system for Truitt, C.L., Ray, G.L., Trempy, J.E., wich, England: Genetics in Strep- the study of the regulation of gene Haldenwang, W.G., Dept. of Mi- tomyces differentiation. expression in Streptomyces. crobiology, University of Texas Baltz, R.H., Seno, E.T., Stonesifer, Health Science Center, San Anto- J., Matsushima, P., Lilly Research

SESSION 6Sporulation and Bud Formation in Yeast and Other Fungi Chairperson:A. Klar, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Pringle, J.R., Coleman, K., Adams, Brighton, England: Cell cycle con- tary to sporulation-specific tran- A., Lillie, S., Oeller, P., Robinson, trols in fission yeast. scripts. J., Kelley, M., Division of Biologi- Timberlake, W.E., Gwynne, D.I., cal Sciences, University of Michi- Magee, RT.,' Clancy, M.J.,2 Primer- Miller, B.L., Miller, K., Zimmer- gan, Ann Arbor: Cellular morpho- ano, D.,' 'Dept. of Microbiology, mann, C.R., Dept. of Plant Pathol- genesis in the Saccharomyces cell Michigan State University, East ogy,Universityof California, cycle. Lansing; 'Dept. of Microbiology, Davis: Organization and develop- Notre Dame University,South Henry, S., Letts, V.A., Klig, L.S., mental regulation of the spoC1 gene Bend, Indiana: Transcriptional con- cluster of Aspergillus nidulans. Loewy, B.S., Dept. of Genetics, trol and mutant phenotype of genes Albert Einstein College of Medi- involved in sporulation in Saccha-Champe, S.P., Yager, L.N., Butnick, cine, Bronx, New York: The role of romyces cerevisiae. N.J., Kurtz, M.B., Waksman Insti- phospholipid synthesis and regula- tute of Microbiology, Rutgers Uni- tion in membrane biogenesisin Ninfa, E.G., Kaback, D.B., Dept. of versity, New Brunswick, New Jer- yeast. Microbiology, UMDNJ, New Jersey sey: Sporulation-defective mutants Nurse, P., Dept. of Biological Sci- Medical School, Newark: Isola- of Aspergillus nidulans. ences, University of Sussex Falmar, tion of DNA sequences complemen-

SESSION 7Cell Communication and Morphogenesis in Dictyostelium Chairperson:L. Shapiro, Albert Einstein College of Medicine, Bronx, New York Lodish, H.F., Barklis, E., Chisholm, of California, San Diego, La Jolla: MacWilliams, H., Dept. of Zoology, R., Pontius, B., Dept. of Biology, Induction and modulation of cell University of Munich, Federal Re- Massachusetts Institute of Technol- type-specific gene expression in public of Germany: Morphogenesis ogy, Cambridge: Regulation of Dictyostelium. in cellular slime mold slugs. Dictyostelium discoideum mRNAs Gerisch, G., Max-Planck-Institut fiirDavid, C.N.,' Sternfeld, J.,' specific for prespore or prestalk Biochemie Martinsried, Federal 'Zoologisches Institut, Munich, cells. Republic of Germany: Control of Federal Republic of Germany; Mehdy, M.C., Mann, S.K.O., Firtel, early cell differentiation in Dictyo- 'Dept. of Biology, University of R.A., Dept. of Biology, University stelium discoideum. Southwestern Louisiana, Lafayette:

171 Formation of the prestalk prespore cellular responses controlling the Fontana, D.R., Devreotes, RN., Dept. pattern in Dictyostelium occurs by choice between stalk- and spore-cell of Physiological Chemistry, Johns cell sorting. differentiation in Dictyostelium. Hopkins University School of Med- Kay, R., Brookman, J., Kopachik, W,Williams, J.G., Garreau, H., Imperial icine, Baltimore, Maryland: Inhi- Pogge, R., Dhokia, B., Jermyn, K., Cancer Research Fund, Mill Hill bition of the cAMP signal relay re- Peacey, M., Gross, J., Imperial Can- Laboratories, London, England: sponse in Dictyostelium discoideum cer Research Fund, London, Eng- Nuclear DNA-binding proteins of amoebae by agents which cross-link land: The morphogens and intra- Dictyostelium discoideum. surface components.

SESSION 8 Chairperson:D. Kaiser, Stanford University, Stanford, California Cell Communication and Morphogen- ohs: Cell-surface interactions dur- Genetik, Fakultat fur Biologie, esis in Myxobacteria ing development in Myxococcus Universitat Bielefeld, Federal Re- Shimkets, L.,' Gill, R.,' Kaiser, D.,3 xanthus. public of Germany: Analysis of 'Dept. of Microbiology, UniversityInouye, S., Teintze, M., Inouye, M., symbioticgenesof Rhizobium of Georgia, Athens; 'Dept. of Mi- Dept.of Biochemistry, State Uni- meliloti. crobiology, University of Colorado versity of New York, Stony Brook: Haselkorn, R., Curtis, S.E., Ri- Health Center, Denver; 3Dept. of Development-specific calmodulin- chaud, C., Robinson, Si., Turner, Biochemistry, Stanford University, like protein of Myxococcus xanthus. N., Dept. of Biophysics, University California: Cell interactions in of Chicago, Illinois: Organization Myxococcus development. Bacteroid Formatin by Rhizobium and and transcription of Anabaena Nelson, D.R.,' Downard, J.S.,3 Zus- Heterocyst Formation by Anabaena genes regulated during heterocyst man, D.R.,' 'Dept. of Microbiol-Ausubel, F., Buikema, W, Sundare- differentiation. ogy, University of Rhode Island, san, V., Szeto, W, Zimmerman, L., Kingston; 'Dept. of Microbiology Dept. of Molecular Biology, Mas- Pattern Formation in Pseudomonas and Immunology, University of Cal- sachusetts General Hospital, Bos- Shapiro, J.A., Dept. of Microbiology, ifornia, Berkeley: Long-lived mes- ton: Identification and characteri- University of Chicago, Illinois: senger RNA during fruiting body zationofRhizobiummeliloti Pattern formation in Pseudomonas formation in Myxococcus xanthus. symbiotic genes. putida colonies revealed by inser- Dworkin, M., Dept. of Microbiology, Piihler, A., Klipp, W., Priefer, U., Si- tions of a Mud lac phage. University of Minnesota, Minneap- mon, R., Weber, G., Lehrstuhl fiir

SESSION 9 Mating Interactions Chairperson:I. Herskowitz, University of California, San Francisco, California Hopwood, D.A., Bibb, M.J., Kieser, plasmid-dependent conjugal donor Biosynthesis and cell-type-specific T., Lydiate, D.J., Wright, H.M., activity of E. coli K-12. gene expression. John Innes Institute, Norwich, Eng-VanWinkle-Swift, K., Aubert, B., Herskowitz, I., Wilson, K., Jenson, land: Plasmid-mediated conjuga- Burrascano, C., Dept. of Biology, R., Fields, S., Dept. of Biochemis- tion in Streptomyces. San Diego State University, Cali- try and Biophysics, University of Clewell, D., Ike, Y., White, B., Craig, fornia: Genetic anlaysis of sexual California, San Francisco: Deter- R., Yagi, Y., Dept. of Oral Biology, reproduction in the homothallic alga mination of yeast cell type by the University of Michigan, Ann Arbor: Chlamydomonas monoica. mating-type locus. Sex pheromones in StreptococcusJulius, D. ',3 Brake, Emr, 5.,3 Beach, D., Klar, A., Cold Spring faecalis. Flessel, M.,' Thorner, J.,1 'Dept. of Harbor Laboratory, New York: De- Silverman, P., Sambucetti, L., Al- Microbiology and Immunology; velopmental switches of the mat- bins, R., Cuozzo, M., Dept. of Mo- 'Dept. of Biochemistry, University ing-type locus in Schizosaccharo- lecular Biology, Albert Einstein of California, Berkeley; 3Chiron myces pombe. College of Medicine, Bronx, New Corporation, Emeryville, Califor- York: Cellular contributions to nia: Yeast peptide pheromones -

RNA PROCESSING May 18-May 22

SESSION 1Nuclear Structure and Function Chairperson:G. Blobel, Rockefeller University, New York, New York Berrios, M.,' Filson, A.,' Blobel, G.,' Sciences, State University of New cifically identified by direct UV Fisher, R,3 'Laboratory of Cell Bi- York, Stony Brook: An ATPase/ photoaffinity labeling. ology, Rockefeller University, New dATPase of the nuclear matrix-Risau, W, Symmons, F, Saumweber, York; 'Dept. of Pharmacological pore, complex-lamina fraction spe- H., Frasch, M., Bonhoeffer, F, Ab-

172 teilung fur Physikalische Biologie, of Chicago, Illinois: Immunologi- with snRNAcap-specificanti- Max-Planck-Institut ftir Virusfor- cal studies of nuclear hnRNP and bodies. schung, Tubingen, Federal Repub- snRNP complexes. Mattaj, I.W, Btirglin, T., De Rober- lic of Germany: Nonpackaging andScheer, U.,' Rose, K.M.,' 'Institute of tis, E.M., Biocenter, University of packaging proteins of Drosophila Cell and Tumor Biology, German Basel, Switzerland: 7S and 42S hnRNP. Cancer Research Center, Heidel- RNP particles are excluded from Trendelenberg,M.F.,'Oudet,P.,' berg, Federal Republic of Ger- thenucleoplasmof X.laevis Franke,WW,' Gallwitz,D.,' many; 'Milton S. Hershey Medical oocytes. 'Institute of Cell and Tumor Biol- Center, Pennsylvania State Univer-Forbes, D., Kirschner, M., Dept. of ogy and Experimental Pathology, sity, Hershey: Localization of tran- Biochemistry and Biophysics, Uni- German Cancer Research Center, scribed rRNA genes in interphase versity of California, San Fran- Heidelberg, Federal Republic of cells and detection of RNA poly- cisco: New nuclear structures con- Germany; 'CNRS,Strasbourg, merase I bound to mitotic chromo- taining snRNP antigens in the France;'Universityof Marburg, somes by light and electron micro- developing Xenopus embryo. FederalRepublic of Germany: scope immunocytochemistry. Atkinson, N.S., Nolan, S.L., Dunst, Structuralorganization of definedBringmann, P., Rinke, J., Reuter, R. R.W., Hopper, A.K., Dept. of Bio- pre -mRNP transcripts and patterns Appel, B., Liihrmann, R., Max- logical Chemistry, Milton S. Her- of posttranscriptional RNP modi- Planck-Institut fiir Molekulare Ge- shey Medical Center, Pennsylvania fications. netik, Berlin, Federal Republic of State University, Hershey: Charac- Leser, G.E. Monsma, S.A., Martin, Germany: Structure-function rela- terization of a yeast gene affecting T.E., Dept. of Biology, University tionships of U-snRNPs as studied RNA processing.

SESSION 2 RNPs and Processing Chairperson:T. Martin, University of Chicago, Chicago, Illinois LeStourgeon, W.M., Arenstorf, H.P., complex in heat-shocked Drosoph- Branlant, C.,' Krol, A.,' Ebel, J.P.,' Lothstein, L., Dept. of Molecular ila cells. Haendler,B.,' Lazar, E.,2 Jacob, Biology,VanderbiltUniversity, M.,' 'University of Strasbourg; Economidis, I.V, Pederson, T., Cell 'CNRS, Strasbourg, France: A study Nashville, Tennessee: Observations Biology Group, Worcester Founda- on the arrangement of protein and of snRNAs within hnRNPs using tion for Experimental Biology, DMS as a probe. RNA in 40S hnRNP particles. Shrewsbury, Massachusetts: As- Wilk, H.-E., Schafer, K.P. Lehrstuhl sembly of a pre-mRNP in vitro. Sri-widada, J., Brunel, C., Liautard, Biochemie, Ruhr-Universitat Bo- J.P.Jeanteur,P.,Laboratoire de chum, of Ger-Wieben, E., Madore, S., Pederson, T., Bochimie, Laboratoire de Biologie many: The in vitro reconstitution of Cell Biology Group, Worcester Molecular, Universite des Sciences hnRNP-like complexes. Foundation for Experimental Biol- et Techniques du Languedoc, Mont- Thomas, J.0., Glowacka, S.K., Szer, ogy, Shrewsbury, Massachusetts: pellier, France: Interaction of sn- W, Dept. of Biochemistry, New Maturation of Ul and U2 RNAs. RNAs with rapidly sedimenting subnuciear structures (hnRNP). York University School of Medi-Dahlberg, IE.,' Lund, E.,' Mitchen, cine, New York: Structure of an J.L.,' Skuzeski, J.M.,' Burgess, Calvet, J.P., Myers, J.A., Dept. of hnRNP protein-poly nucleotide R.R.,' Murphy, LT.,' Steinberg, T.,' Biochemistry, University of Kansas complex. 'Dept. of Physiological Chemistry, Medical Center, Kansas City: In Kloetzel, P.M., Bautz, E.K.F., Dept. 'Dept. of Oncology, University of vivo secondary structure and inter- of Molecular Genetics, University Wisconsin, Madison: Synthesis and molecular base-pairing interactions of Heidelberg, Federal Republic of process of wild-type and mutant involving the snRNAs analyzed by Germany: Organization of hnRNP human Ul RNA transcripts. psoralen cross-linking.

SESSION 3 Poster Session Aloni, Y., Abulafia, R., Hay, N., Ben- Cancer Research Center, Heidel- from genomic clones injected in X. Ze'ev, A., Dept. of Genetics, Weiz- berg, Federal Republic of Ger- laevis oocytes. mann Institute of Science, Rehovot, many; 'Institute of Microbiology, Benyajati, C.,Dray,J.F.,Frederick Israel: The control of late SV40 University of Heidelberg, Federal Cancer Research Facility, Freder- transcription by the attenuation Republic of Germany; 'Institute of ick, Maryland: Expression of the mechanism, and transcriptionally Zoology, University of Zurich, cloned adh gene in transfected Dro- active ternary complexes are asso- Switzerland: Cloning and character- sophila tissue culture cells. ciated with the nuclear matrix. ization of U2 and Ul snRNA genes Billings, RB., Hoch, S.O., Division of from D. melanogaster. Aloni, Y., Hay, N., Skolnik-David, Cellular Biology, Research Institute H., Ben-Asher, E., Pruzan, R., Beccari, E.,' Amaldi, F.,' Annesi, E,' of Scripps Clinic, La Jolla, Califor- Dept. of Genetics, Weizmann Insti- Bozzoni, I.,' Fragapane, P.,' Mileo, nia: Isolation of Ul and U2, U4, and tute of Science, Rehovot, Israel: A.M.,'Pierandrei-Amaldi,P.,2 U5 plus U6 snRNP populations. Attentuation in the control of viral 'Centro Acidi Nucleici; 'Institute di Brandt, C.R., Morrison, S.L., Mil- gene expression. Biologia Cellulare, CNR, Rome, It- carek, C., Dept. of Microbiology, Alonso, A.,' Jorcano, J.L., Beck,E.,' aly:X.laevis ribosomal protein Columbia University, New York, Spiess, E.,' Kubli, E.,' 'German genes-Processing of transcripts New York: Altered RNA splicing in

173 immunoglobulin in heavy-chain an SV40 expression vehicle to study mRNA encoding the SV40 T-anti- mutants. splicing of the rat prolactin primary gen-specific 30K protein in the Dreyfuss,G.,Choi,Y.D., Adam, transcript. nondefective adeno-SV40 hybrid S.A., Dept. of Biochemistry, Mo- Leys, E.J.,' Hook, A.G.,' Crouse, virus (Ad2+ ND1). lecular and Cell Biology, North- G.F.,2 Kellems, R.E.,''Dept. of Schrier, W., Feinbaum, R., Okarma, western University, Evanston, Illi- Biochemistry, Baylor College of T., Dept. of Medicine, Stanford- nois: Characterization of proteins in Medicine, Houston, Texas; University School of Medicine, direct contact with mRNA and 'Frederick Cancer Research Facil- California:Characterizationof hnRNA in vivo. ity, Frederick, Maryland: Control of snRNP particles isolated for L-cell Frayne, E., Yeung, C., Hook, A., Al- DHFR mRNA production. nuclei. Ubaidi, M., Bobonis, C., Ingolia, Lund, E.,' Schenborn, E.T.,' Bos- Setyono, B.,' Pederson, T.,' 'Institute D., Kellems, R., Dept. of Biochem- tock, C.,2 Mitchen, J.L.,' Dahl- of Biology, University of Stuttgart, istry, Baylor College of Medicine, berg, J.E.,' 'University of Wiscon- Federal Republic of Germany; Houston, Texas: ADA gene-ampli- sin, Madison; 2MRC-MGU 2Worchester Foundation for Exper- fication mutants-A model system Edinburgh, Scotland: Expression of imentalBiology,CellBiology for studying ADA mRNA metab- human Ul snRNA genes in mouse Group, Shrewsbury, Massachu- olism. cells containing either human chro- setts:Interactionbetweensn- Fritz, A., Zeller, R., Carrasco, A., mosome 1 or a human gene cloned RNPs and hnRNPs as revealed by Mattaj, I., De Robertis, E.M., Bio- in BPV. UV light and psoralen cross-linking center, University of Basel, Switz-McKenzie, D., Aiken, J.M., Dixon, in vivo. erland: snRNA genes and snRNA- G.H., Dept. of Medical Biochem- Tollervey, D., Wise, J.A., Maloney, binding proteins of X. laevis. istry, University of Calgary, Al- D., Dunn, E., Guthrie, C., Dept. of Hammarstr6m, K., Monstein, H.-J., berta, Canada: mRNP particles in Biochemistry and Biophysics, Uni- Westin, G., Bark, C., Zabielski, J., the developing testis of rainbow versity of California, San Fran- Philipson, L., Pettersson, U., Dept. trout. cisco: Cloning and genetic analysis of Medical Genetics and Microbi-Morris, G.F.,' Brown, D.T.,' Mar- of yeast snRNAs. ology, Biomedical Center, Uppsala, zluff, WE,' 'Dept. of Chemistry, Villarreal, L.,' White, R.,' 'Dept. of Sweden: Loci for human U1, U2, Florida State University, Talla- Microbiology and Immunology, and U4 RNAs. hasse; 2Dept. of Biochemistry, Uni- University of Colorado Health Sci- Jacobson, A.B., Dept. of Microbiol- versity of Mississippi Medical Cen- ences Center; 'Dept. of Biochem- ogy, State University of New York, ter, Jackson: In vivo and in vitro istry,University of California, Stony Brook: Studies on the folding synthesis of snRNA N1 in sea ur- Berkeley: A splicing-junction dele- of MS2 RNA. chin embryos. tion deficient in the transport of RNA does not polyadenylate nu- Khandjian, E.W., Darlix, J.-L., Weil,Patton, J.R., Ross, D.A., Chae, C.-B., clear RNA. R., Dept. of Molecular Biology, Dept. of Biochemistry, University University of Geneva, Switzerland: of North Carolina, Chapel Hill: 0- Wilk,H.-E.,Kecskemethy,N., Interaction of SV40 large T antigen Globin RNA-protein interaction in Schafer, K.P., Lehrstuhl Bioch- with noncoding and repetitive se- chicken reticulocyte nuclei. emie, Ruhr-Universitat Bochum, quences of primary transcripts. Federal Republic of Germany: An Pawar, S., Ahmed, C.M.I., Watkins, affinity matrix for capped snRNAs Lagrimini, L.M., Donelson, J.E., R., Zain, S., Cancer Center, Uni- and mRNAs. Dept. of Biochemistry, University versity of Rochester, New York: In of Iowa, Iowa City: The use of vitro and in vivo processing of

SESSION 4 Messenger RNA Processing Chairperson:A. Shatkin, Roche Institute of Molecular Biology, Nutley, New Jersey Padgett, R.A.,' Mount, S.M.,' Steitz, Fradin, A.,' Jove, R.,' Hemenway, for splicing the large intron of the LA.,' Sharp, P.A.,' 'Massachusetts C.,' Michaeli, T.,' Keiser, H.D.,' rabbit i3-globin pre-mRNA? Instituteof Technology, Cam- Manley, J.L.,2 Prives, C.,2 'Dept. of Langford, C.J., Donath, C., Klinz, E- bridge; 'Dept. of Molecular Bio- Medicine, Albert Einstein College J., Gallwitz, D., Institut fur Phy- physics and Biochemistry, Yale of Medicine, Bronx, New York; siologische Chemie I, Universitat University, New Haven, Connecti- 'Dept. of Biological Sciences, Co- Marburg, Lahnberge, Federal Re- cut: Splicing of adenoviral RNA in lumbia University, New York: Anti- public of Germany: The identifica- a cell-free transcription system re- bodiesto snRNPs inhibit SV40 tion of an intron sequence neces- quires Ul RNP. RNA processinginX.laevis sary for the splicing of the yeast Hernandez, N., Frick, M., Keller, W, oocytes. actin gene transcript. Institute of Cell and Tumor Biol- Green, M., Maniatis, T., Melton, D., Pikielny, C., Teem, J., Abovich, N., ogy, Germany Cancer Research Dept. of Biochemistry and Molec- Rosbash, M., Dept. of Biology, Center, Heidelberg: In vitro tran- ular Biology, Harvard University, BrandeisUniversity,Waltham, scription and splicing of adenoviral Cambridge, Massachusetts: Eukar- Massachusetts: Yeast mRNA RNA in HeLa cell extracts. yotic mRNA processing in microin- splicing. DiMaria, P.R., Goldenberg, C.J., jected frog oocytes. Kaafer, N.F., Warner, J.R., Albert Dept. of Pathology, Washington Wieringa, B., Weissmann, C., Institut EinsteinCollege of Medicine, University, St. Louis, Missouri: In fur Molekularbiologie I, Universi- Bronx, New York: Intron deletion vitro splicing of purified Ad2 pre- tat Zurich, Switzerland: What are studies with the cycloheximide-re- cursor RNAs. the minimal sequence requirements sistance gene of S. cerevisiae.

174 Nelson, K.J.,1 Haimovich, J.,2 Perry, of immunoglobulin heavy /*-chain expression of mRNAs from the cal- R.P.,1 1Institute for Cancer Re- gene expression in Cos cells. citonin gene. search, Philadelphia, Pennsylvan- Manley, J.L., Dept, of Biological Sci- nia; 2Tel Aviv University Medical Amara, S.G.,1 Evans, R.M.,2 Rosen- ences, Columbia University, New School, Israel: Characterization of feld, M.G.,1 1Dept, of Medicine, York, New York: Accurate ,and spe- productive and sterile transcripts University of California, San cific polyadenylation of mRNA from {he immunoglobulin heavy- Diego, La Jolla; 2Molecular Biol- precursors in a soluble whole-cell chain locus—Processing of /1m and ogy and Virology Laboratory, Salk lysate. /*s mRNA. Institute, San Diego, California: Nishikura, K., Wister Institute, Phil- Poly (A) site selection is a critical adelphia, Pennsylvania: Regulation determinant in the alternative

SESSION 5 Ribosomal RNA Processing Chairperson: A. Dahlberg, Brown University, Providence, Rhode Island

Stark, J.R.,1 Gourse, R.L.;2 ■ Dahl- ington University, St. Louis, Mis- gene—Comparison of experimen- berg, A .E.,1 1Section of Biochem- souri: Precursor nucleotides at the tally determined contacts and the .end are not required for process- predicted secondary structure ׳istry, Brown University, Provi- 5 -end of 5S Garriga, G.,1 Bertrand, H.,2 Lam ׳dence, Rhode Island; 2Institute for ing by RNase E at the 3 Enzyme Research, University of rRNA. bowitz, A.M .,1 1St. Louis Univer- Wisconsin, Madison: A mutation in Grabowski, P.J., Cech, T.R., Dept, of sity, Missouri; 2University of Re- the rrnB operon that affects the pro- Chemistry, University of Colorado, gina, Saskatchewan, Canada: RNA duction of precursor 23S rRNA by Boulder: Accurate exon ligation ac- splicing in Neurospora mitochon- RNase III. end-׳ companies I VS excision during self- dria—A relationship between 3 King, T.C., Schlessinger, D., Divi- splicing of the rRNA precursor of synthesis and splicing of the large sion of Biology and Biological Sci- Tetrahymena. rRNA. ences, Washington University Wollenzien, P.,1 Cantor, C .,1 Jacob- Strittmatter, G., Natt, E., Kossel, H., School of Medicine, St. Louis, son, A.,2 Garriga, G.,3 Lambow- Institiit fur Biologie III, Universitat Missouri: rRNA processing in wild- itz, A.,3 1Dept. Of Human Genetics Freiburg, Federal Republic of Ger- type and processing-deficient E. and Development, Columbia Uni- many: Processing sites of tran- coli. versity College of Physicians and scripts from the maize chloroplast Loughney, E., Lund, E., Dahlberg, Surgeons, New York, New York; rRNA operon and its tRNA genes. J.E., Dept, of Physiological Chem- 2Dept, of Microbiology, State Uni- Prince, D.L., Dubin, D.T., UMDNJ, istry, University of Wisconsin, versity of New York, Stony Brook; Rutgers Medical School, Piscata- Madison: Processing sites for pre- 3Dept, of Biochemistry, St. Louis way, New Jersey: Possible effects of cursor rRNAs of B. subtilis. University Medical School, Mis- t*he methylation inhibitor cycloleu- Szeberenyi, J., Roy, M.K., Apirion, souri: The intervening sequence in cine on the processing of mammal- D., Dept, of Microbiology, Wash­ the N. crassa mitochondrial rRNA ian mitochondrial RNA.

SESSION 6 Poster Session

Adeniyi-Jones, S., Romeo, P., Zas- Missouri, Columbia; 2Dept, of Cooley, L., Burke, D.J., Soil, D., loff, M. A., Human Genetics Branch, Muscle Research, Boston Biomedi- Dept, of Molecular Biophysics and NICHD, National Institutes of cal Research Institute, Massachu- Biochemistry, Yale University, New Health, Bethesda, Maryland: Hu- setts: Association of Sm with cyto- Haven, Connecticut: Posttranscrip- ׳man tRNAMet gene as a portable eu- plasmic mRNA-containing RNP tional guanylate addition to the 5 karyotic promoter. particles and polysomes of chick terminus of histidine tRNA. embryonic muscle. AbuBakar, U .,1 Schmidt, J.C.,,1•2 Edlind, T., Cooley, T., Ihler, G., Texas 1Dept, of Chemistry and Biochem- Bonen, L., Boer, P.H., Hensgens, A&M College of Medicine, Col- istry, 2Medical Biochemistry, L.A.M., Grivell, L.A., Section for lege Station: Potential secondary Southern Illinois University, Car- Molecular Biology, University of structures in papovavirus^|fate bondale: Defective rRNA process- Amsterdam, Kruislaan, The Neth- RNA—Implications to splicing. ing in a mutant strain of N. crassa. erlands: A dispersed, multigene Anziano, P.Q.,1 Perlman, P.S.,1 Sass, family of intron maturases in yeast Francoeur, A.M., Mathews, M.B., P.,2 Lamb, M.R.,2 Mahler, H.R.,2 mitochondria. Cold Spring Harbor Laboratory, 1Genetics Dept, and MCD Pro- New York: Purification and char- gram, Ohio State .University, Co- Bonitz, S., Tzagoloff, A., Cold Spring acterization of the lupus antigen, lumbus; 2Chemistry Dept., Indiana Harbor Laboratory, New York: RNA La. processing in yeast mitochondria. University, Bloomington: Isolation Frendewey, D., Willis, I., Hottinger, and characterization of nuclear su- Cimino, G.D., Hearst, J.E., Dept, of A., Hottinger, H., Schaack, J., Soil, pressor of splicing mutants in yeast Chemistry, University of Califor- D., Dept, of Molecular Biophysics mitochondria. nia, Berkeley: Localization of sec- and Biochemistry, Yale University, Boak, A.M .,1 Agris, P.F.,1 Chakra- ondary structure regions in E. coli New Haven, Connecticut: Process- borty, D.,2 Sarkar, S.,21Dept, of Bi- 23s RNA by psoralen cross- ing of dimeric tRNA precursors ©logical Sciences, University of linkage. from S. pombe.

175 Furdon, P., Altman, S., Dept. of Bi- ential transcription of rRNA in ton University Medical School, St. ology, Yale University, New Haven, hamster mitochondria. Louis, Missouri; 'Dept. of Micro- Connecticut: Site-specific mutagen- Krause, M.O., Sohn, U., Division of biology, Medical College of Vir- esis of the dihydrouridine loop of Molecular and Microbiology, Uni- ginia, Richmond: Initiation, proc- the tRNAT, su3* gene from E. coli. versity of New Brunswick, Freder- essing, and termination of rRNA Gurevitz, M., Apirion, D., Dept. of icton, Canada: A small RNA from from a hybrid 5S rRNA gene in a Microbiology, Washington Univer- SV40-transformed cells recognizes plasmid. sity, St. Louis, Missouri: Interplay the viral early promoter. Tanner, N.K.,' Cech, T.R.,' Tinoco, among processing and degradativeKrol, A., Laboratoire de Biochimie, I.,Jr.,' Weir, B.R.,' Zuker, M.,3 enzymes and a precursor RNA in IBMC, Strasbourg, France: Isola- Perlman, P.S.,' 'Dept. of Chemis- the selective maturation of tRNA tion and sequence of the U-RNA try, Univeristy of Colorado, Boul- molecules. family from plant nuclei. der; 'Dept. of Chemistry and Lab- Hickey, A., Dept. of Biology, Univer- oratory of Chemical Biodynamics, Lee, M.-C., Knapp, G., Dept. of Mi- University of California, Berkeley; sity of Ottawa, Canada: Introns as crobiology, University of Alabama, 'Division of Biological Sciences, genomic parasites. Birmingham: Secondary and ter- National Research Council of Can- Jacobson, A., Favreau, M., Manrow, tiary structures of unspliced yeast ada, Ottawa; 'Dept. of Genetics, R.E., Steel, L., Dept. of Molecular tRNA precursors. Ohio State University, Columbus: Genetics and Microbiology, Uni-Pape, L.K., Tzagoloff, A., Dept. of Determination of the secondary versity of Massachusetts Medical Biological Sciences, Columbia Uni- structure of the Tetrahymena rRNA School, Worcester: Possible in- versity, New York, New York: A intervening sequence and compari- volvement of poly(A) in protein nuclear gene required for process- son with fungal mitochondrial in- synthesis. ing the S. cerevisiae mitochondrial tervening sequences. Kinlaw,C.S.,Robberson,B.L., apocytochrome-B gene. Wallace, J.C., Edmonds, M., Dept. of Brandt, C., Berget, S.M., Dept. of Biological Sciences, University of Biochemistry,RiceUniversity,Roe, B.A., Wong, J.F.H., Ma, D.P., Wilson, R.K., Dept. of Chemistry, Pittsburgh, Pennsylvania: Locali- Houston, Texas: Characterization zation of branches within nuclear of the polypeptides of human sn- University of Oklahoma, Norman: Nucleotide sequence analysis of the polyadenylated RNA molecules. RNPs Ul, U2, and U4. X. laevis mitochondrial genome. Watson, N., Gurevitz, M., Ford, J., Klein, B.K., Forman, P., Staden, A., Apirion, D., Dept. of Microbiology Romero, J., Schlessinger, D., Divi-Schnare, M.N., Gray, M.W, Dept. of Biochemistry, Dalhousie Univer- and Immunology, Washington Uni- sion of Biology and Biomedical versity School of Medicine,St. Sciences, Washington University sity, Halifax, Nova Scotia, Canada: The 3'-terminal sequence of wheat Louis, Missouri: Possible self- School of Medicine, St. Louis, cleavage of a precursor RNA of a Missouri:Stabilizing factors for mitochondrial large subunit (26S) rRNA. tRNA-like molecule from bacterio- tRNA and ribosome secondary phage T4. Skuzeski, J.M., Jendrisak, J.J., Dept. structureassessed by electron Winicov, I., Dept. of Biochemistry, microscopy. of Botany, University of Minnesota, St. Paul: A family of wheat embryo University of Nevada, Reno: tRNA Kotin, R.M., Dubin, D.T., Dept. of processing in isolated mouse L-cell U2 snRNAs. Microbiology, UMDNJ, Rutgers nuclei. Medical School, Piscataway, NewSzeberenyi,J.,'Elford,R.M.,' Jersey: Further support for atten- Holmes, W.M.,2Apirion,D.,' uation as a mechanism for prefer- 'Dept. of Microbiology, Washing-

SESSION 7Transfer RNA Processing Chairperson:D. Soil, Yale University, New Haven, Connecticut Sakamoto, H., Kimura, N., Shimura, ver; 'Dept. of Molecular and Cel- Pearson, D., Willis, I., Chisholm, V., Y., Dept. of Biophysics, Kyoto Uni- lular Biology, National Jewish Hos- Soll, D., Dept. of Molecular Bio- versity,Japan:Structureand pital and Research Center: Pre- physics and Biochemistry, Yale expression of the gene coding for cursor tRNA substrate binding by University, New Haven, Connecti- the RNA component of RNase P B. subtilis RNase P protein. cut: Second-site mutations of the from E. coli. Deutscher, P., Asha, P.K., Blouin, T., sup3-e locus of S. pombe -New in- Dallmann, G.D., Gurevitz, M., Dall- Zaniewski, R., Dept. of Biochem- sights to transcription and process- mann, K., Apirion, D., Dept. of istry, University of Connecticut ing of eukaryotic tRNAs. Microbiology, Washington Univer- Health Center, Farmington: RNase Tocchini-Valentini, G.P., Baldi, M.I., sity Medical School,St.Louis, BN - Description of a new tRNA Mattoccia, E., Gandini-Atardi, D., Missouri: Studies on the RNA processing enzyme and comparison Margarit, I., Institut of Cell Biol- moiety of the tRNA processing en- with other E. coli exoribonucleases. ogy, CNR, Rome, Italy: Mutations zyme, RNase P, and the concept ofBarkay, T., Goldfarb, A., Daniel, V., that affect tRNA processing. an RNA processing complex. Weizmann Institute, Rehovot, Is- Castaiio,J.G., Zasloff,M.A., Guerrier-Takada, C., Furdon,P., rael: RNase PC, an E. coli endonu- NICHD, NationalInstitutesof Baer, M., Reed, R., Altman, S., clease responsible for processing of Health, Bethesda, Maryland: Hu- Dept. of Biology, Yale University, tRNA precursors. man tRNA''.' formation by nucleo- New Haven, Connecticut: Recogni-Kaine, B.P., Gupta, R., Woese, C.R., lytic cleavage and evidence of its tion of tRNA precursor substrates Dept. of Genetics and Develop- nuclear transport. by RNase P from E. coli. ment, University of Illinois, Ur- Marsh, T.L.,' Pace, N.R.,' 'University bana: tRNA genesinarchae- of Colorado Medical Center, Den- bacteria.

176 SESSION 8Transcripts of Cytoplasmic Organelles Chairperson:N. Martin, University of Texas Health Science Center,Dallas, Texas Greenberg, B.M.,' Gruissem,W.,' sity of Chicago, Illinois: Transcrip- McGraw, P., Tzagoloff, A., Dept. of Prescott, D.M.,2 Hal lick, R.B.,' tionalinitiationinyeastmito- Biological Sciences, Columbia 'Dept. of Chemistry, 'Dept. of Mo- chondria. University, New York, New York: lecular, .Cellular and Develop-Hopper, A.K.,' Hurt, D.J.,' Morales, The role of the CBP2 gene in splic- mental Biology, University of Col- M.,' Martin, N.C.,' 'Dept. of Bio- ing cytochrome-b pre-mRNA. orado, Boulder:Invitro tran- logical Chemistry, Milton S. Her- Sass, P.,' Mecklenburg, K.,' Ralph, scription and processing of chloro- shey Medical Center, Pennsylvania; D.,' Robinson, S.,' Mahler, H.R.,' plast tRNAs in chloroplast soluble 'Dept. of Biochemistry, University Perlman, P.S.,' 'Dept. of Chemis- extracts. of Texas Health Science Center, try, Indiana University, Blooming- Attardi, G., Doersen, C., Gaines, G., Dallas: Modification of both cyto- ton; 'Genetics Dept. and MCD Pro- King, M., Montoya, J., Shuey, D., plasmic and mitochondrial tRNAs gram,OhioStateUniversity, California Institute of Technology, are affected by single nuclear Columbus: cis-dominant and trans- Pasadena: In vivo and in vitro syn- mutations. recessivesplicing-defectivemu- thesis and processing of human mi- Simon, M., Faye, G., Institut Curie, tantsin the oxi3 gene of yeast tochondrial RNA and their control Orsay, France: MSS51 -A yeast mtDNA. by the cytoplasm. nuclear gene implicated in the mi- Haldi, M.L., Anziano, P.Q.,Perl- Osinga, K.A., Van der Bliek, A.M., tochondrial processing of the cyto- man, P.S., Dept. of Genetics, Ohio De Vries, E., Groot Koerkamp, M., chrome oxidase subunit 1 pre- State University,Columbus: New Tabak, H.F., Laboratory of Bio- mRNA. insights to cis-acting domains in chemistry, University of Amster-Dieckmann, C.L., Homison, G., Ko- yeast mitochondrial introns. dam, Kruislaan, The Netherlands: erner, T.J., Dept. of Biological Sci- Martin, N.C., Miller, D.L., Najarian, Identification of promoters on yeast ences, Columbia University, New R., Underbrik-Lyon, K., Dept. of mtDNA. York, New York: Characterization Biochemistry, University of Texas Edwards, IC., Christianson, T., Ra- of CBPI, a nuclear gene involved in Health Science Center,Dallas: binowitz, M., Dept. of Medicine, maturation and cytochrome-b Yeast mitochondrial tRNA gene Biochemistry, and Biology, Univer- mRNA. transcripts and tRNA biosynthesis.

SESSION 9 Mechanisms of Cleavage and Ligation Chairperson:T. Cech, University of Colorado, Boulder, Colorado Filipowicz, W,I2 Shatkin, A.J.,' Kon- nois, Urbana: T4 RNA ligase forms studies involved in the excision of arska, M.,' Tyc, Kikuchi, Y.,' cyclic-phosphate-terminated oligo- the intervening sequence of the Te- Gross, Ha,' 'Roche Institute of ribonucleotides. trahymena tRNA precursor. Molecular Biology,Nutley, New David, M., Borasio, G.D., Teichman, Bass, B., Cech, T.R., Dept. of Chem- Jersey; 'Institute of Biochemistry A., Vekstein, R., Kaufmann, G., istry, University of Colorado, Boul- and Biophysics, Polish Academy of Dept. of Biochemistry, Weizmann der: Ribozymic catalysis. of Science, Warsaw; 'Institute fur Institute, Rehovot, Israel: Process- Mount, S.M., Pettersson, I., Hinter- Biochemie,University of\\if:11'z- ing of mature host tRNA by T4 an- burg, Federal Republic of Ger- berger, M.,Karmas, A., Steitz, J.A., ticodon nuclease, polynucleotide Dept. of Molecular Biophysics and many: Distinct ligation pathways kinase, and RNA ligase. for tRNA splicing in plant and ani- Biochemistry, Yale University, New mal cell extracts. Greer, C.,' Javor, B.,' Abelson, J.,' Haven, Connecticut: Isolated Ul 'Division of Biology, California In- snRNA-protein complexes can rec- Furneaux, H.M., Pick, L., Arenas, J., stitute of Technology, Pasadena; ognize a 5' splice site in vitro. Reinberg, D., Hurwitz, J., Dept. of 'Scripps Institute of Oceanography, Watson, N., Gurevitz, M., Ford, J., Developmental Biology and Can- La Jolla, California: Identification Apirion, D., Dept. of Microbiology cer, Albert Einstein College of of an RNA ligase activity in bacte- Medicine, Bronx, New York: Iso- and Immunology, Washington Uni- rial extracts and formation of a versity School of Medicine,St. lation and characterization of an novel 2', 5' linkage. Louis, Missouri: Possible self- RNA ligase from wheat germ. Engberg, J., Nielsen, H., Panum In- cleavage of a precursor RNA of a Pyle, VS., Gumport, R.I., Dept. of stitute, University of Copenhagen, tRNA-like molecule from bacterio- Biochemistry, University of Illi- Denmark: Model for secondary phage T4.

SESSION 10 Functions of RNP Particles Chairperson:S. Berget, Rice University, Houston, Texas Albrecht, G., Brawerman, G., Tufts Germany: Evidence that the inter- chick embryonic muscle -Isola- University School of Medicine, action of a scRNP with globin-free tion, characterization, and possible Boston, Massachusetts: Specific mRNPs inhibits the messenger role in regulation of myogenesis. RNA-protein interactions in rabbit translation. (3-globin mRNP particles - Relation Sarkar, S., Mukherjee, A.K., Roy, Walter, P., Blobel, G., Dept. of Cell to mRNA function. R.K., Chandrika, S.R., Dasgupta, Biology, Rockefeller University, Schmid, H.-R, Kohler, K., Setyono, S., Dept. of Muscle Research, Bos- New York, New York: Disassembly B., Institute of Biology, University ton Biomedical Research Institute, and reconstitution of signal recog- of Stuttgart, Federal Republic of Massachusetts: RNP particles of nition particle.

177 Wolin, S.L., Steitz, LA., Dept. of polymerase III transcription factorMathews, M.B.,' Bernstein, R.M.,2 Molecular Biophysics, Yale Univer- with the La RNP complex. 'Cold Spring Harbor Laboratory, sity, New Haven, Connecticut: The New York;'RoyalPostgraduate Ro small cytoplasmic RNAs - GeneStefano, J., Dept. of Molecular Bio- Medical School, London, England: structure and cluesto snRNP physics and Biochemistry, Yale Characterization of cytoplasmic function. University, New Haven, Connecti- RNP complexes recognized by myositis autoantibodies. Gottesfeld, J.M., Hoch, S.O., Divi- cut: Purified Lupus antigen La rec- sion of Cellular Biology, Research ognizes uridylate residues at the 3' Institute of Scripps Clinic, La Jolla, terminus of RNA polymerase III California: Association of an RNA transcripts.

RNA TUMOR VIRUSES May 25-May 29

SESSION 1Oncogene Proteins Chairperson:J. Brugge, State University of New York, Stony Brook, New York Brugge, J., Darrow, D., Dept. of Mi- investigated by means of antibodies sachusetts: Different subcellular crobiology, State University of New prepared against synthetic oligo- localization regulates v-abl protein York, Stony Brook: Isolation of peptides. phosphorylation and functional activity. protease-resistant fragments fromYamamoto, T., Nishida,T., Miya- pp60."c and pp90," that function as jima, N., Kawai, S., Toyoshima, K.,Reynolds, FH., Jr., Stephenson, J.R., tyrosine-specific protein kinases. Institute of Medical Science, Uni- NCI, Federick Cancer Research Fa- Ralston, R.,' Bishop, J.M.,' Deuel, versity of Tokyo, Japan: Amino acid cility, Frederick, Maryland: Tyro- T.F.,2 'Dept. of Microbiology, Uni- sequence of a domain of the erbB sine phosphorylation of a cellular versity of California, San Fran- protein is homologous to pp60.'. serine-specific protein kinase by cisco; 'Dept. of Medical Oncology, virus (v-fes and v -abl)- encoded pro- Washington University School ofPrywes, R.,' Foulkes, J.G.,' Rosen- tein kinases. berg, N.,' Baltimore, D.,' 'White- Medicine, St.Louis, Missouri: Curran,T.,Miller, A.D., Verma, Novel phosphorylation of pp60'-"° head Institute for Biomedical Re- search and Massachusetts Institute I.M., Molecular Biology and Virol- and enhancement of its kinase ac- ogy Laboratory, Salk Institute, San tivity in response to PDGF. of Technology, Cambridge; 'Tufts University School of Medicine, Diego, California: The FBJ-MSV Maness, P., Levy, B., Sorge, L., Perry, Boston, Massachusetts: Sequences oncogene product (p55) is located M., Dept. of Biochemistry, Univer- of Ab-MLV required for transfor- in the nucleus. sity of North Carolina, Chapel Hill: Differential sensitivity of viral and mation. Alitalo, K.,' Colby, W.," McGrath, J.,' cellular pp60 'c to inhibition by Wang, J.Y. J.,'Baltimore, D.,' Levinson,A.,2Bishop,J.M.,' Ap4A. 'Whitehead Institute for Biomedi- 'Dept. of Microbiology, University cal Research; 'Center for Cancer ofCalifornia,SanFrancisco; Greenberg, M.E., Edelman, G.M., 2Genetech, Inc., South San Fran- Rockefeller University, New York, Research, Massachusetts Institute of Technology, Cambridge: Struc- cisco, California: Search for c-myc New York: Characterization of the protein product with antibodies 34-kD pp6O'rc substrate using mon- tural and functional domains of the transforming gene of Ab-MLV. against a v-myc-encoded polypep- oclonal antibodies. tide expressed in bacteria. Tamura, T.,' Bauer, H.,' Pipkorn, R.,2 Watanabe, S.M.,' Robertson, D.L.,' Birr, C.,' Friis, R.R.,' 'Institut fiir Rosenberg, N.,2 Whitlock,C.,' Pon-Hann, S., Eisenman, R., Fred Hutch- Virologie,Universitat Giessen; ticelli, F.,' Witte, 0.N.,' 'Molecular inson Cancer Research Center, Se- 'Max-Planck-Institut fur Medizin- Biology Institute, University of attle, Washington: Identification of ische Forschung, Heidelberg, Fed- California, Los Angeles; 'Cancer v-myc and c-myc proteins by means eral Republic of Germany: Struc- Research Center, Tufts University of an antiserum against a carboxy- ture and function of pp60"° as School of Medicine, Boston, Mas- terminal peptide of v-myc.

SESSION 2Viral Genetics Chairperson:J.T. Parsons, University of Virginia, Charlottesville, Virginia Duyk, G.,' Leis, J.,' Longiaru, M.,' Louis, Missouri: In vitro mutagen- kyo, Japan: Genome structure of a Skalka, A.,2 'Case Western Reserve esis of the RSV pp32 region. mutant of RSV that is defective in University School of Medicine, packaging of its own genome. Ju, G., Cullen, B., Dept. of Molecu- Cleveland, Ohio; 'Roche Institute of Molecular Biology, Nutley, New lar Genetics, Hoffmann-La Roche,Mann, R., Baltimore, D., Whitehead Inc., Nutley, New Jersey: Site-di- Institute for Biomedical Research; Jersey: Selective cleavage of the rected mutagenesis of the avian re- RAV-2 LTR sequence by the endo- Massachusetts Institute of Technol- nuclease associated with the a)3 trovirus LTR. ogy, Cambridge: A packaging dele- form of reverse transcriptase. Kawai, S., Nishizawa, M., Koyama, tion mutant of Mo-MLV reverts to Hippenmeyer, P.J., Grandgenett, D.P., T., Yamamoto, T., Institute for wild type after transfected into NIH-3T3 cells. Institute for Molecular Virology, St. Medical Science, University of To-

178 Schwartzberg, P., Colicelli, J., Goff, Richter,A.,'Ozer,H.L.,2 Des- Lute of Environmental Health Sci- S.P., Dept. of Biochemistry, Co- Groseillers,L.,'Jolicoeur,P.,' ences, Research Triangle Park, lumbia University, College of Phy- 'Institut de Recherches Cliniques de North Carolina; 'Biology Division, sicians and Surgeons, New York, Montreal, Universite de Montreal, Oak Ridge National Laboratory, New York: Biochemical and genetic Canada; 'Dept. of Biological Sci- Tennessee: Analysis of the Fv-1 gene analysis of mutants of Mo-MLV ences, Hunter College, City Uni- target in N-tropic and B-tropic constructed by in vitro mutagene- versity of New York, New York: An MLVs by restriction fragment ex- sis. X-linked gene affecting mouse-cell change and nucleotide sequence Hunter, E., Wills, J., Hardwick, M., DNA synthesis also affects produc- analysis. Shaw,K.,Dept. of Microbiol- tion of competent unintegrated lin-Sorge, J.,' Hughes, S.H.,2 'Research ogy, University of Alabama, Bir- ear and supercoiled DNAs of MLV. Institute of Scripps Clinic, La Jolla, mingham: Site-directed mutations DesGroseillers, L., Jolicoeur, P., In- California; 'Cold Spring Harbor in the env gene of RSV. stitut de Recherches Cliniques de Laboratory, New York: Suppres- Buetti, E., Diggelmann, H., Swiss In- Montreal, Universite de Montreal, sion of retroviral RNA splicing. stitutefor Experimental Cancer Canada: Physical mapping and se- Research, Lausanne, Switzerland: quencing of the Fv-1 tropism host- Identification of a short segment of range determinant of BALB/c MLV. the MMTV LTR involved in the Boone, Ou, C. -Y.,' Myer, hormone stimulation of transcrip- F.E.,'Yang,D.-M.,'Tennant, tion. R.W.,' Yang, WK.,' 'National Insti-

SESSION 3Poster Session Canaani, E.,' Gale, R.P.,2 'Dept. of R.D.,' 'Merck Sharp and Dohme Health, Bethesda, Maryland: High- Chemical Immunology, Cell Biol- Research Laboratories, West Point, level expression in E. coli of the car- ogy, and Medicine, Weizmann In- Pennsylvania; 'School of Veteri- boxyterminal sequences of the avian stitute of Science, Rehovot, Israel; nary Medicine, University of Penn- myelocytomatosis virus (MC29) v- 'University of California School of sylvania, Philadelphia; 'Howard myc protein. Medicine, Los Angeles: Oncogenes Hughes Medical Institute Labora- Soe, L.H.,' Devi, B.G.,' Roy-Bur- in human leukemia - Abnormal tory, University of Washington, Se- man, 'Dept.of Pathology, expression of c-abl in chronic mye- attle: Cloning and expression of p21 'Dept. of Biochemistry, University logenous leukemia (CML). ras" genes adjacent to the metallo- of Southern California, School of Collins, S.,' Groudine, M.,2 'Veterans thionein promoter. Medicine, Los Angeles: Allelic AdministrationHospital,Seat- Swan, D., Gol, R., Tronick,S., variation in the feline c-myc gene. tle; 'Fred Hutchinson Cancer Re- McBride, W., Aaronson, S., NCI,Dalla-Favera, R.,' Gelmann, E.P.,2 search Center, Seattle, Washington: National Institutes of Health, Be- 'Dept. of Pathology, New York Uni- Rearrangement and amplification of thesda, Maryland: Chromosomal versity School of Medicine, New endogenous c-abl and X immuno- localization of the human homologs York; 'NCI, National Institutes of globulin sequences in the chronic of the ras gene family. Health, Bethesda, Maryland: Clon- myelogenous leukemia cell line Rasheed, S.,' Norman, G.,' Hei- ing and molecular analysis of the K562. decker, G.,' 'University of Southern 48:14) chromosomal translocation Dale,B.,Born, W, Mason,I., California, School of Medicine, Los involving the c-myc onc gene in hu- Ozanne, B., University of Texas Angeles; 'University of California, man Burkitt lymphoma. Health Science Center,Dallas: School of Medicine, Davis: TwoKeath, E.J., Piccoli, S.P., Cole, M.D., Comparison of methylated status of new mutations in the rat sarcoma Dept. of Biochemistry, St. Louis the c-abl locus with transcriptional virus oncogene are similar to those University School of Medicine, activity of c-abl in mouse tissues. present in the human bladder car- Missouri: Alteration of the c-myc cinoma gene. oncogene by chromosomal translo- Leibowitz, D., Miller, C., Donovan- Teumer, J.,' Wigler, M.,' Friedman, cation in mouse plasmacytomas. Peluso, M., Cubbon, R., Bank, A., E.,'Lipkin, M.,' Winawer,S.,' Krump-Konvalinkova ,V., Vaessen , Depts. of Medicine, Human Ge- Stavnezer, E.,' 'Memorial Sloan- netics, and Development, Colum- M.J.,RadiobiologicalInstitute Kettering Cancer Center, New TNO, Rijswijk, The Netherlands: bia University, New York, New York; 'Cold Spring Harbor Labo- York: Organization of c-abl in K562 Oncogenic capacity of normal ver- ratory, New York: Comparison of c- tebrate DNAs. cells. ras" mRNA levels in normal, pre- Groffen, J.,Heisterkamp, N., Ste- Milly, M.I.,Haas,M.,1.2 'Cancer malignant, and malignant colonic Center, 'Dept. of Biology, Univer- phenson, J.R., NCI, Frederick epithelia. Cancer Research Facility, Freder- sity of California, San Diego: On- ick, Maryland: The human v-ablCooper, C.S.,' Blair, D.G.,2 Oskars- cogene expression in factor-de- cellular homolog. son, M.K.,' Vande Woude, G.F.,' pendent T- lymphoblastoma cells 'NCI, National Institutes of Health, and autonomous T-lymphoma cells. Youngren, S.D., de Noronha, F., New Bethesda; 'NCI, Frederick Can- Levy, L.S.,' Gardner, M.,' Casey, J.,' York State College of Veterinary cer Research Facility, Frederick, 'Dept. of Biochemistry, Louisiana Medicine, Cornell University, Ith- Maryland: Transforming activity of State University Medical Center, aca: A transmissible FeSV contain- DNA from chemically transformed New Orleans; 'Dept. of Pathology, ing sequences related to the rase human cells and cell lines derived University of California, Davis: "onc" gene. from human tumors. Structural alterations in the feline c- Ellis, R.W.,' Lowe, R.,' Scolnick, Lautenberger, J.A., Court, D., Papas, myc locus in naturally occurring E.M.,' Brinster, R.L.,2 Palmiter, T.S., NCI, National Institutes of tumors.

