September 11-13, 2011
ROME Università Urbaniana th probiotics prebiotics 6 & new foods chairpeople of the meeting L. Capurso G. Delle Fave L. Morelli A. Guarino
th probiotics prebiotics 6 & new foods the meeting is organised by
OLTRE LA NUTRIZIONE
under the patronage of
Italian Academy for the study of Intestinal Microbiota
SIGE - Società Italiana di Gastroenterologia
SINUT - Società Italiana di Nutraceutica
ESPGHAN - European Society for Paediatric Gastroenterology, Hepatology and Nutrition
SIGENP - Società Italiana di Gastroenterologia Epatologia e Nutrizione Pediatrica
Centro Studi dell’Alimentazione
2 INDEX
Sunday, September 11 Aula Magna p. 4
Monday, September 12 Aula Magna p. 6 Aula C p. 8 Aula Newman - Pediatric Day p. 12
Tuesday, September 13 Aula Magna p. 14 Aula C - Oral Communications p. 15 Aula Newman p. 19
Posters p. 20
Abstracts p. 27
Faculty p. 53 Index of Authors p. 57
General Information p. 61 Scientific Information p. 64 Exhibition Area p. 66
3 Aula Magna sunday, September 11
10.00 a.m. - 12.45 p.m. ITALIAN SOCIETY OF GASTROENTEROLOGY - GUT MICROBIOTA STUDY GROUP President: D. Festi (Italy) Chairpeople: A. Gasbarrini (Italy), G. Capurso (Italy)
The gut barrier: a complex interplay A. Gasbarrini (Italy)
LITERATURE UP TO DATE Gut mucous barrier E. Scarpellini (Italy)
Neuroenteric system activation R. De Giorgio (Italy)
Gut barrier and pancreatic diseases G. Capurso (Italy)
Discussion
REPORT OF ONGOING STUDIES
Microbiota, innate system, and gastrointestinal smooth muscles: ongoing studies C. Severi (Italy)
The pig model to study IBD-associated intestinal inflammation and dysbacteriosis: results from a preliminary study E. Grilli (Italy) BREAK
Morphology of segmented filamentous bacteria and their patterns of contact with the follicle-associated epithelium of the mouse terminal ileum: Implications for the relationship with the immune system M. Caselli (Italy)
HCV and liver steatosis: viral role and dismetabolic diseases C. Balsano (Italy)
Gut microbiota, probiotics and liver diseases C. Loguercio (Italy)
LECTURE The microbiota in IBS G. Barbara (Italy)
TAKE HOME MESSAGES D. Festi (Italy)
4 sunday, September 11 Aula Magna
03.00 - 03.30 p.m. WELCOME ADDRESS L. Capurso (Italy) 03.30 - 05.30 p.m. ROUND TABLE SCIENCE AND GUIDELINES: 10 TH YEARS OF FAO GUIDELINES Chairpeople: R. Marabelli (Italy), L. Morelli (Italy)
G. Delle Fave (Italy)
F. Guarner (Spain)
Y. Sanz (Spain)
M. Serafini (Italy) 05.30 - 07.00 p.m LECTURES Chairpeople: G. Delle Fave (Italy), A. Guarino (Italy)
Brain-gut axis and intestinal microbiota S.M. Collins (Canada)
Cellular stress as sensor for luminal factors and the microbiome D. Haller (Germany)
Functional metagenomics with relevance to host-microbe interactions J. Dorè (France)
WELCOME COCKTAIL
5 Aula Magna Monday, September 12
08.30 - 10.30 a.m. MICROBIOTA AND INTESTINAL HEALTH Chairman: R. Crittenden (Finland) Microbiota in Health and Disease W.M. de Vos (The Netherlands) Health Biomarker Bacteria C. Belzer (The Netherlands) Microbiota and Diet A. Salonen (Finland) Lactobacillus GG - Life After the Genome R. Kekkonen (Finland) Round Table Panel: WHAT DO WE NOW KNOW AND HOW CAN WE USE THIS? R. Crittenden (Finland), C. Belzer (The Netherlands), A. Salonen (Finland), R. Kekkonen (Finland), W.M. de Vos (The Netherlands) 10.30 - 11.30 a.m. IMMUNOLOGY AND GUT BACTERIA Chairpeople: M. Rescigno (Italy), F. Pallone (Italy) Probiotics and immunoregulation C. Nicoletti (United Kingdom) Immune modulation by probiotic bacteria in immune-compromised subjects A. Castellazzi (Italy) Aging, immunity and intestinal microbiota E. Mengheri (Italy) Fermented dairy product containing Lactobacillus casei CNCM I-1518/DN-114 001 reduces the incidence of common infections and modulates the innate immune response in shift workers E. Guillemard (France) 11.30 a.m. - 12.30 p.m. LACTOBACILLUS REUTERI: A SINGLE PROBIOTIC FOR SEVERAL INDICATIONS Chairpeople: C. Cricelli (Italy), M. Koch (Italy) Probiotics, Gutpain and the Nervous System J. Bienenstock (Canada) Role of Lactobacillus reuteri DSM 17938 in the uncomplicated diverticular disease A. Andriulli (Italy) Mucosal permeability and immune activation as potential therapeutic targets of probiotics in irritable bowel syndrome G. Barbara (Italy) Role of Lactobacillus reuteri DSM 17938 in the modulation of the bronchial inflammation in patients with cystic fibrosis S. Cucchiara (Italy) 12.30 - 01.30 p.m. NON BACTERIAL PROBIOTICS Chairwoman: M. Elli (Italy) Use of bacillus spores as probiotics for human use E. Ghelardi (Italy)
6 Monday, September 12 Aula Magna
Diet supplementation with Saccahromyces boulardii as a novel strategy to improve the Metabolic Syndrome in an animal model of obesity I. Castagliuolo (Italy) New clinically proven yeast probiotic in the area of IBS P. Justen (France) 01.30 - 02.30 p.m. LUNCH 02.30 - 04.00 p.m. NUTRIGENOMICS & GUT HEALTH Chairpeople: P. Louis (United Kingdom), G. Perozzi (Italy) Nutrigenomics as a tool to discover new functions for "old" molecules in chronic disease prevention F. Virgili (Italy) Inside the adaptation mechanisms of bifidobacteriam to the gastrointestinal environment A. Margolles (Spain) Dietary modulation of the human gut microbiota P. Louis (United Kingdom) A metagenomic approach to the “fermented food microbiota” C. Devirgiliis (Italy) 04.00 - 06.00 p.m. INTESTINAL MICROBIOTA AND IBD Chairpeople: R. Caprilli (Italy), M.A. Gassull (Spain) Engineering commensal bacteria and plants for the treatment of intestinal inflammation S. Carding (United Kingdom) Dysbiosis in IBD and differences in microbiota composition between inflamed and non inflamed intestine A. Walker (United Kingdom) Colonization by faecalibacterium prausnitzii and maintenance of clinical remission in patients with ulcerative colitis F. Guarner (Spain) Probiotics and IBD M. Rescigno (Italy) Clinical evidence of probiotic efficacy in IBD S. Danese (Italy)
Interactions between intestinal microbiota and innate immune system in pediatric inflammatory bowel disease S. Cucchiara (Italy) 06.00 - 07.00 p.m. LECTURES Chairpeople: E. Corazziari (Italy), M. Anti (Italy)
Prebiotics, probiotics and obesity-related disorders H. Tilg (Austria)
Bacterial overgrowth in IBS: the role for probiotics T. Karakan (Turkey)
7 Aula C Monday, September 12
08.30 - 10.00 a.m. NATURAL PRODUCTS AND GUT Chairpeople: D. Matteuzzi (Italy), N. Caporaso (Italy)
The modern analytical determination of complex mixtures of natural products M. Nicoletti (Italy)
Bioactivation of dietary phytochemicals by intestinal microbiota and bifidobacteria M. Rossi (Italy)
Polyphenols and human intestinal microflora: implications for health G. Scapagnini (Italy)
Gut microbiota and metabolic diseases M. Serino (Italy)
10.00 - 11.30 a.m. ORAL COMMUNICATIONS 1 Chairpeople: A. Saggioro (Italy), G. Capurso (Italy)
OC 1.1 - PATHOGEN AND PROBIOTIC BACTERIA DIFFERENTIALLY STIMULATE NITRIC OXIDE PRODUCTION AND S100B PROTEIN EXPRESSION IN HUMAN ENTEROGLIAL CELLS Turco Fabio* [1] , Sarnelli Giovanni [1] , Cirillo Carla [2] , Mango Annamaria [1] , Nasti Anna [1] , D'Alessandro Alessandra [1] , Farina Virginia [1] , Cuomo Rosario [1] [1] Università Federico II - Napoli, Italy - [2] K.U. Leuven - Leuven, Belgium
OC 1.2 - A PROBIOTIC COMBINATION TO REDUCE ANTIBIOTIC ASSOCIATED DIARRHOEA AND OTHER SIDE-EFFECTS OF ANTIBIOTIC-USE: A DOSE-RESPONSE STUDY Ouwehand Arthur* [1] [1] Danisco Sweeteners - Kantvik, Finland
OC 1.3 - ANTI-INFLAMMATORY EFFECTS OF LACTOBACILLUS RHAMNOSUS (LGG) COUNTERACT LIPOPOLYSACCHARIDE (LPS)-INDUCED PERSISTENT ALTERATIONS OF HUMAN COLONIC SMOOTH MUSCLE Ammoscato Francesca* [1] , Matarrese Paola [2] , Scirocco Annunziata [1] , Petitta Chiara [1] , Ascione Barbara [2] , Di Natale Giuseppe [3] , Marignani Massimo [4] , Malorni Walter [2] , Severi Carola [1] [1] Gastroenterology Unit A, Dip.Medicina Interna e Specialità Mediche, Università Sapienza - Roma, Italy [2] Department of Drug Research and Evaluation, Istituto Superiore di Sanità - Roma, Italy - [3] Department of Surgery, F. Durante, University ‘‘Sapienza’’ - Roma, Italy - [4] UOC Gastroenterologia, Ospedale S. Andrea - Roma, Italy
OC 1.4 - BEHAVIOUR OF ENTEROHEMORRHAGIC ESCHERICHIA COLI O157: H7 IN HUMAN SIMULATED DIGESTIVE CONDITIONS AND ANTAGONISTIC PROPERTIES OF A SACCHAROMYCES CEREVISIAE PROBIOTIC YEAST STRAIN Etienne-Mesmin Lucie* [1,2] , Livrelli Valérie [2] , Chassaing Benoit [2] , Privat Maud [2] , Denis Sylvain [1] , Alric Monique [1] , Darfeuille-Michaud Arlette [2] , Blanquet-Diot Stéphanie [1]] [1] ERT 18, Equipe de Recherche Technologique «Conception, Ingénierie et Développement de l’Aliment et du Médicament », Université d'Auvergne, Clermont-Ferrand, F-63000, France [2] E 2526 USC INRA 2018, Evolution des bactéries pathogènes et susceptibilité génétique de l’hôte, Université d'Auvergne, Clermont-Ferrand, F-63000, France
8 Monday, September 12 Aula C
OC 1.5 - BIFIDOBACTERIUM LACTIS BL-04™ REDUCES SYMPTOMS OF COMMON COLD IN HEALTHY PHYSICALLY ACTIVE INDIVIDUALS: A RANDOMISED CONTROLLED TRIAL Lahtinen Sampo* [1] , West Nic [2] , Pyne David [2] , Horn Peggy [2] , Cripps Allan [3] , Hopkins Will [5] , Brun Mary [6] , Warren Hilary [6] , Wu Fan [6] , Fricker Peter [2] [1] Danisco Health & Nutrition - Kantvik, Finland - [2] Australian Institute of Sport - Canberra, Australia - [3] Griffith University - Gold Coast, Australia - [5] Auckland University - Auckland, New Zealand - [6] Canberra Hospital - Canberra, Australia
OC 1.6 - HEAT INACTIVATED PROBIOTIC STRAINS SPECIFICALLY STIMULATE NFK - MAP KINASE PATHWAYS, DIFFERENT MIRNAS AND MATURATION IN CACO II ENDOTHELIAL CELLS AND IN DENDRITIC CELLS Ladan Giahi [1] , Eva Aumueller [1] , Manuela Nestlberger [1] , Ibrahim Elmadfa [1] , Alexander Haslberger* [1] [1] Univ Vienna, Dep. Nutritional Sciences - Vienna, Austria
OC 1.7 - SUPPLEMENTATION OF YOGURT BY COMMERCIALLY AVAILABLE BACILLUS CLAUSII ENDOSPORES Pal Karoly* [1] , Szarvas Jozse f [4] , Hilyakne Kadlott Maria [1] , Szen Orsolya [5] , Naar Zoltan [1] , Kiss Attila [4] [1] Eszterhazy Karoly College, Dept. of Food Chemistry and Biochemistry - Eger, Hungary - [4] Eszterhazy Karoly College, Dept. of Microbiology and Food Technology - Eger, Hungary - [5] Eszterhazy Karoly College, EGERFOOD Regional Knowledge Centre - Eger, Hungary
OC 1.8 - GALACTOOLIGOSACCHARIDES PRODUCTION FROM WHEY USING ENZYME ISOLATED FROM STREPTOCOCCUS THERMOPHILUS AND ASSESSMENT OF THEIR PREBIOTIC POTENTIAL Sangwan Vikas* [1] , Tomar Sudhir Kumar [1] , Ali Babar [1] , Singh R.R.B. [1] [1] National Dairy Research Institute - Karnal, India
OC 1.9 - DOSE-RESPONSE EFFECT OF BIFIDOBACTERIUM LACTIS HN019 ON WHOLE GUT TRANSIT TIME AND FUNCTIONAL GASTROINTESTINAL SYMPTOMS IN ADULTS Ouwehand Arthur* [1] , Waller Philip [2] , Gopal Pramod [3] , Leyer Greg [4] , Reifer Cheryl [5] , Stewart Morgan [5] , Miller Larry [5] [1] Danisco Sweeteners - Kantvik, Finland - [2] Accurate Clinical Research - Huston, USA - [3] Fonterra - Palmerston North, New Zealand - [4] Danisco USA - Madison, USA - [5] SPRIM - San Francisco, USA
OC 1.10 - MORPHOLOGY OF SEGMENTED FILAMENTOUS BACTERIA AND THEIR PATTERNS OF CONTACT WITH THE FOLLICLE-ASSOCIATED EPITHELIUM OF THE MOUSE TERMINAL ILEUM: IMPLICATIONS FOR THE RELATIONSHIP WITH THE IMMUNE SYSTEM Caselli M. [1] , Cassol F. [1] , Boldrini P. [1] , Vaira D. [1] , Calò G. [1] [1] School of Gastroenterology - Department of Experimental and Clinical Medicine; University of Ferrara, Ferrara, Italy
OC 1.11 - THE PIG MODEL TO STUDY IBD-ASSOCIATED INTESTINAL INFLAMMATION AND DYSBACTERIOSIS: RESULTS FROM A PRELIMINARY STUDY E. Grilli [1] , B. Tugnoli [1] , A. Zannoni [1] , M. L. Bacci [1] , M. Forni [1] , A. Piva [1] [1] DSMVET, Faculty of Veterinary Medicine, University of Bologna, Italy
9 Aula c Monday, September 12
11.30 a.m - 12.30 p.m. NEW FOODS AND LIVER DISEASE: EVIDENCE IN ANIMAL MODELS Chairpeople: A.F. Attili (Italy), F. Morisco (Italy)
Coffee components and NAFLD P. Vitaglione (Italy)
Garlic and liver what news? G. D'Argenio (Italy)
Nanoparticles and food component delivery G. Peluso (Italy) 12.30 - 01.00 p.m. LECTURE Flavonoids probable made of action M. Serafini (Italy) 01.00 - 01.30 p.m. LECTURE Probiotics and prebiotics: unconventional use M. Miraglia del Giudice (Italy) 01.30 - 02.30 p.m. LUNCH
02.30 - 04.00 p.m. NEW FOODS SESSION Chairman: V. Fogliano (Italy)
Prebiotic and cryoprotective properties of soluble fiber from hazelnut skin: effect on growth and viability of L. plantarum M. Arlorio (Italy)
Biological effects of yerba maté D. Bastos (Brazil)
Whole grain and cardiovascular health V. Fogliano (Italy)
Effects of dietary starch on the gut microbiota K.P. Scott (United Kingdom)
Gut in local and systemic anticancer response L. Vannucci (Czech Republic)
Apple polyphenols and colon cancer L. Ricciardiello (Italy)
10 Monday, September 12 Aula C
04.00 - 05.30 p.m. HEALTH AGEING PERSPECTIVE Chairpeople: M. Calvani (Italy), F. Marotta (Italy)
Gene-Nutraceutical interplay in a healthy-aging perspective: present tips & future avenues F. Marotta (Italy)
Aging and menopausal transition: effects of Klamath algae extracts on well-being and oxidative status A.D. Genazzani (Italy)
Proteic malnutrition, aminoacids and elderly V. Marigliano (Italy)
Exploring the role of “estrogen factor” in ageing men and its modulation through nutraceutics A. Polimeni (Italy)
Microbiota and health M. Calvani (Italy)
11 Aula Newman Monday, September 12 PEDIATRIC DAY With the endorsement of ESPGHAN
Chairman: A. Guarino (Italy)
08.30 - 10.00 a.m. DETERMINANTS OF MICROFLORA IN CHILDREN AND THEIR FUNCTIONAL MODIFICATION Chairpeople: G. Buonocore (Italy), J. Vanderhoof (USA)
Molecular approaches to intestinal microflora A. Swidsinski (Germany)
Nutrimetabolomics and its applications V. Fanos (Italy)
Microbiota composition and nutrition effects P. Lionetti (Italy)
Early immunomodulation by intestinal microflora L. de Ridder (The Netherlands)
10.00 - 10.30 a.m. LECTURE Intestinal microbiome and the metabolic consequences in neonates J.B.H. van Goudoever (United Kingdom)
10.30 - 11.00 a.m. COFFEE BREAK
Chairpeople: F. Indrio (Italy), F. Mosca (Italy), R. Shamir (Israel)
11.00 - 11.30 a.m. LECTURE Is early intestinal colonization a determinant of obesity? E. Isolauri (Finland)
11.30 a.m. - 12.00 p.m . LECTURE The gut barrier: new acquisitions and therapeutical approaches A. Gasbarrini (Italy)
12.00 - 01.30 p.m. EARLY FUNCTIONAL NUTRITION Early nutrition for the prevention of atopy C. Dupont (France)
Intestinal motility and microflora: a novel target for intestinal functional disorders (probiotics in IBS) S. Guandalini (USA)
Functional nutrition as adjunctive treatment in Cystic Fibrosis E. Bruzzese (Italy)
Bifidogenics effects by prebiotics: are they clinically important? I. Hojsak (Croatia) 12 Monday, September 12 Aula Newman
01.30 - 02.30 p.m. LUNCH
02.30 - 04.00 p.m. SAFETY AND QUALITY OF INFANT FORMULA AND ITS REGULATION Chairpeople: M. Giovannini (Italy), H. Szajewska (Poland)
Introduction P. Aggett (United Kingdom)
True and potential dangers from nutrient-deficient formulae. Lessons from a thiamine deficient formula R. Shamir (Israel)
The role of national and international health authorities in the control of infant formula V. Di Giorgi Gerevini (Italy)
Functional foods or functional nutrients for infants and children? C. Agostoni (Italy)
04.00 - 04.30 p.m. COFFEE BREAK
Chairpeople: M. Giovannini (Italy), J.B.H. van Goudoever (United Kingdom)
04.30 - 05.00 p.m. LECTURE Supplementation of infant formula with probiotics/prebiotics: lessons learned with regard to documentation of outcomes H. Szajewska (Poland)
05.00 - 06.30 p.m. FUNCTIONAL FOODS FOR PREVENTION IN THE GENERAL POPULATION AND IN RISK GROUPS
Clinical effects of PUFA in infant formula E. Verduci (Italy)
Time course of the bifidogenic effect and its clinical implications F. Salvini (Italy)
Co-administration of antibiotics and probiotic: what is the purpose Y. Vandenplas (Belgium)
Functional nutrition in preterm infants F. Indrio (Italy)
13 Aula magna Tuesday, September 13
08.30 - 11.30 a.m. PROBIOTI CS, DIETARY PHENOLICS AND HEALTH Chairpeople: A. Andriulli (Italy), M. Crespi (Italy)
Microbiota studies from European MetaHIT project F. Guarner (Spain)
Diet, prebiotics and intestinal microbiota K. Tuohy (United Kingdom)
Prebiotics and calcium absorption M.L. Brandi (Italy)
Probiotic benefits for athletes M. Gleeson (United Kingdom)
The aging gut microbiota: a new perspective P. Brigidi (Italy)
Antiageing strategies: the role of pre-probiotics and polyphenols from red wine E. Jirillo (Italy)
Dietary phenolics in human health and disease: from molecular mechanisms to preventive and therapeutic opportunities D. Del Rio (Italy)
Predictive biomarkers for response to functional foods P. Patrignani (Italy)
The microbiota and IBS; from dysbiosis to SIBO, from prebiotics and probiotics to antibiotics E. Quigley (Ireland)
11.30 a.m. - 01.00 p.m. CELIAC DISEASE SESSION Chairpeople: G.R. Corazza (Italy), M. Del Piano (Italy)
Enzyme strategies to detoxify gluten M. Rossi (Italy)
Gut microbiota analysis of italian children at-risk for celiac disease C. Catassi (Italy)
Weaning and prevention of food intolerance M. Silano (Italy)
Gut microbes and gliadin interactions in celiac disease pathogenesis Y. Sanz (Spain)
14 Tuesday, September 13 Aula C
08.30 - 09.30 a.m. FUNCTIONAL MEDICINE AND PRE-PROBIOTICS Chairman: A. Saggioro (Italy)
An introduction to functional medicine F. Ongaro (Italy)
Leaky gut and chronic inflammation A. Saggioro (Italy)
Prebiotics and microbiota health effects M. Roberfroid (Belgium)
Gut microbiota links gut barrier and metabolic endotoxemia to obesity and diabetes P.D. Cani (Belgium)
09.30 - 10.30 a.m. LECTURES Chairman: G. Fatati (Italy)
Synthesis "in vitro" of antioxidant compounds by enzymatic complexes isolated from germinated wheat G.L. Gianfranceschi (Italy)
Probiotics and cytochromes expression E. Bezirtzoglou (Greece)
10.30 a.m. - 01.00 p.m. ORAL COMMUNICATIONS 2 Chairpeople: M. Marignani (Italy), D. Festi (Italy)
OC 2.1 - COLONIC MUSCLE CONTRACTILE ACTIVITY FOLLOWING EXPOSURE TO LACTOBACILLUS RHAMNOSUS GG Guarino Michele [1] , Cocca Silvia* [1] , Altomare Annamaria [1] , Ammoscato Francesca [2] , Alloni Rossana [1] , Severi Carola [2] , Cicala Michele [1] [1] Campus Bio-Medico - Roma, Italy - [2] Università degli Studi "La Sapienza" - Roma, Italy
OC 2.2 - DETECTION, IDENTIFICATION AND QUANTIFICATION OF DIFFERENT PROBIOTIC STRAINS IN FOOD BY USING A MULTIPLEX QPCR Herbel Stefan* [1] , Gu n̈ ther Sebastian [3] , Wieler Lothar H. [2] [1] Stefan Roland Herbel - Berlin, Germany - [2] Lothar H. Wieler - Berlin, Germany - [3] , Sebastian Gu n̈ ther - Berlin, Germany
OC 2.3 - EVALUTATION OF PROBIOTIC BACTERIAL ADHESION TO NORMAL AND DIS PLASTIC COLONIC MUCOSA BY AN EX-VIVO ORGAN CULTURE EXPERIMENTAL MODEL Pagnini Cristiano* [1] , Corleto Vito [1] , Di Giulio Emilio [1] , Delle Fave Gianfranco [1] [1] Universita' di Roma "La Sapienza" - Roma, Italy
15 Aula c Tuesday, September 13
OC 2.4 - LACTOBACILLUS CASEI RHAMNOSUS STRAIN GG INHIBITS THE OXIDATIVE STRESS INDUCED BY ROTAVIRUS IN HUMAN ENTEROCYTES Buccigrossi Vittoria* [1] , Laudiero Gabriella [1] , Sofia Morena [1] , Oliva Valentina [1] , Verrone Maria Antonietta [1] , Wudy Anna [1] , Guarino Alfredo [1] [1] Dept. of Pediatrics University of Naples "Federico II°" - Naples, Italy
OC 2.5 - MOLECULAR BIOLOGICAL METHODS FOR RAPID DETERMINATION OF LACTIC ACID BACTERIA STRAINS ISOLATED FROM FOOD AND ENVIRONMENTAL SAMPLES Szen Orsolya* [3] , Pal Karoly [4] , Naar Zoltan [4] , Kiss Attila [5] [3] Egerfood National Knowledge Centre - Eszterhazy Karoly College - Eger, Hungary - [4] Eszterhazy Karoly College - Dept. of Microbiology and Food Technology - Eger, Hungary - [5] Eszterhazy Karoly College - Dept. of Food Chemistry and Biochemistry - Eger, Hungary
OC 2.6 - PROBIOTIC STRUCTURE FUNCTION ANALYSIS REVEALS PRTP- ENCODED LACTOCEPIN TO MEDIATE ANTI-INFLAMMATORY EFFECTS VIA SELECTIVE DEGRADATION OF IP-10 Szen Orsolya* [3] , Pal Karoly [4] , Naar Hörmannsperger Gabriele* [1] , von Schillde Marie- Anne [1] , Weiher Monika [1] , Alpert Carl-Alfred [2] , Hahne Hannes [3] , Bäuerl Christine [4] , Perez Gaspar [4] , Haller Dirk [1] [1] Biofunctionality, Technical University of Munich - Freising-Weihenstephan, Germany - [2]Gastrointestinal microbiology, German Institute for Human Nutrition - Potsdam-Rehbrücke, Germany - [3]Chair for Bioanalytics, Technical University of Munich - Freising-Weihenstephan, Germany - [4]Departamento de Biotecnología, Instituto de Agroquímica y Tecnología de Alimentos - Valencia, Spain
OC 2.7 - PROTECTION AGAINST SEPSIS BY PROBIOTIC THERAPY IS CORRELATED WITH STIMULATION OF A NOT PREVIOUSLY DESCRIBED BACTERIAL PHYLOTYPE Gerritsen Jacoline* [1] , Timmerman Harro M. [2] , Fuentes Susana [1] , van Minnen L. Paul [2] , Panneman Henk [3] , Konstantinov Sergey R. [1] , Rombouts Frans M. [1] , Gooszen Hein G. [2] , Akkermans Louis M. A. [2] , Smidt Hauke [1] , Rijkers Ger T. [2] [1] Wageningen University - Wageningen, Netherlands - [2] University Medical Center - Utrecht, Netherlands - [3] Dr. van Haeringen Laboratorium B.V. - Wageningen, Netherlands
OC 2.8 - EFFECT OF A NOVEL TRANS-GALACTOOLIGOSACCHARIDE MIXTURE (B-GOS) ON METABOLIC SYNDROME RISK FACTORS IN OVERWEIGHT ADULTS Vulevic Jelena* [1] , Juric Aleksandra [2] , Tzortzis George [2] , Gibson Glenn [3] [1] University of Reading/Clasado Ltd. - Reading, United Kingdom - [2] Clasado Ltd. - Reading, United Kingdom - [3] University of Reading - Reading, United Kingdom
OC 2.9 - EFFECTS OF ANTIBIOTIC THERAPY ON THE GASTROINTESTINAL MICROBIOTA AND THE INTERVENTION WITH L.CASEI Angelika Pirker [1] , Berit Hippe [1] , Christoph Kamhuber [2] , Felix Stockenhuber [2] , Alexander Haslberger* [1] [1] Univ. Vienna, Dep for Nutritional Sciences - Vienna, Austria - [2] Krankenhaus Oberpullendorf, - Vienna, Austria
16 Tuesday, September 13 Aula c
OC 2.10 - GLYCOSAMINOGLYCANS OF HUMAN MILK DURING THE FIRST MONTH OF LACTATION: FURTHER POTENTIAL PREBIOTICS FOR THE BREASTFED INFANT Coppa Giovanni Valentino* [1] , Gabrielli Orazio [1] , Zampini Lucia [1] , Galeazzi Tiziana [1] , Padella Lucia [1] , Bertino, Enrico [2] , Maccari Francesca [3] , Volpi Nicola [3] [1] Università Politecnica Marche - Ancona, Italy - [2] Università di Torino - Torino, Italy - [3] Università Modena e Reggio Emilia - Modena, Italy
OC 2.11 - L. PLANTARUM TENSIA COMPRISING PROBIOTIC CHEESE WITH HYPOTENSIVE EFFECT Hu ẗ t Pirje* [1] , Songisepp Epp [2] , Rätsep Merle [2] , Shkut Elena [2] , Zilmer Mihkel [3] , Ehrlich Kersti [3] , Mikelsaar Marika [1] [1] University of Tartu, Dept. of Microbiology - Tartu, Estonia - [2] Bio-Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia - [3] University of Tartu, Dept. of Biochemistry - Tartu, Estonia
OC 2.12 - STUDY OF PROBIOTIC WHEY BASED ORAL REHYDRATING SOLUTION (BIO-ORS) AGAINST SHIGELLA DYSENTERIAE INFECTION IN MICE Goyal Nupur* [1] [1] Amity Institute of Biotechnology,Amity University - Noida, India
OC 2.13 - THERAPEUTIC EFFECTS OF OAT AND MILK BASED PROBIOTIC FERMENTED PRODUCT AGAINST TYPE 2 DIABETES Sangwan Seema* [1] , Karasi Anbu K [1] , Nanda Dhiraj K [2] , Poply Sarang [1] , Singh Rameshwar [1] [1] National Dairy Research Institute - Karnal, India - [2] National Bureau of Animal Genetic Resources - Karnal, India
OC 2.14 - TANAGEL REDUCE COLITIS SEVERITY IN DEXTRAN SODIUM SULPHATE (DSS) MODEL OF MURINE ACUTE COLITIS Lopetuso Loris Riccardo* [1] , Scaldaferri Franco [1] , Cufino Valerio [2] , Petito Valentina [2] , Gerardi Viviana [1] , Pizzoferrato Marco [1] , Pecere Silvia [1] , Laterza Lucrezia [1] , Stigliano Egidio [2] , Arena Vincenzo [2] , Sgambato Alessandro [2] , Gasbarrini Antonio [1] [1] Internal Medicine, CATHOLIC UNIVERSITY OF ROME - Roma, Italy - [2] Pathology, CATHOLIC UNIVERSITY OF ROME - Roma, Italy
OC 2.15 - MODULATION OF THE FAECAL MICROBIOTA PROFILE AND IMMUNE MARKERS BY A NOVEL TRANS-GALACOOLIGOSACCHARIDE MIXTURE (B-GOS) IN OVERWEIGHT ADULTS Vulevic Jelena* [1] , Juric Aleksandra [3] , Tzortzis George [2] , Gibson Glenn [4] [1] University of Reading/Clasado Ltd. - Reading, United Kingdom - [2] Clasado Ltd. - Reading, United Kingdom - [3] Clasado Ltd. - Reading, United Kingdom - [4] University of Reading - Reading, United Kingdom
