Haploinsufficiency and Triploinsensitivity of the Same 6P25.1P24.3 Region in a Family Zhongxia Qi1, Linda Jo Bone Jeng2, Anne Slavotinek3 and Jingwei Yu1*
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Regulation of DNA Cross-Link Repair by the Fanconi Anemia/BRCA Pathway
Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Regulation of DNA cross-link repair by the Fanconi anemia/BRCA pathway Hyungjin Kim and Alan D. D’Andrea1 Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 02215, USA The maintenance of genome stability is critical for sur- and quadradials, a phenotype widely used as a diagnostic vival, and its failure is often associated with tumorigen- test for FA. esis. The Fanconi anemia (FA) pathway is essential for At least 15 FA gene products constitute a common the repair of DNA interstrand cross-links (ICLs), and a DNA repair pathway, the FA pathway, which resolves germline defect in the pathway results in FA, a cancer ICLs encountered during replication (Fig. 1A). Specifi- predisposition syndrome driven by genome instability. cally, eight FA proteins (FANCA/B/C/E/F/G/L/M) form Central to this pathway is the monoubiquitination of a multisubunit ubiquitin E3 ligase complex, the FA core FANCD2, which coordinates multiple DNA repair activ- complex, which activates the monoubiquitination of ities required for the resolution of ICLs. Recent studies FANCD2 and FANCI after genotoxic stress or in S phase have demonstrated how the FA pathway coordinates three (Wang 2007). The FANCM subunit initiates the pathway critical DNA repair processes, including nucleolytic in- (Fig. 1B). It forms a heterodimeric complex with FAAP24 cision, translesion DNA synthesis (TLS), and homologous (FA-associated protein 24 kDa), and the complex resem- recombination (HR). Here, we review recent advances in bles an XPF–ERCC1 structure-specific endonuclease pair our understanding of the downstream ICL repair steps (Ciccia et al. -
Checkpoint Defects Require WRNIP1 to Counteract R-Loop-Associated
bioRxiv preprint doi: https://doi.org/10.1101/858761; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. CHECKPOINT DEFECTS REQUIRE WRNIP1 TO COUNTERACT R-LOOP- ASSOCIATED GENOMIC INSTABILITY Veronica Marabitti1, Giorgia Lillo1, Eva Malacaria1, Valentina Palermo1, Pietro Pichierri1 and Annapaola Franchitto1, * 1Department of Environment and Health, Section of Mechanisms Biomarkers and Models, Istituto Superiore di Sanita’, Viale Regina Elena 299, Rome, 00161, Italy * To whom correspondence should be addressed. Tel: +39 0649903042; Fax: +39 0649903650; Email: [email protected] Keywords: Werner syndrome, RECQ helicases, DNA repair, Replication stress 1 bioRxiv preprint doi: https://doi.org/10.1101/858761; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. ABSTRACT Conflicts between replication and transcription are common source of genome instability and many factors participate in prevention or removal of harmful R-loops. Here, we demonstrate that a WRNIP1-mediated response plays an important role in counteracting accumulation of aberrant R- loops. Using human cellular models with compromised ATR-dependent checkpoint activation, we show that WRNIP1 is stabilised in chromatin and is needed for maintaining genome integrity by mediating the ATM-dependent phosphorylation of CHK1. -
Involvement of NRN1 Gene in Schizophrenia-Spectrum And
1 THE WORLD JOURNAL OF BIOLOGICAL PSYCHIATRY, 2015 55 http://dx.doi.org/10.3109/15622975.2015.1093658 2 56 3 RESEARCH ARTICLE 57 4 58 5 Involvement of NRN1 gene in schizophrenia-spectrum and bipolar disorders 59 6 and its impact on age at onset and cognitive functioning 60 7 61 8 62 Mar Fatjo´-Vilas1,2*, Claudia Prats1,2*, Edith Pomarol-Clotet2,3, Luisa La´zaro2,4,5, Carmen Moreno2,6, 9 63 Itxaso Gonza´lez-Ortega2,7, Sara Lera-Miguel4, Salvador Miret2,8, Ma Jose´ Mun˜oz9, Ignacio Iba´n˜ez2,10, 10 Sı´lvia Campanera8, Maria Giralt-Lo´pez9, Manuel J. Cuesta11, Victor Peralta11, Genero´s Ortet2,10, 