179 Narayanan, R., Srinivasan, A., Dunn, Vancouver, Canada: Analysis of thesda, Maryland: Ra-MLV-induced C.Y., Reddy, E.P., Aaronson, S.A., structural and functional regions of stage-specific transformation of B NCI, National Institutes of Health, the FuSV-transforming protein. cellsanditsassociationwith Bethesda, Maryland: Activation ofNeckameyer, W.S., Wang, L.-H., changes in the c-myc locus. the mos gene by 3' LTR -Analysis Rockefeller University, New York, Barker, P.E.,' Verma, I.,2Ruddle, of cis-acting sequences New York: Molecular cloning and F.H.,' 'Dept. of Biology, Yale Uni- Kloetzer, W, Maxwell, S., Gal lick, characterization of UR-2 ASV DNA versity, New Haven, Connecticut; G., Stanker, L., Arlinghaus, R., and analysis of the cellular homo- 'Tumor Virology Laboratory, Salk Dept. of Tumor Virology, Univer- log of the UR-2 transforming gene. Institute,La Jolla,California: Chromosomal mapping of the hu- sity of Texas System Cancer Cen-Naharro, G.,' Tronick, S.R.,1 Rash- ter,M.D.AndersonHospital, eed, S.,' Gardner, M.B.,' Aaron- man c-fos oncogene. Houston: 1,858.- encoded by ts110 son, S.A.,' Robbins, K.C.,' 'NCI, MacConnell, W P., Verma, I.M., Mo- Mo-MSV has an associated protein National Institutes of Health, Be- lecular Biology and Virology Lab- kinase activity. thesda, Maryland; 'Dept. of Pathol- oratory, Salk Institute, San Diego, Somers, K.D., Murphey, M.M., Mar- ogy, University of Southern Cali- California: Expression of FBJ-MSV tin, D., Dept. of Microbiology and fornia, School of Medicine, Los fos gene product in bacteria. Immunology,EasternVirginia Angeles; 'Dept.of Pathology, Uni- Moelling, K., Bunte, T., Donner, P., Medical School, Norfolk: Detec- versity of California, Davis: The Greiser-Wilke, I., Owada, M.K., tion of candidate v -mos gene prod- one sequence of Gardner-Rasheed Max-Planck-Institut fiir Moleku- ucts in a morphological revertant of FeSV is distinct from the trans- lareGenetik,Berlin-Dahlem, Mo-MSV-transformed rat cells. forming genes of other retroviruses Federal Republic of Germany: with associated tyrosine kinase Gal lick, G.E.,' Sparrow, J.,' Stanker, Analysis of different transforming activity. L.H.,'Arlinghaus,R.B.,''Uni- polyproteins of acute avian leuke- versity of Texas Systems Cancer Huang, C.-C., Hammond, C., Bishop, mia viruses. Center, M.D. Anderson Hospital, J.M., Dept. of Microbiology and Josephs, S.F., Wong-Staal, F., NCI, Houston; 'Dept.of Medicine, Bay- Immunology, University of Califor- National Institutes of Health, Be- lor College of Medicine, Houston, nia, San Francisco: Nucleotide se- thesda, Maryland: 3' viral and hu- Texas: Recognition of a normal cel- quence of the oncogene of PRCII man cellular sequences correspond- lular protein structurally related to ASV and its cellular homolog. ing to the transforming gene of SSV. the transforming protein of MSVParker, R.C., Mardon, G., Varmus, Thiel, H.-J., Hafenrichter, R., Gre- 124 with antisera to synthetic pep- H.E., Bishop, J.M., Dept. of Mi- ger, B., Federal Research Institute tides of the v-mos'''''gene product. crobiology and Immunology, Uni- for Animal Virus Diseases, Tiibin- Kan, N., Papas, T., NCI, National In- versity of California, San Fran- gen, Federal Republic of Germany: stitutes of Health, Bethesda, Mary- cisco: Humancellularsrc - Characterization of a transforma- land: Molecular cloning of MH2 Isolation and characterization of tion-specific glycopeptide in SSV- provirus. two distinct loci. NP cells. Lipsich, L.A., Lewis, A., Brugge, Gibbs, C.,' Anderson, S.K.,2 Tanaka, Robbins, K.C., Devare, S.G., Aaron- J.S., Dept. of Microbiology, State A.,2 Ridgway, A.,' Radul, J.,' Kung, son, S.A., NCI, National Institutes University of New York, Stony H.-J.,' Fujita, J.,' 'Dept. of Bio- of Health, Bethesda, Maryland: Brook: Isolation of monoclonal chemistry, Michigan State Univer- Posttranslational modifications of antibodies that recognize the trans- sity,East Lansing; 'Cancer Re- the SSV transforming gene product. forming proteins of ASVs. search Laboratory, University of Jansen, H.W., Patschinsky, T., Bister, Kurth, R., Western Ontario, London, Canada: K., Max-Planck-Institut fiir Molek- Tanaka, T., Lower, J., Human c-src-Structural analysis of Paul-Ehrlich-Institute, Frankfurt, ulare Genetik, Berlin, Federal Re- cloned DNA reveals extensive ho- public of Germany: Genetic struc- Federal Republic of Germany: mology with avian v-src. Monoclonal antibodies specific for tureofavianleukemiaand RSV-coded structural and trans- Hill, K., Robertson, D.L., Dept. of carcinoma virus MH2 and its rela- forming proteins. Chemistry, Brigham Young Univer- tionship to other myc-containing vi- Parsons, S.J., Mc Carley, D.J., Ely, sity, Provo, Utah: Biochemistry of ruses. C.M., Benjamin, D.C., Parsons, pp60.'c-cAMP - dependent phos-Schultz, A.M., Oroszlan, S., NCI, J.T., University of Virginia, Char- phorylation. Federick Cancer Research Facility, lottesville: Monoclonal antibodiesJullien, M.,' Harel, L.,' Golde, A.,' Frederick, Maryland: Retroviral to the src protein of RSV. Villaudy, J.,2Pugnet, P.,' 'Institut de transforming proteins and gag Ingman-Baker, J.,' Buchan, A.,2 Gin- Recherches Scientifiques sur le polyproteins of type-B, -C, and -D ter, G.,' Pawson, T.,' 'Dept. of Mi- Cancer, Villejuif; 'Institut Curie, viruses are myristylated. crobiology; 'Dept. of Physiology, Paris, France: Inhibition by quer- Teich, N.M., Rowe,J.,Harrison, University of British Columbia, cetin of the early effect of src gene M.A., Imperial Cancer Research Vancouver, Canada: Isolation of expression on ATP turnover. Fund, London, England: Studies of monoclonal antibodies to the FuSV- Schofield, M.A., Mardon, G., Var- BSB, a murine erythroleukemia vi- transforming protein. mus, H.E., Dept. of Microbiology rus complex distinct from Friend Wang, L.-H., Edelstein, B., Rocke- and Immunology, University of virus. feller University, New York, New California, San Francisco: Molec- Wright, S.,1, Harmon, Smith, York: Molecularly cloned src dele- ular and biological characterization D.,' Hayes, J.,3 Robertson, P.,' tion mutants of RSV are able to in- of frame-shift mutants and back Wayne, A.,"Dept. of Medicine and duce tumors and generatere- mutants of src arising in a single Cellular, Viral and Molecular Biol- covered sarcoma virus in chickens. Rous sarcoma provirus. ogy, University of Utah School of Weinmaster, G., Stone, J., Hinze, E.,Balachandran, R., Swan, D.C., Aar- Medicine; 'Dept. of Biology, Uni- Pawson, T., Dept. of Microbiology, onson, S.A., Reddy, E.P., NCI, Na- versity of Utah; 'Veterans Admin- University of British Columbia, tional Institutes of Health, Be- istration Medical Center, Salt Lake

180 City, Utah: Candidate products of quence of the polyprotein-coding E., Dept. of Molecular Biology and the AMV oncogene region pro- region of McDonough FeSV and its Virology, Sloan-Kettering Institute, duced by in vitro translation of ge- oncogene v-fins. New York, New York: Novel fea- nomic RNA. Heisterkamp, N., Groffen, J.,Ste- tures of v-ski and c-ski revealed by Bonner, T.I., IMark, G.E.,' Golds- phenson,J.R., NCI, Frederick molecularcloningand DNA borough, M.D.,' O'Brien, S.J.,' Cancer Research Facility, Freder- sequencing. Nash, W.G.,' Minna, J.D.,2 Rapp, ick, Maryland: Molecular cloning Brodeur, D., Barkas, A., Brennan, L., U.R., "Laboratory of Viral Carcin- and chromosomal localization of the Teumer, J., Myers, D., Nguyen, H., ogenesis, NCI, Federick, Mary- human c-fins oncogene. Stavnezer, E., Dept. of Molecular land; 'NCI-Navy Medical Oncol-Kollek, R.,' Stocking, C.,' Arbuth- Biology and Virology, Sloan-Ket- ogy Branch, Bethesda, Maryland: nott, C.,2 Ostertag, W,' 'Heinrich- tering Institute, New York, New The human cellular homologs of a Pette-Institut fur Experimentelle York: Transformation and tumor new oncogene, v -raf. Virologie and Immunologic an der induction by biologically and molec- Roussel, M.F.,' Baker, P.F.,2 Fedele, Universitat Hamburg, Federal Re- ularly cloned SK viruses. L.A.,' Rudd le, F.H.,2 Sherr, C.J.,' public of Germany; 2Beatson Insti- Lederman, L., Singhal, M.C., Zuck- 'NCI, National Institutes of Health, tute for Cancer Research, Glasgow, erman, E.E., Hardy, W D., Jr., Bes- Bethesda, Maryland; 'Dept. of Bi- Scotland: Molecular and biological mer, P., Signorelli, K.L., Snyder, ology, Yale University, New Haven, analysis of the MPSV and its tem- H.W., Jr., Memorial Sloan-Ketter- Connecticut: Molecular characteri- perature-sensitive mutants. ing Cancer Center, New York, New zation and chromosomal localiza-Leprince, D., Gegonne, A., Coll, J., York: Subcellular localization of the tion of the human proto-oncogene Schneeberger, A., Lagrou, C., Ste- transforming proteins of FeSV. c-fins. helin, D., INSERM, Institut Pas- Snyder, H.W.,Jr.,Singhal, M.C., Hampe, A.,' Gobet, M.,' Galibert, F,' teur, Lille, France: The AMV E26 Zuckerman, E.E., Jones,F.R., Sherr, C.J.,' 'Laboratoire d'Hema- contains a new specific nucleotide Hardy, WD., Jr., Memorial Sloan- tologieExperimentale,Hopital sequence (v-ets) in addition to the Kettering Cancer Center, New Saint-Louis, Paris, France; 'NCI, v-myb oncogene. York, New York: Characterization National Institutes of Health, Be-Brennan, L., Li, Y., Magarian, C., of FOCMA from feline lymphosar- thesda, Maryland: Nucleotide se- Brodeur, D., Barkas, A., Stavnezer, coma cells.

SESSION 4 Poster Session Balduzzi, P., Christensen, J.R., Dept. product with mitogenic and onco- Pathologic Aviaire de I'INRA, of Microbiology, University of genic properties. Monnaie, France: Role of the mito- Rochester School of Medicine and Carlberg, K., Woolford, J., Chamber- genic function and kinase activity of Dentistry, New York: Initial char- lin, M.E., Beemon, K., Dept. of p60'rc in tumor formation by RSV. acterization of a temperature-sen- Biology, Johns Hopkins University,Rabotti, G.E, Teutsch, B., Mongiat, sitive mutation in the transforming Baltimore, Maryland: PRCII gene of ASV UR-2. F, Mariller, M., College de France, ASV -Genomecharacterization Laboratorie de Medecine Experi- Bryant, D., Wilkerson, V., Coffman, and subcellular localization of mentale, Paris: Virus production in A., Parsons, LT., Dept. of Micro- transforming protein. human fibroblasts transformed by biology, University of Virginia Adams, S.L., Allebach, E.S., Focht, RSV. Medical School, Charlottesville: R.J., Holtzer, H., Boettiger, D., Pa- Site-directed mutagenesis in the src cifici, M., Depts. of Human Ge- Amini, S., Kaji, A., Dept. of Micro- gene of RSV. netics, Anatomy, and Microbiol- biology, University of Pennsylvan- Cross, ER., Pellman, D., Hanafusa, ogy, University of Pennsylvania ia, Philadelphia: Association of H., Rockefeller University, New School of Medicine, Philadelphia: the nonphosphorylated 36K protein York, New York: Mapping regions Transformation by RSV alters with the plasma membrane of in p60n'. of RSV that are required phenotypic properties of chick chicken embryo fibroblasts. for transformation. chondroblasts by altering host-cell Antler, A., Greenberg, M.E., Edel- Foster, D.A., Hanafusa, H., Rocke- gene expression at multiple levels. man, G.M., Goldberg, A.R., Han- feller University, New York, NewCrisanti, P.,' Lorinet, A.M.,' Pessac, afusa, H., Rockefeller University, York: A gag-deficient mutant of B.,' Calothy, G.,' 'INSERM, Hopi- New York, New York: Transforma- FuSV transforms fibroblasts in cul- tal Broussais, Paris; 'Dept. Biolo- tion by ASV and the distribution of tureandinducestumorsin gie, Institut Curie, Orsay, France: vinculin and actin in transformed chickens. src-gene-dependent stimulation of cells-The role of vinculin tyrosine Garber, E.A., Krueger, J.G., Hana- glutamine decarboxylase activity in phosphorylation. fusa, H., Goldberg, A.R., Rocke- quail embryo neuroretina cells in- feller University, New York, New fected with a temperature-sensitive Carter, V.C., Martin, G.S., Dept. of mutant of RSV. Zoology, University of California, York: Localization and biochemical Berkeley: Localization of the 36K characterization of aminoterminal-Dolberg, D., Bissell, M.J., Lawrence altered src proteins. Berkeley Laboratory,Berkeley, tyrosine phosphorylation substrate to the cell cortex. Marx, 'M.,' Poirier, F,2 Genvrin, P.,' California: The anomolous inabil- Dambrine, G.,' Hill, M.,' Calothy, ity of RSV to cause tumors in the Friis, R.R.,' Eigenbrodt, E.,2 Ribas- G.,2'CNRS,Villejuif;'Institut avian embryo. men, H.,' 'Institut fur Virologie, Curie, Orsay; 'Station de Patholo-Poirier, F.,' Jullien, P.,' Dezelee, P.,' 'Institut ffir Biochemie, Justus-Lie- gic Aviaire de L'INRA, Monnaie, Dambrine, G.,2Calothy,G.,' big-Universitat, Giessen; 'Paul- France: A 45,000-M, src gene 'Institut Curie, Orsay; 'Station de Ehrlich-Institut, Frankfurt, Federal

181 Republic of Germany: Host target Machida, C., Bestwick, R., Kabat, cellular localization of the Mo-MSV proteins for one-gene-specific D., School of Medicine, Oregon transforming protein p37m0\ Health Sciences University, Port- phosphorylation. Anderson, S J.,1 Gonda, M.A.,2 Sherr, land: Isolation of Spontaneous env Gould, K.L.,1 Cooper, J.A.,2 Hunter, C.J.,1 1NCI, National Institutes of gene mutants and a molecular clone T.,21Dept, of Biology, University of Health, Bethesda; 2Frederick Can- of Rauscher SFFV. California, La Jolla; 2Salk Institute, cer Research Facility, Frederick, San Diego, California: Tissue dis- Bilello, J.A., Pitha, P.M., Johns Hop- Maryland: Transforming glycopro- tribution of p39 and p46—Two sub- kins Oncology Center, Baltimore, teins encoded by the oncogene v-fins strates of tyrosine protein kinases. Maryland: Interferon-mediated are associated with intermediate Lau, A.F., Cancer Center, University changes in retroviral protein filaments. of Hawaii, Honolulu: A phospho- synthesis. Hwang, S., Park, J., Freeman, H., tyrosine-containing 135,000-dalton Chatterjee, S;, Hunter, E., Dept, of Boublik, M., Gilboa, E., Biochem- protein immunoprecipitated by tu- Microbiology, University of Ala- ical Sciences, Princeton University, mor-bearing rabbit serum from bama, Birmingham: Effect of New Jersey: Structure and proper- ASV-transformed cells. cloned human interferon on the ties of envelope vectors derived Anderson, S.M., Virus and Cell Bi- replication of MPMV. from Mo-MLV — Characterization of the envelope acceptor splice ology Dept., Merck Sharp and Fenyo, E.M .,1 Wiener, F.,2 Rafnar, sequence. Dohme Research Laboratories, B.,1 Asjo, B.,1 1Dept, of Virology, West Point, Pennsylvania: Indue- 2Dept, of Tumor Biology, Karolin- Joyner, A., Bernstein, A., Ontario tion of sarcomas in newborn ani- ska Instituted Stockholm, Sweden: Cancer Institute, Toronto, Canada: mals by a murine retrovirus con- Tumors arising from Ab-MLV-in- Generation of infectious retrovi- taining the sre gene. fected spleen cells in pristane- ruses expressing dominant and se- Krycbve-Martinerie, C., Lawrence, primed BALB/c mice produce anti- lectable genes is associated with in D.A., Crochet, J., Jullien, R, Vi- bodies to preselected antigens. vivo recombination and deletion events. gier, P, Dept. Biologie, Institut Swanson, S.K.,1 Watanabe, S.M.,1 Curie, Orsay, France: Further study Treiman, L .,1 Rosenberg, N.E.,2 Miller, A .D .,1 Jolly, D.J.,2 Fried- of TGF released by RSV-trans- Witte, O.N.,1 1Dept, of Microbiol- mann, T.,2 Verma, I.M .,1 formed cells. ogy and the Molecular Biology In- 1Molecular Biology and Virology Mulcahy, L., Kahn, M., Kelder, B., stitute, University of California, Laboratory, Salk Institute, San Rehberg, E., Pestka, S., Stacey, Los Angeles; 2Dept, of Pathology Diego; 2Dept, of Pediatrics, Uni- D.W., Roche Institute of Molecular and Cancer Research Center, Tufts versity of California, San Diego, La Biology, Nutley, New Jersey: Hu- University School of Medicine, Jolla, California: A transmissible man fibroblast interferon produc- Boston, Massachusetts: Ab-MLV retrovirus expressing human HPRT. tion under avian retroviral con- mutants with weak lymphoid trans- Norton, P., Coffin, J.M., Tufts Uni- trol—Optimal genomic locations. formation potential select very early versity School of Medicine, Bos- Serunian, L.A., Rosenberg, N.> Can- stages of the B-cell lineage as target ton, Massachusetts: Expression and cer Research Center, Tufts Univer- cells. propagation of the bacterial gene for sity School of Medicine, Boston, Sheiness, D., Gardinier, M., Dept, of /3-galactosidase in avian cells by a Massachusetts: Abelson virus in- Biochemistry, Louisiana State Uni- retrovirus. duces continuous growth of differ- versity Medical School, New Orle- entiated B lymphocytes. Robins, T.S., Vande Woude, G.F., ans: Investigation of a possible role NCI, National Institutes of Health, Heard, J.M.,1 Fichelson, S.,1 Sola, for c-myb in T-lymphocyte differ- Bethesda, Maryland: A retroviral B .,1 Berger, R .,2 Varet, B .,1 entiation. “shuttle” vector—Molecular cion- 1Laboratorie Immunologie et Virol- Bechade, C., Laugier, D., Poirier, F., ing of infectious, nonpermuted, cir- ogle des Tumeurs, Hdpital Cochin; Calothy, G., D6pt. of Biologie, In- cular MSV DNA. 2Laboratoire de Cytogdn&ique, stitut Curie, Orsay, France: Two Hdpital Saint-Louis, Paris, France: Muller, R .,1 Tremblay, J.M.,1 Adam- classes of v-myc-containing viruses son, E.D .,2 Verma, I.M .,1 Myeloblastic transformation in Fr- with distinguishable transforming MLV-infected long-term bone-mar- 1Molecular Biology and Virology and mitogenic properties in chick Laboratory, Salk Institute, San row cultures — In vitro reproduction embryo neuroretinal cells. of a long-term leukemogenesis. Diego; 2Cancer Research Center, La Jolla Cancer Research Foundation, Amanuma, H .,1 Katori, A .,1 Obata, Anderson, G.R., Fung, B., Polonis, California: Expression of cellular -V., Manly, K., Roswell Park Me ־M .,2 Sagata, N .,2 Ikawa, Y.,12 oncogenes during mouse devel- 1Dept, of Viral Oncology, Cancer morial Institute, Buffalo, New York: asp56/LDHk in the KiSV and HaSV opment. Institute, Toshima-ku, Tokyo; 2Laboratory of Molecular Oncol- systems. Pederson, N.C.,1 Johnson, L .,1 Thei- ogy, Institute of Physical and Papkoff, J.,1 Nigg, E.,2 Hunter, T.,3 len, G.H.,? 1Dept, of Medicine, Chemical Research, Saitama, Ja- 1Stanford University, California; 2Dept, of Surgery, School of Veter- pan: Nucleotide sequence of the 2Swiss Federal Institute of TechnoL inary Medicine, University of Cali- gene for the specific glycoprotein ogy, Zurich, Switzerland; 3Salk In- fornia, Davis: Latent FeLV in- (gp55) of the Friend SFFV. stitute, San Diego, California: Sub­ fection.

SESSION 5 Mechanisms of Leukemogenesis Chairperson: W. Hayward, Memorial Sloan-Kettering Cancer Institute, New York, New York

van Ooyen, A.J.J.1 Nusse, R .,1 Var- University of California, San Fran- Peters, G., Dickson, C., Imperial mus, H.E.,21Dept, of Virology, The cisco: Integration of MMTV in a Cancer Research Fund Laborato- Netherlands Cancer Institute, Am- specific chromosomal region and ries, London, England: int-2—A sterdam; 2Dept, of Microbiology, activation of a cellular gene. second common integration region

182 for MMTV proviruses in mouse Specific rearrangement of a uniqueLamph, W, Dudley, J., Arfsten, A., mammary tumors. cellular sequence in Mo-MLV-in- Green,P.,Risser,R., McArdle duced rat thymoma. Laboratory for Cancer Research, Raines, M.,' Lewis, W,' Crittenden, University of Wisconsin, Madison: L.B.,2 Kung, H.J.,' 'Dept. of Bio- Tsichlis, RN., Strauss, P.G., Hu, L.F., Phenotypic changes and DNA rear- chemistry, Michigan State Univer- NCI, National institutes of Health, rangement in clonal Abelson lym- sity; 'USDA Poultry Research Lab- Bethesda, Maryland: Mo-MLV phoma cells. oratory, East Lansing, Michigan: tegration in rat thymic lymphomas. LTR insertional activation of c-erb- Casey, J. W.,' Levy, L.S.,' Derse, B- The molecular basis of ALV-in- Steffen, D., Worcester Foundation for D.D.,' Caradonna, S.J.,2 Deininger, duced erythroblastosis. Experimental Biology, Shrewsbury, P.L.,''Dept.of Biochemistry, Massachusetts: Proviruses are in- Miles, B., Robinson, H., Worcester 2Dept. of Pharmacology, Louisiana tegrated adjacent to c-myc in some State University Medical Center, Foundation for Experimental Biol- MLV-induced lymphomas. ogy, Shrewsbury, Massachusetts: New Orleans: The nucleotide se- High-frequencyoccurrenceofHerman, S.A., Coffin, J.M., Dept. of quence of the BLV LTR and host- transduced erb sequences in ALV- Microbiology and Molecular Biol- virus junctions suggests a depend- induced erythroblastosis. ogy,Tufts University School of ence on host DNA for transcrip- tional activity. Swift, R.A., Schaller, E., Kung, H.- Medicine, Boston, Massachusetts: J., Dept. of Biochemistry, Michi- Downstream transcription in virus- Frykberg, L.,' Graf, T.,2 Vennstrom, gan State University, East Lansing: es of differing oncogenic potential. B.,"Dept. of Medical Genetics, Insertion-activation of c-myc by Cullen, B., Lomedico, P.T., Ju, G., Uppsala University, Sweden; REV -Cloning and structure anal- Dept. of Molecular Genetics, Hoff- 'German Cancer Research Center, ysis of an activated c-myc gene. mann-La Roche, Inc., Nutley, New Heidelberg,Federal Republic of Lemay, G., Jolicoeur, P., Institut de Jersey: Interference between LTR Germany: Transformation capaci- Recherches Cliniques de Montreal, promoters in the avian retrovirus ties of avian retroviruses containing University de Montreal, Canada: transcriptional unit. chicken c-myc sequences.

SESSION 6 Human Retroviruses Chairperson: M. Martin, National Institutes of Health, Bethesda, Maryland

Seiki, M., Hattori, S., Hirayama, Y., tion and chromosomal localization Rabson, A.B., Steele, RE., Bryan, T., Yoshida, M., Dept. of Viral Oncol- of a specific integration site of Martin, M.A., NIAID, National In- ogy, Cancer Institute, Kam-Ikebu- HTLV. stitutes of Health, Bethesda, Mary- land: Organization and expression kuro, Tokyo, Japan: Human retro- Merl, S.,' Kloster, B.,' Moore, J.,'3 virus (ATLV)- Complete nucleotide of full-length human endogenous Hubbell, C.,' Tomar, R.,' Davey, retroviral DNA. sequence of the provirus genome F.,' Gordon, L.,' Comis, integrated in leukemic cell DNA. Poiesz, B.,',2' 'Upstate Medical Cohen, M., Bonner, T., O'Connell, Hahn, B., Wong-Staal, F., Manzari, Center, State University of New C., NCI, Frederick Cancer Re- V., Franchini, G., Gelmann, E.R, York, Syracuse; 'Syracuse Veterans search Facility, Frederick, Mary- Gallo, R.C., NCI, National Insti- Administration Medical Center; land: A full-length endogenous hu- tutes of Health, Bethesda, Mary- 'Barbara Rapp Research Center, man retroviral genome. land: A survey of human leukemias Auburn, New York: A sensitive Gelmann, E., Popovic, M., Robert- and lymphomas using cloned HTLV biologic assay for HTLV- Trans- Guroff, M., Blayney, D., Gallo, sequences and adjacent cellular formation of previously activated R.C., NCI, National Institutes of sequences. T lymphocytes. Health, Bethesda, Maryland: HTLV Yoshida, M., Watanabe, T.,Seiki, proviral sequences in peripheral Souyri, M., Fleissner, E., Memorial lymphocytes of two patients with M., Dept. of Viral Oncology, Can- Sloan-Kettering Cancer Center, cer Institute, Tokyo, Japan: New AIDS. New York, New York: Analysis of Mullins, J.I.,' McLane, M.F.,' Essex, proviral genomes with small human transforming sequences in DNA of M.,' Schooley, R.,' Gold, J.,' 'Dept. retroviral (ATLV) and integration human T-cell leukemias. sites in leukemic and nonleukemic of Cancer Biology, Harvard School cell DNAs. Steele, RE., Rabson, A.B., Bryan, T., of Public Health, Boston; 2Dept. of Franchini, G.,' Wong-Staal, F.,' Man- Repaske, R., O'Neill, R.R., Mar- Infectious Diseases, Massachusetts General Hospital, Boston; 'Special zari,V.,' Hahn, B.,' Croce, C.,' tin, M.A., NIAID, National Insti- Gallo, R.C.,"NCI, National Insti- tutes of Health, Bethesda, Mary- Microbiology Laboratory, Memor- tutes of Health, Bethesda, Mary- land: Human DNA contains at least ial Sloan-Kettering Cancer Center, land; 'Wistar Institute,Philadel- two families of endogenous retro- New York, New York: HTLV se- phia, Pennsylvania: Characteriza- viral sequences. quences in AIDS.

SESSION 7 Poster Session Wolfe, J.H.,' Blankenhorn, E.P.,' cine, Philadelphia: gag precursor Etzerodt, M., Andersen, H.D., Blank, K.J.,"Dept. of Pathology, polyprotein alteration in Gross-vi- gensen, P., Kjeldgaard, N.O., Ped- 'Dept. of Microbiology, University rus-induced cell lines derived from ersen, F.S., Dept. of Molecular Bi- of Pennsylvania School of Medi- H-2 congenic mice. ology, University of Aarhus, Den-

183 mark: The nucleotide sequence of presumptive45K limit-digest Iowa City: Localization of adeno- Akv MLV. breakdown product (gp45). sine methylations in RSV genomic Elder, J.,' Mullins, J.,' 'Research In-Pepinsky, R.B., Vogt, V.M., Section RNA. stitute of Scripps Clinic, La Jolla, of Biochemistry, Molecular and Staskus, K.,' Resnick, R.,' Omer, C.,2 California; 'Dept. of Cancer Biol- Cell Biology, Cornell University, Retzel, E.,' Faras, A.,' 'Dept. of ogy, Harvard School of Public Ithaca: Localization of lipid-pro- Microbiology, University of Min- Health, Boston, Massachusetts: tein and protein-protein interac- nesota, Minneapolis; 2Dept. of Ge- Nucleotide sequence of the enve- tions within the murine retrovirus netics, Stanford University, Cali- lope gene of GA-FeLV-B reveals gag precursor by a novel peptide- fornia:RNase-H-mediated initia- unique sequence homologies with a mapping technique. tion of strong-stop (+)DNA syn- murine MCF virus. Oroszlan, S.,' Copeland, T.D.,' Ger- thesis. Buchhagen, D.L., Downstate Medi- ard, G.,' 'NCI, Frederick CancerStacey, D.W.,' Mulcahy, L.,' Pu- cal Center, State University of New Research Facility,Frederick; gatsch, T.,2 'Roche Institute of Mo- York, Brooklyn, New York: Inte- 'Bethesda Research Laboratory, lecular Biology, Nutley, New Jer- gration of recombinant and eco- Gaithersburg, Maryland: Primary sey; 'International Genetics Insti- tropic proviruses in preleukemic structure studies of Mo-MLV re- tute, Jerusalem, Israel: Correlation and leukemic AKR/J thymus DNAs. verse transcriptase. of a sequence required for virion Famulari, N.G.,' Cieplensky, D.,'Murphy, E. C.,Jr.,Nash, M. A., packaging with a 28-bp self-com- Koehne, C.,' Lenz, J.,' Haseltine, Brown, N.V., Dept. of Tumor Vi- plementing sequence in SR-B. W.,' O'Donnell,P.V.,''Memorial rology, University of Texas System Smith, J.K., Hsu, T.W., Cywinski, A., Sloan-Kettering Cancer Center, Cancer Center, M.D. Anderson Taylor, J.M., Institute for Cancer New York, New York; 'Sidney Far- Hospitaland TumorInstitute, Research, Fox Chase Cancer Cen- ber Cancer Institute, Harvard Med- Houston: Nuclease-S1 mapping of ter,Philadelphia, Pennsylvania: ical School, Boston, Massachu- viral RNA from MSV ts110 -A pos- Synthesis of DNA intermediates by setts:Viral gene expression in sible temperature-sensitive splicing ASV. thymocytes and primary leukemias mutant of MSV. of mice inoculated with leukemo- Wang, L.-H., Rockefeller University, genic ecotropic virus. Miller, A.D., Verma, I.M., Molecu- New York, New York: Deletion in lar Biology and Virology Labora- pol sequences affects the RNA O'Donnell, P V.,Famulari, N.G., tories, Salk Institute, San Diego, expression of certain ASVs. Chu, A., Memorial Sloan-Kettering California: A Cancer Center, New York, New single-base-pair Leis, J., Jentoft, J., Case Western Re- change between infectious and non- serve University School of Medi- York: Stages in development of vi- infectious Mo-MLV. rus-accelerated leukemia in AKR cine, Cleveland, Ohio: RNA-bind- mice. Karpel, R.L.,12 Henderson, L.E.,' ingpropertiesoftheavian Oroszlan,S.,''NCI, Frederick retrovirus pp 12 protein - Regula- Me lief,C.J.M.,Zijlstra, M., de tion by phosphorylation. Goede,R.E.Y., Cancer Research Facility, Freder- Schoenmakers, ick; 2Dept. of Chemistry, Univer- H.J.,Central Laboratory of the Edbauer, C.A., Naso, R.B., Univer- Netherlands, Red Cross Blood sity of Maryland Baltimore County, sity of Texas System Cancer Cen- Transfusion Services, and Univer- Catonsville: Interactions of the ter,M.D.AndersonHospital, sity of Amsterdam, The Nether- basic nucleic-acid-binding protein Houston: Cytoskeleton-associated lands: Influence of the H-2 com- of type-C viruses with RNA. Pr65vg and retrovirus assembly. plex on the phenotype of lym-Yoshinaka, Y., Shames, R., Luftig, Crawford, S., Goff, S.P., Dept. o' phomas induced by different host- R.B., University of South Carolina Biochemistry, Columbia Univer range classes of MLV. School of Medicine, Columbia: city, College of Physicians and Sur- Bach, R.G., Meruelo, D., Irvington Partial purification and characteri- geons, New York, New York: Dele- House Institute, New York Univer- zation of the MLV-associated pro- tion mutants in the P12 gag gene of sity Medical Center, New York: tein kinase. Mo-MLV generated by site-specific Identification of a 36,000-molecu-Yoshinaka, Y., Luftig, R.B., Dept. of mutagenesis. lar-weight gag-related phosphopro- Microbiology and Immunology, Lerner, T., Hanafusa, H., Rockefeller tein in lymphoma cells transformed University of South Carolina School University, New York, New York: by RadLV. of Medicine,Columbia: MLV The nature of the pol and env de- Bach, R.G., Meruelo, D., Irvington Pr658,, forms a 130K dimer in the fects in Bryan RSV. House Institute, New York Univer- absenceofdisulfidereducing Hughes, S.H., Kosik, E., Cold Spring sity Medical Center, New York: agents. Harbor Laboratory, New York: Mu- Heterogeneity of p15(E)-relatedKatoh, I., Yoshinaka, Y., Luftig, tagenesis of the region between env polypeptides expressed by MLV-in- R.B., Dept. of Microbiology and and src in the SR-A strain of RSV. fected cells-Phenotypic marker for Immunology, University of South Katz, R.A.,' Malavarca, R.,' Cullen, oncogenic RadLV? Carolina School of Medicine, Co- B.,2 Ju, G.,2 Skalka, A.M.,' 'Roche Pinter, A., Honnen, W.J., Memorial lumbia: MLV p30 heterogeneity as Institute of Molecular Biology; Sloan-Kettering Cancer Center, revealed by 2-D electrophoresis and 2Dept.of Molecular Genetics, New York, New York: Comparison column chromatofocusing methods. Hoffmann-La Roche, Inc., Nutley, of structural and antigenic featuresFan, H., Chute, H., Chao, E., Feuer- New Jersey: Localization of a de- of specific domains of ecotropic and man, M., Dept. of Molecular Biol- fect in the mRNA leader region of MCF MLV gp70 molecules. ogy and Biochemistry, University of the endogenous avian retrovirus Trauger, R.J., Luftig, R.B., Dept. of California, Irvine: Mutants of Mo- ev-1. MicrobiologyandImmunology, MLV unable to synthesize glycosy- Ficht, T.A., Chang, L.-J., Stoltzfus, UniversityofSouth Carolina lated gag polyprotein. C.M., Dept. of Microbiology, Uni- School of Medicine, Columbia:Stoltzfus, C.M., Dane, R.W., Dept. of versity of Iowa, Iowa City: Amino- Studies on Mo-MLV gp70 and a Microbiology, University of Iowa, terminal analysis of the primary

184 translation products of the gag and France: BLV protein expression in N.E.,1 1Kernforschungszentrum env genes of avian RNA tumor vi- cultured cells. Karlsruhe, Federal Republic of ruses. Kashmiri, S.V.S., Mehdi, R., Alt- Germany; 2Netherlands Cancer In- Bizub, D., Katz, R.A., Skalka, A., land, B., Ferrer, J.F., University of stitute, Amsterdam; 3Phillips Uni- Roche Institute of Molecular Biol- Pennsylvania, Kennett Square: Mo- versity, Institute of Physiological ogy, Nutley, New Jersey: Compari- lecular cloning of covalently closed, Chemistry, Marburg, Federal Re- son of the noncoding sequences circular DNA of BLV. public of Germany: Transcriptional control signals contained in the LTR of avian retroviruses. Wernicke, D .,1 Trainin, Z .,1 Ungar- sequences of MMTV. Caballero, A., Luftig, R.B., Dept, of Waron, H .,2 Essex, M .,1 ‘Dept, of Microbiology and Immunology, Cancer Biology, Harvard Univer- Zavada, J.,1 Huang, A.S.,1 Svec, J.,2 School of Medicine, University of sity School of Public Health, Bos- 1Harvard Medical School and Chil- South Carolina, Columbia: Com- ( ton, Massachusetts; 2Dept, of Im- dren’s Hospital Medical Center, parative effects of divalent cations munology, Kimron Veterinary In- Boston, Massachusetts; 2Institute of (Mn+ + , M g++) and membrane-dis- stitute, Bet-Dagan, Israel: Suppres- Experimental Oncology, Bratis- ruptive agents (melittin, Sterox SL) sion of the humoral antibody re- lava, Czechoslovakia: Phenotypic on the reverse transcriptase activi- sponse associated with infection by mixing of VSV with human tumor ties of murine and avian retro- FeLV. cell proteins. viruses. Reeves, R.H., O’Brien, S.J., NCI, Wilson, M., Gautsch, J., Research In- Notani, G.W., Sauerbier, W., Dept, of Frederick Cancer Research Facil- stitute of Scripps Clinic, La Jolla, Genetics and Cell Biology, Univer- ity, Frederick, Maryland: Molecular California: Extent of methylation of I sity of Minnesota, St. Paul: Varia- characterization of endogenous fe- proviral and other genes in differ- tions in the LTR of REVs. line RD114 viral sequences. entiated and undifferentiated tera- Woodland, E.C., Horowit, T.S., Haapala, D .K .,1 Denniston, K.J.,1 tocarinoma cells. Shank, P.R., Division of Biology Robey, W.G.,' 1NCI, Frederick Bremont, M., d’Auriol, L., Cavalieri, and Medicine* Brown University, Cancer Research Facility, Freder- F., Emanoil-Ravicovitch, R., Per- Providence, Rhode Island: Highly ick, Maryland; 2Dept, of Microbi- ies, J., Dept. d’Oncologie Exp6ri- defective viral RNA and DNA mol- ology, Georgetown University, mentale, Institut de Recherches sur ecules in cells infected with trans- Washington, DC: Isolation and les Maladies du Sang, Hopital formation-defective RSV. characterization of an RD 114-like Saint-Louis, Paris, France: Methy- Brooks, B.R., Priester, E., Dept, of virus with a novel coat. lation and restriction of ecotropic Neurology and Medical Microbiol- Firzlaff, J., Diggelmann, H., Swiss MLV expression in cloned em- ogy, University of Wisconsin Med- Institute for Experimental Cancer bryonal carcinoma cells. ical School, and William S. Mid- Research, Lausanne, Switzerland: Bandyopadhyay, A.K., Liang, L.T., dleton Veterans Hospital, Madison: Glucocorticoids stimulate the rate Chang, K.S.S., NCI, National In- Virus-specific protein synthesis in of MMTV transcription in isolated stitutes of Health, Bethesda, Mary- murine neurotropic retrovirus-in- nuclei of transfected cells. land: DNA methylation affecting fected astrocytes in vitro. Ponta, H .,1 Groner, B .,1 Kennedy, N .,1 retrovirus expression in murine Mamoun, R.Z., Astier, T., Guille- Herrlich, P.,1 van Ooyen, A.,2 embryonal carcinoma and tropho- main, B., INSERM, Bordeaux, Scheidereit, C.,3 Beato, M.,3 Hynes, blast cells.

SESSION 8 Poster Session

Robert-Lezenes, J., Moreau-Gach- 1University of Virginia School of rus—Molecular analysis of these elin, F., INSERM Unit 248, Faculte Medicine, Charlottesville; 2Tufts recombinant MLVs. de Medecine Lariboisi&re-Saint University School of Medicine, Cooper, R.E., Scott, J.L., Pal, B.K., Louis, Paris, France: Expression of Boston, Massachusetts: Role of Dept, of Biological Sciences, Cali- SFFV env-gene-related sequences ecotropic viruses in the generation fornia State Polytechnic University, in normal mice. of recombinant leukemogenic re- Pomona: Wild mouse retrovirus-in- Tsichlis, P.N.,1 Strauss, P.G.,1 Kozak, troviruses of HRS mice. duced splenic lymphoma and B-cell C.,2 1NCI; 2NIAID, National Insti- Ou, C.Y.,1 Boone, L.R.,2 Boone, G.,1 differentiation. Yang, W.K.,1 1Biology Division, tutes of Health, Bethesda, Mary- Mirenda, C., Oliff, A., Memorial Oak Ridge National Laboratory, land: The MLVI-2 locus maps in Sloan-Kettering Cancer Center, Tennessee; 2National Institute of chromosome 15 in the mouse. New York, New York: Expression Environmental Health Sciences, Strauss, P.G., Tsichlis, P.N., NCI, of endogenous viral sequences ho- Research Triangle Park, North Car- National Institutes of Health, Be- mologous to the envelope gene of olina: A novel, mouse-specific, in- thesda, Maryland: Nature of DNA Friend MCF MLV in normal Swiss terdispersed, short, repetitive se- rearrangements in the MLVI-1 locus mouse tissues. quence found in the LTR of most in Mo-MLV-induced rat thymic MLV-related proviral sequences of Khan, A.S., Repaske, R., Martin, lymphomas. mouse genome. M.A., NIAID, National Institutes of Health, Bethesda, Maryland: En- Robey, W.G., Dekaban, G.A., Fis- Rassart, E., Sankar-Mistry, P., Joli- dogenous MLV segments isolated chinger, P.J., NCI, Frederick Can- coeur, R, Institut de Recherches from mouse chromosomal DNA cer Research Center, Frederick, Cliniques de Montreal, Universite contain nucleotide sequences Maryland: Isolation of newly gen- de Montreal, Canada: Selective unique to MCF MLVs. erated recombinant MLVs after in- growth in vivo and in vitro of fection with ecotropic MLV. C57BL/6 radiation-induced thy- Mark, G.E., Rapp, U.R., NCI, Fred- Thomas, C.Y.,1 Khiroya, R.,2 moma cells containing new eco- erick Cancer Research Facility, Schwartz, R.S.,2 Coffin, J.M.,2 tropic recombinant MLV provi­ Frederick, Maryland: Analysis of

185 the env gene of molecularly cloned RNA sequences in normal tissues of Blatt,C.,' Mileham, K.,' Nesbitt, MCF MLV recombinants isolated in DBA/2 and NZB mice. M.N.,' Haas, M.,3 Simon, M.I.,' vitro that are capable of transform-Kozak, C.A., Gromet, N.J., Buckler, 'Agouron Institute, La Jolla, Cali- ing cells in culture. C.E., Ikeda, N., NIAID, National fornia; 'Dept. of Biology, 'Cancer Johnson, D., Elder, J., Research Insti- Institutes of Health,Bethesda, Center, University of California, tute of Scripps Clinic, La Jolla, Maryland: A novel ecotropic enve- San Diego: Chromosomal mapping California: An antibody directed to lope-related sequence associated of the xenotropic env gene family in determinants of a Moloney-virus- with the Fv-4 locus. the mouse. derived MCF gp70 specifically rec- Jenkins, N.A., Copeland, N.G., Jack- Blam, S., Fry, K., Kaplan, H., Dept. ognizes an antigen on normal thy- son Laboratory, Bar Harbor, Maine: of Radiology, Stanford University mus cells. Instability of endogenous ecotropic School of Medicine, California: Friedrich, R.,' Koch, W,' Oliff, A.,2 proviruses of RF/J-derived hybrid Molecular cloning and characteris- 'Institute of Immunobiology, Uni- mice. tics of a xenotropic virus of the C57BL/Ka mouse strain. versity of Freiburg, Federal Repub-Ikeda, Odaka, T.,2 'NIAID, Na- lic of Germany; 'Memorial Sloan- tional Institutes of Health, Be- Astier, T., Rebeyrotte, N., Laigret, F., Kettering Cancer Center, New thesda, Maryland; 'Institute of Legrand, E., Guillemain, B., Du- York, New York: Analysis of the Medical Science, University of To- plan, J.F., INSERM, Bordeaux, env gene of a molecularly cloned kyo, Japan: A unique cell-surface France: B and T lymphomas with Friend MCFV. gp70 molecule is associated with the splenic localization induced by eco- DesGroseillers, L., Villemur, R., Fv-4' gene. tropic recombinant retroviruses isolated from the C57BL/6 mouse. Barrette, M., Jolicoeur, P., InstitutHutchinson, K.W., Copeland, N.G., de Recherches Cliniques de Mon- Jenkins, N.A., Jackson Laboratory, Lobel, L., Goff, S.P., Dept. of Bio- treal, Universite de Montreal, Can- Bar Harbor, Maine: Excision of chemistry, Columbia University, ada: Physical mapping of the "leuk" the DBA ecotropic provirus in di- College of Physicians and Sur- gene of three different leukemo- lute coat-color revertants occurs by geons, New York, New York: Con- genic MLVs. homologous recombination involv- struction and analysis of linker in- sertion mutants of Mo-MLV. Datta, S.K., Thomas, C.Y. Nick las, ing the viral LTRs. J.A., Coffin, J.M., Cancer Re- Horowitz, J.M., Risser, R., McArdle Lenz, J., Celander, D., Crowther, R., search Laboratories, Tufts Univer- Laboratory for Cancer Research, Patarca, R., Perkins, D., Sheldon, sity School of Medicine, Boston, University of Wisconsin, Madison: A., Trus, M., Haseltine, W, Dana- Massachusetts: The role of thymic Molecular cloning and biological Farber Cancer Institute, Harvard epithelium in leukemogenesis. analysis of the endogenous eco- Medical School, Boston, Massa- tropic provirus of BALB/c mice. chusetts: Nucleotide sequencing of Cloyd, M., Evans, L., NIAID, Na- the leukemogenic MLV, SL3-3, tional Institutes of Health, Rocky Horak, I., Wirth, T., Gloggler, K., shows striking changes relative to Baumruker, T., Schmidt, M., Insti- Mountain Laboratories, Hamilton, the nonleukemogenic virus, Akv, in Montana: Ecotropic viruses recom- Virology and Immunology, the LTR. bine with specific endogenous pro- University of Wdrzburg, Federal viralsequencesingenerating Republic of Germany: New familyLevy, D.,' Lerner, R.,2 Wilson, M.,2 MCFVs. of middlerepetitive DNA se- 'Division of Biology, California In- stitute of Technology, Pasadena; Buchhagen, D.L.,' Stockert, quences in the mouse genome with E.,2 structural features of solitary retro- 2Dept. of Immunology, Scripps 'Downstate Medical Center, State viral LTRs. Clinic and Research Foundation, University of New York, Brooklyn, Hojman-Montes de Oca, F., Lasneret, La Jolla, California: Endogenous New York; 'Memorial Sloan-Ket- retrovirus gene expression in virus- tering Cancer Center, New York, J., Canivet, M., Tobaly, J., Peries, negative mice. New York: Thymus DNAs from J., Emanoil-Ravicovitch, R., Insti- SMX-1-inoculated AKR mice lack tut de Recherches sur les MaladiesMesser L.I.,' Levin, LG.,' Currey, integrated recombinant proviruses. du Sang, Hopital Saint-Louis, Paris, K.M.,1 Gerwin, B.I.,2 'NICHD, 'National Institutes of Health, Be- Wejman, J.C., Taylor, B.A., Jenkins, France: Intracisternal A particles- Gene methylation and expression in thesda, Maryland:Sensitivity of N.A., Copeland, N.G., Jackson teratocarcinoma cell lines and re- MLV reverse transcription to tem- Laboratory, Bar Harbor, Maine: trovirus-transformed murine cells. plate secondary structure generates Concordant segregation of endoge- multiple intermediates. nous xenotropic MLV sequences Copeland, N.G.,' Hutchinson, K.W.,' and mouse lymphocyte antigens de- Bedigian, H.G.,' Thomas, C.Y.,2Schmidt, J.,'Erfle, V.,' Luz, A.,' tected by monoclonal antibodies. Jenkins, N.A.,' 'Jackson Labora- Rohmer, H.,' Pedersen, F.S.,2 Hehl- tory, Bar Harbor, Maine; 'Dept. mann, R.,' 'Abteilung fiir Patholo- Nexd, B.A.,' Jenkins, N.,2 Copeland, of Medicine, University of Virginia gic, Gesellschaft ffir Strhlenund N.,2 Ulrich, K.,' 'Fibiger Labora- Hospital, Charlottesville: Muta- Umweltforschung, Neu herberg , tory, Copenhagen, Denmark; tions within poorly expressed en- Federal Republic of Germany; 'Jackson Laboratory, Bar Harbor, dogenous ecotropic MLV genomes 'Dept. of Molecular Biology, Uni- Maine: Endogenous ecotropic MLV inhibit their expression. versityof Aarhus,Denmark; of DBA/2 mice - Activation and Connors, W, Vaidya, A.B., Dept. of 'Ludwig Maximilian Universitat, pathogenicity. Microbiology and Immunology, Munich, Federal Republic of Ger- Lee, Kaminchik, J.,2 Hankins, Hahnemann University, Philadel- many: Bone-tumor- and lymphoma- W.D.,2 'Dept. of Pathology, Uni- phia, Pennsylvania: Comparative inducing retroviruses in radiation- form Services University of the analysis of molecular clones of en- induced osteosarcomas. Health Sciences; 2NCI, National In- dogenous MMTV proviral unit IIGraham, D.E.,' Medina, D.,2 Smith, stitutes of Health, Bethesda, Mary- from the C57BL/6 and BALB/c G.H.,' 'NCI, National Institutes of land: Expression of xenotropic strains. Health, Bethesda, Maryland; 'Dept.