OC 2.16 - OBESITY-INDUCED CHANGES IN GUT MICROBIOTA ARE GENERATED BY MUCOSAL DEFENSINS AND MODULATED BY LACTOBACILLUS CRISPATUS M247 DIET SUPPLEMENTATION Cavallo Donatella [1] , Elli Marina [2] , Morelli Lorenzo [3] , Moratelli Ketty [1] , Castagliuolo Ignazio [1] , Martines Diego [1] , Brun Paola* [1] [1] Università di Padova - Padova, Italy - [2] AAT - Piacenza, taly - [3] Cattolic University - Piacenza, Italy
17 Aula c Tuesday, September 13
OC 2.17 - ADMINISTRATION OF BERBERINE IMPROVES HEPATIC NECRO- INFLAMMATION IN MURINE STEATOHEPATITIS, BUT IS ASSOCIATED WITH INCREASED MORTALITY Elisa Vivoli [1] , Angela Provenzano [1] , Stefania Madiai [1] , Erica Novo [1] , Maurizio Parola [1] , Fabio Marra [1] [1] University of Florence - Florence, Italy
OC 2.18 - FACTORS INFLUENCING CLINICAL EFFICACY OF VAGINAL PROBIOTICS Heczko Piotr* [1] , Strus Magdalena [1] , Wiecek Grazyna [1] , Kupka Anna [1] , Kryczyk Jadwiga [1] [1] Jagiellonian University Medical College - Krakow, Poland
OC 2.19 - PROBIOTIC VSL#3 MAY BE EFFECTIVE TO CHANGE THE PROFILE OF CYTOCHINES AND IMMUNOGLOBULINS IN BREAST MILK ? Baldassarre Mariella* [1] , Fanelli Margherita [2] , Tafaro Angela [3] , Laforgia Nicola [1] [1] Ospedale Policlinico-Neonatology and NICU, University of Bari - Bari, Italy - [2] Dept of Internal Medicin and Public Health, Section of Diagnostic Imaging, Medical Statistics, University of Bari - Bari, Italy - [3] IRCCS Ospedale "S.De Bellis" - Castellana Grotte, Italy
OC 2.20 - EFFECT OF DIETARY SUPPLEMENTATION OF A LACTOBACILLUS PLANTARUM STRAIN IN AN ARTIFICIALLY INDUCED NECROTIZING ENTEROCOLITIS MODEL Castro Erica* [1] , Jofre Jaime [1] , Vera Rodrigo [1] , Monsalvez Elizabeth [1] , Pardo Karen [1] , Aguayo Maria [1] , Soza Francisco [1] , Stillfried Nicolas [1] , Medina Rossi [1] , Labra Alan [1] , Montecinos Hernan [1] [1] Universidad De Concepciòn - Concepciòn, Chile
18 Tuesday, September 13 Aula NEWMAN
08.30 - 10.30 a.m. DERMATOLOGY SESSION Chairman: M. Picardo (Italy)
Nutrition and skin M. Picardo (Italy)
Probiotics and atopic dermatitis V. Fabiano (Italy)
Probiotics and seborrheic dermatitis C. Vincenzi (Italy)
Dietary antioxidants and photoprotection E. Camera (Italy)
Antioxidants and skin diseases M. Picardo (Italy)
Nutraceuticals for hair and nails B.M. Piraccini (Italy) Effects of Lactobacillus salivarius Ls01 (DSM 22775) treatment on atopic dermatitis in adults: randomized placebo-controlled study L. Drago (Italy) 10.30 - 11.15 a.m. LECTURES Chairman: G. Scapagnini (Italy) The use of carnitine in patients with elevated levels of Lp(a) C. Sirtori (Italy) The role of meta-analysis in the evaluation of probiotics: arguments for and against H. Szajewska (Poland) 11.1 5a.m.- 12.30 p.m. PROBIOTICS IN FOODS Chairpeople: P. Aureli (Italy), G.L. Gianfranceschi (Italy) Role of the pro bio tic strain Lactoba cillu s paracasei LMGP22043 carried by artichokes in inf luencing faecal ba cteria and biochemical parameters in human subje cts P. Lavermicocca (Italy) Use of Lactobacillus paracasei enriched artichokes in the treatment of functional constipation G. Riezzo (Italy)
Effects of a diet with inulin-enriched pasta on intestinal permeability in healthy young volunteers F. Russo (Italy) Antiproliferative effects of LGG and L. paracasei on HGC-27 and DLD-1 human gastrointestinal cell lines A. Orlando (Italy)
Lactotripeptides from L. helveticum and blood pressure modulation A.F.G. Cicero (Italy) Dysbiosis, probiotics and IBS R. Francavilla (Italy) 19 posters
P1 INTERFENCES OF A SYMBIOTIC FORMULATION ON A GASTRIC AND INTESTINAL PERMEABILITY IN RATS WITH EXPERIMENTALLY INDUCED CHRONIC LIVER DAMAGE Cariello Rita [1] , Tuccillo Concetta [1] , Mazzone Giovanna [2] , Ribecco Maria Teresa [2] , Federico Alessandro [1] , Iadevaia Maddalena [1] , De Magistris Laura [1] , D'Argenio Giuseppe* [2] , Grossi Enzo [3] , Caporaso Nicola [2] , Loguercio Carmela [1] [1] Dipartimento Medico-Chirurgico di Internistica Clinica e Sperimentale, SUN - Napoli, Italy - [2] Dipartimento di Medicina Clinica e Sperimentale, Univ. Federico II - Napoli, Italy - [3] Bracco Spa, Italy
P2 EVALUATION AND GENETIC VALIDATION OF MEDIA SELECTIVE FOR BIFIDOBACTERIUM Rebecchi Annalisa* [1] , Pisacane Vincenza [1] , Callegari Maria L. [1] , Morelli Lorenzo [1] [1] Centro Ricerche Biotecnologiche- Università Cattolica del Sacro Cuore - Cremona, Italy
P3 IN VITRO PROBIOTIC EVALUATION USING A MICROBIAL ENGINEERING APPROACH WITH THE 3S-ECSIM, A 3-STAGES ENVIRONMENTAL CONTROL SYSTEM FOR INTESTINAL MICROBIOTA David Féria-Gervasio [1] , William Tottey* [1] , Pascal Vandekerckove [2] , Monique Alric [1] , Jean-François Brugère [1] [1] ERT-CIDAM - Clermont-Ferrand, France - [2] Lesaffre International Sarl - Marcq En Baroeul, France
P4 INVESTIGATION OF ANTIBACTERIAL ACTIVITY OF LACTOBACILLUS SPECIES Szen Orsolya* [1] , Pal Karoly [2] , Hilyakne Kadlott Maria [2] , Naar Zoltan [2] , Kiss Attila [3] [1] Egerfood National Knowledge Centre - Eszterhazy Karoly College - Eger, Hungary - [2] Eszterhazy Karoly College - Dept. of Microbiology and Food Technology - Eger, Hungary - [3] Eszterhazy Karoly College - Dept. of Food Chemistry and Biochemistry - Eger, Hungary
P5 LACTOBACILLUS PLANTARUM TENSIA AND LACOBACILLUS PLANTARUM INDUCES ANTILISTERIAL ACTIVITY IN EXPERIMENTAL CHEESE Rätsep Merle* [1] , Smidt Imbi [2] , Songisepp Epp [1] [1] Bio-Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia - [2] University of Tartu - Tartu, Estonia
P6 LACTOBACILLUS REUTERI IMPROVES THE ERADICATION RATE OF HELICOBACTER PYLORI Efrati Cesare* [1] , Nicolini Giorgia [1] , Cannaviello Claudio [1] [1] Ospedale israelitico - Roma, Italy
P7 LACTOBACILLUS RHAMNOSUS LR06 DSM 21981, LACTOBACILLUS PENTOSUS LPS01 DSM 21980, LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII LDD01 DSM 22106 IN VITRO STRONGLY INHIBIT DIFFERENT ESCHERICHIA COLI SEROTYPES, INCLUDED E. COLI O157:H7 M. Del Piano * [1] , G.P. Strozzi [2] , F. Deidda [3] , S. Allesina [3] , M. Barba [3] , L. Soattini [4] , F. Sforza [4] , G. Mogna [2] [1] Gastroenterology Independent Operating Unit, Maggiore della Carità Hospital - Novara, Italy - [2] Probiotical SpA - Novara, Italy - [3] Biolab Research Srl - Novara, Italy - [4] Casa di Cura I Cedri - Novara, Italy
P8 PROBIOTICS FOR PREVENTION OF NECROTIZING ENTEROCOLITIS IN PRETERM INFANTS Al Faleh Khaled* [1] , Anabrees Jasim [1] , Bassler D [2] , Al-Kharfi T [1] [1] King Saud University - Riyadh, Saudi Arabia - [2] U - Germany
P9 QUANTIFICATION OF LACTIC ACID AND ENTERIC BACTERIA BY MEANS OF QPCR Pal Karoly* [1] , Szen Orsolya [2] , Naar Zoltan [1] , Kiss Attila [3] [1] Eszterhazy Karoly College, Dept. of Microbiology and Food Technology - Eger, Hungary - [2] Eszterhazy Karoly College, EGERFOOD Regional Knowledge Centre - Eger, Hungary - [3] Eszterhazy Karoly College, Dept. of Food Chemistry and Biochemistry - Eger, Hungary
20 posters
P10 THE USE OF LACTOBACILLUS GG IN CHILDREN WITH FUNCTIONAL ABDOMINAL PAIN: A DOUBLE-BLIND RANDOMIZED CONTROL TRIAL Sabbi Tamara* [1] , Palumbo Massimo [1] [1] Belcolle Hospital Viterbo - Pediatric Unit, Italy
P11 IN VITRO EFFECT OF FOUR NOVEL FLOURS FERMENTATION ON GUT MICROBIOTA PARAMETERS Chitarrari Roberto* [1] , Carnevali Paola [2] , Costabile Adele [1] [1] Foo d Microbial Sciences, School of Food and Nutritional Science s, University of Reading - Reading, United Kingdom - [2] Barilla G. e R. Fratelli - Parma, Italy
P12 SURVIVAL OF LACTOBACILLUS RHAMNOSUS LR06 DSM 21981, LACTOBACILLUS PENTOSUS LPS01 DSM 21980, LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII LDD01 DSM 22106 IN DIFFERENT PARTS OF THE DIGESTIVE TRACT OF PATIENTS CHRONICALLY TREATED WITH PPI M. Del Piano * [1] , M. Ballarè [1] , M. Pagliarulo [1] , A. Anderloni [1] , M. Balzarini [1] , M. Orsello [1] , S. Carmagnola [1] , R. Tari [1] , F. Deidda [3] , S. Allesina [3] , M. Barba [3] , G.P. Strozzi [2] , G. Mogna [2] , L. Mogna [2] , F. Sforza [4] [1] Gastroenterology Independent Operating Unit, Maggiore della Carità Hospital, Novara - Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab Research Srl - Novara, Italy - [4] Casa di Cura I Cedri - Novara, Italy
P13 STRUCTURAL CHARACTERIZATION OF CHONDROITIN SULFATE FROM ITALIAN CHEESE PARMIGIANO REGGIANO Coppa Giovanni [1] , Maccari Francesca [2] , Zampini Lucia [1] , Santoro Lucia [1] , Galeazzi Tiziana [1] , Gabrielli Orazio [1] , Volpi Nicola* [2] [1] Polytechnic University of the Marche, Ospedali Riuniti, Presidio Salesi - Ancona, Italy - [2] University of Modena and Reggio Emilia - Modena, Italy
P14 FLAVONOIDES AND GASTROINTESTINAL TRACT: FROM THE BENCH TO CLINICAL PERSPECTIVES Marotta Francesco* [1] , Tomella Claudio [1] , Polimeni Ascanio [1] , Joyal Steven [2] [1] ReGenera Res Group - Milano, Italy - [2] Life Extension Foundation - Ft. Lauderdale, USA
P15 SUPPLEMENTATION WITH LACTOBACILLUS HELVETICUS AND BIDIFOBACTERIUM LONGUM INDUCED IMMUNOLOGICAL CHANGES IN MODERATE MALNOURISHED ELDERLY SUBJECTS Finamore Alberto* [1] , Roselli Marianna [1] , Brasili Elisa [1] , Donini Lorenzo M [2] , Neri Barbara [3] , Carnevali Paola [4] , Mengheri Elena [1] [1] National Research Institute on Food and Nutrition (INRAN) - Roma, Italy - [2] Sapienza University - Rome, Italy - [3] Villa delle Querce Rehabilitation Institute - Nemi, Italy - [4] Barilla G. e R. Fratelli - Parma, Italy
P16 CAN LACTOBACILLUS RHAMNOSUS LR06 DSM 21981, LACTOBACILLUS PENTOSUS LPS01 DSM 21980, LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII LDD01 DSM 22106 RESTORE THE “GASTRIC BARRIER EFFECT” IN PATIENTS CHRONICALLY TREATED WITH PPI? M. Del Piano* [1] , M. Ballarè [1] , M. Pagliarulo [1] , A. Anderloni [1] , M. Balzarini [1] , M. Orsello [1] , S. Carmagnola [1] , R. Tari [1] , F . Deidda [3] , S. Allesina [3] , M. Barba [3] , G.P.Strozzi [2] , G. Mogna [2] , L. Mogna [2] , F. Sforza [4] [1] Gastroenterology Independent Operating Unit, Maggiore della Carità Hospital, Novara, Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab Research Srl, Novara, Italy - [4] Casa di Cura I Cedri, Novara, Italy
P17 CHARACTERISATION OF THE CYANOBACTERIAL TOXIN REMOVAL PROCESS IN THE PRESENCE OF PROBIOTIC BACTERIA Nybom Sonja* [1] , Dziga Dariusz [2] , Salminen Seppo [3] , Meriluoto Jussi [1] [1] Åbo Akademi University/Department of Biosciences - Turku, Finland - [2] Jagiellonian University - Krakow, Poland - [3] University of Turku - Turku, Finland
21 posters
P18 PROBIOTIC LACTOBACILLUS RHAMNOSUS LGA UPREGULATES ß-DEFENSIN AND EXPRESSION IN CULTURED CHICKEN SMALL INTESTINAL EPITHELIAL CELLS Guanhong Li*, Siguo Liu, Zhimin Hong, Yongjie Jia, Jinming You, Minreng Qu Minreng [1] [1] College of Animal Science and Technology, Jiangxi Agricultural University - Nanchang, China - [2] Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences - Harbin, China
P19 SELENIUM AND ZINC INTERNALIZED BY LACTOBACILLUS BUCHNERI LB26 DSM 16341 AND BIFIDOBACTERIUM LACTIS BB1 DSM 17850: DEVELOPMENT OF A NEW BIOLOGICAL METHOD TO EVALUATE THE BIOAVAILABILITY OF THE TWO MINERALS M. Pane* [2] , M. D'Andrea [3] , S. Nicola [3] , G.P. Strozzi [2] , G. Mogna [2] , M. Del Piano [1] [1] Gastroenterology Independent Operating Unit, Maggiore della Carità Hospital - Novara, Italy - [2] Probiotical SpA - Novara, Italy - [3] Biolab Research Srl - Novara, Italy
P20 SAFETY OF A PROBIOTIC CHEESE COMPRISING L. PLANTARUM TENSIA ACCORDING VARIETY OF HEALTH INDICES IN DIFFERENT AGE GROUPS Songisepp Epp* [1] , Hu ẗ t Pirje [2] , Rätsep Merle [1] , Shkut Elena [1] , Zilmer Mihkel [2] , Kõljalg Siiri [2] , Truusalu Kai [2] , Smidt Imbi [2] , Kolk Helgi [2] , Zagura Maksim [3] , Mikelsaar Marika [2] [1] Bio-Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia - [2] University of Tartu - Tartu, Estonia - [3] Tartu University Clinics - Tartu, Estonia
P21 EFFECT OF LAB ON CYTOKINE SECRETION BY THP-1 CELLS STIMULATED BY LPS Hacin Biljana* [2] , Citar Manuela [2] , Tompa Gorazd [1] , Rogelj Irena [1] [1] University of Ljubljana - Ljubljana, Slovenia - [2] Medis, d.o.o., Ljubljana, Slovenia
P22 SLOWL RELEASE EFFERVESCENT TABLETS WITH L. FERMENTUM LF10 DSM 19187 AND L. ACIDOPHILUS LA02 DSM 21717 INHIBIT CANDIDA AND PUTRESCENT FLORA G. Mogna [1] , F. Deidda [2] , S. Allesina [2] , M. Pane [2] , M. Barba [2] , M. D’Andrea [2] , P. Lorenzini [2] , S. Nicola [2] , E. Raiteri [2] , G.P. Strozzi [1] , L. Mogna [2] , F. Vicariotto [3] [1] Probiotical SpA - Novara, Italy - [2] Biolab Research Srl - Novara, Italy [3] - Department of Obstetrics and Gynecology, San Pio X Hospital - Milan, Italy
P23 SYMPTOM RESOLUTION AND IMMUNE MATURATION IN INFANTS WITH ATOPIC DERMATITIS RECEIVING HYDROLYZED FORMULA WITH LACTOBACILLUS GG (LGG) Nermes Merja [1] , Salminen Seppo [1] , Isolauri Erika* [1] [1] University of Turku - Turku, Finland
P24 THE GLOBAL PHENOTYPIC ANALYSIS OF PUTATIVE ANTIALLERGIC POTENTIAL OF THREE LACTOBACILLUS STRAINS Aleksandrzak-Piekarczyk Tamara* [1] , Koryszewska-Baginska Anna [1] , Bardowski Jacek [1] [1] Institute of Biochemistry and Biophysics Polish Academy of Sciences - Warsaw, Poland
P25 IS CRANBERRY USEFUL FOR PREVENTION RECURRENT URINARY TRACT INFECTIONS IN CHILDREN? Dessì Angelica* [1] , Fanos Vassilios [1] [1] Department of Paediatrics, Neonatal Intensive Care Unit, Neonatal Pathology, Puericultura Institute and Neonatal Section, University of Cagliari - Cagliari, Italy
22 posters
P26 LACTOBACILLUS SPP. STRAINS OF CULTURE COLLECTION OF TARTU UNIVERSITY, ESTONIA Štšepetova Jelena* [1] , Rööp Tiiu [1] , Mändar Reet [1] , Sepp Epp [1] , Mikelsaar Marika [1] [1] University of Tartu - Tartu, Estonia
P27 ASSESSMENT OF SAFETY AND TOLERANCE OF A FERMENTED DAIRY FOOD CONTAINING NOVEL, POTENTIALLY PROBIOTIC STRAINS Chambaud Isabelle* [1] , Jeansen Stéphanie [1] , Elfakir Anissa [1] , Banning Federike [2] , Queudot Jean- Christophe [3] , Bouchez Elodie [3] , Bourlioux Pierre [4] , Marteau Philippe [5] , Schrezenmeir Juerguen [6] [1] Danone Research - Palaiseau, France - [2] Harrison Clinical Research Deutschland GmbH - Munich, Germany - [3] CIT Safety and Health Research Laboratories - Evreux, France - [4] Faculty of Parmacy - Paris-Sud University - Paris, France - [5] University Denis Diderot, Paris 7 & AP-HP, Lariboisière ospital - Paris, France - [6] Gutenberg-University Mainz - Kiel, Germany
P28 PROBIOTIC TREATMENT INDUCED AGE DEPENDENT METABOLIC CHANGES Brasili Elisa [1] , Tomassini Alberta [2] , Finamore Alberto* [1] , Roselli Marianna [1] , Mengheri Elena [1] , Capuani Giorgio [2] , Sciubba Fabio [2] , Miccheli Alfredo [2] [1] National Research Institute on Food and Nutrition, INRAN - Roma, Italy - [2] Sapienza University - Roma, Italy
P29 COMPARATIVE STUDY ON THE CELL SURFACE PROPERTIES AND STRUCTURE OF EXOPOLYSACCHARIDES PRODUCED BY LACTOBACILLUS CASEI AND LACTOBACILLUS PARACASEI STRAINS Górska-Fraczek Sabina* [1] , Gamian Andrzej [1] , Kozakova Hana [2] , Schwarzer Martin [2] [1] Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, - Wroclaw, Poland - [2] Department of Immunology and Gnotobiology, Institute of Microbiology of the Academy of Sciences of the Czech Republic, v. v. i - Novy Hradek, Czech Republic
P30 PREBIOTIC AND ANTIMICROBIAL EFFECT OF KEFIRAN Vardjan Tinkara* [1] , Canžek Majhenic Andreja [2] , Rogelj Irena [2] [1] Kele & Kele, d.o.o. - Logatec, Slovenia - [2] University of Ljubljana, Biotechnical Faculty - Domžale, Slovenia
23
September 2013
th probiotics prebiotics 7 & new foods
ROME
ABSTRACTS ORAL COMMUNICATIONS 1
OC1.1 shown to negatively influence the composition and PATHOGEN AND PROBIOTIC BACTERIA DIFFERENTIALLY functionality of our intestinal microbiota. The most prominent STIMULATE NITRIC OXIDE PRODUCTION AND S100B sign of this is antibiotic associated diarrhoea, but it can also PROTEIN EXPRESSION IN HUMAN ENTEROGLIAL CELLS manifest itself in more benign side effects as bloating, gas, Turco Fabio* [2] , Sarnelli Giovanni [2] , Cirillo Carla [3] , Mango cramps, etc. Probiotics have in several studies shown to Annamaria [2] , Nasti Anna [2] , D'Alessandro Alessandra [2] , ameliorate the risk for antibiotic associated diarrhoea (AAD); Farina Virginia [2] , Cuomo Rosario [2] in particular Saccharomyces cerevisiae (boulardii), but also [2] Università Federico II - Napoli, Italy - [3] K.U. Leuven - Leuven, Belgium various strains of lactobacillus probiotics. We have recently shown that a combination of lactobacilli and bifidobacteria Background and aim: Enteric glial cells (EGC) are involved in was able to maintain the stability of the whole microbiota of intestinal homeostasis and may contribute to regulate host- volunteers consuming antibiotics. We therefore aimed to bacteria interaction. Astrocytes, the equivalent of enteroglial investigate the effect of this probiotic combination on patients cells (EGC) in Central Nervous System respond to bacteria seeking clinical care and being prescribed antibiotics. We releasing nitric oxide (NO), whether this occur in bacterial-EGC recruited 503 patients whom were randomised over three interaction and whether glial derived S100B protein is involved groups receiving either a placebo (micro crystalline cellulose) in this response is not known. We aimed to investigate the or a combination of L. paracasei Lpc-37, L. acidophilus effects of pathogens and probiotics on NO release from EGC. NCFM, B. lactis Bi-07 and B. lactis Bl-04 at a dose of 2.5 x Material and methods: Human EGC were obtained according 109 CFU/day (Low) or 1010 CFU/day (High). Incidence and to a method previously described by our group. Briefly, duration of diarrhoea was assessed as well as the incidence myenteric plexus preparations were isolated from ileum of of Clostridium difficile associated diarrhoea Subjects were patients undergoing surgery and enzimatically dissociated. 50 years of age (±11 years). Older subjects were more likely Ganglia were plated and cell cultures were grown to to suffer from AAD then younger subjects; also subjects with subconfluence. After 21 days, EGC were purified by incubation a longer exposure to antibiotics were more likely to suffer with the anti-Thy-1.1 ab-coated magnetic beads and separated from AAD. Women tended to have a higher incidence of AAD, using a Dynal Magnet®. EGC were incubated for 24 hours with but this did not reach statistical significance. Over all the probiotic Lactobacillus Paracasei F19 (LP F19) and the incidence of AAD was 19% while overall incidence of C. pathogen Enteroinvasive Escherichia Coli (EIEC). 2 different difficile associated diarrhoea (CDAD) was 2.8%. There was bacteria/cells ratios were used (0.1/1 and 10/1, respectively). a significant difference in the incidence of AAD between the Nitrite assay and Western Blot analysis were respectively used treatment groups; 25%, 20% and 13%, for placebo, Low and to evaluate NO release and S100B expression in stimulated High dose, respectively. There was also a significant cells compared to unstimulated cells that served as controls. difference in CDAD between the treatment groups; 4.8%, Data are expressed as mean±SD of 3 independent 1.8% and 1.8%, for placebo, Low and High dose, experiments. Results: Glial derived S100B protein expression respectively. Also the duration of diarrhoea was significantly was significantly higher in response to EIEC than to LP F19 different between groups; 5.4, 2.6 and 3.5 days (placebo, (+2.9±0.2 and +0.9±0.3 fold increase vs control; p<0.05). EIEC Low and High dose, respectively) as well as bloating, fever induced a significantly higher NO release than LP F19 both at and abdominal pain. This is one of the few dose-response a 0.1/1 (17.7±0.7 vs 4.0±0.1 nmol x 10^6 cells; p<0.001) and studies with probiotics; showing a dose dependent reduction at 10/1 ratio (20.7±2.1 vs 9.0±0.1 nmol x 10^6 cells; p<0.001). in side effects of antibiotic use. Compared to control conditions (3.7±0.1 nmol x 10^6 cells), EIEC and high concentration of LP F19 induced a significant OC1.3 increase of NO release (all p<0.001). Conclusions: We show ANTI-INFLAMMATORY EFFECTS OF LACTOBACILLUS that EGC are able to release nitric oxide when challenged with RHAMNOSUS (LGG) COUNTERACT LIPOPOLYSACCHARIDE bacteria and that this is dependent on the different expression (LPS)-INDUCED PERSISTENT ALTERATIONS OF HUMAN of S100B protein. As bacterial induced NO production was COLONIC SMOOTH MUSCLE different between pathogens and probiotics, we suggest that Ammoscato Francesca* [1] , Matarrese Paola [2] , Scirocco human EGCs likely participate to host-bacteria interaction via Annunziata [1] , Petitta Chiara [1] , Ascione Barbara [2] , Di Natale a different NO release and that probiotics may exert Giuseppe [3] , Marignani Massimo [4] , Malorni Walter [2] , Severi immunostimulatory and/or immunomodulatory effects Carola [1] interacting with EGCs. [1] Gastroenterology Unit A, Dip.Medicina Interna e Specialità Mediche, Università Sapienza - Roma, Italy - [2] Department of Drug Research and OC1.2 Evaluation, Istituto Superiore di Sanità - Roma, Italy - [3] Department of A PROBIOTIC COMBINATION TO REDUCE ANTIBIOTIC Surgery, ‘‘F. Durante’’, University ‘‘Sapienza’’ - Roma, Italy - [4] UOC ASSOCIATED DIARRHOEA AND OTHER SIDE-EFFECTS OF Gastroenterologia, Ospedale S.Andrea - Roma, Italy ANTIBIOTIC-USE; A DOSE-RESPONSE STUDY Ouwehand Arthur* [1] Toll-like receptor (TLR) 2, heterodimerized with TLR1 and 6, [1] Danisco Sweeteners - Kantvik, Finland recognizes Gram-positive bacteria and exerts anti- inflammatory effects in myocardium by inhibition of NFkB By their nature, antibiotics kill bacteria and although narrow activation through the PI3K/Akt/GSK3ß pathway. We have spectrum antibiotics are available even these will inevitably previously described that human colonic smooth muscle affect bacterial groups other then the pathogen they are cells (SMC) express functional TLR2 and TLR4 receptors and intended to kill. Antibiotic consumption has therefore been that the activation of TLR4 by LPS persistently alters 28 ORAL COMMUNIC ATIONS 1 biological and morphological SMC features whereas that of strategies using probiotics have been considered. TLR2 by LGG reduces LPS-induced effects. AIMS: to analyze Complementary in vitro approaches have been used to better cellular mechanisms involved in LGG protective role against understand the behavior of EHEC in the human digestive LPS-induced motor alterations. METHODS: The direct effect environment and investigate the antagonist properties of of 120x106CFU/ml LGG (ATCC 53103 strain) was tested on Saccharomyces cerevisiae CNCM I-3856 probiotic strain. a highly pure human SMC culture exposed to the TLR4 AIMS & methods: First, in vitro digestions of a standard meal agonist LPS (1µg/ml) for 24h. LGG effects were evaluated on containing ground beef inoculated with EHEC O157:H7 or EHEC LPS-induced NFkB activation, cytokines production and with S. cerevisiae were performed in a dynamic gastro-intestinal muscular morphofunctional properties. NFkB activation was tract model (TIM). Second, we analyzed the ability of EHEC examined by ELISA determination of the phosphorylation of O157:H7 (i) to interact in vivo with murine Peyer’s Patches (PPs) p65 NFkB subunits Ser468 and Ser536. Cytokines production in ileal loop assay and ex vivo in Ussing chambers and (ii) to was determined by ELISA for the pro-inflammatory IL6 and translocate in vitro using an M cell model. RESULTS: Bacterial the anti-inflammatory IL10. Data are expressed as mean±SD, mortality was observed in the stomach and duodenum of the p<0.05 considered significant. RESULTS: LPS induced a TIM, showing the sensitivity of EHEC O157:H7 to gastric persistent significant (p<0.05) increase in phosphorylation acidity and digestive secretions. By contrast, growth of NFkB subunits (Ser468 89.9%±12.6; Ser536 resumption was shown in the distal parts of the small 117.0%±15.9). In the presence of LGG, LPS-induced NFkB intestine. The co-administration of S. cerevisiae CNCM I- activation was inhibited by up to 74.8±12.1% for Ser468 and 3856 led to a significant decrease in bacterial growth. 