64 11 Mara Parellada2,6, Ana Gonza´lez-Pinto2,7, Peter J. Mckenna2,3 and Lourdes Fan˜ana´s1,2 65 12 66 1 2 13 Departament de Biologia Animal, Facultat de Biologia, Universitat de Barcelona, Barcelona, Spain; Instituto De Salud Carlos III, Centro De 67 Investigacio´n Biome´dica En Red De Salud Mental (CIBERSAM), Madrid, Spain; 3FIDMAG Germanes Hospitala`ries, Research Foundation, 14 Barcelona, Spain; 4Servei de Psiquiatria i Psicologia Infantil i Juvenil, Hospital Clı´nic de Barcelona, Barcelona, Spain; 5Institut 68 15 d’investigacions Biome`diques August Pi Sunyer (IDIBAPS), Barcelona, Spain; Departament de Psiquiatria i Psicobiologia Clı´nica, Facultat De 69 16 Medicina, Universitat de Barcelona, Barcelona, Spain; 6Servicio de Psiquiatrı´a del Nin˜o y del Adolescente, Hospital General Universitario 70 17 Gregorio Maran˜o´n, Madrid, Spain; Instituto de Investigacio´n Sanitaria del Hospital Gregorio Maran˜o´n (IiSGM); Departamento de Psiquiatrı´a, -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference -
Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy. -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone
A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila Lucía Bruzzone To cite this version: Lucía Bruzzone. A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila. Cellular Biology. Université Sorbonne Paris Cité, 2018. English. NNT : 2018USPCC234. tel-02899776 HAL Id: tel-02899776 https://tel.archives-ouvertes.fr/tel-02899776 Submitted on 15 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparée à l’Université Paris Diderot Ecole doctorale HOB n° 561 Institut Jacques Monod / Equipe Développement, Signalisation et Trafic A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in Drosophila Lucía Bruzzone Thèse de doctorat de Biologie Dirigée par Anne Plessis Présentée et soutenue publiquement à Paris le 19 mars 2018 Président du jury: Alain Zider / Professeur Université Paris Diderot -
Number 8 August 2015 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Volume 1 - Number 1 May - September 1997 Volume 19 - Number 8 August 2015 Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematologyis a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It is made for and by: clinicians and researchers in cytogenetics, molecular biology, oncology, haematology, and pathology. One main scope of the Atlas is to conjugate the scientific information provided by cytogenetics/molecular genetics to the clinical setting (diagnostics, prognostics and therapeutic design), another is to provide an encyclopedic knowledge in cancer genetics. The Atlas deals with cancer research and genomics. It is at the crossroads of research, virtual medical university (university and post-university e-learning), and telemedicine. It contributes to "meta-medicine", this mediation, using information technology, between the increasing amount of knowledge and the individual, having to use the information. Towards a personalized medicine of cancer. It presents structured review articles ("cards") on: 1- Genes, 2- Leukemias, 3- Solid tumors, 4- Cancer-prone diseases, and also 5- "Deep insights": more traditional review articles on the above subjects and on surrounding topics. It also present 6- Case reports in hematology and 7- Educational items in the various related topics for students in Medicine and in Sciences. The Atlas of Genetics and Cytogenetics in Oncology and Haematology does not publish research articles. See also: http://documents.irevues.inist.fr/bitstream/handle/2042/56067/Scope.pdf Editorial correspondance Jean-Loup Huret, MD, PhD, Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France phone +33 5 49 44 45 46 [email protected] or [email protected] . -