186 of Cell Biology, Baylor College of on MMTV expression and tumor- public of Germany: Retrovirus-re- Medicine, Houston, Texas: Malig- igenesis. lated antigens in human sera. Fur- nant transformation is linked to in- Fasel, N., Buetti, E., Pearson, K., ther characterization of a 70,000- creased amounts of an LTR-con- Firzlaff, J., Diggelmann, H., Swiss dalton protein in human sera that taining transcript in a mouse strain Institute for Experimental Cancer cross-reacts with SSAV p30 and defective for MMTV production. Research, Lausanne, Switzerland: BaEV. Etkind, P.R., Szabo, P., Sarkar, N.H., The same signals for initiation ofHowe, C.W.S., Tachibana, N., Lee, Memorial Sloan-Kettering Cancer transcription and RNA processing T.H., McLane, M.F., Essex, M., Center, New York, New York: are used in cells transfected with Dept. of Cancer Biology, Harvard Characterization of cloned subge- cloned MMTV DNA and in mam- School of Public Health, Boston, nomic MMTV proviral DNA unit mary tumor cells. Massachusetts: Coexistent immu- VII. Mullins, J.I.,' Rubsamen, H.,2 Wong- nosuppression and cytotoxic anti- Kettmann, R. , ' ,2Deschamps,J.,' Staal,F.,' Franchini, G.,' Gallo, bodies in patients with HTLV-re- Couez, D.,' Burney, 'Dept. R.C.,' 'Dept. of Cancer Biology, lated malignances. de Biologie Moleculaire, Universite Harvard School of Public Health, Nagy, K., Clapham, P., Weiss, R.A., Libre de Bruxelles; 2Chaire de Zo- Boston, Massachusetts; 'Paul-Ehr- Institute of Cancer Research, Ches- otechnie,Faculte des Sciences lich Institut, Frankfurt, Federal Re- ter Beatty Laboratories, London, Agronomiques de l'Etat, Gem- public of Germany; 'NCI, National England: HTLV- Receptors and bloux, Belgium: Is there a prefer- Institutes of Health, Bethesda, antibodiesto viralenvelope ential chromosome integration do- Maryland: Molecular cloning and antigens. main for the bovine leukemia pro- analysis of HTLV-UK proviral andChiu, I.M., Andersen, P., Callahan, flanking sequence DNAs. virus? R., Schlom, J., Tronick, S.R., Aar- Couez, D.,' Deschamps, J.,'Kett-Lee, T.H., Howe, C.W.S., McLane, onson, S.A., NCI, National Insti- mann, R.,',2 Burny, A.,',2 'Dept. de M.F., Tachibana, N., Essex, M., tutes of Health, Bethesda, Mary- Biologie, Moleculaire, Universite Dept. of Cancer Biology, Harvard land: SMRV - Molecular cloning Libre de Bruxelles; 2Faculte des University School of Public Health, and evolutionary relationships with Sciences Agronomiques de l'Etat, Boston, Massachusetts: HTLV-as- type-A, -B, and -C retroviruses. Bruxelles, Belgium: Nucleotide se- sociated membrane antigens recog-Callahan, R., Chiu, I.M., Tronick, S., quence analysis of the LTR of inte- nized by human serum antibodies. Aaronson, S., Schlom, J., NCI, Na- grated bovine leukemia proviralJosephs, S.F., Gallo, R.C., Wong- tional Institutes of Health, Be- DNA and of adjacent viral and host Staal, F., NCI, National Institutes of thesda, Maryland: The relationship sequences. Health, Bethesda, Maryland: HTLV and organization of type-A, -B, and Lee, W.T.-L., Etkind, P.R., Sarkar, LTR sequences-Detection of re- -D retrovirus-related sequences in N.H., Memorial Sloan-Kettering lated sequences in nonhuman ver- human recombinant DNA clones. Cancer Center, New York, New tebrate DNA. Shank, P.R.,' Schatz, P.J.,' Coffin, York: Amplification and hypometh- Popovic, M.,' Lange-Wantzin, G.,2 J.M.,2 Jensen, L.,' Robinson, H.L.,' ylation of mouse mammary tumor Sarin, R S., Michalski, M.,' Mann, 'Division of Biology and Medicine, proviruses in DBA/2 leukemia. D.,' Minowada, J.,' Gallo, R.C.,' BrownUniversity,Providence, Crepin, M.,' Lidereau, R.,2 Pouillart, 'NCI, National Institutes of Health, Rhode Island; 'Tufts University P.,' Magdelenat, H.,' Montagnier, Bethesda, Maryland; 'Dermatology School of Medicine, Boston, Mas- L.,' 'Institut Pasteur; 'Centre Rene Dept., Finsen Institute, Copen- sachusetts; 'Worchester Foundation Huguenin;'Institut Curie, Paris, hagen, Denmark; 'Veterans Admin- for Experimental Biology, Shrews- France: MMTV-related sequences istration Hospital, Hines, Illinois: bury, Massachusetts: Disease spec- in lymphocytes of humans with Neoplasmic transformation of hu- trum of in-vitro-created recombi- breast cancer. man T cells by HTLV. nant ALVs targeted towarddifferent Dekaban,G.A.,'Arthur,L.O.,'Haas, M., Altman, A.,' Rothenberg, diseases. Robey, W.G.,' Ball, J.K.,' Fischin- E.,' Eogart, M.,' Jones, 0.W.,' Halpern, W S.,'England,J.M.,' ger, P.J.,' 'NCI, Frederick Cancer 'Universityof California,San Decry, D.T.,' Petcu, D.J.,' Mason, ResearchFacility, Frederick, Diego; 'Scripps Clinic, La Jolla; W.S.,2Molnar-Kimber,K.L.,' Maryland; 'Dept. of Biochemistry, 'Division of Biology, California In- 'Wistar Institute of Anatomy and University of Ontario, London, stitute of Technology, Pasadena: Biology; 'Institute for Cancer Re- Canada: Characterization of the env Transformation of factor-depen- search, Philadelphia, Pennsylvania: gene products of a highly leukemo- dent T lymphoblastoma cells to au- Synthesis of duck hepatitis-B virus genic retrovirus - Determination of tonomous T lymphoma cells. nucleic acids and antigen accumu- the leukemogenic potential for aGelmann, E.,Popovic, M., Fran- lation in tissues of infected ducks. type-B retrovirus. chini, G., Cetta, A., Wong-Staal, F, Mark, G.E., Schultz, A., Goldsbor- Ball, J.K.,' Dekaban, G.A.,' 'Dept. of Gallo, R.C., NCI, National Insti- ough, M.D., Rapp, U.R., NCI, Biochemistry, University of West- tutes of Health, Bethesda, Mary- Frederick Cancer Research Facil- ern Ontario, London, Canada; land: A new human retrovirus as- ity, Frederick, Maryland: Nucleo- 'Frederick Cancer Research Facil- sociated with a T-cell hairy cell leu- tide sequence and expression of v- ity, Frederick, Maryland: Specific- kemia. Cloning and characteriza- raf, the oncogene of 3611-MSV. ity of integration of MMTV in vi- tion of HTLV-II.o. rus-induced primary thymic lym-Hehlmann, R.,' Schetters, H.,' Hof- phomas. herr, H.,2 Erfle, V,' 'Medisch Po- Vaidya, A.B., Long, C.A., Dept. of liklinik der Universitat Munchen; Microbiology and Immunology, 'Abteilung fiir Pathologic, Gesell- Hahnemann University, Philadel- schaft fur Strahlenund Unweltfor- phia, Pennsylvania: Genetic studies schung, Neuherberg, Federal Re-

187 SESSION 9Oncogenes Chairperson:J. Coffin, Tufts University School of Medicine, Boston, Massachusetts

Hoffmann, F.M.,' Fresco, L.D.,' ter, Seattle, Washington: Charac- Bethesda, Maryland; 'Life Sciences Hoffman-Falk, H.,' Shilo, B.Z.,' terization and cloning of oncogenes Institute, Hebrew University, Jeru- 'Cell and Developmental Biology, of the frog X. laevis. Harvard University, Cambridge, salem, Israel: Flat revertants from Ruta, M.,' Wolford, R.,' Dhar, R.,' Ki-MSV-transformed NIH-3T3 Massachusetts; 'Dept. of Virology, Ellis,R.,' cells -Fusion studies indicate pos- Weizmann Institute, Rehovot, Is- Scolnick,E.M.,' 'Laboratory of Tumor Virus Ge- sible functional relationships among rael: Nucleotide sequence compar- netics; 'Laboratory of Molecular retroviral oncogenes. ison of v-abl and v-src to the Dro- Virology, National Institutes of sophila oncogenes Dash and Dsrc. Samarut, J.,' Mathey-Prevot, B.,' Health, Bethesda, Maryland; Hanafusa, H.,' 'Universite Claude DeFeo, D., Papageorge, A., Stokes, 'Merck Sharp and Dohme, West P., Temeles, G., Scolnick, E.M., Bernard Lyon-I, Lyon, France; Point, Pennsylvania: Comparison of 'Rockefeller University, New York, Merck Sharp and Dohme Research the nucleotide sequences of c -ras " - New York: Preferential expression Laboratories, West Point, Pennsyl- 1, c- ras " -2, and v-ras". of NCP98 in chicken cells of the vania: ras-related gene sequences granulocytic cell lineage. and ras-related gene products are Keshet, E.,Itin,A., Rotman, G., present in S. cerevisiae. Asher, A., Dept. of Virology, He-Waneck, G., Rosenberg, N., Cancer brew University-Hadassah Medical Research Center, Tufts University Hammond, C.I., Bishop, J.M., Dept. School, Jerusalem, Israel: Murine School of Medicine, Boston, Mas- of Microbiology and Immunology, viruslike (VL30) DNA- Sequence sachusetts: Abelson- and Harvey- University of California, San Fran- analysis of the LTR and adjacent virus-induced modulation of eryth- cisco: Analysis of DNA and RNA DNA, and apparent recombinants ropoiesis. homologous to fps in S. cerevisiae. with MLV-related proviruses. Ihle, J.N., Scott, A., Gilbert, D., Pa- Simon,M.A.,'Kornberg,T.B.,' Goldsborough, M.D., Mark, G.E., laszynski, E., NCI, Frederick Can- Bishop, J.M.,' 'Dept. of Biochem- Bonner,T.I., Rapp, U.R., NCI, cer Research Facility, Frederick, istry and Biophysics; 'Dept. of Mi- Frederick Cancer Research Facil- Maryland: Mo-MLV-induced inter- crobiology and Immunology, Uni- ity, Frederick, Maryland: Structure leukin-3-dependent lymphomas in versity of California, San Fran- and biological activity of v-raf- A BALB/c mice. cisco: The cellular src gene of D. new oncogene transduced by retro- melanogaster. virus. Ralston R., Bishop, J.M., Dept. of Microbiology, University of Cali- Steele, R.E., Reeder, R.H., Fred Noda, M.,' Selinger, Z.,' Bassin, R.,' fornia, San Francisco: Evolution- Hutchinson Cancer Research Cen- 'NCI, National Institutes of Health, ary relationships among oncogenes.

SESSION 10 Oncogene Activation Chairperson:G. Vande Woude, National Institutes of Health, Bethesda, Maryland

Parada, L.F., Land, H., Dautry, E, Blair, D.,' Woodworth, A.,' Oskars- ter Beatty Laboratories, London, Cunningham, J.M., Murray, M.J., son, M.,' McGeady, M.,' Tainsky, England: Activated ras genes in hu- Weinberg, R.A., Center for Cancer M.,' Vande Woude, G.,' 'Frederick man and mouse tumors. Research, Massachusetts Institute Cancer Research Facility, Freder- of Technology; Whitehead Institute ick; 'NCI, National Institutes ofYuasa, Y., Srivastava, S.K., Rhim, for Biomedical Research, Cam- Health, Bethesda, Maryland: Bio- IS., Reddy, E.R, Aaronson, S.A., bridge: N-ras and 3MC-Ki-ras - logical properties of the human NCI, National Institutes of Health, Two cellular oncogenes that are ac- DNA sequence homologous to the Bethesda, Maryland: Isolation from tivated in a variety of tissues. v-mos transforming gene of Mo- a human lung carcinoma-derived Shimizu, K., Taparowsky, E., Fa- MSV. cell line of a bas/has oncogene whose site of activation differs from sano, 0., Suard, Y., Birnbaum, D., Dreazen, 0., Horowitz, M., Cohen, Goldfarb, M., Wigler, M., Cold that of T24 and EJ bladder carci- J., Rechavi, G., Givol, D., Canaani, noma oncogenes. Spring Harbor Laboratory, New E., Dept. of Chemical Immunol- York: Structure and mutational ac- ogy, Weizmann Institute of Science, Moroni, C.,' Senn, H.-P.,' Gambke, tivation of three human ras genes. Rehovot, Israel: Viral A-particle-re- C.,''Friedrich Miescher-Institut; Parker, R.C., Varmus, H.E., Bishop, lated sequences are associated with 'Research Dept., Ciba-Geigy Ltd., J.M., Dept. of Microbiology and the activation of a cellular oncogene Basel, Switzerland: Identification Immunology, University of Califor- (c-mos) in a murine plasmacytoma. and characterization of an onco- nia, San Francisco: High levels ofGol, R., Eva, A., Yuasa, Y., Kraus, gene from fresh bone marrow from pp60r'c do not morphologically M., Needleman, S., Tronick, S., a patient with AML. transform Rat-2 cells-Lower lev- Aaronson, S., NCI, National Insti-Sodroski, J., Haseltine, W, Dana-Far- els of v-src are adequate for tutes of Health, Bethesda, Mary- ber Cancer Institute, Harvard Med- transformation. land: Isolation and characterization ical School, Boston, Massachu- Wood, T., Blair, D., McGeady, M., of the normal human homolog of setts: Activation of the human c-fes Baroudy,B., Vande Woude, G., the neuroblastoma oncogene- Fre- locus by recombination with FeSV NCI, National Institutes of Health, quent activation of closely related sequences. Bethesda, Maryland: The normal oncogenesindiversehuman tumors. Shalloway, D.,' Coussens, P.M.,' Ya- mouse DNA sequences preceding c- ciuk, R,' Zelenetz, A.D.,' 'Dept. of mos can prevent activation of theMarshall, C.J., Hall, A., Vousden, K., Biochemistry, Molecular Biology, transforming potential of c-mos. Institute of Cancer Research, Ches- Molecular and Cell Biology, Penn-

188 sylvania State University, Univer- 'Dept. of Microbiology, University sity of Pennsylvania School of of California, San Francisco; 'Dept. Medicine, Philadelphia: Amplifi- sity Park; 'Sidney Farber Cancer cation of c-myc and c-myb onco- Institute, Boston, Massachusetts: c- of Human Genetics, University of Pennsylvania, Philadelphia: Dou- genes in human colon carcinoma src overexpression causes enhanced cells-Relationship with chromo- in vivo tyrosine phosphorylation but ble minute chromosomes (DMs) somal abnormalities. not neoplastic transformation. and a homogeneously staining chro- mosomal region (HSR) contain an Schwab, M., Alitalo, K., Varmus, Mushinski, J.F., Bauer, S.R., Potter, amplifiedandabundantlyex- M., Reddy, E.P., NCI, National In- H.E, Bishop, J.M., Dept. of Micro- pressed cellular oncogene (c-Ki- biology, University of California, stitutes of Health, Bethesda, Mary- San Francisco: Molecular rear- ras) in mouse adrenocortical tumor land:Expression and rearrange- rangements in the 5'-flanking re- cells. ment of c-myb locus in lympho- gion of an amplified c-myc onco- sarcomas arising in pristane-treated Alitalo, K.,' Lin, C.C.,' George, D.,' mice infected with Abelson MLV. gene in the human colon carcinoma Schwab,M.,'Varmus,H.E.,' cell line COLO 320 result in altered Bishop, J.M.,"Dept. of Micro- c-myc transcripts. biology and Immunology, Univer- Schwab, M.,' Alitalo, K.,' Varmus, sity of California, San Francisco; H.E.,' Bishop, J.M.,' George, D.,' 'Dept. of Human Genetics, Univer-

SESSION 11Vectors/Transforming Viruses Chairperson:A. Skalka, Roche Institute, Nutley, New Jersey of Health, Bethesda, Maryland; Emerman, M., Bandyopadhyay,P., ogy and Virology Laboratory, Salk Panganiban, A., Tarpley, G., Watan- Institute, San Diego, California: 'Merck Sharp and Dohme Research Laboratories, West Point, Pennsyl- abe, S., Temin, H.M., McArdle Organization of the fos gene- FBR murine osteosarcoma virus encodes vania: Unique carboxyl terminus of Laboratory for Cancer Research, SFFV gp52 is encoded by envelope University of Wisconsin, Madison: a gag-fos fusion protein. Infectious retroviral vectors that sequences that contain both a large Lipsick, J., Boyle, W, Lampert, M., deletion and insertions. express foreign DNA. Dvorak, M., Baluda, M., Dept. of Cone, R., Cepko, C., Mann, R., Bal- Pathology, University of CaliforniaClark, S.R, Mak, T.W., Ontario Can- School of Medicine, Los Angeles: cer Institute, Toronto, Canada: timore, D., Mulligan, R., Center for Complete nucleotide sequence of Cancer Research, Massachusetts The product of the AMV oncogene of Technology, Cam- and its normal cellular homolog. Friend SFFV -gp55 is an envelope Institute fusion glycoprotein. bridge:Constructionofhighly Klempnauer, K.-H.,' McGrath, J.P.,' transmissible mammalian cloning Benedict, S.H.,' Beug, H.,' Graf, T.,' Levinson, A.D.,' Bishop, J.M.,' P.K.,' vectorsderivedfrommurine 'Dept. of Microbiology, University Wallbank, A.M.,' Vogt, retroviruses. California,SanFrancisco; 'Dept. of Microbiology, University of of Southern California School of Cepko, C.L., Mulligan, R.C., Center 'Genentech, Inc., South San Fran- cisco, California: Identification of Medicine, Los Angeles; 2Deutsches for Cancer Research, Massachusetts Institut the proteins encoded by v-myb and Krebsforschungszentrum, Instituteof Technology, Cam- fiir Virusforschung, Heidelberg, bridge: Rescue of Mo-MLV-derived c-myb. Federal Republic of Germany; recombinant genomes as bacterial Schiff-Maker, L.,' Ponticelli, A.S.,' 'Dept. of Medical Microbiology, plasmids. Witte,0.N.,2 Rosenberg,N.,' University of Manitoba, Winnepeg, Joyner, A., Keller, G., Phillips, R., 'Cancer Research Center, Tufts Canada: The properties of S13 Bernstein, A., Ontario Cancer In- University School of Medicine, avian sarcoma and erythroleukosis stitute, Toronto, Canada: Retrovi- Boston, Massachusetts; 'Molecular virus. rus-mediated transduction of nor- Biology Institute, University of mal bone-marrow progenitor cells California: Los Angeles: Expres- to neomycin resistance. sion of v-abl and c-abl. Van Beveren, C., Curran, T., Enami, Wolff,L.,'Scolnick,E.,'Rus- S., Verma, I.M., Molecular Biol- cetti, S.,' 'NCI, National Institutes

SESSION 12Genetics of Retroviral Diseases Chairperson: H. Robinson, Worcester Institute for ExperimentalBiology, Shrewsbury, Massachusetts characteristicofALV-induced with recombinant retrovirus con- Robinson, H.,' Eisenman, R.,' 'Wor- taining the Eco gpt gene. cester Institute for Experimental osteopetrosis. Biology, Shrewsbury, Massachu- Stuhlmann, H.,' Milner, D.,' Mulli-Schnieke, A., Harbers, K., Jaenisch, setts; 'Fred Hutchinson Cancer gan, R.,' Jaenisch, R.,' 'Heinrich- R., Heinrich-Pette-Institut fiir Ex- Center, Seattle, Washington: New Pette-Institut fiir Experimentelle perimentelle Virologie und Immu- findings on the congenital trans- Virologie und Immunologic an der nologic an der Universitat Ham- mission of ALVs. Universitat Hamburg, Federal Re- burg, Federal Republic of Germany: public of Germany; 'Center for Retroviruses and insertion mutagen- Robinson, H., Miles, B., Worcester esis -Germ-line integration iden- Foundation for Experimental Biol- Cancer Research, Massachusetts tifies the gene essential for mouse ogy, Shrewsbury, Massachusetts: Instituteof Technology, Cam- Unintegrated proviral DNA is a bridge: Infection of mouse embryos embryogenesis.

189 Robinson, D.R.,' Luciw, P.A.,' Crit- Maryland: A role for the 3' end of Lenz, J., Celander, D., Crowther, R., tenden, L.B.,' Kung, H.-J.,' 'Dept. the genome in determining disease Patarca, R., Perkins, D., Sheldon, of Biochemistry, Michigan State specificity of Fr-MLV and Mo- A., Trus, M., Haseltine, W, Dana- University, East Lansing; 'Chiron MLV. Farber Cancer Institute, Harvard Medical School, Boston, Massa- Corp.,Emeryville,California; Silver,J.,' Fredrickson, T.,2 Rowe, 'USDA Regional Poultry Research W.,' 'Laboratory of Viral Diseases, chusets: Localization of the leuke- Laboratory, East Lansing, Michi- National Institutes of Health, Be- mogenic determinants of SL3-3. gan: "Enhancer" sequences are re- thesda, Maryland; 'Dept. of Pathol- quired for in vivo tumor induction DesGroseillers, L., Rassart, E., Joli- ogy,University of Connecticut, P.,Institut de Recherches by injection of cloned v-src DNAs. coeur, Storrs: Mouse genes control the Cliniques de Montreal, Universite Rein, A.,' Oliff, A.,2 'NCI, Frederick type of leukemia induced by Fr- de Montreal, Canada: The thymo- Cancer Research Facility, Freder- MLV. tropism of MLV is conferred by its ick, Maryland; 'Sloan-Kettering Holland, C.A.,' Hartley, J.W.,2 Rowe, LTR. Research Institute, New York, New W.P.,2 Hopkins, N.H.,' 'Center for York: Studies on MLV receptor Cancer Research, MassachusettsBaba, T.W., Humphries, E.H., Dept. specificity in NIH-3T3 cells. Instituteof Technology, Cam- of Microbiology, University of Chatis, RA.,' Holland, C.A.,' Har- bridge;'NationalInstitutesof Texas Health Science Center, Dal- tley, J.W.,2 Rowe, W.P.,2 Hopkins, Health, Bethesda, Maryland: Leu- las: Quantitative difference of hy- N.,' 'Massachusetts Institute of kemogenicity of in vitro recombi- perplasia in chickens susceptible Technology, Cambridge; 'National nants between molecule clones of and resistant to lymphomas induced Institutes of Health,Bethesda, Akv and MCF 247 viruses. by ALV.

THE MOLECULAR BIOLOGY OF YEAST August 16-August 21

SESSION 1Cell Cycle, Cell Structure, and Chromosome Stability Chairperson:J. Pringle, University of Michigan, Ann Arbor, Michigan Adams, A.E.M., Jacobs, C.W., Prin- University, Japan: Roles of cAMP Dept. of Biology, Massachusetts gle, J.R., Division of Biological in mitosis and meiosis of S. cere- Instituteof Technology, Cam- Sciences, University of Michigan, visiae. bridge: Isolation of trifluoperazine- Ann Arbor: Fluorescence localiza-Shuster, E.O., Byers, B., Dept. of Ge- resistant yeast mutants. tion of actin and tubulin in wild-type, netics, University of Washington,Huberman, J.A., El Assouli, S., Po- mutant, and inhibitor-treated Sac- Seattle: Meiotic analysis of the tashkin, J.A. Saavedra, R.A., Spo- charomyces. "start" class of cdc mutations. tila, L.D., Dept. of Cell and Tumor Katz, M.E., Reed, S.I., Dept. of Bi- Novick, P.,' Shortie, D.,2 Osmond, Biology, Roswell Park Memorial ological Sciences, University of B.,' Grisafi,P.,'Botstein, D.,' Institute, Buffalo, New York: Initi- California, Santa Barbara: Isola- 'Dept. of Biology, Massachusetts ation of DNA replication in yeast tion and characterization of sup- Instituteof Technology, Cam- cells. pressors of ste mutations. bridge; 'Dept. of Microbiology, Wagner, D.W., Wood, J.S., Hartwell, Singer, R.A., Johnston, G.C., Faculty State University of New York, Stony Brook: Genetic analysis of actin and L.H., Dept. of Genetics, University of Medicine, Dalhousie University, of Washington, Seattle:Identi- Halifax, Nova Scotia, Canada: The interacting proteins. fying genes involved in chromo- G, cell-cycle interval is shortenedThomas, J.H., Botstein, D., Dept. of somal structures important for rep- by differentially slowing the DNA- Biology, Massachusetts Institute of lication and segregation. division sequence or increasing Technology, Cambridge: Pheno- growth capacity. typic and genetic analysis of mu-Hieter,P., Mann, C., Snyder M., Uno, I.,' Matsumoto, K.,2 Ishikawa, tants in the gene encoding 0-tubulin Davis, R.W., Dept. of Biochemis- T.,' 'Institute of Applied Microbi- (TUB2). try, Stanford University School of ology, University of Tokyo, 'Dept.Neff, N., Botstein, D., Solomon, F., Medicine, California: Functions in- of Industrial Chemistry, Tottori Center for Cancer Research and volved in chromosome stability.

SESSION 2 DNA Replication and Chromosome Structure Chairperson:C.S. Newlon, University of Iowa, Iowa City, Iowa Sclafani, R.A., Wagner, D.'W., Fang- DNA sequences and proteins im-Maine, G., Sinha, P., Tye, B.-K., Sec- man, W.L., Dept. of Genetics, Uni- portant for yeast replication using tion of Biochemistry, Molecular and versity of Washington, Seattle: Ge- in vitro replication systems. Cell Biology, Cornell University, netics of DNA replication in yeast Makkuni, J., Wu, L.,Li,Y.-Y., Ithaca, New York: Mutants of S. CDC7- and CDC8-gene products. Broach, J.R., Dept. of Microbiol- cerevisiae defective in the mainte- nance of minichromosomes. Campbell, J.L., Kuo, C.-I., Celniker, ogy, State University of New York, S.E., Dept. of Chemistry, Caltech, Stony Brook: Control of 2u circleNewlon, C.S., Lipchitz, L.R., Dept. Pasadena, California: Analysis of replication. of Zoology, University of Iowa,

190 Iowa City: Cloning, mapping, and School, Boston, Massachusetts: DiNardo, S., Voelkel, K.A., Stern- localization of ARSs on a circular Structure and function of telomeres glanz, R., Dept. of Bochemistry, in yeast. State University of New York, Stony derivative of yeast chromosome III. Brook: Mutation in the gene coding Clarke, L., Carbon, J., Dept. of Bio- Scott, J., Long, C., Woontner, M., for S. cerevisiae DNA topoisomer- logical Sciences, University of Cal- Strich, R., Dept. of Microbiology, ase II affects termination of DNA ifornia, Santa Barbara: Genomic University of Illinois,Urbana: replication. Structure of ARSI chromatin and substitutions of centromeres in S. cerevisiae. Jazwinski,S.M., Edelman, G.M., functional domains of its DNA Rockefeller University, New York, sequence. Dani, G.M., Zakian, V.A., Fred New York: Evidence for the in- Szostak, J.W., Claus, T.E., Murray, Hutchinson Cancer Research Cen- volvement of a multiprotein com- A.W., Dunn, B., Dana-Farber Can- ter, Seattle, Washington: Behavior and ARSI DNA of linear centromere plasmids in plexin2u cer Institute and Dept. of Biologi- replication. cal Chemistry, Harvard Medical meiosis.

SESSION 3 Poster Session Percival-Smith, A., Segall, J., Dept. CDC and Cell Structure istry and Molecular Biology Sec- tion, Dept. of Biological Sciences, of Biochemistry, University of To- Basson, M., Barnes, G., Rine, J., University of California, Santa ronto, Ontario, Canada: Identifica- Dept. of Biochemistry, University Barbara: Genetic and molecular tion of sporulation genes of S. cere- of California, Berkeley: Studies of visiae. gene controlling the activity of analysis of the cell cycle control HMG-CoA reductase in S.cere- gene CDC28. visiae. Hiraoka, Y., Yanagida, M., Dept. of Biophysics, Faculty of Science,DNA Replication and Chromosome Casperson, G.F., Walker, N., Brasier, Kyoto University, Japan: MovementStructure A.R., Bourne, H.R., Dept. of Phar- of mitotic chromosomes in the fis- Amin, A.A., Pearlman, R.E., Dept. macology and CVRI, University of sion yeast S. pombe. ofBiology,YorkUniversity, California, San Francisco: Adenyl- Downsview, Ontario, Canada: ARS ate cyclase in the yeast S. cerevisiae. Soll, D.R., Herman, M.A., Ander- regions from rDNA of T ther- son, J.M., Dept. of Zoology, Uni- Matsumoto, K.,' Uno, I.,' Ishikawa, versity of Iowa, Iowa City: Use of mophila. T.,2 'Dept. of Industrial Chemistry, a perfusion chamber to analyze Bloom, K., Yeh, E., Dept. of Biol- Tottori University; 'Institute of Ap- budding characteristics of S. cere- ogy, University of North Carolina, plied Microbiology, University of visiae. Chapel Hill: Topology of yeast cen- Tokyo, Japan: Identification of the tromere DNA. structural gene and nonsense alleles Elder, R., Easton Esposito, R., Dept. Yeh, E.,12 Carbon, J.,. Bloom, K.,' for adenylate cyclase in S.cere- of Biology, University of Chicago, 'Dept. of Biological Sciences, Uni- visiae. Illinois: Cloning of the SP012 gene-A gene necessary for the versity of California, Santa Bar- Coleman, K.G., Lillie, S.H., Jacobs, bara; 'Dept. of Biology, University C.W., Robinson, J.S., Haarer, B., meiosis-I division. of North Carolina, Chapel Hill: Stapleton, A.E., Pringle, J.R., Di- Giroux, C.N., National Institute of RNA transcripts from the centro- vision of Biological Sciences, Uni- Environmental Health Sciences, mere region of chromosomes III versity of Michigan, Ann Arbor: Research Triangle Park, North Car- and XI in yeast. Formal and molecular genetic anal- olina: Selective system for isolating Karns, L.R., Smith, M.M., Dept. of ysis of cellular morphogenesis in meiosis-specific genes-Cloning of Microbiology, University of Vir- Saccharomyces. a spoil -1 complementing function. ginia School of Medicine, Char- Yochem, J., Byers, B., Dept. of Ge- Ninfa, E.G., Kaback, D.B., Dept. of lottesville: Analysis of the regula- netics, University of Washington, Microbiology, UMDNJ-New Jersey tion of expression of yeast histone- Seattle: Molecular analysis of two Medical School, Newark: Isolation /3-galactosidase gene fusions. G,- arrest CDC mutants. of DNA sequences complementary Bouton, A.,Stirling,V.,Smith, Chlebowicz-Sledziewska, E., Brewer, to sporulation-specific transcripts. M.M., Dept. of Microbiology, Uni- B.J., Fangman, W.L., Dept. of Ge- Magee, RT.,. Clancy, Mi.,' Primer- versity of Virginia, Charlottesville: netics, University of Washington, ano, D.,' 'Dept. of Microbiology, Characterization of an ARS closely Seattle: Unequal mother/daughter Michigan State University, East linked to one copy of the histone cell cycle phase lengths in yeast. Lansing; 'Dept. of Microbiology, H3-H4 genes in S. cerevisiae. Okamoto, S., Laboratory of Molecu- Notre Dame University,South Cross, S.L., Smith, M.M., Dept. of lar Genetics, Institute of Medical Bend, Indiana: Transcriptional con- Microbiology, University of Vir- Science, University of Tokyo, Ja- trol of mutant phenotype of genes ginia, Charlottesville: Transcrip- pan:Isolationofmethyl-benz- involved in sporulation in S. cere- tion of the yeast genes for histones imidazole-2-yl-carbamate-resistant visiae. H3 and H4. mutants and cloning of a MBC' gene Clancy, M.,' Pugh, T.,' Lehman, D.,2 Mittman, B.A., Smith, M.M., Dept. in S. cerevisiae. Magee, P.T.,2 'Dept. of Microbiol- of Microbiology, University of Vir- Peterson, T., Reed, S., Dept. of Bio- ogy, Notre Dame University, South ginia, Charlottesville: Expression logical Sciences, University of Cal- Bend, Indiana; 'Dept. of Microbi- of the histone H4 gene and gene ifornia, Santa Barbara: CDC9 tran- ology and Public Health, Michigan mutants constructed in vitro. scription is cell-cycle-regulated. State University, East Lansing: Program of gene expression during Hsiao, C.L., Jonak, G.J., E.I. du Pont Lorincz, A.T., Cheetham, B.F., Rich- de Nemours and Company, Experi- ardson, S.M., Reed, S.I., Biochem- sporulation in S. cerevisiae.

191 mental Station, Central Research 2u DNA can provide ARS function Bachmair, A., Fessl, F., Mattes E., and Development Dept., Wilming- for centromere and linear plasmids. Ruis, H., Institut fiir Allgemeine ton, Delaware: Effect of yeast cen- Pluta,A.F.,Dani, G.M., Zakian, Biochemie der Universitat Wien and tromeric DNA on pSV2neo vector LudwigBoltzmann-Forschungs- in monkey cells. V.A., Fred Hutchinson Cancer Re- search Center, Seattle, Washington: stelle fiir Biochemie, Vienna, Aus- Thrash, C., Voelkel, K.A., DiNardo, Ends from 0. fallax macronuclear tria: Isolation of minichromatin S., Sternglanz, R., Dept. of Bio- DNA can provide telomere func- from yeast cells transformed with chemistry, State University of New tion in yeast. plasmids derived from 2u DNA. York, Stony Brook: Identification of McMahon, M.E., Petes, T.D., Dept.Fasullo, M.T., Davis, R.W., Dept. of S. cerevisiae DNA topoisomerase I of Microbiology, University of Chi- Biochemistry, Stanford University mutants. cago, Illinois: A novel yeast IS School of Medicine, California: Williams, S.J., Shaw, W.V., Dept. of rRNA gene at the junction of rDNA Method for choosing the type and Biochemistry, University of Leices- withsingle-copychromosomal locationofchromosomerear- ter, England: Replication of staph- DNA. rangements. ylococcal plasmid DNA in yeast. Goebl, M.G., Petes, T.D., Dept. ofGrunstein, M., Rykowski, M., Wal- Koshland, D., Hartwell, L., Dept. of Microbiology, University of Chi- lis, J., Molecular Biology Institute, Genetics, University of Washing- cago, Illinois: Isolation and char- UniversityofCalifornia,Los ton, Seattle: Fidelity of minichro- acterization of poly(dA)-poly(dT) Angeles: Genetic evidence suggest- mosome transmission. sequences in the yeast S. cerevisiae. ing functional differences between Gaudet, A.,Fitzgerald-Hayes, M., the amino and carboxyl termini of Walmsley, R.W.,' Chan, C.,' Tye, B.,2 yeast histone H2B. Dept. of Biochemistry, University Peters, T.D.,' 'Dept. of Microbiol- of Massachusetts, Amherst: Inves- ogy, University of Chicago, Illi-Holm, C., Botstein, D., Dept. of Bi- tigation of the DNA sequence or- nois; 'Section of Biochemistry, ology, Massachusetts Institute of ganization required for mitotic seg- Cornell University, Ithaca, New Technology, Cambridge: Analysis regation of centromere plasmids. York: Poly(GT) tracts in the yeast of the functional region of ars' by Schmitt, E., Olson, M.V, Dept. of genome. in vitro mutagenesis. Genetics,WashingtonUniversityVincent, A., Petes, T.D., Dept. of Mi- Chan, C.S.M.,' Walmsley, R.M.,2 Pe- School of Medicine, St. Louis, crobiology, University of Chicago, tes, T.D.,' Tye, B.-K.,' 'Dept. of Missouri: Use of SUP4-CEN3 plas- Illinois:Repeatedsequencesin Biochemistry, Molecular and Cell mids as genetic tools. yeast-A Ty element associated Biology, Cornell University, Ithaca, Helms, C., Graham, M.Y., Brodeur, with an rDNA sequence. New York; 'Dept. of Microbiology, G.M., Scheinman, R., Olson, M.V., University of Chicago, Illinois: Or- Dept. of Genetics, Washington Uni-Potashkin, J.A.,' Ziegel, R.,' Huber- ganization of DNA sequences and man, J.A.,' 'Dept. of Cell and Tu- versity School of Medicine,St. ARSs at yeast telomeres. mor Biology;'BiophysicsRe- Louis, Missouri: Physical mapping Surosky, T., Tye, B.-K., Section of of yeast chromosomal DNA. Institute, Buffalo, New York: Iso- Biochemistry, Molecular and Cell Dunn, B., Szostak, J.W., Dana-Farber lation and characterization of yeast Biology, Cornell University, Ithaca, Cancer Institute and Dept. of Bio- nuclear matrices. New York: Construction of chro- logical Chemistry, Harvard Medi- mosomes in vivo. Saavedra, R.A., Huberman, J.A., cal School, Boston, Massachusetts: Murakami, S.,' Chan, C.S.M.,2 Tye, Evidence for interaction between Dept. of Cell and Tumor Biology, Roswell Park Memorial Institute, B.-K.,' Livingston, D.M.,' 'Cancer linear plasmids and the ends of Research Institute, Kanazawa Uni- yeast chromosomes. Buffalo, New York: Yeast 2u plas- mid DNA undergoes alterations in versity, Japan; 'Dept. of Biochem- Murray, A.W,12 Szostak, J.W.,.' topology and in tightly bound pro- istry, Molecular and Cell Biology, 'Dana-Farber CancerInstitute; teins as cells enter S phase. Cornell University, Ithaca, New 'Program in Cell and Develop- York; 'Dept. of Biochemistry, Uni- mental Biology; 'Dept. of Biologi- Spotila, L.D., Huberman, J.A., Dept. versityof Minnesota Medical cal Chemistry, Harvard Medical of Cell and Tumor Biology, Roswell School, Minneapolis: Nuclease-hy- School, Boston, Massachusetts: Park Memorial Institute, Buffalo, persensitivesites of chromatin Construction and properties of ar- New York: General method for structure around autonomous repli- tificial linear chromosomes. mapping replication origins. cating segments of S. cerevisiae. Strich, R., Scott, J., Dept. of Micro- Walmsley,R.,'Johnston,L.H.,2Fagrelius, T.J., Livingston, D.M., biology, University of Illinois, Ur- Oliver, S.G.,' Fennell, D.J.,' Mc- Dept. of Biochemistry, University bana:Insertion mutagenesis and Cready,S.,'Williamson,D.H.,' of Minnesota, Minneapolis: Loca- 'University of Manchester Institute subclones of ARS1. tionofDNase-I-hypersensitive of Science and Technology; 'Na- cleavage sites in 2u plasmid DNA Woontner, M., Scott, J., Dept. of Mi- tionalInstitute for Medical Re- chromosomes. crobiology, University of Illinois, search,London;'BotanySchool, Urbana: Deletion analysis of ARS1 University of Oxford, England: Rep-Kim, K.E., Newlon, C.S., Dept. of in TRP1 RI Circle. licon organization of rDNA in S. Zoology, University of Iowa, Iowa Conrad, M.N., Zakian, V.A., Fred cerevisiae. City: Telomeric sequences in a li- Hutchinson Cancer Research Cen-Panzeri, L.,' Groth-Clausen, I.,2 Al- brary constructed from alkaline- denatured DNA. ter, Seattle, Washington: Associa- tenburger, W.,' Philippsen,P.,' tion of nascent DNA with the yeast 'Instituto di Genetica, University di Montiel, F.J., Norbury, C.J., Tuite, nuclear matrix. Milano, Italy; 'Dept. of Microbiol- M.E, Dobson, M.J., Mills, J.S., Dani, G.M., Hager, L.J., Zakian, ogy, Biozentrum, University of Cook,P.R.,Kingsman,A.J., V.A., Fred Hutchinson Cancer Re- Basel, Switzerland: DNA in the Kingsman, S.M., Dept. of Bio- search Center, Seattle, Washington: centromere of chromosome VI. chemistry, Oxford, England: Char-

192 acterization of human chromo- School, Boston, Massachusetts; University of California, Berkeley: somal DNA sequences that replicate 'Dept. of Microbiology, New Jer- Gene conversion of a centromeric in S. cerevisiae. sey Medical School, Newark: Gene ade8-18. Di Gate, R.J., Hinkle, D.C., Dept. of conversion in yeast by double-Williamson, M., Fogel, S., Dept. of Biology, University of Rochester, strand gap repair. Genetics, University of California, New York: DNA primase activity Haber, J., Thorburn, P., Liu, PS., Berkeley: Meiotic correction-de- associated with yeast DNA poly- Klucznik, M., Rosenstiel Center, fective yeast mutants. merase I. BrandeisUniversity,Waltham, Picologlou, S., Dicig, M.E., Lieb- Crowley,J.C.,'Coleman, K.G.,' Massachusetts: Breaking and heal- man, S.W., University of Illinois, Steensma, H.Y.,' Kramer, B.,' Prin- ing of yeast chromosomes. Chicago: Inversions sometimes ac- gle, IR.,' Kaback, D.B.,' 'Dept. ofHaber, J.,' McCusker, J.,' Soltis,A.,' company Tyl-associated deletions Microbiology, UMDNJ-New Jersey Resnick, M.,' 'Brandeis University, in yeast. Medical School, Newark; 'Dept. of Waltham, Massachusetts; 'NIEHS,Pacquin, C., Williamson, V., ARCO Molecular and Cellular Biology, Research Triangle Park, North Car- Plant Cell Research Institute, Dub- University of Michigan, Ann Ar- olina:Mitotic recombination in- lin, California: Temperature affects bor: Molecular organization of duced by double-strand breaks. the rate of transposition of yeast Ty chromosome I. Edwards, C.W., III, Malone, R.E., elements. Kuo, C.-I., Jong, A., Campbell, IL., Dept. of Microbiology, LoyolaEmbretson, LE., Livingston, D.M., Dept. of Chemistry, California In- University Medical Center, May- Dept. of Biochemistry, University stitute of Technology, Pasadena: wood, Illinois: Examination of the of Minnesota, Minneapolis: Initial Analysis of the yeast CDC8 gene pleiotropic effects of rad52 muta- characterization of a plasmid model and the CDC8 protein. tions in yeast. to study genetic recombination in Walmsley, R.M.,Gardner,D.J., Hoekstra, M.E, Malone, R.E., Dept. yeast. Oliver, S.G., Dept. of Biochemistry of Microbiology, Loyola University Prakash, L., Polakowska, R., Rey- and Applied Molecular Biology, Medical Center, Maywood, Illi- nolds, P., Weber, S., Dept. of Ra- University of Manchester Institute of nois: Error-prone repair is not re- diation Biology and Biophysics, Science and Technology, England: quired for rem/-produced hyper- University of Rochester School of Plasmid stability in yeast - Evi- mutability. Medicine, New York: Molecular dence for a phenotype conferred by Jordan, K.B., Malone, R.E., Dept. of cloning and preliminary character- 2u DNA. Microbiology, Loyola University ization of the RAD6 gene of yeast. Sidhu, R., Bollon, A.P., Dept. of Mo- Medical Center, Maywood, Illi-Nisson, P., Lawrence, C., University lecular Genetics, Wadley Institutes nois: Isolation and characterization of Rochester, School of Medicine of Molecular Medicine, Dallas, of extragenic revertants of the and Dentistry, New York: Yeast Texas: Identification of proteins as- rad50-4 mutation. strains with altered nitrosoguani- sociated with unique yeast vectors Barker, D.G., Johnston, L.H., Na- dine mutability. isolated as tional Institute for Medical Re-Nitiss, Resnick, M.A.,' 'National search, London, England: S. cere- Institute of Environmental Health Recombination and Repair visiae CDC9 -A structural gene for Sciences, Research Triangle Park, DNA ligase. North Carolina; 'Illinois Institute of Cottrelle,P.,Thiele, D., Micouin, J.Y., Memmet, S., Buhler, J.M. Sen- Barker, D.G., Johnston, L.H., Na- Technology, Chicago: DNA metab- tenac, A., Dept. de Biologie, Serv- tionalInstitutefor Medical Re- olism during meiosis in rad50 and ice de Biochimie, CEN, Gif-sur search, London, England: A new rad52 mutants of S. cerevisiae. Yvette Cedex, France: Molecular sensitive assay for DNA ligase. Resnick, M.A.,' Sugino, A.,2 Nitiss, cloning of a gene for protein syn- Game, J., Mortimer, R., Donner Lab- Chow, T.,' 'National Institute thesis EFI from S. cerevisiae. oratory, Lawrence Berkeley Labo- of Environmental Health Sciences, ratory, Berkeley, California: Use of Research Triangle Park, North Car- Friedberg, E.C., Naumovski, L., olina; 'Dept. of Molecular Ge- Pure,G.A.,Robinson,G.W., a cold-sensitive rad50 allele to study meiotic recombination. netics, University of Georgia, Ath- Schultz, R.A., Weiss, WA., Yang, ens; 'Dept. of Biology, Illinois E.W., Stanford University, Califor- Schild, D.,' Johnston, J.,2 Chang, C.,' Institute of Technology, Chicago: nia: Characterization of cloned Mortimer, R.,' 'Lawrence Berkeley DNA polymerases, deoxyribonu- genes required for the excision re- Laboratory and University of Cali- cleases, and recombination during pair of UV-irradiated DNA in S. fornia, Berkeley; 'University of meiosis. cerevisiae. Strathclyde, Glasgow, Scotland: Bruschi, C.V., Bjornstad, K.A., Ma- Keil, R.L., Roeder, G.S., Dept. of Bi- Cloning of a yeast photoreactiva- tion gene. leas, D. T., Esposito, M.S., ology, Yale University, New Haven, LawrenceBerkeleyLaboratory, Connecticut: A mitotic recombina- Sitney, K.C.,' Contopoulou, C.R.,' University of California, Berkeley: tion hot spot in the rDNA of S. Calderon, I.L.,2 Mortimer, R.K.,' Miotic recombination and 2u DNA cerevisiae. 'Dept. of Biophysics and Medical plasmid profiles of spoil -1 /spoil -1 Lambie, E.J., Roeder, G.S., Dept. of Physics, University of California, yeast hybrids. Biology, Yale University, New Ha- Berkeley;'Dept.de Genetica, Kunes, S., Fox, M., Dept. of Biology, ven, Connecticut: Transposition of Universidad de Sevilla, Spain: Two Massachusetts Institute of Technol- CEN3 -Effects of meiotic recombi- plasmids that suppress the rad50 ogy, Cambridge: Homology-de- nation and segregation of chromo- mutation in S. cerevisiae. pendent and -independent repair of some III. Rockmill, B., Fogel, S., University of plasmid double-strand breaks. Orr-Weaver, T.L.,' Rothstein, R.J.,' California, Berkeley: Meiotic dis-Hoshizaki, D.K., Dept. of Molecular Szostak, J.W.,' 'Dana-Farber Can- junction mutants. Biology, University of Edinburgh, cer Institute and Dept. of Biolog-Choi, T., Lusnak, K., Williamson, Scotland: Recombination of plas- ical Chemistry, Harvard Medical M., Fogel, S., Dept. of Genetics, mids in yeast.