90.3±3.0% for Ser536. Furthermore LPS induced a Moreover, EHEC O157:H7 was able to target in vivo murine significant 8-fold increase (p<0.05) in secretion of the pro- PPs, to translocate ex vivo through murine ileal mucosa with inflammatory IL6 that resulted inhibited by up of 85.6%±19.6 PPs and across an in vitro M cell model. EHEC were also in the presence of LGG. In parallel, LPS induced a 91%±10 found to survive and produce Stx within macrophages, decrease (p<0.05) in the secretion of the anti-inflammatory leading to host cell apoptosis and Stx release. Once again, S. cytokines IL10 whose levels return to control levels in the cerevisiae showed antagonistic properties against EHEC by presence of LGG. These LGG anti-inflammatory effects significantly decreasing the number of translocated bacteria counteract LPS-induced morpho-functional cellular across M cell. Conclusion This study brought important alterations. In fact the LPS-induced 21.4%±1.7 cell information on EHEC behaviour in simulated human digestive shortening and 44.4%±7.8 decrease in acetylcholine-induced environment. In addition, we showed that S. cerevisiae could contraction were significantly reduced in the presence of be used both to reduce the amount of bacteria reaching the LGG, the cell shortening by 2.96±0.19 times and the decrease large intestine and the uptake of EHEC by M cells. This in contractile response by 1.63±0.20 times indicating a probiotic yeast emerges as a relevant agent in the fight protective role of LGG against motor alterations induced by against EHEC infections. pathogenic infective bursts. Conclusion: LGG has a direct anti-inflammatory effect on colonic muscle and might be an OC1.5 appropriate candidate for probiotic intervention in bacterial- BIFIDOBACTERIUM LACTIS BL-04™ REDUCES SYMPTOMS related intestinal motor disorders. OF COMMON COLD IN HEALTHY PHYSICALLY ACTIVE INDIVIDUALS: A RANDOMISED CONTROLLED TRIAL OC1.4 Arthur Ouwehand [1] , West Nic [2] , Pyne David [2] , Horn Peggy [2] , BEHAVIOUR OF ENTEROHEMORRHAGIC ESCHERICHIA COLI Cripps Allan [3] , Hopkins Will [5] , Brun Mary[6], Warren O157:H7 IN HUMAN SIMULATED DIGESTIVE CONDITIONS Hilary[6], Wu Fan[6], Fricker Peter [2] AND ANTAGONISTIC PROPERTIES OF A SACCHAROMYCES [1] Danisco Health & Nutrition - Kantvik, Finland - [2] Australian Institute CEREVISIAE PROBIOTIC YEAST STRAIN of Sport - Canberra, Australia - [3] Griffith University - Gold Coast, Etienne-Mesmin Lucie* [1] , Livrelli Valérie [2] , Chassaing Australia - [5] Auckland University - Auckland, New Zealand - [6]Canberra Benoit [2] , Privat Maud [2] , Denis Sylvain [1] , Alric Monique [1] , Hospital - Canberra, Australia Darfeuille-Michaud Arlette [2] , Blanquet-Diot Stéphanie [1] ERT 18, Equipe de Recherche Technologique «Conception, Ingénierie Healthy, physically active individuals represent a key target et Développement de l’Aliment et du Médicament», Université group for probiotics. The aim of this study was to determine d'Auvergne, Clermont-Ferrand, F-63000 - France - [2] E 2526 USC INRA the clinical and immunological effects of Bifidobacterium lactis 2018, Evolution des bactéries pathogènes et susceptibilité génétique de Bl-04™ supplementation in such individuals. A total of 117 l’hôte, Université d'Auvergne, Clermont-Ferrand, F-63000, France males and 109 females (age 36 ± 10 y; mean ± SD) ingested either B. lactis Bl-04 (dosage 2x109 live cells per day; Bl-04) Introduction/objectives: Enterohemorrhagic Escherichia coli or placebo in powder form that was dissolved in a beverage (EHEC) O157:H7 is an important food-borne pathogen that daily in a double-blind placebo-controlled design over 150 d causes diarrhea, hemorrhagic colitis and life-threatening that incorporated autumn, winter and spring. Subjects complications such as hemolytic-uremic syndrome (HUS). recorded symptoms of illness (symptom type, duration and Both the survival of EHEC O157:H7 and the translocation of severity), medication usage and daily physical activity patterns bacteria and Shiga-toxins (Stx) in the human digestive on a Web-based self-reported questionnaire. A reduction of environment are key factors in bacterial pathogenesis but the 10% in illness symptoms was determined as the threshold mechanisms involved remain unclear owing to lack of value for a substantial difference between treatments. URTI relevant models. As no specific treatment is available, and as episodes lasting for 5 or 7 days or more were considered to antibiotic therapy has worsened clinical outcomes, alternative be caused by infections. The incidence of URTI lasting 5 days 29 ORAL COMMUNICATIONS 1 or 7 days was reduced by 35% (CI 99% 0.33-1.29) and by the investigation of effects of probiotic intervention on fecal 46% (0.21-1.30), respectively, following Bl-04 intake. microbiota in antibiotic induced diarrhea, suggests quite Incidence of lower respiratory tract infections lasting 5 days striking changes in the abundance of subgroups of or more was reduced by 45% (0.24-1.27). In line with the microbiota. Therefore, changes of subgroups of GI- clinical effects, the medication use during infections lasting microbiota as well as intervention with different probiotic 5 days or more was reduced by 45% (0.30-0.99). Illness total strains should discriminate effects of bacteria on immune- load (severity x duration) was 27% (0.45-1.18) lower in or endothelial cells. subjects taking B. lactis Bl-04 than those on the placebo. No substantial effects of supplementation were evident on OC1.7 gastrointestinal illness between the probiotic and placebo SUPPLEMENTATION OF YOGURT BY COMMERCIALLY groups. The data from this study indicate that B. lactis BI-04 AVAILABLE BACILLUS CLAUSII ENDOSPORES has beneficial clinical effects in healthy physically active Pal Karoly* [1] , Szarvas Jozsef [4] , Hilyakne Kadlott Maria [1] , individuals. Other researchers report that healthy individuals Szen Orsolya [5] , Naar Zoltan [1] , Kiss Attila [4] want an on average 25% to 57% reduction in common cold [1] Eszterhazy Karoly College, Dept. of Microbiology and Food Technology illness severity to justify costs of treatments. Therefore, B. - Eger, Hungary - [4] Eszterhazy Karoly College, Dept. of Food Chemistry lactis Bl-04 supplementation in this study achieved a and Biochemistry - Eger, Hungary - [5] Eszterhazy Karoly College, sufficiently important difference in the reduction of upper EGERFOOD Regional Knowledge Centre - Eger, Hungary respiratory tract illness to meet this criterion. Furthermore, the findings of this study indicate that prophylactic use of Development of probiotic products is based on the use of this supplement could substantially reduce the economic microbes having numerous beneficial effects on the human cost of the common cold. health. Majority of probiotic organisms belong to the group of lactic acid bacteria, but rarely other microbes are shown OC1.6 to have probiotic effects, too. The endospore forming B. HEAT INACTIVATED PROBIOTIC STRAINS SPECIFICALLY clausii is one of these exceptions and its endospores are used STIMULATE NFK-, MAP KINASE PATHWAYS, DIFFERENT in a commercially available product. Since no literature was MIRNAS AND MATURATION IN CACO II ENDOTHELIAL CELLS found about the use of B. clausii in food, we investigated the AND IN DENDRITIC CELLS survival of endospores and their impact on the starter culture Ladan Giahi [1] , Eva Aumueller [1] , Manuela Nestlberger [1] , and ripening process of yogurt. We used fresh, warm (42 °C) Ibrahim Elmadfa [1] , Alexander Haslberger* [1] yogurt samples that were inoculated by the starter cultures [1] Univ Vienna, Dep. Nutritional Sciences - Vienna, Austria (Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus) 30 minutes before the experiment. Spore Introduction: Probiotic strains have been shown to activate number of the B. clausii suspension was counted prior to cell responses involving toll like receptors (TLRs) and NF-kb addition; 175 g yogurt was inoculated by 109 cfu of spores. pathways. Objectives and methods: We investigated effects After inoculation the yogurt cups were closed and treated the of heat inactivated Lactobacillus, Bifido- and Streptococcus same way as in the normal manufacturing procedure. Two strains on expression of inflammatory mediators, maturation parameters of acidity, the Soxhlet-Henkel degree (°SH) and markers, NF-kb and miRNAs in the endothelial CACO II cell pH were measured during the 4 hours of ripening in every line and in dendritic cells derived from whole blood. hour. The yogurts were stored at 4 °C for 16 days; endospore Expression of immune- and inflammatory mediators, kbs and and total cell numbers were counted regularly. At the end of miRNAs were analysed by qRT-PCR. MiRU6 was used as a the experiment the yogurts were tasted and scored. Our control. Maturation markers of dendritic cells were results showed that addition of B. clausii endospores did not determined with FACS-analysis. Results: In untreated or have any significant effect on the progress of ripening. Acidity IL1ß- pretreated CACO2 cells the expression of IL6 and TNFa was not altered, pH and °SH in the supplemented yogurts as well as NF?Bp65 and Ikb as well as p38 was increased changed in the same rate and degree as in the control differently after treatment with heat inactivated cells of samples. B. clausii endospores survived the ripening and Lactobacillus acidophilus, Streptococcus thermophilus and storage period very well. Taste, texture, colour and smell of Bifidobacterium lactis. KBs showed an increased expression the endospore enriched yogurts were very similar to that of in the first 60 min and decreased thereafter. LPS and the controls. This research was financed by Egerfood Ltd. probiotic strains to different degrees decreased miRNA and the NKTH research program. levels, especially miR7i after 6hrs and 24hrs. In dendritic cells, heat inactivated Lactobacillus GG (LGG) and L. delbrueckii stimulated an enhanced expression of IL-6, TNFa and IL-10 mRNA and expression of surface molecules CD86, CD80,CD83,CD209,CD54 however to a different degree. Further, in dendritic cells the investigated strains effected expression of the analysed miRNAs. Discussion: Our results from CACO II cells and dendritic cells support the hypothesis that heat inactivated cells from often closely related probiotic strains or bacteria from the gut differentially induce signaling pathways, gene expression and miRNAs which epigenetically control gene expression. Other work of our group, such as 30 ORAL COMMUNICATIONS 1
OC1.8 OC1.9 GALACTOOLIGOSACCHARIDES PRODUCTION FROM WHEY DOSE-RESPONSE EFFECT OF BIFIDOBACTERIUM LACTIS USING ENZYME ISOLATED FROM STREPTOCOCCUS HN019 ON WHOLE GUT TRANSIT TIME AND FUNCTIONAL THERMOPHILUS AND ASSESSMENT OF THEIR PREBIOTIC GASTROINTESTINAL SYMPTOMS IN ADULTS POTENTIAL Ouwehand Arthur* [1] , Waller Philip [2] , Gopal Pramod [3] , Leyer Sangwan Vikas* [1] , Tomar Sudhir Kumar [1] , Ali Babar [1] , Singh Greg [4] , Reifer Cheryl [5] , Stewart Morgan [5] , Miller Larry [5] R.R.B. [1] [1] Danisco Sweeteners - Kantvik, Finland - [2] Accurate Clinical Research [1] National Dairy Research Institute - Karnal, India - Huston, USA - [3] Fonterra - Palmerston North, New Zealand - [4] Danisco USA - Madison, USA - [5] SPRIM - San Fransisco, USA 1. Production of ß-galactosidase from isolated strains of S. thermophilus. Slow colonic transit is a common complaint in western 2. Production of prebiotic Galactooligosaccharides (GOS) societies and manifests itself as constipation. It is, however, using whey as a substrate. also associated with more serious diseases such as various 3. Evaluation of immunomodulatory effect of GOS using mice types of cancer, diverticulitis, gall stones, etc. Various as animal model. alternative remedies exist to relieve constipation and these Materials and methods: may have various success. The present study aimed to 1. ß-galactosidase production: S. thermophilus strains assess the impact of Bifidobacterium lactis HN019 isolated from different dairy products were evaluated for the supplementation on total colonic transit time (TCTT) and production of ß-galactosidase (intracellular). Five different frequency and severity of functional gastrointestinal (GI) methods viz. lysozyme treatment, SDS-chloroform, symptoms in adults. We randomized 100 subjects (mean sonication, glass beads and microfluidizer were tried for the age: 44 years; 64% female) with functional GI symptoms to isolation of enzyme. consume a B. lactis HN019 (Danisco Cultures, Paris), at daily 2. Production of GOS: Lactose is the main substrate for the doses of 17.2 billion colony forming units (CFU) (high dose; production of GOS. Different concentrations of lactose and n = 33), 1.8 billion CFU (low dose; n = 33), or placebo (n = ß-galactosidase for varying time periods were used for the 34) for 14 days. The primary endpoint of TCTT was assessed production of GOS. The HPLC was used for the detection of by X-ray on days 0 and 14 and was preceded by consumption GOS. of radio-opaque markers once a day for 6 days. The 3. Evaluation of immunomodulatory effect of GOS: Crude secondary endpoint of functional GI symptom frequency was GOS (produced in the lab) was then evaluated for the its recorded with a subject-reported numeric (1–100) scale immunomodulatory effect using mice as animal model. Along before and after supplementation. Decreases in mean TCTT with the immunomodulation, it was also tested for its ability over the 14-day study period were statistically significant in to reduce the infection caused by Listeria monocytogenes. the high dose group (49 ± 30 to 21 ± 32 h, p < 0.001) and Results the low dose group (60 ± 33 to 41 ± 39 h, p = 0.01), but not Among the various methods used for the isolation of ß- in the placebo group (43 ± 31 to 44 ± 33 h). Time to excretion galactosidase, lysozyme treatment was found to be the best of all ingested markers was significantly shorter in the one. As it is a chemical method so cannot be used for the treatment groups versus placebo. Of the nine functional GI production of food grade GOS. Therefore, microfluidizer symptoms investigated, eight significantly decreased in (found to be the best among mechanical methods) was used frequency in the high dose group and seven decreased with for the isolation of ß-galactosidase to be used in the low dose, while two decreased in the placebo group. No production of GOS. The GOS was found to be produced at a adverse events were reported in any group. Daily B. lactis lactose conc. of 15% and at this conc. max production was HN019 supplementation is well tolerated, decreases TCTT in observed after 10 hrs of incubation at 400C. The amount of a dose-dependent manner, and reduces the frequency of GOS production showed a gradual increase with increasing functional GI symptoms in adults. This is one of the few lactose concentration. In animal model GOS was found to dose-response studies with probiotics; showing a dose modulate the immune system (Increase in IgG and IgA dependent reduction in colonic transit and functional GI concentration) along with a significant reduction of L. symptoms. Waller et al. 2011 Scand. J. Gastroenterol. DOI: monocytogenes infection in mice. 10.3109/00365521.2011.584895 Future projections: 1. Further standardization to increase the maximum amount of GOS production using whey as substrate is underway. 2. Evaluation of anticancerous effect of GOS.
31 ORAL COMMUNICATIONS 1
OC1.10 leucocytosis (P<0.05). Histologically, DSS group showed a MORPHOLOGY OF SEGMENTED FILAMENTOUS BACTERIA moderate inflammation, limited to the mucosal surface, AND THEIR PATTERNS OF CONTACT WITH THE FOLLICLE- associated with a damage of the basal portion of the crypts ASSOCIATED EPITHELIUM OF THE MOUSE TERMINAL (in cecum, colon and rectum) and with infiltration of ILEUM: IMPLICATIONS FOR THE RELATIONSHIP WITH THE inflammatory cells (lymphocytes, plasma cells and IMMUNE SYSTEM eosinophils; P<0.05). Microbiological analysis revealed a [1] Caselli M., Cassol F., Boldrini P., Vaira D., Calò G. significant reduction of lactobacilli and coliforms in ileum, [1] School of Gastroenterology; Department of Experimental and Clinical cecum and colon contents of pigs treated with DSS Medicine; University of Ferrara; Ferrara, Italy compared to controls (1-3 Log CFU; P<0.05); also inflammatory cytokines expression patterns were altered in Recent evidence indicates that segmented filamentous the treated group compared to control. In conclusion, our bacteria (SFB), "Candidat us Arthromitus", play a unique role swine model showed clinical symptoms and in different aspects of the maturation of the immune histopathological signs consistent with DSS-induced colitis system, including T cell responses. Thus, it seems in murine models. Further investigations will allow the use particularly relevant in this moment to shortly review the of the pig as a human model to better understand the information on these bacteria and their relationship with the complex interactions between intestinal inflammation, immune system, and to actively investigate their microbiota and intervention strategies. morphological aspects. We distinguished a developmental form from a vegetative form of these organisms. These different forms have distinct roles in the life cycle: the developmental form permits a rapid growth of the organisms while the vegetative form permits the attachment of SFB to the follicular epithelium. We have also given special attention to the modes of contact between SFB and the epithelial cells of the terminal ileum to better understand the unique relationship between these bacteria and the immune system. OC1.11 THE PIG MODEL TO STUDY IBD-ASSOCIATED INTESTINAL INFLAMMATION AND DYSBACTERIOSIS: RESULTS FROM A PRELIMINARY STUDY E. Grilli [1] , B. Tugnoli [1] , A. Zannoni [1] , M.L. Bacci [1] , M. Forni [1] , A. Piva [1] [1] DSMVET, Faculty of Veterinary Medicine, University of Bologna, Italy
Inflammatory Bowel Disease (IBD) is a chronic idiopathic inflammation of the gastrointestinal tract and includes Crohn’s Disease and Ulcerative Colitis. It is considered a complex disorder caused by many factors among which genetic susceptibility, immune dysfunction, and dysbacteriosis. In recent years, many animal models of IBD have been developed mainly in rats and small laboratory animals. The pig, which is considered the animal specie most similar to humans in terms of immunological development, intestinal microbiota, and physiology, is still under-investigated compared to other species. Therefore, the aim of the study was to develop a swine model of diet-induced acute colitis. Six post-weaning pigs were assigned to two different dietary treatments: the control group fed with a control diet and the challenged group fed with control diet supplemented with 5% w/w of sodium dextran sulphate (DSS). Animals were daily inspected for health status, feed intake and fecal score, and were sacrificed after 7 days of treatment. Intestinal mucosa and contents were collected to perform histochemical analysis, inflammatory cytokines expression, and lactobacilli and coliforms analysis. Results showed that pigs treated with DSS developed a pathological condition characterized by a significant anorexia, weight loss, hyperthermia, bloody diarrhea, anemia and 32 ORAL COMMUNIC ATIONS 2
OC2.1 OC2.2 COLONIC MUSCLE CONTRACTILE ACTIVITY FOLLOWING DETECTION, IDENTIFICATION AND QUANTIFICATION OF EXPOSURE TO LACTOBACILLUS RHAMNOSUS GG DIFFERENT PROBIOTIC STRAINS IN FOOD BY USING A Guarino Michele [1] , Cocca Silvia* [1] , Altomare Annamaria [1] , MULTIPLEX QPCR Ammoscato Francesca [2] , Alloni Rossana [1] , Severi Carola [2] , Herbel Stefan* [1] , Günther Sebastian [3] , Wieler Lothar H. [2] Cicala Michele [1] [1] Stefan Roland Herbel - Berlin, Germany - [2] Lothar H. Wieler - Berlin, [1] Campus Bio-Medico - Roma, Italy - [2] Università degli Studi "La Germany - [3] Sebastian Günther - Berlin, Germany Sapienza" - Roma, Italy Probiotic strains are often used in dairy products and in INTRODUCTION: Clinical studies support the efficacy of medical pharmaceuticals. They are also fed to animals, in probiotics in the treatment of acute and chronic intestinal particular since the European Union adopted a prohibition to disorders, although mechanisms underlying are still unclear. use antibiotics to increase the immune defense of animals Direct effect of probiotics on the intestinal muscle has been against bacterial infections. In general, probiotics promote suggested by preliminary findings showing that Lactobacillus beneficial influences on the gastrointestinal tract and thereby strains modulate intestinal contractility. AIMS & METHODS: on health. So far the different strains of the genera We investigated the effect of Lactobacillus rhamnosus GG Lactobacillus and Bifidobacterium were isolated from (LGG) on human colonic circular muscle strip (HCCMS) different probiotic food samples and were compared with contractility. HCCMSs were obtained from disease-free other reference strains from culture collections by phenotypic margins of resected segments for cancer. After removing the criteria and by using the polymerase chain reaction (PCR). mucosa and serosa layers, strips were mounted in separate Present methods for the isolation of probiotic bacterials are chambers, oxygenated at 37°C. Isometric contractions were using selective media, utilizing different growth conditions. measured using force displacement transducers connected However, these methods are time-consuming, labor- with a computer using MacLab system. The strips were intensive and the species differentiation via the phenotypic exposed to LGG obtained from the strain ATCC53103 characterization is error-prone. To detect and quantify (Dicofarm spa, Rome, Italy) at different concentrations different strains in a food sample, a DNA-isolation- and a (36x109, 12x109 and 6x109 CFU/ml), to analyze contractile molecular-based method has to be established for a species- frequency and amplitude and muscle response to Acetylcholine specific characterization and quantification within a DNA- (Ach, 10-5M). LGG effects were also tested on a highly pure mixture of probiotic strains isolated from food or feed primary smooth muscle cells (SMC) culture where Toll-like samples. Therefore, the use of a usual PCR-detection method receptor (TLR) 1, 2 and 6 expression was tested by real-time is not feasible, as this method does not enable a PCR. RESULTS: After 30 minute perfusion at 37°C, HCCMSs quantification ability of strains in the samples analysed. It developed a stable phasic contraction, with a significant Ach- was shown that the formerly selected target-sequences elicited contractile response (50±8% compared to baseline). situated within the 23s-5s rRNA intergenic spacer region Compared to baseline, exposure to LGG induced a dose- were not species-specific enough to differentiate close related dependent enhancement of contractile frequency and an probiotic strains from each other. So other sequences like increase of 10.2±3%, 8±1.4% and 3±1% of mean contractile the heat shock proteins (hsp60) had been chosen for the amplitude at the concentration of 36x109, 12x109 and 6x109 specific detection and identification of different Lactobacillus CFU/ml of LGG, respectively. Maximum effect was reached strains. For the species-specific detection of strains after 3±2 minutes, then decreased to mean value till wash-out. belonging to the genera Bifidobacterium we chose the Following washout, contractile frequency and amplitude as well sequences for the clpC, dnaJ1 and atpD proteins. In a final as response to Ach returned to baseline values. Similarly, direct step we designed TaqMan-labelled primer pairs based on the exposure of SMCs to LGG (120x106CFU/ml) caused dose- already existing specifically working gene sequences for the dependent cell shortening and inhibition of Ach contractile detection of eight different probiotic species by qPCR – six response (15%±7 and 59%±15, respectively; p<0.05). Indeed, species of the genera Lactobacillus and two belonging to the PCR analysis showed SMC constitutive expression of TLR1, 2 genera Bifidobacterium; they are all used in probiotic food. and 6. CONCLUSION: LGG exerts a direct and reversible effect The advantage of a multiplex-qPCR method is a rapid and on human colonic smooth muscle which could be related to the species-specific detection, identification and quantification of constitutive expression of TLR1, 2 and 6 receptors, involved in different probiotic strains within a single qPCR run. recognition of Gram+ bacteria, on SMCs. These effects could possibly explain the clinical beneficial effect of probiotics.