Riok1 (BC002158) Mouse Tagged ORF Clone – MR204785 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR204785 Riok1 (BC002158) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Riok1 (BC002158) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Riok1 Synonyms: 3110046C13Rik, Ad034, MGC7300 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR204785 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAGGACGTGGGCAGAGAAGGAGATGAGGAATTTGTGCAGGCTAAAAACAGCAAACATACCATGTC CAGAACCAATCAGGCTAAGAAGTCATGTTCTTCTCATGGGCTTCATTGGCAAGGATGACATGCCAGCCCC ACTTTTGAAAAATGTCCAGCTGTCAGAGTCCAAGGCACGGGAGTTGTACCTGCAGGTCATTCAGTACATG AGGAAAATGTATCAGGATGCTAGACTTGTCCACGCGGATCTCAGTGAATTCAACATGCTGTACCATGGTG GAGATGTTTACATCATTGATGTTTCTCAGTCTGTGGAGCATGACCACCCACATGCATTGGAGTTCTTGAG AAAAGACTGTACCAATGTCAATGATTTCTTTTCCAAGCATGCTGTTGCAGTGATGACCGTGCGGGAGCTC TTCGACTTCGTCACAGATCCCTCCATCACTGCTGACAACATGGATGCTTACCTGGAAAAGGCTATGGAAA TAGCATCCCAGAGGACCAAGGAAGAAAAGACTAGCCAAGATCATGTGGATGAAGAGGTGTTCAAACAAGC ATATATTCCCAGAACCTTAAACGAAGTAAAGAATTATGAGAGAGATGTGGACATCATGATGAGGTTAAAG GAAGAAGACATGGCTTTGAACACTCAGCAAGACAACATTCTATACCAGACTGTCATGGGATTGAAAAAAG ATTTGTCAGGAGTCCAGAAGGTCCCCGCGCTCCTAGAAAGTGAAGTTAAGGAAGAGACTTGTTTTGGTTC AGACGATGCTGGGGGCTCTGAGTGCTCCGACACAGTCTCTGAAGAGCAGGAAGATCAAGCCGGATGCAGA AACCATATTGCTGACCCCGACGTTGATAAAAAGGAAAGAAAAAAGATGGTCAAGGAAGCCCAGAGAGAGA -
Involvement of NRN1 Gene in Schizophrenia-Spectrum and Bipolar Disorders and Its Impact on Age at Onset and Cognitive Functioning
TITLE: Involvement of NRN1 gene in schizophrenia-spectrum and bipolar disorders and its impact on age at onset and cognitive functioning. RUNNING TITLE: NRN1 in schizophrenia-spectrum and bipolar disorders AUTHORS: Mar Fatjó-Vilas1,2,a,*, Claudia Prats1,2,*, Edith Pomarol-Clotet2,3, Luisa Lázaro2,4,5, Carmen Moreno2,6, Itxaso González-Ortega2,7, Sara Lera4, Salvador Miret2,8, MªJosé Muñoz9, Ignacio Ibáñez2,10, Sílvia Campanera8, Maria Giralt9, Manuel J Cuesta11, Victor Peralta11, Generós Ortet2,10, Mara Parellada2,6, Ana González-Pinto2,7, Peter J Mckenna2,3, Lourdes Fañanás1,2. AFFILIATIONS 1. Departament de Biologia Animal, Facultat de Biologia, Universitat de Barcelona. Institut de Biomedicina de la Universitat de Barcelona (IBUB). Barcelona, Spain. 2. Centro de Investigación Biomédica en Red de Salud Mental (CIBERSAM), Instituto de Salud Carlos III, Spain. 3. FIDMAG, Germanes Hospitalàries. Benito Menni Complex Assistencial en Salut Mental. Sant Boi de Llobregat, Spain. 4. Servei de Psiquiatria i Psicologia Infantil i Juvenil, Hospital Clínic de Barcelona. Barcelona, Spain. 5. Institut d'Investigacions Biomèdiques August Pi Sunyer (IDIBAPS), Barcelona. Departament de Psiquiatria i Psicobiologia Clínica, Facultat de Medicina, Universitat de Barcelona. Barcelona, Spain. 6. Servicio de Psiquiatría del Niño y del Adolescente, Departamento de Psiquiatría. Hospital General Universitario Gregorio Marañón, Facultad de Medicina, Universidad Complutense. Instituto de Investigación Sanitaria del Hospital Gregorio Marañón (IISGM). Madrid, Spain. 7. Psychiatry Service, University Hospital of Alava-Santiago. EMBREC. EHU/UPV University of the Basque Country. Kronikgune. Vitoria, Spain. 8. Centre de Salut Mental de Lleida, Servei de Salut Mental i Addiccions, Hospital Santa Maria, Lleida. Lleida, Spain. 9. Àrea d’Adolescents. -
Mouse Nrn1 Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Nrn1 Knockout Project (CRISPR/Cas9) Objective: To create a Nrn1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Nrn1 gene (NCBI Reference Sequence: NM_153529 ; Ensembl: ENSMUSG00000039114 ) is located on Mouse chromosome 13. 3 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 3 (Transcript: ENSMUST00000037623). Exon 2 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit a reduction in body length and body weight, delayed axonal, dendritic, and synaptic development, reduced dendritic spine maintenance leading to gradual spine loss, and impaired associative and spatial learning. Exon 2 starts from about 13.15% of the coding region. Exon 2 covers 34.04% of the coding region. The size of effective KO region: ~145 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 Legends Exon of mouse Nrn1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.