193 ence, Kyoto University, Japan: Two Braun, R.J., Roth, R.M., Dept. of Bi- Mazzara, G.P., Greer, H., Harvard University, Cambridge, Massachu- a-tubulin genes of the fission yeast ology, Illinois Institute of Technol- S. pombe-Isolation and sequence ogy, Chicago: Exonuclease A from setts: Sequence analysis of HIS4 analysis. S. cerevisiae specific for 5'-P-termi- chromosomal rearrangements im- nated SS and DS DNAs. plicate short regions of homology. Nunes, E.,' Brum, G.,' Candreva, Ruby, S.W., Szostak, J.W., Dana-Far- E.C.,' Schenberg Frascino, A.C.,2 Higgins, D., Prakash, S., Dept. of Bi- ber Cancer Institute and Dept. of 'Facultad de Medicina, Montevi- ology, University of Rochester, New BiologicalChemistry,Harvard dea, Uruguay; 2Universidade de Sao York: Isolation and characteriza- Medical School, Boston, Massa- Paulo, Brazil: Interacting repair tion of S.cerevisiae genes that chusetts: Regulation of yeast genes pathways for UV and X-ray inacti- function in incision of UV-irradi- induced by DNA-damaging agents. vation of S. cerevisiae diploid cells. ated DNA. Whiteway, M.S., Szostak, J.W., Dana-Osley, M.A., Gould, J., Hereford, Farber Cancer Institute and Dept. L.M., Dana-Farber Cancer Insti- Moore, C.W., Dept. of Radiation Bi- of Biological Chemistry, Harvard tute and Dept. of Microbiology and ology and Biophysics, University of Medical School, Boston, Massa- Molecular Biology, Harvard Medi- Rochester School of Medicine, New chusets: Yeast mutant defective in cal School, Boston, Massachusetts: York: Genetic and molecular con- cell-cycle arrest. Analysis of an ars region involved trol of the sensitivity of S. cerevis- in histone gene regulation. iae to the "radiomimetic" bleomy-Toda, T., Adachi, Y., Yanagida, M., cin group antibiotics. Dept. of Biophysics, Faculty of Sci-

SESSION 4 Recombination and Repair Chairperson:M.S. Esposito, University of California, Berkeley, California ical School, Newark: Mechanism of Chow, T.Y.-K, Resnick, M.A., Na-Klar, A., Strathern,J.,Hicks,J., Abraham, J., Ivy, J., Weisbrod, S., recombination between short re- tional Institute of Environmental peated sequences. Health Sciences, Research Triangle Kelly, M., Stephens,C., Cold Park, North Carolina: Purification Spring Harbor Laboratory, NewAndrews, B.J., Vetter, D., Beatty, L., of a deoxyribonuclease controlled York: Resolution of the recombina- Sadowski, P.D., Dept. of Medical by the RADS2 gene of S. cerevisiae. tion intermediate generated by the Genetics, University of Toronto, mating-type gene-transposition Canada: FLP-mediated recombina- Esposito, M.S., Bruschi, C.V., Ma- tion of yeast 2u DNA in vitro. leas, D.T., Bjornstad, K.A., Law- mechanism. rence Berkeley Laboratory, Univer- Lichten, M., Borts, R., Hearn, M.,McLeod, M., Makkuni, J., Li, Y.-Y., sity of California, Berkeley: Yeast Haber, J., Rosenstiel Center, Bran- Broach, J.R., Dept. of Microbiol- REC genes-Genetic analysis and deis University, Waltham, Massa- ogy, State University of New York, molecular isolation. chusetts: Analysis of two cloned re- Stony Brook: Site-specific recom- gions with high frequencies of bination associated with the yeast Wagstaff, J., Waddell, C., Klapholz, recombination in yeast. plasmid 2u circle. S., Cwirla, S., Easton Esposito, E., Dept. of Biology, University ofEibel, H., Gafner, J., Stotz, A., Fleig, Symington, L., Kolodner, R., Dana- Chicago, Illinois: Functional anal- U., Schirmaier, F., lien, E., Phil- Farber Cancer Institute and Dept. of ysis of meiotic Rec- mutations us- ippsen, P., Dept. of Microbiology, BiologicalChemistry,Harvard ing the spo13-1 haploid meiosis sys- Biozentrum, University of Basel, Medical School, Boston, Massa- tem. Switzerland: Transposition and ex- chusetts: Plasmid recombination cision of Ty elements. catalyzed by cell-free extracts of Klein, H., Dept. of Biochemistry, New York University Medical Center,Rothstein, R., Helms, C., Chrebet, yeast. New York: Genetic interactions of G., Rosenberg, N., Dept. of Micro- tandem duplications in yeast. biology, UMDNJ-New Jersey Med-

SESSION 5 Regulation I Chairperson:J. Broach, State University of New York, Stony Brook, NewYork shey: Transcriptional expression of Beier, D.J., Young, E.T., Biochemis- University, Cambridge, Massachu- try Dept., University of Washing- setts: GALl-GALIO UAS - Struc- the structural gene for a-galac- ton, Seattle: Characterization of the ture vs. function. tosidase. regulatory sequences that control Laughon, A., Gesteland, R.E, How-Johnston, M., Dept. of Genetics, ADH2 expression. ard Hughes Medical Institute, Uni- Washington University School of Medicine, St. Louis, Missouri: Se- Losson, R., Fuchs, R.P.P., Lacroute, versity of Utah, Salt Lake City: F., IBMC de CNRS, Strasbourg, Characterization of the GAL4 gene lection for GAL regulatory mutants France: Positive control of URA1 of yeast. using GAL -HISS gene fusions. and URA3 transcription initiation. Post-Beittenmiller, M.A., Hopper, Celenza, J., Neigeborn, L., Sarokin, L., Carlson, M., Dept. of Human West,R.W.,Jr.,Yocum,R.R., J.E., Dept. of Biological Chemis- try, M.S. Hershey Medical Center, Genetics and Development, Colum- Ptashne, M., Dept. of Biochemistry bia University, College of Physi- and Molecular Biology, Harvard Pennsylvania State University, Her-

194 cians and Surgeons, New York, of the City of New York, Flushing, Queens t-onege or tne Lit), of P4CW New York: Regulation of SUC2- New York; 'Dept. of Biochemistry, York, Flushing, New York: The gene expression. Wayne State University School of MALE gene is a complex locus. Goldenthal, M.J., Chow, T., Cohen, Medicine, Detroit, Michigan: The Stuhl, K., Dept. of Biological Chem- J., Marmur, J., Dept. of Biochem- MAL loci- A dispersed family of istry, Harvard Medical School, istry, Albert Einstein College of repeated genes controlling the fer- Boston, Massachusetts: his3 chro- Medicine, Bronx, New York: Phys- mentation of maltose. matin structure and gene regulation. ical and functional organization ofNeedleman, R.,' Michels, C.,2 Du- the MAL loci of yeast Saccha- bin, R.,2 Perkins, E.,' 'Dept. of romyces. Biochemistry, Wayne State Univer- Michels, C.A.,' Needleman, R.B.,2 sity School of Medicine, Detroit 'Dept. of Biology, Queens College Michigan;'Dept.ofBiology,

SESSION 6 Poster Session - Regulation I Chakraburtty, K., Medical College of e Biologia Molecolare, University di theS.cerevisiae a-galactosidase Wisconsin, Milwaukee: Elongation Roma; 'Centro di Studio per gli gene and deletion analysis of the factor 3 is the temperature-labile Acidi Nucleici, CNR Roma, Italy: controlling region. translational component in the yeast Transitions in topological organi- Johnston, S.A., Hopper, J.E., Dept. of mutant ts275. zation of supercoiled DNA do- Biochemistry, M.S. Hershey Medi- Werner, M.,' Feller, A.,' Messenguy, mains as potential regulatory mech- cal Center, Pennsylvania State Uni- F.,' Crabeel, M.,3 Pierard, anism. versity, Hershey: Effects of the in- 'Laboratoire deMicrobiologie, Denis, C.L.,' Wood, J.S.,2 'Dept. of sertional disruption of the GAL4 Universite Libre de Bruxelles; Biochemistry, University of New regulatory gene on the expression of 'Institut de Recherches du CERIA; Hampshire, Durham; 'Lilly Re- the galactose/melibiose regulon. 3Microbiologie, Vrije Universiteit search Laboratories, Indianapolis, Kirschman, J.A., Hopper, J.E., Dept. Brussel, Belgium: Sequences of the Indiana: Characterization of posi- of Biological Chemistry, M.S. Her- regulatory regions of genes CPA1 tive and negative regulatory ele- shey Medical Center, Pennsylvania and CPA2 encoding the arginine ments controlling ADHII expres- State University, Hershey: Multiple pathway carbamoylphosphate syn- sion. copies of GAL1, Z and 10 structural thase of S. cerevisiae. Fukasawa, T.,' Nogi, Y.,' Shimada, genes after the expression of a- Hauge, B., Greer, H., Dept. of Cel- H.,2 Hashimoto, H.,' Matsuzaki, galactosidase and a-D-GAL-/-P-uri- lular and Developmental Biology, Y.,' 'Laboratory for Molecular Ge- dyltransferase enzymes in nonin- Harvard University, Cambridge, netics; 'Dept. of Biochemistry, Keio ducing media. Massachusetts: 5' HIS4 and TRP5 University School of Medicine, To- Torchia, T.E., Hopper, J.E., M.S. transcripts implicated in general kyo, Japan: Isolation and character- Hershey Medical Center, Pennsyl- control of amino acid biosynthesis. ization of the regulatory gene vania State University, Hershey: Penn, M.D., Thireos, G., Greer, H., GAL80 in the galactose metabolism Analysis of gaB-gene function in Dept. of Cellular and Develop- in S. cerevisiae. theinduction pathway forthe mental Biology, Harvard Univer-Bajwa, W, Meyhack, B., Rudolf, H., expression of the Leloir genes and sity, Cambridge, Massachusetts: Hinnen, A., Friedrich Miescher-In- the MEL1 gene. Cloning and molecular analysis of stitut, Basel, Switzerland: Struc- Torchia, T.E., Hamilton, R.W., Cano, positive regulatory genes involved tural analysis of two tandemly re- C. L. ,Kirschman, J. A. ,Hopper, in general control of amino acid peated acid phosphatase genes in J.E., M.S. Hershey Medical Center, biosynthesis. yeast. Pennsylvania State University, Her- Greenberg, M., Barr, R., Ganem, M., Rudolf, H., Hinnen, A., Friedrich shey:Characterizationofthe Greer, H., Dept. of Cellular and Miescher-Institut, Basel, Switzer- GAL80 gene - Assignment of the Developmental Biology, Harvard land: Deletion scanning of the yeast GAL80 protein as a purely negative University, Cambridge, Massachu- PHO5 promoter. regulator of the inducible Leloir and MEL1 genes in S. cerevisiae. setts: New regulatory mutations af- Meyhack, B., Hinnen, A., Ciba-Geigy fecting histidine biosynthesis. AG, Basel, Switzerland: High lev- Johnston, S.A.,' Hopper, J.E.,' Am- Thireos, G., Penn, M.D., Greer, H., els of expression of foreign genes merer, G.,2 'M.S. Hershey Medical Dept. of Cellular and Develop- under the control of the yeast PHO5 Center, Pennsylvania State Univer- mental Biology, Harvard Univer- promoter. sity, Hershey; 'Dept. of Genetics, sity, Cambridge, Massachusetts: University of Washington, Seattle: Allison, D.,' Goh, S.H.,2 Hall, B.,' Partitioning of the GAL4 regula- General control of amino acid bio- 'Dept.of Genetics,University synthesis involves the coordinate of Washington, Seattle; 'Dept. of tory gene into two functional do- action of "initiation" and "mainte- Biochemistry, University of British mains. nance" genes. Columbia, Vancouver, Canada: In- M.F., Dobson, M.J., Mellor, J., Alexander,P.,' Cooper, T.G.,2 Ad- ternal promoter sequence of the Kingsman, S.M., Kingsman, A.J., ams, B.G.,' 'University of Hawaii, yeast SUP4 tRNATY' gene. Dept. of Biochemistry, Oxford, Honolulu; 'University of Pitts-Hurley, D.L.,' Hopper, J.E.,2 England: Roles of the 5'- and 3'- burgh, Pennsylvania: Role of me- 'Molecular and Cell Biology Pro- flanking sequences in expression of tabolite transport in nitrogen cata- gram, 'Dept. of Biological Chem- the PGK gene of yeast. bolite repression. istry, M.S. Hershey Medical Cen-Dobson, M.J., Mellor, J.,Tuite, M.F., Di Mauro, E.,' Caserta, M.,' Negri, ter, Pennsylvania State University, Roberts, N.A., Kingsman, S.M., R.,' Carnevali, F.,' 'Dept. Genetica Hershey: Nucleotide sequence of Kingsman, A.J., Dept. of Biochem-

195 istry, Oxford, England: Factors af- Klekamp, M., Parsons, M., Weil, T., Barron, E., Sidhu, R., Bollon, A.R, fecting heterologous gene expres- Dept. of Biochemistry, University Dept. of Molecular Genetics, Wad- sion in yeast. of Iowa Medical School, Iowa City: ley Institutes of Molecular Medi- Partial purification and characteri- cine, Dallas, Texas: Construction of Mellor, J., Dobson, M.J., Roberts, zation of yeast class-III gene tran- high copy yeast-bacteria shuttle N.A., Tuite, M.F., Emtage, J.S., scription factors. vectors containing improved select- White, S., Lowe, P.A., Patel, T., able markers. Kingsman, A.J., Kingsman, S.M.,Ruet, A., Camier, S., Smagowicz, W, Dept. of Biochemistry, Oxford, and Sentenac, A., Dept. de Biologie,De Wilde, M., Cabezon, T., Harford, Celltech Ltd.,Slough, England: Service de Biochimie, CEN Sac lay, N., Simoen, E., Rutgers, T., Van Efficient synthesis of enzymatically Gif-sur-Yvette, France: Factors in- Wijnendaele, F., Smith Kline-RIT, active calf chymosin inS.cere- volved in transcription of yeast Genetic Research Dept., Rixensart, visiae. tRNA genes in vitro. Belguim: Hepatitis-B vaccine pro- Panchal, C.J., Peacock, L., Whitney, duced in yeast by R-DNA. Hubert, J.C.,Exinger, E, Guyon- varch, A., Krammerer, B., Lilje- G., Stewart, G.G., Production Re-Young, R.A., Dept. of Biochemistry, search Dept., Labatt Brewing Com- Stanford University School of Med- lund, P., Losson, R., Lacroute, F, pany Limited, London, Ontario, icine, California: Cloning of the Laboratoire de Genetique Physiol- ogique, IBMC du CNRS, Stras- Canada: Drug resistance phenome- yeast RNA polymerase II subunit non in amaylase-producing yeasts of genes using antibody probes. bourg,France:Sequences and properties of two yeast regulatory the genus Schwanniomyces. Elliott, S.G., Carbon, J.A., Dept. of genes. Butt, T., Sternberg, E., Crooke, S.T., Biology, University of California, Dept. of Molecular Pharmacology, Santa Barbara: Fusion of ARG4 (ar- Stiles, J.I.,' Fleischer, D.,2 Neill, J.,' Smith Kline & French Laborato- ginosuccinate lyase) with (3-galac- Barry, K.,' Friedman, L.,' Sher- ries, Philadelphia, Pennsylvania: tosidase - Control of ARG4 expres- man, F.,' 'Dept. of Botany, Univer- Cloning of copper-inducible genes sion. sity of Hawaii, Honolulu; 'Dept. of of yeast. Knowlton,R.G.,Stearman,R.S., Life Sciences, Indiana State Uni- versity, Terre Haute; 'Dept. of Ra- Butt, T., Herd, J., Crooke, S.T., Dept. Dept. of Molecular Genetics, Col- diation Biology and Biophysics, of Molecular Pharmacology, Smith laborative Research, Inc., Lexing- Kline & French Laboratories, Phil- ton,Massachusetts:Regulated University of Rochester, New York: expression of interferon from the Genetic and DNA sequence analy- adelphia,Pennsylvania: Copper SUC2 promoter. sis of revertants of a mutation in the metallothionein of yeast -A model leader region of the iso-l-cyto- system for gene-expression studies. Lawyer, F.C., Stoffel,S., Gelfand, chrome c mRNA of S. cerevisiae. Marshall, M., Li,Y.-Y., Wu, L., D.H., Cetus Corporation, Berke- Makkuni, J., Sumida, S., Broach, ley, California: Derivation and use Lohr, D., Dept. of Chemistry, Ari- J.R., Dept. of Microbiology, State of a dominant selectable marker for zonaStateUniversity,Tempe: University of New York, Stony yeast. Chromatin structure of upstream Brook: Vectors for high-level, in-Gjermansen, C.,' Holmberg, S.,' Pe- flanking sequences compared to ducible expression of cloned genes tersen, J.G.L.,' Nilsson-Tillgren, coding sequence chromatin struc- in yeast. T.,' Kielland-Brandt, M.C.,' Sigs- ture. Strausberg, R., Strausberg, S., Vas- gaard, P.,' Pedersen, M.B.,' 'Dept. Ingles,C.J.,Himmelfarb, let, C., Fisher, K., Haigwood, N., of Physiology, Carlsberg Labora- Shales, M.,' Friesen, J.D.," 'Banting Rollence, M., Finkelman, M., Ge- tory, Copenhagen Valby; 'Institute and Best Dept. of Medical Re- nex Corporation, Gaithersburg, of Genetics, University of Copen- search; 'Dept. of Medical Genetics, Maryland: Expression of calf pro- hagen; 'Dept. of Brewing Chemis- University of Toronto, Canada: A chymosin in S. cerevisiae. try,Carlsberg Research Labora- family of S. cerevisiae RNA poly- Goff,C.,Moir, D., Schumm, J., tory,CopenhagenValby, Den- merase genes-Identification, mo- Smith, R., Kohno, H., Duncan, M., mark: Genetics of lager yeast. lecular cloning, and mutagenesis. Dept. of Molecular Genetics, Col-Gritz, L., Davies, J., Biogen S.A., Klootwijk, J., Verbeet, M.P., van laborative Research, Inc., Lexing- Geneva, Switzerland: Hygromycin- Heerikhuizen, H., Veldman, G.M., ton, Massachusetts: Expression of B resistance- A new selectable de Regt, V.C.H.F., Planta,R.J., calf prochymosin in S. cerevisiae. marker for yeast transformation. Dept. of Biochemistry, Free Uni- Williams,S.A.,'Hodges,R.A.,'Breilmann, D., Gafner, J.,Ciriacy, versity, Amsterdam. The Nether- Spector, L.,' Snow, R.,' Kunkee, M., Institutfiir Mikrobiologie, lands: Initiation of transcription of R.E.,' 'Dept. of Biology, Smith Universitat Dusseldorf, Federal Re- 37S pre-rRNA on S. carlsbergensis College, Northampton, Massachu- public of Germany: Effects of delta- rDNA in vivo and in vitro. setts; Depts. of 'Genetics, sequence-mediated DNA rear- Molenaar, C.M.T., Leer, R.J., Woudt, 'Viticulture and Enology, Univer- rangements on the expression of the L.P., Mager, W.H., Planta, R.J., sity of California, Davis: Cloning ADH2 gene. Dept. of Biochemistry, Free Uni- the malolactic gene from L. del- Holmberg,S.,'Petersen,J.G.L.,' versity, Amsterdam, The Nether- brueckii into E. coli and yeast. Kielland-Brandt, M.C.,Nilsson- lands: Duplicate genes coding forJones, M., Koski, R., Amgen, Thou- Tillgren, T.,' 'Dept. of Physiology, yeast ribosomal proteins. sand Oaks, California: Expression Carlsberg Laboratory, Copenhagen van Heerikhuizen, H., Fontijn, R.D., ofsyntheticgamma-interferon Valby; 'Institute of Genetics, Uni- Kempers-Veenstra, A.E., Kloo- genes in S. cerevisiae. versity of Copenhagen, Denmark: twijk,J.,Planta,R.J.,Verbeet, Bitter, G.A., Egan, K.M., Amgen, Structural and transcriptional anal- M.P., Dept. of Biochemistry, Free Thousand Oaks, California: ysis of ILV1 from S. cerevisiae. University, Amsterdam, The Neth- Expression of heterologous genes inHsu, Y.-P., Schimmel, P., Dept. of erlands: Evolution and transcrip- S.cerevisiae from the GAPDH Biology, Massachusetts Institute of tion of yeast rDNA. promoter. Technology,Cambridge:Yeast

196 LEU1 -Isolation of gene, charac- University of Texas Health Science versity: CHO1 locus of yeast - terization of in vivo transcripts, and Center, Dallas: HSP90 gene fami- Cloning and analysis of its gene relationship of 5' sequence to that of ly. product,phosphatidylserinesyn- coordinately regulated LEU2. Craig, E.A., Jacobsen, K., University thase. Merryweather, J.P.,Barr,P.J., Ma- of Wisconsin, Madison: Character-Perlman, D., Raney, P., Halvorson, siarz, ER., Coit, D., Heberlein, U., ization and analysis of mutations of H.O., Rosenstiel Center, Brandeis Valenzuela, P., Brake, Al, Chiron the 70K heat-shock and related University, Waltham, Massachu- ResearchLaboratories,Chiron genes of yeast. setts: Regulation of the invertase Corporation, Emeryville, Califor- Ellwood, M., Slater, M., Craig, E., mRNAs in S. cerevisiae. nia: a-Factor promoter and proc- Dept. of Physiological Chemistry,Platt, T., Dept. of Molecular Bio- essing signals direct regulated syn- University of Wisconsin, Madison: physics and Biochemistry, Yale thesis and secretion of authentic Differential regulation of the 70K University, New Haven, Connecti- heterologous proteins. heat-shock and related genes in S. cut: Toxicity of 2-deoxygalactose to Tekamp-Olson, P., Rosenberg, S., cerevisiae. cells induced for the galactose en- Choo, Q.L., Colt, D., Najarian, Keegan, L., Silver, P., Ptashne, M., zymes and analysis of survivors. R.C., Valenzuela, P., Chiron Re- Dept. of Biochemistry and Molec-Niederberger, P., Aebi, M., Furter, search Laboratories, Chiron Cor- ular Biology, Harvard University, R., Prantl, F, Hatter, R., Mikro- poration, Emeryville, California: Cambridge, Massachusetts: Char- biologisches Institut ETH-Z, Zu- Regulatory regions of yeast pyru- acterization of the GAL4-gene rich, Switzerland: Expression of an vate kinase and glyceraldehyde-3- product. artificial yeast TRP-gene cluster in phosphate dehydrogenase pro- S. cerevisiae and E. coli. moters. Yocum, R., BioTechnica Interna- tional, Cambridge, Massachusetts: Romero, D.P., Dahlberg, A.E., Divi- Mowatt, N.,' Johnston, J.,' Watson, Use of E. coli lacZ gene fusions to sion of Biology and Medicine, D.,2 'Dept. of Bioscience and Bio- study the yeast galactose-inducible BrownUniversity,Providence, technology, University of Strath- genes. Rhode Island: Phosphorylation of clyde, Glasgow, Scotland; 2Chivas Das, S., Hollenberg, C.P., Institut fiir initiation factor 2 (eIF2) in the yeast Brothers, Ltd., Strathisla-Glenlivet S. cerevisiae. Distillery, Keith, Scotland: Hybrid- Mikrobiologie, Universitat Dussel- dorf, Federal Republic of Germany:Brandriss, M.C., Dept. of Microbi- ization of distillery yeasts by spher- ology, New Jersey Medical School, oplast fusion. Regulation of the yeast #-galacto- sidase gene in K. lactis and S. cere- Newark:Prolineutilizationin Lalonde, B., Guarente, L., Dept. of visiae on an autonomously replicat- yeast - Analysis of the cloned PUT2 Biology, Massachusetts Institute of ing plasmid. gene. Technology, Cambridge: Isolation Winston, M., Bhattacharjee, J.K., of point mutations in the promoter Hill, D.E., Struhl, K., Dept. of Bio- logical Chemistry, Harvard Medi- Dept. of Microbiology, Miami Uni- region of the CYC1 gene of S. cere- versity, Oxford, Ohio: Regulation visiae. cal School, Boston, Massachusetts: Mechanism of HISS regulation - oflysinebiosynthesisin S. Keng, T., Guarente, L., Dept. of Bi- Cloning of the regulatory gene cerevisiae. ology, Massachusetts Institute of TRA3. Wright, C.F., Weiss, J.L., Walthall, Technology, Cambridge: Mutants in D.A., Zitomer, R.S., Dept. of Bio- heme biosynthesis. Letts, V.A., Moss, L., Henry, S.A., Depts. of Genetics and Molecular logical Sciences, State University of Gillum, A.M., Tsay, E., Kirsch, Biology, Albert Einstein College of New York, Albany: Regulation of D.R., Biotechnology Dept., Squibb Medicine, Bronx, New York: A CYC7 expression. Institute for Medical Research, mutant of yeast altered in phospha-Rymond, B.C., Zitomer, R.S., Dept. Princeton, New Jersey: Cloning of tidylmonomethylethanolamine bio- of Biological Sciences, State Uni- the C. albicans gene for orotidylate synthesis. versity of New York, Albany: Iso- decarboxylase (ODC) by comple- Cooperman, B.S., Letts V.A., Henry, lation of CYC1 regulatory muta- mentation of S. cerevisiae ura3 and tions using a CYCl/galK gene fu- E. coli pyrF mutations. S.A., Depts. of Genetics and Mo- lecular Biology, Albert Einstein sion. McAlister, L., Holland, M., Dept. of College of Medicine, Bronx, New Breunig, K., Dahlems, U., Hollen- BiologicalChemistry,Medical York: Solubilization and character- berg, C.P., Institut fiir Mikrobiolo- School, University of California, ization of the phospholipid N-meth- gie, Universitat Diisseldorf, Fed- Davis: Expression of yeast genes yltransferases from yeast. eral Republicof Germany: encoding glyceraldehyde-3-phos- Characterization of the regulatory Loewy, B.S., Klig, L.S., Henry, S.A., phate dehydrogenase. region of the S-galactosidase gene Depts. of Genetics and Molecular in K. [(lair. Kurtz, S., Petko, L., McGarry, T., Biology, Albert Einstein College of Lindquist,S.,Dept. of Biology, Medicine, Bronx, New York: Reg-Carlson, M., Taussig, R., Dept. of University of Chicago, Illinois: ulatory mutants that uncouple the Human Genetics and Development, Expression of heat-shock genes in coordinate regulation between ino- Columbia University, College of S. cerevisiae. sitol metabolism and phosphatidyl- Physicians and Surgeons, New Plesset,J.,Collatz,E.,Foy,J.J., choline synthesis. York, New York: Structure of the SUC gene family. McLaughlin, C.S., Dept. of Bio- Letts, V.A.,' Klig, L.S.,' Lee-Bae, logical Chemistry, University of M.S.,2 Carman, G.M.,2 Henry,Bisson, L.J., Fraenkel, D.G., Dept. of California, Irvine: Expression of S.A.,' 'Depts. of Genetics and Mo- Microbiology and Molecular Ge- the Drosophila 70,000-dalton heat- lecular Biology, Albert Einstein netics, Harvard Medical School, shock protein in yeast. College of Medicine, Bronx, New Boston, Massachusetts: Yeast mu- tants deficient in hexose uptake. Finkelstein, D. B. ,Farrelly,F. W. , York; 2Dept. of Food Science, Cook Davis, A.H., Division of Molecular College, New Jersey AgriculturalSedivy, J.M., Fraenkel, D.G., Dept. Biology, Dept. of Biochemistry, Experimental Station, Rutgers Uni- of Microbiology and Molecular Ge-

197 netics, Harvard Medical School, tion, Seattle, Washington: Produc- ogy, Cambridge: Segment-directed Boston, Massachusetts: Genetics of tion of human AT in yeast. mutagenesis in vitro of the pro- moter and regulatory regions of the fructose- l,6- bisphosphatase in S. Russell,P., Woodbury, R., Zymos cerevisiae. Corporation, Seattle, Washington: yeast URA3 gene. Mitchell, A.R., Magasanik, B., Mas- Expression of human AT in fissionGordon, C., Fantes, P., Dept. of Zo- sachusetts Institute of Technology, yeast. ology, University of Edinburgh, Cambridge: Multiple regulatoryEccleshall, T.R.,' Federoff, H.J.,2 Scotland: Cloning of a gene re- systems for glutamine synthetase. Marmur, J.,''Sungene Technolo- quired for DNA synthesis in S. Turner, K.J.,' Elliott, Q.,2 Lemire, gies Corp., Palo Alto, California; pombe. J.M.,2 Thill, G.P.,' Rogers, D.T.,' 'Massachusetts General Hospital,McKnight, G., McConaughy, B., Kramer, R.A.," Bostian, K.A.,2 Boston; 'Albert Einstein College of Dept. of Genetics and Center for 'Genetics Institute, Boston, Massa- Medicine, Bronx, New York: Reg- Inherited Diseases, University of chusetts; 'Division of Biology and ulation of the inducible and repres- Washington, Seattle: Cloning of Medicine, Brown University, Prov- sible maltase in S. carlsbergensis. cDNAs by functional complemen- idence, Rhode Island; 'SIBIA, La Abovich, N., Tung, L., Rosbash, M., tation in yeast. Jolla, California; 'Dept. of Molec- Dept. of Biology, Brandeis Univer- Baker, S.M., Jaehning, J.A., Dept. of ular Genetics, Hoffman-LaRoche, sity,Waltham,Massachusetts: Biochemistry, University of Illi- Inc., Nutley, New Jersey: Regula- Characterization of the expression nois, Urbana: Transcription of the tion and organization of two tan- of two genes coding for ribosomal GAL 7 genefromautonomous demly duplicated yeast acid phos- protein 51. plasmids. phatase genes. Overbye, K.M., Rose, M., Grisafi, P., Kawasaki, G.H., Woodbury, R.G., Botstein, D., Dept. of Biology, Forstrom,J.F., Zymos Corpora- Massachusetts Institute of Technol-

SESSION 7 Regulation II Chairperson:J. Hicks, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Greer, H., Hauge, B., Thireos, G., quence and genetic analysis of the Cambridge: Regulation of the CYCI Penn, M., Greenberg, M., Maz- Ty912 transposable element. gene of S. cerevisiae. zara, G., Dept. of Cellular and De- Bowen, B.A., Fulton, A.M., Dobson,Lowry, C.V., Zitomer, R.S., Dept. of velopmental Biology, Harvard Uni- M.J., Tuite, M.E, Kingsman, S.M., Biological Sciences, State Univer- versity, Cambridge, Massachusetts: Kingsman, A.J., Dept. of Biochem- sity of New York, Albany: Regula- General control of amino acid istry, Oxford, England: Expression tory mutations affecting oxygen- biosynthesis. of Ty-lacZ fusions in yeast. regulated expression of the ANBI, Hinnebusch,A.G.,Fink,G.R., Pearlman, R.E.,' Rose, A.,' Roeder, CYC1, and tr-1 genes. Whitehead Institute for Biomedical G.S.,2 'Dept. of Biology, York Uni-Cooper, T.G., Platoniotis, D., Yoo, H.- Research and Massachusetts Insti- versity, Downsview, Ontario, Can- S., Rai, R., Chisholm, G., Gen- tute of Technology, Cambridge: ada; 'Dept. of Biology, Yale Uni- bauffe, E, Buckholz, R., Sumrada, AAS3 is a positive regulator of gen- versity, New Haven, Connecticut: R.A., University of Pittsburgh, eral amino acid control. Control of HIS4 expression by Ty Pennsylvania: Regulatory elements Winston, F., Fink, G.R., Whitehead elements. of nitrogen catabolic genes and their Institute for Biomedical Research Bairn, S.B., Sherman, F., Dept. of target sequences. and MassachusettsInstituteof Radiation Biology and Biophysics,Klig, L.S., Henry, S.A., Dept. of Ge- Technology, Cambridge: Genes that University of Rochester School of netics and Molecular Biology, Al- affect Ty-mediated gene expression Medicine, New York: Mutations af- bert Einstein College of Medicine, in yeast. fecting the translation of CYCI Bronx, New York: INO1 locus- Farabaugh, P., Dept. of Microbiol- mRNA. Cloning and analysis of transcripts. ogy, University of Connecticut Guarente, L., Dept. of Biology, Mas- Health Center, Farmington: Se- sachusetts Institute of Technology,

SESSION 8 Regulation III Chairperson:J. Marmur, Albert Einstein College of Medicine, Bronx, New York Welch, J.W.,' Fogel, S.,' Karin, M.,2 pression of yeast ribosomal protein ington University School of Medi- 'Dept. of Genetics, University of genes. cine, St. Louis, Missouri: Role of California, Berkeley; 'Dept. of Mi- Warner, J.R.,' Schwindinger, W.F.,' 5'-flanking sequences in the in vivo crobiology, University of Southern Mitra, G.,' Fried, H.M.,2 Pearson, expression of the SUP4-o gene. California School of Medicine, Los N.,' 'Albert Einstein College ofStillman, D.J., Sivertsen, AL., Gei- Angeles: Molecular genetics of Medicine,Bronx,New York; duschek, E.P., Dept. of Biology, copper resistance in industrial yeast 'University of North Carolina, Universityof California,San strains. Chapel Hill; 'University of Mary- Diego, La Jolla: S. cerevisiae pro- land, Catonsville: Varieties of reg- teins binding to genes that are tran- Woolford, J.L., Levy, A., Rotenberg, scribed by RNA polymerase III. M.O., Larkin, IC., Last, R., Dept. ulatory experience. of Biological Sciences, Carnegie- Shaw, K.J.,' Olson, M.V.,2 'UnigeneHitzeman, R., Chen, C., deBoer, H., MellonUniversity,Pittsburgh, Laboratories, Inc., Fairfield, New Kastalein, R., Etcheverry, T., Op- Pennsylvania:Structure and ex- Jersey; 'Dept. of Genetics, Wash- permann, H., Dept. of Molecular

198 Biology, Genentech, Inc., South San the expression of foreign proteins in Transcription termination control Francisco, California: Factors af- yeast. region in S. cerevisiae. fecting homologous and heterolo- Miyajima, A., Miyajima, I., Arai, K., Saffer, L., Miller, O.L., Jr., Dept, of gous gene expression in yeast. Arai, N., DNAX Research Institute Biology, University of Virginia, Valenzuela, P.,1 Medina, M .A.,1 of Molecular and Cellular Biology, Charlottesville: Electron micro- Bishop, R .,1 Najarian, R.C•,1 Barr, Palo Alto, California: Expression of scope study of replication and its P.J.,1 Karin, M.,2 'Chiron Research plasmid-encoded R388 type-II dihy- interaction with transcription in Laboratories, Chiron Corporation, drofolate reductase gene as a dom- synchronized yeast Cells. Emeryville; 1Dept, of Microbiol- inant selection marker in S. cere- Swanson, M., Holland, M., Dept, of ogy, University of Southern Cali- visiae. Biological Chemistry, School of fornia School of Medicine, Los An- Cohen, E.H., Kelly, J.D., Heinikoff, Medicine, University of California, geles: Structure of the yeast CUP1 S., Fred Hutchinson Cancer Re- Davis: Transcription of yeast ribo- locus and its use in the regulation of search Center, Seattle, Washington: somal cistrons.

SESSION 9 Poster Session

Regulation stituut, COOVI, and Microbiolo- Young, E.T., Dept, of Biochemistry, Potter, A .A .,1 Nestmann, E.R.,2 Iyer, gie, Vrije Universiteit Brussel, Bel- University of Washington, Seattle: -ends of S. ADH3, the structural gene for mi ׳V.N.,1 *Dept, of Biology, Carleton gium: Mapping of the 5 University; 2Mutagenesis Section, cerevisiae ARG3 mRNA in various tochondrial alcohol dehydrogenase. Dept, of National Health and Wei- physiological conditions. Osterman, J.C., Young, E.T., Dept, of fare, Ottawa, Ontario, Canada: Dubois, E., Messenguy, F., Institut de Biochemistry, University of Wash- Transfer of the pKMlOl-associated RecheTches du CERIA, Brussels, ington, Seattle: Deletion analysis of muc genes to S. cerevisiae. Belgium: Transcriptional organiza- Ty-mediated constitutivity at ADH2. Pall, M.L., Program in Genetics and tion of the argRII regulatory gene Shuster, J.R., Young, E.T., Dept, of Cell Biology, and Biochemistry/ in S. cerevisiae. Biochemistry, University of Wash- Biophysics, Washington State Uni- ington, Seattle: Two regions con- versity, Pullman: cAMP stimula- Dubois, E .,1 Messenguy, F.,1 Bercy, taining homologous inverted repeat tion of glycolysis and inhibition of J.,2 1Institut de Recherches du DNA sequences are required for gluconeogenesis — An evolutionar- CERIA; 2Laboratoire de Micro- repression of the glucose-regulated ily conserved response. biologie, Brussels, Belgium: Anal- alcohol dehydrogenase gene of S. ysis of a 1.8-kb DNA fragment en- cerevisiae. Sutton, A., Broach, J.R., Dept, of Coding the argRI and argRIII Microbiology, State University of regulatory genes in S. cerevisiae. Sledziewski, A., Young, E.T., Dept, New York, Stony Brook: Precise of Biochemistry, University of mapping of 2u circle transcripts. Verschueren, K.,1 Messenguy, F.,2 Washington, Seattle: Hypersensi- .end of ADH2 ׳Microbiologie, tive sites at the 5׳Willsky, G.R., Dosch, S.F., Dept, of Glansdorff, N .,1 1 2 Biochemistry, State University of Vrije -Universiteit Brussel; 2Institut Larkin, J.C., Levy, A., Woolford, New York, Buffalo: Vanadate-re- de Recherches du CERIA, Brus- J.L., Dept, of Biological Sciences* sistant mutants in S. cerevisiae. sels, Belgium: Regulation does not Carnegie-Mellon University, Pitts- affect chromatin sensitivity toward Courchesne, W.E., Magasanik, B., burgh, Pennsylvania: Expression DNase I of the ARG3 gene of S. and regulation of CRY1, a ribo- Massachusetts Institute of Technol- cerevisiae. ogy, Cambridge: Nitrogen regula- somal protein gene. tion in S. cerevisiae. Messenguy, F., Dubois, E., Institut de Simchen, G., Styles, C., Fink, G.R., Recherches du CERIA, Brussels, Buckholz, R.G., Cooper, T.G., Uni- Whitehead Institute and Massachu- Belgium: ARG3 and CAR1 mRNA versity of Pittsburgh, Pennsylvania: setts Institute of Technology, Cam- measurements in isolated nuclei in Oxalurate induction of multiple bridge: Yeast trarisposable elements S. cerevisiae. at LYS2 are controlled by the same URA3 transcripts in S. cerevisiae. SPM genes that control Ty’s at HIS4. Rai, R., McKelvey, J., Cooper, T.G., Messenguy, F.,1 Bouthelet, F.,2 Hil- University of Pittsburgh, Pennsyl- ger, F.,2 'Institut de Recherches du Lucchini, G., Fink, G.R., Whitehead vania: Transport and metabolism of CERIA, Brussels; 2Laboratoire de Institute and Massachusetts Insti- GABA, an alternative means of de- Microbiologie, Faculte des Sci- tute of Technology, Cambridge: Po- grading glutamate to ammonia. ences Agronomiques de l’Etat & sitive regulation of the HIS4 gene in Gembloux, Belgium: Relation be- S. cerevisiae. Genbauffe, F.S., Chisholm, G.E., tween cdc~ mutations and the “gen- Cooper, T.G., University of Pitts- Tanaka, J., Fink, G.R., Whitehead In- eral control” of amino acid biosyn- burgh, Pennsylvania: Isolation and stitute and Massachusetts Institute thetic pathways. characterization of two novel re- of Technology, Cambridge: Cion- peated DNA sequences in S. Irani, M.H., Young, E.T., Dept, of ing and analysis of the HIP1 gene cerevisiae. Biochemistry, University of Wash- of yeast. Crabeel, M., Defour, J., Hilven, P, ington, Seattle: New chromosomal Melnick, L., Shefman, F., Dept, Glansdorff, N., Onderzoekingsin- genes involved in the regulation of of Radiation Biology and Biophys- stituut, COOVI, and Microbiolo- the glucose-repressible alcohol de- ics, University ot Rochester School gie, Vrije Universiteit Brussel, hydrogenase of S. cerevisiae. of Medicine, New York: COR and Belgium: Construction of a family Hartshorne, T., Young, E.T., Dept, of ARC duplicated gene clusters. of deletions in the 5' noncoding re- Biochemistry, University of Wash- Barry, K .,1 Laiken, R.M.,2 Sherman, gion of the S. cerevisiae ARG3 gene. ington, Seattle: DNA sequence F.,2 Stiles, J.I.,1 *Dept, of Botany, Huygen, R., Crabeel, M., Cunin, R., analysis of the positive regulatory University of Hawaii, Honolulu; Glansdorff, N., Onderzoekingsin- gene ADR1. 2Dept, of Radiation Biology and

199 Biophysics, University of Roches- and encapsidation of multiple spe- Manney, T.R., Nath, R., Christian- ter, New York: Structure of the cies of L DS RNA. son, K., Dept. of Physics, Kansas COR region of S. cerevisiae -Posi-Georgeopoulos, D.E. ,Leibowitz, State University, Manhattan: Char- acterization of a secreted protein tioning of the OSMJ and RAD7 M.J.,Dept.ofMicrobiology, genes byanalysisof deletion UMDNJ-Rutgers Medical School, under the control of the BAR1 gene mutations. Piscataway, New Jersey: Transcrip- in S. cerevisiae. Easton Esposito, R., Wang, H.-T., tion of killer DS RNA of yeast. MacKay,V.L.,'Manney,T.R.,' Kowalisyn, J., Elder, R., Dept. ofThiele, D.J., Haning, E.M., Leibow- 'Zymos Corp., Seattle, Washing- Biology, University of Chicago, Il- itz, M.J., Dept. of Microbiology, ton; 'Dept. of Physics, Kansas State linois: Cloning and preliminary UMDNJ-Rutgers Medical School, University, Manhattan: Molecular characterization of the SP013 gene Piscataway, New Jersey: Genetic analysis of the expression of the required for the separation of ho- expression of the S3 deletion mu- BAR1 gene. mologous chromosomes during tant killer virus DS RNA. Abraham, J.,' Nasmyth, K.,' Klar, A.,' Hicks, J.,' 'Cold Spring Harbor meiosis. Hannig, E.M., Thiele, D.J., Leibow- itz, M.J., Dept. of Microbiology, Laboratory, New York; 'MRC, UMDNJ-Rutgers Medical School, Cambridge, England: Sequences that regulate silent mating-type cas- Killer Piscataway, New Jersey: Template- settes in yeast. El-Sherbeini,M.,'Tipper,D.J.,' coding of polyadenylate tracts in Mitchell, D.J.,' Bostian, K.A.,3 yeast killer virus transcripts. Ivy,J.,' Hicks, J.,' Weisbrod, S.,' 'Queen Mary College, London Uni- Broach, J.,' Stephens, C.,' Maho- Weinstein, L.A., Thiele, D.J., Gold- ney, D.,' Klar, A.,' Strathern, J.,' versity, England; 'University of smith, P.M., Leibowitz, M.J., Dept. Massachusetts Medical School, 'Cold Spring Harbor Laboratory, of Microbiology, UMDNJ-Rutgers New York; 'Dept. of Microbiology, Worcester;'BrownUniversity, Medical School, Piscataway, New Providence, Rhode Island: Capsid State University of New York, Stony Jersey: Oligonucleotides associated Brook: Characterization of the Mar/ proteins in VLPs containing the L with viral DS RNA in yeast. and M species in killer yeast. Sir genes in yeast. Sommer, S.S., Wickner, R.B., Na- Bostian, K.A.,' Bussey, H.,' Tipper, Jensen, R., Herskowitz, I., Dept. of tional Institutes of Health, Be- Biochemistry and Biophysics, Uni- D.J.,' 'Biomed Division, Brown thesda, Maryland: Further charac- University, Providence, Rhode Is- versity of California, San Fran- terization of M DS RNA -The size cisco: Asymmetric, periodic, and land; 'Dept. of Biology, McGill of M, is inhibited by Mi, and L-A- University, Quebec, Canada; 'Dept. cell-type-specific control of HO of Microbiology, University of E. expression. Massachusetts Medical School,Ridley, S.P., Sommer, S.S., Wickner, R.B., National Institutes of Health,Kurjan, J., Dept. of Biological Sci- Worcester: Toxin precursor gene ences, Columbia University, New sequence in M, DS RNA. Bethesda, Maryland: Superkiller mutations suppress exclusion of Al2 York, New York: Mutagenic analy- Bussey, H.,' Tipper, D.J.,' Bostian, DS RNA by L-A-HN and mktl, sis of two a-factor genes. K.A.,' 'Dept. of Biology, McGill if M and L-A-HN are present, con-Becker, J.M.,' Pousman, C.,' Lipke, University,Montreal,Canada; fer cold sensitivity. P.,' Baffi, R.,' Shenbagamurthi, P.,3 'Dept. of Molecular Genetics and Naider, F.,' 'Dept. of Microbiology, Microbiology, University of Mas- Ball, S.G., Wickner, R.B., National Bethesda, University of Tennessee, Knox- sachusetts Medical School, InstitutesofHealth, Maryland: Genetic control of L-A ville; 'Dept. of Biological Sci- Worcester; 'Division of Biology and ences, Hunter College, New York, Medicine, Brown University, Prov- and L-(BC) DS RNA copy number. New York; 'Dept. of Chemistry, idence, Rhode Island: Secretion of Wesolowski, M., Wickner, R.B., Na- College of Staten Island, New York: yeast killer toxin-Processing of the tional Institutes of Health, Be- Activity of a-factor analogs. glycosylated precursor. thesda, Maryland: Two new DS RNAs (T and W) showing non-Lipke,P.,'Baffi, R.,' Becker, J.,2 Skipper, N., Thomas, D.Y., Lau, P., Mendelian inheritance in S. cere- Shenbagamurthi, P.,' Terrance, K.,' Division of Biological Sciences, Naider,F.,''Biochemistry Pro- National Research Council, Ot- visiae. gram, City University of New York, tawa, Canada: Cloning and se- New York; 'Dept. of Microbiology, quencing of a cDNA copy of the University of Tennessee, Knox- killer toxin-coding region of the M, Mating Type ville: a-Factor induced morphogen- DS RNA from S. cerevisiae. Miller, A.M., Nasmyth, K.A., Labo- esis and increased agglutinability Sclafani, R.A., Fangman, W.L., Dept. ratory of Molecular Biology, Cam- by different mechanisms. of Genetics,University of Washing- bridge, England: The MATal geneWagner, N., Terrance, K., Lipke, P., ton,Seattle: Production of con- is spliced. Dept.ofBiologicalSciences, served duplexes during killer DS Chaleff, D., Tatchell, K., Dept. of Bi- Hunter College, New York, New RNA replication in S. cerevisiae. ology, University of Pennsylvania, York: Properties of sexual agglutin- Bruenn, J.,Field, L., Holmes, G., Philadelphia: Conjugation in yeast ins of S. cerevisiae. Reilly, J.D., Chang, T.H., Division -An analysis of the STE7 STEllMargolskee, J.P., Herskowitz,I., ofCellandMolecularBiol- STE12 genes. Dept. of Biochemistry and Bio- ogy, State University of New York, Moore, S.A., Dept. of Genetics, Uni- physics, University of California, Buffalo: Heterogeneity of yeast versity of Washington, Seattle: S. San Francisco: Chromosome walk- viral DS RNAs and mapping of cerevisiae MATa cells recover from ing toward RME. viral genes. mating pheromone (alpha factor) - Li, A.W., Johnston, G.C., Singer, Thiele, DJ., Hannig, E.M., Leibow- induced cell-division arrest by be- R.A., Faculty of Medicine, Dalhou- itz, M.J., Dept. of Microbiology, coming insensitive to pheromone, in sie University, Halifax, Nova Sco- UMDNJ-Rutgers Medical School, the absence of pheromone destruc- tia,Canada: Mating ability and Piscataway, New Jersey: Structure tion. chemically induced G, arrest.