33 ORAL COMMUNICATIONS 2
OC2.3 (LGG) is an established probiotic for treatment of childhood EVALUTATION OF PROBIOTIC BACTERIAL ADHESION TO gastroenteritis. Rotavirus (RV) is the most severe agent of NORMAL AND DISPLASTIC COLONIC MUCOSA BY AN EX- gastroenteritis and induces a sequence of enterotoxic and VIVO ORGAN CULTURE EXPERIMENTAL MODEL cytotoxic effects in enterocytes, including oxidative stress. Pagnini Cristiano* [1] , Corleto Vito [1] , Di Giulio Emilio [1] , Delle The aim of this study was to investigate the antioxidant Fave Gianfranco [1] effects of LGG in RV infection in human enterocytes. Methods: We used a RV infection model developed in our [1] Universita' di Roma "La Sapienza" - Roma, Italy laboratory, which consists in the infection of Caco-2 cell Background: Probiotic bacteria have shown to promote monolayers with RV strain SA11 (1). Tissue integrity was mucosal health in several pathologic conditions. The capacity evaluated by the transepithelial resistance (TER). Reactive to interact with the mucosa strictly depends on the adhesion oxygen species (ROS) and reduced (GSH)/oxidated (GSSG) of such bacteria to mucosal surface, but specific studies on glutathione ratio were assessed using respectively adhesion properties of different bacterial species are scanty. dichlorofluorescein (DCF) and a colorimetric assay. DCF was Evidence of in-vivo colonization of specific probiotic bacteria also used to evaluate ROS increase by fluorescence in different colonic segments is lacking, but bacterial species microscope. We also tested the effects by the antioxidant N- are likely to distribute not univocally in the colon. We acetylcysteine (NAC). Results: RV induced a significant intended to evaluate the adhesion property of different increase in ROS intracellular level (223±76 vs 25±19 DCF probiotic bacteria either in normal colonic mucosa and in fluorescence units, p<.05) and a reduction of GSH/GSSG adenomatous polyps. To this purpose, an ex-vivo organ ratio compared to controls (4.48 vs 0.08, p<.05) indicating culture technique was developed. Bifidobacterium infantis and that the virus alters the oxidative status and impairs Streptococcus thermophilus, contained in a multiple probiotic antioxidant defences. The addition of NAC to Caco-2 cells preparation commercially available, were preliminary tested. reduced RV-induced tissue damage by 68.9% (p<.05) Materials and methods: Biopsies of macroscopically normal indicating that tissue damage is oxidative stress-dependent. mucosa from proximal and distal colon were collected upon NAC completely inhibited RV-induced ROS increase and endoscopic examination (n=6 each group). The samples were GSH/HSSH unbalance (p<.05). LGG prevented TER decrease washed and incubated with a multiple probiotic preparation by 79.8% (p<.05). LGG counteracted RV-induced oxidative for 2h at 37°C, and then washed again. Total DNA was stress, reducing ROS increase by 42.8% and restoring extracted, and S. thermophilus and B. infantis mucosal GSH/GSSH ratio to the control level (p<.05). Microscopic concentration was evaluated by real-time PCR with specific evaluation confirmed the protective role of LGG in RV- primers. Analogue procedure was performed with biopsies induced oxidative stress. Conclusions: RV induces decrease from adenomatous polyps and normal mucosa (n=8 each group), in TER associated with ROS increase and a reduction of in the rectum-sigma. Results: After probiotic incubation, GSH/GSSG ratio. LGG prevents tissue damage induced by mucosa-associated concentra tion of B. infantis was RV by counteracting oxidative stress induced by the viral significantly higher in the mucosa of proximal colon biopsies infection. These data provide a new mechanisms for the high compared with distal colon specimens (8.1±2.4 vs. 1.8±0.6, efficacy of LGG against childhood diarrhea observed in 4.4-relative increment, p<0.05), w hile no significant difference clinical trials. in mucosal concentration was found for S. thermophilus. 1. De Marco et al. J Infect Dis 2009;200:813 Adenomatous polyps mucosa had a significant reduction of OC2.5 both the probiotic bacteria concentration compared with normal mucosa (B. infantis: 1.7±0.5 vs. 5.5±1.9, S. MOLECULAR BIOLOGICAL METHODS FOR RAPID thermophilus: 13.6±8.4 vs. 70.9±24.4, p<0.01 for both), with DETERMINATION OF LACTIC ACID BACTERIA STRAINS a 3.2-fold decrement for B. infantis and a 5.2-fold decrement ISOLATED FROM FOOD AND ENVIRONMENTAL SAMPLES for S. thermophilus. Conclusion: Preliminary results in ex- Szen Orsolya* [3] , Pal Karoly [4] , Naar Zoltan [4] , Kiss Attila [5] vivo organ culture experimental model indicate that different [3] Egerfood National Knowledge Centre - Eszterhazy Karoly College - probiotic bacteria show peculiar adhesion to normal and Eger, Hungary - [4] Eszterhazy Karoly College - Dept. of Microbiology and [5] pathologic colonic mucosa. Adhesion properties of probiotc Food Technology - Eger, Hungary - Eszterhazy Karoly College - Dept. of Food Chemistry and Biochemistry - Eger, Hungary bacteria appear to be important for clinical effectiveness and need to be further investigated in experimental models. The most popular methods for determination of the OC2.4 microbiological composition of foods are the time consuming classical microbiological techniques. Our primary aims were LACTOBACILLUS CASEI RHAMNOSUS STRAIN GG INHIBITS 1. Building a collection of bacteria that show beneficial THE OXIDATIVE STRESS INDUCED BY ROTAVIRUS IN HUMAN (probiotic) features and might be used for food ENTEROCYTES manufacturing in the future; 2. Adapting and developing Buccigrossi Vittoria* [1] , Laudiero Gabriella [1] , Sofia Morena [1] , molecular biology tools for rapid determination of isolated Oliva Valentina [1] , Verrone Maria Antonietta [1] , Wudy Anna [1] , bacterium strains. In our experiments we investigated Guarino Alfredo [1] different samples: raw milk, fermented food products, [1] Dept. of Pediatrics University of Naples "Federico II°" - Naples, Italy stomach of bees and beebread. In order to select the lactic acid bacteria, we used BSM and MRS media as selective Background/Aim: Lactobacillus casei rhamnosus strain GG medium. DNA of 70 bacterial strains was extracted. At first 34 ORAL COMMUNIC ATIONS 2 we identified the strains by traditional microbiological demonstrated that established IP-10 gradients in inflamed methods and then we performed restriction analysis (RFLP) intestinal tissue can be selectively targeted by the probiotic to confirm the results. We used the E8F-E1115R primer pair protease, resulting in reduced ileal inflammation. that amplified an 1100 bp long fragment of the 16S rDNA. Chromatographic fractionation and LC-MS/MS analysis of This product was digested simultaneously by the mix of three the active L.p supernatant indicated prtP-encoded lactocepin restriction enzymes (AluI, HhaI and RsaI). Standard to be the protective probiotic protease, which was finally restriction patterns were made by the use of known reference proven by the generation of a lactocepin-negative mutant of bacterial strains (from the DSMZ collection) and the patterns an analogously active, but transformable, human of the new isolates were compared to these. The reference Lactobacillus casei (L.c) isolate (L.c lac-/-), which did no Lactobacillus casei, Lb. paracasei and Lb. zeae strains (the longer show the protective anti-IP-10 activity. Physiologically ‘Lb. casei group’) showed the same restriction pattern, so we important, oral probiotic treatment in a colitis model (T cell had to use species specific primers for the appropriate transferred RAG2-/- mice) revealed L.c to mediate reduced differentiation of these strains and the isolates having the cecal inflammation, whereas the lactocepin negative isogenic same pattern. In addition, we tried the ‘High Resolution L.c mutant is not able to exert anti-inflammatory effects. The Melting’ (HRM) method for the identification of bacteria. In present study identified the selective degradation of IP-10 by our experiments we managed to identify bacterial strains prtP-encoded lactocepin to be a therapeutically relevant originating from raw milk, fermented food and bees by probiotic structure-function relationship. As dysregulated IP- means of time-saving molecular techniques. Though the 10 secretion is linked to an array of chronic inflammatory RFLP method is commonly used in laboratories, we diseases like IBD, allergy and arthritis, the development of combined three restriction enzymes and got a much better lactocepin-based therapies might result in broadly applicable, resolution of restriction fragments. safe and efficient anti-inflammatory treatment options. Those bacteria that showed the restriction pattern of the ‘Lb. casei’ group were identified by species specific primers. The OC2.7 HRM method was a useful tool for the separation of some PROTECTION AGAINST SEPSIS BY PROBIOTIC THERAPY IS strains. We continue the search for new bacterium strains and CORRELATED WITH STIMULATION OF A NOT PREVIOUSLY the improvement of our database and hope that it will help us DESCRIBED BACTERIAL PHYLOTYPE in the rapid identification of bacteria. The research was Gerritsen Jacoline* [1] , Timmerman Harro M. [2] , Fuentes financed by Egerfood Ltd. and the NKTH research program. Susana [1] , van Minnen L. Paul [2] , Panneman Henk [3] , Konstantinov Sergey R. [1] , Rombouts Frans M. [1] , Gooszen OC2.6 Hein G. [2] , Akkermans Louis M. A. [2] , Smidt Hauke [1] , Rijkers PROBIOTIC STRUCTURE FUNCTION ANALYSIS REVEALS Ger T. [2] PRTP-ENCODED LACTOCEPIN TO MEDIATE ANTI- [1] Wageningen University - Wageningen, Netherlands - [2] University INFLAMMATORY EFFECTS VIA SELECTIVE DEGRADATION Medical Center - Utrecht, Netherlands - [3] Dr. van Haeringen OF IP-10 Laboratorium B.V. - Wageningen, Netherlands Szen Orsolya* [3] , Pal Karoly [4] , Naar Hörmannsperger Background: Prophylactic probiotic therapy has shown Gabriele* [1] , von Schillde Marie-Anne [1] , Weiher Monika [1] , beneficial effects in an experimental rat model for acute Alpert Carl-Alfred [2] , Hahne Hannes [3] , Bäuerl Christine [4] , pancreatitis on the health status of the animals. Mechanisms Perez Gaspar [4] , Haller Dirk [1] by which probiotic therapy interfere with severity of acute [1] Biofunctionality, Technical University of Munich - Freising- Weihenstephan, Germany - [2] Gastrointestinal microbiology, German pancreatitis and associated sepsis, however, are poorly Institute for Human Nutrition - Potsdam-Rehbrücke, Germany - [3] Chair understood. Aims of this study were to identify the probiotic- for Bioanalytics, Technical University of Munich - Freising- induced changes in the intestinal microbiota and to correlate Weihenstephan, Germany - [4] Departamento de Biotecnología, Instituto these changes to disease outcome. Methods: Duodenum and de Agroquímica y Tecnología de Alimentos - Valencia, Spain ileum samples were obtained from healthy and diseased rats subjected to pancreatitis for seven days and prophylactically Interferon-inducible protein (IP)-10 is a major chemokine for treated with either a multispecies probiotic mixture or placebo. lymphocyte recruitment and known to be strongly Intestinal microbiota was characterized by terminal-restriction upregulated in the context of an array of chronic fragment length polymorphism (T-RFLP) analyses of PCR- inflammatory diseases. We previously demonstrated that amplified 16S rRNA gene fragments. Results: These analyses VSL#3, a clinically relevant probiotic mixture in the context showed that during acute pancreatitis the host-specific ileal of inflammatory bowel diseases (IBD), normalizes intestinal microbiota was replaced by an ‘acute pancreatitis associated epithelial IP-10 levels via cell surface proteins of microbiota’. This replacement was not reversed by Lactobacillus paracasei (L.p). In the present study, we aimed administration of the probiotic mixture. An increase, however, to identify the probiotic structure-function relationship was observed in the relative abundance of an uncultured underlying this anti-inflammatory effect. In vitro studies bacterial phylotype most closely related to Clostridium revealed the observed loss of epithelial derived IP-10 to be lituseburense, and referred to as commensal rat ileum due to direct degradation of the chemokine via a highly bacterium (CRIB). Specific primers targeting the CRIB 16S selective secreted and cell surface associated serine protease rRNA gene sequence were developed to detect this phylotype of L.p. Explant culture and intraperitoneal injection by quantitative PCR. An ileal abundance of CRIB 16S rRNA experiments using a murine ileitis model (TNFdeltaARE/+) genes of more than 7.5% of the total bacterial 16S rRNA gene 35 ORAL COMMUNICATIONS 2 pool was correlated with reduced duodenal bacterial 56 patients. overgrowth, reduced bacterial translocation to remote organs, Study design: Stool samples from 4 groups/ 56 patients were improved pancreas pathology and reduced pro-inflammatory taken at one before and 2 timepoints after antibiotic treatment cytokine levels in plasma. Conclusion: Our current findings and ± intake of L.casei. Samples of control group were taken at future studies involving this uncharacterized bacterial same time points. (A=antibiotic therapy; AP= phylotype will contribute to unraveling one of the potential antibiotic/probiotic therapy; P= control group receiving the mechanisms of probiotic therapy. probiotic drink; C= Control) Methods: feacal samples were investigated for C.difficile toxin OC2.8 and changes of bacterial groups in GI microbiota by qPCR EFFECT OF A NOVEL TRANS-GALACOOLIGOSACCHARIDE using 16S rRNA group specific primers and probes, MIXTURE (B-GOS) ON METABOLIC SYNDROME RISK Euroclone® C.difficile A/B kit, PCR/DGGE and a C.difficile FACTORS IN OVERWEIGHT ADULTS ELISA test. Especially abundance and diversity of total Vulevic Jelena* [1] , Juric Aleksandra [2] , Tzortzis George [2] , bacteria, Lactobacilli, Bifidobacteria, Bacteroides, Clostridium Gibson Glenn [3] cluster IV and XIV, C.difficile, and Enterobacteriaceae were [1] University of Reading/Clasado Ltd. - Reading, United Kingdom - analyzed. [2] Clasado Ltd. - Reading, United Kingdom - [3] University of Reading - Results: 16S rRNA qPCR suggested some C.difficile in all Reading, United Kingdom groups but only one C.difficile positive patient could be detected by Euroclone® kit in group A. In group A and AP Background: Metabolic syndrome is combination of was a decrease of total bacteria following therapy. disorders that increase the risk of developing cardiovascular Also mean values of all bacteria were lower in A and AP disease and diabetes. Prebiotics are known to support the groups compared to control groups. growth of beneficial bacteria that can be reduced in The results of PCR/DGGE showed a higher diversity in group overweight adults and to also reduce cholesterol levels in AP than in group A. The abundance of Enterobacteriaceae some instances. However, their effects on the metabolic was higher especially in group A than in control groups. By syndrome risk factors in overweight adults have not been contrast, the abundance of Clostridium Cluster IV was lower investigated thus far. Objective/Design: Overweight adults in both antibiotic receiving groups than in control groups. (47) with three or more risk factors [increased fasting Within group P there was a significant increase of glucose and/or insulin, high blood pressure (BP), Lactobacilli. Discussion: Only qPCR tests addressing the dyslipidaemia, waist circumference (>94cm in man; >84cm C.difficile toxin may indicate CDI apropriately. CDI seems to in women), BMI>25] associated with metabolic syndrome be a rare reason for AAD. To understand other pathogenic were randomised to receive a prebiotic GOS mixture (B-GOS) mechanisms for AAD, group specific shifts under antibiotic and placebo in a double-blind, placebo-controlled, crossover treatment must be better analysed. This will also lead to the study. They consumed both treatments daily for 12 wk with development of improved probiotic approaches. a 4 wk wash-out period in between. Blood, BP and anthropometric measurements were taken at the beginning, OC2.10 middle (6 wk), and end of each test period. Insulin, glucose, GLYCOSAMINOGLYCANS OF HUMAN MILK DURING THE total cholesterol (TC), HDL-C, LDL-C and triacylglycerol FIRST MONTH OF LACTATION: FURTHER POTENTIAL (TAG) were measured. Results: B-GOS significantly reduced PREBIOTICS FOR THE BREASTFED INFANT insulin, TC and TAG compared with the baseline and placebo. Coppa Giovanni Valentino* [1] , Gabrielli Orazio [1] , Zampini No effect was observed on other measurements. Conclusion: Lucia [1] , Galeazzi Tiziana [1] , Padella Lucia [1] , Bertino Enrico [2] , B-GOS administration to overweight adults resulted in Maccari Francesca [3] , Volpi Nicola [3] positive effects on insulin, TC and TAG. Thus, B-GOS may be [1] Univ. Vienna, Dep for Nutritional Sciences [1] Università politecnica considered as a useful dietary candidate for the reduction of Marche - Ancona, Italy - [2] Università di Torino - Torino, Italy - these metabolic syndrome risk factors in overweight adults. [3] Università Modena e Reggio Emilia - Modena, Italy
OC2.9 In an our previous study (1) we defined the structure and EFFECTS OF ANTIBIOTIC THERAPY ON THE composition of pooled human and bovine milk GASTROINTESTINAL MICROBIOTA AND THE INTERVENTION glycosaminoglycans (GAGs). Human milk GAGs (HMGs) WITH L.CASEI were about 7 times higher compared to bovine milk; moreover their patterns were significantly different. Angelika Pirker [1] , Berit Hippe [1] , Christoph Kamhuber [2] , Felix Structural analyses of HMGs, revealing the presence of Stockenhuber [2] , Alexander Haslberger* [1] glycosidic linkages resistant to the digestion by intestinal [1] Univ. Vienna, Dep for Nutritional Sciences - Vienna, Austria - enzymes as in human milk oligosaccharides (HMOs), [2] Krankenhaus Oberpullendorf - Vienna, Austria suggest a possible prebiotic role of such substances. As no Background: Results from a clinical study reported reduced data are actually available, the aim of the present study was antibiotic associated diarrhoea (AAD, 18%:5%) by to obtain data on HMGs concentration during the first month intervention with L.casei Shirota (Stockenhuber et al., 2008). of lactation.Quantitative agarose-gel electrophoresis was Objectives: In the present pilot study effects of a combination performed on milk samples collected at 4th, 10 th, 20 th and therapy antibiotic and L.casei Shirota and controls were 30 th day post partum from healthy mothers delivering at tested for AAD, C.difficile and changes of fecal microbiota in term, according to (1).The mean HMGs content was 3.8, 1.0, 36 ORAL COMMUNIC ATIONS 2
0.5 and 0.4 g/L at 4 th, 10 th, 20 th, and 30 th day of lactation OC2.12 respectively. In conclusion consistent amount of GAGs was STUDY OF PROBIOTIC WHEY BASED ORAL REHYDRATING found during all first month of lactation; moreover a time SOLUTION (BIO-ORS) AGAINST SHIGELLA DYSENTERIAE related decrease of concentration have been observed, as INFECTION IN MICE already described for HMOs. Because of their biochemical Goyal Nupur* [1] characteristics HMGs can represent a further class of non- [1] Amity Institute of Biotechnology,Amity University - Noida, India digestible carbohydrates with a potential prebiotic effect. Two BIO-ORS were prepared with whey, a dairy by-product, OC2.11 in combination with probiotic cultures, Lactobacillus L. PLANTARUM TENSIA COMPRISING PROBIOTIC CHEESE paracasei 17 and Lactobacillus casei 299 separately. WITH HYPOTENSIVE EFFECT Osmolarity was maintained at 311mM/l (WHO standard). Hütt Pirje* [1] , Songisepp Epp [2] , Rätsep Merle [2] , Shkut Elena [2] , Swiss Albino mice were divided into 5 groups with two Zilmer Mihkel [3] , Ehrlich Kersti [3] , Mikelsaar Marika [1] controls i.e. Infected (I) and Non-fermented whey (NFW) [1] University of Tartu, Dept. of Microbiology - Tartu, Estonia - [2] Bio- group. 109cfu/ml cells of Shigella could provoke diarrhea Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia - with soft fecal output on 2nd day and shedding at 103cfu/g. [3] University of Tartu, Dept. of Biochemistry - Tartu, Estonia The BIO- ORS treatment in experimental groups started on 2nd day. Fecal output was lowest in L.casei 299 groups The prevalence of risk markers of atherosclerosis, incl. within 5 days of the BIO-ORS treatment. On 2nd day, there increased blood pressure are increasing among worldwide was a significant (p<0.01) increase in body weight in groups population. Functional probiotic food could affect positively 17 and 299 animals. Serum Na+ was normal (143mM/l) after the metabolism of host. Some peptides, harbored in milk 3 days of drinking BIO-ORS. Higher serum K+ was observed possess blood pressure lowering ability through inhibition of in group 299. Loss of K+ ion in faeces was least in WHO ACE. group but also gets reduced to 20.7mM±5.09 and 19.5 Aim. To assess if the consumption of the L. plantarum mM±1.90 in 17 and 299 group respectively. Na+ ion loss in TENSIA comprising cheese has any cardio-protective effect. feces was (p<0.05) lower in both BIO-ORS groups, indicating Methods. The strain TENSIA (DSM 21380) originates from a cure against dehydration. The blood glucose level was non- healthy Estonian child. The strain possesses some proteolytic significantly lowered in control groups but higher in BIO ORS ability and is able to produce polyamines and NO in vitro. ACE groups. inhibitory effect of the probiotic cheese extracts was On 6th day, there was a sharp increment in total lactobacilli assessed spectrophotometrically at 228 nm. A DBPC cross- count, although transient in feces of group 17 (8.229±0.07) over study (ISRCTN15061552) was carried out with the and 299 (8.399±0.181). On 4th day, shedding of coliforms probiotic and control cheese. In clinically healthy adults was less than 5 log cycle in groups 17 and 299 and highest (n=82; 37.7 ? 11.1 yrs, M/F: 33/49) the 3-week consumption in control groups’ i.e.7.5log cfu/g. On 5th day, there was an of probiotic or control cheese was followed with two-week increase in total LAB count in order as 299 > 17> WHO. washout period. Daily dose: 50 g of cheese (i.e. TENSIA 10.0 Shedding of pathogen completely reduced (>1.5 log cfu/g) log CFU). in groups 17 and 299. Colonization of aerobic bacteria in The self-reported questionnaire was applied. Fasting blood, small intestine was highest in group 17 (6.77±0.25) followed faeces and urine were collected and blood pressure was by 299. Colonization of pathogen in small intestine was least measured at recruitment, after probiotic treatment, after (2 log cfu/ml) in group 299 among all till 7th day. wash-out and after control period. Haematological and Colonization of aerobic bacteria in large intestine was highest biochemical indices incl. serum glucose, hs-CRP, total (6.6 log cfu/ml) in 17 groups followed by 299 groups (5.60 cholesterol, cholesterol fractions and triglycerides were log cfu/ml). Significantly fewer viable Shigella cells were determined. measured on 7th day in group 17 than 299. Colonization of Results The consumption of cheese comprising L. plantarum Shigella in liver was reduced by 5 log units in group17. On TENSIA did not cause abdominal discomfort (abdominal 7th day, anti-Shigella antibodies in the intestinal lumen were pain, flatulence, bloating). The probiotic cheese of relatively high in both BIO ORS groups facilitating the clearing of high fat content did not increase the body mass index of pathogen. Moreover, lactic acid produced in the intestine volunteers. At the end of the trial the systemic inflammation adds to inhibitory effect. Nupur Goyal *(Noida,India)and D.N. markers (hs-CRP, leukogram) did not show increased values, Gandhi (Karnal,India) remaining within the normal range. The 3-week consumption of probiotic cheese reduced significantly systolic and diastolic blood pressure in adults (-3.4 mmHg and -2.4 mmHg, p=0.0006, p=0.0004, respectively). Conclusion. Probiotic cheese expressing blood pressure lowering peptides helps to maintain blood pressure supporting the cardiovascular system.