200 Russell, D.,' Burke, J.,' Smith, M.,' Deletion of the actin intron from S. causes lethality of omnipotent sup- Jensen,R.,2Herskowitz,I.,' cerevisiae has no apparent effect. pressors. 'University of British Columbia, Kohli, J.,' Grossenbacher, A.,' Heyer, Soidla, T.R., Dept. of Genetics, Len- Vancouver, Canada; 2University of W -D.,' Stadelmann, B.,' Thuriaux, ingrad University, USSR: One more California, San Francisco: Nucleo- P.,' Ebert, R,2 Kersten, H.,2 Kuo, way to make ends meet- A possible tide sequence of the HO gene and K.,2Agris,P.,3Gehrke,C.,3 role of tRNA in splicing. flanking sequences required for a/ 'Institute of General Microbiology, a control of transcription University of Bern, Switzerland; 2Institute of Physiological Chemis-Mitochondria try, University of Erlangen, FederalTabak, H.F., Osinga, K.A., Van der RNA Processing Republic of Germany; ;Division of Bliek, A.M., De Vries, E., Groot Last, R., Woolford, J.L., Dept. of Bi- Biological Sciences, University of Koerkamp, M.J.A., Section for Mo- ological Sciences, Carnegie-Mellon Missouri: Antisuppressors of S. lecular Biology, Laboratory of Bio- University, Pittsburgh, Pennsylva- pombe leading to loss of tRNA chemistry, Amsterdam, The Neth- nia: Isolation and characterization modification at the anticodon. erlands: Initiation of transcription of genes necessary for pre-mRNA Eigel, A., Nelbock, P., Hauber, J., of yeast mtDNA. processing in yeast. Feldman, H., Institut fiir Physiolo-Poutre, C.G., Fox, T.D., Section of Soltyk, A., Tropak, M., Friesen, J.D., gischeChemie,Physikalische Genetics and Development, Cornell Dept. of Medical Genetics, Univer- Biochemie and Zellbiologie der University,Ithaca, New York: sity of Toronto, Ontario, Canada: UniversitAt Mfinchen, Federal Re- Characterization of a nuclear mu- Molecular cloning of S. cerevisiae public of Germany: Organizational tation, petE11-1, that affects mito- putative RNA splicing gene. patterns of yeast tRNA genes. chondrial gene expression and can Laten, H.M., Biology Dept., Loyola Toda, T., Nakaseko, Y., Niwa, 0., be partially suppressed by a mito- University of Chicago, Illinois: An- Yanagida, M., Dept. of Biophysics, chondrial mutation. tisuppression of class-I supersup- Faculty of Science, Kyoto Univer-Mueller, P., Fox, T.D., Section of Ge- pressors in S. cerevisiae. sity, Japan: Localization of major netics and Development, Cornell Elion, E.A., Warner, J.R., Albert rDNA repeats in the nucleolus-as- University, Ithaca, New York: Mo- EinsteinCollege of Medicine, sociating chromosome III of S. lecular cloning and genetic map- Bronx, New York: Transcription of pombe. ping of pet494, a nuclear gene spe- an individual rDNA repeat unit. cifically required for the expres- Mecklenberg, K.,' Sass, P ,2 Ralph, sion of oxi2. Pearson, N.J., Dept. of Biological D.,' Robinson, S.,' Mahler, H.R.,2 Sciences, University of Maryland Perlman, P.S.,' 'Dept. of Genetics Nagley, P., Vaughan, P.R., Linnane, Baltimore County,Catonsville: and MCD Program, Ohio State A.W., Dept. of Biochemistry, Mon- Further characterization of SRN1, a University, Columbus; 2Dept. of ash University, Clayton, Victoria, suppressor of RNA-processing-de- Chemistry,IndianaUniversity, Australia:Cotransformation of fective mutants. Bloomington:cis-dominantand yeast with mtDNA and the plasmid YEp13. Mendenhall, M.D., Fen, H., Culbert- trans-recessivesplicing-defective son, M.R., Laboratories of Ge- mutants in the oxi3 gene of yeast Cumsky, M.G., Trueblood, C.E., netics and Molecular Biology, Uni- mtDNA. McEwen, J.E.,Ko, C., Poyton, versity of Wisconsin, Madison: Use Breitenbach, M., Hall, B.D., Dept. of R.O., Dept. of Molecular, Cellular of a selective labeling procedure to Genetics, University of Washing- and Developmental Biology, Uni- identify the major yeast glycine ton, Seattle: Isolation of yeast nat- versity of Colorado, Boulder: Mo- tRNA isoacceptors. ural suppressor genes that cause lecular cloning of cytochrome c ox- idase nuclear genes. Edelman, I., Culbertson, M.R., Lab- readthrough of the UGA stop co- oratories of Genetics and Molecu- don. Deters, D.W., Ewing, M., Dept. of lar Biology, University of Wiscon- Microbiology, University of Texas, Fabian, G.R., Hopper, A.K., Hershey Austin: Identification of mitochon- sin, Madison: A recessive lethal Medical Center, Pennsylvania: Fur- frameshift suppressor in yeast. drial translation products in various ther characterization of a tempera- yeasts. Mertins, P., Gallwitz, D., Physiolo- ture-sensitive lesion affecting rRNA gisch-Chemisches Institut I, Uni- processing. Najarian, D.R., Martin, N.C., Dept. versitat Marburg, Lahnberge, Fed- of Biochemistry,University of Nolan, S.L., Hopper, A.K., M.S. Texas Health Science Center, Dal- eral Republic of Germany: Single Hershey Medical Center, Hershey, intronless actin gene in the fission las: Mitochondrial tRNAA.P biosyn- Pennsylvania: Isolation and char- thesis in syn- and petite mutants of yeast S. pombe -Its nucleotide se- acterization of a set of mutations quence, its transcripts, and the pro- yeast. that suppress rnal-1. tein it codes for. Khan, N.A., Mendelsohn, A., Eisen- Weeks-Levy, C., Rothstein, R., Dept. Lee, M.G.,' Young, R.A.,2 Beggs, berg, H., Gaskin, S., Dept. of Bi- of Microbiology, UMDNJ-New Jer- J.D.,' 'Cancer Research Campaign, ology, Brooklyn College, New sey Medical School, Newark: Se- Eukaryotic Molecular Genetics Re- York: Concomitant reversion of the quences necessary for transcription search Group, Dept. of Biochemis- petitite mutants induced by man- of the yeast amber suppressor gene, try, Imperial College of Science and ganese on glycerol and maltose England; SUP3-a. Technology,London, plates in yeast. 2Dept. of Biochemistry, StanfordColson, A.M., Meunier, B., Labora- Ng, R.,' Domdey, H.,2 Rossi, J.J.,3 University School of Medicine, Abelson, J.,2 'Dept. of Chemistry, toire de Cytogenetique, Universite California: Cloning of the RNA-2 de Louvain, Belgium: Diuron-re- UniversityofCalifornia,San gene from S. cerevisiae. Diego; 2Dept. of Biology, Califor- sistant mutant of S. cerevisiae, se- nia Institute of Technology; 3Dept. Liebman, S.W., All-Robyn, LA., lected on DL-lactate, presents nei- of Molecular Genetics, City of University of Illinois, Chicago: A ther a mitochondrial nor a typical Hope Hospital, Duarte, California: non-Mendelian element,e*,that nuclear heredity.

201 Secretion Julius,D.J.,1,2 Blair, L.C.,' Brake, and the synthesis and secretion of Ramirez,R.M.,Atkinson,K.D., A.J.,3Thorner,J.,'Depts.of mammalian proteins in yeast. Dept. of Biology, University of 'Microbiology and Immunology,Burn, V.,' Buckholz, R.,2 Adams, B.,' California, Riverside: Secretion 'Biochemistry, University of Cali- Bostian,K.,''Brown University, proceeds uncoupled from plasma fornia, Berkeley; 'Chiron Corpora- Providence, Rhode Island; 'Uni- membrane growth in sucrose-grown tion, Emeryville, California: Yeast versity of Pittsburgh, Pennsylvania; inositol-starved yeast. pheromone biosynthesis - Overgly- 'University of Hawaii, Honolulu: cosylation of prepro-a-factor in Analysis of a putative processing Cuoto, J.R., Huffaker, T.C., Robbins, kex2 mutants. RW., Dept. of Biology and Center mutant of yeast a-galactosidase. for Cancer Research, Massachu-Brown, RA., Perlman, D., Halvor-Wise, J.A., Guthrie, C., University of setts Institute of Technology, Cam- son, H.O., Rosenstiel Center, Bran- California, San Francisco: Genetic bridge: Cloning and expression of a deis University, Waltham, Massa- analysis of the role of 7S RNA in mannosyl transferase in the N- chusetts: Investigation of the role of protein secretion. linked protein glycosylation path- the signal sequence in the secretion of yeast invertase. Heyer, W-D.,' Amstutz, H.,' Szan- way. kasi, P.,' Koh li, J.,' Aebi, R.,' Gys- Runge, K.W., Robbins, P.W., Dept. ofBitter,G.A., Chen, K.K., Banks, ler, C.,' Munz, P.,' Gamulin, V.,' Biology and Center for Cancer Re- A.R., Lai, P.-H., Amgen, Thou- Soli, D.,' Leupold, U.,' 'Institute of search, Massachusetts Institute of sand Oaks, California: Secretion of General Microbiology, University Technology, Cambridge: Two yeast foreign peptides from S. cerevisiae of Bern, Switzerland; 'Dept. of mutants in asparagine-linked directed by a-factor gene fusions. Molecular Biophysics and Bio- glycosylation. Singh, A.,' Lugovoy, J.M.,' Chen, chemistry,Yale University, New Call, R, Schekman, R., Dept. of Bio- E.Y.,' Perry, J.,2 Kohr, W.J.,2 Hitze- Haven, Connecticut:Intergenic chemistry, University of Califor- man, R.A.,' Depts. of 'Molecular conversion in a family of serine nia, Berkeley: Golgi isolation from Biology;'ProteinBiochemistry, tRNA genes in S. pombe. a yeast secretory mutant-Presence Genentech, Inc., South San Fran- of secreted and vacuolar enzymes. cisco, California: a-Factor genes Killer Workshop

SESSION 10 Mating Type Chairperson:A. Klar, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Siliciano, P., Tatchell, K., Dept. of Hagen, D., McCaffrey, G., Sprague, mutations on homothallic switching Biology, University of Pennsylva- G., Institute of Molecular Biology, of yeast mating-type genes. nia, Philadelphia: Deletion map- University of Oregon, Eugene:Schnell, R., Kimmerly, W, Rine, J., ping in the MATaTMATcr2 inter- Regulation of a-specific STE3 gene Dept. of Biochemistry, University genic region. and a possible role for the STE3 of California, Berkeley: Genetic in- product in mating. Brake, A.J.,' Najarian, R.C.,' Lay- teraction between the genes con- bourn, P.J.,'Thorner, J. W., Stet ler, G.L., Thorner, J., Dept. of trolling expression of thesilent 2Merryweather, J.P.,' 'Chiron Re- Microbiology and Immunology, mating-type genes in S. cerevisiae. search Laboratories, Chiron Cor- University of California, Berkeley: Hicks,J.,Strathern,J.,Klar, A., poration, Emeryville, California; Yeast pheromone action-Isolation Abraham, J., Ivy, J., Kelly, M., Ste- 'Dept. of Microbiology and Immu- and characterization of genes under phens, C., Cold Spring Harbor nology, University of California, transcriptional control by a-factor. Laboratory, New York: Mating-type Berkeley: Identification and char- Beach, D., Klar, A., Cold Spring switching and control of gene acterization of a structural gene for Harbor Laboratory, New York: expression. the yeast peptide mating phero- Mating-type switching in fissionWilson, K.L., Herskowitz, I., Dept. mone a-factor. yeast. of Biochemistry and Biophysics, Ammerer, G.,' Tatchell, K.,2 Spra- Stern, M., Jensen, R., Herskowitz, I., University of California, San Fran- gue, G.,3 'Zymos Corp., Seattle, Dept. of Biochemistry and Bio- cisco: Analysis of the STE6 gene Washington; 2Dept. of Biology, physics, University of California, and its expression. University of Pennsylvania, Pitts- San Francisco: Five SWI genes are burgh; 'Institute of Molecular Bi- required for HO expression. ology, University of Oregon, Eu- Haber, J., Stewart, S., Weiffenbach, gene:Regulation of a-specific B., Brandeis University, Waltham, genes. Massachusetts: Effect of various

SESSION 11RNA Processing and tRNA Suppressors Chairperson:J. Abelson, University of California, San Diego, La Jolla, California Gallwitz, D., Langford, C.J., Klinz, public of Germany: Splicing ofKaufer, N.F., Warner, J.R., Albert F.-J., Donath, C., Physiologisch- RNA polymerase II transcripts in S. EinsteinCollege of Medicine, Chemisches Institut I, Universitat cerevisiae requires an intron-con- Bronx, New York: Effect of intron Marburg, Lahnberge, Federal Re- tained conserved sequence element. deletions on the cyh2 gene.

202 isaffectedbysinglenuclear consin, Madison: Frameshift sup- Teem, J.,' Pikielny, C.,2 Rosbash, M.,' mutationsoutsidethe Depts. of 'Biology, 'Biochemistry, mutations. pressor Waltham, anticodon in proline tRNAs con- BrandeisUniversity, Thompson, J.R.,' Last, R.,2 Larkin, taining an intervening sequence. Massachusetts: A conserved se- J. Z.,2 Levy, A.,2 Woolford, J.L.,2 quence within mRNA introns is re- Wakem, P.,' Consaul, S.,' Wilhelm, Fournier, M.J.,' 'Dept. of Biochem- of quired for splicing and may be a istry, University of Massachusetts, J.,'Sherman,F.,'Depts. counterpart of U1 snRNA of Amherst; "Dept. of Biological Sci- 'Radiation Biology and Biophysics, metazoans. 'Microbiology, University of Roch- ences, Carnegie-Mellon University, ester School of Medicine, New Parker, R., Guthrie, C., Dept. of Bio- Pittsburgh, Pennsylvania: A yeast snRNA is tightly linked to a ribo- York: Isolation and characteriza- chemistry and Biophysics, Univer- tion of omnipotent suppressors. sity of California, San Francisco: somal protein gene. Genetic analysis of mRNA splicingTollervey, D., Wise, J.A., Dunn, E.J., Willis, I., Chisholm, V., Pearson, D., Schaack, J., Frendewey, D., Soli, in S. cerevisiae. Maloney, D., Guthrie, C., Dept. of Biochemistry and Biophysics, Uni- D., Dept. of Molecular Biophysics Hopper, A.K.,' Hurt, D.J.,' Morales, versity of California, San Fran- and Biochemistry, Yale University, M.,2 Martin, N.C.,' 'Dept. of Bio- cisco: Yeast snRNAs - Characteri- New Haven, Connecticut: Second- logical Chemistry, M.S. Hershey zation and genetic analyses of U2 site mutations in the sup3-e and Pennsylvania; MedicalCenter, and U4 analogs. sup9-e loci of S. pombe-New in- 'Dept. of Biochemistry, University sights on transcription and process- of Texas Health Science Center, Cummins, C.M., Culbertson, M.R., ing of eukaryotic tRNAs. Dallas: Modification of both cyto- Laboratories of Genetics and Mo- plasmic and mitochondrial tRNAs lecular Biology, University of Wis-

SESSION 12 Mitochondria Chairperson:F. Sherman, University of Rochester Medical Center, Rochester, NewYork Haldi, M.L., Anziano, P.Q., Perl- York; 'Dept. of Biological Sci- tants altered in nuclear structural genes for cytochrome oxidase sub- man, P.S., Genetics Dept. and MCD ences, Columbia University, New Program, Ohio State University, York, New York: Yeast nuclear gene units. Columbus: New insights into cis- required for the correct expression Grivell, L.A., Van Loon, A.P.G.M., acting domains in yeast mitochon- of a mitochondrial cytochrome De Haan, M., Maarse, A.C., Sec- drial introns. oxidase gene. tion for Molecular Biology of the Laboratory of Biochemistry, Uni- Novitski, C.E., John, U.R, Ooi, B.-Underbrink-Lyon, K., Miller, D., Ross, N., Martin, N., Dept. of Bio- versity of Amsterdam, The Nether- G., McMullen, G.L., Macreadie, lands: Protein import by mitochon- I.G., Maxwell, R.J., Choo, W.M., chemistry, Division of Molecular Biology, University of Texas Health dria.Characterizationandex- Watkins, L.C., Marzuki, S., Lu- pression of genes coding for im- kins, H.B., Linnane, A.W., Nag ley, Science Center, Dallas: Deletion and restriction mapping of a mito- ported subunits of the ubiquinol- P., Dept. of Biochemistry, Monash cytochrome c reductase. University, Clayton, Victoria, Aus- chondrial gene required for yeast tralia: Mitochondrial aapl gene mitochondrial tRNA biosynthesis. McCammon, M.,' Geller, B.,' Emr, coding for mitochondrial ATPaseMueller, P., Reif, M.K., Fox, T.D., S.,2 Douglas, M.,' 'Dept. of Bio- subunit 8 -Nature of mutants and SectionofGeneticsandDe- chemistry, University of Texas mitochondrial revertants. velopment, Cornell University, Ith- Health Science Center, San Anto- aca, New York: The pet494-1 mu- nio; 'Dept. of Biology, California Szekely, E., Montgomery, D., Dept. tation blocks a posttranscriptional Institute of Technology, Pasadena: of Biochemistry, University of step leading to accumulation of cy- Targeting and mitochondrial im- Texas Health Science Center, San tochrome oxidase subunit III, but it port of ATP2-lacZ fusion protein. Antonio: Glucose represses tran- can be suppressed by a mitochon- Sor, F.,' Bolotin-Fukuhara, M.,2 Fu- scription of nuclear genes coding drial gene rearrangement. kuhara, H.,' 'Institut Curie, Section for mitochondria! components. McEwen, J.E.,Ko.,C., Cumsky, de Biologie; 2Laboratoire de Biolo- Prezant, T., Guarente, L., Dept. of M.G., Forrester, H., Kloeckener- gie Generale, Faculte des Sciences, Biology, Massachusetts Institute of Gruissem, B., Poyton, R.O., Dept. Orsay, France: Mutations of the mi- Technology, Cambridge: Regula- of Molecular, Cellular and Devel- tochondrial gene coding for the tion of mitochondrial genes in S. opmental Biology, University of large rRNA -Identification and lo- cerevisiae. Colorado, Boulder: Genetics of mi- calization on the secondary struc- ture model of the RNA. Bonitz,S.,'Tzagoloff, A.,2'Cold tochondrial membrane biogenesis in Spring Harbor Laboratory, New S. cerevisiae-Identification of mu-

SESSION 13Secretion and Protein Localization Chairperson:E.W. Jones, Carnegie-Mellon University, Pittsburgh, Pennsylvania Flessel, biosynthesis- Use of an a-factor- Jones, E.W,' Hospodar, M.,' Stevens, Emr, S.,' Schekman, R.,' T.,2 'Dept. of Biological Sciences, M.C.,2 Thorner,J.,'Depts. of invertase (MFal-SUC2) gene fu- 'Biochemistry, 'Microbiology and sion to study protein localization Carnegie-Mellon University, Pitts- and cell-type-specific gene expres- burgh, Pennsylvania; 2Dept. of Immunology, University of Califor- Biochemistry, University of Califor- nia, Berkeley: Yeast pheromone sion.

203 nia, Berkeley: Mutations of yeast cleavage of hybrid invertase signals Barnes, G., Hansen, W, Holcomb, C., that affect processing of vacuolar and mature forms of human inter- Rine,J., enzyme precursors. Dept. of Biochemistry, feron (IFN-a2) in yeast. University of California, Berkeley: Stevens, T.H.,' Emr, S.D.,2 'Institute Identification of genes and muta- of Molecular Biology, University of Moreland, R.B.,'Rozdzial, M.,2 tions affecting an enzyme of the en- Oregon, Eugene; 2Division of Bi- Hereford, L.,' 'Dana-Farber Can- doplasmic reticulum. ology, California Institute of Tech- cer Institute and Dept. of Microbi- ology and Genetics, Harvard Medi- Huffaker, T., Robbins, P.W., Dept. of nology, Pasadena: Intracellular lo- Biology and Center for Cancer Re- calization of carboxypeptidase Y- cal School, Boston, Massachusetts; 'Dept. of Biology, University of search, Massachusetts Institute of LacZ fusion proteins in yeast. Technology, Cambridge: Mutants Schauer, I., Emr, S., Schekman, R., California, Riverside: Nuclear lo- deficient in protein glycosylation. Dept. of Biochemistry, University calization of yeast histones. Ogrydziak, D.M., Fukayam, J.W., In- of California, Berkeley: SUC2 mu- Hall, M.N.,' Hereford, L.,' Herskow- stitute of Marine Resources, Uni- tants defective for secretion of ac- versity of California, Davis: Pre- tive invertase. itz, I.,' 'Dept. of Biochemistry and Biophysics, University of Califor- cursorsandprocessingofthe Chang, C.N., Matteucci, M., Perry, nia, San Francisco; 'Sidney Farber alkaline extracellular protease of S. J., Chen, C.Y., Hitzeman, R.A., Cancer Institute, Boston, Massa- lipolytica. Genentech, Inc., South San Fran- chusetts: Targeting of proteins to cisco, California: Recognition and- the nucleus.

PHAGE AND BACTERIAL REGULATORYMECHANISMS August 23-August 28

SESSION 1Regulatory Mechanisms I

Danchin, A.,' Guiso, N.,2 Roy, A.,' Microbiology,TuftsUniversity ogy, University of California, Ir- Ullmann, A.,' 'Institut de Biologie School of Medicine, Boston, Mas- vine: Structure and regulation of the Physico-Chimique, Paris;' Institut sachusetts: Regulation and autoreg- Tn10 and pSC101 tetracycline-re- Pasteur, Paris, France: Structure ulation of the dnaA gene in E. coli sistance determinants. and regulation of adenylate cyclase K12. in E. coli. Wolf, R.E., Jr., Baker, H.V. II, Dept. Maloy, S., Menzel, R., Roth, J., Dept. of Biological Sciences, University Aiba, H., Radioisotope Laboratory, of Biology, University of Utah, Salt of Maryland, Baltimore County, Faculty of Medicine, Kyoto Univer- Lake City: Genetic regulation by a Catonsville: A site within the 6- sity, Japan: CRP-cAMP regulates membrane-bound protein-Cloning phosphogluconate dehydrogenase- negatively the cya gene transcrip- and characterization of the regula- codingsequenceformaximal tion in vitro. tory sites of the put operon. growth-rate-dependentexpression Nieuwkoop,A.J.,Boylan,S.A., Hu, J.C., Gross, C.A., Dept. of Bac- of gnd-lac gene fusions. Bender, R.A., Division of Biologi- teriology, University of Wisconsin,Garrett, S., Taylor, R.K., Sodergren, cal Sciences, University of Michi- Madison: Mutations of the a sub- E.J., Silhavy, T.J., NCI, Frederick gan, Ann Arbor: Regulation of unit of E. coli RNA polymerase that Cancer Research Facility, Freder- hutUH operon expression by the affect expression of the ara operon. ick, Maryland: Regulation of porin CAP-cAMP complex in K. aero- expression in E. coli K12. genes -"Double-negative" control. Mizusawa, S., Court, D., Gottesman, S., NCI, National Institutes ofFrench, S.,' Martin, K.,' Patterson, Menzel, R., Gellert, M., NIADDK, Health, Bethesda, Maryland: Cell T.,2 Bauerle, R.,' Miller, 0.L., Jr.,' National Institutes of Health, Be- division regulation- Transcription 'Dept. of Biology, University of thesda, Maryland: Analysis of the of the sulA gene and repression by Virginia,Charlottesville; 'Cold control of gyrB gene expression. LexA. Spring Harbor Laboratory, New York: Electron microscopic visual- Braun, R., O'Day, K., Wright, A., Nguyen, T., Postle, K., Isackson, D., ization of trp operon expression in Dept. of Molecular Biology and Bertrand, K., Dept. of Microbiol- S. typhimurium.

SESSION 2Regulatory Mechanisms II

Magasanik, B., Hunt, T., Ueno-Ni- Batik, S., Bhattacharya, P., Das, A., Lupski, J., Ruiz, A.A., Godson, G.N., shio, S., Reitzer, L., Bueno, R., University of Connecticut School of Biochemistry Dept., New York Dept. of Biology, Massachusetts Medicine, Farmington: Regulation University Medical Center, New Instituteof Technology, Cam- of rho - Alterations of the protein York: Regulation of the rpsU-dnaG- bridge: Transcriptional and trans- and depression of the gene activity. rpoD macromolecular synthesis op- lational regulation of the complex eron of E. coli K12. glnALG operon. Shigesada, K., Matsumoto, Y., Tsu- rushita, N., Hirano, M., Imai, M., Garges, S., Adhya, S., NCI, National Institute for Virus Research, Kyoto Grossman, A.D., Gross, C.A., Dept. Institutes of Health, Bethesda, University, Japan: Attenuation con- of Bacteriology, University of Wis- Maryland: Regulation of expres- trol of the gene for transcription consin, Madison: Regulation of the sion of the rho gene of E. coli. termination factor rho in E. coli. a operon of E. coli.

204 Burton, Z.,' Watanabe, K.,' Gross, mique, Paris, France: Transcrip- Western Ontario, London, Canada: C.,' Burgess, R.,' 'McArdle Labo- tional control of polarity in lactose Structure and expression of the gene ratory for Cancer Research; 'Dept. and galactose operons in E. coli by for ribosomal protein S20. of Bacteriology, University of Wis- cAMP. Cerretti, D.P., Nomura, M., Institute consin, Madison: Structure of the Zengel, J.M., Archer, R.H., Lindahl, operon that encodes the sigma sub- for Enzyme Research, University of L., Dept. of Biology, University of Wisconsin, Madison: The spc ope- unit of RNA polymerase from S. ty- Rochester, New York: Attenuation phimurium. ron of E. coli -Localization of the control of the S10 ribosomal pro- S8 repressor target site in the S8 Guidi-Rontani, C.,' Danchin, A.,2 tein operon. translational control unit. Ullmann, A.,''Institut Pasteur; Mackie, G.A., Parsons, G.D., Dept. 'Institut de Biologie Physico-Chi- of Biochemistry,University of

SESSION 3 Regulatory Mechanisms III

Sambucetti, L., Silverman, P., Albert of capsular polysaccharide synthe- tion of the phosphate regulon in E. Einstein College of Medicine, sis in E. coli K12. coli. Bronx, New York: Regulation of conjugative plasmid transfer geneStrauch, K., Miller, C., Dept. of Mo-Lau,E.T.,'Landick,R.,2Van- expression in E. coli. lecular Biology and Microbiology, Bogelen, R.A.,' Neidhardt, F.C.,' Case Western Reserve University, 'Dept. of Microbiology and Immu- Krylov, V.N., Yanenko, A.S., Gorbu- Cleveland, Ohio: S. typhimurium nology; 'Dept. of Biological Chem- nova, S.A., Institute for Genetics of genes regulated by growth phase. istry, University of Michigan, Ann Microorganisms, Moscow, USSR: Arbor: Regulatory gene for the heat- RP4-promoted expression of a si-Young, F.S.,' Furano, A.V.,' Cashel, shock response in E. coli. lent genetic material and SOS ef- C.M., 'Dept. of Molecular Biology, fects in E. coli and P. aeruginosa. Genentech, Inc., South San Fran-Woolford, C.,' Hendrix, R.,' Tilly, cisco,California; 2NIADDK, K.,2 Georgopoulos, C.,' 'Dept. of Brooks, J.E.,' Theriault, G.,' Gin- Biological Sciences, University of geras, T.R.,' 'Cold Spring Harbor 'NICHHD, National Institutes of Health, Bethesda, Maryland: The Pittsburgh, Pennsylvania; 'Dept. of Laboratory, New York; 'Dept. of Biochemistry and Molecular Biol- Biochemistry, Universite Laval, tufB gene is essential for the regu- lation of growth by E. coli. ogy, Harvard University, Cam- Quebec,Canada:Controlof bridge, Massachusetts; 'Dept. of expression of a type-II restriction-Sarmientos, P., Cashel, M., NICHHD, Cellular, Viral, and Molecular Bi- modification system fr9rn P. aeru- National Institutes of Health, Be- ology, University of Utah Medical ginosa. thesda, Maryland: The rrnA down- Center, Salt Lake City: Studies on Bhagwat, A., Brooks, J.,Starr, P., stream P2 promoter behaves as a the E. coli heat-shock genes, groEL Gingeras, T., Cold Spring Harbor maintenancepromoterduring and groES. Laboratory, New York: Cloning and growth rate control and carbon starvation. Freundlich, M., Friden, P., Tsui, P., analysis of EcoRII restriction-mod- Dept. of Biochemistry, State Uni- ification genes. Shinagawa, H., Makino, K., Ame- versity of New York, Stony Brook: Torres-Cabassa, A., Gottesman, S., mura, M., Nakata, A., Research In- IHF -A global regulator in E. coli? NCI, National Institutes of Health, stitutefor Microbial Diseases, Bethesda, Maryland: Ion regulation Osaka University, Japan: Regula-

SESSION 4 Nusness

Franklin, N.C., Biology Dept., Uni-Haber, R.,' Levin, J.,' Carver, D.,' Canada: Interactions among the versity of Utah, Salt Lake City: N Friedman, D.,' Adhya, S.,' 'NCI, nusA and RNA polymerase of E. antitermination proteins of X, 021, National Institutes of Health, Be- coli and the N-gene protein of bac- and P22 -Initial probings by com- thesda, Maryland; 'University of teriophage X. parison and by mutation. Michigan, Ann Arbor: Characteri-Lau, L.F., Roberts, J.W., Wu, R., Schauer, A.T., Friedman, D.I., Dept. zation of the nusA gene of E. coli. Dept. of Biochemistry, Cell and of Microbiology and Immunology, Shoemaker, K., Wolska, K., Das, A., Molecular Biology, Cornell Univer- University of Michigan Medical University of Connecticut School of sity, Ithaca, New York: Transcrip- School, Ann Arbor: X and P22 an- Medicine, Farmington: Modulation tion termination at XtR 1. titerminator interactions with phage of transcription termination by nus- Zuber, M., Court, D., NCI, National sites and host factors. gene products. Institutes of Health,Bethesda, Olson,E.R.,' Tomich, C.-S.C.,'Warren, F., Shoemaker, K., Das, A., Maryland: Deletion analysis of Friedman, D.I.,' 'Dept. of Micro- University of Connecticut School of nutR and tR1 sites of phage X. biology and Immunology, Univer- Medicine, Farmington: FormationLeason, K.R., Baumann, M., Fried- sity of Michigan, Ann Arbor; of termination-resistant transcrip- man, D.I., Dept. of Microbiology 'Molecular Biology Research, Up- tion complex at nut locus-Evi- and Immunology, University of john Co., Kalamazoo, Michigan: dence bearing on a tentative model. Michigan, Ann Arbor: Analysis of Evidence that a unique nucleotideGreenblatt, J., Li, J., Dulhanty, A., the nin region. sequence, "boxA," is involved in the Banting and Best Dept. of Medical Kroger, M., Decker, T., Hobom, G., action of the nusA-gene product. Research, University of Toronto, Universitat Frieburg,Institut fur

205 motogie, Federal Republic of Ger-Chinali, G., Sarmientos, R, Glaser, land: A plasmid rrnA clone that re- many: Control mechanism for the G.,Mozer,B.A.,Cashel, M, stricts phage X growth. expression of bacteriophage X late NICHHD, National Institutes of control gene Q. Health, Bethesda, Maryland: Ribo-Malik, S., Goldfarb, A., Dept. of Mi- Grayhack, E.J., Lau, L., Hart, C., somal RNA operon transcription crobiology, Columbia University termination and antitermination. College of Physicians and Sur- Goliger, J., Verner, K., Yang, X., geons, New York, New York: Ef- Roberts, J.W., Section of Biochem- fect of bacteriophage-T4-induced istry, Molecular and Cell Biology, Gottesman, M.E.,' Chinali, G.,2 Sar- modification of RNA polymerase Cornell University, Ithaca, New mientos, P.,' Mozer, B.,2 Cashel, on rho-dependent and rho-inde- York: Antitermination by purified M.,2 'NCI; ' NICHHD, National In- pendent termination. X Q-gene protein in vitro. stitutes of Health, Bethesda, Mary-

SESSION 5 Poster Session

Ad ley,C.C., Bukhari,A.I., Cold vine: Mutations in the divergent tion of bacteriophage N4 deletion Spring Harbor Laboratory, New overlapping promoters that control mutants. York: Methylation-dependent ex- Tn10 tetA and tetR. pression of the mom gene of bacte- Eliason, J.L., Ptashne, M., Dept. ofKoop, A.H., Bourgeois, S., Regula- riophage Mu -The promoter is lo- Biochemistry and Molecular Biol- tory Biology Laboratory, Salk In- cated about 200 by downstream ogy, Harvard University, Cam- stitute, San Diego, California: The from the methylation sites. isolation and characterization of bridge, Massachusetts: The bases in Bear, S.E.,' Court, D.L.,2 Friedman, cAMP receptor protein mutants in the phage X operators recognized by E. coli. D.,' 'NCI, National Institutes of repressor and Cro- A mutational Health, Bethesda, Maryland; 'Dept. study. Kutsukake, K., Dept. of Biology, Uni- of Microbiology, University ofFranklin, N.C., Biology Dept., Uni- versity of Tokyo, Japan: Invertible Michigan Medical School, Ann Ar- versity of Utah, Salt Lake City: DNA in E. coli. bor: Characterization of a X mutant that grows with reduced efficiency Conservation of structure but notLifson, E.,' Zengel, J.,2 Lindahl, L.,' on integration host factor (IHF) sequence in the DNA coding for Depts. of 'Microbiology, 'Biology, mutants of E. coli. transcription of the N region in bac- University of Rochester, New York: teriophages X, 4,21, and P22. An altered form of EFTu from E. Brown, A.,' Drahos, D.,' Szybalski, Freedman, L.P., Zengel, J.M., Lin- coli is associated with the outer W,' 'McArdle Laboratory for Can- membrane. cer Research, University of Wis- dahl, L., Dept. of Biology, Univer- consin, Madison; 'Corporate Re- sity of Rochester, New York: Study Lin, C.-S.,' Six, E.,' Christie, G.E.,2 search Laboratory, Monsanto Co., of autogenous regulation of the SIO Dale, E.,' Calendar, R.,' 'Micro- St. Louis, Missouri: Synthesis and operon of E. coli using gene fusion biology Dept., University of Iowa, effect of transcription antitermina- plasmids. Iowa City; 'Molecular Biology tion of the postulated NusA-pro- Goldfarb, A., Malik, S., Dept. of Mi- Dept., University of California, tein-binding sequence of E.coli crobiology, Columbia University Berkeley: Organization of the late phage X. College of Physicians and Sur- gene cluster of bacteriophage P4. Bussman,K.,Pelzer-Reith,B., geons, New York, New York: NewLopez, J., Webster, R.E., Dept. of Rasched, I., Fakultat fiir Biologie, promoter specificity resulting from Biochemistry,Duke University Universitat Konstanz, Federal Re- bacteriophage-T4-induced modifi- Medical Center, Durham, North public of Germany: Bacteriophage cation of RNA polymerase. Carolina: Filamentous phage fl ex- fd- Amplifying the expression ofGrundy, F.J., Howe, M.M., Dept. of trusion occurs at adhesion zones gene III (adsorption protein). Bacteriology, University of Wis- between the inner and outer mem- Chattoraj, D.K.,' Das, A.,' Cordes, consin, Madison: Phage particle branes of the host cell. K.,' 'NCI, Frederick Cancer Re- structures found in lysates of MuLynn, S.P.,' Burton, W,' Gould, R.,' search Facility, Frederick, Mary- amber mutants defective in essen- Gumport, Gardner,J.F.,' land; 'University of Connecticut tial genes. Depts. of 'Microbiology, 'Biochem- Health Center, Farmington: Muta- Guzman, P., Guarneros, G., Dept. of istry,University of Illinois,Ur- genesis and mutation transfer in- Genetics and Molecular Biology, bana:Oligodeoxyribonucleotide duced by UV in plasmid-cloned Centro de Investigacidn y de Estu- site-directed mutagenesis of the DNA. dios Avanzaos del IPN, Mexico threonine operon regulatory re- Craig, N.L., Nash, H.A., NIMH, Na- City, Mexico: Four regions in X gion. tional Institutes of Health, Be- phage genome are involved in rapPatterson, T.A.,' Bauerle, R.H.,' thesda, Maryland: art sites juxta- exclusion by E. coli. 'Cold Spring Harbor Laboratory, position during phage Xsite- Hodgson, D.A., Shapiro, L., Ame- New York; 'University of Virginia, specific recombination -Collison miya, K., Dept. of Molecular Biol- Charlottesville: A system for in versus sliding. ogy, Albert Einstein College of vivo cloning of mutant and wild- Craigie, R.A.,Mizuuchi, K., Medicine, Bronx, New York: In- type genes of the S. typhimurium trp NIADDK, National Institutes of duction of a protein kinase after in- operon. Health, Bethesda, Maryland: Clon- fection of C. crescentus by bacteri- Peterson,K.R.,'Mount, ing of bacteriophage Mu A and B ophage 4Cd1. D.W.,' proteins. 'Dept. of Molecular and Medical Hyman, D., Malone, C., Rothman- Microbiology, University of Ari- Daniels, D., Nguyen, T., Moyed, H., Denes, L.B., Dept. of Biophysics zona, Tucson: Characterization of Bertrand, K., Dept. of Microbiol- and Theoretical Biology, University noncleavable and hypocleavable ogy, University of California, Ir- of Chicago, Illinois: Characteriza- mutants of the E. coli lexA gene.

206 Shultz, J., Berman, M., NCI, Fred- nesota, Minneapolis: Terminal re- Laboratory, New York: Transposi- erick Cancer Research Facility, dundancy and cycle permutation in tion of IS5. Frederick, Maryland: Construction the group A streptococcal bacterio- Whalen, W.A., Berg, C.M., Biologi- of an E. coli tRNA suppressor gene phage SP24. cal Sciences Group, University of regulated by the lac operon pro- Sung, W.,1 Brousseau, R .,1 Narang, Connecticut, Storrs: avtA is under moter/operator. S.,1 Patterson, T.,2 Bukhari, A.I.,2 repressor control in E. coli K12. Spanier, J.G., Cleary, P.P., Dept, of 1National Research Council of Can- Microbiology, University of Min­ ada, Ottawa; 2Cold Spring Harbor

SESSION 6 Regulatory Mechanisms IV

Basu, S., Sarkar, P, Adhya, S., Sen- Lagos, R., Godstein, R., Dept, of University-Hadassah Medical School, gupta, D., Maitra, U., Albert Ein- Microbiology and Molecular Ge- Jerusalem, Israel: Regulation of stein College of Medicine, Bronx, netics, Harvard Medical School, phage X lysogenic response by the New York: Locations and nucleo- Boston, Massachusetts: Functions E. coli me gene. tide sequences of promoters for of satellite phage P4 affecting plas- Baker, T.A., Grossman, A.D., Gross, bacteriophage T3 RNA polymerase mid copy number. C.A., Dept, of Bacteriology, Uni- on T3 DNA. Abeles, A., Austin, S., Chattoraj, D., versity of Wisconsin, Madison: Markiewicz, P., Haynes, L .,1 Chase, Laboratory of Molecular Biology, Proteolysis defect in htpR mutants J.,2 Rothman-Denes, L.B.,1 1Dept, NCI, Frederick Cancer Research of E. coli. of Biophysics and Theoretical Bi- Facility, Frederick, Maryland: PI Baker, T.A., Gross, C.A., Dept, of ology, University of Chicago, Illi- plasmid maintenance. Bacteriology, University of Wis-: nois; 2Dept, of Molecular Biology, Blumer, K.J., Steege, D.A., Dept, of consin, Madison: Identification of Albert Einstein College of Medi- Biochemistry, Duke University genetic loci involved in nonessen- cine, Bronx, New York: Promoters Medical Center, Durham, North tial proteolysis in E. coli K12. for the bacteriophage N4 virion-en- Carolina: Host cell enzymatic ac- Burbee, D., Roberts, J.W., Field of capsulated RNA polymerase. tivity processes bacteriophage fl Biochemistry, Cornell University, Reyes, O., Section de Radiobiologie mRNAs. Ithaca, New York: Kinetics of LexA Cellulaire, Laboratoire d’Enzymo- Guarneros, G.,1 Galindo, J.M.,1 Bear, cleavage by RecA protease. logie du CNRS, Gif-sur-Yvette, S.,2 Court, D.,2 1Dept, of Genetics Hoyt, M .A.,1 Banuett, F.,2 Herskow- France: Toward a physiological un- and Molecular Biology, CINVES- itz, I.,2 Echols, H .,1 1Dept, of Mo- derstanding of bacteriophage 080 TAV, Mexico City, Mexico; 2NCI, lecular Biology, University of Cali- induction—A preliminary descrip- National Institutes of Health, Be- fornia, Berkeley; 2,Dept, of tion of some regulatory loci. thesda, Maryland: Retrostimula- Biochemistry and Biophysics, Uni- Christie, G.E., Calendar, R., Dept, of tion—Positive regulation of gene versity of California, San Fran- Molecular Biology, University of expression by a transcription ter- cisco: Control of phage X develop- California, Berkeley: Common fea- minator. ment by stability of ell protein— tures of bacteriophage P2 late gene Oppenheim, A.B., Altuvia, S., Dept, Characterization of the host hflA promoters. of Molecular Genetics, Hebrew degradati velfunction.

SESSION 7 Protein Processing and Phage Morphogenesis

Molineux, I.J., Schmitt, M., Con- Putterman, D.G.,1 Boyle, P.D.,1 Cas- cal School, Boston, Massachusetts: dreay, J.P., Dept, of Microbiology, adevall, A .,1 Yang, H.-L.,1 Fran- Adhesion mediated by the Pap pili University of Texas, Austin: Mu- gione, B.,2 Marzec, C.J.,1 Day, operon can be genetically separated tants of bacteriophage T3 that are L.A.,1 1Public Health Research In- from the presence of Pap pili fi- subject to F-mediated restriction. stitute of the City of New York; bers. 2Dept, of Pathology, New York Uni- Karam, J., Trojanowska, M., Daw- Berget, P.B., Schwarz, J., Chidam- versity School of Medicine, New son, M., Alford, C., Dept, of Bio- baram, M., Dept, of Biochemistry York: Genomic sequence of the fil- chemistry, Medical University of and Molecular Biology, University amentous phage Pf3. South Carolina, Charleston: Mo- of Texas Medical School, Houston: lecular cloning, nucleotide se- Krikos, A .,1 Mutoh, N .,1 Boyd, A.,2 Assembly-defective phage P22 tail quence, and expression of the regA Simon, M.,1 1Division of Biology, protein mutants. gene of T4 phage. California Institute of Technology, Casjens, S., Hayden, M., Dept, of Pasadena; 2Leicester Biocentre, Macdonald, P.,1 Kutter, E.,2 Mosig, Cellular, Viral and Molecular Biol- Medical Sciences Building, Eng- G.,1 1Dept, of Molecular Biology, ogy, University of Utah Medical land: Sensory transducers o f E. Vanderbilt University, Nashville, Center, Salt Lake City: Bacterio- coli-^ Structural and functional do- Tennessee; 2Evergreen State Col- phage P22 headful DNA packag- mains. lege, Olympia, Washington: Regu- mg. lation of a late bacteriophage T4 Normark, S.,1 Norgren, M .,1 Lark, Sternberg, N., Hoess, R., NCI, Fred- gene, soc, which maps in an early D.,2 O’Hanley, P.,2 Schoolnik, G.,2 erick Cancer Research Facility, region. Uhlin, B.E.,1 Svanborg-Eden, C.,3 Frederick, Maryland: The PI pac- McGraw, T., MacKenzie, G., Min- Falkow, S.,2 Goldstein, R.,4 cutting system—Possible involve- dich, L., Public Health Research 1University of Umea, Sweden; ment in phage replication. Institute of the City of New York, 2Stanford University School of Inc., New York: cDNA cloning and Medicine, California; 3University of Mindich, L .,1 Bamford, D.,2 Me- sequencing of the 06 genome. Goteborg, Sweden; 4Harvard Medi­ Graw, T.,1 'Public Health Research

207 Institute of the City of New York, ogy, University of Oregon, Eugene; biology, University of Iowa, Iowa Inc., New York; 2 University of Hel- 'Dept. of Molecular Biology, Uni- City: Structure of X terminase. sinki,Finland: Bacteriophage versity of Edinburgh, Scotland: In PRD1 has terminal proteins on its vitro packaging of X DNA -A one-Murialdo, H., Fife, W, Becker, A., DNA. Dept. of Medical Genetics, Univer- component cos-less packaging sys- sity of Toronto, Canada: Xcos-cut- tem free from endogenous phages. Rosenberg, S.M.,' Stahl, M.M.,' Ko- ting in vivo in the absence of pro- bayashi, I.,' Leach, D.R.F.,2 Stahl, Frackman, S., Siegele, D.A., Mom- heads. F.W.,' 'Institute of Molecular Biol- any, T., Feiss, M., Dept. of Micro-

SESSION 8Tricks

Gottesman, M.E., Court, D., NCI, Mu-lac hybrid phage for creatingReynolds, A.E.,' Wright, A.,2 'Dana- National Institutes of Health, Be- lacZ gene fusions in a single step. Farber Cancer Research Institute, thesda, Maryland: A X vector for Boston; 'Tufts University, Boston, the cloning of prokaryotic pro- Hughes, K.T., Roth, J.R., Dept. of Massachusetts: Characterization of moters. Biology, University of Utah, Salt bglR mutations that activate the Wang, A., Roth, J., Dept. of Biology, Lake City: Mu-d8, a conditionally cryptic bgl operon of E. coli K12. University of Utah, Salt Lake City: transposition-defective derivative of Mu-di (Ap, lac). Wertman, K.F, Mount, D.W., Dept. of Activation of silent genes by trans- Molecular and Medical Microbiol- posons Tri5 and Tn10. Berg, C.M., Simpson, D.A., Biologi- ogy, University of Arizona, 'Me- Bremer, E., Silhavy,T.J., Weise- cal Science Group, University of son: Gene fusions on bacteriophage mann, J.M., Weinstock, G.M., Connecticut, Storrs: Bacteriophage M13 allow for rapid mutational NCI, Fredrick Cancer Research Fa- P1 as a vector for the Tn5 mutagen- analysis of regulatory loci in E. coli cility, Frederick, Maryland: A X- esis in the Enterobacteriaceae. K12.

SESSION 9 DNA-Protein Interactions

Mandecki, W,' Caruthers, M.H.,2 Kelley, R., Yanofsky, C., Dept. of Bi- Molecular Genetics and Microbiol- 'Dept. of Molecular Biology, Ab- ological Sciences, Stanford Univer- ogy, University of Massachusetts bott Laboratories, North Chicago, sity,California: Mapping func- Medical School, Worcester: The Illinois; 'Dept. of Chemistry, Uni- tional domains of the E.coli Mnt and Arc proteins of bacterio- versity of Colorado, Boulder: Large tryptophan repressor by in vitro phage P22. insertions and deletions between the mutagenesis. CAP site and the -35 region of the Hahn, S., Dunn, T.M., Schleif, R., Pakula, A.A., Sauer, R.T., Dept. of lac promoter. Dept. of Biochemistry, Brandeis Biology, Massachusetts Institute of Cossart, P., Gicquel-Sanzey, B., Dept. University, Waltham, Massachu- Technology, Cambridge: Lambda de Biochimie et Genetique MolCcu- setts: A site required for repression cro mutants. laire, Institut Pasteur, Paris, France: of the E. coli L-arabinose operon, A genetic and structural study of the which lies 270 by upstream from theNelson, H.C.M., Hecht, M.H., Sauer, cAMP receptor protein of E. coli. start of transcription. R.T., Dept. of Biology, Massachu- setts Institute of Technology, Cam- Ebright, R.H.,' Beckwith, J.,' Cos- Hendrickson, W, Schleif, R., Dept. sart,P.,2Gicquel-Sanzey,B.,2 bridge: Interaction of mutant X re- of Biochemistry, Brandeis Univer- pressors with operator DNA. 'Dept. of Microbiology and Molec- sity, Waltham, Massachusetts: E. ular Genetics, Harvard Medical coli araC protein binding to the School, Kang, I., Fien, K., Wulff, D.L., Dept. Boston,Massachusets; araBAD promoter sites assayed by of Biological Sciences, State Uni- 2Unite de Biochimie Cellulaire, In- the altered migration of DNA-pro- versity of New York, Albany: The stitut Pasteur, Paris, France: Muta- tein complexes in polyacrylamide dI proteins of phages X and 21 are tions that alter the DNA-sequence gels. specificity of the catabolite gene highly specific for their respective Youderian, P.,'Bouvier,S.,'Suss- NE promoters. activator protein (CAP) of E. coli. kind, M.,' Vershon, D.,2 Sauer, Adhya, S., Irani, M., Orosz, L., Ma- R.,2 'Dept. of Molecular GeneticsShih, M.-C., Gussin, G.N., Genetics jumdar, A., NCI, National Insti- and Microbiology, University of Ph.D. Program and Zoology Dept., tutes of Health, Bethesda, Mary- Massachusetts Medical School; University of Iowa, Iowa City: land: Use of repressor titration to 'Dept. of Biology, Massachusetts Analysis of mutations affecting cII isolate operator mutations-An op- Instituteof Technology, Cam- activation of the X PRE promoter. erator within a gal structural gene. bridge: Altered specificity repres- sor mutations. Hoopes, B.C., McClure, W.A., Dept. Majumdar, A., Adhya, S., NCI, Na- of Biological Sciences, Carnegie- tional Institutes of Health, Be- Vershon, A.,' Youderian, P.,2 Suss- MellonUniversity,Pittsburgh, thesda, Maryland: Repressor oper- kind, M.,' Sauer, R.,' 'Dept. of Bi- Pennsylvania: Activation of the X ator interaction in the gal operon of ology, Massachusetts Institute of promoters PE and p, by X dI pro- E. coli. Technology, Cambridge; 2Dept. of tein.

208 SESSION 10 DNA Replication and Recombination Maurer, R.,',2 Osmond, B.C.,' Bot- igin of bacteriophage fl DNA rep- cal School, Worcester; 'Massachu- stein, D.,' 'Dept. of Biology, Mas- lication- Its signals and domains. setts Institute of Technology, Cam- sachusetts Institute of Technology, Roth, M., Brown, D., Schmidt-Gle- bridge; 'University of Pittsburgh, Cambridge; 'Dept. of Molecular newinkel, T., Hu, M., Belgado, N., Pennsylvania: Structure of the P22 Biology and Microbiology, Case Goetz, G., Hurwitz, J., Albert Ein- Erf protein. Western Reserve University School stein College of Medicine, Bronx, Fassler, J.S., Tessman, I., Tessman, of Medicine, Cleveland, Ohio: In- New York: Replication of OX174 E.S, Purdue University, West La- teraction of the dnaQ and dnaE DNA -Characterization of the 4,X fayette, Indiana: Inviability of rho- proteins of Salmonella. A protein-DNA complex. rep and rho-ssb double mutants-A Engstrom, J., Maurer, R., Dept. ofMosig, G., Macdonald, P., Lin, G., role for rho in DNA replication. Molecular Biology and Microbiol- Levin, M., Seaby, R., Dept. of Mo- Fassler, J.S., Tessman, E.S., Tess- ogy, Case Western Reserve Univer- lecular Biology, Vanderbilt Univer- man, E., Purdue University, West sity School of Medicine, Cleveland, sity,Nashville, Tennessee: Gene Lafayette, Indiana: rep-rec double Ohio: Genetics of the dnaX and expression and initiation of DNA mutants-A role for recA in DNA dnaZ genes of S. typhimurium. replication of bacteriophage T4 in synthesis. Zylicz, M., Georgopoulos, C., Dept. phage and host topoisomerase mu-Chaudhury, A.M., Smith, G.R., Fred of Cellular, Viral and Molecular Bi- tants. Hutchinson Cancer Research Cen- ology, University of Utah MedicalKreuzer, K.N., Alberts, B.M., Dept. ter, Seattle, Washington: Novel re- Center, Salt Lake City: Properties of Biochemistry and Biophysics, combination-proficient recB mu- of the dnaK protein of E. coli. University of California, San Fran- tants of E.coli lacking ATP- dependent exonuclease activity. Johnston, S.A., Ray, D.S., Molecular cisco: Specific recognition of bac- Biology Institute, University of teriophage T4 DNA by the T4-in-Thaler, D.S., Stahl, M.M., Stahl, California, Los Angeles: Identifi- duced type-II DNA topoisomerase. F.W., Institute of Molecular Biol- cation of a DNA replication enhan- Zahn, K., Blattner, F.R., Dept. of Ge- ogy, University of Oregon, Eugene: cer sequence in the genome of bac- netics,University of Wisconsin, The red recombination pathway of teriophage M13. Madison: DNA binding properties X has double-strand break repair of phage 410 protein. activity; the recA, recBC pathway Dotto, G.R, Horiuchi, K., Zinder, of E. coli does not. N.D., Rockefeller University, New Poteete, A.,' Sauer, R.,2 Hendrix, R.,' York, New York: The functional or- 'University of Massachusetts Medi-

SESSION 11Transposition and Site-specific Recombination Biel, S.W., Berg, D.E., Dept. of Mi- Pato, M.,' Waggoner, B.,' Reich, C.,' Flamm, E., Weisberg, R., NICHHD, crobiology,and Immunology, Howe, M.,2 'National Jewish Hos- National Institutes of Health, Be- Washington University Medical pital and Research Center, Denver, thesda, Maryland: Primary struc- School, St. Louis, Missouri: Two Colorado; 'Dept. of Bacteriology, ture of the hip gene and its protein. modes of IS/-mediated gene trans- University of Wisconsin, Madison: Craig, N.L., Nash, H.A., NIMH, Na- position-Conservative and repli- Requirements for maximal levels of tional Institutes of Health, Be- cative. replication of bacteriophage Mu thesda, Maryland: Sequence-spe- Sasakawa, C., Carle, G.F., Berg, DNA. cificinteractionof E. coli D.E.,Dept.of Microbiology, Miller, J.L., Lynn, D.L., Obukowicz, integration host factor with DNA. Washington University School of M.G.,Glasgow,A.C.,Howe, Bear, S.E., Court, D.L., NCI, Na- Medicine, St. Louis, Missouri: The M.M., Dept. of Bacteriology, Uni- tional Institutes of Health, Be- termini of IS50- Sequences essen- versity of Wisconsin, Madison: thesda, Maryland: Characterization tial for transposition. Mutants of X::mini-Mu altered in of Xint mutants-A negative com- Bukhari, A.I.,' Godson, G.N.," 'Cold Mu-specific integration, replica- plementation test. Spring Harbor Laboratory, New tion, and growth inhibition proper-Redfield,R.J., Campbell, A.M., York: 'Dept. of Biochemistry, New ties. Dept. of Biological Sciences, Stan- York University Medical School, Roberts, D., Kleckner, N., Dept. of ford University, California: IS2 and New York: Transposase recognizes Biochemistry and Molecular Biol- the generation of cryptic X pro- a site that is located 53 by from the ogy, Harvard University, Cam- phages. left of bacteriophage Mu. bridge, Massachusetts: Host mu-Summers, D., Sherratt, D., Institute Mizuuchi, M., Mizuuchi,K., tants of E. coli affected for Tn1D of Genetics, Glasgow University, NIADDK, National Institutes of transposition. Scotland: Role of site-specific re- Health, Bethesda, Maryland: Sub-Plasterk, R.H.A., van de Putte, P., combination in the stable mainte- strate requirement of bacteriophage Laboratory of Molecular Genetics, nance of the natural plasmid ColEl. Mu transposition. State University of Leiden, The Mizuuchi, K., NIADDK, National Netherlands: A DNA invertase and Institutes of Health, Bethesda, methylation-regulated DNA-modi- Maryland: In vitro transposition of fying protein coded for by the Mu bacteriophage Mu. /3 region.

SESSION 12 Open Discussion

209 MODERN APPROACHES TO VACCINES August 31-September 4

SESSION 1Viral Structure and Function Chairperson: W.K. Joklik, Duke University Medical Center, Durham, North Carolina Wilson, I.A.,' Skehel, J.J.,' Wiley, Comparison of the genes of the pression of human respiratory syn- D.C.,' 'Dept. of Molecular Biol- three serotypes of reovirus and of cytial virus. ogy, Research Institute of Scripps the proteins that they encode. Both, G.W.,' Siegman, L.J.,' Atkin- Clinic,LaJolla,California; Norrby, E.,' Varsanyi, T.,' Utter, G.,' son, PH.,' Poruchynsky, M.S.,' 'National Institute for Medical Re- Appel, M.,2 'Dept. of Virology, Ka- Kabcenell, A.K.,2 Street, J.E.,3 search, London, England; 'Dept. of rolinska Institute School of Medi- Gunn, P.R.,' Sato,F.,' Powell, Biochemistry and Molecular Biol- cine, Stockholm, Sweden; 'Dept. of K.F.H.,' Bellamy, A.R.,' 'CSIRO, ogy, Harvard University, Cam- Microbiology, New York State Col- Molecular and Cellular Biology bridge, Massachusetts: Three-di- lege of Veterinary Medicine, Cor- Unit, North Ryde, Australia; 'Dept. mensional structure of aviral nell University, Ithaca, New York: of Developmental Biology and Can- antigen - Haemagglutininglyco- Morphology and immunogenicity of cer, Albert Einstein College of protein of influenza virus. purified measles virus envelope Medicine, Bronx, New York; 'Dept. Hog le, J.M., Dept. of Molecular Bi- components. of Cell Biology, University of ology, Scripps Clinic and Research Schild, G.C., Minor, P., Evans, P., Auckland, New Zealand: Analysis Foundation, La Jolla,Califor- Almond, J.W., National Institute for of cloned genes corresponding to nia:High-resolutionstructural Biological Standards and Control, the rotavirus group- and type-spe- studies of poliovirus. London, England: Molecular basis cific antigenic determinants. Joklik, WK., Antzcak, J.B., Cashdol- of antigenicity and virulence ofPurcell, R.H., Feinstone, S.M., Dae- lar, L.W., Chmelo, R., Gaillard, poliovirus type 3. mer, R.J., Ticehurst, J.R., Baroudy, R.K., Lee, P.W.K., Li, J.K.K., Venkatesan, S., Elango, N., Satake, B.M., NIAID, National Institutes of Dept. of Microbiology and Immu- M., Camargo, E., NIAID, National Health, Bethesda, Maryland: Ap- nology, Duke University Medical Institutes of Health,Bethesda, proaches to hepatitis A vaccine - Center, Durham, North Carolina: Maryland: Organization and ex- The old and the new.

SESSION 2The Chemistry of Virus Neutralization Chairperson:E. Wimmer, State University of New York, Stony Brook, New York Wimmer, E.,' Emini, E.A.,' Jame- sity, Whiteknights Park, England; tutes of Health, Bethesda, Mary- son, B.A.,' 'Dept. of Microbiology, 'Research instituteofScripps land; 'Research Institute of the State University of New York, Stony Clinic, La Jolla, California: Chem- Scripps Clinic, La Jolla, Califor- Brook; 'Merck Sharp and Dohme ical basis for variation in the major nia: Chemically synthesized pep- Research Laboratories, West Point, antigenic site eliciting neutralizing tides of hepatitis B surface anti- Pennsylvania: Poliovirus-specific antibodies in FMDV. gens -Immunogenicity and pro- synthetic peptides-Priming and in- Arnon, R., Shapira, M., Dept. of tective efficacy in chimpanzees. duction of a neutralizing antibody Chemical Immunology, WeizmannShih, J.W.-K.,1 Gerety, R.L.,' Liu, response and identification of viral Institute of Science, Rehovot, Is- D. T. , Yajima, H.,' Fujii,N.,' neutralizing antigenic sites. rael: Anti-influenza synthetic vac- Nomizu,M.,'Katakura,S.,' Lerner, R.A., Wilson,I.,Niman, cine. 'NCDB, FDA, National Institutes of H.L., Dept. of Molecular Biology,Dreesman, G.R.,' Sparrow, J.T.,' Health, Bethesda, Maryland; Scripps Clinic and Research Foun- Kennedy, R.C.,' Melnick, J.L.,' 'Kyoto University, Japan: Immuno- dation, La Jolla, California: Learn- 'Dept. of Virology and Epidemiol- genicity of the unconjugated syn- ing the chemistry of antigen-anti- ogy; 'Dept. of Medicine, Baylor thetic polypeptides of HBsAg. body union. College of Medicine, Houston,Parker, J.M.R., Bhargave, S., Hodges, Rowlands, D.J.,' Clarke, B.E.,' Car- Texas: Immunogenic and antigenic R.S., Dept. of Biochemistry and roll, A.R.,' Brown, F,' Nicholson, activity of a cyclic synthetic HBsAg Medical Research Council of Can- B.H.,'Bittle, Houghten, peptide. ada, University of Alberta, Edmon- R.A.,3 Lerner, R.A.,' 'Animal Vi- Gerin, J.,' Purcell, R.,' Lerner, R.,' ton: A general method to prepare rus Research Institute, Pirbright; 'Georgetown University, Rockville, peptide conjugates. 'Biochemistry Dept., The Univer- Maryland; ' NIAID, National Insti-

SESSION 3Poster Session Arora,D.J.S.,Justewicz,D.M., and Research Foundation, La Jolla, search Foundation, La Jolla, Cali- Mandeville, R., Institut Armand- California; 'Animal Virus Research fornia: Viruses perturb functions of Frappier, Universite du Quebec, Institute, Pirbright, England: Im- human lymphocytes -Effects of Canada: In vitro stimulation of NK munization with a chemically syn- measles virus and influenza virus cell activity with purified influenza thesizedpeptidederivedfrom on lymphocyte-mediated killing and virus surface antigens. FMDV polypeptide VP1. antibody production. Bittle, J.,' Worrell, P.,' Houghten, R.,' Fox, G.M., Langley, D., Hu, S., Am- Brown, F,2 Lerner, R.,' 'Dept. ofCasa li, R ,Rice, P.A., Oldstone, gen, Inc., Thousand Oaks, Califor- Molecular Biology, Scripps Clinic M.B.A., Scripps Clinic and Re- nia: Development of PPV subunit 210 vaccine by recombinant DNA ical School, England: Progress in Rowlands, D.J.,' Clarke, B.E.,' Car- methods. the development of an EBV subunit roll, A.R.,' Brown, F.,' Nicholson, Gal lick, G.E., Brown, D.B., Murphy, vaccine. B. H. ,'Bittle,J. L Houghten , E.C., Arlinghaus, R.B., UniversityMoore, D.,' Morgan, D.,' Robertson, R.A.,3 Lerner, R.A.,3 'Animal Vi- of Texas Science Center, M.D. An- B.,' McKercher, P.,' Patzer, E.,2 rus Research Institute, Pirbright; derson Hospital, Houston: Inhibi- Shire, S.,2 Kleid, D.,' 'Plum Island 'Biochemistry Dept., The Univer- tion of transformation in a cell line Animal Disease Center, Greenport, sity, Whiteknights Park, England; infected with a temperature-sensi- New York; 'Genentech, Inc., South 3ResearchInstituteof Scripps tive mutant of MSV by cytoplasmic San Francisco, California: A highly -Clinic, La Jolla, California: Com- microinjection of purified IgG from antigenic portion of FMDV 0, VP, parative structural studies of the an- an antisera generated against a syn- elicits bovine antibodies that pro- tigenic sites of FMDV. thetic v-mos peptide. tect mice but not cattle from FMDV Sela, M., Jacob, C.O., Arnon, R., Klemm, P., Gaastra, W, Josephsen, infection. Dept. of Chemical Immunology, J., Petersen, J.K., Dept. of Micro- Murphy, B.,' Green, N.,2 Alexander, Weizman Institute of Science, Re- biology, Technical University of S.,2 Lerner, R.,2 Chanock, R.,' hovot, Israel: Synthetic approaches Denmark, Lyngby: E. coli fimbriae 'NIAID,NationalInstitutesof to vaccination against bacterial tox- as basis for vaccines. Health, Bethesda, Maryland; ins. 'ResearchInstituteofScrippsvan derMarel,P.,'Osterhaus, McCahon, D., King, A.M.Q., Slade, Clinic, La Jolla, California: Evalu- W.R., Saunders,K., Newman, A.D.M.E.,' van Steenis, G.,' van ation in hamsters of synthetic pep- Wezel, A.L.,' Sundquist, B.,2 Mor- J.W.L., Animal Virus Research In- tides representing different anti- stitute, Pirbright, England: Study of ein,B.,2'Rijsinstiuut voor de genic sites of the influenza A virus Volksgezondheid, Bilthoven, The the nature and extent of RNA re- hemagglutinin. combinationinapicornavirus Netherlands; 'Dept. of Virology, (FMDV). Petteway, S.R., Ray, J., Ivanoff, L.A., NationalVeterinaryInstitute, Korant, B.D.,E.I. Du Pont de Uppsala, Sweden: Toward a mea- Morgan, A.J., Smith, A.R., Barker, Nemours and Co., Wilmington, sles virus subunit vaccine. R.N., Epstein, M.A., Dept. of Pa- Delaware: Expression of viral anti- thology, University of Bristol Med- gens in E. coli.

SESSION 4Cloning and Expression of Viral Genes I Chairperson:F. Brown, Animal Virus Research Institute, Pirbright,England Flores, J., Sereno, M., Kalica, A.,van der Marel, P.,' Hazendonk, A.G.,' Federal Republic of Germany: Keith, J., Kapikian, A., Chanock, Henneke, M.A.C.,' de Vries, F.A.J.,' High-level production in E. coli of R., NIAID, National Institutes of Wieringa, B.,' van Wezel, A.L.,' hybrid proteins expressing parts of Health, Bethesda, Maryland: Mo- Jore,J.,2 Pouwels, P.H.,2 Enger- the coding sequences of HSV-1 gly- lecular cloning of rotavirus genes Valk, B.E.,2 'National Institute of for use in immunoprophylaxis. coproteins gC and gD. Public Health, Bilthoven; 'MedicalCarlson, J., Maxwell, I., Maxwell, F., Biological Laboratory, TNO, McNab, A., Rushlow, K., Mid- Nayak, D.P., Dept. of Microbiology Rijswijk, The Netherlands: Expres- and Immunology, University of brand, M., Teramoto, Y., Winston, sion in E. coli of capsid-protein S.,Syngene Products and Re- California School of Medicine, Los VP1 of poliovirus type 1. Angeles: Immunological response search, Fort Collins, Colorado: to human influenza virus hemag- Leung, WC., Jing, G. Z., Hasnain, Expression of FPV antigens in E. glutinin expressed in E. coli. S.E., Manavathu, E.K., Leung, M., coli. Zwaagstra, J., Dept. of Medicine,Malek, L., Soostmeyer, G., James, E., De Wilde, M., Cabezon, T., Harford, University of Alberta, Edmunton, Garvin, R.T., Genetic Engineering N., Simoen, E., Rutgers, T., Van Canada:Expression of cDNA Group, Connaught Research Insti- Wijnendaele, F., Genetic Research clones for HSV-1 and HSV-2 neu- tute, Willowdale, Ontario: Expres- Dept., Smith Kline-RIT, Rixensart, tralization antigen glycoprotein gB. sion of rabies glycoprotein gene in Belgium: Hepatitis-B vaccine pro-Amann, E., Broker, M., Wurm, F., E. coli. duced in yeast by R-DNA. Research Laboratories, Marburg,

SESSION 5Cloning and Expression of Viral Genes II Chairperson:R. Purcell, National Institutes of Health, Bethesda, Maryland

Cavanagh, D., Binns, M., Boursnell, Oaks,California:Cloning andTiollais, P., INSERM, Institut Pas- M.E.G., Brown, T.D.K., Dept. of expression of the surface glycopro- teur, Paris, France: Synthesis and Microbiology, Houghton Poultry tein gp195 of porcine transmissible excretion of HBsAg in animal cells. Research Station, England: Geneti- gastroenteritis virus (TGEV). cally engineered vaccine to avian Stratowa, C., Wang, Y., Hughes, J., infectious bronchitis virus (IBV) Bouges-Bocquet, B., Guesdon, J.L., Doehmer, J., Hofschneider, with "live" and "killed" vaccine Hofnung, M., INSERM, Institut Max-Planck-Institut fiir Biochemie, Pasteur, Paris, France: In vitro ge- characteristics. Martinsried, Federal Republic of netic construction devised to ex- Germany: Construction of cell lines Hu, S., Bruszewski, J., Boone, T., press given antigenic determinants producing HBsAg using eukaryotic Souza, L., Amgen, Inc., Thousand at the surface of bacteria. viral vectors. 211 M.R., McAleer, W, Scolnick, E., Technology, Cambridge: Expres- Burnette, W.N., Samal, B., Bitter, sion of poliovirus capsid proteins G.A., Browne, J.K., Fenton, D., Merck Sharp and Dohme Research Laboratories, West Point, Pennsyl- and antigenic activity of synthetic Amgen, Inc., Thousand Oaks, Cal- peptides. ifornia: Production of hepatitis-B vania: HBsAg purification by im- recombinant vaccines. mune affinity chromatography. Wampler, D.E., Buynak, E., Harder, Chow, M., Baltimore, D., Whitehead B.J., Herman, A.C., Hilleman, Institute, Massachusetts Institute of

SESSION 6 Attenuation of Virulence I Stockholm, Sweden Chairperson:E. Norrby, Karolinska Institute of Virology, York State Department of Health, Kilbourne, E.D., Mount Sinai School ogy; 'Dept. of Pathology, Harvard Medical School, Boston, Massa- Albany: Genetically engineered of Medicine of the City University poxviruses as live recombinant vac- of New York, New York: Immuni- chusetts: Reovirus hemagglutinin - Specific attenuation and antigenic cines. zation strategy -Infection-permis- sive vaccines for the modulation of mimicry as approaches for immu-Mackett, M., Smith, G.L., Moss, B., NIAID,NationalInstitutesof infection. nization. Flamand, A.,' Coulon, P.,'Pepin, Health, Bethesda, Maryland: Gen- Roizman, B., Marjorie B. Klover On- M.,2 Blancou,J.,2Rollin,P.,3 eral method for the production and cology Laboratory, University of ' University Paris-Sud; 2Centre Na- selection of infectious vaccinia vi- Chicago, Illinois: Genetic engi- tional d'Etude sur la Rage; 'Institut rus recombinants expressing for- neering of the herpes simplex virus Pasteur,Paris, France: Immuno- eign genes. genome for the purpose of immu- genic and protective power of avi-Plotkin, S.A., Children's Hospital of noprophylaxis. rulent mutants of rabies virus se- Philadelphia, and Wistar Institute, Fields, B.N.,' Sharpe, A.H.,2 Spriggs, lected with neutralizing monoclonal Pennsylvania: Vaccination against D.,2 Greene, M.,3 'Dept. of Medi- antibodies. human cytomegalovirus. cine, Brigham and Women's Hospi- Paoletti, E., Panicali, D., Center for tal, Boston; 'Dept. of Microbiol- Laboratories and Research, New SESSION 7 Attenuation of Virulence II La Jolla, California Chairperson:I.A. Wilson, Scripps Research Foundation, H.F.,3 London, W,4 Chanock, R.,' rus for immunoprophylaxis -Prog- Smith, G., Mackett, M., Murphy, B., of ress and obstacles. Moss, B., NIAID, National Insti- 'NIAID,NationalInstitutes tutes of Health, Bethesda, Mary- Health, Bethesda, Maryland;Rott, R., Scholtissek, C., Institut fur land: Vaccinia virus recombinants 2Center for Vaccine Development, Virologie, Justus-Liebig-Universi- expressing genes from pathogenic University of Maryland School of tat, Giessen, Federal Republic of agents have potential as live vac- Medicine, Baltimore; 3School of Germany: Alterations in pathogen- Public Health, University of Mich- icity of influenza virus through cines. igan, Ann Arbor; 4NINCDS, Na- reassortment. Greenberg, H., Midthun, K., Wyatt, tional Institutes of Health, Be-Kew, 0.M., Nottay, B.K., Division of R., Flores, J., Hoshino, Y., Chan- thesda:Attenuationof human ock, R., Kapikian, A., NIAID, Na- Viral Diseases, Centers for Disease influenza A viruses by genetic reas- Control, Atlanta, Georgia: Evolu- tional Institutes of Health, Be- sortment with attenuated donor vi- thesda, Maryland: Use of reassor- tion of the oral polio vaccine strains tant rotaviruses and monoclonal ruses. in humans occurs by both mutation antibodies to make gene-coding as-Lai, C.-J., Markoff, L., Sveda, M., and intramolecular recombination. signments and construct rotavirus Lin,B.-C.,Chanock,R.M., vaccine candidates. NIAID,NationalInstitutesof Murphy, B.,' Clements, M.,2 Buckler- Health, Bethesda, Maryland: Engi- White, A.,' Tian, S.F.,' Maassab, neering the genome of influenza vi-

SESSION 8 Enhancement of Antigenicity andImmunogenicity I York, New York Chairperson:E.D. Kilbourne, Mt. Sinai Medical Center, New of hepatitis-B polypeptide micelle Morein, B.,' Sundquist, B.,2 Dals- Thibodeau, L.,' Perrin, P ,2 Sureau, Armand-Frappier; vaccines. gaard, K.,'Osterhaus,A.," P.,''Institut 'Institute of Microbiology, Swedish 2Universite du Quebec, Laval, Can-Gordon, L.K., Connaught Research University of Agricultural Sci- ada: Rabies immunosome -A new Institute, Toronto, Canada; Con- candidate for an RNA-free vaccine. ences, Uppsala, Sweden; 'National naught Laboratories, Swiftwater, Veterinary Institute for Virus Re-Sanderson, A.R., MRC Immunology Pennsylvania: Characterization of a search,Kalvehave,Denmark; Team, Guy's Hospital, London, hapten-carrier conjugate vaccine. 'National Institute of Health, Bil- England: MHCI molecules - H. influenzae-diphtheria conjugate thoven, The Netherlands: Iscom, a Widelyapplicablepurification vaccine, H- flu -VAXTM cagelike immunostimulating com- technology and evidence for supe- plex of membrane proteins. rior carrier function. Audibert, F, Chedid, L., Immuno- Howard, C.R., Young, P., Tsiquaye, therapie Experimentale, Institut Hopp, T.P., Immunex Corporation, Pasteur, Paris, France: Of antigens, Seattle, Washington: Use of palmi- K.,Zuckerman,A.J.,London School of Hygiene and Tropical adjuvants, and carriers in synthetic tic acid as a carrier for chemically vaccines. synthesized vaccines. Medicine, England: Development 212 SESSION 9Cloning and Expression of Viral Genes III Chairperson:J. Gerin, Georgetown University School of Medicine and Dentistry, Rockville, Maryland Koprowski, H.,Dietzschold,B., Rosenberg, S.,' Tekamp-Olson, P.,' Structures in influenza A/USSR/90/ Macfarlan, R., Sutcliffe, J.G., Ler- Burlingame, A.,' Rutter,W.J.,' 77 hemagglutinin associated with ner, R.A., Wistar Institute, Phila- 'Chiron Research Laboratories, epidemiologic and antigenic delphia, Pennsylvania: Localiza- Chiron Corporation, Emeryville, change. tionoftheimmunodominant California; 'Dept. of Biochemistry, Gething, M.J.,' Braciale, T.J.,2 Sam- domains of rabies virus glycopro- University of California, San Fran- brook, J.F.,' 'Cold Spring Harbor tein. cisco: Characterization of HBsAg Laboratory, New York; 'Washington Dietzschold, B., Cohen, G.H., Wister particles produced in yeast and in University School of Medicine, St. Institute, Philadelphia, Pennsylva- mammalian cells. Louis, Missouri: Comparison of nia: Synthesis of an antigenic deter- Kendal, A.,' Nakajima, S.,' Naka- different eukaryotic vector systems minant of HSV glycoprotein D that jima, K.,' Raymond, L.,' Caton, for the high-level expression of a stimulates production of virus-neu- A.,' Brownlee, G.,3 Webster, R.,4 cloned copy of the hemagglutinin tralizing antibody and confers pro- 'Centers for Disease Control, At- glycoprotein of influenza virus. tection against a lethal challange in- lanta, Georgia; 'Institute of Public fection of HSV. Health, Tokyo, Japan; 'University Valenzuela, P.,' Coit, D.,' Heberlein, of Oxford, England;4St.Jude's U.,' Masiarz, FR.,' Medina, M.A.,' Hospital,Memphis, Tennessee:

SESSION 10Enhancement of Antigenicity and Immunogenicity II Chairperson:M. Oldstone, Scripps Clinic and Research Foundation, La Jolla, California Mandeville, R., Justewicz, D.M., Le- Parker, J.M.R., Taneja, A.K., Woro- man, G.R.,' 'Dept. of Virology and comte,J.,Institut Armand-Frap- bec, E.A., Paranchych, W., Hodges, Epidemiology, 'Dept. of Medicine, pier, Universite du Quebec, Laval, R.S., Dept. of Biochemistry and Baylor College of Medicine, Hous- Canada: Specific inhibition of in- Medical Research Council of Can- ton, Texas: Enhancement of the im- fluenza-virus-induced boosting of ada, University of Alberta, Edmon- mune response to a cyclic synthetic natural killer-cellactivity by an ton: Immunodominant region of HBsAg peptide by prior injection of anti-HA-specific monoclonal anti- EDP208 pili- A model system for anti-idiotype antibodies. body. the design of pilus synthetic vac- Trudel, M., Payment, P., Boudreault, cines. Armand-Frappier, Gallick, G.E.,' Sparrow, J.,2 Stanker, Welling, G.W, Groen, G., Boer, T., University du Quebec, Laval, Can- L.H.,' Nash, M.A.,' Arlinghaus, Nijmeijer, J., van der Zee, R., Wil- ada: Efficiency of subunit vac- R.B.,' 'University of Texas Science terdink, J.B., Welling-Wester, S., cines-Case illustration with influ- Center, M.D. Anderson Hospital, Laboratorium voor Medische Mi- enza immunosomes and rubella Houston; 'Dept. of Medicine, Bay- crobiologie, Rijksuniversiteit Gro- virosomes. lor College of Medicine, Houston, ningen, The Netherlands: HPLC ofSummary: R. Chanock, National In- viral proteins as a tool in the design Texas: Recognition of native pro- stitutes of Health, Bethesda, Mary- of synthetic vaccines. teins with antisera to synthetic pep- land tides may depend on the size and Kennedy, R.C.,' Sparrow, J.T.,' San- conformation of the peptide. chez, Y.,' Melnick, J.L.,' Drees-

THE CANCER CELL September 8-September 13

Welcoming Remarks:J. D. Watson

SESSION 1src I Chairperson:G. Vande Woude, NCI, National Institutes of Health, Bethesda, Maryland Hanafusa, H.,' Iba, H.,' Takeya, T.,'Parker, R.C., Swanstrom, R., Var- the activity of catalytic subunit of Cross, E,' 'Rockefeller University, mus, H.E., Bishop, J.M., Dept. of cAMP-dependent protein kinase by New York, New York; 'Institute for Microbiology, University of Cali- pp60.-"4. Chemical Research, Kyoto Univer- fornia, San Francisco: Cloning andParsons, J.T., Bryant, D., Parsons, sity, Japan: Transforming activity of expression of chicken c-src reveals S.J., Wilkerson, V., Dept. of Mi- the c-src gene. structural and biological differ- crobiology, University of Virginia, ences from v-src. Site-directed mu- Shalloway, D., Coussens, P.M., Ya- Charlottesville: Graziani, Y.,' Mailer, J.,' Sugimoto, tagenesis of RSV pp60"4-Identifi- ciuk, P., Molecular and Cell Biol- cation of functional domains re- ogy Program, Pennsylvania State Y.,' Erikson, R.L.,' 'Dept. of Pa- University, University Park: Effect thology, 'Dept. of Pharmacology, quired for transformation. of c-src overexpression in mouse University of Colorado School ofBrugge, J.S., Jarvis-Morar, M., Cot- cells. Medicine, Denver: Modification of ton, P., Lipsich, L., Yonemoto, W, 213 Darrow, D., Dept. of Microbiol- transforming proteins. nia: Lysine 295 comprises part of ogy, State University of New York, Kamps, M., Sefton, B., Molecular Bi- the active site of pp60'. Stony Brook: Structural and func- ology and Virology Laboratory, tional studies on the tyrosine kinase Salk Institute, San Diego, Califor-

SESSION 2 Growth Factors Chairperson:G. Todaro, Oncogen, Inc., Seattle, Washington Sporn, M.B., Anziano, M.A., As- McClure, D.B.,' Dermody-Weisbrod, Aaronson, S.A.,' 'NCI, National soian, R.K., De Larco, J.E., Fro- M.,2 Topp, W.C.,' 'Cancer Center, Institutes of Health, Bethesda, lik, C.A., Roberts, A.B., NCI, Na- UniversityofCalifornia,San Maryland; 'Center for Blood Re- search, Harvard School of Public tional InstitutesofHealth, Diego, La Jolla; 'Cold Spring Har- Bethesda, Maryland: Isolation and bor Laboratory, New York: In vitro Health, Boston, Massachusetts; characterization of transforming correlates of tumorigenicity of 'Division of Biology, California In- growth factors from human, bo- REF52 cells transformed by SV40. stitute of Technology, Pasadena: Structural and functional relation- vine, and murine sources. Waterfield, M.D.,' Scarce, G.T.,' P.,' ships between the transforming Whittle,N.,' Stockwell, gene product(s) of a primate sar- Cowley, J.,' Gustason, B.,' Smith, J.,' Stroobant,P.,'Johnsson,A.,' Hendler, F.,2 Ozanne, B.,' 'Ludwig Wasteson, A.,2 Westermark, B.,' coma virus and human PDGF. Institute of Cancer Research, Lon- Heldin,C.-H.,'Huang,J.S.,'Cochran, B.H., Reffel, A.C., Stiles, don, England; 'University of Texas Deuel, T.F.,' 'Imperial Cancer Re- C.D., Dana-Farber Cancer Institute Health Science Center, Dallas: EGF search Fund, London, England; and Dept. of Microbiology and Mo- receptor is expressed at high levels 'University of Uppsala, Sweden; lecular Genetics, Harvard Medical on squamous carcinomas. 'Washington University School of School, Boston, Massachusetts: Molecular cloning of intermittently Kamata, T., Feramisco, J.R., Cold Medicine, Jewish Hospital of St. Louis, Missouri: Relationship be- firinggenesequenceswhose Spring Harbor Laboratory, New tween PDGF and the transforming expression is regulated by platelet- York: Nucleotide effects on EGF derived growth factor. receptors in normal and trans- protein of simian sarcoma virus. formed cells-A relationship to Ha- Robbins, K.C.,' Antoniades, H.N.,' ras oncogenes? Devare, S.G.,' Hunkapiller, M.W.,'

SESSION 3Cytoskeleton Chairperson:K. Weber, Max-Planck Institute, Goettingen, Federal Republic of Germany Matsumura, F., Lin, J.J.-C., Yama- thesda, Maryland; 'Linus Pauling herd, E.L., Dana-Farber Cancer shiro-Matsumura, S., Cold Spring Institute, Palo Alto, California: Institute, Harvard Medical School, Harbor Laboratory, New York: Dif- Point mutation and other changes in Boston, Massachusetts: Effect of ferential expression of tropomyosin cytoplasmic actins associated with altered cytoskeleton on mitochon- forms in the microfilaments iso- theexpression of transformeo drial distribution in tumor cells. lated from normal and transformed phenotype. Albrecht-Buehler, G., Northwestern cultured cells. Chen, L.B., Summerhayes, I.C., University Medical School, Chi- Kakunaga, T.,' Taniguchi, S.,' Leav- Weiss, M.J.,Davis,S.,Bernal, cago, Illinois: Movement of nu- itt,J.,' Hamada, H.,' 'NCI, Na- S.D., Mclsaac, R.M., Lampidis, cleus and centrosphere in animal tional Institutes of Health, Be- T.J., Nadakavukaren, K.K., Shep- tissue cells.

SESSION 4a src II Chairperson:J. Brugge, State University of New York, Stony Brook, New York Hunter, T., Cooper, J.A., Gould, K., Phosphotyrosine-containing pro- Young, J., Dept. of Zoology, Uni- Saris, C.J., Molecular Biology and teins in normal and transformed versity of California, Berkeley: Virology Laboratory, Salk Insti- cells. Role of tyrosine phosphorylation in tute, San Diego, California: Tyro- transformation and mitogenesis. sine protein kinases and the controlGoldberg, A.R., Krueger, J.G., Gar-Greenberg, M.E., Brackenbury, R., ber, E.A., Wong, T.W., Rockefeller of cell proliferation. Edelman, G.M., Rockefeller Uni- University, New York, New York: versity, New York, New York: Weber, M.J., Bishop, R.W., Crabb, Subcellular localization of viral and Changes in the tissue distribution of G., Martinez, R., Monteagudo, C., cellular tyrosyl protein kinases. Nakamura, K.D., Tondravi, M., the 34-kD pp6O" substrate during Williams, D., Dept. of Microbiol- Martin, G.S., Radke, K., Carter, V.C., differentiation and maturation. ogy, University of Illinois, Urbana: Moss, P., Dehazya, P., Gilmore, T.,

SESSION 4b Polyoma New York Chairperson:J. Sambrook, Cold Spring Harbor Laboratory, Cold Spring Harbor, CNRS, Universite de Nice; 'Institut rus oncogenes in the transformation Cuzin,F.,' Rassoulzadegan, M.,' and immortalization of cells in cul- Lemieux, L.,' Rouget, P.,' Renaud, Jacques Monod, Paris,France: ture. J.F.,''Centre de Biochimie du Functions of the three polyoma vi- 214 Benjamin, T., Dept. of Pathology, W ,' Markham, A.F.,2 Paucha, E.,' Ito, Y., National Institutes of Health, Harvard Medical School, Boston, Courtneidge, S.A.,' 'Biochemistry Bethesda, Maryland: Evaluation of Massachusetts: The polyoma HR-T Division, National Institute for the importance of the sequence of gene-An "oncogene" with a pur- Medical Research, London; 'ICI middle T antigen of polyoma virus. Pharmaceuticals Division, Mac- GLU-GLU-GLU-GLU-TYR-MET- pose. PRO-MET-GLU. Smith, A.E.,' Oostra, B.A.,' Kalde- clesfield, England: Biochemical basis of transformation by polyoma ron, D.D.,' Belsham, G.J.,'Ely, B.K.,' Harvey, R.W.,' Mark land, virus middle T and SV40 large T.

SESSION 5 myb, myc Chairperson:D. Baltimore, Massachusetts Institute of Technology, Cambridge, Massachusetts Baluda, M.A., Lipsick, IS., Boyle, Moelling, K., Bunte, T., Donner, P., Activation of host c-onc genes. W.J., Dvorak, M., Lampert, M.A., Greiser-Wilke, I., Max-Planck-In-Cole, M.D., Keath, E.J., Piccoli, S.P., University of California School of stitut fiir Molekulare Genetik, Ber- Caimi, P., Kelekar, A., Dept. of Medicine, Jonsson Cancer Center, lin, Federal Republic of Germany: Biochemistry, St. Louis. University Los Angeles: Oncogene of AMV is Analysis of transformation-specific School of Medicine, Missouri: Ac- an altered proto-oncogene. polyproteins of acute avian leuke- tivation of the c-myc oncogene by Papas, T.S., Watson, D., Kan, N., mia and sarcoma viruses. chromosomal translocation. Psallidopoulos, M., Flordellis, C., Eisenman, R., Hann, S., Abrams, H., Croce, C., Wistar Institute, Philadel- Samuel, K., Lautenberger, J., NCI, Tachibana, C., Rohrschneider, L., phia, Pennsylvania: Differential National Institutes of Health, Be- Fred Hutchinson Cancer Research expression of the normal and of the thesda, Maryland: Oncogenes of Center, Seattle, Washington: myc translocated human c-myc onco- oncogene encodes a class of nuclear avian acute leukemia viruses MC29 genes in B cells. (myc) and MH2 (mht-myc) and their proteins-Possible association with normal cellular avian and human the nuclear matrix. Diamond, A., Devine,J.,Cooper, homologs (c-myc). Hayward, WS., Goodenow, M., Si- G.M., Ritz, J., Lane, M.-A., Dana- Bishop, J.M., University of Califor- mon, M.C., Shih, C.-K., Wiman, Farber Cancer Institute,Boston, nia, San Francisco: Tumorigenesis K., Memorial Sloan-Kettering Can- Massachusetts: Transforming genes by myb and myc. cer Center, New York, New York: in human B-cell lymphomas.

SESSION 6Chromosomal Rearrangements Chairperson:J. Rowley, University of Chicago, Chicago, Illinois Marcu, K.B.,' Stanton, L.W ,' Harris, sachusetts Institute of Technology, stitute; 'Dept. of Medical Biophys- Toronto; L.J.,' Yang, J.Q.,' Remmers, E.F.,' Cambridge;'MemorialSloan- ics, Universityof 'Wellesley Hospital, Toronto, Can- Fahrlander,P.,'Watt,R.,2 Eck- Kettering Cancer Center, New hardt,L.A.,' Birshtein,B.K.,' York, New York:Structure and ada: Intracisternal A-particle genes 'Biochemistry Dept., State Univer- expression of the human c-myc gene are mammalian transposable ele- sity of New York, Stony Brook; from germ line and from rear- ments. 2WistarInstitute,Philadelphia, ranged loci. Dickson, C., Peters, G., Smith, R., Pennsylvania; 'Cell Biology Dept., Wirschubsky, Z., Dept. of Tumor Bi- Brookes, S., Laboratory of Viral Albert Einstein College of Medi- ology, University of Stockholm, Carcinogenesis, Imperial Cancer cine, Bronx, New York: Activation Sweden:Specific chromosomal Research Fund Laboratories, Lon- of c-myc oncogene by chromosomal translocations and the genesis of B- don, England: Tumorigenesis by translocation in murine plasmacy- cell-derived tumors in mice, rat, MMTV may involve provirus inte- tomas. and man. gration in a specific region and ac- Leder, P.,' Battey, J.,' Lenoir, G.,2 tivation of a cellular gene. Groffen, J.,' Heisterkamp, N.,' Gros- Murphy, W,' Stewart, T.,' Taub, 'NCI, R.,' 'Dept. of Genetics, Harvard veld, G.,2 Stephenson, J.,' Varmus, H.,' Westaway, D.,' Fung, Frederick Cancer Research Facil- Y.K.,' van Ooyen, A.A.,' Nusse, Medical School, Boston, Massa- ity, Frederick, Maryland; "Dept. of chusetts; 'International Agency for R.,' 'Dept. of Microbiology and Cell Biology and Genetics, Eras- Immunology, University of Califor- Research on Cancer, Lyon, France: Translocations involving the c-myc mus University, Rotterdam, The nia, San Francisco; "Dept. of Virol- Netherlands: Chromosomal trans- oncogene in Burkitt lymphoma. ogy, Antoni van Leeuwenhoekhuis, locations involving human cellular Amsterdam, The Netherlands: Re- Hayday, A.,' Saito, H.,' Wood, C.,' oncogenes. troviral insertion mutations during Tonegawa, S.,' Wiman, K.,2 Hay- oncogenesis by retroviruses with- ward, W.,' 'Center for Cancer Re-Hawley, R.G.,12 Shulman, M.1,', out viral oncogenes. search and Dept. of Biology, Mas- Hozumi, N.,12 'Ontario Cancer In-

SESSION 7mos, fos, erb, fes, rel, abl Chairperson:H. Hanafusa, Rockefeller University, New York, New York Danos, 0., Yaniv, M., Molecular Bi- Blair, D.G., Wood, T.G., Propst, F., ick Cancer Research Facility, Fred- ology Dept., Pasteur Institut, Paris, Seth, A., McGeady, M.L., Oskars- erick, Maryland: Properties of the mouse and human mos oncogene France: An homologous domain son, M.K., Woodworth, A.M., between the human c-mos gene Vande Woude, G.F., NCI, Freder- loCus.

215 product and a papillomavirus poly- Verma, I.M ., Curran, T., Miller, for Biomedical Research, Massa- peptide with putative role in eellu- A.D., Muller, R., Van Beveren, C., chusetts Institute of Technology, lar transformation. Molecular Biology and Virology Cambridge: Transformation by Ab- Laboratory, Salk Institute, San MLV. Cohen, J.B., Dreazen, O., Horowitz, Diego, California: Viral and eellu- M., Klar, A., Unger, T., Rechavi, lar/as gene—Structure and expres- G., Givol, D., Canaani, E., Dept, Anderson, S.J., Sherr, C.J., Division sioii. of Chemical Immunology, Weiz- of Human Tumor Cell Biology, St. mann Institute of Science, Rehovot, Jude Children’s Research Hospital, Witte, O.N., Whitlock, C., Ziegler, Israel: Insertion of endogenous in- Memphis, Tennessee: Transform- S., Swanson, S., Robertson, D., tracisternal A-particle genomes ing glycoproteins encoded by the Stafford, J., Dept, of Microbiology oncogene v-fms. into the c-mos oncogene in mouse and Molecular Biology Institute, plasmacytoma. University of California, Los An- Wilhelmsen, K.C., Tarpley, W.G., geles: Transformation and differ- Hayman, M.J.,1 Beug, H.,2 1Imperial Temin, H.M., McArdle Labora- entiation of defined stages of mu- Cancer Research Fund, London, tory, University o f Wisconsin, rine B .lymphocytes by the abl England; 2European Molecular Bi- Madison: Identification of some of oncogene. ology Laboratory, Heidelberg, Fed- the parameters governing transfor- eral Republic of Germany: Analysis mation by oncogenes in retrovi- Baltimore, D., Prywes, R., Wang, J., of the avian erythroblastosis virus ruses. Foulkes, J.G., Whitehead Institute erbB gene product.

SESSIO N 8 Gene Expression Chairperson: A. Levine, State University of New York, Stony Brook, New York

Rigby, P.W.J.,1 Brickell, PM .,1 Latch- Linzer, D.I.H., Nathans, D., Dept, of Garrels, J.I., Franza, R , Cold Spring man, D .S.,1 Murphy, D .,1 Westphal, Molecular Biology and Genetics, Harbor Laboratory, New York: K.-H.,1 Willison, K.,2 Scott, Johns Hopkins University School of Transformation-sensitive proteins M. R. D.,1 1 Dept I of Biochemistry, Medicine, Baltimore, Maryland: detected by computer-analyzed two- Imperial College of Science and Growth-related changes in specific dimensional gel electrophoresis. Technology; 2Chester Beatty Re- mRNAs of cultured mouse cells. Bravo, R., European Molecular Biol- search Laboratories, Institute of Celis, J.E., Fey, S.J , Larsen, P.M., ogy Laboratory, Heidelberg, Fed- Cancer Research, London, Eng- Celis, A., Dept, of Chemistry, Aar- eral Republic of Germany: Epider- land: Cellular genes activated in hus University, Denmark: Expres- mal growth-factor-induced changes transformed cells and their rela- sion of cellular proteins in normal in the polypeptide synthesis of A431 tionship to normal development. and tumor cells of human origin. cells.