37 ORAL COMMUNICATIONS 2
OC2.13 confirm its efficacy or unravel further mechanism of action. THERAPEUTIC EFFECTS OF OAT AND MILK BASED AIMS & METHODS: Aim of this study was to evaluate the PROBIOTIC FERMENTED PRODUCT AGAINST TYPE 2 therapeutic effect and mechanisms of action of Tanagel in DIABETES the murine model of acute colitis by DSS. C57BL/6 mice were Sangwan Seema* [1] , Karasi Anbu K [1] , Nanda Dhiraj K [2] , Poply exposed to 2.5% Dextran Sodium Sulfate(DSS), given for 8 Sarang [1] , Singh Rameshwar [1] days in tap water. At the 5th,6th, 7th, 8th day mice received [1] National Dairy Research Institute - Karnal, India - [2] National Bureau 1mg or 10mg of TANAGEL by gavage in 200 ul of drinking of Animal Genetic Resources - Karnal, India water; control mice received water only. Body weight, occult blood test and stool consistency were measured every day In today’s modern lifestyle, where prevalence of diabetes is and used to calculate the Disease Activity Index (DAI) to increasing at an alarming rate, our aim is to develop an oat assess severity of colitis; survival was expressed as %. Mice and milk based probiotic fermented product and to study its were sacrificed at day 9 and colon length was measured, then effect on high fructose diet (HFD) induced type 2 diabetes. colon was opened and underwent microscopical analysis to 1st product was optimized by Response Surface assess the degree of inflammation. To explore the direct Methodology and level of oat bran in milk, level of inoculum effects of Tanagel on intestinal epithelial cell proliferation, an and incubation time for product were decided. Then oat bran MTT assay was used on CT26 and Caco2, a murine and appropriately diluted in skim milk was steam treated for human intestinal epithelial cell line, respectively. TNF –a appropriate time, cooled to 370C and fermented for 7 hours pretreated cells were incubated in presence of TNF-a with L. rhamnosus GG (LGG) and Lactobacillus casei NCDC (25ng/mL) or Tanagel (5, 10, 50 µg/ml) and cell vitality was 19 (~104 CFU/ml) separately. After fermentation, storage evaluated after 48 hours. studies were done for 10 weeks at 40C and it was found that RESULTS: Tanagel significantly reduced DAI in treated mice LGG fermented product contain protein (2.49%), fat (0.96%), compared to controls in a dose dependent manner, being 10 total dietary fibre (2.38%), ß-glucan (0.857%) and viability mg more efficacious than 1 mg dose. No differences were of Lactobacilli (1.5×107 CFU/gm). Similarly L. casei NCDC 19 assessed between the three groups about body weight loss. fermented product contain protein (2.26%), fat (1.24%), total Neither differences in mortality were observed. At the dietary fibre (2.43%), ß-glucan (0.831%) and viability of sacrifice the lenght of colons was measured. Gelatine Tannate Lactobacilli (4.2×106 CFU/gm). Further evaluation of these treated mice showed a longer colon, compared to controls. products was done to study their effect on progression and Tanagel did not significantly affect the proliferation of Caco2 induction of type 2 diabetes in HFD-fed wistar rats as animal and CT26 at MTT assay. Proliferation was reduced at higher model. Various blood parameters were evaluated after (no physiological) concentrations. feeding for 9 weeks. Best results were shown by the rats CONCLUSION: Taken together our preliminary observation group fed with oat and milk based product fermented with suggest that Tanagel decreased the clinical severity of colitis LGG and it was found that this product results in a significant in mice. Gelatin tannate is an interesting product able to re- decrease in blood glucose (74-76%), oxidative stress (SOD, establish intestinal homeostasis in course of acute colitis as catalase, glutathione), cholesterol (71-74%) and triglycerides shown by human studies. Further analysis are required to level (63-64%) during progression study of type 2 diabetes. better define mechanisms of action underlying these findings But during induction study, it was found that there was and more indication for gelatin tannate could be developped comparatively less reduction in blood glucose level (52- following specific studies. 55%), oxidative stress, cholesterol level (35-39%) and triglycerides level (25-27%). Gene expression studies OC2.15 regarding 3 genes (GLUT-4, IRS-1 and IRS-2, PPAR-?) are MODULATION OF THE FAECAL MICROBIOTA PROFILE underway and will be completed within 3 months. AND IMMUNE MARKERS BY A NOVEL TRANS- GALACOOLIGOSACCHARIDE MIXTURE (B-GOS) IN OVERWEIGHT OC2.14 ADULTS TANAGEL REDUCE COLITIS SEVERITY IN DEXTRAN SODIUM Vulevic Jelena* [1] , Juric Aleksandra [3] , Tzortzis George [2] , SULPHATE (DSS) MODEL OF MURINE ACUTE COLITIS Gibson Glenn [4] Lopetuso Loris Riccardo* [1] , Scaldaferri Franco [1] , Cufino [1] University of Reading/Clasado Ltd. - Reading, United Kingdom - [2] [3] Valerio [2] , Petito Valentina [2] , Gerardi Viviana [1] , Pizzoferrato Clasado Ltd. - Reading, United Kingdom - Clasado Ltd. - Reading ~ [4] Marco [1] , Pecere Silvia [1] , Laterza Lucrezia [1] , Stigliano United Kingdom - University of Reading - Reading, United Kingdom Egidio [2] , Arena Vincenzo [2] , Sgambato Alessandro [2] , Gasbarrini Antonio [1] Background: Recent evidence suggests that gut microbiota [1] Internal Medicine, Catholic University of Rome - Roma, Italy - is altered towards less beneficial one in overweight [2] Pathology, Catholic University of Rome - Roma, Italy individuals. Also, inflammation can be associated with increased weight and altered by microbiota. INTRODUCTION: Tanagel, a gelatin powder containing Tannic Galactooligosaccharides (GOS) support the growth of Acids, is commonly used for diarrhea in children. Fewm beneficial bifidobacteria and can positively modify the information exist on its mechanisms of action, involving gel immune system, but little is known about their effect in formation and bacterial toxin sequestration, mostly obtaine overweight adults. by in vitro studies. No information, however, exist regarding Objective/Design: We assessed the effect of a prebiotic GOS in vivo studies and no animal model has been used to mixture (B-GOS) on faecal microbiota and immune markers 38 ORAL COMMUNIC ATIONS 2 in a double-blind, placebo-controlled, crossover study with antimicrobial activity on Gram+ and Gram– in vitro assays. 47 overweight subjects. They consumed both prebiotic and Daily supplementation with L . crispatus M247 partially placebo treatments daily for 12 wk with a 4 wk wash-out corrected HFD-induced changes in gut microbiota. Conclusions: period in between. Blood, saliva and faeces were collected at changes in gut microbiota in mice receiving a HFD precede the the beginning, middle (6 wk), and end of each test period. onset of obesity and are associated to reduced defensins Predominant bacterial groups were quantified and cytokine production in the ileal mucosa, suggesting that diet can influence production, faecal/saliva IgA, calprotectin and CRP were gut microbiota affecting the production of antimicrobial peptides measured. and dietary supplementation with a probiotic strain is effective Results: B-GOS significantly increased the numbers of to correct gut dysbiosis caused by an HFD. beneficial bacteria, especially bifidobacteria, at the expense of less beneficial groups compared with the baseline and OC2.17 placebo. Significant decrease in CRP, calprotectin and IL-6 ADMINISTRATION OF BERBERINE IMPROVES HEPATIC and significant increase in faecal IgA levels were also NECROINFLAMMATION IN MURINE STEATOHEPATITIS, BUT observed. Conclusion: B-GOS administration to overweight IS ASSOCIATED WITH INCREASED MORTALITY individuals resulted in positive effects on both the microbiota Vivoli Elisa* [1] , Provenzano Angela [1] , Madiai Stefania [1] , Novo composition and the immune response. Thus, B-GOS may Erica [1] , Parola Maurizio [1] , Marra Fabio [1] be a useful dietary candidate for the enhancement of [1]University of Florence - Florence, Italy gastrointestinal health and immune function in overweight adults. Berberine (BRB) is an alkaloid present in several medicinal OC2.16 plant species. BRB has been shown to possess antibacterial, anti-inflammatory, and antidiabetic properties. The use of OBESITY-INDUCED CHANGES IN GUT MICROBIOTA ARE BRB could be particularly appealing for the treatment of GENERATED BY MUCOSAL DEFENSINS AND MODULATED BY nonalcoholic steatohepatitis, based on its hepatoprotective LACTOBACILLUS CRIS PATUS M247 DIET SUPPLEMENTATION role during hepatotoxicity, and the ability to limit metabolic Cavallo Donatella [1] , Elli Marina [2] , Morelli Lorenzo [3] , Moratelli damage and obesity. The aim of this study was to test the Ketty [1] , Castagliuolo Ignazio [1] , Martines Diego [1] , Brun effects of chronic administration of BRB in a dietary model Paola* [1] of murine steatohepatitis. Male C57BL/6 mice were divided [1]Università di Padova - Padova, Italy - [2]AAT - Piacenza, Italy - into four groups and fed a diet deficient in methionine and [3]Cattolic University - Piacenza, Italy choline (MCD) or a control diet. BRB (5 mg/kg) or its vehicle was administered intraperitoneally every day. Histology was Changes in gut microbiota have been described in obese analyzed by H&E staining followed by a semiquantitative subjects and associated to body weight gain. However it is score. Intrahepatic gene expression was assayed by not clear which factor(s) are driving microbiota changes and quantitative real time PCR. The experiment was set up to whether the modification of microbiota is a consequence of investigate two time points, 4 and 8 weeks. However, animals obesity or rather a culprit. Taking advantage of a murine high administered BRB together with MCD showed a remarkable fat diet-induced obesity model, the aims of this study were excess in mortality during the first weeks of experimental to determine whether: 1) changes in gut microbiota precede observation compared to mice administered MCD and vehicle or follow body weight gain; 2) variation of ileal mucosa (60% vs. 5% mortality at 4 weeks). Thus, all data are referred antimicrobial peptides (defensins) is associated to just to the 4 week time point which included all surviving modifications of intestinal microflora; 3) administration of a animals. Mortality was similar comparing mice administered probiotic strain (Lactobacillus crispatus M247) influences a control diet with or without BRB. Animals receiving MCD diet-induced gut microbiota alteration. and BRB had significantly lower ALT levels than those on Methods: male C57Bl/6 mice received either a regular chow MCD+vehicle. BRB also caused a significant increase in diet (RCD) or an high fat diet (HFD) for 9 weeks, with or liver/body weight ratio in MCD-fed mice. As well established, without daily L. crispatus M247 (108 cfu) supplementation. MCD induced hepatic steatosis and inflammation. The grade Fecal microbiota was studied by quantitative real time PCR of steatosis was not significantly affected by BRB. In contrast, and Denaturing Gradient Gel Electrophoresis, whereas necroinflammation was markedly and significantly reduced mucosal level of defensins, mRNA and peptides, was in mice treated with MCD+BRB vs. MCD+vehicle. MCD- determined by qRT-PCR and bactericidal assays, induced steatohepatitis resulted in a significant increase in respectively.Results: A significantly increase in body weight the intrahepatic gene expression of monocyte gain was evident in mice receiving HFD as compared RCD chemoattractant protein-1 and transforming growth factor ß. after the seventh week on diet. However significative Co-administration of BRB normalized the expression levels changes, both qualitative and quantitative, in gut microbiota of these factors. Autoptic examination of animals died upon started to be detectable as early as two weeks on diet. We administration of MCD+BRB demonstrated the presence of observed a significant increase in Firmicutes phylum bilateral effusions in the lungs, compatible with pneumonia. associated to Bacteroidetes phylum reduction in mice fed a In conclusion, BRB administration effectively limits the HFD, with a severe drop of Lactobacillus species. HFD- development of necro-inflammation in mice with induced changes in gut microbiota paralleled a significant experimental steatohepatitis, but this effect is overshadowed by increased mortality possibly due to deleterious actions on reduction in mucosal defensins mRNA (e.g. RegIII? and extrahepatic organs, such as the lungs. RegIIIß) that was associated to a significant loss of 39 ORAL COMMUNICATIONS 2
OC2.18 3 strains of bifidobacteria, and 1 strain of Streptococcus FACTORS INFLUENCING CLINICAL EFFICACY OF VAGINAL thermophilus) starting from 1 month before delivery until 1 PROBIOTICS month after delivery, the others were used as control group. Heczko Piotr* [1] , Strus Magdalena [1] , Wiecek Grazyna [1] , Milk and stool samples were collected 3 days (T0) and one Kupka Anna [1] , Kryczyk Jadwiga [1] month (T30) after delivery in order to assess cytokines values [1] Jagiellonian University Medical College - Krakow, Poland (Il-6,IL-1ß, Il-10 and TGFß-1) and immunoglobulin values (IgA, IgG, IgM) in breast milk of healthy mothers and Several clinical trials have been reported over the last years immunoglobulins values (IgA, IgG, IgM) in stool samples of about the efficacy of vaginal probiotic preparations. Although their newborns,.The concentrations of TGF-ß1, IL-6, IL-10 the use of lactobacilli containing capsules appeared to be and IL-1ß were analyzed using commercial kits (R & D generally beneficial for the treatment of patients with bacterial System Inc., Minneapolis, MN, USA; Research Diagnostics vaginosis or for prevention of its recurrences, results of these Inc., Flandern, NJ, USA). studies were heterogeneous mainly due to different Statistical analysis. Analysis was done by SPSS. A non Lactobacillus strains used and variations in study protocols. parametrical test for independent samples (U-Mann-Whitney) Selection of probiotic strains for vaginal delivery varied from was performed for each variable examined. well-characterized bacteria isolated from vaginal microbiota Results.TGF-ß values (pg/ml) were higher at T0 in VSL#3 showing strongly antagonistic properties against Gardnerella group (mean: 637 +/- 520 vs 381 +/-143,31, (p<0.006). and vaginalis and other vaginal pathogens to those used in dietary increased significantly at T30 in the VSL#3 group (1754 +/- supplements without marked specificity for vaginal 1151,16) but not in control group (273 +/-53,81) (p<0.001). ecosystems. Also doses of the applied lactobacilli differed IL10: in both groups, there was significant decrease between from study to study by several logarithms. Moreover, only in T0 and T30. No group difference was observed at T0 but at a few trials the presence of the applied lactobacilli in vagina T30, IL10 levels were significantly higher in the VSL#3 group during the observation period was proved by colonization (85+/- 9,81 vs 72 +/-17,93)( p= 0.01).IL-1ß: significantly studies. Protocols of the clinical studies were based on short- higher at T0 in VSL#3 group (284 +/- 448,63 vs 46 +/- 68,01) or long-term application of preparations regardless of (p=0.02). menstrual cycles of the studied women. It is known from Immunoglobulins. IgA and IgM levels were significantly microbiological observations that vaginal microbiota is higher (p<0.05) at T30 and IgG levels were significantly subject to great quantitative changes during and after higher at both T0 and T30 in the milk samples of the VSL#3 menstruation. Our in vitro studies have shown that higher group (p<0.05). Regarding the stool samples, IgM levels estrogen levels increase adherence of the vaginal were significantly higher at T0 and T30 and IgA and IgG were Lactobacillus to vaginal epithelium while those of significantly higher at T30 in the VSL#3 group (p<0.05) progesterone negatively influence these interactions. These data indicate that VSL#3 may be a powerful Successful colonization of the vaginal epithelium in vitro immunomodulator in terms of cytokines and prevented its subsequent colonization with vaginal immunoglobulin production, mostly at mucosal surface. pathogens. Thus, physiological hormonal changes may be a Preliminary experiments also indicate that VSL#3 can factor which probably strongly influences efficacy of vaginal represent a good supplement in the diet of pregnant women. probiotics used to treat or prevent bacterial vaginosis in women at reproductive age. A critical analysis of already OC2.20 published clinical trials with respect to the above mentioned EFFECT OF DIETARY SUPPLEMENTATION OF A LACTOBACILLUS variables will be made in this presentation. PLANTARUM STRAIN IN AN ARTIFICIALLY INDUCED NECROTIZING ENTEROCOLITIS MODEL OC2.19 Castro Erica* [1] , Jofre Jaime [1] , Vera Rodrigo [1] , Monsalvez PROBIOTIC VSL#3 MAY BE EFFECTIVE TO CHANGE THE Elizabeth [1] , Pardo Karen [1] , Aguayo Maria [1] , Soza Francisco [1] , PROFILE OF CYTOCHINES AND IMMUNOGLOBULINS IN Stillfried Nicolas [1] , Medina Rossi [1] , Labra Alan [1] , Montecinos BREAST MILK? Hernan [1] Baldassarre Mariella* [1] , Fanelli Margherita [2] , Tafaro Angela [3] , [1] Universidad De Concepciòn - Concepciòn, Chile Laforgia Nicola [1] [1] Ospedale Policlinico-Neonatology and NICU, University of Bari - Bari , Necrotizing enterocolitis (NEC) is the principal cause of death taly - [2] Dept of Internal Medicin and Public Health, Section of Diagnostic from gastrointestinal disease in premature neonates and is Imaging, Medical Statistics, University of Bari - Bari, Italy - [3] IRCCS associated with long-term complications in surviving Ospedale "S.De Bellis" - Castellana Grotte, Italy patients. The primary focus of research in NEC has shifted to the prevention and treatment of the disease. Our hypothesis Aim of study. To examine the specific effects of maternal proposed that one Lactobacillus plantarum strain could supplementation with the oral probiotic VSL#3 on breast milk decreases the intestinal injuries caused for an artificially health promoting agents (cytokines and immunoglobulins). induced NEC´s model. Patients and methods. 18 healthy pregnant women were The experimental protocol was approved by the Ethical included in the study. Committee of the University of Concepción. Twelve newborn Half of the mothers received daily VSL#3 probiotic (VSL Sprague Dawley pups were used in this study. The Pharmaceuticals, Inc, Towson, MD: sachets containing 900 experimental groups were: i) Control group: Pups artificially billion live lyophilized bacteria of 4 strains of Lactobacillus, fed with infant formula (Similac NeosureTM, Abbott); ii) 40 ORAL COMMUNIC ATIONS 2
Probiotic group: Pups artificially fed with the same infant formula containing 109 CFU/dose of probiotic strain. Each group was fed with 300 µl of food formula every three hours, by using an adapted urethral catheter. All experimental groups were exposed to asphyxia/cold stress, 60 seconds in 100% N2, followed by cold stress 4°C for 10 minutes (twice daily) to develop experimental NEC. At signs of illness or at the end of the experimental period (96 hrs), animals were euthanized and their small intestines carefully removed and evaluated for typical signs of NEC, microbiological and histologically. A standardized scoring system was developed to describe the NEC´s severity. The histological evaluation showed severe damage in both treatments. The entire control group showed transmural necrosis and hereby classified as grade 4. The probiotic group, even if showed severe damage too, the grade of NEC was comparatively lower, given that three probiotic fed pups showed mid or complete villous necrosis and hereby classified as grade 2 and 3. One animal had a complete recovery. The mortality was similar in both groups. SGR were negative and not significantly differences between groups were observed. The LABs counts in the probiotic were higher than the control group (2,76x108 and 2,32x106 CFU/g respectively). We conclude that the artificially induced NEC model was effectively established in all pups, and the probiotic strain slightly decreases the injury´s grade in newborn pups. However, we propose some improvements to our model mainly in apply more effective feeding methods that ensure the correct incorporation of the probiotic in the animals with lesser stress levels. Research financed by INNOVA Chile project 09CN14-5919.
41 posters
P1 P2 INTERFENCES OF A SYMBIOTIC FORMULATION ON A GASTRIC EVALUATION AND GENETIC VALIDATION OF MEDIA SELECTIVE AND INTESTINAL PERMEABILITY IN RATS WITH FOR BIFIDOBACTERIUM EXPERIMENTALLY INDUCED CHRONIC LIVER DAMAGE Rebecchi Annalisa* [1] , Pisacane Vincenza [1] , Callegari Maria L. [1] , Cariello Rita [1] , Tuccillo Concetta [1] , Mazzone Giovanna [2] , Morelli Lorenzo [1] Ribecco Maria Teresa [2] , Federico Alessandro [1] , Iadevaia [1] Centro Ricerche Biotecnologiche- Università Cattolica del Sacro Cuore - Maddalena [1] , De Magistris Laura [1] , D'Argenio Giuseppe* [2] , Cremona, Italy Grossi Enzo [3] , Caporaso Nicola [2] , Loguercio Carmela [1] [1] Dipartimento Medico-Chirurgico di Internistica Clinica e Sperimentale, The selective enumeration of Bifidobacteria is of great interest SUN - Napoli, Italy - [2] Dipartimento di Medicina Clinica e Sperimentale, for the study of intestinal microbiota. During the routine analysis Univ. Federico II - Napoli, Italy - [3] Bracco Spa, Italy the differentiation of bifidobacteria is made difficult by the high presence of lattobacilli. Background & Aim: we have previously reported that liver In our study three selective media for the detection and damage was significantly reduced by treatment with a enumeration of bifidobacteria were compared and evaluated for symbiotic preparation (Lactobacillus paracasei FB, Bracco, their efficiency in the recovery of bifidobacteria from piglet Spa) in a rat model of liver fibrosis induced by CCl4. This effect stools. The used media were: Beerens agar supplemented with was associated with improvement of biochemical parameters nalidixic acid (15mg/ml), Bifidus selective medium (BSM, Fluka) and reduced liver inflammation. supplemented with a mixture of antibiotics and Aim of the present study was to go deeper inside into the Transoligosaccharide propionate agar medium (TOS, Merck) effects of FB on liver fibrosis with particular interest in the modified by addition of mupirocin (50 mg/ml). On Beerens and gastrointestinal permeability. Methods: We examined 10 TOS media the bifidobacteria colonies shown a white/cream Wistar rats with liver fibrosis induced by twice a week CCl4 colour whereas on BSM medium the colonies of bifidobacteria i.p injection for 7 weeks, 10 rats with liver fibrosis treated daily are violet/brown. Supplementation used for all these media with symbiotic FB (200mg/kg/die, by gavage), and 10 normal should inhibit the lactobacilli growth. rats receiving symbiotic treatment alone. A further group of Thirty-five stools samples were tested and 380 colonies were normal rats was considered as control. In all animals gastro- isolated following the indications of the manufacture’s intestinal permeability was assessed by means of multiple instructions. For example on BSM medium only violet colonies probes test (urinary recovery of sucrose-mannitol-lactulose); were picked up. Difference in count number on the three different liver damage and inflammation were documented by routinely media: in particular the Beerens supplemented medium gave the laboratory tests and histology for tissue collagen deposition higher number of colonies (ranging from 108 to 109 cfu/g), was also assessed. Results: The administration of CCl4 around one log less was detected on BSM medium and the lower significantly increased gastric permeability in respect to basal value was obtained on TOS modified medium (ranging from 105 value (p<0.001), while the treatment with FB significantly to106 cfu/g). In order to confirm that isolated colonies belonged decreased it (p<0.01). Unexpectedly, CCl4 reduced intestinal to the Bifidobacterium genera a PCR reaction with primers Bif permeability compared to normal rats, and this reduction was 164-Bif 662 described by Satokari et al. 2001, were performed. even more marked when these rats were treated with On Beerens medium we detected only presence of lactobacilli, on symbiotic preparation. Interestingly, FB administered to BSM and TOS medium colonies of bifidobacteria represented the normal rats significantly reduced intestinal permeability. In 20% and 75 % of the total colonies respectively. Moreover TOS other terms CCl4 induces liver damage without enhancing medium allowed the isolations of several species of bifidobacteria intestinal permeability, that, on the contrary, results lowered indeed after identifications isolated colonies belonged to the by it, and is further reduced by symbiotic treatment. The other following species in order to frequency: Bifidobacterium parameters were all improved by FD treatment. pseudolongum, Bifidobacterium tsurumiense, Bifidobacterium Conclusions. The treatment with CCl4 induces, in rats, a thermophilum, Bifidobacterium choerinum, Bifidobacterium chronic liver damage, and also less known effects, such as thermacidophilum, Bifidobacterium coryneforme. On BSM increase of gastric and decrease of intestinal permeability, medium only the first two species were isolated. On the basis of through mechanisms not well defined. Bacterial translocation our results the TOS medium could be a good candidate for the (BT) is one of the mechanisms involved both in the induction isolation of bifidobacteria from a complex ecosystem such as the and progression of chronic liver disease. BT isn’t synonimus faecal microbiota. of altered intestinal permeability and in course of cirrhosis experimentally induced in rats with CCl4, BT may be due to P3 changes on the surfactant and brush border intestinal IN VITRO PROBIOTIC EVALUATION USING A MICROBIAL membranes, changes in the luminal gut flora, which might ENGINEERING APPROACH WITH THE 3S-ECSIM, A 3- alter adherence to the mucosa, and/or by a significant STAGES ENVIRONMENTAL CONTROL SYSTEM FOR oxidative stress in the intestine that precedes the damage at INTESTINAL MICROBIOTA the cellular level and that affects the mucosal barrier. A David Féria-Gervasio [1] , William Tottey* [1] , Pascal symbiotic such as FB per se modifies gastric and intestinal Vandekerckove [2] , Monique Alric [1] , Jean-François Brugère [1] mucosa, without effects on liver function. In presence of liver [1] ERT-CIDAM - Clermont-Ferrand, France - [2] Lesaffre International Sarl damage, a chronic treatment with this symbiotic formulation - Marcq En Baroeul, France improves liver fibrosis and inflammation and also affects both gastric and intestinal permeability. A microbial engineering approach was applied to evaluate the metabolic impact of probiotics Bacillus subtilis (Bs) and 42 posters
Lactobacillus plantarum (Lp) on the human gut microbiota, bacteria strains that were isolated from food products and using an alternative in-vitro fermentation system called environmental samples. After identification we tested these Environmental Control System for Intestinal Microbiota isolates on lawn of sensitive bacteria (related LAB strains and (ECSIM). This system can simulate the human gut microbiota different species that cause food spoilage). Two strains, a L. under various nutritional and environmental conditions. The plantarum and a L. acidophilus were selected, since these strategy applied to evaluate probiotics using ECSIM showed the strongest inhibition against the most sensitive consisted of the introduction, during microbiota anaerobic strains. In the next step we investigated whether antibacterial metabolism with/without substrate limitation, of a local substrates or pH-lowering activity of organic acids were perturbation by the addition of probiotics, and in the analysis responsible for the inhibition effect. By PCR we could detect of the consequences of such a perturbation on the human the plantaricin gene in four amongst the six isolated L. gut microbiota’s metabolism and structure. The probiotics plantarum. We did not find evidence for the presence of concentration feeding in the bioreactor was set at 2x109 antimicrobial peptides produced by the L. acidophilus, so in CFU/day added once in batch cultures and in continuous flow this case presumably the low pH was the reason of the in the proximal section of the 3S-ECSIM at D=0.004h-1(each inhibition. Production of bacteriocins requires certain probiotic was studied individually). Feeding the cultures with environmental conditions and most likely induction by signal probiotics Bs and Lp led to modifications of the microbial molecules. At the present we are working on the metabolism in-vitro. Results showed a perturbation of the determination of those parameters that affect the metabolism caused by the introduction of two probiotics in biosynthesis of plantaricin. anaerobic batch and continuous culture systems. Differences were observed in the biomass production, specific biomass P5 production, gas production, short chain fatty acids (SCFA) LACOBACILLUS PLANTARUM TENSIA AND LACOBACILLUS and bacteria concentration. Those results were confirmed by PLANTARUM INDUCIA ANTILISTERIAL ACTIVITY IN varying profiles observed with molecular fingerprinting EXPERIMENTAL CHEESE techniques. The probiotics used did not show implantation Rätsep Merle* [1] , Smidt Imbi [2] , Songisepp Epp [1] in the human microbiota in-vitro. However, a decrease of the [1] Bio-Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia - specific biomass and of the gas production was observed in [2] University of Tartu - Tartu, Estonia the presence of both probiotics. The probiotic Bs in cultures without substrate limitation led to a decrease in the short Background: the food-borne illnesses are one of the most chain fatty acids (SCFA) production and also affected the widespread health problems. The most common bacteria that Bacteroides population. On the other hand, in cultures with cause food-borne infections are Salmonella, Listeria and substrate limitation in presence of Lp and Bs, Bacteroides Campylobacter. Some studies show inhibition of these enteric and Bifidobacteria population increased and SCFA observed pathogens by indigenous lactobacilli of human origin and decreased. In conclusion, this microbial engineering probiotic Lactobacillus strains. Objective: the aim was to approach combined with appropriate analytical techniques investigate the influence of Lactobacillus plantarum Tensia DSM provides an alternative and efficient means to study the 21380 and L. plantarum Inducia DSM 21379 as adjunct starters effects of probiotics in the human microbiota in its in Edam-type cheese to the viability of L. monocytogenes and constitution, metabolism and adaptation to environmental SCFA profile. The probiotic strains Tensia and Inducia possess and particularly nutritional changes. strong antagonistic activity against food-borne pathogens in vitro and produce plantaricins. Material and methods: The semi- P4 hard Edam-type cheeses were prepared from cow milk with INVESTIGATION OF ANTIBACTERIAL ACTIVITY OF 0.8-1 % of the precultured starter C92 (CSK Food Enrichment LACTOBACILLUS SPECIES Nederlands) Different additives (adjunct probiotical starter Szen Orsolya* [1] , Pal Karoly [2] , Hilyakne Kadlott Maria [2] , Naar and/or Listeria monocytogenes) were used: one with only Zoltan [2] , Kiss Attila [3] probiotic adjunct (in count of 5 log10CFU/g); with probiotic [1] Egerfood National Knowledge Centre - Eszterhazy Karoly starter and Listeria monocytogenes; and control cheese with College - Eger, Hungary - [2] Eszterhazy Karoly College - Dept. only Listreria monocytogenes (in count of 4-5 log10CFU/g). of Microbiology and Food Technology - Eger, Hungary - [3] Eszterhazy Antilisterial activity of probiotic strains was assessed by viability Karoly College - Dept. of Food Chemistry and Biochemistry - Eger, Hungary of added listeria. The SCFA profile was determined by gas chromatography (HP 6890 Series GC System). Results: The Research of lactic acid bacteria gets more and more attention count of added lactobacilli strains Tensia and Inducia increased from the consumers and producers, as well. In addition to by two logarithms during the four week ripening period. The their well-known effects, some Lactobacillus strains have pH decrease of experimental cheeses was characteristic for that another useful feature: production of antibacterial proteins, type of cheese. Listeria count in cheese with probiotic adjunct which prevent the growth and multiplication of food spoilage was significantly lower (p=0.03) in both probiotic cheeses than Gram-positive bacteria, thus may represent alternatives to in the control cheese No differences were found in SCFA profile artificial preservatives. Lactic acid bacteria are widely used in in experimental cheeses with dfferent additives, but succinic the production of fermented products. The primary use of acid amount was significantly higher (p<0,01) in probiotic lactic acid bacterial strains that might produce bacteriocin- cheese compared to cheeses comprising only listeria. like proteins is to supplement the commonly used starter Conclusions: Both probitic strains have good viablility in cheese cultures in order to produce antimicrobial agents. We environment and are able to sustain the antimicrobial activity investigated the antimicrobial activity of nearly 100 lactic acid in food matrix. 43 posters
P6 P8 LACTOBACILLUS REUTERI IMPROVES THE ERADICATION PROBIOTICS FOR PREVENTION OF NECROTIZING RATE OF HELICOBACTER PYLORI ENTEROCOLITIS IN PRETERM INFANTS Efrati Cesare* [1] , Nicolini Giorgia [1] , Cannaviello Claudio [1] Al Faleh Khaled* [1] , Anabrees Jasim [1] , Bassler D [2] , Al-Kharfi T [1] [1] Ospedale israelitico - Roma, Italy [1] King Saud University - Riyadh, Saudi Arabia - [2] U - Germani, Germany
Several studies report an inhibitory effect of probiotics on Background: Necrotizing enterocolitis (NEC) and nosocomial Helicobacter pylori. In particular, Lactobacillus Reuteri (LR) sepsis are associated with increased morbidity and mortality exerts a competition of binding to glycolipid receptor of and in preterm infants. Through prevention of bacterialmigration suppresses H. pylori urease activity. The aim of this study is across themucosa, competitive exclusion of pathogenic to evaluate whether adding LR to antibiotic therapy may bacteria, and enhancing the immune responses of the host, improve the H. pylori eradication rate. The H. pylori infection prophylactic enteral probiotics may play a role in reducing was diagnosed in 90 adult dyspeptic patients. Patients were NEC and associated. excluded if previously treated for H. pylori infection and if morbidity. Objectives: To compare the efficacy and safety of they were taking PPI, H2-receptor antagonist or antibiotics prophylactic enteral probiotics administration versus placebo in the four weeks preceding the study. Patients were assigned or no treatment in the prevention of severe NEC and/or sepsis to receive one of the following therapies: (a) 7- day triple (PPI in preterm infants. Methods: Searches were made of plus clarithromycin and amoxicillin or metronidazole) plus MEDLINE (1966 to October 2010), EMBASE (1980 to October LR supplementation during the antibiotic treatment; (b) 7- 2010), CENTRAL (Cochrane Library, Issue 2, 2010), and day triple plus LR supplementation after the antibiotic abstracts of annual meetings of SPR (1995 to 2010). treatment; (c) sequential regimen (5-day PPI plus amoxicillin Only randomized or quasi-randomized controlled trials that therapy followed by a 5-day PPI, clarithromicin and enrolled preterm infants < 37 weeks gestational age and/or tinidazole) plus LR supplementation during the antibiotic < 2500 g birth weight were considered. Trials were included treatment; (d) sequential regimen plus LR supplementation if they involved enteral administration of any live microbial after the antibiotic treatment. Successful eradication therapy supplement (probiotics) and measured at least one was defined as a negative UBT performed at least 4 weeks prespecified clinical outcome. Standard methods of the following the eradication treatment. Eighty-three patients (30 Cochrane Collaboration and its Neonatal Group were used to males and 53 females; mean age 57 ± 13 years) completed assess the methodologic quality of the trials, data collection the study. Nineteen patients were administrated a 7-day triple and analysis. Results Sixteen eligible trials randomizing 2842 treatment: 11 with LR supplementation during and 8 after infants were included. Included trials were highly variable therapy. Sixty-four patients were administered sequential with regard to enrollment criteria (i.e. birth weight and regimen: 32 with LR supplementation during and 32 after gestational age), baseline risk of NEC in the control groups, therapy. At the end of the study, the whole eradication rate timing, dose, formulation of the probiotics, and feeding with the LR supplementation was 82% versus 74-76 % regimens. Data regarding extremely low birth weight infants reported in literature without probiotics. Furthermore, in our (ELBW) could not be extrapolated. In a meta-analysis of trial population the eradication rate was significantly higher in the data, enteral probiotics supplementation significantly reduced sequential group compared with the 7-day triple (88 % vs 63 the incidence of severe NEC (stage II or more) (typical RR %; p = 0.01). The results of our study confirmed that as the 0.35, 95% CI 0.24 to 0.52) and mortality (typical RR 0.40, first-line, the sequential therapy seems more efficiency than 95% CI 0.27 to 0.60). There was no evidence of significant standard 7-day, in the H.pylori eradication. The LR reduction of nosocomial sepsis (typical RR 0.90, 95% CI 0.76 supplementation appears improve the H.pylori eradication to 1.07). The included trials reported no systemic infection rate, although large, double-bind, controlled studies are with the probiotics supplemental organism. The statistical needed to confirm these results. test of heterogeneity for NEC, mortality and sepsis was insignificant. Conclusions: Enteral supplementation of P7 probiotics prevents severe NEC and all cause mortality in LACTOBACILLUS RHAMNOSUS LR06 DSM 21981, preterm infants. Our updated review of available evidence LACTOBACILLUS PENTOSUS LPS01 DSM 21980, supports a change in practice. More studies are needed to LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND assess efficacy in ELBW infants and assess the most effective LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII formulation and dose to be utilized. LDD01 DSM 22106 IN VITRO STRONGLY INHIBIT DIFFERENT ESCHERICHIA COLI SEROTYPES, INCLUDED E. COLI P9 O157:H7 QUANTIFICATION OF LACTIC ACID AND ENTERIC BACTERIA Del Piano M.* [1] , Strozzi G.P. [2] , Deidda F. [3] , Allesina S. [3] , BY MEANS OF QPCR Barba M. [3] , Soattini L. [4] , Sforza F. [4] , Mogna G. [2] Pal Karoly* [1] , Szen Orsolya [2] , Naar Zoltan [1] , Kiss Attila [3] [1] Gastroenterology Independent Operating Unit, Maggiore della Carità [1] Eszterhazy Karoly College, Dept. of Microbiology and Food Technology Hospital, Novara, Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab - Eger, Hungary - [2] Eszterhazy Karoly College, EGERFOOD Regional Research Srl, Novara, Italy - [4] Casa di Cura I Cedri, Novara, Italy Knowledge Centre, Eger, Hungary - [3] Eszterhazy Karoly College, Dept. of Food Chemistry and Biochemistry - Eger, Hungary
Beneficial features of probiotic bacteria have been well known since Metchnikoff published his results one hundred years 44 posters ago. However, a couple of decades elapsed until the industry the end of follow-up (P < .02 and P < .001, respectively). discovered the potential in the production of probiotic CONCLUSIONS: Lactobacillus GG was superior to placebo in products, and nowadays the probiotic industry is blooming. the treatment of recurrent abdominal pain in children, LGG Discovery of prebiotics boosted the use of probiotic microbes significantly reduces the frequency and severity of functional and the most innovative food products try to combine the abdominal pain and may help relieve such symptoms as advantageous effects of these ingredients. perceived abdominal distention. In order to have the proper effect, probiotic bacteria must be present in the colon in an adequately high number. P11 Enumeration of microbes is traditionally made by the IN VITRO EFFECT OF FOUR NOVEL FLOURS FERMENTATION traditional microbiological method, on selective plates. ON GUT MICROBIOTA PARAMETERS Though this technique is very efficient, it might be time Chitarrari Roberto* [2] , Carnevali Paola [3] , Costabile Adele [2] consuming, depending on the species. - [2] Food Microbial Sciences, School of Food and Nutritional Sciences, Our aim was to adapt existing species-species primers and University of Reading - Reading, United Kingdom - [3] Barilla G. e R. a TaqMan probe for quantitation of four bacteria. These Fratelli - Parma, Italy species were used as model organisms and cultivated in two ways: in the presence of and without various substances (e.g. The prebiotic concept has attracted much interest as an inulin, a prebiotic ingredient). In our experiments we used approach for the modulation of the colonic microbiota. The three bacteria, which probiotic strains are present in pills and aim of the present study was to evaluate the potential food supplements (Bifidobacterium bifidum, Enterococcus prebiotic properties of four novel selected flours (wholegrain faecium, Lactobacillus acidophilus) and the Escherichia coli, rye -WR, nutriwheat -NW, pulses -PS, 50% lentils + 50% as member of the normal human colon flora. We isolated chickpeas and barley milled grains -BMG) using in vitro DNA from the bacteria by three different kits, in order to human gut models, which represent different anatomical compare the efficacy of the two basic DNA extraction areas of the large intestine. Prior to introduction into the gut methods (precipitation vs. adsorption on column). model, the test ingredients were currently being digested The precipitation based kit was efficient in those cases where under conditions that resemble the gastric (HCl, pepsin) and floating particles were present in the liquid cultivation small intestinal (bile salts, pancreatic enzymes) medium, because the sediment occluded the column at environments, at appropriate pH and incubation times. centrifugation. The other two kits resulted clean DNA in a Studies on the development of the microbiota in the gut shorter time, but only from those suspensions, which did not models have been performed and bacteria identified by contain supplementing substances as floating particles. molecular characterization techniques (FISH). Short chain The PCR based identification and quantification of bacteria fatty acids (SCFAs), as principal end products of gut bacterial was made by primers that were available in the literature. We metabolism, have been measured along with a quantitative managed to identify and quantify the E. coli, but we need to assessment of predominant microbiota. Furthermore, we do more experiments and optimization to get the same result investigated the impact of the tested carbohydrates on the with the other three bacteria, however, we got reassuring growth and survival of the human colon carcinoma cell line results up to now. HT29 using the growth curve assay. No statistically The expected result of our work is the elaboration of such a significant cytotoxicity effects were observed for each tested quick and reliable practical method that can at least partially flours. Significant results were observed in modulation of the replace the work- and time-consuming microbiological overall composition of the gut microbiota and on the overall technique and might be used for validation of it. SCFA production. In this context the results of our study on This research was financed by Egerfood Ltd. and the NKTH the four selected flours provided new insight into potential research program. changes undergone due to digestion and fermentation in the gastrointestinal tract. We demonstrated that WR and NW P10 showed higher prebiotic properties compare to PS and BMG. THE USE OF LACTOBACILLUS GG IN CHILDREN WITH In details, both WR and NW caused an increase of FUNCTIONAL ABDOMINAL PAIN: A DOUBLE-BLIND bifidobacteria, lactobacilli and Desulfovibrionales, whereas a RANDOMIZED CONTROL TRIAL different shift in microbial metabolism was observed by an Sabbi Tamara* [1] , Palumbo Massimo [1] increase in the concentration of acetate and propionate [1] Belcolle Hospital Viterbo - pediatric unit, Italy respectively. In conclusion, this study provides findings supporting the utilization of WR and NW for the production OBJECTIVE: To determine whether oral administration of the on new functional food as pasta and bakery products. probiotic Lactobacillus GG under randomized, double- However, in order to classify these flours as prebiotic, human blinded, placebo-controlled conditions would improve studies are necessary to prove that these ingredients symptoms of recurrent abdominal pain in children. withstands digestion in the upper gastrointestinal tract and PATIENTS AND METHODS: 61 children with functional has a selective effect within faecal microbiota. abdominal pain were given Lactobacillus GG or placebo for 6 weeks and entered follow-up for 4 weeks. Children entered a randomized, double-blind, placebo-controlled trial. RESULTS: LGG, but not placebo, caused a significant reduction of both frequency (P < .01) and severity (P < .01) of abdominal pain. These differences still were significant at 45 posters
P12 quantities of quercetin and possibly myricetin and kaempferol SURVIVAL OF LACTOBACILLUS RHAMNOSUS LR06 DSM are absorbed in the gut. A larger fraction probably remains 21981, LACTOBACILLUS PENTOSUS LPS01 DSM 21980, in the lumen, and thus a substantial proportion of the LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND gastrointestinal mucosa is exposed to biologically significant LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII concentrations of these compounds. Until recently the major LDD01 DSM 22106 IN DIFFERENT PARTS OF THE DIGESTIVE focus of interest in flavonoids has been their putative TRACT OF PATIENTS CHRONICALLY TREATED WITH PPI antioxidant properties in the plasma, but other biological Del Piano M.* [1] , Ballarè M. [1] , Pagliarulo M. [1] , Anderloni A. [1] , effects at the cellular level are now receiving greater attention Balzarini M. [1] , Orsello M. [1] , Carmagnola S. [1] , Tari R. [1] , and may yet turn out to be even more important. This aspect Deidda F. [3] , Allesina S. [3] , Barba M. [3] , Strozzi G.P. [2] , of polyphenolic biochemistry is particularly relevant to the Mogna G. [2] , Mogna L. [2] , Sforza F. [4] alimentary tract because the mucosal surfaces of the gut are [1] Gastroenterology Independent Operating Unit, Maggiore della Carità the most rapidly proliferating epithelial cells in the human Hospital, Novara, Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab body. In this context, it needs to be critically evaluated Research Srl, Novara, Italy - [4] Casa di Cura I Cedri, Novara, Italy whether positive properties of flavonoid-rich diets can be replaced by purified flavonoids as dietary supplements. Plant P13 sources of flavonoids contain a complex mixture of STRUCTURAL CHARACTERIZATION OF CHONDROITIN secondary plant metabolites and not only flavonoids per se. SULFATE FROM ITALIAN CHEESE PARMIGIANO REGGIANO Like the flavonols, catechins are biologically active and Coppa Giovanni [1] , Maccari Francesca [2] , Zampini Lucia [1] , abundant in commercially relevant food products such as Santoro Lucia [1] , Galeazzi Tiziana [1] , Gabrielli Orazio [1] , green tea. Unabsorbed catechins may exert biologically Volpi Nicola* [2] important effects on the metabolism of the colonic [1] Polytechnic University of the Marche, Ospedali Riuniti, Presidio Salesi - microflora. Cathechins have also been positively involved in Ancona, Italy - [2] University of Modena and Reggio Emilia - Modena Italy a number of lipid metabolic pathways especially in obese subjects. We conducted a study to ascertain whether an high- Chondroitin sulfate (CS) was purified for the first time from purity green tea extract [decaffeinated Camellia sinensis leaf Italian cheese Parmigiano-Reggiano and analyzed to evaluate extract std. to 98% polyphenols by UV (710.5 mg), 45% its structure and properties. Two main polysaccharides were EGCG by HPLC (326.25 mg), Mega Green Tea, LEF, USA] identified as CS, ~72%, and fast moving-heparin/heparan could affect body fat accumulation in normal-weight healthy sulfate, ~28%. Quantitative analyses yielded ~1.5-3.0 µg of rats fed a regular diet. Green tea extract-supplemented rats total GAGs per gram of Parmigiano-Reggiano (0.15-0.30%). showed a significant lower body weight increase while By means of specific chondroitinases and HPLC separation showing an increased fluid intake. Green tea extract of generated unsaturated disaccharides, CS was found to be supplementation brought about also a significant decrease composed of ~9% on nonsulfated disaccharide, ~26% of of either hepatic and mesenteric lipid content together with disaccharide monosulfated in 6 of the GalNAc, ~65% of lower triglyceride and cholesterol liver, but not plasma, level. disaccharide monosulfated in 4 of the GalNAc, with a charge However, these rats showed a significant decreased plasma density of ~0.91 and a 4/6-sulfated ratio of 2.45. The ratio of level of total bile acids. These preliminary data further enforce 4/6 sulfated residues was confirmed by 13C-NMR the prospective clinical application towards a pro-active experiments. Chondroitinase B confirmed that the purified healthy-promoting approach of medicine. Parmigiano-Reggiano CS contained mainly GlcA (~94%) as uronic acid. PAGE analysis showed a CS having a molecular P15 mass with an average value of 15400. Along with other SUPP LEMENTATION WITH LACTOBACILLUS HELVETICUS AND possible functions, such as glycomimetic playing a role as BIDIFOBACTERIUM LONGUM INDUCED IMMUNOLOGICAL soluble receptors able to inhibit the binding of different CHANGES IN MODERATE MALNOURISHED ELDERLY pathogens to the intestinal mucosa, CS may perform a SUBJECTS prebiotic role compared to other well known complex Finamore Alberto* [1] , Roselli Marianna [1] , Brasili Elisa [1] , oligo(poly)saccharides such as inulin, fructo- and isomalt- Donini Lorenzo M [2] , Neri Barbara [3] , Carnevali Paola [4] , oligosaccharides. Studies are in progress to deeply Mengheri Elena [1] understand the physiological role of complex [1] National Research Institute on Food and Nutrition (INRAN) - Roma, Italy glycosaminoglycans and CS in human and bovine milks and - [2] Sapienza University - Rome , Italy - [3] Villa delle Querce Rehabilitation derivatives. Institute - Nemi, Italy - [4] Barilla G&R f.lli SpA - Parma, Italy