SESSIO N 9 Keratins Chairperson: H. Green, Harvard Medical School, Boston, Massachusetts

Weber, K., Geisler, N., Max-Planck Franke, W.W.,1 Schiller, D .L.,1 Hatz- proteins to type human tumor ma- Institute for Biophysical Chemistry, feld, M,,1 Magin, T.,1 Jorcano, J.,2 terial. Goettingen, Federal Republic of Mittnacht, S.,2 Achtstaetter, T.,2 Germany: Structure of nonepithe- Cohlberg, J.,1 Quinlan, R .,1 Geiger, B.,1 Gigi, O.,1 Kreis, T.E.,1 | | | and epithelial intermediate fil- Schmid, E.,1 Moll, R.,1 Franz, Schmid, >E.,2 Jorcano, J.L.,2 Mitt- ament proteins—A molecular basil J.K.,1 Kartenbeck, J.,1 Venetianer, nacht, S.,3 Franke, W.W.,21Dept, of of their diversity. A .,3 1Institute of Cell and Tumor Chemical Immunology, Weizmann Institute of Science, Rehovot, Is- Fuchs, E., Dept, of Biochemistry, Biology, German Cancer Research Center; 2Center of Molecular Biol- rael; 2Institute of Cell and TUmor University of Chicago, Illinois: Two Biology, German Cancer Research distinct classes of keratins from the ogy, University of Heidelberg, Fed- Center; 3Center of Molecular Biol- intermediate filaments of verte- eral Republic of Germany; 3Institute ogy, University o f Heidelberg, Fed- brate epithelial cells. of Genetics, Hungarian Academy of Sciences, Szeged, Hungary: Cyto- eral Republic of Germany: Dy- Sun, T.-T.,1■2 Eichner, R.,2 Weiss, keratins-Biosynthesis, complex namic rearrangements of cyto- R.A.,2 Nelson, W.G.,2 Cooper, D .,1 formation, and interactions with keratin polypeptides in cells. 1Dept, of Dermatology and Phar- desmosomes. macology, New York University Rheinwald, J.G., Dana-Farber Cancer Medical School, New York; 2Depts. Osborn, M .,1 Debus, E .,1 Altmanns- Institute, Harvard Medical School, of Dermatology, Opthamology, and berger, M.,2 Weber, K .,1 1Max- Boston, Massachusetts: Expression Cell Biology and Anatomy, Johns Planck Institute for Biophysical of subsets of the keratin family and Hopkins University Medical Chemistry; 2Dept, of Pathology, vimentin in differentiated epithelial School, Baltimore, Maryland: Im- University of Goettingen, Federal cell types as a function of growth munological characterization and Republic of Germany: Use of con- and malignant transformation. functional significance of mammal- ventional and monoclonal anti- ian epithelial keratins. bodies to intermediate filament

SESSION 10 T, t, P53 EBNA Chairperson: D. Nathans, Johns Hopkins University, Baltimore, Maryland

Kriegler, M., Botchan, M., Dept, of California, Berkeley: Enhanced DNA tumor viruses mediated by re- Molecular Biology, University of morphological transformation by troviral expression systems. 216 Pipas, J.M., Chiang, L.-C., Barnes, Schlossman, R., Dana-Farber Can- Cancer Research Fund Laborato- D.W., Dept, of Biological Sciences, cer Institute and Harvard Medical ries, London; 3Marie Curie Memor- University of Pittsburgh, Pennsyl- School, Boston, Massachusetts: ial Foundation, Oxted, England: vania: Effect of cell type, hormonal Immunofluorescent localization and Molecular analysis of the gene for conditions, and viral genetic back- antigenic modulation of SV40 small the p53 cellular tumor antigen. ground on transforming infections T antigen in cells producing T but .Oren, M., Zakut, R., Bienz, B., Gi- of SV40. not large T antigen. vol, D., Dept, of Chemical Immu- Tijan, R., Dynan, W., Rio, D., Jones, Mercer, W.E., Avignolo, C., Baserga, nology, Weizmann Institute of Sci- K., Dept, of Biochemistry, Univer- R., Dept, of Pathology, Temple ence, Rehovot, Israel: Structure and sity of California, Berkeley: Posi- University Medical School, Phila- expression of the genes coding for tive and negative regulation of tran- delphia, Pennsylvania: p53 protein murine p53. scription by binding of Spl and T in cell proliferation. Hearing, J., Levine, A.J., Dept, of antigen to the SV40 early promoter Microbiology, State University of region. Harlow, E .,1 Benchimol, S.,2 Craw- New York, Stony Brook: Expres- ford, L.,2 Lamb, P.,2 Leppard, K.,2 sion and genetic mapping of an EBV Livingston, D.M., Murphy, C.I., Ell- Jenkins, J.,3 1Cold Spring Harbor nuclear antigen. man, M.S., Bikel, I., Figge, J., Laboratory, New York; 2Imperial

SESSION 11 Promoters Chairperson: B. Weinstein, Columbia University, New York, New York

Nishizuka, Y., Dept, of Biochemistry, N.A., Yeh, E., NCI, National Insti- and characterization of specific re- Kobe University School of Medi- tutes of Health, Bethesda, Mary- ceptor for biologically active phor- cine; Dept, of Cell Biology, Insti- land: Membrane and cytosolic re- bol and ingenol esters—Homoge- tute for Basic Biology, Okazaki, Ja- ceptors for the phorbol ester tumor neous receptor is a calcium- pan: Protein kinase C and mechan- promoters. independent protein kinase. ism of action of tumor promoters. Shoyab, M., Boaze, B., Jr., NCI, Blumberg, P.M., Jaken, S., Jeng, A.Y., Frederick Cancer Research Facil- Konig, B., Leach, K.L., Sharkey, ity, Frederick, Maryland: Isolation

SESSION 12 ras Chairperson: P. Duesberg, University of California, Berkeley, California

Wigler, M., Shimizu, K., Tapa- Laboratories, West Point, Pennsyl- and mechanisms of activation of the rowsky, E., Fasano, O., Birnbaum, vania: ra5-related gene sequence human c-rasKl oncogene in lung tu- D. , Ruley, M.A., Goldfarb, M., identified and isolated from S. mors. Cold Spring Harbor Laboratory, cerevisiae. Guerrero, I., Mayer, A., Pellicer, A., New York: Structures of three ras Yuasa, Y., Eva, A., Needleman, S., Dept, of Pathology and Kaplan genes activated in human tumor cell Kraus, M., Pierce, J., Rhim, J., Sri- Cancer Center, New York Univer- lines. vastava, S., Gazit, A., Srinivasan, sity Medical Center, New York: McGrath, J., Capon, D., Seeburg, P, A., Gol, T., Tronick, S., Reddy, P., Carcinogen- and radiation-induced Goeddel, D., Levinson, A., Dept, Aaronson, S., NCI, National Insti- mouse lymphomas contain an acti- of Molecular Biology, Genentech tutes of Health, Bethesda, Mary- vated c-ras oncogene. Inc., South San Francisco, Califor- land: ras-related oncogenes of hu- Bassin, R.H .,1 Noda, M .,1 Scolnick, nia: Structure, organization, and man tumors. E.M.,2 Selinger, Z.,3 1NCI, Na- activation of the human Kirsten-ras Marshall, C.J., Hall, D., Newbold, tional Institutes of Health, Be- gene family. R., Malcolm, S., Weiss, R., Insti- thesda, Maryland; 2Merck Sharp Barbacid, M., Santos, E., Sukumar, tute for Cancer Research, Chester and Dohme Laboratories, West S., Notario, V., Pulciani, S., Reddy, Beatty Laboratories, London, Eng- Point, Pennsylvania; 3Hebrew Uni- E. P., NCI, National Institutes of land: ras genes and cell transfor- versity, Jerusalem, Israel: Study of Health, Bethesda, Maryland: ras- mation. possible relationships among one transforming genes in human and Nakano, H., Yamamoto, H., Neville, genes using flat revertants isolated experimentally induced tumors. C., Evans, D., Perucho, M., Dept, from Ki-MSV-transformed cells. DeFeo-Jones, D., Scolnick, E.M., of Biochemistry, State University of Merck Sharp and Dohme Research New York, Stony Brook: Structure

SESSION 13 E1A, E1B Chairperson: J. Darnell, Rockefeller University, New York, New York

Land, H., Parada, L.F., Cunningham, version of primary rat embryo fi- van der Eb, A.J.,1 Bernards, R .,1 J., Murray, M., Weinberg, R.A., broblasts. Schrier, P.I.,1 Bos, J.L.,1 Vaessen, Center for Cancer Research, Mas- Ruley, E., Cold Spring Harbor Labo- R.T.M.J.,1 Jochemsen, A.G.,1 Me- sachusetts Institute of Technology; ratory, New York: Separate estab- lief, C.,2 1Dept, of Medical Bio- Whitehead Institute for Biomedical lishment and transforming func- chemistry, State University, Lei- Research, Cambridge, Massachu- tions are required for transform- den; 2Dept, of Tumor Immunology, setts: Two cooperating oncogenes ation of primary cells by viral and Amsterdam, The Netherlands: Al- are required for tumorigenic con­ cellular genes. 217 tered expression of cellular genes in sylvania: Examination of the trans- bridge; Regulation of gene expres- adenovirus-transformed cells. forming and tumor-inducing capac- sion by the El A region of Ad5. Chinnadurai, G., Institute for Molec- ity of a number of Ad 12 El host- Treisman, R., Green, M., Maniatis, ular Virology, St. Louis University range mutants and cells transform- T., Dept, of Biochemistry and Mo- Medical Center, Missouri: Ad2 ed by subgenomic fragments of EIB-coded 19-kD tumor antigen Ad 12 El region. lecular Biology, Harvard Univer- plays an essential role in cell trans- Logan, J., Winberg, G., Pilder, S., sity, Cambridge, Massachusetts: formation. Hearing, P., Shenk, T., Dept, of Activation of globin gene transcrip- Microbiology, State University of tion by viral immediate early gene Gallimore, P.H.,1 Byrd, P.J.,1 Grand, products. R.,1 Whittaker, J.,1 Breiding, D.,2 New York, Stony Brook: Func- Williams, J.F.,2 1Cancer Research tional analysis of the Ad5 E1A and Nevins, J.R., Imperiale, M.J., Feld- Campaign Laboratories, University E1B transcription units. man, L.T., Kao, H.-T., Rockefeller of Birmingham, England; 2Dept, of Jat, P.S., Kingston, R.E., Sharp, P.A., University, New York, New York: Biological Sciences, Carnegie-Mel- Dept, of Biology, Massachusetts Function of the adenoviral El A Ion University, Pittsburgh, Penn­ Institute of Technology, Cam­ gene product.

SESSION 14 Surface Antigens Chairperson: S. Weissman, Yale University, New Haven, Connecticut

Gooding, L.,1 Geib, R.,1 O’Connell, nia State University College of associated antigens defined by K.,1 Harlow, E.,2 |Dept. of Micro- Medicine, Hershey: Localization of monoclonal antibodies. biology and Immunology, Emory antigenic sites reactive with cyto- Koprowski, H., Dept, of Anatomy University School of Medicine, At- toxic lymphocytes on the proximal and Biology, Wistar Institute, Phil- lanta, Georgia; 2Cold Spring Har- half of SV40 T antigen. adelphia, Pennsylvania: Human tu- bor Laboratory, New York: Anti- mor antigens. body and cellular detection of SV40 Schlom, J., Colcher, D., Hand, P.H., T antigenic determinants on the Greiner, J., Wunderlich, D., NCI, surfaces of transformed cells. National Institutes of Health, Be- Tevethia, S., Lewis, A., Tevethia, M., thesda, Maryland: Human breast Dept, of Microbiology, Pennsylva­ carcinoma and colon-carcinoma-

HUMAN T-CELL LEUKEMIA VIRUSES September 14-September 15

Welcoming Address: M. Essex, Harvard School of Public Health Introduction: R. Gallo, National Cancer Institute

SESSION 1 Animal Models and Related Viruses Chairpersons: Y. Ito, Kyoto University, Japan, and P. Vogt, School of Medicine, University of Califor- nia, Los Angeles

Vogt, P.K., Dept, of Microbiology, Cancer Center, New York, New Short Talks University of Southern California York: T-cell lymphoid malignan- Ito, Y., Dept, of Microbiology, Fac- School of Medicine, Los Angeles: cies and feline acquired immune ulty of Medicine, Kyoto University, Mechanisms of viral leukemogene- deficiency syndrome (FAIDS) of Japan: Tumor-promoting diterpene pet cats induced by FLV. sis. esters as possible environmental de The, G., Faculty of Medicine, cofactor(s) for ATL. Brack, C.,1 Ghysdael, J.,1 Portetelle, CNRS, Lyon, France: Pathobiology -University of Goodenow, M.M., Shih, C.-K., Hay־Burny, A.,1 1 2 ׳D.^l2 and epidemiology of Epstein-Barr ward, W.S., Memorial Sloan-Ket- Brussels; 2Faculty of Agronomy, virus. Gembloux, Belgium: Antigenicity tering Cancer Center, New York, of the envelope glycoprotein (gp51) Shafritz, D.A., Rogler, C.E., Liver New York: ALV and c-myc activa- ofBLV. Research Center, Albert Einstein tion. College of Medicine, Bronx, New Rowley, J., University of Chicago Hardy, W.D., Jr., Zuckerman, E.E., York: Review of properties of hep- Medical School, Illinois: Chromo- Laboratory of Veterinary Oncol- atitis B virus related to DNA and some abnormalities in human ogy, Memorial Sloan-Kettering RNA tumor viruses. lymphoid disease.

SESSION 2 HTLV: Proteins and Nucleic Acids Chairpersons: F. Wong-Staal, National Cancer Institute, Bethesda, Maryland, and M.M. Yoshida, Can- cer Institute, Tokyo, Japan

Sarngadharan, M.G., Dept, of Cell Kensington, Maryland: Introduc- Oroszlan, S.,1 Copeland, T.D.,1 Kaly- Biology, Litton Bionetics, Inc., tion. anaraman, V.S.,2 Sarngadharan, 218 M.G.,' Schultz,A.M.,'Gallo, tured T cells of adult T-cell leuke- General Hospital, Boston; 6NCI, mia patients. National Institutes of Health, Be- R.C.,' 'NCI, Frederick Cancer Re- se- search Facility, Frederick; 'Dept. of thesda,Maryland:HTLV Yoshida, M., Seiki, M., Hattori, S., quences in leukemias and in AIDS. Cell Biology, Litton Bionetics, Inc., Watanabe, T., Dept. of Viral Oncol- Kensington; 'NCI, National Insti- ogy, Cancer Institute, Tokyo, Ja-Seigel, L.J.,' Nash, W.G.," Manzari, tutes of Health, Bethesda, Mary- pan: Genome structure of ATLV V.,' Wong-Staal, E,' Gallo, R.C.,' land: Chemical analysis of HTLV (HTLV) and its involvement in leu- O'Brien, S.J.,' 'Laboratory of Tu- structural proteins. kemogenesis of ATL. mor Cell Biology, 'Laboratory of Viral Carcinogenesis, NCI, Na- Lee, T.H., Howe, C.W.S., McLane, Haseltine, WA., Sodroski, J.G., Pa- tional Institutes of Health, Be- M.F., Tachibana, N., Essex, M., tarca, R., Trus, M., Perkins, D., thesda, Maryland: On the dynamic Dept. of Cancer Biology, Harvard Crowther, R., Dana-Farber Cancer nature of proviral integration in School of Public Health, Boston, Institute, Harvard Medical School, HTLV-infected malignancies- A Massachusetts: HTLV-associated Boston, Massachusetts:Structure genetic analysis. antigens recognized by human and function of HTLV. serum antibodies. Reitz, M.S., Jr., Clarke, M.F., Trai- Mullins, IL,' Brody, D.,' Kim, H.J.,' nor, C.D., Mann, D.L., Gallo, Weiss, R., Nagy, K., Clapham, P., McLane, M.E,' Essex, M.,' Rub- R.C., NCI, National Institutes of Cheingsong-Popov, R., Institute of samen, H.,' Gold, J.W.,' Feorino, Health, Bethesda, Maryland: HTLV Cancer Research, Chester Beatty P.,' Cabradilla, C.,' Schooley, R.,' and HLA antigen expression. Laboratories, London, England: Hirsch, M.,' Wong-Staal, F.,6 Fran- Biological properties of HTLV en- chini, B.,6 Gallo, R.C.,6 'Harvard Short Talks velope antigens. School of Public Health, Boston, Popovic, M., Fran- Wong-Staal, F., Franchini, G., Hahn, Massachusetts; 'Paul Ehrlich Insti- Gelmann, E., B., Gelmann, E.P., Manzari, V., tut, Frankfurt, Federal Republic of chini, G., Wong-Staal, F., Gallo, Gallo, R.C., NCI, National Insti- Germany; 'Memorial Sloan-Ketter- R.C., NCI, National Institutes of ing Cancer Center, New York, New Health, Bethesda, Maryland: A new tutes of Health, Bethesda, Mary- human retrovirus associated with a land: Integration and expression of York; 'Centers for Disease Control, HTLV genomes in fresh and cul- Atlanta, Georgia; 'Massachusetts T-cell hairy cell leukemia.

SESSION 3T-cell Biology and the Effects of HTLV Chairpersons: K. Lennert, Christian-Albrechts University, Kiel, Federal Republic of Germany, and H. Kaplan, Stanford University, Stanford, California

Greaves, M.F., Imperial Cancer Re- thesda; 'NCI, Frederick Cancer Re- G.,' Trainor, C.D.,' Gallo, R.C.,' search Fund Laboratories, London, search Facility, Frederick, Mary- Reitz, M.,' 'NCI, National Insti- England: T-cell differentiation and land;'VeteransAdministration tutes of Health; 'Uniformed Serv- malignancy. Hospital, Hines, Illinois: Infection ices University of the Health Sci- ences, Bethesda, Maryland: HTLV- Haynes, B.F.,' Palker, T.J.,1 Scearce, and transformation of human T cells by HTLV. infected B-cell lines established R.M.,' Robert-Guroff, M.,' Kaly- from patients with adult T-cell leu- anaraman, V.S.,2 Bolognesi, D.P.,' Michalski, M., Popovic, M., NCI, kemias. Gallo, R.C.," 'Depts. of Medicine National Institutes of Health, Be- and Surgery, Duke University, Dur- thesda, Maryland: Induction ofPoiesz, B., ',2,' Moore, J.,.3 Merl, ham, North Carolina; 'NCI, Na- syncytia of HTLV isolates. Tomar, R.,' Zamkoff, tional Institutes of Health, Be- Davey, E,' Planas, Gottlieb, thesda,Maryland:Monoclonal Miyoshi, I.,' Taguchi, H.,' Fujishita, A.,' Runge, L.,' Cowan, B.,123 antibodies against human T-cell M.,' Yoshimoto, S.,' Ohtsuki, Y.,' Reeves, W.,'2 Ruscetti, F.,' Han, leukemia virus (HTLV) p24 inter- 'Dept. of Medicine, 'Dept. of Pa- T.,° Cabradilla, C.,' Ehrlach, G.,' thology, Kochi Medical School, Ja- nal core protein and HTLV-associ- R. Comis,',3 'Upstate Medical Cen- pan: Natural infection in monkeys ated p19 protein identify antigens in ter, 'Veterans Administration Med- normal human tissue. with adult T-cell leukemia virus or ical Center, Syracuse; 'Barbara a closely related agent. Weissman,I.,McGrath, M., Tid- Kopp Research Center, Auburn; marsh, G., Marian, J., Dept. of Pa- Mituya, H., Gallo, R., Broder, S., 'Syracuse University, New York; thology, Stanford University School NCI, National Institutes of Health, 'NCI, Frederick Cancer Research of Medicine, California: Retrovirus Bethesda, Maryland: Cytotoxic T Facility,Frederick,Maryland; receptors on T- and B-cell lympho- cells specific for HTLV. 6Roswell Park Medical Institute, cytes. Buffalo, New York; 'Centers for Popovic, M.,' Markham, P.,' Sarin, Disease Control, Atlanta, Georgia: P.,' Salahuddin, Z.,' Robert-Gur- Short Talks Biology and epidemiology of HTLV. off, M.,' Mann, D.,' Allavena, P.,' Minowada, J.,' Gallo, R.C.,' 'NCI, Mann, D.L.,' Clark, J.,'Clarke, National Institutes of Health, Be- M.F.,' Strong, D.M.,' Franchini,

SESSION 4 Epidemiology and Natural History of HTLV-relatedDiseases Takatsuki, Kumamoto Chairpersons:D.P. Bolognesi, Duke University, Durham, North Carolina, and K. University, Japan versity Medical School, Japan: Takatsuki, K., Yamaguchi, K., Ka- H., Sanada, I., Second Dept. of In- wano, F., Nishimura, H., Tsuda, ternal Medicine, Kumamoto Uni- Adult T-cell leukemia/lymphoma 219 (ATL)- Clinicalfeature,epide- M.,3 Evatt, B.,4 Cabradilla, C.,4 Japan; Dept. of Cell Biology, Bio- miology, and cytogenetic, pheno- Francis, D.,4 'Dept. of Cancer Bi- tech Research Laboratory, Rock- typic, and functional studies of leu- ology, Harvard School of Public ville; NCI, National Institutes of kemia cells. Health, Boston, Massachusetts; Health, Bethesda, Maryland: Lo- Blattner, W., Saxinger, C., Blayney, 'Memorial Sloan-Kettering Cancer cation of HTLV p19 antigen on D., Clark, J., Robert-Guroff, M., Center, New York, New York; HTLV-producing cells and a role of Gallo, R., NCI, National Institutes 'Massachusetts General Hospital, natural antibody to HTLV-related of Health, Bethesda, Maryland: Boston; 4Centers for Disease Con- antigens in antibody-dependent cell- HTLV- Epidemiology and rela- trol, Atlanta, Georgia: Distribution mediatedcytotoxicity against tionship to human malignancy. of antibodies to HTLV-MA in pa- HTLV-producing cells. Catovsky, D., Matutes, E., Brito-Ba- tients with AIDS and related con- trol groups. Miyoshi, I.,' Taguchi, H.,' Fujishita, bapulle, V., MRC Leukaemia Unit, M.,' Yoshimoto, S.,' Ohtsuki, Y.,' Royal Postgraduate Medical School, Greaves, M.E,' Verbi, W,' Blattner, 'Dept. of Medicine, 'Dept. of Pa- London, England: Laboratory stud- thology, Kochi Medical School, Ja- ies in Caribbean patients with ATL. W.,' Robert-Guroff, M.,2 Hong- Guong, G.,2 Reitz, M.,2 Gallo, pan: Natural infection in monkeys Robert-Guroff, M.,' Saxinger, W C.,' R.C.,2 'Imperial Cancer Research with ATLV or a closely related Schupbach, J.,' Blayney, D.W.,' Po- Fund, London, England; 'NCI, Na- agent. povic, M.,' Kalyanaraman, V.S.,2 tional Institutes of Health, Be- Sarngadharan, M.G.,' Gallo, R.C.,' Saxinger, C.,' Blattner, W,' Lange- thesda, Maryland: HTLV in immi- Wantzin, G.,2 Lapin, B.,' Yakoleva, 'NCI, National Institutes of Health, grants to the United Kingdom. L.,3 Guo, C.,' Robert-Guroff, M.,' Bethesda; 'Litton Bionetics, Inc., Gallo, R.,' 'NCI, National Insti- Kensington, Maryland: Seroepide-Aoki, T., Hamada, C., Ohno, S., Mi- tutes of Health, Bethesda, Mary- miologic studies on HTLV. yakoshi, H., Robert-Guroff, M., land; 2Dept. of Dermatology, Fin- Essex, M.,' McLane, M.,' Lee, T.H.,' Ting, R.C., Gallo, R.C., Research sen Institute, Denmark; 'USSR Tachibana, N.,' Homma, T.,' Mul- Division,Shinrakuen ' Hospital; Academy of Medical Science, Suk- lins, J.,' Falk, L.,' de The, G.,' Dept. of Virology, Niigata, Univer- hami:HTL-Seroepidemiological Gold, J.,' Schooley, R.,3 Hirsch, sity School of Medicine, Niigata, studies in diverse populations.

SESSION 5Possible Role of HTLV in AIDS Chairpersons:J. Gutterman, University of Texas, Houston, and D. Francis, Centers for Disease Control, Phoenix, Arizona

Fauci, A.S., NIAID, National Insti- Health, Boston, Massachusetts; cellleukemia/lymphomavirus tutes of Health, Bethesda, Mary- 'Memorial Sloan-Kettering Cancer (HTLV) -Their role in lymphoid land: The immunobiology of AIDS. Center, New York, New York; disorders (AIDS). Safai, B., Pollack, M., Dupont, B., 'Massachusetts General Hospital, Boston; 4Centers for Disease Con- Montagnier, L.,' Barre-Sinoussi, F.,' Memorial Sloan-Kettering Cancer Dauguet, C.,' Rozenbaum, W.,' Center, New York, New York: HLA trol, Atlanta, Georgia: Distribution of antibodies to HTLV-MA in pa- Brun-Vezinet, F.,3 Rouzioux, C.,3 in cutaneous T-cell lymphoma and Klatzmann, D.,' Gluckman, J.C.,2 Kaposi's sarcoma -A possible ge- tients with AIDS and related con- trol groups. Chermann, J.C.,2 'Dept. of Virol- netic susceptibility to HTLV. ogy, Institut Pasteur; 2Hopital la Letvin, Hunt, R.D.,' 'Dana-Yoshida, M.,' Seiki, M.,' Watanabe, Pitie Salpetriere; 3H6pital Claude Farber Cancer Institute,Boston; T.,' Sugano, H.,' Kinoshita, T.,2 Bernard, Paris, France: A human T- 'New England Regional Primate Kazawa, M.,2 Abe, T.,2 'Dept. of lymphotropic retrovirus - Charac- Research Center, Southborough, Viral Oncology, Cancer Institute; terization and possible role in Massachusetts: Transmissible im- 'Dept. of Internal Medicine, School AIDS. munodeficiencysyndromeand of Medicine, Teikyo University, To- lymphomas in Macaque monkeys. Scott, G., Parks, W, Kanner, S., kyo, Japan: Proviral DNA of ATLV Fischl, M., Dickenson, G., de Med- Essex, M.,' McLane, M.,' Lee, T.H.,' (HTLV) in a hemophilia patient ina, M., Schiff, E., Depts. of Pedi- Tachibana, N.,' Homma, T.,' Mul- with AIDS-like symptoms in Japan. atrics, Microbiology, and Immu- lins,J.,' Falk, L.,' de The, G.,' nology and Medicine, University of Gold, J.,' Schooley, R.,3 Hirsch,Gallo, R.C., Sarin, P., Popovic, M., Miami School of Medicine, Flor- M.,' Evatt, B.,4 Cabradilla, C.,4 NCI, National Institutes of Health, ida: AIDS and HTLV. Francis, D.,4 'Dept. of Cancer Bi- Bethesda, Maryland: The family of ology, Harvard School of Public human retroviruses called human T-

220 BANBURY MEETINGS PROGRAMS

ACQUIRED IMMUNODEFICIENCY SYNDROME (AIDS) AND KAPOSI'S SARCOMA February 6-February 8

OVERVIEW

B. Safai, Memorial Sloan-Kettering J.W. Curran, centers for Disease Con- J.Shuster, McGill University, Mon- Cancer Center, New York, New York: trol,Atlanta, Georgia: Epidemiol- treal, Canada: AIDS and the hemo- Clinical aspects. ogy. philiac population.

SESSION 1Immunological Aspects I Chairperson:R.A. Good, Oklahoma Medical Research Foundation, Oklahoma City B. Dupont, Memorial Sloan-Kettering H.C. Lane, National Institute of Al- of Medicine, Bronx, New York. Cancer Center, New York, New York. lergy and Infectious Disease, Be- Al Ammann, University of Califor- P.Rubinstein, The New York Blood thesda, Maryland. nia, San Francisco. Center, New York, New York. A. Rubinstein, Albert Einstein College Discussants:J. Reuben, M.D. Anderson Hospital and Tumor Institute, Houston, Texas; J.L. Fahey, University of California, Los Angeles; F.P. Siegal, Mt. Sinai School of Medicine, New York, New York.

SESSION 2Immunological Aspects II Chairperson:K.W. Sell, National Institute of Allergy and Infectious Disease, Bethesda, Maryland S. Cunningham-Rundles, MemorialG. Quinnan, National Institutes ofG.M. Shearer, National Institutes of Sloan-Kettering Cancer Center, New Health, Bethesda, Maryland. Health, Bethesda, Maryland. York, New York. S. Zolla-Pazner, New York University E.M. Shevach, National Institute of Al- J. Laurence, Rockefeller University, School of Medicine, New York, New lergy and Infectious Disease, Be- New York, New York. York. thesda, Maryland.

SESSION 3 Pathology and Cell Biology Chairperson:R.C. Gallo, National Cancer Institute, Bethesda, Maryland D. Gospodarowicz, University of Cali-L.C.M. Reid, Albert Einstein College fornia, San Francisco. of Medicine, Bronx, New York.

SESSION 4Virology I D. Armstrong, Memorial Sloan-Ketter- G. Noble, Centers for Disease Control, D. Francis, Centers for Disease Con- ing Cancer Center, New York, New Atlanta, Georgia. trol, Phoenix, Arizona. York. W.L. Drew, University of California, M.S. Hirsch, Massachusetts General San Francisco. Hospital, Boston.

SESSION 5Virology H K.K. Takemoto, National Institute of M.S. Horwitz, Albert Einstein College D.H. Spector, University of California, Allergy and Infectious Disease, Be- of Medicine, Bronx, New York. San Diego, La Jolla, California. thesda, Maryland. G.S. Hayward, Johns Hopkins Univer- I.M. Arias, Albert Einstein College of R.C. Gallo, National Cancer Institute, sity, Baltimore, Maryland. Medicine, Bronx, New York. Bethesda, Maryland. 221 PLANT VIRUSES AND VIROIDS February 27-March 2

SESSION 1 S.H. Howell, University of California, England: Unencapsidated nucleic St. Paul: CaMV minichromosome. San Diego, La Jolla: Introduction to acids of CaMV and their significanceS.H. Howell, University of California, DNA viruses. in virus replication. San Diego, La Jolla, California: Re- K.E. Richards, Institut de Biologie Mo- T. Hohn, Friedrich Miescher-Institut, combination of CaMV genomes. loculaire et Cellulaire, Strasbourg, Basel, Switzerland: Reverse tran-L. Hirth, Institut de Biologie Molec- France: Structure and expression of scription involved in CaMV replica- ulaireetCellulaire,Strasbourg, CaMV DNA. tion. France: CaMV DNA in the elabora- R. Hull, John Innes Institute, Norwich, T.J. Guilfoyle, University of Minnesota, tion of gene vectors.

SESSION 2 R.M. Goodman, Calgene, Inc., Davis, M. Zaitlin, Cornell University, Ithaca, A. Siegel, Wayne State University, De- California: Genome structure and re- New York: Introduction to RNA vi- troit, Michigan: Characterization of lationships among whitefly-borne ruses. the subgenomic and host RNA spe- geminiviruses. P. Goelet, MRC Laboratory of Molec- cies encapsidated in vivo by TMV K.W. Buck, Imperial College of Sci- ular Biology, Cambridge, England: capsid protein. ence, London, England: Intracellular Nucleotide sequence of TMV RNA. T.J. Morris, University of California, forms of TGMV DNA. Berkeley:Virus-specific dsRNA - R.H. Symons, University of Adelaide, M. Zaitlin, Cornell University, Ithaca, Functional role in RNA virus infec- Australia: Characterizations of the New York: Characterization of sin- tion. DNA genomes of the Australian gle- and double-stranded subgenomic geminiviruses. RNAs from TMV-infected plants.

SESSION 3

W.O. Dawson, University of California, Lafayette, Indiana: Characterization Structure and genetic organization of Riverside: Examination of the mRNA of the RNAs of four strains of BSMV. CPMV RNAs. component of TMV RNA synthesis. G. Bruening, University of California, D.L. Nuss, New York State Department D.L.D. Caspar, Brandeis Univers; Ly, Davis: RNA and nucleocapsid accum- of Health, Albany: Molecular biol- Waltham, Massachusetts: Electro- ulationinprotoplastsresistant to ogy of WTV -Characterization of static interactions in the structure and CPMV. subgenomic RNAs associated with assembly of TMV. R.W. Goldbach, Agricultural Univer- extravectorial isolates. A.O. Jackson, Purdue University, West sity, Wageningen, The Netherlands:

SESSION 4

T.C. Hall, University of Wisconsin, Laboratory, New York: Molecular aca, New York: Reexamination of the Madison: Template and product spec- and genetic examination of virally as- nature and biological significance of ificity of plant virus replicases. sociated mutations in maize. linear viroid molecules -Sequence of A. van Kammen, Agricultural Univer- H.D. Robertson, Rockefeller Univer- the 5' end of linear PSTV molecules. sity, Wageningen, The Netherlands: sity, New York, New York: Introduc- A.D. Branch, Rockefeller University, Isolation and characterization of the tion to viroids, virusoids, and satel- New York, New York: Structure of CPMV RNA replication complex. lites. the viroid replication complex. J. Mottinger, University of Rhode Is- H. Sanger, Max-Planck-Institut fiirJ. Semancik, University of California, land, Kingston: Genetic and molecu- Biochemie, Munich, Federal Repub- Riverside: Nuclear replication and lar examination of virally associated lic of Germany: Studies on viroid cellular pathology in CEV infection. mutations in maize. replication. S.Dellaporta, Cold Spring Harbor P.Palukaitis, Cornell University, Ith-

SESSION 5 D. Riesner, Universitat Dusseldorf, Davis: Properties and biological ef- aca, New York: Comparison of four Federal Republic of Germany: Struc- fects of satellite RNA of TobRV. satellite RNAs of CMV. ture and cellular organization of vi-C.W. Collmer, Plant Protection Insti-R.I.B. Francki, University of Adelaide, roids. tute, USDA, Beltsville, Maryland: Glen Osmond, South Australia: Sat- R.A. Owens, Plant Protection Institute, Structural analyses of the cucumovi- ellite nature of some viroidlike RNAs. USDA, Beltsville, Maryland: Biolog- rus satellite RNAs differing in bio-R.H. Symons, University of Adelaide, ical activity of cloned PSTV cDNAs. logical function. Australia: Comparative structure and G. Bruening, University of California, P.Palukaitis, Cornell University, Ith- properties of virusoids.

222 ENHANCERS AND CONTROLLING ELEMENTS April 3-April 6

SESSION 1Papova Enhancers P. Chambon, Faculte de Medecine de tional position effects and enhance- enhancers of transformation and ac- Strasbourg, France: Upstream ele- ment of the SV40 early promoter. tivators of transcription. ments (72-bp and 21-bp repeats) of the A. Nordheim, Massachusetts Institute ofG. Khoury, National Cancer Institute, SV40 early promoter-In vivo and in Technology, Cambridge: Potential Z- Bethesda, Maryland: Specificity as- vitro studies. DNA in the SV40 enhancer region. sociated with viral enhancers. P Gruss, University of Heidelberg, W. Schaffner,University of Zurich,M.R. Capecchi, University of Utah, Germany: Competition for cellular Switzerland: Transcriptional enhanc- Salt Lake City: Location and function factors required for the transcrip- ers of viral and cellular origin. of retroviral and SV40 sequences that tional activation of enhancers. M. Botchan, University of California, enhance biochemical transformation T. Kadesch, Stanford University School Berkeley: Anatomy of the BPV acti- after microinjection of DNA. of Medicine, California: Transcrip- vator and the relationship between SESSION 2Promoters G.L. Hager, National Cancer Institute, D.H. Hamer, National Institutes of York, New York: Regulatory signals Bethesda, Maryland: Glucocorticoid Health, Bethesda, Maryland: Distinct in adenovirus-inducible promoter. regulatory sequence from MMTV - promoter and regulatory sequences of W. Dynan, University of California, A negative element? an inducible metallothionein gene. Berkeley: A promoter-specific tran- K.R. Yamamoto, University of Califor- scription factor that allows recogni- B. Roizman, University of Chicago, Il- nia, San Francisco: Fusions of a glu- tion of upstream sequence in early linois: Identification of the regulatory cocorticoid regulatory element to the SV40 promoter. tk promoter region-Hormone-regu- regions of alpha genes of HSV by lated enhancement of promoter activ- construction of a chimeric gene. ity. J. Nevins, Rockefeller University, New SESSION 3 Enhancers II R. Kamen, Genetics Institute, Boston, J.A. Hassell, McGill University, Mon- parison of enhancer functions in Massachusetts: Relationship between treal, Canada: Deletion mapping of SV40 and RSV. the polyoma virus enhancer and the the polyoma virus early promoter-en- T.E. Shenk, State University of New cis-acting element required for vi- hancer region. York, Stony Brook: The Ad5 E1A ral DNA replication- Studies using I.M. Verma, The Salk Institute, San transcription unit contains an en- SV40/polyoma recombinants. Diego, California: Enhancer ele- hancerlike element. E. Linney, La Jolla Cancer Research ments in murine LTR. P. Sassone-Corsi, Faculte de Medecine Foundation, California: Virus en- T.G. Wood, National Cancer Institute, de Strasbourg, France: An activator hancing sequences for teratocarci- Bethesda, Maryland: Sequences re- element upstream from the Ad2 E1A noma cells. quired for the activation of the trans- promoter. M. Yaniv,Institut Pasteur,Paris, forming potential of a normal cellular France: Function of polyoma virus gene, c-mos. enhancer in embryonal and differen- B.H. Howard, National Institutes of tiated cells of the mouse. Health, Bethesda, Maryland: Corn- SESSION 4 Promoters II S. Beckendorf, University of Califor- gene by heme via an upstream acti-K. Zinn, Harvard University, Cam- nia, Berkeley: Chromatin structure vation site. bridge, Massachusetts: DNA se- and expression of a Drosophila gluA.G. Hinnebusch, Massachusetts Insti- quences controlling expression of the protein gene. tute of Technology, Cambridge: Re- human 0-interferon gene. P.M. Bingham, State University of New peated DNA sequences and regula-H.R.B. Pelham, MRC Laboratory of York, Stony Brook: Properties of pu- tory genes that control amino acid Molecular Biology, Cambridge, Eng- tative enhancerlike elements at the biosynthetic genes in yeast. land: Anatomy of stress-inducible white locus of Drosophila. S. Mitrani-Rosenbaum, National Can- promoters. L.P. Guarente, Massachusetts Institute cer Institute, Bethesda, Maryland: of Technology, Cambridge: Regula- Regulation of the human interferon tion of the yeast iso-l-cytochrome c gene expression.

SESSION 5Special Systems M. Fried, Imperial Cancer Research V.T. 0i, Stanford University School of A. Rich, Massachusetts Institute of Fund Laboratories, London, Eng- Medicine, California: Control of im- Technology, Cambridge: Nucleotide land: Host sequences that enhance the munoglobulin gene expression in sequences, Z-DNA formation, and expression of adjacent DNA. transfected lymphoid cells. protein interactions. K. Calame, University of California, S. Tonegawa, Massachusetts Institute ofM. Green, Harvard University, Cam- Los Angeles: Regions in the mouse Technology, Cambridge: Tissue-spe- bridge, Massachusetts: Activation of immunoglobulin heavy-chain locus cific enhancer element in the major human globin gene transcription by that enhance transcription from the intron of an immunoglobulin heavy- cis- and trans-acting factors. SV40 early promoter. chain gene.

223 MECHANISMS OF PERCEPTION: MARR MEMORIAL CONFERENCE April 24-April 29 Participants

Allman, John, California Institute of Hoffman, Donald, Massachusetts Insti- Institute of Technology, Cambridge Technology, Pasadena tute of Technology, Cambridge Segev, Idan, National Institutes of Bajcsy, Ruzena, Moore School of Elec- Kass, Michael, Massachusetts Institute Health, Bethesda, Maryland tricalEngineering,Philadelphia, of Technology, Cambridge Sejnowski, Terrence, Johns Hopkins Pennsylvania Koch, Cristof, Massachusetts Institute University, Baltimore, Maryland Baker, Curtis, Dalhousie University, of Technology, Cambridge Stevens, Kent, University of Oregon, Halifax, Nova Scotia Koenderink,J.J.,Rijksuniversiteit Eugene Binford, Thomas, Stanford University, Utrecht, The Netherlands Sutherland, Stuart N., Sussex Univer- California Longuet-Higgins, Christopher H., Sus- sity, Brighton, England Bobick, Aaron, Massachusetts Institute sex University, Brighton, England Terzopoulos, Demetri, Massachusetts of Technology, Cambridge Mayhew, John, University of Sheffield, Institute of Technology, Cambridge Braddick, Oliver J., University of Cam- England Thompson, William, University of bridge, England Mandelbrot, Benoit B., Thomas J. Wat- Minnesota, Minneapolis Brady, Michael, Massachusetts Institute son Research Center, IBM, YorktownTorre, Vincent, Universita di Genova, of Technology, Cambridge Heights, New York Italy Brown, Christopher M., University ofMcGill, Michael, National Science Treisman, Anne, University of British Rochester, New York Foundation, Washington, D.C. Columbia, Vancouver, Canada Bulthof,Heinrich,Max-Planck-Insti-Mitchison, Graeme J.,University ofUllman, Shimon, Massachusetts Insti- tut fiir Biologische Kybernetik, Tu- Cambridge, England tute of Technology, Cambridge bingen, Federal Republic of Germany Morgan, Michael J., University College Vaina, Lucia, Boston University, Mas- Chien, Y.T., National Science Founda- London, England sachusetts tion, Washington, D.C. Nielsen, Kenneth R.K., Massachusetts Van Essen, David, California Institute Crick, Francis H.C., Salk Institute, San Institute of Technology, Cambridge of Technology, Pasadena Diego, California Nishihara, Keith H., Massachusetts In- Watt, R.J., University College London, Daugman, John, Harvard University, stitute of Technology, Cambridge England Cambridge, Massachusetts Poggio, Tomaso, Massachusetts Insti- Westheimer, Gerald, University of Cal- Dawson, Benjamin, Massachusetts In- tute of Technology, Cambridge ifornia, Berkeley stitute of Technology, Cambridge Reichardt, Werner, Max-Planck-Insti- Winston, Patrick, Massachusetts Insti- Fah le, Manfred, Eberhard-Karls-Uni- tut ffir Biologische Kybernetik, Tu- tute of Technology, Cambridge versitat, Tubingen, Federal Republic bingen, Federal Republic of Germany Witkin, Andrew, Fairchild Corpora- of Germany Richards, Whitman, Massachusetts In- tion, Palo Alto, California Frisby, John, University of Sheffield, stitute of Technology, Cambridge Woodham, RobertJ.,University of England Richter, Jacobi, Weizmann Institute of British Columbia, Vancouver, Canada Glaser, Donald A., University of Cali- Science, Rehovot, Israel Yuille, A., Massachusetts Institute of fornia, Berkeley Rosenfeld, Azriel, University of Mary- Technology, Cambridge Grimson, Eric, Massachusetts Institute land, College Park Zipser, David, University of California, of Technology, Cambridge Rubin, John, Massachusetts Institute of San Diego, La Jolla Hildreth, Ellen, Massachusetts Institute Technology, Cambridge of Technology, Cambridge Scheuhammer, Joseph, Massachusetts

SLOAN JOURNALISTS' WORKSHOP: NEW CONCEPTS IN MUTATION August 5-August 7

SESSION 1Genetic Origins SESSION 2Origins of Genetic SESSION 3 Engineering the of Human Disease Change Mutation Process J.Cairns, Harvard School of Public J.H. Miller, University of California,D. Shortle, State University of New Health, Boston, Massachusetts. Los Angeles. York, Stony Brook. M. Botchan, University of California, J.F.Crow, University of Wisconsin, M. Smith, University of British Colum- Madison. Berkeley. R.T. Schimke, Stanford University, bia, Vancouver, Canada. California.

SESSION 4 Mutation in EvolutionSESSION 5 Approaches to Hu- man Genetic Disease A.C. Wilson, University of California, Berkeley. C.T. Caskey, Baylor College of Medi- cine, Houston, Texas. 224 MECHANISMS OF MUTAGENESIS August 7-August 10

SESSION 1Genomic Rearrangements

J.Cairns, Harvard School of Public Madision. R.T. Schimke, Stanford University, Health, Boston, Massachusetts. G.Fink,MassachusettsInstitute of California. M. Botchan, University of California, Technology, Cambridge. M. Wigler, Cold Spring Harbor Labo- Berkeley. T.D. Tlsty, Stanford University, Cal- ratory, New York. W.R. Engels, University of Wisconsin, ifornia.

SESSION 2 Mutagenesis in Prokaryotes

J.H. Miller, University of California, New York. P.L. Foster, Harvard School of Public Los Angeles. G.C. Walker, Massachusetts Institute of Health, Boston, Massachusetts. F Hutchinson, Yale University, New Technology, Cambridge. L.A. Loeb, University of Washington, Haven, Connecticut. E. Eisenstadt, Harvard School of Pub- Seattle. J.E. LeClerc, University of Rochester, lic Health, Boston, Massachusetts.

SESSION 3Origins of Eukaryotic Mutation I

C.T. Caskey, Baylor College of Medi- R.J. Albertini, University of Vermont, ver, Colorado. cine, Houston, Texas. Burlington. F Sherman, University of Rochester, M. Calos, Stanford University, Cal- D. Martin, Jr., Genentech, Inc., South New York. ifornia. San Francisco, California. L. Prakash, University of Rochester, D.F. Barker, University of Utah, Salt D. Patterson, Eleanor Roosevelt Insti- New York. Lake City. tute for Cancer Research, Inc., Den-

SESSION 4Origins of Eukaryotic Mutation II

J.F.Crow, University of Wisconsin, Heidelberg,Federal Republic of Berkeley. Madison. Germany. T. Maniatis, Harvard University, Cam- S.M. Weissman, Yale University, New L.S. Lerman, State University of New bridge, Massachusetts. Haven, Connecticut. York, Albany. R.A. Flavell, Biogen Research Corpo- F.Vogel, Ruprecht-Karls-Universitat, A.C. Wilson, University of California, ration, Cambridge, Massachusetts.

SESSION 5 Directed Mutagenesis

M. Smith, University of British Colum- R.B. Wallace, City of Hope ResearchM. Grunstein, University of California, bia, Vancouver, Canada. Institute, Duarte, California. Los Angeles. D. Shortle, State University of New M. Inouye, State University of New York, Stony Brook. York, Stony Brook.

THE ROLE OF GENETIC PREDISPOSITION IN RESPONSES TO CHEMICAL EXPOSURE October 2-October 5

INTRODUCTION G.S. Omenn, University of Washing- W Kalow, University of Toronto, Can- ton, Seattle: From pharmacogenetics ada: A pharmacologist looks at phar- to ecogenetics. macogenetics and ecogenetics.

SESSION 1P-450 Systems Chairperson:G.S. Omenn, University of Washington, Seattle R.N. Hines, University of Nebraska,H. Gelboin, National Institutes of Nashville, Tennessee: Purification Omaha: Regulation of expression of Health, Bethesda, Maryland: Pheno- and characterization of a rat liver mi- cytochrome P-450. typing cytochrome P450 by mono- crosomal cytochrome P-450 involved M.J. Coon, University of Michigan, clonal-antibody-directed enzyme in- in debrisoquine 4-hydroxylation, a Ann Arbor: P-450 - Multiplicity of hibition and radioimmunoassay. prototype for genetic polymorphism inducers, isozymes, and substrates. F.P. Guengerich, Vanderbilt University, in drug metabolism. 225 SESSION 2Drug and Carcinogen Metabolism Chairperson:W.F. Bodmer, Imperial Cancer Research Fund Laboratories, London, England

D.S. Davies, University of London, E.S. Vesell, Pennsylvania State Univer-R.E. Kouri, Microbiological Associ- England: Studies of thesubstrate shy, Hershey: Impact of multiple dy- ates, Bethesda, Maryland: Variations specificity of human cytochrome P- namically interacting genetic and en- in aryl hydrocarbon hydroxylase lev- 450. vironmental factors on methods to J.R. Idle, University of London, Eng- els in mitogen-activated human lym- detect new polymorphisms of hepatic phocytes. land: Lung cancer-Consequence of drug oxidation. habit and inheritance? W.F. Bodmer, Imperial Cancer Re- search Fund Laboratories, London, C. Von Bahr, Huddinge University Hos- A.H. Conney, Hoffmann-La Roche, Inc., England: DNA polymorphisms in pital, Sweden: In vitro metabolism by Nutley, New Jersey: Variability in population and family studies -Ex- human liver in relation to poly- chemical biotransformations in hu- amples from the HLA system. morphic drug oxidation. man beings.

SESSION 3 Polymorphisms of Metabolizing Enzyme Systems Chairperson: A.H. Conney, Hoffmann-La Roche, Inc., Nutley, New Jersey

S.P. Spielberg, Hospital for Sick Chil- A.G. Motulsky, University of Washing- Sensitivity to drug-induced hemolytic dren, Toronto, Canada: Pharmaco- ton, Seattle: Biochemical genetics of anemia in glucose-6-dehydrogenase genetic susceptibility to toxic drug paraoxonase polymorphism. deficiency. metabolites in man. E Oesch, University of Mainz, FederalE.J. Calabrese, University of Massa- B.N. La Du, Jr., University of Michi- Republic of Germany: Variations in chusetts, Amherst: Animal model for gan, Ann Arbor: Could the human epoxide hydrolase activities in human blood hereditary disorders-Environ- paraoxonase polymorphism account liver and blood. mental applications. for different responses to certain en- E. Beutler, Scripps Clinic and Research vironmental chemicals? Foundation, La Jolla, California:

SESSION 4 Oncogene Activation and DNA and Chromosomal Markers Chairperson:J.E. Cleaver, University of California, San Francisco

R.A. Weinberg, Massachusetts Institute chemical carcinogenesis in different sociated with neoplastic transforma- of Technology, Cambridge: Onco- mouse strains. tion by chemical carcinogens. genes and human carcinogenesis. C.C. Harris, National Cancer Institute,J. Garrels, Cold Spring Harbor Labo- A. Pellicer, New York University, New Bethesda, Maryland: Carcinogenesis ratory, New York: Use of two-dimen- York: A chemical carcinogen acti- studies using cultured human tissues sional gel electrophoresis for detec- vates in vivo a mouse c-ras oncogene. and cells. tion of proteins indicating genetic A. Balmain, Beatson Institute for Can- T. Kakunaga, National Cancer Institute, risk. cer Research, Glasgow, Scotland: Bethesda, Maryland: Mutations as- Activation of oncogenes at stages of

SESSION 5 Immunological and Molecular Genetic Approaches Chairperson:H. Gelboin, National Institutes of Health, Bethesda, Maryland

B. Dupont, Memorial Sloan-Kettering specific for steroid-2l hydroxylation. netic predisposition in response to Cancer Center, New York, New York: H. Erlich, Cetus Corporation, Emery- chemical exposure. Disease susceptibility genes in the ville, California: HLA DNA poly-M.-C. King, University of California, HLA complex. morphisms -Use as genetic markers Berkeley: Genetic and epidemiologic P.C. White, Memorial-Sloan Kettering in control and disease populations. approaches for detecting susceptibil- Cancer Center, New York, New York: S. Wolff, University of California, San ity in populations. Cloning and expression of cDNA en- Francisco: Use of sister chromatid coding an adrenal cytochrome P-450 exchanges to determine possible ge-

SESSION 6Population Correlations Chairperson:C.C. Harris, National Cancer Institute, Bethesda, Maryland

F.Kueppers, Temple University, R.A. Cartwright, Yorkshire Regional P.G. Archer, University of Colorado, Philadelphia: Effect of smoking Cancer Organisation, Leeds, Eng- Denver: Some statistical and meth- on the development of emphy- land: Epidemiological studies on N- odologicalissuesincytogenetic sema in alpha-1 antitrypsin defi- acetylation and C-center ring oxida- testing. ciency. tion in neoplasia.

226 COFFEE AND HEALTH October 30-November 2

SESSION 1The Coffee Product Chairperson:R.G. Bost, GeneralFoods Corporation, White Plains, NewYork G.E. Boecklin, National Coffee Asso- W P. Clinton, General Foods Corpora- R.G.K. Strobel,Procter & Gamble ciation of USA, Inc., New York, New tion, White Plains, New York: Chem- Company, Ohio: Chemistry of instant York: Coffee-A social history. istry of coffee. coffee. A.E Beltrao, International Coffee Or- S.N. Katz, General Foods Corporation, A. Leviton, Harvard Medical School, ganisation, London, England: Coffee Hoboken, New Jersey: Decaffeina- Boston, Massachusetts: Correlates of in the world economy. tion of coffee. coffee consumption.

SESSION 2Coffee Mutagenesis -Experimental Approaches Chairperson:L.W. Wattenberg, University of Minnesota, Minneapolis T. Sugimura, National Cancer CenterH.P. Wurzner, Nestle Products Techni- tagenicity testing. Research Institute, Tokyo, Japan: cal Assistance Co. Ltd., Orbe, Switz- S. Takayama, Japanese Foundation for Mutagens in coffee-Background and erland: Preliminary findings of a car- Cancer Research, Tokyo: Long-term present knowledge of mutagens and cinogen bioassay of coffee in mice. carcinogenicity studies on caffeine, carcinogens produced by pyrolysis. H.-U. Aeschbacher, Nestle Products instant coffee, and methylglyoxal in M. Nagao, National Cancer Center Re- Technical Assistance Co. Ltd., Orbe, rats. search Institute, Tokyo, Japan: Muta- Switzerland: Risk evaluation of cof- gens in coffee. fee based on in vitro and in vivo mu-

SESSION 3Coffee and Human Carcinogenesis I Chairperson:T. Sugimura, National Cancer Center Research Institute, Tokyo, Japan Pancreatic Cancer Hygiene and Public Health, Balti- L.W. Wattenberg, University of Min- B. MacMahon, Harvard School of Pub- more, Maryland: Coffee and pan- nesota, Minneapolis: Protective ef- lic Health, Boston, Massachusetts: creatic cancer. fects of coffee constituents on carci- Coffee and cancer of the pancreas - A.S. Morrison, Harvard School of Pub- nogenesis in experimental animals. A review. lic Health, Boston, Massachusetts: Control of cigarette smoking in eval- Bladder and GI Tract Cancer uating the association of coffee drink- L. Gordis, Johns Hopkins School of ing and bladder cancer.