P14 The immune system undergoes age-associated alterations, FLAVONOIDES AND GASTROINTESTINAL TRACT: FROM THE termed immunosenescence, which is a process where some BENCH TO CLINICAL PERSPECTIVES functions are reduced, others unchanged or increased. Aging Marotta Francesco* [1] , Tomella Claudio [1] , Polimeni Ascanio [1] , is also characterized by changes in gut microbiota with a Joyal Steven [2] decrease of probiotic bacteria. The principal mechanism of [1] ReGenera Res Group - Milano, Italy - [2] Life Extension Foundation - Ft. the probiotic protective activity is the immunomodulation. Lauderdale, USA Based on these considerations, probiotic supplementation has been suggested to improve the immunosenescence and There is increasing interest in the potential health benefits of promising results have been obtained up to now, although dietary flavonoids. Recent evidence suggests that significant some studies reported contrasting results on the 46 posters effectiveness of probiotics, depending on several factors probiotic bacteria to remove cyanotoxins, such as including probiotic strain, dose, time of treatment, and microcystins, from aqueous solutions. Furthermore, the physiological conditions of elderly. removal process was investigated by testing the hypothesis In this study we assessed whether of Lactobacillus helveticus of enzymatic degradation of microcystin-LR in the presence Bar13 and Bifidobacterium longum Bar33 could improve the of probiotic lactic acid and bifidobacterial strains and the immune function of moderate malnourished elderly. A participation of a proteolytic system in the toxin removal. randomized placebo controlled study was conducted on Specific strains of probiotic bacteria, including Lactobacillus hospitalized elderly aged 75 ? 11.1 years with a moderate rhamnosus, Bifidobacterium lactis and Bifidobacterium malnutrition (BMI < 17 Kg/m2), that received daily a biscuit longum, were studied. containing L. helveticus and B. longum (109 CFU each; A maximum removal of 70-90% of microcystins was provided by Barilla) or the same product without probiotics observed (100 µg toxin/L, 1E+10 CFU/mL, 37°C, 24 h). The as placebo, for 30 days. Peripheral blood lymphocyte subsets removal of microcystins was shown to be dependent on were analyzed by cytofluorimetric assay. After the probiotic temperature, bacterial cell density and cell viability. The supplementation, the main changes occurred in the female results suggest that extracellularly located cell-enveloped population, where naïve T cells (CD4+CD45RA+CCR7+) proteinases are involved in the decomposition of increased, whereas central memory T (CD4+CD45RA- microcystins. In particular, a correlation between proteolytic CCR7+), effector memory T (CD4+CD28-CD95+), and naïve activity and microcystin removal was found. In addition, CD8+ CD28+ cells decreased. In the male population only a EDTA, which was indicated as a main inhibitor of proteinases decrease in effector memory T cells was found. A strong of the investigated strains, was shown to limit the rate of induction of Treg (CD4+CD25+CD127-) was observed in both microcystin removal. females and males. In conclusion, L. helveticus and B. Toxin removal by probiotic bacteria may open new longum were able to improve the immunosenescence by opportunities for detoxification and decontamination of reducing age-induced changes in lymphocyte subpopulations microcystin-contaminated water and also to provide human and increasing Treg cell population which may contribute to health protection by eliminating toxins from the improve the defense against the age associated inflammatory gastrointestinal tract. diseases. This work was supported by an Italian grant from MiPAAF, project Qualifu (Alieta) P18 PROBIOTIC LACTOBACILLUS RHAMNOSUS LGA UPREGULATES P16 SS-DEFENSIN 9 EXPRESSION IN CULTURED CHICKEN CAN LACTOBACILLUS RHAMNOSUS LR06 DSM 21981, SMALL INTESTINAL EPITHELIAL CELLS LACTOBACILLUS PENTOSUS LPS01 DSM 21980, Li Guanhong* [1] , Liu Siguo [2] , Hong Zhimin [1] , Jia Yongjie [1] , LACTOBACILLUS PLANTARUM LP01 LMG P-21021 AND You Jinming [1] , Qu Minreng [1] LACTOBACILLUS DELBRUECKII SUBSP. DELBRUECKII [1] College of Animal Science and Technology, Jiangxi Agricultural LDD01 DSM 22106 RESTORE THE “GASTRIC BARRIER University - Nanchang, China - [2] Harbin Veterinary Research Institute EFFECT” IN PATIENTS CHRONICALLY TREATED WITH PPI? of Chinese Academy of Agricultural Sciences - Harbin, China Del Piano M.* [1] , Ballarè M. [1] , Pagliarulo M. [1] , Anderloni A. [1] , Balzarini M. [1] , Orsello M. [1] , Carmagnola S. [1] , Tari R. [1] , The avian beta-defensin 9 (AvBD9), an inducible antimicrobial Deidda F. [3] , Allesina S. [3] , Barba M. [3] , Strozzi G.P. [2] , peptide expressed in the epithelial cells of chicken small Mogna G. [2] , Mogna L. [2] , Sforza F. [4] intestine, plays an important role in maintaining the [1] Gastroenterology Independent Operating Unit, Maggiore della Carità homeostasis of gastrointestinal microflora and intestinal Hospital, Novara, Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab immune system. The probiotic Lactobacilli, predominantly Research Srl, Novara, Italy - [4] Casa di Cura I Cedri, Novara, Italy clonized in the chicken small intestine, interact with epithelial cells and can modulate the physiological function of the P17 epithelial cells. We hypothesize that the probiotic Lactobacilli CHARACTERISATION OF THE CYANOBACTERIAL TOXIN could stimulate the antimicrobial peptides expression during REMOVAL PROCESS IN THE PRESENCE OF PROBIOTIC the Lactobacilli-epithelial cell interaction. However, there have BACTERIA been no studies regarding the effects of Lactobacilli-epithelial Nybom Sonja* [1] , Dziga Dariusz [2] , Salminen Seppo [3] , cell interactions on the antimicrobial peptide expression in Meriluoto Jussi [1] chicken. [1] Åbo Akademi University/Department of Biosciences - Turku, Finland - Probiotic Lactobacillus rhamnosus LGA (L. rhamnosus LGA) [2] Jagiellonian University - Krakow, Poland - [3] University of Turku - was selected to investigate the effects of lactobacillus stimuli Turku, Finland on the AvBD9 mRNA expression in cultured chicken small intestinal epithelial cells. The time-and dose-response of Toxic cyanobacteria have been reported in lakes and AvBD9 gene expression upon stimulation of epithelial cells reservoirs in several countries. The presence of toxins in with L. rhamnosus LGA was also examined. The AvBD9 drinking water creates a potential risk of toxin transference mRNA expression was determinted by fluorescence for water consumers. Besides chemical and physical quantitative PCR. AvBD9 expression was upregulated by methods of cyanotoxin removal from water and raw materials stimulation of L. rhamnosus LGA at different concentrations for food industry, biodegradation methods should be (2×105 cfu/ml, 2×106 cfu/ml, 2×107 cfu/ml), and expression proposed. difference was observed between treatments at three The aim of the current study was to assess the ability of bacterial concentrations. Heat-inactivated L. rhamnosus LGA 47 posters also stimulated the expression of AvBD9, and showed the strain possessed tet(K) and tet(M) genes. stronger induction response than live bacteria (P<0.05). The L. plantarum TENSIA did not produce potentially harmful BA. L. rhamnosus LGA promoted AvBD9 mRNA transcription in In animal model no translocation of administrated strain or time-dependent manner. The AvBD9 mRNA expression other microbes into blood or organs of mice was detected. peaked at 12 h of incubation upon treatment of epithelial cells No harmful impact on body mass index, inflammatory with lactobacillus. AvBD9 peptide was detected by Western markers or serum lipidogram was registered during human blot in the supernatants of cultured epithelial cells treated trials in daily dose of 2x1010 CFU or 1.5x 108 CFU per with L. rhamnosus LGA, indicating that AvBD9 peptide serving for 3-weeks. releases into extracellular medium and exerts bactericidal No negative impact on gastrointestinal welfare was registered action. Probiotic L. rhamnosus LGA stimulates AvBD9 but the consumption of 100g/d for 3 weeks caused hard expression in the epithelial cells of chicken small intestine stools from the second week of the trail. The content of total during lactobacillus-epithelial cell interaction. This study lactobacilli increased in feces and the presence of ingested revealed the new possible functional mechanism by which probiotic strain was confirmed after consumption of cheese. the probiotic Lactobacilli exert their beneficial effects to the Thus, L. plantarum strain TENSIA strain did not harbor any host through the antimicrobial peptide expression in the undesirable characteristic. The regular semi-hard Edam-type small intestinal epithlium, which will contribute to further cheese (fat content 26%) with probiotic additive in daily dose studies and understanding on the molecular mechanism of 50 g or in excess (100 g) and with probiotic daily dose of underlying the modulation of intestinal function by probiotics. 1010 CFU during 3-weeks is was proved to be safe. P19 P21 SELENIUM AND ZINC INTERNALIZED BY LACTOBACILLUS EFFECT OF LAB ON CYTOKINE SECRETION BY THP-1 CELLS BUCHNERI LB26 DSM 16341 AND BIFIDOBACTERIUM STIMULATED BY LPS LACTIS BB1 DSM 17850: DEVELOPMENT OF A NEW Hacin Biljana* [2] , Citar Manuela [2] , Tompa Gorazd [1] , Rogelj Irena [1] BIOLOGICAL METHOD TO EVALUATE THE BIOAVAILABILITY [1] University of Ljubljana - Ljubljana, Slovenia - [2] Medis, d.o.o., OF THE TWO MINERALS Ljubljana, Slovenia Pane M.* [2] , D'Andrea M. [3] , Nicola S. [3] , Strozzi G.P. [2] , Mogna G. [2] , Del Piano M. [1] Inflammatory bowel syndrome is regarded as a chronic [1] Gastroenterology Independent Operating Unit, Maggiore della Carità illness that can dramatically affect the quality of a sufferer's Hospital, Novara, Italy - [2] Probiotical SpA, Novara, Italy - [3] Biolab life. Lactic acid bacteria have shown to alleviate the syptoms Research Srl, Novara, Italy of IBD presumably due to their anti-inflammatory properties. To investigate the role of cytokines in interactions between P20 lactic acid bacteria and the immune system, production of SAFETY OF A PROBIOTIC CHEESE COMPRISING L. TNF-a and IL-6 by THP-1 cells after stimulation with LPS, PLANTARUM TENSIA ACCORDING VARIETY OF HEALTH lactic acid bacteria or both was measured. INDICES IN DIFFERENT AGE GROUPS Lactobacillus gasseri K7, a strain of human origin, was Songisepp Epp* [1] , Hütt Pirje [2] , Rätsep Merle [1] , Shkut Elena previously found to exhibit several probiotic properties such [1] , Zilmer Mihkel [2] , Kõljalg Siiri [2] , Truusalu Kai [2] , Smidt as survival in simulated conditions of the gastrointestinal Imbi [2] , Kolk Helgi [2] , Zagura Maksim [3] , Mikelsaar Marika [2] tract, antimicrobial activity, adhesion to porcine intestinal [1] Bio-Competence Centre of Healthy Dairy Products LLC - Tartu, Estonia mucosa ex vivo, as well as adhesion to human and porcine - [2] University of Tartu - Tartu, Estonia - [3] Tartu University Clinics - Tartu, mucus and Caco-2 cell line in vitro. Additional investigation Estonia of its anti-inflammatory properties will further establish the probiotic properties of the strain. Due to their well known Safety of L. plantarum TENSIA (DSM 21380) was tested in probiotic effects including modulation of immune response, vitro, in composition of semi-hard cheese, in an animal Lactobacillus casei DN 114 001 and Bifidobacterium animalis model and in human intervention studies with different age subsp. lactis BB12 were used as positive controls. groups. THP-1 cells were grown in RPMI medium supplemented with The susceptibility of L. plantarum TENISA to 8 antibiotics, FBS and antibiotics. Prior to the experiment the cells were presence of tet (M, S, O, K, L) genes and class 1 integron stimulated with PMA (phorbol ester) for 48 hours to induce was assessed by E-test and PCR methods. Production of differentiation into macrophages. biogenic amines (BA) in decarboxylation medium with 1% of Cells were then incubated either with selected lactic acid L-histidine, L-glutamine, L-ornithine, L-arginine or L-lysine bacteria (DN 114 001, K7 or BB12), LPS (lipopolysaccharides and in cheese was tested by gas chromatograph. The bio- of E. coli O111:B4) or combination of LPS and LAB. Samples safety of L. plantarum TENSIA was evaluated on NIH line of the cell line supernatant were collected after 2, 4, 6, 8, 12 mice fed with probiotic cheese comprising TENSIA in and 24 hours of incubation to determine cytokine production concentration of 4x 109 CFU/g for 30 consecutive days. (ELISA). In human trials in adults and elderly the impact of different High concentrations of TNF-a in the THP-1 cell supernatant doses of Edam-type cheese and probiotic strain on body could already be measured after 2h of incubation and high weight, gut functionality indices and host metabolism was levels of IL-6 were measured after 4h of incubation with LPS. evaluated. The strain TENSIA was susceptible to all tested When LPS and LAB were applied simultaneously, LAB antibiotics, did not possess tetracycline resistance genes reduced the concentration of inflammatory cytokines tet(L), tet(S) and tet(O) nor contained the IntI gene. However, measured. 48 posters
THP- 1 cell line macrophages stimulated with LPS proved to Severity of AD was determined by SCORAD and blood was be a good model for assessing cytokine release and could be drawn at study entry, 1, and 3 months. Immunoglobulin- used as a tool for screening anti-inflammatory properties of secreting cells by ELISPOT and the proportions of B cells various LAB strains. (CD19+) and memory B cells (CD27+) among peripheral blood leukocytes by flow cytometry were determined. Data P22 were analyzed by ANCOVA adjusted for baseline. SLOW RELEASE EFFERVESCENT TABLETS WITH L. Results: Baseline characteristics were similar between FERMENTUM LF10 DSM 19187 AND L. ACIDOPHILUS LA02 groups, including age at onset of AD and at study entry, G. Mogna [1] , F. Deidda [2] , S. Allesina [2] , M. Pane [2] , M. Barba [2] , mode of delivery, and duration of breastfeeding. There were M. D’Andrea [2] , P. Lorenzini [2] , S. Nicola [2] , E. Raiteri [2] , G.P. no significant differences in SCORAD between the two Strozzi [1] , L. Mogna [2] , F. Vicariotto [3] groups during the study. However, the greatest mean [1] Probiotical SpA - Novara, Italy - [2] Biolab Research Srl - Novara, Italy [3] - decrease in SCORAD occurred at 1 month in the H-LGG [from Department of Obstetrics and Gynecology, San Pio X Hospital - Milan, Italy 27.9 (95%CI 22.3–33.5) to 17.6 (95%CI 10.6–24.6)] and at 3 months in the Control group [from 30.2 (95%CI 23.6–36.8) Candida is an opportunistic fungus that normally inhabits the to 17.8 (95%CI 10.3–25.3)]. The proportions of IgA- and IgM-secreting cells decreased mouth, throat, gastrointestinal tract and vagina, but Candida significantly in the H-LGG group (Figure); the baseline- overgrowth can cause infections such as candidiasis and adjusted ratios for H-LGG vs. Control at 1 month were 0.59 thrush. Both physiological and pathological affections can lead (95%CI 0.36–0.99, P = 0.044) for IgA- and 0.53 (95%CI to mucosal microbiota imbalance, conditioning the growth of 0.29–0.96, P = 0.036) for IgM-secreting cells. The opportunistic “putrescent flora”. The composition of vaginal proportions of CD19+CD27+ B cells increased in H-LGG but microflora is known to be critical for woman‘s health and not in the Control group. wellbeing. In a healthy vagina, the dynamic micro-environment Figure. Ig-secreting cells in peripheral blood may reflect is mainly composed of “Döderlein’s bacilli”, which generally lower antigen uptake in H-LGG group Conclusion: A comprise different species of lactobacilli. Imbalance of the hydrolyzed formula with LGG may strengthen gut barrier, vaginal microbiota leads to a prevalence of opportunistic thus reducing antigen uptake and immunoglobulin secretion, microrganisms that may cause vaginitis or forms of vaginosis. potentially causing faster immune maturation and symptom It is known from literature that some lactic acid bacteria have resolution in infants with intrinsic AD. the capacity to inhibit the overgrowth of Candida spp. The aim of this in vitro study was to evaluate the ability of an innovative dosage form of effervescent tablets releasing CO2, containing two select probiotics, L. fermentum LF10 and L. acidophilus LA02, to inhibit different species of Candida and putrescent opportunistic flora. In particular, L. fermentum LF10 DSM 19187 has shown a strong in vitro antimycotic activity against different Candida biotypes. L. acidophilus LA02 DSM 21717 may help to rebalance the microbial vaginal flora. Lactobacilli with antimycotic activity in the form of innovative effervescent tablets which release CO2 may represent a new effective tool for long term treatment of altered microflora in the vaginal lumen. P23 SYMPTOM RESOLUTION AND IMMUNE MATURATION IN INFANTS WITH ATOPIC DERMATITIS RECEIVING HYDROLYZED FORMULA WITH LACTOBACILLUS GG (LGG) Nermes Merja [1] , Salminen Seppo [1] , Isolauri Erika* [1] [1] University of Turku - Turku - Finland P24 THE GLOBAL PHENOTYPIC ANALYSIS OF PUTATIVE Background: Gradual intestinal colonization promotes ANTIALLERGIC POTENTIAL OF THREE LACTOBACILLUS maturational events in the gut barrier. Abnormal barrier STRAINS function in atopic dermatitis (AD) could lead to a vicious circle Aleksandrzak-Piekarczyk Tamara* [1] , Koryszewska-Baginska of sensitization to antigens and further barrier compromise. Anna [1] , Bardowski Jacek [1] We previously showed that LGG enhances gut barrier and [1] Institute of Biochemistry and Biophysics Polish Academy of Sciences hastens recovery of symptoms in infants with AD and - Warsaw, Poland challenge-proven food allergy (FA). This study assesses the effect of LGG on antigen absorption and symptom resolution The increase in incidence of allergy in the last few decades in intrinsic AD not related to FA. Methods: In a double-blind has been linked to the high hygienic standards connected to randomized study, 39 infants with AD received extensively a reduced microbial stimulation of the mucosal immune hydrolyzed casein formula (Nutramigen®) with (H-LGG, system. Hence, this demands the development of new n=19) or without (Control, n=20) LGG 5.0 x 107 cfu/g for 3 prevention strategies to inhibit the rapidly increasing months. prevalence of allergic diseases. 49 posters
There is much evidence concerning the role of probiotics in by literature. The use of cranberry fulfils these needs by the prevention and therapy of allergic diseases. Various potentially replacing or enhancing traditional procedures. The strains of lactic acid bacteria (LAB), especially lactobacilli and purpose of this study was to assess the effectiveness of bifidobacteria, are considered as probiotics and have been cranberry in preventing UTI in pediatric populations. We reported to suppress the allergic reactions. Recently, two searched PUBMED, the Cochrane Central Register of strains of Lactobacillus casei LOCK 0900 and LOCK 0908 and Controlled Trials and Internet. Cranberry in patients with one strain of Lactobacillus paracasei LOCK 0919 were previous UTI was evaluated in three studies, cranberry in selected according to their antagonistic activity against patients with VUR in three studies and four studies analyzed pathogenic bacteria, tolerance to low pH and bile acids the efficacy of cranberry in children with NB. In seven of nine (demonstrated by Cukrowska et al. 2009). Preliminary studies cranberry had a significant effect in preventing UTI. studies have shown that ingestion of that the mixture of L. References Fanos V, Atzei A, Zaffanello M, Piras A, Cataldi L casei LOCK 0900, L. casei LOCK 0908 and L. paracasei LOCK 2006. Cranberry and prevention of urinary tract infections in 0919 strains affects the immune system by inducing TH1 and children. J Chemother 3: 21-24. Dessì A, Atzei A, Fanos V. regulatory cytokine production and by suppressing pro- 2010. Cranberry in pediatria: efficacia clinica e revisione della allergic response (Cukrowska et al. 2010). letteratura. SILAE - Abstract Book of XIX Congress “Fernando In this work, we present an additional phenotypic Cabieses Molina” - ISBN: 88-8160-218-0; 56-57. Keywords: characterization, as it is considered to be essential in better Cranberry, UTI, VUR, pediatrics, children, neurogenic bladder. defining the role and use of specific probiotics Lactobacillus strains. Using Biolog Phenotype Microarrays we investigated, P26 which of metabolic substrates (various carbon and nitrogen LACTOBACILLUS SPP. STRAINS OF CULTURE COLLECTION sources) could or could not be used by these Lactobacillus OF TARTU UNIVERSITY, ESTONIA strains. The same technique was used to examine the Štšepetova Jelena* [1] , Rööp Tiiu [1] , Mändar Reet [1] , Sepp Epp [1] , response of tested strains to various osmolytes and pH. Mikelsaar Marika [1] Furthermore, API ZYM (BioMerieux) test was used to [1] University of Tartu - Tartu, Estonia complete phenotypic identification as each strain was examined for 19 enzymatic reactions. Culture collection of Lactobacillus spp. isolates (more than Cukrowska B., Motyl I., Kozáková H., Schwarzer M., Górecki 1000, LB) of University of Tartu, Estonia has been established R.K., Klewicka E., Slizewska K., Libudzisz Z.: Probiotic in 1994. LB were collected from fecal samples of healthy and Lactobacillus strains: in vitro and in vivo studies. Folia diseased infants, children, adults, elderly persons during 8 Microbiol. 54, 533–537 (2009). different projects (1994-2009). First level of testing of LB Cukrowska B., Rosiak E., Klewicka E., Motyl I., Schwarzer M., includes in house preliminary identification by specific colony Libudzisz Z., Kozáková H.: and cell morphology, gram-positive, catalase negative, Impact of heat-inactivated Lactobacillus casei and fermentation groups. Next, for more precise identification of Lactobacillus paracasei strains on cytokine responses in some LB isolates the molecular methods have been used. whole blood cell cultures of children with atopic dermatitis. However, to know which of the advanced methods is the best Folia Microbiol. 55, 277–280 (2010). for species identification, the selection should be based on This work is partly supported by the grant from the National comparative studies. Aim: To compare the suitability of Centre for Research and Development No. N R12 0101 10. different methods for identification of LB strains from Tartu collection. Material and methods: A total 120 LB isolates and P25 21 reference strains of 20 species were analysed by DOES CRANBERRY USEFUL FOR PREVENTION RECURRENT biochemical (API 50CHL) and molecular methods internal- URINARY TRACT INFECTIONS IN CHILDREN? transcribed spacer polymerase chain reaction (ITS-PCR) Dessì Angelica* [1] , Fanos Vassilios [1] and sequencing of 16S rRNA. ITS-PCR was performed [1] Department of Paediatrics, Neonatal Intensive Care Unit, Neonatal according to Jacobsen et al. (1999) with primers Pathology, Puericultura Institute and Neonatal Section, University of (GATTCTGGCTCAGGATGAACG and AGGTCCTAACAAGGTA). Cagliari - Cagliari, Italy The PCR products were restricted with TaqI restriction enzyme. Two primers, CO1: AGTTTGATCCTGGCTCAG and Urinary tract infections (UTI) are common in childhood. In CO2: TACCTTGTTACGACT, were used to generate a 1.5-kb 30-50% of children with UTI the infections occur recurrently, 16S rRNA product for sequencing (Simpson et al. 2003). The especially in those with vesicoureteral reflux (VUR), 16S rRNA sequences were compared with GeneBank neurogenic bladder (NB), previous cystitis or pyelonephritis database by BLAST algorithm.Results: The concordance and malformative uropathies. To reduce the likelihood of UTI, between API 50CHL and ITS-PCR was found in 10 out of 21 antibiotic prophylaxis has been regarded as the therapeutic (48%) reference strains. The concordance between API standard for many years. However, the disadvantage of long- 50CHL and ITS-PCR for LB isolates belonging to 14 species term antibiotic therapy is the potential for development of was 85/112 (75.8%). Some strains remained unidentified by collateral effects and resistant organisms in the host. Such both methods. In the case of sequencing the concordance reasons have induced scientists to search for alternative was high. Both molecular methods (ITS-PCR and modalities of UTI prevention and have contributed to sequencing) assigned the isolates of L. acidophilus (API determining the increasing desire for “naturalness” of the 50CHL) to either L. acidophilus or L. gasseri. Different population and preventing excessive medication. Cranberry, functional properties (metabolites, antimicrobial and alone or in combination with probiotics has been suggested antioxidative activity) of the possible probiotic strains have 50 posters been evaluated. Conclusion: The preliminary identification P28 methods of Lactobacillus spp. serve as basis for obtaining PROBIOTIC TREATMENT INDUCED AGE DEPENDENT large collections. The molecular identification methods are METABOLIC CHANGES necessary for selection of the strains with health effects. Brasili Elisa [1] , Tomassini Alberta [2] , Finamore Alberto* [1] , Roselli Marianna [1] , Mengheri Elena [1] , Capuani Giorgio [2] , P27 Sciubba Fabio [2] , Miccheli Alfredo [2] ASSESSMENT OF SAFETY AND TOLERANCE OF A [1] National Research Institute on Food and Nutrition, INRAN - Roma, FERMENTED DAIRY FOOD CONTAINING NOVEL, Italy - [2] Sapienza University - Roma, Italy POTENTIALLY PROBIOTIC STRAINS Chambaud Isabelle* [1] , Jeansen Stéphanie [1] , Elfakir Anissa [1] , The intestinal microflora plays an important role in host Banning Federike [2] , Queudot Jean-Christophe [3] , Bouchez metabolism. The aging process is characterized by changes Elodie [3] , Bourlioux Pierre [4] , Marteau Philippe [5] , Schrezenmeir in gut microbiota community and metabolic system. Lactic Juerguen[6] acid bacteria can ameliorate several biological functions. Up [1] Danone Research - Palaiseau, France - [2] Harrison Clinical Research to now only few studies were conducted on the regulation of Deutschland GmbH - Munich, Germany - [3] CIT Safety and Health metabolism by probiotics and no data are available during Research Laboratories - Evreux, France - [4] Faculty of Parmacy - Paris- aging processes. This work was conducted to assess the Sud University - Paris, France - [5] University Denis Diderot, Paris 7 & effects of a probiotic mixture on the metabolic phenotype of AP-HP, Lariboisière hospital - Paris, France - [6] Gutenberg-University adult and aged mice, and to find possible biomarkers of the Mainz - Kiel, Germany probiotic induced metabolic changes in different ages. Aged (16 months old) and adult (3 months old) BALB/c mice Lactobacilli have a long history of use as probiotics, without received Lactobacillus acidophilus (La5) and Bifidobacterium established risks in humans (Bernardeau et al., 2006). There lactis (BB12) (1.5×109 CFU) or PBS, daily for 4 weeks. Urine currently is no regulation or consensus for the safety and feces were collected for 48h at the beginning and at the assessment of live micro-organisms added in food products as end of treatment, and analyzed by high-resolution 1H-NMR cultures or ingredients. However, there are a number of spectroscopy combined with partial least squares- guidelines, recommendations and expert reviews on possible discriminant analysis. In the old PBS treated mice, feces steps to document and validate the safety of live micro- NMR-based metabolomic analysis identified a gut flora age organisms used in foods (Borriello et al., 2003; O'Brien et al., associated metabolic phenotype (metabotype) that differed 1999; de Vrese & Schrezenmeir, 2008; FAO and WHO, 2002 and from that of the adult mice. Discriminant metabolites were 2006). The safety and tolerance of a dairy drink containing bile salts, isoleucine, a-keto-ß- metil N-valerate, histidine and potentially probiotic strain were investigated in a monocentric tyrosine, a-keto-isovalerate, 4-OH phenyalcetate and randomised double-blind clinical trial following FAO/WHO succinate. Urine NMR-based metabolomic analysis in the old guidelines. 96 healthy adults, aged from 18 to 55 years were PBS treated mice identified an aged metabotype that differed randomly allocated to 4 groups of 24 subjects each. Subjects from that of adult mice, and the altered metabolites were consumed either 1 bottle (100 g) or 3 bottles (3 x 100 g) of study succinate, citrate, 3-OH-isovalerate and taurine. Probiotic products (either a fermented dairy product or a control product) administration induced several metabolic changes in feces per day. The total duration of the study was 10 weeks, including and urine of aged and adult mice. Among the changes, the a 2-week wash-out period, a 4-week product consumption common alterations occurring in aged and adult mice were period and 4-week follow-up period. The recorded outcomes an increase in 4-OH phenylacetate in fecal water and an were: adverse events, bowel movements, faeces consistency, increase in dimethylglycine in urine. Urine metabolomic and frequency of Digestive Symptoms (Questionnaire), physical analysis identified a metabotype in probiotic treated aged examination, blood cell counts, creatinin, CRP, glycaemia, blood mice that suggested a systemic effect on trans-methylation lipids, calprotectin in faeces,). Based on descriptive statistics and trans-sulfuration processes. In conclusions, the used including Cohen’s d approach for quantitative and probabilities approach has proved useful to study the interactions between of an event in the verum/control group for qualitative binary host and probiotics and to identify biomarkers of the parameters, confidence intervals, and case by case evaluation probiotic induced age dependent metabolic changes. none of these parameters appeared to be influenced by the product consumption, compared to the test product. The number of adverse events during the whole study period were: 89 in the verum and 88 in the control group at 1 bottle per day and 71 in the verum group versus 83 in the control group at 3 bottles per day. In conclusion the results of this study do not indicate at this step safety concerns for the product ingestion in the dosages of 1 to 3 times per day. In view of the limited sample size and power of the study monitoring of safety parameters and adverse events is still recommended in future intervention trials dedicated to efficacy and other goals. In addition, Repeated Dose 90-day Oral Toxicity Study in Rodents, following OECD408 guidelines were conducted on the probiotic strains. No signs of toxicity were observed at the clinical, laboratory and pathology investigations. 51 posters
P29 P30 COMPARATIVE STUDY ON THE CELL SURFACE PROPERTIES PREBIOTIC AND ANTIMICROBIAL EFFECT OF KEFIRAN AND STRUCTURE OF EXOPOLYSACCHARIDES PRODUCED Vardjan Tinkara* [1] , Canžek Majhenic Andreja [2] , Rogelj Irena [2] BY LACTOBACILLUS CASEI AND LACTOBACILLUS [1] Kele & Kele, d.o.o. - Logatec, Slovenia - [2] University of Ljubljana, PARACASEI STRAINS Biotechnical Faculty - Domžale, Slovenia Górska-Fraczek Sabina* [1] , Gamian Andrzej [1] , Kozakova Hana [2] , Schwarzer Martin [2] Kefiran is water soluble exoploysaccharide embedding lactic [1] Institute of Immunology and Experimental Therapy, Polish Academy acid bacteria and yeasts inside kefir grains. This symbiotic of Sciences, - Wroclaw, Poland - [2] Department of Immunology and community of microbiota and kefiran has been described to Gnotobiology, Institute of Microbiology of the Academy of Sciences of the posses many health-promoting properties. Especially kefiran Czech Republic, v. v. i - Novy Hradek, Czech Republic has attracted considerable interest because of its antimicrobial, anti-inflammatory, antifungal and antitumoural Probiotics are defined as live microorganisms which, when activity. It has been also shown, that kefiran lowers blood administrated in adequate amounts, confer a health benefit pressure and reduces serum cholesterol levels in rats. In our on the host. There is much evidence concerning the role of study, the prebiotic and antimicrobial effects of kefiran, probiotics in the prevention or therapy of allergic diseases extracted either from pure lactobacilli cultures or kefir grains, [1] . Novel probiotics used in allergy treatment must meet were investigated. Preliminary, lactobacilli were isolated from several criteria: be safe for the host organism, be resistant kefir grains and identified by partial sequencing of the 16S to gastric acids and bile salts in order to survive into the gut, rDNA. To optimize their ability for kefiran or kefiran-like and be able to modulate Th1/Th2 balance in favor of anti- polysaccharide production lactobacilli were cultivated in allergic Th1 immune responses [2] . Three strains presenting different media at different pH. Exopolysaccharides were antagonistic activity against pathogenic bacteria, tolerance to extracted from both, pure lactobacilli suspensions low/high pH, which in functional animal studies induced and kefir grain. To determine their sugar composition, cytokine production towards Th1 anti-allergic response were extracted exopolysaccharides were subjected to capillary selected. The strain specificity may be related to the structure electrophoresis. Antimicrobial activity of kefiran was evaluated of cell-wall components such as exopolysaccharides (EPSs), using disk diffusion method. To establish the prebiotic effect the major components of lactobacilli biofilm, however their of kefiran, the growth of different lactobacilli and role in the “cross-talk” between bacteria and the immune bifidobacteria, common to gastrointestinal tract, was tested system is poorly understood. In the present work we reported on plain agar medium or agar medium, supplemented with the surface properties and structure of the EPS produced by kefiran. Lactobacilli, isolated from kefir grains were identified Lactobacillus casei LOCK 0900, L. casei LOCK 0908 and L. as members of Lactobacillus kefiranofaciens subsp. paracasei LOCK 0919 strains. Methods: The biopolymers kefirgranum, Lactobacillus parakefiri and Lactobacillus kefiri were isolated from human intestinal flora. The polysaccharide species. Since these species are not recognized as typical materials were prepared by TCA extraction of bacterial cell kefiran produces, their exopolysaccaharides were also mass, purified by anion-exchange and gel permeation identified as kefiran-like polysaccharides. Furthermore, only chromatography and characterized using chemical and exopolysaccharide, extracted from kefir grains was confirmed enzymatic methods. Surface properties were characterized to be kefiran due to its structure composed of equal amounts by salt aggregation test, adherence to xylene, adhesion to of D-glucose and D-galactose. Moreover, this kefiran exerted Caco-2 cell line and slime production. antimicrobial activity against some potentially pathogenic Results: On the basis of sugar and methylation analysis the strains and prebiotic effect stimulating the growth of certain EPS were shown to be composed of glucose, galactose, lactobacilli and bifidobacteria. Findings obtained in this study mannose, galactosamine, glucosamine, mannosamine and suggest that kefiran is present in kefir grains, but none of the fucose in different configuration and ratio. Strains appeared isolated strains was able to produce kefiran in pure culture to be a different entities and their surface properties were indicating that kefiran production by strains in pure culture is distinct. The project is supported by grant co-funded by the limited. To conclude the antimicrobial activity and prebiotic European Regional Development Fund under Operational effect were demonstrated for kefiran extracted from kefir grains. Programme Cross-border Cooperation “Czech Republic - Republic of Poland 2007 -2013'”.Programme under the European Territorial Cooperation Objective. „Probiotics: scientific cooperation, transfer of knowledge and education” No CZ.3.22/2.1.00/09.01574 1. BORCHERS A.T., SELMI C., MEYERS F.J., KEEN C.L., GERSCHWIN M.E.: Probiotics and immunity. J.Gastroenterol. 44, 26–46 (2009). 2. ISOLAURI E.: Probiotics in human disease. Am.J.Clin.Nutr. 73, 1142–1146 (2001)
52 faculty
53 faculty
A Del Rio Daniele (Italy) p. 14 Aggett Peter (United Kingdom) p. 13 Delle Fave Gianfranco (Italy) p. 5 Agostoni Carlo (Italy) p. 13 Devirgiliis Chiara (Italy) p. 7 Andriulli Angelo (Italy) p. 6, 14 de Ridder Lissy (The Netherlands) p. 12 Anti Marcello (Italy) p. 7 de Vos Willem M. (The Netherlands) p. 6 Arlorio Marco (Italy) p. 10 Di Giorgi Gerevini Valeria (Italy) p. 13 Attili Adolfo Francesco (Italy) p. 10 Dorè Joel (France) p. 5 Aureli Paolo (Italy) p. 19 Drago Lorenzo (Italy) p. 19 Dupont Christophe (France) p. 12 B Balsano Clara (Italy) p. 4 E Barbara Giovanni (Italy) p. 4, 6 Elli Marina (Italy) p. 6 Bastos Deborah (Brazil) p. 10 Belzer Clara (The Netherlands) p. 6 F Bezirtzoglou Eugenia (Greece) p. 15 Fabiano Valentina (Italy) p. 19 Bienenstock John (Canada) p. 6 Fanos Vassilios (Italy) p. 12 Brandi Maria Luisa (Italy) p. 14 Fatati Giuseppe (Italy) p. 15 Brigidi Patrizia (Italy) p. 4, 14 Festi Davide (Italy) p. 4, 15 Bruzzese Eugenia (Italy) p. 12 Fogliano Vincenzo (Italy) p. 10 Buonocore Giuseppe (Italy) p. 12 Francavilla Ruggiero (Italy) p. 19
C G Calvani Menotti (Italy) p. 11 Gasbarrini Antonio (Italy) p. 4, 12 Camera Emanuela (Italy) p. 19 Gassull Miguel Angel (Spain) p. 7 Cani Patrice D. (Belgium) p. 15 Genazzani Alessandro D. (Italy) p. 11 Caporaso Nicola (Italy) p. 8 Ghelardi Emilia (Italy) p. 6 Caprilli Renzo (Italy) p. 7 Gianfranceschi Gian Luigi (Italy) p. 15, 19 Capurso Gabriele (Italy) p. 4, 8 Giovannini Marcello (Italy) p. 13 Capurso Lucio (Italy) p. 5 Gleeson Michael (United Kingdom) p. 14 Carding Simon (United Kingdom) p. 7 Grilli Ester (Italy) p. 4 Caselli Michele (Italy) p. 4 Guandalini Stefano (USA) p. 12 Castagliuolo Ignazio (Italy) p. 7 Guarino Alfredo (Italy) p. 5, 12 Castellazzi Annamaria (Italy) p. 6 Guarner Francisco (Spain) p. 5, 7, 14 Catassi Carlo (Italy) p. 14 Guillemard Eric (France) p. 6 Cicero Arrigo F.G. (Italy) p. 19 Collins Stephen M. (Canada) p. 5 H Corazza G. Roberto (Italy) p. 14 Haller Dirk (Germany) p. 5 Corazziari Enrico (Italy) p. 7 Hojsak Iva (Croatia) p. 12 Crespi Massimo (Italy) p. 14 Cricelli Claudio (Italy) p. 6 I Crittenden Ross (Finland) p. 6 Indrio Flavia (Italy) p. 12, 13 Cucchiara Salvatore (Italy) p. 6, 7 Isolauri Erika (Finland) p. 12
D J Danese Silvio (Italy) p. 7 Jirillo Emilio (Italy) p. 14 D'Argenio Giuseppe (Italy) p. 10 Justen Peter (France) p. 7 De Giorgio Roberto (Italy) p. 4 Del Piano Mario (Italy) p. 14 54 faculty
K Roberfroid Marcel (Belgium) p. 15 Karakan Tarkan (Turkey) p. 7 Rossi Maddalena (Italy) p. 8 Kekkonen Riina (Finland) p. 6 Rossi Mauro (Italy) p. 14 Koch Maurizio (Italy) p. 6 Russo Francesco (Italy) p. 19
L S Lavermicocca Paola (Italy) p. 19 Saggioro Alfredo (Italy) p. 8, 15 Lionetti Paolo (Italy) p. 12 Salonen Anne (Finland) p. 6 Loguercio Carmelina (Italy) p. 4 Salvini Filippo (Italy) p. 13 Louis Petra (United Kingdom) p. 7 Sanz Yolanda (Spain) p. 5, 14 Scapagnini Giovanni (Italy) p. 8, 19 M Scarpellini Emidio (Italy) p. 4 Marabelli Romano (Italy) p. 5 Scott Karen P. (United Kingdom) p. 10 Margolles Abelardo (Spain) p. 7 Serafini Michele (Italy) p. 5, 10 Marigliano Vincenzo (Italy) p. 11 Serino Matteo (France) p. 8 Marignani Massimo (Italy) p. 15 Severi Carola (Italy) p. 4 Marotta Francesco (Italy) p. 11 Shamir Raanan (Israel) p. 12, 13 Matteuzzi Diego (Italy) p. 8 Silano Marco (Italy) p. 14 Mengheri Elena (Italy) p. 6 Sirtori Cesare (Italy) p. 19 Miraglia del Giudice Michele (Italy) p. 10 Swidsinski Alexander (Germany) p. 12 Morelli Lorenzo (Italy) p. 5 Szajewska Hania (Poland) p. 13, 19 Morisco Filomena (Italy) p. 10 Mosca Fabio (Italy) p. 12 T Tilg Herbert (Austria) p. 7 N Tuohy Kieran (United Kingdom) p. 14 Nicoletti Claudio (United Kingdom) p. 6 Nicoletti Marcello (Italy) p. 8 V Vandenplas Yvan (Belgium) p. 13 O Vanderhoof Jon (USA) p. 12 Ongaro Filippo (Italy) p. 15 van Goudover J.B. Hans (United Kingdom) p. 12, 13 Orlando Antonella (Italy) p. 19 Vannucci Luca (Czech Republic) p. 10 Verduci Elvira (Italy) p. 13 P Vincenzi Colombina (Italy) p. 19 Pallone Francesco (Italy) p. 6 Vitaglione Paola (Italy) p. 10 Patrignani Paola (Italy) p. 14 Virgili Fabio (Italy) p. 7 Peluso Gianfranco (Italy) p. 10 Perozzi Giuditta (Italy) p. 7 W Picardo Mauro (Italy) p. 19 Walker Alan (United Kingdom) p. 7 Piraccini Bianca Maria (Italy) p. 19 Polimeni Ascanio (Italy) p. 11
Q Quigley Eamon (Ireland) p. 14
R Rescigno Maria (Italy) p. 6, 7 Ricciardiello Luigi (Italy) p. 10 Riezzo Giuseppe (Italy) p. 19 55
index of authors
index of authors
57 index of authors
A Citar Manuela p. 48 Aguayo Maria p. 40 Cocca Silvia p. 33 Akkermans Louis M. A. p. 35 Coppa Giovanni Valentino p. 36, 46 Al Faleh Khaled p. 44 Corleto Vito p. 34 Aleksandrzak-Piekarczyk Tamara p. 49 Costabile Adele p. 45 Ali Babar p. 31 Cripps Allan p. 29 Al-Kharfi T p. 44 Cufino Valerio p. 38 Allesina S. p. 44, 46, 47 Cuomo Rosario p. 28 Alloni Rossana p. 33 Alpert Carl-Alfred p. 35 D Alric Monique p. 29, 42 D'Alessandro Alessandra p. 28 Altomare Annamaria p. 33 D'Andrea M. p. 48 Ammoscato Francesca p. 28, 33 Darfeuille-Michaud Arlette p. 29 Anabrees Jasim p. 44 D'Argenio Giuseppe p. 42 Anderloni A. p. 46, 47 De Magistris Laura p. 42 Arena Vincenzo p. 38 Deidda F. p. 44, 46, 47 Ascione Barbara p. 28 Del Piano Mario p. 44, 46, 47 , 48, 49 Aumueller Eva p. 30 Delle Fave Gianfranco p. 34 Denis Sylvain p. 29 B Dessì Angelica p. 50 Bacci M.L. p. 32 Di Giulio Emilio p. 34 Baldassarre Mariella p. 40 Di Natale Giuseppe p. 28 Ballarè M. p. 46, 47 Donini Lorenzo M p. 46 Balzarini M. p. 46, 47 Banning Federike p. 50 E Barba M. p. 44, 46, 47 Efrati Cesare p. 44 Bardowski Jacek p. 49 Ehrlich Kersti p. 37 Bassler D p. 44 Elfakir Anissa p. 50 Bäuerl Christine p. 35 Elli Marina p. 39 Bertino Enrico p. 36 Elmadfa Ibrahim p. 30 Blanquet-Diot Stéphanie p. 29 Etienne-Mesmin Lucie p. 29 Boldrini P. p. 32 Bouchez Elodie p. 50 F Bourlioux Pierre p. 50 Fanelli Margherita p. 40 Brasili Elisa p. 46, 51 Fanos Vassilios p. 50 Brugère Jean-François p. 42 Farina Virginia p. 28 Brun Mary p. 29 Federico Alessandro p. 42 Brun Paola p. 39 Féria-Gervasio David p. 42 Buccigrossi Vittoria p. 34 Finamore Alberto p. 46, 51 Fricker Peter p. 29 C Fuentes Susana p. 35 Callegari Maria L. p. 42 Calò G. p. 32 G Cannaviello Claudio p. 44 Gabrielli Orazio p. 36, 46 Canžek Majhenic Andreja p. 52 Galeazzi Tiziana p. 36, 46 Caporaso Nicola p. 42 Gamian Andrzej p. 51 Capuani Giorgio p. 51 Gasbarrini Antonio p. 38 Cariello Rita p. 42 Gerardi Viviana p. 38 Carmagnola S. p. 46, 47 Gerritsen Jacoline p. 35 Carnevali Paola p. 45, 46 Gibson Glenn p. 36, 38 Caselli M. p. 32 Gooszen Hein G. p. 35 Cassol F. p. 32 Gopal Pramod p. 31 Castagliuolo Ignazio p. 39 Górska-Fraczek Sabina p. 51 Castro Erica p. 40 Goyal Nupur p. 37 Cavallo Donatella p. 39 Grilli Ester p. 32 Chambaud Isabelle p. 50 Grossi Enzo p. 42 Chassaing Benoit p. 29 Guarino Alfredo p. 34 Chitarrari Roberto p. 45 Guarino Michele p. 33 Cicala Michele p. 33 Günther Sebastian p. 33 Cirillo Carla p. 28 58 index of authors
H Marra Fabio p. 39 Hacin Biljana p. 48 Marteau Philippe p. 50 Hahne Hannes p. 35 Martines Diego p. 39 Haller Dirk p. 35 Matarrese Paola p. 28 Haslberger Alexander p. 30, 36 Mazzone Giovanna p. 42 Heczko Piotr p. 40 Medina Rossi p. 40 Herbel Stefan p. 33 Mengheri Elena p. 46, 51 Hilyakne Kadlott Maria p. 30, 43 Miccheli Alfredo p. 51 Hippe Berit p. 36 Mikelsaar Marika p. 37, 48, 50 Hong Zhimin p. 47 Miller Larry p. 31 Hopkins Will p. 29 Mogna Giovanni p. 44, 46, 47, 48, 49 Hörmannsperger Gabriele p. 35 Mogna Luca p. 46, 47, 49 Horn Peggy p. 29 Monsalvez Elizabeth p. 40 Hütt Pirje p. 37, 48 Montecinos Hernan p. 40 Moratelli Ketty p. 39 I Morelli Lorenzo p. 39, 42 Iadevaia Maddalena p. 42 Isolauri Erika p. 49 N Naar Zoltan p. 30, 34, 35, 43, 44 J Nanda Dhiraj K. p. 38 Jeansen Stéphanie p. 50 Nasti Anna p. 28 Jia Yongjie p. 47 Neri Barbara p. 46 Jofre Jaime p. 40 Nermes Merja p. 49 Joyal Steven p. 46 Nestlberger Manuela p. 30 Juric Aleksandra p. 36, 38 Nicola S. p. 48 Nicolini Giorgia p. 44 K Novo Erica p. 39 Kamhuber Christoph p. 36 Karasi Anbu K. p. 38 O Kiss Attila p. 30, 34, 43, 44 Oliva Valentina p. 34 Kõljalg Siiri p. 48 Orsello M. p. 46, 47 Kolk Helgi p. 48 Ouwehand Arthur p. 28, 29, 31 Konstantinov Sergey R. p. 35 Koryszewska-Baginska Anna p. 49 P Kozakova Hana p. 51 Padella Lucia p. 36 Kryczyk Jadwiga p. 40 Pagliarulo M. p. 46, 47 Kupka Anna p. 40 Pagnini Cristiano p. 34 Pal Karoly p. 30, 34, 35, 43, 44 L Palumbo Massimo p. 45 Labra Alan p. 40 Pane M. p. 48 Ladan Giahi p. 30 Panneman Henk p. 35 Laforgia Nicola p. 40 Pardo Karen p. 40 Laterza Lucrezia p. 38 Parola Maurizio p. 39 Laudiero Gabriella p. 34 Pecere Silvia p. 38 Leyer Greg p. 31 Perez Gaspar p. 35 Li Guanhong p. 47 Petito Valentina p. 38 Liu Siguo p. 47 Petitta Chiara p. 28 Livrelli Valérie p. 29 Pirker Angelika p. 36 Loguercio Carmela p. 42 Pisacane Vincenza p. 42 Lopetuso Loris Riccardo p. 38 Piva A. p. 32 Pizzoferrato Marco p. 38 M Polimeni Ascanio p. 46 Maccari Francesca p. 36, 46 Poply Sarang p. 38 Madiai Stefania p. 39 Privat Maud p. 29 Malorni Walter p. 28 Provenzano Angela p. 39 Mändar Reet p. 50 Pyne David p. 29 Mango Annamaria p. 28 Marignani Massimo p. 28 Marotta Francesco p. 46
59 index of authors
Q Tompa Gorazd p. 48 Qu Minreng p. 47 Tottey William p. 42 Queudot Jean-Christophe p. 50 Truusalu Kai p. 48 Tuccillo Concetta p. 42 R Tugnoli B. p. 32 Rätsep Merle p. 37, 43, 48 Turco Fabio p. 28 Rebecchi Annalisa p. 42 Tzortzis George p. 36, 38 Reifer Cheryl p. 31 Ribecco Maria Teresa p. 42 V Rijkers Ger T. p. 35 Vaira D. p. 32 Rogelj Irena p. 48, 52 van Minnen L. Paul p. 35 Rombouts Frans M. p. 35 Vandekerckove Pascal p. 42 Rööp Tiiu p. 50 Vardjan Tinkara p. 52 Roselli Marianna p. 46, 51 Vera Rodrigo p. 40 Verrone Maria Antonietta p. 34 S Vivoli Elisa p. 39 Sabbi Tamara p. 45 Volpi Nicola p. 36, 46 Salminen Seppo p. 49 von Schillde Marie-Anne p. 35 Sangwan Seema p. 38 Vulevic Jelena p. 36, 38 Sangwan Vikas p. 31 Santoro Lucia p. 46 W Sarnelli Giovanni p. 28 Waller Philip p. 31 Scaldaferri Franco p. 38 Warren Hilary p. 29 Schrezenmeir Juerguen p. 50 Weiher Monika p. 35 Schwarzer Martin p. 51 West Nic p. 29 Scirocco Annunziata p. 28 Wiecek Grazyna p. 40 Sciubba Fabio p. 51 Wieler Lothar H. p. 33 Sepp Epp p. 50 Wu Fan p. 29 Severi Carola p. 28, 33 Wudy Anna p. 34 Sforza F. p. 44, 46, 47 Sgambato Alessandro p. 48 Y Shkut Elena p. 37, 38 You Jinming p. 47 Singh R.R.B. p. 31 Singh Rameshwar p. 38 Z Smidt Hauke p. 35 Zagura Maksim p. 48 Smidt Imbi p. 43, 44 Zampini Lucia p. 36, 46 Soattini L. p. 44 Zannoni A. p. 32 Sofia Morena p. 34 Zilmer Mihkel p. 37, 48 Songisepp Epp p. 37, 43, 48 Soza Francisco p. 40 Stewart Morgan p. 31 Stigliano Egidio p. 38 Stillfried Nicolas p. 40 Stockenhuber Felix p. 36 Strozzi G.P. p. 44, 46, 47, 48, 49 Strus Magdalena p. 40 Szarvas Jozsef p. 30 Szen Orsolya p. 30, 34, 35, 43, 44
Š Štšepetova Jelena p. 50
T Tafaro Angela p. 40 Tari R. p. 46, 47 Timmerman Harro M. p. 45 Tomar Sudhir Kumar p. 31 Tomassini Alberta p. 51 Tomella Claudio p. 46
60 general information
Venue Università Urbaniana - Terminal Gianicolo Via Urbano VIII, 16 - 00165 Rome, Italy (Tel. +39 06 69889611 - Fax +39 06 69881871) www.urbaniana.edu Dates September 11-13, 2011 Language The official language of the Meeting is English Clothing Informal for all occasions except for the gala dinner Climate September in Rome is still hot but unpredictable. For all the excursions we suggest casual wear and outdoor shoes Badges All participants, accompanying persons and exhibitors are kindly requested to wear their badges throughout the Meeting area in order to be admitted to the scientific sessions and to all the activities of the Meeting Registration Fees Fees (20% VAT included) Participants € 600,00 Under 35* € 324,00 Accompanying Persons € 290,00 Pediatric Day** € 240,00 Daily Registration € 240,00 Gala dinner € 150,00 * the applicant’s registration form must be accompanied by a copy of an official document ** If not registered to the general Meeting Registration fees include: Participants: - Admission to scientific sessions, technical exhibition - Final programme - Proceedings and abstract book - Coffee corners and lunches - Opening ceremony and welcome cocktail - Certificate of attendance - Italian CME certificate (to whom entitled) Accompanying Persons - Opening ceremony and welcome cocktail - Two half day tours (on request) Participants are kindly requested to wear their badges during all meeting activities and social events: No badge, no entry Banking and Exchange The Italian monetary system is the Euro. Foreign currency may be exchanged at banks during normal banking hours, at hotels, at airports and in exchange offices. All major credit cards are accepted in most hotels, restaurants and shops Liability and Insurance The Meeting Organisers cannot accept liability for personal injuries or for loss of, or damage to, property belonging to meeting participants (or their accompanying persons), either during or as a result of the meeting. Please check the validity of your own insurance
61 general information
Visa Requirements All visitors entering Italy must be in possession of a valid passport. For European Community citizens an Identity Card is sufficient. Participants should check the Italian Embassy or Consulate in their country regarding visa and health certificate requirements. Official Letter of Invitation Official letters of invitation designed to help overcome administrative difficulties in certain countries are available on the Meeting website. It must be understood that such letters do not represent a commitment on behalf of the Organising Committee or Conference to provide any financial assistance Certificate of Attendance Certificates of attendance will be available for all registered participants at the registration desk from September 13, 2011 Food and Beverages Business lunches during breaks and coffee/tea service (as indicated in the programme) are included in the registration fee Parking Cars can be parked at terminal Gianicolo. Participants to the Meeting will have a special rate. To obtain it, please contact the Organising Secretariat About Rome Rome is the capital city of Italy and of the Lazio region, as well as the country's largest and most populous comune, with more than 2.7 million residents. The metropolitan area has a population of about 4 million. It is located in the central-western portion of the Italian peninsula, where the river Aniene joins the Tiber. The Mayor of Rome is Gianni Alemanno. An enclave of Rome is the State of the Vatican City, the sovereign territory of the Holy See. It is the smallest nation in the world, and the capital of the only religion to have representation in the United Nations (as a non-member observer state). Rome, Caput mundi ("capital of the world"), la Città Eterna ("the Eternal City"), Limen Apostolorum ("threshold of the Apostles"), la città dei sette colli ("the city of the seven hills") or simply l'Urbe ("the City"), is thoroughly modern and cosmopolitan. As one of the few major European cities that escaped World War II relatively unscathed, central Rome remains essentially Renaissance and Baroque in character. The Historic Centre of Rome is listed by UNESCO as a World Heritage Site Airport Information Rome can easily be reached by plane and is served by two international airports. Participants can fly into Rome via Leonardo da Vinci Airport, located in Fiumicino, 34 km from Rome's historic city centre or via Ciampino Airport, situated 15 km southeast of central Rome Access to Rome from the Airports Access from Leonardo da Vinci Airport: The airport is served by the Leonardo Express train operated by Trenitalia, available at the airport terminal. The trip takes 30 minutes (nonstop) to Termini Station in Rome - there are two such connections per hour. Alternatively, local trains leave once every 15 minutes, stopping at all train stations. You may have to change at Trastevere, Ostiense (Metro Piramide) or Tuscolana. Rental cars are available in the airport terminal from all the usual companies Access from Ciampino Airport: There is no rail transport at Ciampino Airport. The options are to take a bus to a rail station (either metro or regular train) or to take a bus or taxi all the way All the way by road transport: • Terravision runs a direct bus service to Termini. The price is € 8,00 c.a. one-way or € 13,50 c.a. return, taking 40 minutes (about 20 services a day). Despite timing buses to connect with flights, passengers on the return trip from Termini are asked to board the bus 2.5 hours before their flight's departure time. The last bus is at 07:20 p.m. Terravision also offers buses from Fiumicino airport to Termini, and a transfer bus between the two airports. • Schiaffini also runs direct buses to Termini station for € 5,00 one-way, taking 40 minutes, but with far fewer departures than Terravision (see above). These buses are not mentioned on the airport website but they can be found on Schiaffini's own site • BusShuttle runs a service similar to Terravision. Their stop near Termini is about 20 metres up the road from Terravision's. Cost is € 6,00 for a single • The fixed fare for a taxi ride to the city centre (inside the Aurelian Walls) is € 30,00, according to the official agreement between Roman taxi driver associations and Rome municipality. It is advisable to negotiate the total price including luggage supplements before boarding the taxi Rental cars are available in the airport terminal from all the usual companies 62 general information
How to get to the Meeting venue From Termini Rail Station: By taxi - We recommend you to only use licensed taxis available outside the station. Telephone number main taxis companies: 06 - 3570 Radio Taxi 06 - 5551 Samarcanda 06 - 4994 La Capitale By public transport - Arriving from Termini Railways Station - BUS 64 stop at Lgt. Sassia (S. Spirito Hospital) - 350 metres walking From Leonardo da Vinci Airport: By taxi – We recommend you to only use licensed taxis available outside the airport. Telephone number main taxis companies: 06 - 3570 Radio Taxi 06 - 5551 Samarcanda 06 - 4994 La Capitale By public transport - Follow the signs for “Station” of Leonardo express. Take the train for Stazione Termini and get off at the Station. Take the BUS 64 stop at Lgt. Sassia (S. Spirito Hospital) - 350 metres walking From Ciampino Airport: We advice to take a taxi available outside the airport. We recommend you to only use licensed taxis available outside the airport Transportation in the City Rome has a very efficient transportation system that services the entire city, which includes the Metro network as well as buses, trains and taxis Organising Secretary Desk at the Meeting venue will be open as follows: DAY DATE FROM TO Sunday September 11 12.00 p.m. 7.00 p.m. Monday September 12 8.00 a.m. 7.00 p.m. Tuesday September 13 8.00 a.m. 3.00 p.m.
Organising Secretariat Please do not hesitate to contact the Organisers if you require any additional information or assistance. Please address all correspondence to:
e MEETING&CONSULTING Via M. Mercati, 33 00197 Rome, Italy Phone: +39 06 80693320 Fax: +39 06 3231136 www.emec-roma.com e-mail: [email protected] Website: www.probiotics-prebiotics-newfood.org
63 scientific information
Oral communications Oral communications sessions are scheduled as follows:
- ORAL COMMUNICATIONS 1: September 12, 2011 AULA C from 10.00 a.m. to 11.30 a.m.
- ORAL COMMUNICATIONS 2: September 13, 2011 AULA C from 10.30 a.m. to 01.00 p.m.
Posters Poster authors are kindly requested to hang the poster at the poster area from 3.00 p.m. on September 11 and remove it after 1.00 p.m. on September 13. Your position will be indicated in the poster area
Slide centers All speakers and authors must deliver their presentation (CD Rom, USB ) 2 hours in advance or the day before their speech to the slide centers
CME for Italian delegates Gli attestati riportanti i crediti ECM, dopo attenta verifica della partecipazione e dell'apprendimento, saranno inviati on-line dopo la chiusura dell'evento. Il partecipante riceverà una password che gli permetterà di scaricare l'attestato con i crediti conseguiti (10,5) per la professione di Medico Chiurugo, Infermiere, Infermiere pediatrico
64 THE MEETING WAS MADE POSSIBLE THANKS TO THE CONTRIBUTION PROVIDEd BY: major sponsors
AG PHARMA ANGELINI DANONE ITALCHIMICI PROBIOTICAL SANOFI AVENTIS YAKULT
ACQUA E TERME DI ULIVETO AIIPA BIOACTIVAL BIOFARMA BRACCO CEC EDITORE DKSH FARMACEUTICI PROCEMSA GIULIANI GNOSIS LESAFFRE HUMAN CARE MEAD JOHNSON NUTRITION ITALIA NATHURA NÓOS NUTRICIA PARMALAT SIGMA-TAU S.I.I.T. SOFAR TEKNOSCIENCE VITIS PHARMA ZAMBON ITALIA
65 exhibition area Floor plan, level 1
EXHIBITORS
MAIN ENTRANCE 1) YAKULT SLIDE CENTER 2) NÓOS 3) ITALCHIMICI AULA MAGNA 4) LESAFFRE 5) ANGELINI 6) SOFAR 7) ZAMBON 13 14 7bis ) PROBIOTICAL
2 8) AG PHARMA/VITIS PHARMA 1 ORGANISING COFFEE 9) AG PHARMA/VITIS PHARMA SECRETARIAT 1 CORNER 10) FARMACEUTICI PROCEMSA 1 AREA 11) BIOFARMA
0 12) BRACCO 1 13) SANOFI AVENTIS 14) SANOFI AVENTIS 9 8 s i
b A) MEAD JOHNSON 7 NUTRITION 7 6 5 4 3 2 1 A
Floor plan, ground level
EXHIBITORS
AULA C 15) DKSH 16) S.I.I.T. 17) BIOACTIVAL R E E 17 16 15 T D I N L E S C
COFFEE CORNER/LUNCH AREA
AULA NEWMAN
66 notes
67 notes
68