SESSION 4Coffee and Human Carcinogenesis II Chairperson:R. Saracci, International Agency for Research on Cancer, Lyon, France Ovarian Cancer Breast Cancer and Fibrocystic Disease setts: Breast cancer and coffee drink- D. Trichopoulos, University of Athens V.L. Ernster, University of California, ing. School of Medicine, Greece: A case- San Francisco: Epidemiological stud- E.M. Grossman, General Foods Cor- control investigation of a possible as- ies of coffee and breast disease. poration, Tarrytown, New York: Caf- sociation between coffee consump- E Lubin, Chaim Sheba Medical Center, feine and benign breast disease-A tion and ovarian cancer in Greece. Tel-Hashomer, Israel: Coffee and proposed clinical trial. S. Shapiro, Boston University School of methylxanthine in benign and malig- Medicine, Cambridge, Massachu- nant breast disease. setts: Ovarian cancer and coffee L. Rosenberg, Boston University School drinking. of Medicine, Cambridge, Massachu-

SESSION 5Physiological and Behavioral Effects Chairperson:S.R. Tannenbaum, Massachusetts Institute of Technology, Cambridge G.D. Friedman, The Permanente Med- L. Welin, University of Gothenburg,A. Sivak, Arthur D. Little, Inc., Cam- ical Group, Inc., Oakland, Califor- Sweden: Coffee, traditional risk fac- bridge, Massachusetts: Chronic ex- nia: Coffee and coronary heart dis- tors,coronary heartdisease, and perimental animal studies with cof- ease -Are there grounds for concern? mortality. fee.

227 BIOLOGICAL IMAGING AND NUCLEAR MAGNETIC RESONANCE (CONGRESSIONAL WORKSHOP) December 2-December 4

INTRODUCTION B. Chance, University of Pennsylvania, Philadelphia

OVERVIEW P.C. Lauterbur, State University of New York, Stony Brook

SESSION 1 SESSION 2 SESSION 3 T. Brady, Massachusetts General Hos- B. Chance, University of Pennsylvania, T. Budinger, University of California, pital, Boston, Massachusetts: Mole- Philadelphia: In vivo nuclear mag- Berkeley: Comparative and safety as- cules in magnetic fields. netic resonance. pects. M. Ter-Pogossian, Washington Univer- C. Higgins, University of California, P.C. Lauterbur, State University of New sity Medical School, St. Louis, Mis- San Francisco, Medical School: Pro- York, Stony Brook, and B. Chance, souri: Positron emission tomography. ton imaging and computed tomogra- University of Pennsylvania, Philadel- phy. phia: Summary discussion. Congressional redirect.

228 POSTGRADUATE COURSES Participants and Seminars

THE CELLULAR AND MOLECULAR BIOLOGY OF BEHAVIOR

Participants Blum, Andrew S., B.A., Rockefeller University, New York, Walsh, John, University of Texas, Houston New York Williams, Heather, B.A., Rockefeller University, New York, Bodnar, Deana A., B.S.E., University of Iowa, Iowa City New York Earnest, Thomas N., M.A., Boston University, Massa- chusetts Floeter, Mary Kay, B.S., Washington University, St. Louis, Seminars Missouri Axel, R., Columbia University. Introduction to the study of Friedman, Alan M., A.B., Yale Medical School, New Ha- gene regulation. ven, Connecticut Goldberg, D., Columbia University. Regulation of transmit- Goode, Marian I., B.A., Georgia Institute of Technology, ter synthesis. Atlanta Scheller, R., Stanford University. Genes, peptides, and Hakim, Vincent, Attache de Recherche of the CNRS, Paris, behavior. France Truman, J.,University of Washington. Hormones and Indik, Jonathan H., M.D., University of Pennsylvania, behavior. Philadelphia Kupfermann, I., Columbia University. Motivation. Jones, Bradley R., B.S., Hopkins Marine Station, Pacific Wine, J., Stanford University. Nerve circuitry for simple Grove, Pennsylvania behavioral acts and their control. LaMantia, Anthony-Samuel, B.A., Yale Medical School, Getting, P., University of Iowa. Rhythm generation in in- New Haven, Connecticut vertebrate motor systems. McFarland, Jenny Lee, S.B., University of Washington, Thach, WT., Jr., Washington University. Cerebellar content Seattle of posture and movement. Mistler, Lisa A.,S.B.,University of California, San Fuchs, A., University of Washington. Adaptive regulation Francisco in the oculomotor system. Morielli, Anthony D., B.S., University of California, Santa Ghez, C., Columbia University. Voluntary movements in Cruz mammals. Reye, David N., B.S., University of Alberta, Edmonton, Suga, N., Washington University. Brain pathways for sound Canada processing in bats. Sakurai, Masaki, M.D., University of Tokyo, Japan Heiligenberg, W, University of California, San Diego. Schachter, Leah A., B.A., Yale University, New Haven, Electrolocation and electric communication in fish. Connecticut Ross, E., Southwestern Medical School. Language func- Tamsky, Carolyn A., B.S., Arizona State University, Tempe tions in the human brain and their location. Wagner, Michael A., B.S., Institute for Cancer Research, Black, I., Cornell University. The role of neurotransmitters Philadelphia, Pennsylvania in behavioral abnormalities.

MOLECULAR BIOLOGY OF PLANTS

Participants Barnes, Wayne M., Ph.D., Washington University, St. Louis, Curtis, Stephanie E., Ph.D., University of Chicago, Illinois Missouri De Lorenzo, Giulia, Ph.D., Universita di Roma, Italy Choi, Kyung-Hee, Ph.D., Albert Einstein College of Medi- Fox, Thomas D., Ph.D., Cornell University, Ithaca, New cine, Bronx, New York York

229 Geste land, Raymond F, Ph.D., University of Utah, Salt Long, S., Stanford University. Nitrogen fixation -Sym- Lake City biosis. Green, Pamela J., B.S., State University of New York, Stony Hanson, M., University of Virginia. Plant cell culture and Brook organelle genetics. Haugli, Finn B., Ph.D., University of Troms6, Norway Van Montagu, M., Rijksuniversiteit Gent. Molecular biol- Hombrecher, Gerd G., Ph.D., John Innes Institute, Nor- ogy of crown gall disease. wich, England Ausubel, E, Massachusetts General Hospital. Nitrogen fix- Kinlaw, Claire S., Ph.D., Rice University, Houston, Texas ation -Enzymology and genetics. Kuhlemeier, Cris, M.S., State University of Utrecht, The Harada, J., University of California, Los Angeles. Regula- Netherlands tion of abundant genes during soybean embryogeny. Lemaux, Peggy G., Ph.D., Stanford University, California Dooner, H., Advanced Genetic Sciences. Maize controlling Mackey, CatherineJ.,Ph.D.,Pfizer,Inc.,Groton, elements. Connecticut Ellingboe, A., University of Wisconsin. Genetics of plant- Murphy, Caroline, Ph.D., University of Connecticut, Storrs pathogen interactions. Tenning, Paul P., Max-Planck-Institut, Koln, Federal Re- Bogorad, L., Harvard University. Chloroplast molecular public of Germany biology. Van Den Elzen, Peter J., Ph.D., Advanced Genetic Sci- Zaitlin, M., Cornell University. Plant viruses, viroids, vi- ences, Inc., Berkeley, California rusoids, and satellites. Miles, D., University of Missouri. Mutants in the photosyn- thesis pathway. Steinback, K., Advanced Genetic Sciences. Analysis of thy- lakoid polypeptides and electron flow in photosynthesis. Seminars Chau, N.H., Rockefeller University. Nuclear chloroplast in- Bidney, D., Advanced Genetic Sciences. The potato proto- teractions and gene regulation. plast system and plant breeding. Walbot, V., Stanford University. Developmental genetics of Kemble, R., Kansas State University. Mitochondrial DNA maize. and male sterility. Ho, D., University of Illinois. Hormone response mutants Maliga, P., Washington University. Cell culture mutant se- of barley. lection and protoplast fusion. Dunsmuir, P., CSIRO. Chlorophyll ab binding protein.

NERVOUS SYSTEM OF THE LEECH

Participants Davis, Robin L., B.S., M.A., Stanford University, California Thompson, Stephen W.N., B.S., University of Glasgow, Dietzel, Irmgard D., Ph.D., Max-Planck-Institut, Heidel- Scotland berg, Federal Republic of Germany Frederiksen, Kristen, M.S., Cold Spring Harbor Labora- tory, New York Friedman, Beth, Ph.D., Montreal General Hospital Re- Seminars search Institute, Canada Stent, G., University of California, Berkeley. Development Giraldez, Fernando, M.D., Ph.D., Physiological Labora- of leech nervous system. tory, Cambridge, England Weisblat, D., University of California, Berkeley. Develop- Kotak, Vibhakar C., Ph.D., Sardar Patel University, Kaira, ment of leech nervous systems. India Friesen, 0., University of Virginia. Swimming. Loer, Curtis M., B.S., University of California, San Diego Kristan, W, University of California,San Diego. Magill, Catherine, B.A., University of California, Berkeley Swimming. Sundin, Olof, Ph.D., Cold Spring Harbor Laboratory, New Hockfield, S., Cold Spring Harbor Laboratory. Monoclonal York antibodies for leech CNS.

MOLECULAR CLONING OF EUKARYOTIC GENES

Participants Alter, Barbara J., M.S., University of Minnesota, Duluth Gurney, Mark E., Ph.D., University of Chicago, Illinois Buxser, Stephen E., Ph.D., University of Massachusetts Kimura, Shoji, Ph.D., Memorial Sloan-Kettering Cancer Medical School, Worcester Center, New York, New York Carter, Richard, Ph.D., National Institutes of Health, Be- Leonard, Warren J., M.D., NCI, National Institutes of thesda, Maryland Health, Bethesda, Maryland Chen, Jeff W, M.S., Johns Hopkins University Medical Ponzetto-Zimmerman, Carola, Ph.D., Columbia University School, Baltimore, Maryland College of Physicians & Surgeons, New York, New York Griep, Anne E., B.A., University of Wisconsin, Madison Riddle, Donald L., Ph.D., University of Missouri, Columbia

230 Roberts, Anita B., Ph.D., National Institutes of Health, Be- Davis, M., Stanford University. Lymphocyte-specific gene thesda, Maryland expression and cloning. Roitman, Isaac, Ph.D., Universidad de Brasilia, Brazil Sutcliff, J.G., Scripps Institute. Localizing the products of Samson, Leona, Ph.D., University of California, Berkeley brain-specific genes. Sinangil, Faruk, Ph.D., University of Nebraska Medical Fischer, S., State University of New York, Albany. DNA Center, Omaha sequence-specific separation in denaturing gradient gel Tominaga, Akira, Ph.D., Harvard Medical School, Boston, electrophoresis. Massachusetts Fink, G., Massachusetts Institute of Technology. The con- Van Pel, Aline, Ludwig Institute, Brussels, Belgium trol of recombination between repeated DNA elements. Irwin, N., Harvard University. Expression of foreign genes in E. con. Hirsch, J., Harvard University. Reintroduction and expres- sion of genes into Drosophila. Seminars St. John, T., Stanford University. cDNA cloning in phage and manipulation of insert material. Croce, C., Wistar Institute. Genetics of Burkitt's lymphoma. McKnight, S., Fred Hutchinson Cancer Research Center. Lacy, E., Columbia University. Gene transfer into mice. Regulation of cellular and viral TK enzyme expression. Seed, B., Harvard University. Recovery and manipulation Wigler, M., Cold Spring Harbor Laboratory. Human trans- of recombinant DNA in vivo. forming genes. Vande Woude, G., National Institutes of Health. Properties Ruley, E., Cold Spring Harbor Laboratory. Ela, c-myc. of the mos oncogene locus in human and mouse genomes. Ward, D., Yale University. Biotin-labeled polynucleotides Scheller, R., Stanford University. The molecular genetic ba- as hybridization probes and affinity selection reagents. sis of simple behaviors. Mulligan, R., Massachusetts Institute of Technology. New Bender, W, Harvard University. Molecular genetics of the vectors for gene transfer in the mammalian cell and the bithorax complex in Drosophila. intact animal. Shortie, D., State University of New York, Stony Brook. Maniatis, T., Harvard University. Regulated expression of Directed mutagenesis. eukaryotic genes.

GENETICS AND MOLECULAR BIOLOGY OF CHLAMYDOMONAS

Participants Adams, G.M.W., Louisiana State University, Baton Rouge Hodson, Robert, Ph.D., University of Delaware, Newark Aldrich, Jane, Ph.D., Standard Oil of Ohio, Cleveland Homan, Wieger L., Ph.D., University of Amsterdam, The Ausich, Rodney L., Ph.D., Amoco Research Center, Naper- Netherlands ville, Illinois Hourcade, Dennis, Washington University,St. Louis, Bartlett, Sue G., Louisiana State University, Baton Rouge Missouri Bean, Barry,Ph.D., LehighUniversity,Bethlehem, Howell, Stephen H., Ph.D., University of California, San Pennsylvania Diego, La Jolla Benedick, Michael J., Ph.D., DNAX Research Institute, Palo Huang, Bessie, Baylor College of Medicine, Houston, Texas Alto, California Jarvik, Jonathan, Carnegie Mellon University, Pittsburgh, Blair, Lindley C., Ph.D., University of California, Berkeley Pennsylvania Brunke, Karen, Ph.D., Institute for Cancer Research, Phil- Lee, Robert W, Dalhousie University, Halifax, Nova Scotia adelphia, Pennsylvania Lemieux, Claude, Ph.D., National Research Council, Ot- Cox, John C., Ph.D., Martin Marietta Laboratories, Balti- tawa, Canada more, Maryland Lewin, Ralph, Scripps Institute of Oceanography, La Jolla, Detmers, Patricia A., Ph.D., Albert Einstein College of California Medicine, Bronx, New York Matagne, Rene F., Laboratory of Molecular Genetics, Liege, Dutcher, Susan K., Ph.D., Rockefeller University New York, Belgium New York Merlin, Ellis, Standard Oil of Ohio, Cleveland Forest, Charlene L., Ph.D., Brooklyn College, New York Mets, Laurens, University of Chicago, Illinois Foster, Ken, Mt. Sinai School of Medicine, New York, New Morel,Nicole,Ph.D.,TuftsUniversity,Medford, York Massachusetts Galloway, Ruth E.,Washington University,St.Louis, Mosig, Gisela, Ph.D., Vanderbilt University, Nashville, Missouri Tennessee Greenbaum, Elias, Ph.D., Oak Ridge National Laboratory, Muskavitch, Karen, Ph.D., Harvard University, Cam- Tennessee bridge, Massachusetts Hicks, James, Ph.D., Cold Spring Harbor Laboratory, New Polley, David L., Ph.D., Wabash College, Crawfordsville, York Indiana

231 Rochaix, Jean-David, University of Geneva, Switzerland Wang, W-Y., University of Iowa. Genetic dissection of por- Sager, Ruth, Sidney Farber Cancer Center, Boston, phyrin biosynthesis. Massachusetts Adams, G.M.W., Louisiana State University. Selection of Schloss, Jeffrey, Yale University, New Haven, Connecticut motility mutants. Segal, Rosalind, Rockefeller University, New York, New York Lee, R., Dalhousie University. Induction and selection of Sklar, Robert, Dana Farber Cancer Institute, Boston, chloroplast mutants/synchronized cultures and density Massachusetts transfer experiments. Small, Gary D., Ph.D.,University of South Dakota, Lewin, R., Scripps Institute of Oceanography. The genus Vermillion Chlamydomonas. Surzycki, Stefan, University of Geneva, Switzerland The mating reaction. Togasaki, Robert, Indiana University, Bloomington, Indiana Huang, B., Baylor College of Medicine. Genetic dissection Van Winkle-Swift, Karen, Ph.D., University of California, of flagellar axonemes. San Diego Schloss, J., Yale University. Molecular genetics of tubulin. Wang, Wei-Yeh, University of Iowa, Iowa City Foster, K., Mt. Sinai School of Medicine. Phototaxis. Weeks, Donald P., Ph.D., Zoecon Corporation, Palo Alto, Howell, S., University of California, San Diego. Genetics California and molecular biology of the cell cycle. Weiss, Richard L., Ph.D., San Diego State University, Van Winkle-Swift, K., University of California, San Diego. California Mating type in the genus Chlamydomonas. White, Frank F., Ph.D., University of Washington, Seattle Matagne, R., University of Liege. Cell fusion. Wydrzyndki, Thomas, Ph.D., Amoco Research Center, Na- Surzycki, S., Indiana University. In vitro transcription sys- perville, Illinois tems from Chlamydomonas. Brunke, K., Institute for Cancer Research. Shared homol- Seminars ogies in the 5' promoter regions of the coordinately reg- Sager, R., Sidney Farber Cancer Institute. Control of ma- ulated tubulin gene. ternal inheritance of chloroplast DNA by methylation. Rochaix, J.-D., University of Geneva. Transformation. Mets, L., University of Chicago. Identification of the phys- Hourcade, D., Washington University, St. Louis. Gene ical sites of genetic markers in the chloroplast genome. transfer from bleomycin-treated Chlamydomonas. Bartlett, S., Louisiana State University. Genetics of photo- Ausich, R., Amoco Research Center. Transformation of synthetic membranes. Chlamydomonas using Agrobacterium tumefaciens con- Togasaki, R., Indiana University. Genetics of the dark re- taining the T, plasmid. actions and ribulose bisphosphate carboxylase.

MOLECULAR EMBRYOLOGY OF THE MOUSE

Participants Chung, Su-yun, Ph.D., Princeton University, New Jersey Pratt, H., University of Cambridge. Gene expression in Crenshaw, E. Bryan III, S.B. University of California, San preimplantation embryos. Diego Chapman, V.,Roswell Park Memorial Institute. X- Hanahan, Doug, Ph.D., Cold Spring Harbor Laboratory, inactivation. New York Stewart, T., Harvard Medical School. Chimeras with tera- Krangel, Michael, Ph.D., Cold Spring Harbor Laboratory, tocarcinoma cells. New York McGrath, J., Wistar Institute. Nuclear transplantation with Lehrach, Hans, Ph.D., European Molecular Biology Lab- mouse embryos. oratory, Heidelberg, Federal Republic of Germany Axelrod, H., Wistar Institute. Isolation of pluripotent cell Rassoulzadegan, Minoo, Ph.D., Centre de Biochimie, Nice, lines from mouse embryos. France Spradling, A., Carnegie Institution of Washington. Gene in- Rigby, Peter, Ph.D., Imperial College, London, England sertion in Drosophila. Schmidt, Azriel, Ph.D., National Institutes of Health, Be- Angerer, R., University of Rochester. In situ hybridization thesda, Maryland with sea urchin embryos. Silver, Lee, Ph.D., Cold Spring Harbor Laboratory, New Lo, C., University of Pennsylvania. Intercellular commu- York nication in early mouse embryos. Stubbs, Lisa, University of California, San Diego lontophoresis of DNA into mouse eggs. Taniguchi, Tadatsugu, Ph.D., Cancer Institute, Tokyo, Japan Verma, I., Salk Institute. Oncogene expression in mouse Yisraeli, Joel K., Hebrew University, Jerusalem, Israel embryos. Mulligan, R., Massachusetts Institute of Technology. Viral vectors. Jaenisch, R., Heinrich-Pette Institut. Introduction of retro- viruses into the germ line. Seminars Rigby, P., Imperial College, London. Transformation acti- McLaren, A., MRC Mammalian Development Unit. Ori- vators in embryonic genes. gin, growth, and differentiation of germ cells. Silver, L., Cold Spring Harbor Laboratory. The T complex . X inactivation. in mice.

232 SINGLE-CHANNEL RECORDING

Participants Ashcroft, Frances M., Ph.D., University of Oxford, England McArdle, Joseph J., Ph.D., New Jersey Medical School, Assmann, Sarah M., B.A., Stanford University, California West Orange Carrow, Grant M., Ph.D., Harvard University, Cambridge, Robinson, Hugh P.C., B.A., Rockefeller University, New Massachusetts York, New York Dawson, David C., Ph.D., University of Michigan Medical School, Ann Arbor Ebihara, Lisa, Ph.D., University of Colorado, Boulder Jahr, Craig E., Ph.D., Harvard Medical School, Boston, Seminars Massachusetts Tank, D.W., Bell Laboratories. Patch-clamp procedures for Jalonen, Thula 0., M.S., University of Turku, Finland liposomes. Matthews, Hugh R.,B.A.,University of Cambridge, Steinbach, J.H., Salk Institute. Properties of acetylcholine England receptors in BC3H1 cells.

ADVANCED NEUROANATOMICAL METHODS

Participants Catsicas, Stefano, B.S.,Institute of Anatomy, Bugnon, LeTaillanter,Michel, Ph.D.,University of Minnesota, Switzerland Minneapolis Chuong, Cheng-Ming, M.D., Rockefeller University, New Ronchi, Elettra, M.S., University of Rome, Italy York, New York Vallury, Visalakshi, M.S., University of Illinois, Urbana Davidson, Robert M., M.S., State University of New York, Wald, Steven L., M.D., University of Vermont, Burlington Buffalo Hemmings, Hugh Carroll, Jr., B.S., Yale School of Medi- cine, New Haven, Connecticut Seminars Kennedy, Mary B., Ph.D., California Institute of Technol- Raviola, E., Harvard University. Freeze fracture and related ogy, Pasadena techniques in the study of the retina. Leonard, Debra S., B.S., Purdue University, West Lafayette, McKay, R., Cold Spring Harbor Laboratory. Neuroimmu- Indiana nology and hybridoma technology.

ADVANCED BACTERIAL GENETICS

Participants Armengod, Maria-Eugenia, Ph.D., Instituto de Investiga- Saunders, Roger, Ph.D., Chappaqua, New York ciones Citologicas, Valencia, Spain Shin, Hee-Sup, Ph.D., Sloan-Kettering Institute, New York, Berberich, Mary Anne, Ph.D., National Institutes of Health, New York Bethesda, Maryland Warren, Fred D., B.S., University of Connecticut Health Boxer, David H., Ph.D., Dundee University, Scotland Center, Farmington Brownstein, Bernard H., Ph.D., Abbott Laboratories, North Wolfe, Paul B., Ph.D., University of California, Los Angeles Chicago, Illinois Yakobson, Emanuel A., Ph.D., University of California, San Coulton, James W, Ph.D., McGill University, Montreal, Diego Canada Eichinger, Daniel J., New York University Medical Center, New York Fekete, Thomas, M.D., University of Chicago, Illinois Seminars Horn, Sherman, S.M., Ph.D., Johns Hopkins University, Adhya, S., NCI, National Institutes of Health. Control of Baltimore, Maryland the gal operon of E. coli. Levesque, Roger C., Ph.D., Massachusetts General Hospi- Susskind, M.M., University of Massachusetts Medical tal, Boston School. Changing the binding specificity of the repressor. Marcotte, William R., Jr.,B.S., University of Virginia, Schwartz, M., Institut Pasteur. Positive control in the mal- Charlottesville tose regulation of E. coli. Ruether, James E., B.A, Sloan-Kettering Institute, New Shuman, H., Columbia University. Use of gene fusions to York, New York study membrane transport proteins.

233 Oliver, D., Genetics Institute. Mechanism of protein locali- Roth, J., University of Utah. Novel genetic approaches to zation in E. coli. interesting biological problems. Grindley, N., Yale University Medical School. Rearrange- Miller, C., Case Western Reserve University. Salmonella ments mediated by Tn903 and what they tell us about genes regulated by growth phase. transposition mechanisms.

MOLECULAR AND CELLULAR NEUROBIOLOGY

Participants Akerblom, Ingrid E., B.S., University of California, San . Differences between peptidergic transmissions and Diego classical transmission. Baetscher, Manfred W, University of Basel, Switzerland McKay, R., Cold Spring Harbor Laboratory. How genes Bhakoo, Kishore K., B.S., Institute of Neurology, London, make brains. England Hockfield, S., Cold Spring Harbor Laboratory. Immuno- Bonini, Nancy M., A.B., University of Wisconsin, Madison logical probes of CNS structure. Chamberlain, Susan, B.S., University of Walk, Bristol, Jan, Y.-N., University of California, San Francisco. P/M England hybrid dysgenesis and the cloning of the IC+ channel in Chun, Jerold J.M., B.A., Stanford Medical School, the shaker. California Basbaum, A., University of California, San Francisco. DeVries, Steven H., B.S., University of Chicago, Illinois Principles of immunocytochemistry. Erondu, Ngozi E., B.S., California Institute of Technology, . Substance P and pain. Pasadena . Endorphins. Ge, Bang-lun, Ph.D., University of California, San Corey, D., Yale University. Voltage-dependent Ca conduct- Francisco ance in photoreceptors. Giovanni, Levi, Weizmann Institute, Rehovot, Israel Roberts, J., Columbia University. Use of recombinant DNA Grumet, Martin, Ph.D., Rockefeller University, New York, technology to isolate neuroactive gene sequences. New York Hume, R., Washington University, St. Louis. Neurotermi- Holton, Thomas, Ph.D., California Institute of Technology, nals release acetylcholine before synapse formation. Pasadena Lewis, R., University of California, San Francisco. Patch Kuffer,Pierre,Institutde Physiologie,Lausanne, electrode recording from hair cells. Switzerland Scheller, R., Stanford University. Molecular basis of a Lindgren, Clark A., M.S., University of Wisconsin, Madison "simple" behavior in Aplysia. Nef, Patrick, University of Geneva, Switzerland . Neuroendocrine baf cells, cloning the ELH gene Perkel,DavidJ.,HarvardUniversity,Cambridge, family, in situ hybridization, immunofluorescence. Massachusetts Heinemann, S., Salk Institute, Molecular cloning of the Raghavan, K. Vijay, Ph.D., Tata Institute of Fundamental acetylcholine receptors. Research, Bombay, India . Structure and function of the acetylcholine Ring, George D., M.S., Hebrew University, Jerusalem, receptors. Israel Frank, E., Introduction to sensory-motor synapses in the Stiemer, Rainer Helmut, Institut for Neurobiologie, Federal spinal cord. Republic of Germany . Mechanism of synaptic transmission at sensory- Made, Rebecca, B.S., Purdue University, West Lafayette, motor synapses in the spinal cord. Indiana . Development and plasticity of sensory-motor syn- Waddell, Pamela J., B.S., University of Bristol, Scotland apses in the spinal cord. Williams, Brenda P., University College London, England Dionne, V., University of California, San Diego. From ace- Yaffa, Mizrachi, M.Sc., Weizmann Institute of Science, Re- tylcholine receptors to olefaction. hovot, Israel Steinbach, J., Salk Institute. Developmental changes in Zelingher, Julian, B.S., Hebrew University, Jerusalem, junctional acetylcholine receptors. Israel Van Essen, D., California Institute of Technology. Synapse elimination at the neuromuscular junction. Kehoe, J., Ecole Normale Superieure. Synaptic elimination of synaptic conductance. Erulkar, S., University of Pennsylvania. Single-channel Seminars properties of the synaptically activated chloride channel Lindstrom, J., Salk Institute. Acetylcholine receptor: Puri- in Mollusca. fication, structure of subunits, and reconstitution. Bennett, M., Albert Einstein College of Medicine. Electri- Merlie, J., Washington University, St. Louis. Regulation of cal synapses and gap junctions: Morphology. the acetylcholine receptor. Brocks, J., California Institute of Technology. Glial growth Lindstrom, J., Salk Institute. Myosthenia gravis. factor. Jan, Y.-N., University of California, San Francisco. Do Jones, S., State University of New York, Stony Brook. M peptides act as neurotransmitters? currents of potassium in bullfrog autonomic ganglia.

234 Blaustein, M., University of Maryland. Hooked on angel . Growth and development of calecholaminergic dust: K channels phencyclidine and behavior. systems. Black, I., Cornell University Medical College. Calecholam- . Peptide-calecholamin interactions. inergic synapse. . Neurotransmitter diseases in humans.

NEUROBIOLOGY OF HUMAN DISEASE

Participants Allen, Donald, B.S., Rockefeller University, New York, New Stewart, Kim, B.A., State University of New York, Stony York Brook Boone, Timothy, M.S., University of Texas, Houston Wexler, Nancy, Ph.D., Hereditary Disease Foundation, Boyle, Mary B.,B.A.,YaleUniversity, New Haven, Beverly Hills, California Connecticut White, Jeffrey, Ph.D., State University of New York, Stony Bredesen, Dale E., M.D., University of California, San Brook Francisco Zaczek, Robert, B.S., Johns Hopkins University, Baltimore, Fitzpatrick, Susan, B.S., Cornell University, Ithaca, New Maryland York Greenamyre, Timothy, B.S., University of Michigan, Ann Arbor Halpain, Shelley, B.S., Rockefeller University, New York, New York Johnson,Eric,B.A.,Universityof Pennsylvania, Seminars Philadelphia Coyle, J., Johns Hopkins University School of Medicine. Kato, Ann, Ph.D., University of Geneva, Switzerland Degenerative diseases: Alzheimer's, Huntington's, and Krause, James, Ph.D., State University of New York, Stony experimental models. Brook Plum, F., Cornell University Medical College. Conscious- Levi, Giovanni, M.S., Weizmann Institute, Rehovot, Israel ness, stupor, and coma. Levin, Leonard, B.A., Harvard Medical School, Boston, Brady, R., National Institutes of Health. The lipidoses. Massachusetts Barker, J., National Institutes of Health. Epilepsy. Lillien, Laura, B.A., University of Wisconsin, Madison Fields, H., University of California Medical School. Pain Lipkin, Walter, M.D., University of California, San syndromes and neuropeptides. Francisco Jessell, T., Harvard Medical School. Pain syndromes and Orloff, Gregory, B.A., Yale University, New Haven, neuropeptides. Connecticut Lindstrom, J., Salk Institute. Autoimmune disease -Myas- Patel, Urmi, Ph.D., National Institutes of Health, Bethesda, thenia gravis. Maryland Gajdusek, C., National Institutes of Health. Slow viruses Ruggieri, Michael, B.A., University of Pennsylvania, and the central nervous system. Philadelphia Aguayo, A., McGill University, Montreal General Hospital. Rutecki, Paul, M.D., Baylor College of Medicine, Waco, Neural regeneration in the central and peripheral ner- Texas vous systems. Sapolsky, Robert, B.A., Rockefeller University, New York, Gazzaniga, M., Cornell University Medical College. Cog- New York nitive disorders and split brain function.

ADVANCED TECHNIQUES IN MOLECULAR CLONING OF EUKARYOTIC GENES

Participants Barber, Leslie, B.A., University of California, Los Angeles Osborne, Barbara, Ph.D., Amherst College, Massachusetts Craik, Charles, University of California, San Francisco Rice, Nancy, Ph.D., Frederick Cancer Research Facility, Jacob, William, M.S., Brown University Providence, Rhode Frederick, Maryland Island Savage, Nancy, Ph.D., Bethesda Research Laboratories, Kaczorek, Michel, Ph.D., Institut Pasteur, Paris, France Maryland Kehry, Marilyn, Ph.D., University of Oregon, Eugene Searls, David, Ph.D., Wistar Institute, Philadelphia, Lenardo, Michael, M.D., University of Iowa, Iowa City Pennsylvania Mason, Philip, Ph.D., ICRF, London, England Vincent, Karen, B.A., University of California, Berkeley

235 Seminars Woods, D., Harvard Medical School. Cloning cDNA of Messing, J., University of Minnesota. M13 cloning and gene complement. structure. Seeburg, P., Genentech. Site-directed mutagenesis of the Wallace, B., City of Hope. Hybridization with synthetic human growth hormone gene. DNA. Gallupi, G., Monsanto. Synthesis and use of oligonucleo- Tatchell, K., University of Pennsylvania. Use of oligonu- tides. cleotide linkers as mutagens.

ELECTROPHYSIOLOGICAL METHODS USED IN ANALYZING THE MODE OF ACTION OF TRANSMITTERS

Participants Acevedo, Larisa, B.A., University of California, Davis Numman, Randy, B.S., University of Texas, Galveston Agmon, Ariel, M.S., Stanford University, California Rogawski, Michael, Ph.D., National Institutes of Health, Block, Melodye, M.S.,University of California, Los Bethesda, Maryland Angeles Stansfeld, Catherine, M.S., University College, Cardiff Johansen, Jorgen, M.S., Cold Spring Harbor Laboratory, Wales New York Swope, Sheridan, B.S., Harvard School of Public Health, Lipscombe, Diane, B.S., University College London, Cambridge, Massachusetts England Mitchell, Clifford L., Ph.D., National Institute of Environ- Seminar mental Health Sciences, Research Triangle Park, Adams, P, State University of New York, Stony Brook. Maryland Slow and very slow postsynaptic currents.

YEAST GENETICS

Participants Boyd, Alan, Ph.D., The Leicester Biocentre, England Sternglanz, R., State University of New York, Stony Brook. Driscoll, Robert, B.A., University of Utah, Salt Lake City DNA topoisomerase yeast mutants. Dowhan, William, Ph.D., University of Texas, Houston Broach, J., State University of New York, Stony Brook. Ellwood, Marian Sue, Ph.D., University of Wisconsin, Yeast plasmid 2u circle. Madison Szostak, J., Dana Farber Cancer Institute. Properties of tel- Ford, Clark E, Ph.D., University of Virginia, Charlottesville omeres and artificial chromosomes. Hamer, Dean H., Ph.D., National Institutes of Health, Be- Petes, T., University of Chicago. Recombination of re- thesda, Maryland peated yeast genes. Howell, William M., Ph.D., University of Oregon, Eugene Hereford, L., Dana Farber Cancer Institute. Regulation of Krisch, Henry M., Ph.D., University of Geneva, Switzerland yeast histone gene expression. Lauquin, Guy J.-M., Ph.D., Centre d'Etudes Nucleaires, Rosbash, M., Brandeis University. Splicing of mRNA in- Grenoble, France trons in yeast. Lindberg, Martin J., Ph.D., Biomedical Center, Uppsala, Botstein, D., Massachusetts Institute of Technology. Ge- Sweden netics of actin and tubulin in yeast. Meacock, Peter A., Ph.D., University of Leicester, England Smith, M., University of British Columbia. Site-directed Roulland-Dussoix, Daisy M., Ph.D., Institut Pasteur, Paris, mutagenesis. France Grunstein, M., University of California, Los Angeles. Seale, Ronald L., Ph.D., Scripps Clinic and Research Foun- Deletion analysis of histone H2B genes. dation, La Jolla, California Prakash, L., University of Rochester. RAD genes of yeast. Simons, Robert W, Ph.D., Harvard University, Cambridge, Klar, A. and Strathern, J., Cold Spring Harbor Laboratory. Massachusetts Mechanism of recombination in mating-type switching. West, Robert W, Jr., Ph.D., Harvard University, Cam- Beach, D., Cold Spring Harbor Laboratory. Genetics in bridge, Massachusetts Schizosaccharomyces pombe. Zonneveld, B.J.M., Ph.D., State University of Leiden, The Fox, T., Cornell University. Interaction of mitochondrial and Netherlands nuclear genes. Seminars Bloom, K., University of North Carolina. Topology of yeast centromere DNA. Warner, J., Albert Einstein College of Medicine. Ribosomal protein genes and their regulation.

236 IMMUNOGLOBULINS: MOLECULAR PROBES OF THE NERVOUS SYSTEM

Participants Bixby, John L., Ph.D., University of California, San Wilson, D., University of Pennsylvania. Cell interaction in Francisco the immune system. Borroni, Edilio, Max-Planck-Institut, Gottingen, Federal Sprent, J., University of Pennsylvania. MHC restriction. Republic of Germany Anderson, D., Columbia University College of Physicians Caudy, Michael A., B.S., University of California, Berkeley & Surgeons. Acetylcholine receptor biosynthesis. Chin, Gilbert, A.B., Harvard University, Cambridge, Weber, E., Stanford University. Immunological analysis of Massachusetts opioid peptides. Duguid, John R., Ph.D., University of California, San Lindstrom, J., Salk Institute. The immunobiology of the Francisco acetylcholine receptor. Hishinuma, Akira, M.D., Columbia University, New York, Feramisco, J., Cold Spring Harbor Laboratory. The orga- New York nization of the cytoskeleton. Hockfield, Susan, Ph.D., Cold Spring Harbor Laboratory, Matthew, W., Harvard Medical School. Immunological New York studies of neurite outgrowth. del CNR, Kelly, R., University of California, San Francisco. Synaptic״ Pirchio, Mario, M.D., Istituto di Neurofisiologia Rome, Italy vesicle structure and secretion mechanisms. Sarthy, P. Vijay, Ph.D., University of Washington, St. Louis, Hockfield, S., Cold Spring Harbor Laboratory. Cellular or- Missouri ganization in the mammalian CNS. Wagner, Michael A., B.S., Institute for Cancer Research, Willard, M., Washington University. The structure and Philadelphia, Pennsylvania function of the axon. Harlow, E., Cold Spring Harbor Laboratory. Immunologi- cal analysis of SV40 T antigen. Seminars Karten, H., State University of New York, Stony Brook. Poljak, R., Institut Pasteur. The three-dimensional structure Antibodies as probes of defined neural circuits. of immunoglobulin. Gefter, M., Massachusetts Institute of Technology. Idiotype regulation and the origin of antibody diversity.

237

UNDERGRADUATE RESEARCH

An important aspect of the summer program at the Laboratory is the participation of college undergraduate students in active research projects under the supervision of full-time laboratory staff members. The program was initiated in 1959. Since that year, 249 students have completed the course, and many have gone on to creative careers in biological science. The objectives of the program are to provide (1) a greater understanding of the fundamental principles of biology, (2) an increased awareness of major problem areas under investigation, (3) better understanding of the physical and intellectual tools for modem research and the pertinence of this information to future training, and (4) a personal acquaintance with research, research workers, and centers for study. The following students, selected from a large number of applicants, took part in the program, which was supported by J.M. Foundation, Burroughs Wellcome Fund, and Bayer Aspirin (Glen Brook Labs). They are listed below with their Laboratory sponsors and topics of research.

Marvin Appel, Harvard University Andrew Nathanson, University of Pennsylvania Research Advisor: F. Daldal Research Advisor: R. McKay Growth of anaerobes under normal atmospheric condi- The molecular diversity of the embryonic nervous system tions in medium reduced by E. coli membrane extracts. of the rat. Michael Cahn, Dartmouth College Michael Schor, Cornell University Research Advisor: P. Thomas Research Advisor: A.J.S. Klar Sequence analysis of human stress protein genes. Search for a site-specific endonuclease gene in Schizo- Brad Cookson, University of Utah saccharomyces pombe. Research Advisor: M. Wig ler Thomas Smart, Cornell University Analysis of mutations altering expression of H-ras-1 Research Advisor: R. Malmberg genes. Cloning of the Nicotiana tabacum gene nitrate reduc- tase through insertional mutagenesis of a modified Lillie Hsu, University of Michigan Research Advisor: A.I. Bukhari T-DNA fragment of Agrobacterium tumefaciens. Vectors for shotgun cloning bacterial genes without re- Laurie Smith, Princeton University striction enzymes. Research Advisor: A.I. Bukhari Tn5 mutagenesis of the gin and mom genes of Mu. Kyu-Ho Lee, Massachusetts Institute of Technology Research Advisor: F. Tamanoi Olney Fellow Use of M13 to express H-ras-1 T24 bladder carcinoma Robert Dudley, Duke University p21 protein in E. coli. Research Advisor: R. McKay The generation of antibodies to neural gene products by Ramona Morfeld, Wheaton College Research Advisors: J. Hicks, J. Ivy means of cDNA clones. Anti-Mar-A disrupter of the negative regulation of the silent mating-type cassettes in Saccharomyces cerevisiae.

239

SEMINARS

Cold Spring Harbor Seminars were initiated to provide a semiformal avenue for communication between the various research groups at the Laboratory. They are particularly useful for research personnel who have joined the Laboratory during the summer. The seminars also afford a necessary opportunity for the graduate students and postgraduate staff to develop their skills in defending, organizing, and presenting their research. In addition to those listed below, seminars were given by many others involved in research at this Laboratory.

1982-1983 Mark Zoller, University of British Columbia, Vancouver, Canada: Assays of gene function using site-directed September mutagenesis. Michael Smith, University of British Columbia, Vancou- Michael Rabson, Yale University School of Medicine, ver, Canada: Applications of synthetic oligonucleotides New Haven, Connecticut: Genome structures of non- in molecular biology in DNA sequence determination, transforming Epstein-Barr virus variants. as probes, and site-directed mutagenesis. George Cross, Rockefeller University, New York, New Victoria Bautch, University of Illinois, Urbana: Organi- York: Variant surface glycoproteins of Trypanosoma zation and expression of Drosophila tropomyosin genes. bnicei -Structure and expression. Mary Jane Madonna, University of Indiana, Blooming- ton: Genetic and regulatory studies of the glt in Sal- December monella typhimurium. Susan Watts, University of Minnesota, Duluth: Transfor- Terrence Andreasen, University of Washington, St. Louis, mation by rabbit and human papilloma viruses. Missouri: Studies of calcium-regulated systems using Timothy Donohue, University of Illinois at Urbana- photoaffinity calmodulin probes. Champaign: Regulation of phospholipid biosynthesis in Rhodopseudomonas sphaeroides. October Markku Kurkinen, Imperial Cancer Research Fund, Lon- Lindley Blair, University of California, Berkeley: Pro- don, England: Basement membrane glycoproteins - cessing and secretion of yeast sex factors. Latninin and type IV collagen. Micholas Robakis, Roche Institute, Nutley, New Jersey: John Northup, University of Texas at Dallas: Guanine nu- DNA-directed in vitro synthesis of D1- and tripep- cleotide regulatory component of adenylate cyclase. tides -A novel system to study the regulation of the Patrick Hallenbeck, University of California, Davis: Ni- expression of prokaryotic genes. trogenase from the photosynthetic bacterium Rhodo- Robert Gerard, University of Miami, Florida: Genetic pseudomonas capsulata -Purification and regulation of analysis of nuclease-sensitive sites in SV40 chromatin. activity. Howard Fox, University of San Francisco Medical Cen- Mike Freeling, University of California, Berkeley: Inser- ter, California: Molecular clones of the t complex. tion elements in maize-Structure and function of Rob- Janet Tobian, Virginia Commonwealth University, Rich- ertson's mutator. mond: Molecular cloning in the streptococci. Lou Cantley, Harvard University, Cambridge, Massachu- Toran Wadell, Karolinska Institut, Stockholm, Sweden: setts: The Na/K ATPase and itsrole in cellular Molecular epidemiology of adenoviruses. differentiation. Jeremy Thomer, University of California, Berkeley: Ravi Dhar, National Institutes of Health, Bethesda, Mary- Polypeptide pheromone processing and secretion in land: Activation of the human bladder transforming yeast. gene.

November January Nick Hastie, Roswell Park Memorial Institute, Buffalo, Robert Weiss, University of Washington, St. Louis, Mis- New York: The complexities of gene expression in the souri: Ribosome frameshifting and mistranslation of the mouse. genetic code. Amikam Cohen, Hebrew University, Jerusalem, Israel: Barbara Thalenfeld and Lenore Gardner, Enzo Biochem- General plasmidic recombination -Role of bacterial icals, New York, New York: Nonradioactive labeling of functions. DNA with biotin.

241 Richard Ogden, University of California, San Diego: In Jesse Summers, Institute for Cancer Research, Philadel- vitro mutagenesis of yeast tRNA genes. phia, Pennsylvania: Replication of hepatitis-B-like George Pavlakis, NCI, National Institutes of Health, Be- viruses. thesda, Maryland: The regulation of genes in bovine Mark Furth, Memorial Sloan-Kettering Cancer Center, papilloma virus vectors. New York, New York: Expression of p32ras in E. coli Obaid Siddiqui, Tata Institute for Fundamental Research, and animal cells. Bombay,India:Neurogenetics of olfactionin Bob Steinberg, University of Connecticut, Storrs: Fine- Drosophila. structure analysis of mutations in the regulatory sub- Larry Klobutcher, University of Colorado, Boulder: Ge- unit of cyclic AMP-dependent protein kinase. nome rearrangement during macronuclear develop- Stephen Lam, Montana State University, Bozeman: The ment in ciliated protozoa. use of transposon mutagenesis in genetic studies of Peter Walter, Rockefeller University, New York, New Pseudomonas syringae. York: Trans location of proteins across the endoplasmic Graeme Laver, John Curtin School of Medical Research, reticulum. Birmingham, and Gillian Air, University of Alabama, Douglas Youvan, University of California, Berkeley: "R" Birmingham: The structure and variation of antigenic site-directed transposon mutagenesis and isolation of sites of influenza virus proteins. enhanced fluorescence mutants ofRhodopseudomonas Arnold Berk, University of California, Los Angeles: capsulata. Transcriptional control of adenovirus.

February April Diane Stassi, University of Syracuse, New York: The Mike Mackett, National Institutes of Health, Bethesda, cloning and control of expression of the maltosacchar- Maryland: Infectious vaccinia virus recombinants that omyces utilization gene ofStreptococcus pneumoniae. express foreign genes. Janet Lee, Imperial Cancer Research Fund, London, Clay Armstrong, University of Pennsylvania, Philadel- England: Molecular analysis of HLA-D region genes. phia: Gating currents-Or understanding sodium chan- Alex Rich, Massachusetts Institute of Technology, Cam- nels from its charge movements in the membrane. bridge: Z-DNA and the replication of transcription. Rolf Sternglanz, State University of New York, Stony Tim Baba, University of Texas, Dallas: Analysis of early Brook: Identification and characterization of yeast DNA events in avian leukosis virus-induced lymphomas. topoisomerase mutants. Jerry Lingrel, University of Cincinnati, Ohio: Different Joyce Hamlin, University of Virginia, Charlottesville: evolutionary origins of the developmentally regulated Characterization of a mammalian chromosomal globin genes. replicon. Richard Egel, Institute of Genetics, Copenhagen, Den- March mark: Pattern of mating-type switching in fission yeast. Michael Cole, St. Louis University, Missouri: Activation May ofmyconcogene by chromosome translocation. Marilyn Kehry, University of Oregon, Eugene: Sensory Dan Lundell, University of California, Berkeley: Struc- adaptation in bacterial chemotaxis. ture of the phycombilisome. Clyde Slaughter, University of Texas Health Sciences Pat Higgins, University of Wyoming, Laramie: Bacteri- Center, Dallas: Antibody diversity and idiotypes - ophage Mu transposition in vitro. Studies of murine anti-arsonate antibodies. Pablo Sco lnick, University of Chicago, Illinois: Molecular Chuck Lent, Brown University, Providence, Rhode Is- genetics of nitrogen fixation ofRhodopseudomonas land: Serotonin and feeding behavior in the leech. capsulata. Michael Merchlinsky, Yale University School of Medi- Michael Been, University of Washington, St. Louis, Mis- cine, New Haven, Connecticut: Studies with an infec- souri: Specificity of eukaryotic type-1 topoisomerase on tious molecular clone of the autonomous parvovirus native and single-stranded DNAs. MVM.

242 NATURE STUDY PROGRAM

The Nature Study Program gives elementary and high school students the opportunity to acquire a greater knowl- edge and understanding of their environment. Through a series of specialized field courses, students can engage in such introductory programs as Nature Detectives, Seashore Life, and Pebble Pups, as well as more advanced programs such as Marine Biology, Nature Photography, and the Geology of Long Island. During the summer of 1983 a new high of 475 students participated in the Nature Study Program. Most classes were held outdoors, when weather permitted, or at the Uplands Farm Nature Preserve of the Long Island Chapter of the Nature Conservancy. The Laboratory has equipped and maintains a darkroom and classroom/laboratories at Uplands Farm. This facility is used as a base for the student's exploration of the local environment. Field classes are held on Laboratory grounds, St. John's Preserve, Shu Swamp Preserve, Montauk Point State Park, the Long Island Pine Barrens, Caumsett Park, and in other area parks. In addition to the four-week courses, a series of one-day marine biology workshops was offered to students. Studies on the marine ecology of L.I. Sound were conducted aboard the 66-foot schooner J.N. Carter chartered from Schooner, Inc., of New Haven, Connecticut. Students were able to study the Sound chemically, physically, and biologically using the ship's instrumentation. The three-day Adventure Education class took children on an 18-mile bike hike to Caumsett State Park, a six-mile canoe trip on the Nissequogue River, and a day of sailing on the J.N. Carter.

PROGRAM DIRECTOR Edward Tronolone, M.S., P.D., Science Curriculum Associate, East Williston Public Schools

INSTRUCTORS Kathryn Bott, M.S., science teacher, Friends Academy Ruth Burgess, B.A., naturalist, Nassau County BOCES Michael Fricano, B.S., naturalist, Nassau County BOCES Robert Jaeger, M.S., science teacher, Mineola High School Eric Knuffke, M.S., science teacher, Mineola High School Fred Maasch, M.S., science teacher, Islip High School Bill Payoski, M.S., science instructor, Nassau Community College Linda Payoski, B.A., naturalist, Nassau County BOCES James Romanski, M.S., science teacher, Bay Shore High School

COURSES Nature Bugs Seashore Life Nature Detectives They Swim, Walk, and Crawl Advanced Nature Study Geology of Long Island Introduction to Ecology Marine Biology Frogs, Flippers, and Fins Nature Photography Pebble Pups Adventure Education Bird Study Marine Biology Workshop Fresh Water Life

243

I II LF#4-.'-* Ii ------, ,, , r I f 1 i I I I 1 ,1 / ii } f 1 ii ; i 1 i i i / I t ? i ;

L i '

1 i.

1 I 't-- ti / , 1 t I 5